EP1587825A2 - Antigen imitating extracellular areas of membrane proteins of type iii produced from intracellular pathogenic micro-organisms, derived conformational antibodies and the use thereof - Google Patents

Abstract

The inventive antigen derived from an intracellular pathogenic micro-organism is characterised in that it comprises at least on peptidic fragment which essentially consists of the concatenation of sequences of at least two extracellular adjacent areas in the native structure of a membrane protein of type III of said intracellular pathogenic micro-organism, derived conformational antibodies and the application thereof.

Description

ANTIGENS MIMING THE EXTRACELLULAR DOMAINS OF TYPE III MEMBRANE PROTEINS FROM PATHOGENIC INTRACELLULAR MICROORGANISMS, DERIVATIVE CONFORMATIONAL ANTIBODIES AND THEIR APPLICATIONS. The present invention relates to antigens mimicking the structure of the extracellular domains of type III membrane proteins derived from pathogenic intracellular microorganisms, to conformational antibodies prepared from said antigens, as well as to their applications for detection, prevention and treatment. latent or chronic infections by these microorganisms and associated pathologies, in particular tumor or autoimmune.

Certain intracellular microorganisms (viruses, bacteria, fungi, parasites) responsible for latent or chronic infections pose public health problems in many countries; by way of non-limiting example, mention may be made of viruses such as the hepatitis C virus (HCV), the human immunodeficiency virus (HIV), viruses of the Herpesviridae family [Epstein virus- Barr (EBV); cytomegalovirus (CMV); Kaposi's sarcoma herpes virus (KSHV); herpes simplex virus (HSV); chickenpox virus (VZV)] and hepatitis B virus (HBV), as well as intracellular bacteria, including Chlamydia trachomatis and Mycobacterium tuberculosis. These intracellular microorganisms are characterized by their ability to persist in a latent state throughout the life of the host (human or animal) without being eradicated by the immune system following primary infection; this host-virus relationship, which is very complex and poorly understood, involves viral or bacterial mechanisms of escape from the immune response such as genetic variability (HCV, HIV) and the expression of proteins modulating the immune response [EBNA1 protein (EBV) ].

While infection by these intracellular microorganisms is clinically silent in the majority of individuals, some of them, in particular immunocompromised subjects, develop chronic pathologies, in particular pulmonary (Mycobacterium tuberculosis), genital and ocular (Chlamydia trachomatis), tumor (EBV, HCV, HBV, KSHV) or autoimmune (EBV). For example, EBV is associated with a large number of pathologies tumors: Burkitt's lymphoma (Central Africa), nasopharyngeal carcinoma (Southeast Asia), gastric carcinoma, Hodgkin's disease, nasal lymphomas and breast cancer, post-transplant lymphoproliferative diseases and lymphomas associated with AIDS, as well as pathologies autoimmune: rheumatoid arthritis, systemic lupus erythematosus and Sjôren syndrome.

The antigens expressed during the chronic phase or latency phase represent target antigens for vaccination for preventive or therapeutic purposes and the diagnosis of infections by these intracellular microorganisms and associated pathologies. For example, latent infection by EBV results in the expression of a limited number of viral genes coding respectively for 6 nuclear proteins (EBNA-1, -2, -3a-, -3b, -3c and LP) and two membrane proteins [LMP1 and LMP2 (LMP2A / LMP2B)]; at least three types of latency (I, II, III) representing at least three distinct expression profiles are associated with distinct tumor pathologies, and a fourth type of latency (IV) representing a different expression profile from the preceding ones, could be associated with an asymptomatic state (healthy carriers), (Figure 1).

It is generally accepted that latent EBV infection is essentially controlled by cellular immunity mediated by a population of CD8 ⁺ cytotoxic T lymphocytes (CTLs), specific for EBV latency proteins, essentially EBNAs proteins, whereas l humoral immunity to EBV latency proteins does not play a protective role in infected individuals. The loss of this control due either to the decrease in the activity of effectors (CTLs) or to the decrease in recognition of the target (decrease in the presentation of class I antigens) would severely compromise the ability of the host to control the proliferation of EBV infected cells and is believed to be the cause of the development of malignant tumors associated with latent EBV infections.

Thus, immunotherapy against malignant tumors associated with EBV essentially involves the in vitro activation of autologous CTLs of patients against latency proteins and the reimplantation of these with more or less efficiency (for a review see Khanna R. et al., TRENDS in Molecular Medicine, 2001, 7: 270-276.). This cell therapy has the disadvantage of being very expensive and cumbersome to implement. The detection of latency antigens, which is useful for the diagnosis of latent EBV infections and associated pathologies, requires a cell permeabilization step before contact with the antibodies, which is difficult to implement. In order to fight more effectively against latent or chronic infections by these pathogenic intracellular microorganisms, and associated pathologies there is a real need to have new antigens for preventive and therapeutic vaccination, as well as diagnosis.

Among the antigens expressed during the chronic phase or latency phase of the infection, mention may be made of type III membrane proteins, characterized by transmembrane domains, separating short extracellular (DE) and intracellular (DI) domains and bordered by larger N and / or C-terminal intracellular domains; Figure 2 illustrates the hypothetical structure of type III membrane proteins with 2n membrane domains. By way of nonlimiting example of type III membrane proteins with 2n transmembrane domains expressed during the chronic phase or latency phase of the infection, mention may be made of the LMP1 and LMP2A proteins of EBV (access number in the SWISSPROT database, respectively P03230 and PI 3285, with reference to the sequence of strain B95.8 of EBV), the proteins LAMP K15-P and LAMP K15-M of KSHV (GENBANK access numbers, respectively AAD45297 and AAD45296), HCV p7, NS2 and NS4B proteins (access number EMBL AF009606), MOMP protein from Chlamydia trachomatis (Major Outer Membrane Protein; access number NCBI AF352789) and transport proteins Mmpl 1 to 12 of Mycobacterium tuberculosis. (EMBL access number Z87425.1). The absence of antibodies directed against type III membrane proteins, in individuals latently or chronically infected with these microorganisms, indicates that these proteins are not accessible on the surface of infected cells or that their extracellular domains are not immunogens (Figure 2). The absence of antibodies against the extracellular domains observed during the immunization of laboratory animals with recombinant LMP1 and LMP2 proteins indicates rather that their extracellular domains are not not immunogenic (Hennessy et al., K., Proc. Natl. Acad. Sci. USA, 1984, 81: 7207-7211) and LMP2 (Longnecker et al, J Virol., 1990, 64: 3219-3226). Indeed, all the anti-LMP 1 antibodies described recognize more or less identified fragments of the intracellular regions of the LMP1 or LMP2A proteins, namely, for LMP1: CS1-4 (pool of 4 monoclonal antibodies, Dako, Glostrup, Denmark), S 12 (Dr Elliott Kieff, Harvard Medical School, Boston, MA), OT22C and OT22CN (Organon Teknika, Boxtel, The Neetherlands).

Antibodies directed against extracellular domains of the LMP1 and LMP2 proteins were nevertheless obtained by immunization of rabbits with synthetic peptides representing the sequence of a single extracellular domain coupled to a carrier protein (European application EP 1229043). However, the antibodies obtained are non-conformational antibodies which do not recognize the native antigen expressed on the surface of cells infected latently by EBV but only the denatured antigen or a fragment thereof (linear peptide representing a single extracellular domain). In addition, these antibodies do not exhibit significant biological activity (complement-dependent cytotoxic activity or ADCC for Antibody Dependent Cellular Cytotoxicity).

There are therefore currently no effective antibodies and antigens for the treatment (serotherapy or preventive or therapeutic vaccination) of latent or chronic infections by pathogenic intracellular microorganisms as defined above and associated pathologies, in particular EBV infection and associated tumor pathologies.

Consequently, the inventor set himself the goal of providing antigens and antibodies which better meet the needs of the practice. Surprisingly, the inventor has found that chimeric antigens mimicking the structure of the extracellular domains of type III membrane proteins of pathogenic intracellular microorganisms as defined above, induce the production, in immunized individuals, of conformational antibodies which specifically recognize said type III membrane proteins in native form and which have both complement-dependent cytotoxic activity and pro-apoptotic activity with respect to cells expressing said type III membrane proteins on their surface. Among these antigens, chimeric antigens which mimic the structure of the extracellular domains of EBV latency membrane proteins induce the production, in immunized individuals, of conformational antibodies which specifically recognize the LMP1 and LMP2A proteins in native form. The inventor has also shown that these conformational antibodies have complement-dependent cytotoxic activity and pro-apoptotic activity with respect to cells expressing said proteins LMP1 and LMP2 on their surface and are capable of preventing the appearance and the development in mice of tumors expressing said proteins LMP1 and LMP2 on their surface; this activity has been demonstrated in serotherapy (injection of antibodies) and preventive vaccination (injection of antigen) experiments.

Such conformational antibodies are useful for the detection, from an appropriate biological sample (whole blood, mononuclear cells of peripheral blood, tumor biopsy), of patients suffering from latent or chronic infections and from pathologies induced by pathogenic intracellular microorganisms , as defined above, in particular by EBV; these antibodies which recognize the type III membrane proteins in native form, in a sensitive and specific way, do not in any case require prior steps of denaturation and / or permeabilization of cells and possibly purification of infected cells (enrichment step cell), before the step of bringing the antibody into contact with the biological sample to be tested.

In addition, such conformational antibodies are capable of specifically lysing cells infected with pathogenic intracellular microorganisms which express on their surface type III membrane proteins; these antibodies are useful in serotherapy, for:

- eradicate latent or chronic infections by pathogenic intracellular microorganisms, as defined above, in particular EBV and prevent associated pathologies by destroying the reservoir of viral latency constituted by infected cells expressing type III membrane proteins (B lymphocytes expressing LMP1 and / or LMP2A in the case of EBV, hepatocytes expressing p7, NS2 and NS4B in the case of HCV and lymphoid cells expressing LAMP K15-P and LAMP K15-M in the case of KSHV), - treat malignant tumors associated with latent or chronic infections by pathogenic intracellular microorganisms, as defined above, in particular EBV, KSHV and HCV by targeting and destroying cancer cells expressing type III membrane proteins as defined above (LMP1 and / or LMP2A (EBV), p7 (HCV), LAMP K15-P and / or LAMP K15-M (KSHV)).

Likewise, antigens mimicking the structure of the extracellular domains of type III latency membrane proteins of pathogenic intracellular microorganisms as defined above, which are capable of inducing the production, in immunized individuals, of such conformational antibodies possessing activity Cytotoxic agents are also useful as a vaccine composition for preventing or treating latent infections by these intracellular microorganisms and associated pathologies, in particular infection with EBV and associated malignant tumors. Consequently, the subject of the present invention is an antigen derived from a pathogenic intracellular microorganism, characterized in that it comprises at least one peptide fragment essentially constituted by the concatenation of the sequences of at least two adjacent extracellular domains in the native structure. a type III membrane protein, said pathogenic intracellular microorganism.

For the purposes of the present invention, the term “membrane protein of type III” is intended to mean a membrane protein characterized by transmembrane domains, separating short extracellular (DE) and intracellular (DI) domains and bordered by intracellular N and / or C- domains. larger terminals (Figure 2), as defined above, in particular a membrane protein with 2n transmembrane domains, as defined above.

The invention encompasses antigens derived from type III membrane proteins of any pathogenic intracellular microorganism as defined above and derived variants. In accordance with the invention, the extracellular domains of type III membrane proteins are as defined in the structural model of the native LMPl protein presented in FIG. 3, which applies by analogy to the other type III membrane proteins. Thus, the adjacent extracellular domains of these proteins correspond to those which are close in the native structure of the protein, the first domain corresponding to that located at the N-terminal end of the protein.

The sequences of the different extracellular domains of type III membrane proteins correspond to those located between 2 successive transmembrane domains (numbered TMi to TM _n , from the N-terminal end to the C-terminal end of the proteins), the first domain transmembrane corresponding to an odd number. These sequences are deduced from the sequence of the various transmembrane domains of type III membrane proteins which is determined by analysis of the hydrophobicity of the amino acid sequence of said proteins, using appropriate software, in particular:

- TM-Finder (www.bioinformatics-Canada.org/TM/ ^' ), and - TMHMM (www.cbs.dtu.dk/services/TMHMM-2.0Λ.

For example, the LMP1 protein of the B95-8 strain of EBV (access number P03230 in the SWISSPROT database) has 6 potential transmembrane domains (TMi to TM ₆ ), corresponding, according to the software used, to positions 25 to about 42-44, about 49-52 to 72, 77 to about 97-98, 105 to 125, 139 to 159 and about 164-166 to 186. The sequences between the domains TMi and TM ₂ , TM ₃ and TM , TM ₅ and TM ₆ correspond to those of the 3 extracellular domains (DE1 to DE3), the first domain of the protein corresponding to that located at the N-terminal end of LMP1: - LMP1-DE1 SDWTGGA (positions 45 to 51, SEQ ID NO: 1) or VMSDWT (positions 43 to 48, SEQ ID NO: 24).

- LMP1-DE2 WNLHGQA (positions 98 to 104, SEQ ID NO: 2) or NLHGQA (positions 99 to 104, SEQ ID NO: 25)

- LMP1-DE3 LQQN (positions 160 to 163, SEQ ID NO: 26) or LQQNWW (positions 160 to 165, SEQ ID NO: 3). Analogously for the LMP2A protein of the B95-8 strain of EBV (access number PI 3285 in the SWISSPROT database), the sequence δ of the 6 extracellular domains (DE1 to DE6) is deduced from that of the 12 potential transmembrane domains:

- LMP2-DE1 SCFTASVS (positions 142 to 149, SEQ ID NO: 4)

- LMP2-DE2 RIEDPPFNS (positions 199 to 207, SEQ ID NO: 5) - LMP2-DE3 DAVLQLS (positions 260 to 266, SEQ IS NO: 6)

-LMP2-DE4 GTLN (positions 317 to 320, SEQ ID NO: 7)

-LMP2-DE5 SILQTNFKSLSSTEFIPN (positions 374 to 391, SEQ ID NO: 8)

- LMP2-DE6 SNTLLS (positions 444 to 449, SEQ ID NO: 9).

According to an advantageous embodiment of the invention, said peptide fragment comprises at least one heterologous linker sequence of 1 to 5 amino acids identical or different from one another, preferably from 1 to 3 amino acids, preceding the sequence of one of the extracellular domains as defined above.

According to an advantageous arrangement of this embodiment, said amino acids are different from those present in the sequences of said extracellular domains.

According to another advantageous arrangement of this embodiment, all the sequences of the adjacent extracellular domains, with the exception of those located at the N- and / or C-terminal ends of said peptide fragment, are preceded by a heterologous binding sequence such as defined above. According to yet another advantageous arrangement of this embodiment, all the sequences of the adjacent extracellular domains of said peptide fragment are preceded by a heterologous binding sequence as defined above.

According to the invention, the amino acid residues of the binding sequence have a side chain comprising a reactive function. Among these amino acids, mention may be made of polar amino acids comprising a function: -OH [serine (S), threonine (T) or tyrosine (Y)], -SH [cysteine (C)], -NH ₂ [lysine ( K) or arginine (R)] ₅ -COOH [aspartic acid (D) or glutamic acid (E)] ₃ and the polar amino acids with a side chain functionalized by addition of a reactive function, in particular a chloro- or bromo-acetyl reactive with thiol groups or a hydrazine group reactive with aldehydes.

According to another advantageous arrangement of this embodiment, said amino acids are chosen from cysteine (C) and or lysine (K).

According to yet another advantageous embodiment of the invention, said peptide fragment also includes, between the heterologous binding sequences and the sequences of the extracellular domains and on either side of said sequences of the extracellular domains, a sequence of at least one amino acid, preferably from 1 to 7 amino acids, preferably 2 amino acids, corresponding to that of the transmembrane domain flanking said extracellular domain in the structure of said type III membrane protein.

According to yet another advantageous embodiment of the invention, said antigen is derived from a type III membrane protein selected from the group consisting of: the LMP1 and LMP2A proteins of EBV (access number in the database SWISSPROT, respectively P03230 and P13285, with reference to the sequence of strain B95.8 of EBV), the proteins LAMP K15-P and LAMP K15-M from KSHV (GENBANK access numbers, AAD45297 and AAD45296 respectively), HCV p7, NS2 and NS4B proteins (access number EMBL AF009606), the MOMP protein of Chlamydia trachomatis (Major Outer Membrane Protein; access number NCBI AF352789) and the transport proteins Mmpl 1 to 12 of Mycobacterium tuberculosis. (EMBL access number Z87425.1).

According to yet another advantageous embodiment of the invention, said peptide fragment is essentially constituted by the concatenation of the sequences of 2 to 6 adjacent extracellular domains, preferably 2 or 3 adjacent extracellular domains, in the native structure of said protein.

According to an advantageous arrangement of one of the preceding embodiments, said antigen is derived from the LMP 1 or LMP2 A proteins of EBV and is selected from the sequences SEQ ID NO: 10, 11 and 13 to 23.

According to yet another advantageous embodiment of the invention, said antigen comprises at least two peptide fragments as defined above, derived from different type III membrane proteins; preferably, said fragments are associated covalently via their C-terminal or N-terminal ends (peptide bond) or else of a reactive function of the side chain of an amino acid of their binding sequence. The invention also encompasses the antigens constituted by sequences functionally equivalent to the sequences as defined above, that is to say capable of inducing the production, in immunized individuals, of conformational antibodies which specifically recognize the membrane proteins. type III in native form and which have a complement-dependent cytotoxic activity and a pro-apoptotic activity, with respect to the cells expressing said type III membrane proteins on their surface. Among these sequences, mention may be made, for example, of the sequences derived from the preceding sequences by:

- substitution and / or deletion, and / or addition of one or more amino acids of the sequences as defined above,

modification of at least one peptide bond -CO-NH- of the peptide chain of the antigen as defined above, in particular by replacement with a bond different from the bond -CO-NH- (methylene amino, carba, ketomethylene, thioamide ....) or by the introduction of a retro or retro-inverso type bond, and / or,

- substitution of at least one amino acid in the peptide chain of the antigen as defined above, with a non-proteinogenic amino acid residue.

By non-proteinogenic amino acid residue is meant any amino acid which does not form part of a natural protein or peptide, in particular any amino acid whose carbon carrying the side chain R, namely the group - CHR-, located between -CO- and -NH- in the natural peptide chain, is replaced by a motif which does not form part of the constitution of a natural protein or peptide.

According to another advantageous embodiment of the invention, at least one of the amino acids of said heterologous linker sequence is covalently linked to at least one carrier protein or at least one lipid.

According to an advantageous arrangement of this embodiment, at least two amino acids, each resulting from the single linkage sequence of distinct peptide fragments (of identical or different sequence) are linked to a carrier protein; the antigen thus obtained comprises at least two identical or different peptide fragments covalently linked to a single carrier protein (intermolecular coupling, FIG. 3). According to another advantageous arrangement of this embodiment, at least two amino acids derived from one or more heterologous sequence (s) of link (s) of a single peptide fragment, are each linked to a lipid; the antigen thus obtained comprises a single peptide fragment covalently linked to several lipid molecules (intramolecular coupling, FIG. 3). Such lipopeptide antigens are capable of self-assembling into bilayers or lipid vesicles mimicking the surface of a cell infected with a pathogenic intracellular microorganism expressing a type III membrane protein as defined above.

Such an association advantageously makes it possible to increase the immunogenicity of the antigen according to the invention.

The lipids can be coupled to the peptide antigen via one or more α-amino functions or one or more reactive functions of the side chain of an amino acid of the peptide part; they can comprise one or more chains derived from C ₄ fatty acids. ₂₀ , saturated or unsaturated, linear or branched (palmitic acid, oleic acid, linoleic acid, linolenic acid, 2-amino hexadecanoic acid, pimelautide, trimetauxide) or one or more steroid groups (cholesterol and derivatives). Advantageously, the lipid (s) are linked: by an amide bond to the α-NH ₂ or ε-NH _{2 function} of a lysine (Lys N ^ε (palmitoyl) or to any amino function of said junction peptide, by a thioester bond or thioether to a thiol function of a cysteine, by an ether bond to an alcohol function of said junction peptide or else by an ester bond to an acid or alcohol function of said junction peptide. Preferably, the lipid or lipids are branched by ether, thioether, ester and thioester bonds which are more immunogenic than the amide bond. Even more preferably, the lipid or lipids are connected by a thioester bond which is both more labile and more immunogenic (Gréer et al, J. Immunol ., 2001, 166: 6907-6913) Among the preferred lipid groups, mention may be made in particular of: Asp (cholesteryl), Glu (cholesteryl), Ser (palmitoyl), Cys (palmitoyl), Ser (cholesteryl) or Cys (cholesteryl) .

The present invention also relates to micelles or vesicles of a lipopeptide antigen as defined above.

The carrier protein may be coupled to the peptide antigen by any suitable means; these means which are known to those skilled in the art include in particular coupling using glutaraldehyde or bis-biazotized benzidine. Preferably, the coupling is carried out using a heterofunctional agent such as m-maleimidobenzoyl-N-hydroxysuccinimide (SMCC) or sulfo-SMCC which specifically couples a thiol function of the antigen (cysteine residue) with a function amine (lysine residue) from KLH, and carbodiimide or its water-soluble derivatives such as 1-ethyl-dimethylaminopropyl-carbodiimide hydrochloride, and m-maleimidocaproyl-3-sulfo-N-hydroxysuccinimide. Preferably, m-maleimidocaproyl-3-sulfo-N-hydroxysuccinimide which is more immunogenic is used for the coupling of the antigen. Among the carrier proteins, mention may especially be made of KLH

(Key-Hole Limpet Haemocyaniri), bovine albumin or other albumin such as that of mice or rabbits. A preferred carrier protein is KLH which can be coupled to the antigen, by a thioether bond at the level of a cysteine residue or by an amide bond at the level of a lysine residue, of the heterologous binding sequence as defined above. above.

The present invention also relates to an immunogenic composition, characterized in that it comprises an antigen as defined above, optionally in the form of micelles or lipopeptide vesicles, associated with at least one pharmaceutically acceptable vehicle and optionally with at minus an adjuvant.

The adjuvants used are adjuvants conventionally used in vaccine compositions, such as aluminum hydroxide and squalene.

According to another advantageous embodiment of said immunogenic composition, said antigen is associated with: - one or more peptides containing CD4 + T epitopes derived from latency proteins of pathogenic intracellular microorganisms as defined above, in particular of EBV (Leen et al, J. Virol., 2001, 75: 8649-8659; Paludan et al, J. Immunol, 2002, 169: 1593-1603).

- one or more peptides containing multiple CD4 + epitopes, such as the tetanus toxin peptide TT (positions 830-846), the influenza hemagglutinin peptide HA (positions 307-319), PADRE (Pan DR Epitope, Alexandre J. et al, Immunity, 1994, 1: 751-761) and the LSA3 peptide from Plasmodium falciparum.

The present invention also relates to the use of an antigen as defined above for the preparation of a vaccine intended for the prevention or treatment of latent or chronic infections and associated pathologies as defined above, in particular EBV infections and associated tumor pathologies.

The antigens according to the invention are prepared by conventional techniques of synthesis in solid or liquid phase, known in themselves to those skilled in the art. Alternatively, they can be prepared by recombinant DNA techniques, known in themselves to those skilled in the art.

Consequently, the present invention also relates to an isolated nucleic acid molecule, characterized in that it comprises a sequence coding for an antigen as defined above.

The subject of the invention is also probes and primers, characterized in that they comprise a sequence of approximately 10 to 30 nucleotides corresponding to that located at the junction of the sequences coding for a transmembrane domain and sequences coding for a domain extracellular adjacent to the previous one, a type III membrane protein as defined above; these probes and these primers make it possible to specifically detect / amplify said nucleic acid molecules encoding an antigen according to the invention.

The nucleic acid molecules according to the invention are obtained by conventional methods, known in themselves, by following standard protocols such as those described in Current Protocols in Molecular Biology (Frederick M. AUSUBEL, 2000, Wïley and son Inc , Lïbrary of Congress, USA). The sequences coding for an antigen according to the invention can be obtained by amplification of a nucleic sequence by PCR or RT-PCR or else by screening of genomic DNA libraries by hybridization with a homologous probe. For example, they are amplified by PCR using an appropriate primer pair as defined above. The present invention also relates to a recombinant eukaryotic or prokaryotic vector, characterized in that it comprises an insert consisting of a nucleic acid molecule coding for an antigen as defined above. Of numerous vectors into which a nucleic acid molecule of interest can be inserted in order to introduce and maintain it in a eukaryotic or prokaryotic host cell, are known in themselves; the choice of an appropriate vector depends on the envisaged use for this vector (for example replication of the sequence of interest, expression of this sequence, maintenance of the sequence in extrachromosomal form or else integration into the chromosomal material of the host ), as well as the nature of the host cell. For example, viral or non-viral vectors such as plasmids can be used.

Preferably, said recombinant vector is an expression vector in which said nucleic acid molecule or one of its fragments is placed under the control of regulatory elements for appropriate transcription and translation. In addition, said vector can comprise sequences (labels or tags) fused in phase with the 5 ′ and / or 3 ′ end of said insert, useful for the immobilization, and / or the detection and / or the purification of the protein. expressed from said vector. Alternatively, said nucleic acid molecule can be inserted into the sequence coding for a viral capsid protein, at a site allowing exposure of the antigen according to the invention, on the surface of the viral capsid .

These vectors are constructed and introduced into host cells by conventional recombinant DNA and genetic engineering methods, which are known per se.

The present invention also relates to eukaryotic or prokaryotic cells modified by a recombinant vector as defined above.

The recombinant vectors and the transformed cells, as defined above, are useful in particular for the production of the antigen as defined above.

The present invention also relates to an antibody directed against type III membrane proteins as defined above, characterized in that it is produced by immunization of an appropriate animal with an antigen or an immunogenic composition as defined above. -above. The invention encompasses polyclonal antibodies, monoclonal antibodies, chimeric antibodies such as humanized antibodies, as well as their fragments (Fab, Fv, scFv). For the purposes of the present invention, the term “chimeric antibody”, relative to an antibody of a particular animal species or of a particular class of antibody, means an antibody comprising all or part of a heavy chain and / or of a light chain of an antibody of another animal species or another class of antibody.

For the purposes of the present invention, the term humanized antibody means a human immunoglobulin in which the residues of CDRs (Complementary-Determining Regions) which form the antigen binding site are replaced by those of a non-human monoclonal antibody having the specificity, affinity or activity sought. Compared with non-human antibodies, humanized antibodies are less immunogenic and have a prolonged half-life in humans because they have only a small proportion of non-human sequences since almost all of the residues of FR (Framework) and constant region (Fc) regions of these antibodies are those of a consensus sequence of human immunoglobulins.

Preferred antibodies are monoclonal antibodies and humanized antibodies.

The antibodies according to the invention and their fragments are prepared by conventional techniques known to those skilled in the art, such as those described in Antibodies: A Laboratory Manual, E. Howell and D Lane, Cold Spring Harbor Laboratory, 1988.

More specifically:

- the polyclonal antibodies are prepared by immunization of an appropriate animal with an antigen as defined above, optionally coupled to KLH or to albumin and / or associated with an appropriate adjuvant such as Freund's adjuvant (complete or incomplete) or aluminum hydroxide; after obtaining a satisfactory antibody titer, the antibodies are harvested by sampling the serum of the immunized animals and enriched in IgG by precipitation, according to conventional techniques, then the IgGs specific for type III membrane proteins are optionally purified by chromatography. affinity on an appropriate column on which said protein or the antigen as defined above are fixed, so as to obtain a monospecific IgG preparation. - the monoclonal antibodies are produced from hybridomas obtained by fusion of B lymphocytes from an animal immunized with the antigen as defined above with myelomas, according to the technique of Kohler and Milstein (Nature, 1975, 256, 495-497); hybridomas are cultivated in vitro, in particular in fermenters or produced in vivo, in the form of ascites; alternatively, said monoclonal antibodies are produced by genetic engineering as described in American patent US 4,816,567.

- Humanized antibodies are produced by general methods such as those described in International Application WO 98/45332. - the antibody fragments are produced from the V _H and

V _L cloned, from the mRNAs of hybridomas or splenic lymphocytes of an immunized mouse; for example, the Fv, scFv or Fab fragments are expressed on the surface of filamentous phages according to the technique of Winter and Milstein (Nature, 1991, 349, 293-299); after several selection steps, the antibody fragments specific for the antigen are isolated and expressed in an appropriate expression system, by conventional techniques of cloning and expression of recombinant DNA.

The antibodies or their fragments as defined above are purified by conventional techniques known to those skilled in the art, such as affinity chromatography. The antibodies according to the invention are conformational antibodies, that is to say they recognize a conformational epitope or non-contiguous epitope or else an assembled topographic epitope, which epitope corresponds to two or more adjacent extracellular domains of membrane proteins of the type III, that is to say regions of these type III membrane proteins which are distant in the primary protein sequence, since they are separated by two transmembrane domains and an intracellular domain (FIG. 3 illustrating the example of the LMP1 protein of EBV ), but which are close when type III membrane proteins are folded back into their native form.

These conformational antibodies recognize type III membrane proteins, only in native form; they recognize neither denatured type III membrane proteins, that is to say treated by agents which alter the structure of proteins, which are known to those skilled in the art (methanol, alcohol, acetone, SDS, etc.), or the fragments of these proteins, in particular the peptides representing a single extracellular domain of said type III membrane proteins.

The antibodies according to the invention which specifically recognize type III membrane proteins in native form with a high affinity for said native proteins (affinity constant of the order of nM), represent reliable and sensitive diagnostic reagents for detection , from an appropriate biological sample (whole blood, mononuclear cells of the peripheral blood, tumor biopsy), patients suffering from latent infections and pathologies, in particular malignant, induced by the pathogenic intracellular microorganisms as defined above; these antibodies which specifically recognize the type III membrane proteins in native form do not require prior steps of denaturation and / or cell permeabilization, and possibly purification of the infected cells (cell enrichment), before contacting the antibody with the biological sample to be tested. Thus, the antibodies according to the invention can be used for the detection of a latent infection, for example, by flow cytometry, by immunocytochemistry or immunohistochemistry or else by immunoprecipitation from non-fixed cells (frozen or living) or fixed in non-denaturing conditions which are known to those skilled in the art. The present invention also relates to the use of an antibody as defined above for the preparation of a diagnostic reagent intended for the detection of latent infections and associated pathologies as defined above, in particular infections by EBV and associated cancers.

In addition, such conformational antibodies which are capable of specifically lyzing infected cells expressing type III membrane proteins on their surface are useful in serotherapy, for treating latent infections and preventing or treating associated pathologies as defined above, including EBV infections and associated cancers.

Consequently, the present invention also relates to a pharmaceutical composition, characterized in that it comprises at least one antibody as defined above associated with at least one pharmaceutically acceptable vehicle. The present invention also relates to the use of antibodies as defined above for the preparation of a medicament intended for the treatment of latent infections and associated pathologies as defined above, in particular infections by EBV and cancers associates. The conformational antibodies according to the invention directed against type III membrane proteins have the following advantages over existing antibodies:

- simple and rapid use: due to their (conformational) nature, the antibodies according to the invention allow the direct detection of infected cells in a biological sample without prior steps of denaturation and possibly permeabilization of the cells, or else cell purification (cell enrichment).

- specificity and sensitivity: due to their high affinity for native type III membrane proteins, the antibodies according to the invention make it possible to specifically and sensitively detect cells infected with pathogenic intracellular microorganisms as defined above, to from a complex biological sample (whole blood, tumor biopsy).

Compared to anti-tumor chemotherapy and radiotherapy which are not very specific to their target, or to ex vivo cellular immunotherapy which is specific to each patient but cumbersome to implement and expensive, serotherapy using antibodies according to the invention is inexpensive, simple to use and specific to its target; because of their high cytolytic and pro-apoptotic activities, a limited number of injections per individual will be sufficient to effectively eliminate the infected cells. In addition, a vaccine composition comprising the antigen according to the invention coupled to a carrier protein or to a lipid represents another even less expensive and equally effective alternative for treating latent infections by pathogenic intracellular microorganisms, for example EBV, and preventing or treat the pathologies associated with these infections, in particular cancers. In addition to the foregoing provisions, the invention also comprises other provisions which will emerge from the description which follows, which refers to examples of implementation of the antigens and antibodies according to the present invention as in Table I summarizing the sequences of the Application, in which the sequences corresponding to the extracellular domains are indicated in bold, the sequences corresponding to the binding fragment are boxed, and the amino acids originating from the transmembrane domains are underlined, and to the drawings attached in which: - Figure 1 illustrates the different types of latency (Types I, II and III, and possibly Type IV) associated with EBV infections; the expression profile of viral and cellular genes and the pathologies associated with each type of latency are indicated.

- Figure 2 illustrates the comparative analysis of the structure and immunogenicity (presence of protective antibodies) of different types of viral and bacterial membrane proteins (Type I: immunogenic and non-immunogenic Types III and V).

- Figure 3 illustrates the structure of antigens according to the invention taking as an example those derived from the proteins LMP1 and LMP2A of EBV. DE: extracellular domain. TM: transmembrane domain. DI: intracellular domain.

- Figure 4 illustrates the lipid vesicles which form spontaneously from the lipopeptides according to the invention: Cys (cholesteryl) derived from peptides of sequence SEQ ID NO: 13 and 14. A: staining with Coomassie blue. B: red eye coloring. - Figure 5 illustrates the evolution of the titer in anti-serum antibodies

LMP 1 in 4 mice (mouse 1 to mouse 4) immunized with the peptide antigen SEQ ID NO: 10 (DE1 + DE2 of LMP1) coupled to KLH; the serum antibodies were assayed in ELIS A with the corresponding peptide (SEQ ID NO: 10), on days D ₂ ι, D ₂ , D ₆₃ and D _{8 ι,} ie 3 weeks after each of the 4 successive injections of antigen. Mouse 1: - -, mouse 2: - D -, mouse 3: -Δ-, mouse 4: - ^Q -.

FIG. 6 illustrates the analysis of the specificity of the immune sera of anti-LMP 1 mice (mouse immunized with the peptide antigen SEQ ID NO: 10 (DE1 + DE2) coupled to KLH), measured in indirect ELISA, by a competition test with the corresponding peptide (SEQ ID NO: 10) or with a non-relevant peptide (SEQ ID NO: 12, DE1 + DE3). The results are expressed, for each of the sera taken on D21 (3.1), D42 (2.1) and D63 (1.1), by the ratio (A / A ₀ ) of the absorbance values in the presence or in the absence of competitor peptide, depending on the concen- molar tration (ao) of the competing peptide (DEl + DE2) or (DEl + DE3). Competition with the peptide SEQ ID NO: 10: 3.1: -B-, 2.1: - • * - and 1.1: -Θ-. Competition with the peptide SEQ ID NO: 12: 3.1: - -, 2.1: - - and 1.1: -Δ-.

FIG. 7 illustrates the determination, by linear regression from the curve of FIG. 6, of the affinity constant (K _a ) of the antibodies of the immune sera of anti-LMP 1 mice 1. The values of Ka correspond respectively to 7.3 nM, 20.8 nM and 557 nM for sera 3.1 (- B -), 2.1 (- + -), and ll (-θ-).

- Figures 8 and 9 illustrate the detection, by immunocytochemistry using immune sera of mice specific for the extracellular domains of LMP1, of the native LMP1 protein present on the surface of cells latently infected with EBV. The cells are fixed in PBS buffer, 4% formaldehyde and the detection of the LMP ballast protein is carried out as described in Examples 1.7 and 4.

- Figure 8A illustrates the detection of the native LMP1 protein on lymphoblastoid cell lines transformed by EBV (B.LCL-EBV); all cells are in type III latency and express LMP1 which is detected on all cells.

- Figure 8B illustrates the detection of the LMP1 protein on the B95.8 line of B lymphocytes infected with EBV; 40% to 50% of the cells which are in the lytic phase do not express LMP1 (small unlabeled cells) while a subpopulation of cells express type III latency antigens including LMPl (marked cells indicated by the arrows).

- Figure 9 (9 A, 9B and 9C) illustrates the detection of the native LMP1 protein on PBMC of healthy EBV positive carriers; only a few B lymphocytes are infected and therefore detectable in these healthy carriers. The detection threshold is at least 1 to 2 positive LMP1 cells for 150,000 to 200,000 PBMC of healthy EBV positive carriers.

FIG. 10 illustrates the detection by immunoprecipitation of the native LMP1 protein in HEK-293 cells transfected with an expression vector of the LMP1 protein (pSV-HA-LMPl), using the immune sera of mice specific for extracellular domains of LMP1 according to the invention (Is anti-Peptide), by comparison with a commercial mouse monoclonal antibody recognizing an intracellular domain of LMP1 (CS1-4). HEK-293 cells transfected with the vector pSV5 are used as a control (HEK 293 controls). Line 1: HEK 293 controls immumoprecipitated by the immune serum of anti-LMP 1 mice. Line 2: HEK 293 controls immumoprecipitated by the antibody CS1-4. Line 3 HEK 293 transfected with pSV-HA-LMP1 immumoprecipitated by the immune serum of anti-LMP 1 mice. Line 4: HEK 293 transfected with pSV-HA-LMP1 immumoprecipitated with the antibody CS 1-4. The positions of the molecular weight markers are indicated.

FIG. 11 illustrates the cytotoxic activity and the pro-apoptotic activity of the immune sera of mice specific for the extracellular domains of

LMP on a line of B lymphoblastoid cells latently infected with EBV (B.LCL-EBV or LCL). A, C and E: LCL incubated for 4 days respectively in the presence of complement alone [normal rabbit serum (non-immune serum, not inactivated by heat), dilution ^{1/60 leme} ]. B, D and F: LCL incubated for 4 days in the presence of the same concentration of complement and increasing concentrations of anti-LMP 1 immune serum (dilution l / 600 ^th , l / 300 ^th and l / 200 ^th ). With LCLs incubated in the presence of complement and the lowest dilution of anti-LMP 1 (F) immune serum, significant cell lysis is observed, which results, at the level of the analysis of the cell cycle, in a very significant increase in the proportion of cells in apoptosis (+ 30%), compared to the control (A, C and E).

FIG. 12 illustrates the comparison of the average affinities of the immune sera of mice (BALB / c) and of rats (LOU / M) after three booster immunizations with the peptide antigen SEQ ID NO: 16 (DE2 + DE3 of LMP2A) coupled with KLH. FIG. 13 illustrates the detection, by immunocytochemistry using rat immune sera specific for the extracellular domains of LMP2A, of the native LMP2A protein present on the surface of a line HEK-293 transfected stably by the vector d expression pREP4-LMP2A. The cells are fixed in PB S buffer, 4% formaldehyde and the detection of the LMP2A protein is carried out as described in Example 8.

FIG. 14 illustrates the detection, by immunocytochemistry using specific immune sera of the extracellular domains of LMP1 and LMP2A, of native LMP1 and LMP2A proteins present on the surface of the EBV * El and NC5 lines. The cells are fixed in PB S buffer, 4% formaldehyde and the detection of the proteins LM1 and LMP2A is carried out as described in Examples 1.7, 4 and 8 (magnification: X 400). - Figure 15 shows the survival curve of SCID mice injected with 3 million E1 cells, then treated with anti-LMP2A serum or normal serum.

FIG. 16 illustrates the detection, by immunocytochemistry using the immune serum specific of the extracellular domains of LMP1, of the native LMP1 protein present on the surface of the Sp2o line transfected stably by the vector pREP4-LMP1. The anti-LMP2A antibody is used as a control. The cells are fixed in PBS buffer, 4% formaldehyde and the labeling with the antibodies is revealed as described in examples 1.7, 4 and 8. a and b: labeling with the anti-LMP 1 antibody produced as described in the example 2, respectively at magnification X 400 and X200. c and d: labeling with the anti-LMP2A antibody produced as described in Example 8, respectively at magnification X 400 and X200.

FIG. 17 illustrates the inhibition of tumors expressing LMP1 (Sp2o-pREP4-LMPl line) in mice immunized with the peptide antigen mimicking the extracellular domains (DE1 + DE2; SEQ ID NO: 10) by LMP1, right with the control mice who received an injection of KLH. The mice in the control group (KLH; n = 21) and a first group (n = 10) of mice immunized with the LMP1 antigen were injected subcutaneously with one million Sp2o-pREP4-LMP1 cells . A second group of mice immunized with the LMP1 antigen (n = 10) received an injection subcutaneously, of three million Sp2o-pREP4-LMP 1 cells.

Table I: List of peptides derived from LMPl or LMP2 proteins

** SwissProt P13285

Example I: Materials and Methods

1) Animals

Four-week-old female BALB / c mice (IFFA-

CREDO) are fed at will and immunized at the age of 7 to 10 weeks.

2) Antigens Peptides derived from the extracellular domains of LMPl and

LMP2A were synthesized manually in solid phase, according to the method originally described by Merrifield et al. (J. Am. Chem. Soc, 1964, 85: 2149-) (1964)), using the chemical strategy Fmoc / tert-Butyl on the 0.1 mmole scale. The different protected amino acids (Fmoc-L-aa; NOVABIOCHEM) are sequentially attached to the Rink amide resin (APPLIED BIOSYSTEM) after activation for 3 min at HATU (hexafluorophosphate dO- (7-azabenzotriazol-ly) -N, N, N ', N'-tetramethyluronium), according to the method of Miranda and Alewood (PNAS, 1999, 96: 1181-1186) in the presence of an excess, by a factor of 5, of DIEA (diisopropylethylamine) . In situ neutralization during coupling gives better acylation rates in a minimum of time. The coupling efficiency is checked by a TNBS test (trinitrobenzene sulfonic acid). If the test is positive, a second coupling is carried out, followed by an acetylation of 5 min with an Ac ₂ -DIEA-CH ₂ C1 ₂ 3: 0.3: 96.7 mixture and then 3 washes of one minute with CH ₂ C1 ₂ (chloroform) then with NMP (N-methyl- pyrrolidone). The Fmoc protecting groups are cleaved before each coupling with an NMP solution containing 20% piperidine. At the end of the synthesis, the resin is washed with diethyl ether and dried. The peptide is cleaved from the resin and deprotected with a TFA (trifluoroacetic acid) -H ₂ O-EDT-Pr ₃ SiH mixture (92.5: 2.5: 2.5: 2.5; 15 ml) for 2 hours at room temperature, precipitated in cold diethyl ether, centrifuged, washed in cold diethyl ether, recentrifuged, dissolved in water and finally lyophilized to give a crude peptide extract. The crude peptide is purified by HPLC on a semi-preparative column in reverse phase (column C1 8). The purity of the peptides is always greater than 95% and their identity is confirmed by mass spectrometry (positive MALDI-TOF-MS) and analytical HPLC. The synthesized peptide sequences (SEQ ID NO: 10 to 16) corresponding to the domains of LMP1 (Swiss-Protein Databank number P03230) and LMP2A (Swiss Protein Databank number P13285) are presented in Table I in the form of the one-letter code. 3) Immunization a) Peptides coupled to a carrier protein (KLH)

The peptides derived from LMP1 comprising only one exogenous cysteine (SEQ ID NO: 10, 11, 12, 15, 16) were individually coupled to the activated KLH (Imject maleimide-activated KLH®, PERBIO) according to the protocol of the maker. Mice (4 animals per group) are injected subcutaneously into the flank, with a peptide emulsion (50 μg in 0.1 ml H ₂ O) and complete Freund's adjuvant (0.1 ml). On days 21, 42 and 62 following the first injection (D ₀ ), the animals receive a booster injection, by the same route, with the same amount of antigen but in incomplete Freund's adjuvant. Blood is taken by retro-orbital puncture before each injection, to determine the titer of serum antibodies specific for LMP1 and LMP2A, by ELIS A b) Peptides coupled to a lipid

Peptides derived from LMP1 (SEQ ID NO: 10, 11, 13 and 14) were individually coupled to one or more molecules of cholesterol or palmitic acid, via thioether (cholesterol) or thioester linkage (s) (palmitic acid) with the thiol function of their cysteine residue (s). The coupling of the peptide (5 mg / ml) by a thioether bond to activated cholesterol (bromoacetylcholesterol) is spontaneous in dimethyl-formamide (DMF) medium / phosphate buffer pH 7.5 (95: 5). The progress of the reaction is followed by acidification of the reaction medium and analytical HPLC. The lipopeptide is purified by gel filtration in 20% acetic acid medium. Palmitic acid is incorporated into the peptide chain via a thioester bond, during peptide synthesis. The lipopeptide spontaneously organizes into vesicles (FIG. 4) which are washed by successive centrifugations in an aqueous medium. The immunization protocol for mice is the same as above except that the Freund's adjuvant is replaced by Montanide®.

4) ELISA

Blood samples are taken by retro-orbital puncture from the immunized mice, then the sera are collected and frozen at -20 ° C. in fractions of 20 μl. The wells of a microtiter plate (Maxisorp®, NUNC) are covered with 100 μl of peptide (1 μg / ml) overnight at + 4 ° C. Plates coated with irrelevant peptides of the same molecular weight serve as controls. The wells are then washed with PBS buffer containing 0.5% Tween 20 (PBS-T) and then blocked for 1 h in the presence of PBS buffer containing 2% skimmed milk powder (PBS-SM). After washing in the same buffer as above, 100 μl of serum diluted in PBS-T-SM buffer (PBS, 0.05% Tween 20, 2% skimmed milk powder) are added to the wells and the plates are incubated for 2 hours at 37 ° C. After four washes with PBS-T buffer, 100 μl of secondary anti-total immunoglobulin or anti-IgGl goat antibody, mouse -G2a, G2b and G3, conjugated with peroxidase (BIORAD), diluted to 1/10000 in PBS-T buffer is added to each well and the plates are incubated for 1 h at 37 ° C. After extensive washing with PBS-T buffer, 100 μl of substrate (OPD: o-phenylenediamine dihydrochloride, SIGMA) diluted in 0.05 M citrate buffer, pH 5.5 containing H ₂ O ₂ are added to each well and the plates are incubated for 30 min at room temperature, in the dark. The reaction is stopped by adding 4N sulfuric acid and the absorption at 492 nm is measured using an automatic microplate reader (DYNATECH).

5) Competition test The specificity of antigen-antibody binding is measured by a competition test, according to the method described by Friguet et al. (J Immunol. Methods, 1985, 77: 309-309). The principle of the method is as follows: the constants affinities are determined by linear regression from the displacement curves of the binding of the antibody to the antigen in the solid phase (in constant concentration) by variable concentrations of the same antigen in the liquid phase. The first step consists in the absorption of the antibody by the antigen or by an irrelevant peptide, in solution and the second step consists in the assay, by an indirect ELISA test, of the free antibodies when the antigen and the antibodies are in equilibrium. More specifically:

- step 1: different concentrations of the peptide antigen or of an irrelevant peptide (10 ^"π to 10 ^{" 5} M) are incubated with a fixed concentration of antibodies (serum diluted 1/50), in buffer PBS-T-SM (PBS, 2% skim milk powder, 0.05% Tween 20), for 18 h at 4 ° C.

- step 2: 100 μl of the reaction product obtained in step 1 are withdrawn, added to the wells of a microtiter plate previously coated with the peptide antigen (100 μg / well in NaHCO ₃ buffer, pH 9 , 6) and the plate is incubated for 1 h at 20 ° C. After washing with PBS-T buffer (PBS, 0.05% Tween 20), the immunoglobulins bound to the peptide antigen are detected by a secondary goat anti-mouse total immunoglobulin antibody coupled to peroxidase. The revelation of the reaction and the reading of the plates are carried out as for the ELISA test. 6) Cell culture

The HEK-293 line of human kidney embryonic cells (ATCC CRL 1573) and the line transfected with the plasmid pSV-HA-LMP1, derived from the line HEK-293, are cultured in 24-well plates, in medium of Dulbecco (GIBCO) supplemented with fetal calf serum (10%), glutamine (2 mM), non-essential amino acids (1%), sodium pyruvate (1 mM) and gentamycin (50 μg / ml). The plasmid pSV-HA-LMP1 is derived from the plasmid pSV5 (STRATAGENE) by cloning, under the control of the SV40 virus promoter, of an insert corresponding to the cDNA of LMP1 of the wild strain B95.8 of EBV. The other cells are cultured in RPMI medium supplemented as above. The EB95 infected marmoset B cell line B95.8 is used for the production of viral particles. B lymphocytes transformed by EBV (B-EBVneo) and LCL (EBV + lymphoblastoid cell lines in latency type III) derived from human PBMCs by infection with a culture supernatant of the line B95.8 are obtained as described in Current Protocols in Immunology, 1991, Colingan JE, Kruisbeek AM, Margulies DH, Schevach EM, Strober W, Greene. Peripheral blood mononuclear cells (PBMC) are purified by centrifuging a blood sample on a Ficoll gradient. The Jurkat line of human T lymphocytes and the DG75 line of EBV negative Burkitt lymphoma are also used as controls. 7) Immunocytochemistry

The experiments are carried out on coverslips (cells in suspension) or on 24-well plates (adherent cells) by conventional immunocytochemistry techniques, using a standard ABC protocol. More specifically, the adherent cells grown in plates and the non-adherent cells grown in suspension are washed with PBS, then, only in the case of the cells in suspension, deposited on a coverslip (100 μl to 10 cells / ml ). The cells are then fixed (plates or coverslips) under non-denaturing conditions: incubation for 30 min in PBS buffer, 4% formaldehyde, then 3 washes for 1 min with PBS, and finally blocking with 4% H O . In parallel, the cells are fixed under denaturing conditions: incubation for 30 min in PBS buffer, 4% formaldehyde, then denaturation by dehydration with increasing concentrations of ethanol (50 °, 70 °, 90 ° and 100 °) and finally blocking with 4% H ₂ O ₂ .

Incubations with primary and secondary antibodies are carried out, either in PBS buffer containing 5% skimmed milk powder (cells fixed under non-denaturing conditions), without any detergent or organic compound capable of inhibiting the binding of antibody, either in PBS buffer containing 0.5% Tween 20 or 0.05% saponin (cells fixed under denaturing conditions). More specifically, the cells are first incubated for 45 min at room temperature, in the presence of mouse immune serum specific for LMP1, prepared as described in Example 1 and in Example 2 (dilution to 1/1000 ^th ) and normal rabbit serum (dilution to ^1/300 ). The mouse antibodies are then labeled with a biotinylated rabbit antibody (SIGMA), according to the manufacturer's recommendations. After 3 washes with PBS, the fixed biotin is detected at using an ABC enzymatic system coupled with peroxidase (Axtravidin, SIGMA) then the reaction is revealed by diaminobenzidine (SIGMA).

8) Analysis of proliferation and cell cycle

A culture of lymphoblastoid cells infected with EBV (LCL, 10 ⁶ cells / ml) is distributed in a 6-well plate (10 ⁶ cells / well) then the cells are incubated for 4 days in RPMI medium containing normal serum of rabbit not decomplemented (dilution to l / 60 ^th ). Alternatively, the cells are incubated for 4 days with normal rabbit serum not decomplemented at the same concentration and increasing concentrations of anti-LMP 1 mouse immune serum (dilutions to l / 600 ^th , l / 300 ^th and l / 200 ^th ), prepared as described in Examples 1.3 and 2.

Cell proliferation is analyzed by direct observation of cultures (number of cells and cell morphology) by optical microscopy.

For the analysis of the cell cycle, 1 ml of cells are taken on D ₄ , rinsed in PBS, fixed in PBS buffer, 4% formaldehyde for 30 min at 4 ° C., washed twice in cold PBS buffer and then centrifuged . The cell pellet obtained is resuspended in 1 ml of PBS buffer containing 200 μg of propidium iodide and 100 μg of RNase A (/ ml), then incubated for 30 min at 37 ° C. The reactions are stored overnight at 4 ° C. and then the DNA content of the cells is analyzed by fluorometry (EPICS-XL cytometer, COULTER), so as to determine the percentage of cells in Go / Gi (2n), S (> 2n and <4n), G ₂ / M (4n) and in apoptosis (<2n).

9) Immunoprecipitation

10 ⁶ HEK-293 cells are transfected with the plasmid pSV-HA-LMP1 or with the control plasmid pSV5 ₃ using polyethylene imine, under the conditions recommended by the manufacturer. 48 hours after transfection, the cells are rinsed twice with PBS buffer, lysed for 15 min on ice, in 500 μl of PY buffer (20 mM Tris HC1, pH 7.4, 50 mM NaCl, 5 mM EDTA and 1% Triton X-100) supplemented with protease inhibitors (1 mM leupeptin, 1 mM natrium orthovanadate and 5 IU / μl aprotinin), then the lysate is finally clarified by centrifugation at 14,000 rpm. The lysate thus obtained is incubated for one hour at + 4 ° C. with light agitation, with a murine monoclonal antibody recognizing an intra- cell of LMP1 (CS1-4, NOVOCASTRA) or with 5 μl of anti-LMP 1 mouse immune serum prepared as described in examples 1.3 and 2. 100 μl of a solution of protein A-Sepharose (AMERSHAM-PHARMACIA) are then added and the mixture is stirred lightly on a carousel, for one hour at + 4 ° C. The Sepharose beads are then washed four times with PY buffer, eluted with 30 μl of Laemmli buffer then subjected to electrophoresis on polyacrylamide gel in the presence of SDS (SDS-PAGE).

After the electrophoretic separation, the proteins present in the gel are then transferred to membranes (Immobilon-P, MILLIPORE) by electro-transfer. The membranes are saturated for 1 hour and a half with a solution of casein (0.2%) in PBS-0.1% Tween 20 buffer, then they are incubated for one hour with the murine antibody CS1-4. After successive washes, the membranes are incubated for 15 minutes with anti-mouse IgG immunoglobulins conjugated to peroxidase (JACKSON IMMUNORESEARCH) and the immunoprecipitated LMP1 protein is revealed using the ECL kit (AMERSHAM).

Example 2 Preparation of conformational antibodies directed against the extracellular domains of the EBV LMP1 protein.

Antibodies directed against the extracellular domains of the EBV LMP1 protein were prepared by immunization of mice with the peptides SEQ ID NO: 10 and 11 coupled to KLH or else with the peptide SEQ ID NO: 13 coupled to cholesterol, as described in Example 1. The kinetics of appearance of serum antibodies directed against the extracellular domains of the LMP1 protein was analyzed by ELISA, as described in Example 1.

The results illustrated in FIG. 5 and in Table II show that the antigens according to the invention are immunogenic, that is to say that they induce the production of antibodies directed against the extracellular domains of the LMP1 protein when they are administered in vivo to an individual. Table II: Immunogenic power of antigens

Example 3 Analysis of the Specificity and the Affinity of the Anti-LMP1 Antibodies

The specificity and the affinity of the antibodies produced as described in examples 1 and 2 are measured by the competition test, as described in example 1.

The results obtained with the antibodies directed against the antigen representing the concatenation of the extracellular domains DE1 and DE2, separated by a cysteine residue (antigen (DE1 + DE2), SEQ ID NO: 10) are illustrated respectively in FIGS. 6 and 7 The absence of competition with the peptide (DE1 + DE3) demonstrates;

on the one hand, that the antibodies recognize the antigen (DE1 + DE2) in a specific way (FIG. 6), and

- on the other hand, insofar as these polyclonal antibodies (immune serum) show no reactivity with the peptide DE1 + DE3 which has the sequence DEl in common with the antigen (DEl + DE2), these results also indicate that these antibodies are conformational antibodies since they specifically recognize a non-contiguous epitope corresponding to the extracellular domain 1 associated with the extracellular domain 2, which domains are distant in the primary sequence of proteins because separated by a transmembrane domain and an intracellular domain but close when the LMP1 protein is folded back into its native form.

The affinity constants determined by linear regression from the curve in Figure 6 show that immunization with the antigen (DEl + DE2) makes it possible to produce antibodies having a strong affinity for the antigen (Ka of

7.3 nM and 20.8 nM).

Example 4: Analysis of the reactivity of the antibodies vis-à-vis the native or denatured LMP1 protein. The reactivity of the immune sera of mice prepared as described in examples 1.3 and 2, with respect to the native or denatured LMP1 antigen, is tested by immunocytochemistry, as described in example 1.7. Alternatively, the reactivity of the serums is tested in Western-Blot (denaturing conditions), according to standard protocols known in themselves or in immunoprecipitation (native conditions), as described in Example 1.9.

The results illustrated by FIGS. 8 and 9 and 10 demonstrate that the mouse immune sera contain conformational antibodies which recognize in a sensitive and specific manner the native LMP1 protein expressed on the surface of the cells of patients latently infected by EBV, in immuno - Cytochemistry (cells fixed under non-denaturing conditions as specified in Example 1.7) and in immunoprecipitation (cell lysates prepared under non-denaturing conditions); on the other hand, they do not recognize the LMP1 protein in denatured form, in immunocytochemistry (cells fixed under denaturing conditions as described in example 1.7) and in Western-Blot (cell lysates prepared under denaturing conditions).

EXAMPLE 5 Analysis of the Cytotoxic Activity of Antibodies (ADCC)

The cytotoxic activity of the antibodies is tested on B lymphoblastoid lines latently infected with EBV (B-LCLs), incubated with complement, alone (control) or in the presence of anti-LMP 1 mouse immune serum, as described in Example 1.8.

The results show that the anti-LMP 1 immune sera have a cytotoxic activity of the ADCC type, with respect to the cells latently infected with EBV:

- direct observation of the B-LCLs shows that at 24 hours, 50% of the cells incubated in the presence of complement and the lowest dilution of immune serum have been lysed; in later times, lysis of all cells is observed. - the cell cycle analysis (Figure 11) shows that after 4 days, 50% of the B-LCLs incubated in the presence of complement and the lowest dilution of immune serum are in apoptosis (F); by comparison with the control cells incubated in the presence of complement alone (A, C and E), a clear decrease in cell proliferation is observed with these same B-LCLs incubated in the presence of complement and the lowest dilution of immune serum. (decrease in the proportion of cells in S and G2 / M phases) and a 30% increase in the proportion of cells in apoptosis. Example 6 Preparation of Conformal Antibodies Directed Against the Extracellular Domains of the EBV LMP2A Protein

Antibodies against the extracellular domains of the LMP2A protein were prepared by immunization of batches of 4 BALB / c mice or of batches of 3 LOU / M rats with the peptides SEQ ID NO: 15, 16 and 17 coupled to activated KLH as described in example 1. The response of antibodies directed against the extracellular domains of the LMP2A protein was analyzed by ELISA, as described in example 1.

The results presented in Table III show that the antigens according to the invention have a high immunogenic power (symbolized by +), comparable to that of the antigens derived from the extracellular loops of LMP1 (Example 2). The best humoral response has been developed against the peptide SEQ

ID NO 16 (Table III). The peptides SEQ ID NO: 18 and 19 have not been synthesized.

Table III: Immunogenic power of LMP2A antigens in mice

(BALB / c) and the rat (LOU M)

* NT: not tested Example 7 Analysis of the Specificity and the Affinity of the Anti-LMP2A Antibodies

The specificity and the affinity of the anti-LMP2A antibodies produced as described in example 6, were measured by the competition test described in example 1.

The average affinity of the antibodies produced in BALB / c mice and LOU / M rats immunized with the peptide SEQ ID NO: 16 is illustrated in FIG. 12 which is representative of the results obtained with the three peptides tested (SEQ ID NO: 15, 16 and 17).

Immunization with LMP2A antigens makes it possible, after 3 boosters, to produce antibodies having, in mice, an average affinity (Figure 12, Ka = 50 nM ^"1 ) lower than that obtained with the peptides originating from the extracellular loops of LMPl (Figure 7, Ka≈7.3 nM ^"1 ). Comparative analysis of the affinity, after 3 immunizations, of anti-extracellular anti-loop antibodies DE2 + DE3 of LMP2A produced in rats and mice, shows that the antibodies produced in rats have an affinity much higher than those produced in mouse (Figure 12; Ka = 7.10 ^"π M ^{" 1} in the rat versus 5.10 ^"8 M ^{" 1} in the mouse). Similar results are obtained with mouse and rat antibodies produced against LMP1 peptides.

Anti-LMP2 rat immune sera will be used in in vivo serotherapy studies of EBV positive human tumors induced in SCID mice.

Example 8 Analysis of the Reactivity of Anti-LMP2A Antibodies Towards the Native Protein

1) Materials and methods a) Construction and production of an LMP2A expression vector (pREP4-LMP2 The LMP2A cDNA was amplified by RT-PCR from mRNA extracted from EBV positive lymphoblastic cells (LCLs). The pair of primers used for the PCR (SEQ ID NO: 27: 5ΑGAATTCATGGGGTCCCTAGAA3 'and SEQ ID NO: 28: 5' AGGTACCTTATAGAGTGTTGCGA3 'contains, in bold, the restriction sites EcoRl and Kpnl for insertion into the plasmid TOPO and , underlined, the complementary sequences of the cDNA of LMP2A (strain B95.8).

Competent bacteria JM 109 (INVITROGEN) were transformed, by thermal shock, with the plasmid TOPO-LMP2A, then they were amplified one hour at 37 ° C and selected overnight at 37 ° C on Luria Broth Base agar medium (LB, INVITROGEN) supplemented with ampicillin (APPLIGENE) and X-Gal (EUROGENTEC). Positive clones possessing the LMP2 cDNA insert (1500 bp) were isolated by enzymatic digestion and agarose gel electrophoresis of plasmid DNA mini-preparations. These positive clones were then amplified overnight at 37 ° C in 30 mL of liquid LB supplemented with ampicillin 1 night at 37 ° C, then the TOPO-LMP2 plasmid was extracted using the Nucleobond AX kit, following the manufacturer's protocol (MACHERY NAGEL). The plasmid DNA thus obtained was quantified by spectrophotometry at 260 nm and verified by enzymatic digestion and electrophoresis in 1.5% agarose gel in the presence of ethidium bromide.

The TOPO-LMP2 plasmid (20 μg) was digested with Hindlll and Not I (ROCHE DIAGNOSTIC) then the LMP2A insert (1500 bp) was isolated by agarose gel electrophoresis and purified using the Nucleospin kit Extract (MACHERY NAGEL). 45 ng of insert was added to 100 ng of linearized pREP4 by digestion with HindIII and Not I, then the mixture was ligated with 2 IU of phage T4 ligase (PROMEGA) overnight at 4 ° C. Competent bacteria were then transformed with the ligation product. Positive clones (pREP4-LMP2A) were isolated and amplified as above for the plasmid TOPO-LMP2A. b) Stable transfection of cell lines with the expression vector pREP4- LMP2A

The reactivity of the anti-LMP2A antibodies produced, vis-à-vis the native LMP2A protein, was tested using a cell line transfected stably with the plasmid pREP4-LMP2A obtained as follows:

HEK 293 cells were seeded in 6-well plates in 2 ml of DMEM medium supplemented with 10% S VF (DMEM-10% S VF) and then cultured until a cell culture in exponential phase was obtained. The cells were then rinsed and incubated in 1 ml of Optimem (GIBCO) to which was added a mixture of plasmid pREP4 or pREP4-LMP2A (1 to 2 ug of total DNA) and PEI (polyethylene imine, 4 μL / ug of DNA, EUROMEDEX) as a transfection agent. After 5 hours of incubation, the transfection medium was replaced with 2 ml of DMEM-10% S VF medium. Cells expressing LMP2A stably were selected by culture in the presence of 100 μg / ml of hygromycin for 4 to 5 weeks.

The expression vector used (pREP4) can be maintained in episomal form, stably in the transfected cells, thanks to its origin of Ori P replication. It replicates synchronously with division and is therefore, theoretically, completely transmitted to all the daughter cells. A new cell line expressing LMP2A (HEK-LMP2A) is obtained which can be compared to the original HEK line in immunocytochemistry tests. c) Anti-LMP2 immunocytochemistry on HEK and HEK-LMP2A cells

HEK 293 or HEK-LMP2 cells are suspended (100,000 / ml) by digestion with a trypsin solution for 15 min at 37 ° C. then washing in PBS buffer. The cells are placed on a histological slide, dried completely, then rehydrated and fixed under non-denaturing conditions: incubation in PBS buffer supplemented with 4% 4% paraformaldehyde, for 20 min at room temperature. After washing with PBS, the cells are treated with 3% hydrogen peroxide for 10 min and saturated with blocking buffer (PBS-5% skimmed milk powder). The cells are then incubated with the anti-LMP2 rat immune serum prepared as described in Example 6 (1/500) saturated with normal goat serum (1/50). The rat IgGs are detected using the Extra5 detection-amplification kit (SIGMA) and the presence of exogenous peroxidase is revealed using diamino-benzidine for 5 to 10 min depending on the intensity of the staining. 2) Results

FIG. 13 shows that the anti-LMP2 rat antibodies specifically recognize the LMP2A protein expressed at the membrane of the cells transfected with the expression vector pREP4-LMP2A; in these cells, a very intense labeling (brown coloration) is observed with the anti-LMP2 ₃ rat antibody whereas the cells of the original line, which differ only in the absence of expression of LMP2A, do not are not labeled with anti-LMP2 antibodies. The detection of the LMP2A protein with anti-LMP2A rat antibodies is carried out without prior permeabilization of the cells, demonstrating that the antibodies are capable of binding specifically on the LMP2A protein expressed at the membrane of the transfected cells.

EXAMPLE 9 Serotherapy and Anti-Tumor Vaccination Using Antibodies and Anti-LMP 1 and Anti-LMP2 Antigens The Experiments in Anti-Tumor Serotherapy Using Anti-LMP2A Antibodies were carried out in a tumor model human in SCID (Severe Combined Immunodeficiency) mice. The anti-tumor vaccination experiments were carried out in BALB / c mice, with peptide antigens and transfected murine tumor cells. 1) Serotherapy a) Induction of tumors expressing LMPl and LMP2A in SCID mice

Human EBV + cell lines of monocytic (E1) and T lymphocyte (NC5) origin, developing an EBV latency II phenotype (Masy E. et al., J Virol, 2002, 76: 6460-72; FIG. 1), are tumorigenes in SCID mice. The El and NC5 cells are cultured in DMEM-10% S VF medium and maintained in the exponential growth phase by adding fresh medium. The suspended cells are washed twice in PBS by centrifugation and diluted to 10 or 30 million / ml in 0.9% NaCl medium, then injected subcutaneously into the interscapular region into SCID mice (0.1 ml by mouse). Mice are sacrificed when the interscapular tumor exceeds 250 mm2. The survival results of the mice injected with the two quantities of cells (1 million or 3 million) of each of the lines are presented in Table IV. Table IV: Influence of the number and type of cells injected on the survival of SCID mice Number of cells El cells NC cells 5% survival

1 million + - 42 (n = 12)

3 million + 25 (n = 9)

1 million + 33 (n = 9)

3 million - + 16 (n = 6)

The cells (E1 or NC5) gave palpable tumors at the start of the second week following the injection in most mice who had be sacrificed before the end of the third week of the experiment. Of the two cell types tested, NC5 cells are the most aggressive (Table IV). Some SCID mice gave no tumor more than 45 days after the injection, which justifies a certain percentage of survival in Table IV. b) Verification of the Expression of LMP1 and LMP2A on the Surface of El and NC5 Cells

The presence of LMP1 and LMP2A on the surface of the E1 and NC5 cells was checked in immunocytochemistry, using anti-LMP2A rat immune serum, anti-LMP 1 mouse immune serum and normal serum (NRas). , according to the protocols described in examples 1.7 and 8.

The intensity of the labeling of LMP1 is much greater than that of LMP2A on the two cell types (FIG. 14), in agreement with a higher expression level for LMP1 than for LMP2A. The labeling of LMP2A on NC5 cells is even very slight compared to that of LMP2A on El cells, but clearly superior to the background noise (column NRaS, Figure 14). c) Anti-tumor anti-LMP2 serotherapy

The serotherapy studies of tumors induced in SCID mice were carried out on El cells with anti-LMP2A antibodies of rat affinity 7.10 ^"11 M ^{" 1} described in Examples 6 and 7 and in FIG. 12, directed against the peptide (SEQ ID NO: 16) mimicking the DE2 + DE3 domains of LMP2.

Four groups of 10 SCID mice received an interscapular subcutaneous injection of 3 million El cells in a volume of 100 μL of 0.9% NaCl, on the same day, from the same preparation of El cells. A D +2 and D + 5 after the injection, the 3 groups of 10 mice received two intraperitoneal (ip) injections of 40 μL of anti-LMP2 antibody from rats diluted in 100 μL of 0.9% NaCl, while that the control group received 100 μL of normal rat serum.

The survival curve of the SCID mice injected with 3 million E1 cells, then treated with an anti-LMP2A serum or a normal serum is presented in FIG. 15. Only 22% of the control mice survive an injection of rat noraial serum ( NRaS), in agreement with the data in Table IV showing 25% survival for SCID mice injected with 3.10 ° El cells and having undergone no particular treatment. In contrast, SCID mice injected with 3 million El cells and treated with 2 injections of 40 μL of anti-LMP2 antibodies have delayed tumor progression and 50% of them are protected for at least 45 days from the appearance of tumors (Figure 15) .

These results demonstrate that the anti-extracellular anti-loop antibodies of LMP2 are capable of preventing the appearance and the development of human tumors induced by E1 cells in SCID mice. 2) Preventive cancer vaccination

These experiments include: (i) immunization of BALB / c (immunocompetent) mice with the LMP1 antigen, so as to obtain conformational anti-LMP1 extracellular loop antibodies, and (ii) inoculation of the tumorigenic cells with murine origin. a) Production of a tumorigenic line expressing LMP1

Firstly, a tumorigenic murine line expressing LMP1 in a stable manner was constructed in a manner analogous to the line expressing LMP2 A described in Example 8 _. plasmi ^

The LMP1 cDNA was isolated by digestion of the plasmid pSVHA-LMP1, using the restriction enzymes Hind III and Not I and then cloned at the same sites in the plasmid pREP4, as described in Example 8. - production of 'a Ugne ^ _. stabk

The Sp2o cell line, of BALB / c genetic background, makes it possible to obtain tumors in BALB / c mice. A stable line expressing LMP1 was selected from semi-adherent Sp2o cells transfected with the recombinant vector pREP4-LMP1, then the expression of LMP1 in the transfected line was analyzed, as described in Example 8. After four weeks of growth in a selective medium, all the cells are labeled, in a homogeneous manner, with the extracellular anti-loop antibody of LMP1 (FIGS. 16a and 16b). No labeling of the Sp2o-LMP1 line is obtained with the antibodies directed against the extracellular loops of LMP2 (FIGS. 16c and 16d) or else with normal serum. b) Preventive vaccination

Forty-one BALB / c mice (7 weeks old) are immunized according to a standard protocol described previously in example 1. The mice receive an injection, either of KLH (n = 21), or of the peptide mimicking the extracellular loops of LMP1 (SEQ ID NO: 10) coupled to KLH (n = 20). Five days before the injection of Sp2o-pREP4-LMP1 cells, the mice of each batch receive a booster injection, respectively with KLH or KLH coupled to the peptide SEQ ID NO: 10.

The mice of the control group (KLH; n = 21) receive an injection by the subcutaneous interscapular route, of a million Sp2o-pREP4-LMP1 cells. The mice immunized against the peptide mimicking the extracellular loops of LMP1 are separated into two batches of 10 mice, each receiving the same day, from the same preparation of Sp2o-pREP4-LMP1 cells, a subcutaneous interscapular injection of 1 or 3 million cells in a volume of 100 μL of 0.9% NaCl.

Figure 17 shows that Sp2o cells transfected with pREP4-LMP1 are particularly aggressive and produce very fast growing tumors. Tumors develop in most control mice (KLH) from the first week (D + 5) after the injection. In 15 days, all the mice had to be sacrificed because the tumors exceeded a threshold surface of 250 mm ² .

In contrast, none of the mice that received 1 million Sp2o-pREP4-LMP1 cells (KLH-LMP1 (1 M), Figure 17) developed a tumor for more than 45 days after inoculation. When the quantity of cells injected is increased to 3 million per mouse (KLH-LMP1 (3M), FIG. 17), palpable tumors appear in 23 mice in certain mice. The significant standard deviations of this curve reflect the large individual variation in the size of the tumors encountered in this treated group (KLH-LMP1 (3M), Figure 17). However, tumor progression was slowed in this group and 2 of 10 mice treated remained free from any tumor.

In conclusion, all of these results show that it is possible to obtain a very good humoral response against type III membrane proteins of parasitic, viral or bacterial origins as defined in FIG. 2 and to treat or vaccinate patients against infection by these microorganisms, by mimicking with peptide constructs, the structure of the extracellular loops of these membrane proteins which are naturally little immunogenic. As is apparent from the above, the invention is in no way limited to those of its modes of implementation, embodiment and application which have just been described more explicitly; on the contrary, it embraces all the variants which may come to the mind of the technician in the matter, without departing from the framework, or the scope, of the present invention.

Claims

1) Antigen derived from a pathogenic intracellular microorganism, characterized in that it comprises at least one peptide fragment essentially constituted by the concatenation of the sequences of at least two adjacent extracellular domains in the native structure of a membrane protein. type III of said pathogenic intracellular microorganism.

2 °) Antigen according to claim 1, characterized in that said type III membrane protein has 2n transmembrane domains.

3 °) Antigen according to claim 1 or claim 2, characterized in that said peptide fragment also comprises at least one heterologous binding sequence of 1 to 5 amino acids identical or different from each other, preceding the sequence of one of said extracellular domains.

4 °) Antigen according to claim 3, characterized in that said amino acids are different from those present in the sequences of said extracellular domains.

5 °) Antigen according to claim 3, characterized in that all the sequences of the adjacent extracellular domains, with the exception of those located at the N and / or C-terminal ends of said peptide fragment, are preceded by a heterologous binding sequence. 6 °) Antigen according to claim 3, characterized in that all the sequences of the adjacent extracellular domains of said peptide fragment are preceded by a heterologous binding sequence.

7 °) Antigen according to claim 3, characterized in that said amino acids are chosen from cysteine (C) and / or lysine (K). 8 °) antigen according to any one of claims 1 to 7, characterized in that said peptide fragment also includes, between the heterologous binding sequences and the sequences of the extracellular domains and on either side of said sequences of the extracellular domains, a sequence of at least one amino acid, preferably from 1 to 7 amino acids, preferably 2 amino acids, corresponding to that of the transmembrane domain flanking said extracellular domain in the structure of said type III membrane protein. 9 °) Antigen according to any one of claims 1 to 8, characterized in that it comes from a type III membrane protein selected from the group consisting of: the proteins LMPl and LMP2A of EBV (number of SWISSPROT access, respectively P03230 and P13285, with reference to the sequence of the B95.8 strain of EBV), the LAMP K15-P and LAMP K15-M proteins of KSHV (GENBANK access numbers, AAD45297 and AAD45296 respectively), proteins p7, NS2 and NS4B of HCV (access number EMBL AF009606), protein MOMP of Chlamydia trachomatis (access number NCBI AF352789) and proteins Mmpl 1 to 12 of Mycobacterium tuberculosis (access number EMBL Z87425 .1). 10 °) Antigen according to any one of claims 1 to 9, characterized in that said peptide fragment as defined in claim 1 is essentially constituted by the concatenation of the sequences of 2 to 6 adjacent extracellular domains, preferably 2 or 3 adjacent extracellular domains in the native structure of said protein. 11 °) Antigen according to any one of claims 1 to 10, characterized in that it is selected from the sequences SEQ ID NO: 10, 11 and 13 to 23.

12 °) Antigen according to any one of claims 1 to 10, characterized in that it comprises at least two peptide fragments as defined in claim 1, derived from different type III membrane proteins.

13 °) Antigen according to any one of claims 3 to 12, characterized in that at least one of the amino acids of a heterologous binding sequence as defined in claim 2, is covalently linked to at least a carrier protein or at least one lipid. 14 °) Antigen according to claim 13, characterized in that at least two amino acids, each resulting from the single sequence of connection of distinct peptide fragments are linked to a carrier protein.

15 °) Antigen according to claim 13 or claim 14, characterized in that a cysteine or a lysine of a heterologous binding sequence are linked to a carrier protein, respectively by a thioether bond and an amide bond. 16 °) Antigen according to any one of claims 13 to 15, characterized in that said carrier protein is KLH.

17 °) Antigen according to claim 13, characterized in that the lipid or lipids are connected by ether, thioether, ester and thioester bonds, preferably by thioester bonds.

18 °) Antigen according to claim 16 or claim 17, characterized in that at least two amino acids derived from one or more heterologous sequence (s) of link (s) of a single peptide fragment, are each linked to a lipid.

19 °) Antigen according to any one of claims 13, 17 and 18, characterized in that said lipid is selected from cholesterol and palmitic acid.

20 °) Antigen according to claim 19, characterized in that it comprises at least one cholesterol linked to a cysteine residue, aspartic acid or glutamic acid or else a palmitic acid linked to a serine or a freonine. 21 °) Antigen according to any one of claims 17 to 20, characterized in that it is in the form of vesicles or lipopeptide micelles.

22 °) Immunogenic composition, characterized in that it comprises an antigen according to any one of claims 1 to 21, associated with at least one pharmaceutically acceptable vehicle and optionally with at least one adjuvant. 23 °) Use of an antigen according to any one of claims 1 to 21 for the preparation of a vaccine intended for the prevention or treatment of a latent or chronic infection by a pathogenic intracellular microorganism and associated pathologies.

24 °) antibody directed against a type III membrane protein as defined in claim 1, characterized in that it is produced by immunization of an appropriate animal with an antigen according to any one of claims 1 to 20 or a immunogenic composition according to claim 22.

25 °) Antibody according to claim 24, characterized in that it is selected from monoclonal antibodies and humanized antibodies. 26 °) Reagent for the diagnosis of latent or chronic infection by a pathogenic intracellular microorganism and associated pathologies, characterized in that it comprises at least one antibody according to claim 24 or claim 25.

27 °) Use of an antibody according to claim 24 or claim 25 for the preparation of a diagnostic reagent intended for the detection of a latent or chronic infection by a pathogenic intracellular microorganism and associated pathologies.

28 °) Kit for diagnosing a latent or chronic infection by a pathogenic intracellular microorganism and associated pathologies, characterized in that it comprises at least one antibody according to claim 24 or claim 25.

29 °) Pharmaceutical composition, characterized in that it comprises at least one antibody according to claim 24 or claim 25 associated with at least one pharmaceutically acceptable vehicle.

30 °) Use of an antibody according to claim 24 or claim 25 for the preparation of a medicament intended for the treatment of a latent or chronic infection by a pathogenic intracellular microorganism and associated pathologies.

31 °) Isolated nucleic acid molecule, characterized in that it comprises a sequence coding for an antigen according to any one of Claims 1 to 21.

32 °) probes and / or primers for obtaining an antigen according to any one of claims 1 to 21, characterized in that they comprise a sequence of approximately 10 to 30 nucleotides corresponding to that located at the junction sequences encoding a transmembrane domain and sequences encoding an extracellular domain adjacent to the preceding one, of a type III membrane protein as defined in claim 1.

33 °) Recombinant eukaryotic or prokaryotic vector, characterized in that it comprises an insert constituted by a nucleic acid molecule according to claim 31. 34 °) Eukaryotic or prokaryotic cells modified by a recombinant vector according to claim 33.