EP1575622A2 - Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using same - Google Patents
Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using sameInfo
- Publication number
- EP1575622A2 EP1575622A2 EP03808063A EP03808063A EP1575622A2 EP 1575622 A2 EP1575622 A2 EP 1575622A2 EP 03808063 A EP03808063 A EP 03808063A EP 03808063 A EP03808063 A EP 03808063A EP 1575622 A2 EP1575622 A2 EP 1575622A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- udp
- providing
- recombinant
- glycosaminoglycan
- functional acceptor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L24/00—Surgical adhesives or cements; Adhesives for colostomy devices
- A61L24/04—Surgical adhesives or cements; Adhesives for colostomy devices containing macromolecular materials
- A61L24/08—Polysaccharides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/14—Macromolecular materials
- A61L27/20—Polysaccharides
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08B—POLYSACCHARIDES; DERIVATIVES THEREOF
- C08B37/00—Preparation of polysaccharides not provided for in groups C08B1/00 - C08B35/00; Derivatives thereof
- C08B37/006—Heteroglycans, i.e. polysaccharides having more than one sugar residue in the main chain in either alternating or less regular sequence; Gellans; Succinoglycans; Arabinogalactans; Tragacanth or gum tragacanth or traganth from Astragalus; Gum Karaya from Sterculia urens; Gum Ghatti from Anogeissus latifolia; Derivatives thereof
- C08B37/0063—Glycosaminoglycans or mucopolysaccharides, e.g. keratan sulfate; Derivatives thereof, e.g. fucoidan
Definitions
- the present invention relates to methodology for the production of polymers, such as polysachharides or oligosaccharides, by a glycosaminoglycan synthase and, more particularly, polymer production utilizing glycosaminoglycan synthases from Pasteurella multocida.
- glycosaminoglycans show potential as non-toxic therapeutic agents to modulate blood coagulation, cancer metastasis, or cell growth. Complex sugars cause biological effects by binding to target proteins including enzymes and receptors. Methodologies to synthesize many compounds, however, and to test for potency and selectivity are limiting steps in drug discovery. Moreover, glycosamirioglycans of different sizes can have dramatically different biological effects. As such, the presently claimed and disclosed invention also relates to a chemoenzymatic synthesis methodology to create both pure, chimeric, and hybrid polymers composed of hyaluronan, chondroitin, keratan, dermatan, heparin units, and combinations thereof (e.g. "chimeric or hybrid” polymers), wherein the pure, chimeric and hybrid polymers are substantially monodisperse in size. [0006] Description of the Related Art
- Polysaccharides are large carbohydrate molecules comprising from about 25 sugar units to thousands of sugar units. Oligosaccharides are smaller carbohydrate molecules comprising less than about 25 sugar units. Animals, plants, fungi and bacteria produce an enormous variety of polysaccharide structures that are involved in numerous important biological functions such as structural elements, energy storage, and cellular interaction mediation. Often, the polysaccha ride's biological function is due to the interaction of the polysaccharide with proteins such as receptors and growth factors.
- glycosaminoglycan class of polysaccharides and oligosaccharides which includes heparin, chondroitin, dermatan, keratan, and hyaluronic acid, plays major roles in determining cellular behavior (e.g. migration, adhesion) as well as the rate of cell proliferation in mammals.
- These polysaccharides and oligosaccharides are, therefore, essential for the correct formation and maintenance of the organs of the human body.
- Several species of pathogenic bacteria and fungi also take advantage of the polysaccharide's role in cellular communication. These pathogenic microbes form polysaccharide surface coatings or capsules that are identical or chemically similar to host molecules.
- Group A & C Streptococcus and Type A Pasteurella multocida produce authentic hyaluronic acid capsules
- Other Pasteurella multocida (Type F and D) and pathogenic Escherichia coli (K4 and K5) are known to make capsules composed of polymers very similar to chondroitin and heparin.
- the pathogenic microbes form the polysaccharide surface coatings or capsules because such a coating is nonimmunogenic and protects the bacteria from host defenses, thereby providing the equivalent of molecular camouflage.
- Enzymes alternatively called synthases, synthetases, ortransferases, catalyze the polymerization of polysaccharides found in living organisms. Many of the known enzymes also polymerize activated sugar nucleotides. The most prevalent sugar donors contain UDP, but ADP, GDP, and CMP are also used depending on (1) the particular sugar to be transferred and (2) the organism. Many types of polysaccharides are found at, or outside of, the cell surface. Accordingly, most of the synthase activity is typically associated with either the plasma membrane on the cell periphery or the Golgi apparatus membranes that are involved in secretion. In general, these membrane-bound synthase proteins are difficult to manipulate by typical procedures, and only a few enzymes have been identified after biochemical purification.
- glycosaminoglycan polysaccharides heparin from pig intestinal mucosa and hyaluronic acid from rooster combs
- Polysaccharides extracted from bacterial capsules e.g. various Streptococcus pneumoniae strains
- bacterial capsules e.g. various Streptococcus pneumoniae strains
- chemical modification e.g. hydrolysis, sulfation, deacetylation
- Hyaluronic acid or "HA” is a linear polysaccharide of the glycosaminoglycan class and is composed of up to thousands of ⁇ (l,4)GlcUA- ⁇ (l,3)GlcNAc repeats.
- HA is a major structural element of the extracellular matrix and plays roles in adhesion and recognition.
- HA has a high negative charge density and numerous hydroxyl groups, therefore, the molecule assumes an extended and hydrated conformation in solution.
- the viscoelastic properties of cartilage and synovial fluid are, in part, the result of the physical properties of the HA polysaccharide.
- HA also interacts with proteins such as CD44, RHAMM, and fibrinogen thereby influencing many natural processes such as angiogenesis, cancer, cell motility, wound healing, and cell adhesion.
- HA has been widely used as a viscoelastic replacement for the vitreous humor of the eye in ophthalmic surgery during implantation of intraocular lenses in cataract patients.
- HA injection directly into joints is also used to alleviate pain associated with arthritis.
- Chemically cross-linked gels and films are also utilized to prevent deleterious adhesions after abdominal surgery.
- adsorbed HA coatings also improve the biocompatibility of medical devices such as catheters and sensors by reducing fouling and tissue abrasion.
- HA is also made by certain microbes that cause disease in humans and animals.
- Some bacterial pathogens namely Gram-negative Pasteurella multocida Type A and Gram- positive Streptococcus Group A and C, produce an extracellular HA capsule which protects the microbes from host defenses such as phagocytosis.
- Mutant bacteria that do not produce HA capsules are 10 2 - and 10 3 -fold less virulent in comparison to the encapsulated strains.
- the Paramecium bursaria Chlorella virus (PBCV-1) directs the algal host cells to produce a HA surface coating early in infection.
- HAS HA synthases
- the various HA synthases utilize UDP- GlcUA and UDP-GlcNAc sugar nucleotide precursors in the presence of a divalent Mn, Mg, or Co ion to polymerize long chains of HA.
- the HASs are membrane proteins localized to the lipid bilayer at the cell surface. During HA biosynthesis, the HA polymer is transported across the bilayer into the extracellular space. In all HASs, a single species of polypeptide catalyzes the transfer of two distinct sugars. In contrast, the vast majority of other known glycosyltransferases transfer only one monosaccharide.
- HasA (or spHAS) from Group A Streptococcus pyogenes was the first HA synthase to be described at the molecular level.
- the various vertebrate homologs (Xenopus DG42 or XIHAS1; murine and human HAS1, HAS2, and HAS3) and the viral enzyme, A98R, are quite similar at the amino acid level to certain regions of the HasA polypeptide chain ( ⁇ 30% identity overall) and were discovered only after the sequence of spHAS was disclosed in 1994 . At least 7 short motifs (5-9 residues) interspersed throughout these Class I enzymes are identical or quite conserved. The evolutionary relationship among these HA synthases from such dissimilar sources is not clear at present.
- the enzymes are predicted to have a similar overall topology in the bilayer: membrane-associated regions at the amino and the carboxyl termini flank a large cytoplasmic central domain ( 200 amino acids).
- the amino terminal region appears to contain two transmembrane segments, while the carboxyl terminal region appears to contain three to five membrane-associated or transmembrane segments, depending on the species. Very little of these HAS polypeptide chains are expected to be exposed to the outside of the cell.
- HA made in mammalian cells was reported to have a covalently attached UDP group as measured by an incorporation of low amounts of radioactivity derived from 32 P-labeled UDP- sugar into an anionic polymer. This data implied that the last sugar was transferred to the reducing end of the polymer. Thus, it remains unclear if these rather similar HAS polypeptides from vertebrates and streptococci actually utilize different reaction pathways.
- the Class II HAS, pmHAS has many useful catalytic properties including the ability to elongate exogenous acceptors at the non-reducing end with HA chains.
- the homologous chondroitin synthase, pmCS also is useful, but it adds chondroitin chains to the acceptor's non-reducing terminus.
- the present invention provides a method for the production of glycosaminoglycans of HA, chondroitin, and chimeric or hybrid molecules incorporating both HA and chondroitin, wherein the glycosaminoglycans are substantially monodisperse and thus have a defined size distribution.
- the present invention also encompasses the use of one or more modified synthases that have the ability to produce non-natural polymers.
- An advantage of these mutant enzymes is that their altered specificity allows new useful groups or units to be added to the polymer.
- the present invention also encompasses the methodology of polysaccharide or oligosaccharide polymer grafting, i.e. HA, heparosan or chondroitin, using either a hyaluronan synthase (pmHAS) or a chondroitin synthase (pmCS) or a heparin synthase (pmHS, also referred to as pmHSl, and PglA, also referred to as pmHS2), respectively, from various types of P. multocida.
- Modified versions of the pmHAS or pmCS or pmHSl, or pmHS2 enzymes can also be utilized to graft on polysaccharides of various size and composition.
- the present invention results in (1) the targeting of specific, desirable size distributions or size ranges and (2) the synthesis of monodisperse (narrow size distribution) polymers.
- pmHAS HA synthase from the fowl cholera pathogen, Type A P. multocida
- pmHS2 Two unique heparin synthases, PglA (now referred to as pmHS2) and pmHS (now referred to as pmHSl), from Type A, D, and F P. multocida and Type D P. multocida, respectively, have been identified and cloned and are disclosed and claimed in co-pending
- pmHAS recombinant pmHAS, pmHSl, pmHS2, and pmCS synthases add sugars to the nonreducing end of a growing polymer chain.
- the correct monosaccharides are added sequentially in a stepwise fashion to the nascent chain or a suitable exogenous HA or chondroitin oligosaccharide acceptor molecule.
- the pmHAS sequence is significantly different from the other known HA synthases. There appears to be only two short potential sequence motifs ([D/N]DGS[S/TJ; DSD[D/T]Y) in common between pmHAS and the Group A HAS-spHAS. Instead, a portion of the central region of the pmHAS is more homologous to the amino termini of other bacterial glycosyltransferases that produce different capsular polysaccharides or lipopolysaccharides.
- pmHAS is about twice as long as any other HAS enzyme. [00027] When the pmHAS is given long elongation reaction times, HA polymers of at least
- recombinant versions of pmHAS and pmCS produced in certain foreign hosts also have the ability to extend exogenously supplied HA or chondroitin oligosaccharides with long HA and chondroitin polymers in vitro, respectively.
- the recombinant pmHSl and pmHS2 enzymes produced in a foreign host have the ability to extend HA, chondroitin, or heparin oligosaccharides with long heparosan chains in vitro. See e.g. U.S. Serial No. 10/195,908, filed July 15, 2002, the contents of which are expressly incorporated herein by reference in their entirety. If recombinant versions of pmHAS or pmCS or pmHSl or pmHS2 are supplied with functional acceptor oligosaccharides, total HA, chondroitin and heparin biosynthesis is increased up to
- the native versions of the pmHAS, pmCS, pmHSl, and PmHS2 enzymes isolated from P. multocida do not perform such elongation reactions with exogenous acceptor (or perform with very low efficiency) due to the presence of a nascent HA, chondroitin, or heparin chain in the natural host.
- the nature of the polymer retention mechanism of the pmHAS, pmCS, pmHSl, and PmHS2 polypeptide might be the causative factor for this activity: i.e. a HA- or chondroitin- or heparin-binding site may exist that holds onto the HA or chondroitin or heparin chain during polymerization.
- Small HA or chondroitin or heparin oligosaccharides supplied by the hand of man are also capable of occupying this site of the recombinant enzyme and thereafter be extended into longer polysaccharide chains.
- HAS enzyme from Group A and C Streptococcus bacteria has been detergent-solubilized and purified in an active state in small quantities. Once isolated in a relatively pure state, the streptococcal enzyme has very limited stability.
- a soluble recombinant form of the HAS enzyme from P. multocida called pmHAS 1"703 comprises residues 1-703 of the 972 residues of the native pmHAS enzyme. pmHAS 1"703 can be mass-produced in E. coli and purified by chromatography.
- the pmHAS 1"703 enzyme retains the ability of the parent enzyme to add onto either a long HA polymer, a short HA primer, a long chondroitin polymer, a short chondroitin primer, a short chondroitin polymer, as well as other exogenous acceptors.
- the chondroitin chain may also be sulfated.
- the purified pmHAS 1"703 enzyme is stable in an optimized buffer for days on ice and for hours at normal reaction temperatures.
- One formulation of the optimal buffer consists of IM ethylene glycol, 0.1 - 0.2 M ammonium sulfate, 50mM Tris, pH 7.2, and protease inhibitors which also allow the stability and specificity at typical reaction conditions for sugar transfer.
- UDP-sugars and divalent manganese (10-20 mM) are added.
- pmHAS 1"703 will also add a HA polymer onto plastic beads with an immobilized short HA primer or any other substrate capable of having an acceptor molecule or acceptor group thereon.
- pmCS, pmHAS, pnHS, and PmHS2 possess two separate glycosyltransferase sites.
- the WGGED sequence motif appears to be involved in GlcNAc-transferase activity because E396 mutants and D370 mutants possessed only GlcUA- transferase activity.
- the highly homologous (90% identical) pmCS can also be mutated in the same fashion. For example, mutating the homologous DXD motif in the GlcUA site of pmCS results in an enzyme with only Gal Ac-transferase activity.
- Type F P. multocida synthesizes an unsulfated chondroitin ( ⁇ 3N- acetylgalactosamine [GalNAc]- ⁇ 4GlcUA) capsule. Domain swapping between pmHAS and the homologous chondroitin synthase, pmCS, has been performed.
- a chimeric or hybrid enzyme consisting of residues 1-427 of pmHAS and residues 421-704 of pmCS was an active HA synthase.
- the converse chimeric or hybrid enzyme consisting of residues 1-420 of pmCS and residues 428-703 of pmHAS was an active chondroitin synthase.
- the present invention encompasses methods of producing a variety of unique biocompatible molecules and coatings based on polysaccharides.
- Polysaccharides especially those of the glycosaminoglycan class, serve numerous roles in the body as structural elements and signaling molecules.
- the present invention By grafting or making hybrid molecules composed of more than one polymer backbone, it is possible to meld distinct physical and biological properties into a single molecule without resorting to unnatural chemical reactions or residues.
- the present invention also incorporates the propensity of certain recombinant enzymes, when prepared in a virgin state, to utilize various acceptor molecules as the seed for further polymer growth: naturally occurring forms of the enzyme or existing living wild- type host organisms do not display this ability.
- the present invention results in (a) the production of hybrid oligosaccharides or polysaccharides and (b) the formation of polysaccharide coatings.
- Such hybrid polymers can serve as "molecular glue" ⁇ i.e.
- Such polysaccharide coatings are useful for integrating a foreign object within a surrounding tissue matrix.
- a prosthetic device is more firmly attached to the body when the device is coated with a naturally adhesive polysaccharide.
- the device's artificial components could be masked by the biocompatible coating to reduce immunoreactivity or inflammation.
- Another aspect of the present invention is the coating or grafting of GAGs onto various drug delivery matrices or bioadhesives or suitable medicaments to improve and/or alter delivery, half-life, persistence, targeting and/or toxicity.
- pmHAS and pmCS and pmHSl and PmHS2 appear distinct from most other known HA and chondroitin and heparin synthases based on differences in sequence, topology in the membrane, and/or putative reaction mechanism.
- pmHAS the 972-residue membrane-associated hyaluronan synthase, catalyzes the transfer of both GlcNAc and GlcUA to form an HA polymer.
- pmHAS and pmCS mutants have been analyzed.
- pmHAS 1"703 is a soluble, active HA synthase suggesting that the carboxyl-terminus is involved in membrane association of the native enzyme.
- pmHAS 1"650 is inactive as a HA synthase, but retains GlcNAc-transferase activity.
- Pasteurella multocida Type F the minor fowl cholera pathogen, produces an extracellular polysaccharide capsule that is a putative virulence factor.
- the capsule of Pasteurella multocida Type F was removed by treating microbes with chondroitin AC lyase. It was found by acid hydrolysis that the polysaccharide contained galactosamine and glucuronic acid.
- a Type F polysaccharide synthase was molecularly cloned and its enzymatic activity was characterized.
- the 965-residue enzyme, called pmCS is 90% identical at the nucleotide and the amino acid level to the hyaluronan synthase, pmHAS, from P. multocida Type A.
- pmCS 965-residue enzyme
- a recombinant Escherichia co/7-derived, truncated, soluble version of pmCS was shown to catalyze the repetitive addition of sugars from UDP-GalNAc and UDP-GlcUA to chondroitin oligosaccharide acceptors in vitro.
- pmCS a single polypeptide species
- PmHS2 a single polypeptide specie that possess both transferase activities to catalyze heparin/heparosan.
- glycosaminoglycan chains composed of about 5 kDa to about 4 MDa.
- the two current competing state-of-the-art techniques for creating the desired smaller size glycosaminoglycan [GAG] polymers are extremely limited and will not allow the medical potential of the sugars to be achieved.
- Small GAG molecules are presently made either by: (1) partially depolymerizing costly large polymers with degradative enzymes or with chemical means (e.g. heat, acid, sonication), or (2) highly demanding organic chemistry- based carbohydrate synthesis.
- the former method is difficult to control, inefficient, costly, and is in a relatively stagnant development stage.
- the enzyme wants to degrade the polymer to the 2 or 4 sugar end stage product, but this sugar is inactive for many therapeutic treatments.
- the use of acid hydrolysis also removes a fraction of the acetyl groups from the GlcNAc or GalNAc groups thereby introducing a positive charge into an otherwise anionic molecule.
- the latter method chemical synthesis, involves steps with low to moderate repetitive yield and has never been reported for a HA-oligosaccharide longer than 6 to 8 sugars in length.
- racemization e.g.
- the partial depolymerization method only yields fragments of the original GAG polymer and is essentially useless for creating novel sugars beyond simple derivatizations (e.g. esterifying some fraction of GlcUA residues in an indiscriminate fashion).
- Chemical synthesis may suffice in theory to make novel sugars, but the strategy needs to be customized for adding a new sugar, plus the problems with side-reactions/isomerization and the ultimate oligosaccharide size still pose the same trouble as described earlier.
- Another distinct method using the degradative enzymes to generate small molecules by "running in reverse" on mixtures of two polymers (e.g. HA and chondroitin) has some potential for novel GAG polysaccharide synthesis. See e.g.
- HA polysaccharide dictates its biological effect in many cellular and tissue systems based on many reports in the literature.
- no source of very defined, uniform HA polymers with sizes greater than 5 kDa is currently available. This situation is complicated by the observation that long and short HA polymers appear to have antagonistic or inverse effects on some biological systems. Therefore, HA preparations containing a mixture of both size populations may yield contradictory or paradoxical results.
- one of the objects of the present invention is to provide a method to produce HA with very narrow, substantially monodisperse size distributions that overcomes the disadvantages and defects of the prior art.
- the methods for enzymatically producing defined glycosaminoglycan polymers of the present invention involves providing at least one functional acceptor and at least one recombinant glycosaminoglycan transferase capable of elongating the functional acceptor in a controlled or repetitive fashion to form extended glycosaminoglycan-like molecules. At least one of UDP-GlcUA, UDP-GalUA UDP-GlcNAc, UDP-Glc, UDP-GalNAc, UDP-GlcN, UDP- GalN and a structural variant or derivative thereof is added in a stoichiometric ratio to the functional acceptor to provide glycosaminoglycan polymers that are substantially monodisperse in size.
- substantially monodisperse in size will be understood to refer to defined glycoasminoglycan polymers that have a very narrow size distribution.
- substantially monodisperse glycosaminoglycan polymers having a molecular weight in a range of from about 3.5 kDa to about 0.5 MDa will have a polydispersity value (i.e. Mw/Mn, where Mw is the average molecular weight and Mn is the number average molecular weight) in a range of from about 1.0 to about 1.1, and preferably in a range from about 1.0 to about 1.05.
- substantially monodisperse glycosaminoglycan polymers having a molecular weight in a range of from about 0.5 MDa to about 4.5 MDa will have a polydispersity value in a range of from about 1.0 to about 1.5, and preferably in a range from about 1.0 to about 1.2.
- the functional acceptor utilized in accordance with the present invention will have at least two sugar units of uronic acid and/or hexosamine, wherein the uronic acid may be GlcUA, IdoUA or GalUA, and the hexosamine may be GlcNAc, GalNAc, GlcN or GalN.
- the functional acceptor may be an HA oligosaccharide of about 3 sugar units to about 4.2 kDa, or an HA polymer having a mass of about 3.5 kDa to about 2MDa.
- the functional acceptor may be a chondroitin oligosaccharide or polymer, a chondroitin sulfate oligosaccharide or polymer, or a heparosan-like polymer.
- the functional acceptor may be an extended acceptor such as HA chains, chondroitin chains, heparosan chains, mixed glycosaminoglycan chains, analog containing chains or any combination thereof.
- any recombinant glycosaminoglycan transferase described or incorporated by reference herein may be utilized in the methods of the present invention.
- the recombinant glycosaminoglycan transferase utilized in accordance with the present invention may be a recombinant hyaluronan synthase, a recombinant chondroitin synthase, a recombinant heparosan synthase, or any active fragment or mutant thereof.
- the recombinant glycosaminglycan transferase may be capable of adding only one UDP-sugar described herein above or may be capable of adding two or more UDP-sugars described herein above.
- FIG. 1 is a graphical representation showing that an HA tetramer stimulates pmHAS polymerization.
- FIG. 2 is a graphical plot showing that HA polymerization is effected by HA oligosaccharides.
- FIG. 3 is a graphical plot showing HA tetramer elongation into larger polymers by pmHAS.
- FIG. 4 is a graphical representation of a thin layer chromatography analysis of pmHAS extension of HA tetramer.
- FIG. 5 is a graphical representation of thin layer chromatography analysis of the early stages of HA elongation.
- FIG. 6 is an electrophoresis gel showing the purification of pmHAS 1"703 .
- FIG. 7 is a pictorial representation of the pmHAS truncation mutants.
- FIG. 8 is a Southern Blot showing the hybridization of the pmCS gene with the KfoC gene.
- FIG. 9 is a Western Blot analysis showing the expression of pmHAS and its truncated forms. Either whole cell lysates (pmHAS 437"972 , pmHAS 1"567 , and pmHAS 152"756 ) or membrane preparations (pmHAS 437"756 , pmHAS 1"567 , rl-972, nl-972) or B-Per extract (pmHAS 1"703 ) were analyzed by Western blot (r,recombinant from E. coli; n, native from P- 1059). The bars on the left denote the position of molecular weight standards (from top to bottom: 112, 95, 55, and 29 kDa).
- FIG. 10 is a pictorial representation of domains Al and A2 of pmHAS.
- A The approximate relative positions of domain Al and A2 in pmHAS and pmHAS 1"703 .
- B Partial alignment ofthe amino acid sequences of the two domains (residue 161-267 and 443-547). The aspartate residues mutated in our studies were marked with *. Identical residues are in bold.
- FIG. 11 is a graphical representation of the complementation of the HAS activity of mutant enzymes in vitro.
- HAS enzyme assays with HA-derived acceptor were performed in the presence of either wild type pmHAS 1"703 alone, or D196 mutant alone, or D477 mutant alone or in the presence of both D196 and D477 mutants, for either 25 minutes (open bars) or 1.5 hours (solid bars).
- FIG. 12 is a sequence alignment of pmCS and pmHAS.
- the two Pasteurella GAG synthases are highly homologous. Identical residues are denoted with the hyphen. The numbering scheme corresponds to the slightly longer pmHAS sequence.
- the putative Al (residues 161-267) and A2 (residues 443-547) domains correspond to regions important for hexosamine transferase or for glucuronic acid transferase activity, respectively (33). Most sequence differences are found in the amino-terminal half of the polypeptides.
- FIG. 13 is a pictorial representation of a model of the two putative glycosyltransferase sites of pmHAS and pmCS.
- PmHAS and pmCS contain two distinct and relatively independent glycosyltransferase sites. Each site possesses a DGS and a DXD amino acid motif. A WGGED motif is found near the junction of the two domains, and is involved in hexosamine-transferase activity. The carboxyl-terminus is involved in membrane association. (MEM ASSOC), but is not required for catalytic activity. Residues 1-117 (cross- hatched) appear dispensable for catalysis of sugar transfer but may contain structure scaffolding or play other roles.
- FIG. 14 graphically depicts Sequence Similarity of pmHSl with KfiA and KfiC.
- Elements ofthe Pasteurella heparosan synthase, HSl (containing residues 91-240) and HS2 (containing residues 441-540) are very similar to portions of two proteins from the E. coli K5 capsular locus (A, residues 75-172 of KfiA; C, residues 262- 410 of KfiC) as shown by this modified Multalin alignment (ref. 21; numbering scheme corresponds to the pmHSl sequence).
- the HSl and HS2 elements may be important for hexosamine transferase or for glucuronic acid transferase activities, respectively, (con, consensus symbols: asterisks, [K or R] and [S or T]; %, any one of F,Y,W; $, any one of L,M; !, any one of IN; #, any one of E,D,Q, ⁇ ).
- FIG. 15(A-D) graphically depicts the alignment of the pmHSl (two clones: A2, BIO) with PmHS2, KfiA, KfiC, and DcbF.
- FIG. 16 depicts chimeric constructs of pm-EG, pm-FH, pm-IK, and pm-JL. PCR- overlap-extension was performed.
- Pm-EG contains residues 1-265 from pmHAS and residues 259-704 from pmCS and is a GlcUA-Tase.
- Pm-FH contains residues 1-258 from pmCS and residues 266-703 from pmHAS and is an active chondrotin synthase.
- Pm-IK contains residues 1-221 from pmHAS and residues 215-704 from pmCS and is a Glc-UA- Tase.
- Pm-JL contains residues 1-214 from pmCS and residues 222-703 from pmHAS and is an active HA synthase.
- the switch of Gal-NAc-transferring activity into GlcNAc- transferring activity indicated that 222-265 of pmHAS and possibly the corresponding residues 215-258 of pmCS play critical role in the selectivity between binding and/or transferring of GalNAc and GlcNAc substrate.
- FIG. 17 depicts a comparison of partial primary sequences of pmHAS and different pmCSs.
- Primary sequences of presumably chondroitin synthases from different Type F Pasteruella multocida were obtained by directly sequencing the products of colony- lysis PCR.
- the MULTALIN alignment indicates that most of the differences between pmHAS and pmCS are conserved among these independent strains.
- Residues that were substituted in site-mutagenesis studies were underlined.
- the mutant polypeptides contain a single or combination of different mutations, indicated by star(s). None of these mutations changes the specificity of the original enzymes.
- FIG. 18 depicts chimeric constructs of pmHAS ⁇ -CS ⁇ - ⁇ -HAS 266"703 and pmCS 1" 214 -HAS 222"265 -CS 258"704 .
- Pm-FH and pPm7A DNA were used to create pmHAS ⁇ -CS 215"258 - HAS 266"703 .
- a very interesting result was that pmCS ⁇ -HAS 222"265 ⁇ 258"704 can transfer both GalNAc and GlcNAc to HA oligomer acceptor; this enzyme displays relaxed sugar specificity.
- FIG. 19 depicts a summary of enzyme activities of chimeric proteins. The enzymes are drawn as bars. Black bars represent pmCS.
- FIG. 20 is a graphical representation illustrating in vitro HA synthesis in the presence or absence of HA4 acceptor. Reactions were carried out at 30°C for 48 hours. The 100 ⁇ l reaction contains l ⁇ g/ ⁇ l of pmHAS, 30mM UDP-GlcNAc, 30mM UDP-GlcUA and with (lane 3) or without (lane 4) 0.03 ⁇ g/ ⁇ l of HA4. 0.2 ⁇ l of reactions were loaded on 0.7% agarose gel and stained with STAINS-ALL. Lane 1, 3 ⁇ g of HA from Genzyme.
- Lane 2 DNA of BIOLINE HyperLadder (from top to bottom is 10 kb, 8kb, 6kb, 5kb, 4kb, 3kb, 2.5kb, 2kb, 1.5kb, lkb, 800bp, 600bp, 400bp, 200bp). Lane 5, Invitrogen high-Mw DNA ladder (top band is 48.5 kb).
- FIG. 21 are electrophoresis gels illustrating intermediate size HA polysaccharides as acceptors.
- the starting 20 ⁇ l reaction containl5 ⁇ g of pmHAS, 10 mM UDP-sugars and 5 ⁇ g HA4. 5 ⁇ l of 40 mM UDP-sugars and 15 ⁇ g of pmHAS were supplied additionally every 48 hours ("feeding').
- FIG. 22 is a graphical representation of a model of Pasteurella synthase polymerization.
- FIG. 23 is a graphical representation of a model of reaction synchronization.
- FIG. 24 is a graphical representation of a model of stoichiometric control of polymer size.
- FIG. 25 is an electrophoresis gel illustrating that in vitro generated HA can reach the molecular mass of 1.3 MDa.
- the reaction condition is the same as in FIG. 31 except with 0.2 ⁇ g of HA4.
- 1.2 ⁇ g of purified HA was loaded on 1.0 % agarose gel.
- FIG. 26 is a graphical representation illustrating control of HA product size by acceptor concentration.
- FIG. 27 is an electrophoresis gel illustrating in vitro synthesis of fluorescent HA. 20 ⁇ l of reactions were setup with 2 ⁇ g/ ⁇ l of pmHAS, various amounts of fluorescent HA4 and UDP-sugars. Reaction products were analyzed with 0.8% agarose gel electrophoresis and viewed under UV light.
- FIG. 28 is an electrophoresis gel illustrating utilization of large HA acceptors. Reactions were carried out at 30°C for 48 hours. The 60 ⁇ l reaction contained 0.28 ⁇ g/ ⁇ l of pmHAS, 3.3 mM UDP-GlcNAc, 3.3 mM UDP-GlcUA and without (lane 2) or with various amounts of acceptors (lanes 3-5, 7-9 and 10). 1.0 ⁇ l of each reaction was loaded on 0.7% agarose gel and stained with STAINS-ALL. Lane 1, BIORAD kb ladder (top band is 15 kb). Lane 6, 0.5 ⁇ g of 970 kDa HA starting acceptor. Lane 11, 3 ⁇ g of Genzyme HA starting acceptor.
- FIG. 29 is an electrophoresis gel that illustrates the migration of a ladder constructed of HA of defined size distribution for use as a standard.
- FIG. 30 is an electrophoresis gel illustrating various mondisperse chondroitin sulfate HA hybrid GAGs. The 1% agarose gel stained with STAINS-ALL shows a variety of chondroitin sulfates (either A, B or C) that were elongated with pmHAS, thus adding HA chains.
- Lanes 1, 8, 15, 22 and 27 contain the Kilobase DNA ladder; lanes 2 and 7 contain starting CSA, while lanes 3-6 contain CSA-HA at 2 hrs, 4 hrs, 6 hrs and O/N, respectively; lanes 9 and 14 contain starting CSB, while lanes 10-13 contain CSB-HA at 2 hrs, 4 hrs, 6 hrs and O/N, respectively; lanes 16 and 21 contain starting CSC, while lanes 17-20 contain CSC-HA at 2 hrs, 4 hrs, 6 hrs and O/N, respectively; lanes 23-26 contain no acceptor at 2 hrs, 4 hrs, 6 hrs and O/N, respectively.
- FIG. 31 is an electrophoresis gel illustrating control of hybrid GAG size by stoichiometric control.
- the 1% agarose gel stained with STAINS-ALL shows chondroitin sulfate A that was elongated with pmHAS, thus adding HA chains.
- Lanes 1, 7, 13, 19 and 25 contain the Kilobase ladder; lanes 2 and 6 contain 225 ⁇ g starting CSA, while lanes 3-5 contain 225 ⁇ g CSA-HA at 2 hrs, 6 hrs and O/N, respectively; lanes 8 and 12 contain 75 ⁇ g starting CSA, while lanes 9-11 contain 75 ⁇ g CSA-HA at 2 hrs, 6 hrs and O/N, respectively; lanes 14 and 18 contain 25 ⁇ g starting CSA, while lanes 15-17 contain 25 ⁇ g CSA-HA at 2 hrs, 6 hrs and O/N, respectively; lanes 20 and 24 contain 8.3 ⁇ g starting CSA, while lanes 21-23 contain 8.3 ⁇ g CSA-HA at 2 hrs, 6 hrs and O/N, respectively.
- FIG. 32 is an electrophoresis gel illustrating extension of HA with chondroitin chains using pmCS.
- the 1.2% agarose gel stained with STAINS-ALL shows a reaction with pmCS and UDP-GlcUA, UDP-GalNAC with eithera 81 kDa HA acceptor (lanes 3-7) or no acceptor (lanes 9-13).
- Lanes 1 and 15 contain the Kilobase DNA standard.
- Lanes 2, 8 and 14 contain starting 81 kDa HA.
- Lanes 3-7 contain HA acceptor +HA-C at 2 hr, 4 hr, 4 hr (set O/N in incubator without 4 hr feeding), 6 hr and O/N, respectively.
- Lanes 9-13 contain no acceptor (minus) -HA-C at 2 hr, 4 hr, 4 hr (set O/N in incubator without 4 hr feeding), 6 hr and O/N, respectively.
- FIG. 33 Size exclusion (or gel filtration) chromatography analysis coupled with multi-angle laser light scattering detection confirms the monodisperse nature of polymers created by the present invention.
- HA starting MW 81 kDa
- pmCS methoxycellulose
- FIG. 34 is an 0.7% agarose gel detected with Stains-all compares the monodisperse, 'select HA' to commercially produced HA samples.
- GAGs are linear polysaccharides composed of repeating disaccharide units containing a derivative of an amino sugar (either glucosamine or galactosamine).
- Hyaluronan [HA] chondroitin, and heparan sulfate/heparin contain a uronic acid as the other component of the disaccharide repeat while keratan contains a galactose.
- the GAGs are summarized in Table I.
- Vertebrates may contain all four types of GAGs, but the polysaccharide chain is often further modified after sugar polymerization.
- One or more modifications including O- sulfation of certain hydroxyls, deacetylation and subsequent N-sulfation, or epimerization of glucuronic acid to iduronic acid are found in most GAGs except HA.
- An amazing variety of distinct structures have been reported for chondroitin sulfate and heparan sulfate/heparin even within a single polymer chain.
- a few clever pathogenic microbes also produce unmodified GAG chains; the bacteria use extracellular polysaccharide coatings as molecular camouflage to avoid host defenses.
- chondroitin and heparan sulfate/heparin chains in vertebrates are initially synthesized by elongation of a xylose-containing linkage tetrasaccharide attached to a variety of proteins. Keratan is either O-linked or N-linked to certain proteins depending on the particular molecule.
- HA and all of the known bacterial GAGs are not part of the classification of proteins known as glycoproteins. All GAGs except HA are found covalently linked to a core protein, and such combination is referred to as a proteoglycan.
- Glycoproteins are usually much smaller than proteoglycans and only contain from 1-60% carbohydrate by weight in the form of numerous relatively short, branched oligosaccharide chains, whereas a proteoglycan can contain as much as 95% carbohydrate by weight.
- the core protein in a proteoglycan is also usually a glycoprotein, therefore usually contains other oligosaccharide chains besides the GAGs.
- GAGs and their derivatives are currently used in the medical field as ophthalmic and viscoelastic supplements, adhesion surgical aids to prevent post-operative adhesions, catheter and device coatings, and anticoagulants.
- Other current or promising future applications include anti-cancer medications, tissue engineering matrices, immune and neural cell modulators, and drug targeting agents.
- GAGs Complex carbohydrates, such as GAGs, are information rich molecules.
- a major purpose of the sugars that make up GAGs is to allow communication between cells and extracellular components of multicellular organisms.
- certain proteins bind to particular sugar chains in a very selective fashion.
- a protein may simply adhere to the sugar, but quite often the protein's intrinsic activity may be altered and/or the protein transmits a signal to the cell to modulate its behavior.
- heparin binding to inhibitory proteins helps shuts down the clotting response.
- HA binds to cells via the CD44 receptor that stimulates the cells to migrate and to proliferate.
- HA polysaccharide plays structural roles in the eye, skin, and joint synovium. Large HA polymers ( ⁇ 10 6 Da) also stimulate cell motility and proliferation. On the other hand, shorter HA polymers ( ⁇ 10 4 Da) often have the opposite effect. HA-oligosaccharides composed of 10 to 14 sugars [HA 10 . 14 ] have promise for inhibition of cancer cell growth and metastasis.
- mice injected with various invasive and virulent tumor cell lines develop a number of large tumors and die within weeks.
- Treatment with HA oligosaccharides greatly reduced the number and the size of tumors. Metastasis, the escape of cancer cells throughout the body, is one of the biggest fears of both the ailing patient and the physician.
- HA or HA-like oligosaccharides appear to serve as a supplemental treatment to inhibit cancer growth and metatasis.
- the preliminary mode of action ofthe HA-oligosaccharide sugars is thought to be mediated by binding or interacting with one of several important HA-binding proteins (probably CD44 or RHAM) in the mammalian body.
- CD44 HA-binding proteins
- One proposed scenario for the anticancer action of HA-oligosaccharides is that multiple CD44 protein molecules in a cancer cell can bind simultaneously to a long HA polymer. This multivalent HA binding causes CD44 activation (perhaps mediated by dimerization or a receptor patching event) that triggers cancer cell activation and migration.
- each CD44 molecule individually binds a different HA molecule in a monovalent manner such that no dimerization/patching event occurs. Thus no activation signal is transmitted to the cell.
- the optimal HA- sugar size is 10 to 14 sugars. Although this size may be based more upon the size of HA currently available for testing rather than biological functionality - i.e. now that HA molecules and HA-like derivatives ⁇ 10 sugars are available according to the methodologies of the present invention, the optimal HA size or oligosaccharide composition may be found to be different.
- HA oligosaccharides are the stimulation of blood vessel formation and the stimulation of dendritic cell maturation. Enhancement of wound-healing and resupplying cardiac oxygenation may be additional applications that harness the ability of HA oligosaccharides to cause endothelial cells to form tubes and sprout new vessels.
- Dendritic cells possess adjuvant activity in stimulating specific CD4 and CD8 T cell responses. Therefore, dendritic cells are targets in vaccine development strategies for the prevention and treatment of infections, allograft reactions, allergic and autoimmune diseases, and cancer.
- Heparin interacts with many proteins in the body, but two extremely interesting classes are coagulation cascade proteins and growth factors.
- Antithrombin III [ATHI] and certain other hemostasis proteins are 100,000-fold more potent inhibitors of blood clotting when complexed with heparin. Indeed, heparin is so potent it must be used in a hospital setting and require careful monitoring in order to avoid hemorrhage. Newer, processed lower molecular weight forms of heparin are safer, but this material is still a complex mixture. It has been shown that a particular pentasaccharide (5 sugars long) found in heparin is responsible for the ATIII-anticoagulant effect.
- pentasaccharide since heparin is a very heterogeneous polymer, it is difficult to isolate the pentasaccharide (5 sugars long) in a pure state.
- the pentasaccharide can also be prepared in a conventional chemical synthesis involving ⁇ 50 to 60 steps. However, altering the synthesis or preparing an assortment of analogs in parallel is not always feasible - either chemically or financially.
- VEGF vascular endothelial growth factor
- HBEGF heparin-binding epidermal growth factor
- FGF fibroblast growth factor
- Chondroitin is the most abundant GAG in the human body, but all of its specific biological roles are not yet clear. Phenomenon such as neural cell outgrowth appear to be modulated by chondroitin. Both stimulatory and inhibitory effects have been noted depending on the chondroitin form and the cell type. Therefore, chondroitin or similar molecules are of utility in re-wiring synaptic connections after degenerative diseases (e.g. Alzheimer's) or paralytic trauma.
- the epimerized form of chondroitin (GlcUA converted to the C5 isomer, iduronic acid or IdoUA), dermatan, selectively inhibits certain coagulation proteins such as heparin cofactor II.
- UDP-sugar precursors and divalent metal cofactors e.g. magnesium, cobalt, and/or manganese ion
- the degree of polymerization, n ranges from about 25 to about 10,000. If the GAG is polymerized by a single polypeptide, the enzyme is called a synthase or co-polymerase.
- pmHAS is unique in comparison to all other existing HA synthases of Streptococcus bacteria, humans and an algal virus. Specifically, recombinant pmHAS can elongate exogeneously-supplied short HA chains (e.g. 2-4 sugars) into longer HA chains (e.g. 3 to 150 sugars). The pmHAS synthase has been shown to add monosaccharides one at a time in a step-wise fashion to the growing chain.
- the pmHAS enzyme 's extraordinarily sugar transfer specificity results in the repeating sugar backbone of the GAG chain.
- the pmCS enzyme which is about 90% identical at the amino acid level to pmHAS, performs the same synthesis reactions but transfers GalNAc instead of GlcNAc.
- the pmCS enzyme was described and enabled in copending U.S. Serial No. 09/842,484.
- the pmHSl and PmHS2 enzymes are not very similar at the amino acid level to pmHAS, but perform the similar synthesis reactions; the composition of sugars is identical but the linkages differ because heparosan is Beta4GlcUA-alpha4GlcNAc.
- the pmHSl and PmHS2 enzymes were described and enabled in copending U.S. Serial No. 10/142,143.
- pmHAS possesses two independent catalytic sites in one polypeptide. Mutants were created that transferred only GlcUA, and distinct mutants were also created that transferred only GlcNAc. These mutants cannot polymerize HA chains individually, but if the two types of mutants are mixed together in the same reaction with an acceptor molecule, then polymerization was rescued.
- the chondroitin synthase, pmCS has a similar sequence and similar two-domain structure.
- the heparosan synthases, pmHSl and PmHS2 also contain regions for the two active sites. Single action mutants have also been created for the chondroitin synthase, pmCS, and are described hereinafter in detail.
- Pasteurella GAG synthases are very specific glycosyltransferases with respect to the sugar transfer reaction; only the correct monosaccharide from the authentic UDP-sugar is added onto acceptors.
- the epimers or other closely structurally related precursor molecules e.g. UDP-glucose
- the GAG synthases do, however, utilize certain heterologous acceptor sugars. For example, pmHAS will elongate short chondroitin acceptors with long HA chains. pmHSl will also add long heparosan chains onto HA acceptor oligosaccharides as well as heparin oligosaccharides (see hereinbelow). Therefore, the presently claimed and disclosed invention encompasses a wide range of hybrid or chimeric GAG oligosaccharides prepared utilizing these P. multocida GAG catalysts.
- nucleic acid segment and “DNA segment” are used interchangeably and refer to a DNA molecule which has been isolated free of total genomic DNA of a particular species. Therefore, a “purified” DNA or nucleic acid segment as used herein, refers to a DNA segment which contains a Hyaluronate Synthase (“HAS”) coding sequence or Chondroitin Synthase (“CS”) coding sequence or Heparin/Heparosan Synthase (“HS”) coding sequence yet is isolated away from, or purified free from, unrelated genomic DNA, for example, total Pasteurella multocida.
- HAS Hyaluronate Synthase
- CS Chondroitin Synthase
- HS Heparin/Heparosan Synthase
- DNA segment includes DNA segments and smaller fragments of such segments, and also recombinant vectors, including, for example, plasmids, cosmids, phage, viruses, and the like.
- a DNA segment comprising an isolated or purified pmHAS orpmCS or pmHSl or PmHSl gene refers to a DNA segment including HAS or CS or HS coding sequences isolated substantially away from other naturally occurring genes or protein encoding sequences.
- the term “gene” is used for simplicity to refer to a functional protein-, polypeptide- or peptide- encoding unit. As will be understood by those in the art, this functional term includes genomic sequences, cDNA sequences or combinations thereof.
- isolated substantially away from other coding sequences means that the gene of interest, in this case pmHAS or pmCS or pmHSl or PmHS2 forms the significant part of the coding region of the DNA segment, and that the DNA segment does not contain other non-relevant large portions of naturally-occurring coding DNA, such as large chromosomal fragments or other functional genes or DNA coding regions. Of course, this refers to the DNA segment as originally isolated, and does not exclude genes or coding regions later added to, or intentionally left in, the segment by the hand of man. [00098] Due to certain advantages associated with the use of prokaryotic sources, one will likely realize the most advantages upon isolation of the HAS or CS or HS gene from the prokaryote P. multocida.
- eukaryotic genes may require significant post-transcriptional modifications that can only be achieved in a eukaryotic host. This will tend to limit the applicability of any eukaryotic HAS or CS or HS gene that is obtained.
- those of ordinary skill in the art will likely realize additional advantages in terms of time and ease of genetic manipulation where a prokaryotic enzyme gene is sought to be employed. These additional advantages include (a) the ease of isolation of a prokaryotic gene because of the relatively small size of the genome and, therefore, the reduced amount of screening of the corresponding genomic library and (b) the ease of manipulation because the overall size of the coding region of a prokaryotic gene is significantly smaller due to the absence of introns.
- the product of the pmHAS or pmCS or pmHSl or PmHS2 gene i.e., the enzyme
- DNA sequences in accordance with the present invention will further include genetic control regions which allow the expression of the sequence in a selected recombinant host.
- the genetic control region may be native to the cell from which the gene was isolated, or may be native to the recombinant host cell, or may be an exaggerous segment that is compatible with and recognized by the transcriptional machinery of the selected recbominant host cell.
- the nature of the control region employed will generally vary depending on the particular use (e.g., cloning host) envisioned.
- the invention concerns isolated DNA segments and recombinant vectors incorporating DNA sequences which encode a pmHAS orpmCS or pmHSl or PmHSl gene, that includes within its amino acid sequence an amino acid sequence in accordance with SEQ ID NO:2, 4, 6, 8, 9, or 70, respectively.
- the invention concerns isolated DNA segments and recombinant vectors incorporating DNA sequences which encode a gene that includes within its nucleic acid sequence an amino acid sequence encoding HAS or CS or HS pepetides or peptide fragment thereof, and in particular to a HAS or CS or HS peptide or peptide fragment thereof, corresponding to Pasteurella multocida HAS or CS or HS.
- Truncated pmHAS gene (such as, but not limited to, pmHAS 1"703 , SEQ ID NO:
- Nucleic acid segments having HAS or CS or HS activity may be isolated by the methods described herein.
- the term "a sequence essentially as set forth in SEQ ID NO:X” means that the sequence substantially corresponds to a portion of SEQ ID NO:X and has relatively few amino acids or codons encoding amino acids which are not identical to, or a biologically functional equivalent of, the amino acids or codons encoding amino acids of SEQ ID NO:X.
- biologically functional equivalent is well understood in the art and is further defined in detail herein, as a gene having a sequence essentially as set forth in SEQ ID NO:X, and that is associated with the ability of prokaryotes to produce HA or a hyaluronic acid or chondroitin or heparin polymer in vitro or in vivo.
- X refers to either SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 69, 70 or 71 or any additional sequences set forth herein, such as the truncated or mutated versions of pmHAS 1"703 that are contained generally in SEQ ID NOS: 10-60.
- the invention discloses nucleic acid segments encoding an enzymatically active HAS or CS or HS from P. multocida - pmHAS, pmCS, pmHSl, and PmHS2, respectively.
- P. multocida - pmHAS, pmCS, pmHSl, and PmHS2 are substituted with substitutions for substitutions.
- substitutions can be made to the pmHAS or pmCS or pmHSl or PmHS2 nucleic acid segments listed in SEQ ID NO:l, 3, 5, 7, 69, and 71, respectively, without deviating outside the scope and claims of the present invention. Indeed, such changes have been made and are described hereinafter with respect to the mutants produced. Standardized and accepted functionally equivalent amino acid substitutions are presented in Table II.
- Another preferred embodiment of the present invention is a purified nucleic acid segment that encodes a protein in accordance with SEQ ID NO: l or 3 or 5 or 7 or 71, respectively, further defined as a recombinant vector.
- the term "recombinant vector” refers to a vector that has been modified to contain a nucleic acid segment that encodes an HAS or CS or HS protein, or fragment thereof.
- the recombinant vector may be further defined as an expression vector comprising a promoter operatively linked to said HAS- or CS- or HS- encoding nucleic acid segment.
- a further preferred embodiment of the present invention is a host cell, made recombinant with a recombinant vector comprising an HAS or CS or HS gene.
- the preferred recombinant host cell may be a prokaryotic cell.
- the recombinant host cell is an eukaryotic cell.
- engineered or “recombinant” cell is intended to refer to a cell into which a recombinant gene, such as a gene encoding HAS or CS or HS, has been introduced mechanically or by the hand of man. Therefore, engineered cells are distinguishable from naturally occurring cells which do not contain a recombinantly introduced gene.
- Engineered cells are thus cells having a gene or genes introduced through the hand of man.
- Recombinantly introduced genes will either be in the form of a cDNA gene, a copy of a genomic gene, or will include genes positioned adjacent to a promoter associated or not naturally associated with the particular introduced gene.
- the HAS- or CS- or HS- encoding DNA segments further include DNA sequences, known in the art functionally as origins of replication or "replicons", which allow replication of contiguous sequences by the particular host. Such origins allow the preparation of extrachromosomally localized and replicating chimeric or hybrid segments or plasmids, to which HAS- or CS- or HS- encoding DNA sequences are ligated.
- the employed origin is one capable of replication in bacterial hosts suitable for biotechnology applications.
- origins recognized by other host systems such as in a shuttle vector.
- the isolation and use of other replication origins such as the SV40, polyoma or bovine papilloma virus origins, which may be employed for cloning or expression in a number of higher organisms, are well known to those of ordinary skill in the art.
- the invention may thus be defined in terms of a recombinant transformation vector which includes the HAS- or CS- or HS- coding gene sequence together with an appropriate replication origin and under the control of selected control regions.
- a recombinant transformation vector which includes the HAS- or CS- or HS- coding gene sequence together with an appropriate replication origin and under the control of selected control regions.
- DNA fragments may be obtained which contain full complements of genes or cDNAs from a number of sources, including other strains of Pasteurella or from a prokaryot with similar glycosyltransferases or from eukaryotic sources, such as cDNA libraries.
- Virtually any molecular cloning approach may be employed for the generation of DNA fragments in accordance with the present invention.
- the only limitation generally on the particular method employed for DNA isolation is that the isolated nucleic acids should encode a biologically functional equivalent HAS or CS or HS.
- Typical useful vectors include plasmids and phages for use in prokaryotic organisms and even viral vectors for use in eukaryotic organisms. Examples include pKK223-3, pSA3, recombinant lambda, SV40, polyoma, adenovirus, bovine papilloma virus and retroviruses.
- vectors capable of replication in both biotechnologically useful Gram-positive or Gram-negative bacteria e.g. Bacillus, Lactococcus, or E. coli
- Vectors such as these allow one to perform clonal colony selection in an easily manipulated host such as E. coli, followed by subsequent transfer back into a food grade Lactococcus or Bacillus strain for production of hyaluronan or chondroitin or heparin polymer.
- the recombinant vector is employed to make the functional GAG synthase for in vitro use.
- GRAS generally recognized as safe
- Another procedure to further augment HAS or CS or HS gene copy number is the insertion of multiple copies of the gene into the plasmid.
- Another technique would include integrating at least one copy of the HAS or CS or HS gene into chromosomal DNA. This extra amplification would be especially feasible, since the bacterial HAS or CS or HS gene size is small.
- the chromosomal DNA-ligated vector is employed to transfect the host that is selected for clonal screening purposes such as E. coli, through the use of a vector that is capable of expressing the inserted DNA in the chosen host.
- the invention concerns isolated DNA segments and recombinant vectors that include within their sequence a nucleic acid sequence essentially as set forth in SEQ ID NO: 1,3,5,7,69, or 71.
- the term "essentially as set forth" in SEQ ID NO: 1,3,5,7,69, or 71 is used in the same sense as described above and means that the nucleic acid sequence substantially corresponds to a portion of SEQ ID NO: 1,3,5,7,69, or 71 and has relatively few codons which are not identical, or functionally equivalent, to the codons of SEQ ID NO: 1,3,5,7,69, or 71.
- amino acid and nucleic acid sequences may include additional residues, such as additional N- or C-terminal amino acids or 5' or 3' nucleic acid sequences, and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological protein activity where protein expression and enzyme activity is concerned.
- the addition of terminal sequences particularly applies to nucleic acid sequences which may, for example, include various non-coding sequences flanking either of the 5' or 3' portions of the coding region or may include various internal sequences, which are known to occur within genes.
- residues may be removed from the N- or C-terminal amino acids and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, as well.
- sequences which have between about 40% and about 99%; or more preferably, between about 80% and about 90%; or even more preferably, between about 90% and about 99% identity to the nucleotides of SEQ ID NO: 1,3,5,7,69, or 71 will be sequences which are "essentially as set forth" in SEQ ID NO: 1,3,5,7,69, or 71.
- Sequences which are essentially the same as those set forth in SEQ ID NO: 1,3,5,7,69, or 71 may also be functionally defined as sequences which are capable of hybridizing to a nucleic acid segment containing the complement of SEQ ID NO: 1,3,5,7,69, or 71 under "standard stringent hybridization conditions," “moderately stringent hybridization conditions,” “less stringent hybridization conditions,” or “low stringency hybridization conditions.” Suitable "standard” or “less stringent” hybridization conditions will be well known to those of skill in the art and are clearly set forth hereinbelow. In a preferred embodiment, standard stringent hybridization conditions or less stringent hybridization conditions are utilized.
- standard stringent hybridization conditions “moderately stringent conditions,” and “less stringent hybridization conditions” or “low stringency hybridization conditions” are used herein, describe those conditions under which substantially complementary nucleic acid segments will form standard Watson-Crick base-pairing and thus “hybridize” to one another.
- a number of factors are known that determine the specificity of binding or hybridization, such as pH; temperature; salt concentration; the presence of agents, such as formamide and dimethyl sulfoxide; the length of the segments that are hybridizing; and the like.
- There are various protocols for standard hybridization experiments Depending on the relative similarity of the target DNA and the probe or query DNA, then the hybridization is performed under stringent, moderate, or under low or less stringent conditions.
- the hybridizing portion of the hybridizing nucleic acids is typically at least about 14 nucleotides in length, and preferably between about 14 and about 100 nucleotides in length.
- the hybridizing portion of the hybridizing nucleic acid is at least about 60%, e.g., at least about 80% or at least about 90%, identical to a portion or all of a nucleic acid sequence encoding a HAS or chondroitin or heparin synthase or its complement, such as SEQ ID NO: 1,3,5,7,69, or 71 or the complement thereof.
- Hybridization of the oligonucleotide probe to a nucleic acid sample typically is performed under standard or stringent hybridization conditions.
- Nucleic acid duplex or hybrid stability is expressed as the melting temperature or T m , which is the temperature at which a probe nucleic acid sequence dissociates from a target DNA. This melting temperature is used to define the required stringency conditions. If sequences are to be identified that are related and substantially identical to the probe, rather than identical, then it is useful to first establish the lowest temperature at which only homologous hybridization occurs with a particular concentration of salt (e.g., SSC, SSPE, or HPB). Then, assuming that 1% mismatching results in a 1°C decrease in theT m , the temperature ofthe final wash in the hybridization reaction is reduced accordingly (for example, if sequences having >95% identity with the probe are sought, the final wash temperature is decreased by about 5°C).
- salt e.g., SSC, SSPE, or HPB
- the change in T m can be between about 0.5°C and about 1.5°C per 1% mismatch.
- standard stringent hybridization conditions include hybridizing at about 68°C in 5x SSC/5x Denhardt's solution/1.0% SDS, followed with washing in 0.2x SSC/0.1% SDS at room temperature or hybridizing in 1.8xHPB at about 30°C to about 45°C followed by washing a 0.2-0.5xHPB at about 45°C.
- Moderately stringent conditions include hybridizing as described above in 5xSSC ⁇ 5xDenhardt's solution 1% SDS washing in 3x SSC at 42°C.
- the parameters of salt concentration and temperature can be varied to achieve the optimal level of identity between the probe and the target nucleic acid.
- the present invention also encompasses DNA segments which are complementary, or essentially complementary, to the sequences set forth in SEQ ID NO:l or 3 or 5 or 7 or 69 or 71. Nucleic acid sequences which are "complementary" are those which are capable of base-pairing according to the standard Watson-Crick complementarity rules.
- sequence 5'-ATAGCG-3' is complementary to the sequence 5'- CGCTAT-3" because when the two sequences are aligned, each "T” is able to base-pair with an "A", which each "G” is able to base pair with a "C”.
- complementary sequences means nucleic acid sequences which are substantially complementary, as may be assessed by the nucleotide comparison set forth above, or as defined as being capable of hybridizing to the nucleic acid segment of SEQ ID NO: 1,3,5,7, or 69, or 71 under standard stringent, moderately stringent, or less stringent hybridizing conditions.
- nucleic acid segments of the present invention may be combined with other DNA sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, epitope tags, polyhistidine regions, other coding segments, and the like, such that their overall length may vary considerably. It is therefore contemplated that a nucleic acid fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended recombinant DNA protocol. [000121] Naturally, it will also be understood that this invention is not limited to the particular amino acid and nucleic acid sequences of SEQ ID NO: l, 2, 3, 4, 5, 6, 7, 8, 9, 69, 70, or 71.
- Recombinant vectors and isolated DNA segments may therefore variously include the HAS or CS or HS coding regions themselves, coding regions bearing selected alterations or modifications in the basic coding region, or they may encode larger polypeptides which nevertheless include HAS or CS or HS coding regions or may encode biologically functional equivalent proteins or peptides which have variant amino acid sequences.
- the DNA segments of the present invention encompass DNA segments encoding biologically functional equivalent HAS or CS or HS proteins and peptides. Such sequences may arise as a consequence of codon redundancy and functional equivalency which are known to occur naturally within nucleic acid sequences and the proteins thus encoded.
- functionally equivalent proteins or peptides may be created via the application of recombinant DNA technology, in which changes in the protein structure may be engineered, based on considerations of the properties of the amino acids being exchanged. Changes designed by man may be introduced through the application of site- directed mutagenesis techniques, e.g., to introduce improvements to the enzyme activity or to antigenicity of the HAS or CS or HS protein or to test HAS or CS or HS mutants in order to examine HAS or CS or HS activity at the molecular level or to produce HAS or CS or HS mutants having changed or novel enzymatic activity and/or sugar substrate specificity.
- site- directed mutagenesis techniques e.g., to introduce improvements to the enzyme activity or to antigenicity of the HAS or CS or HS protein or to test HAS or CS or HS mutants in order to examine HAS or CS or HS activity at the molecular level or to produce HAS or CS or HS mutants having changed or novel en
- polysaccharide polymers must be of a certain length before their physical or biological properties become apparent. Often the polysaccharide must comprise at least 20-100 sugar units. Certain enzymes that react with exogenous polymers have been previously available, but typically add only one sugar unit. The unique enzymes described in the present invention, (e.g. pmHAS, pmCS, pmHSl, and PmHS2) form polymers of at least 100-400 sugar units in length. Thus, one embodiment of the presently claimed and disclosed invention, results in long, defined linear polymers composed of only natural glycosidic linkages.
- the four known glycosaminoglycan synthesizing enzymes from Pasteurella multocida bacteria normally make polymers similar to or identical to vertebrate polymers. These bacteria employ the polysaccharide, either HA (Type A bacteria), chondroitin (Type F bacteria), or heparosan (unsulfated, unepimerized heparin - Type D bacteria) as an extracellular coating to serve as molecular camouflage.
- Native enzymes normally make polymer chains of a single type of sugar repeat. If a recombinant HAS or CS or HS enzyme is employed, however, the enzyme can be forced to work on an exogenous functional acceptor molecule.
- the recombinant enzyme may be incubated with a polymer acceptor, and the recombinant enzyme will then elongate the acceptor with UDP-sugar precursors.
- the known native enzymes do not perform this reaction since they already contain a growing polymer chain that was formed in the living cell; enzyme preparations from native cells retain the polymer following isolation.
- pmHAS (SEQ ID NO: 2), a 972 amino acid residue protein from Pasteurella multocida, is made in a functional state in recombinant Escherichia coli.
- the pmHAS gene is given in SEQ ID NO: l.
- Other functional derivatives of pmHAS for example an enzyme called pmHAS 1"703 (SEQ ID NO:9) and the pmHAS 1'703 gene (SEQ ID N0:71), have been produced which are soluble.
- the soluble form can be prepared in larger quantities and in a purer state than the naturally occurring full-length enzyme. The preferred E.
- the recombinant enzyme may be incubated in a mixture comprising from about 10 to about 50mM Tris pH 7.2, from 0.5 to about 20 mM MnCI 2 , from about 0.1 to about 30 mM UDP-GlcUA, from about 0.1 to about 30 mM UDP-GlcNAc, and a suitable acceptor at about 20-37°C for from about 1 to about 600 minutes.
- Suitable acceptors can be any functional acceptor, such as a glycosaminoglycan acceptor or sugar acceptor, for example, but not by limitation, short HA chains (two or more sugar units such as HA or short chondroitin sulfate chains (5 sugar units) or long chondroitin sulfate chains ( ⁇ 10 2 sugar units).
- HA or short chondroitin sulfate chains five sugar units
- chondroitin sulfate chains ⁇ 10 2 sugar units.
- pmHAS or its derivatives
- the length of the HA chain added onto the acceptor is controlled by altering the concentration of UDP-sugars (thus changing the stoichiometry of UDP-sugar to acceptor) and/or the reaction time.
- Immobilized acceptors such as beads or other solid objects with bound acceptor oligosaccharides, can also be extended by the pmHAS enzyme using UDP-sugars. In this manner, the pmHAS enzyme (or its derivatives) can be used to attach polysaccharide chains to any suitable acceptor molecule.
- Type A P. multocida produces HA capsule [GlcUA-GlcNAc repeats] and possesses the pmHAS enzyme.
- Type F P. multocida produces a chondroitin or chondroitin-like polymer capsule [GlcUA-GalNAc repeats].
- the DNA encoding an open reading frame (GenBank accession #AF195517) that is 90% identical to pmHAS at the protein level has been cloned; this enzyme is called PmCS, the P. multocida chondroitin synthase.
- the amino acid sequence of pmCS is set forth in Seq ID NO: 4 and the pmCS gene sequence is set forth in SEQ ID NO: 3.
- testicular hyaluronidase method gives a variety of small products derived from quasi-random linkage of GAGs, HA and chondroitin. Very large polymers are not major or significant products.
- the chimeric or hybrid polysaccharide materials can serve as a biocompatible molecular glue for cell/cell interactions in artificial tissues or organs and the HA/chondroitin/heparin hybrid mimics natural proteoglycans that normally contain an additional protein intermediate between polymer chains. The present invention, therefore, obviates the requirement for a protein intermediary.
- a recombinant HA/chondroitin/heparin chimeric or hybrid polysaccharide is desirous since molecules from animal sources are potentially immunogenic ⁇ the chimeric or hybrid polysaccharide, however, would not appear as "foreign" to the host, thus no immune response is generated.
- the recombinant polymers can be made free of adventitious agents (e.g. prions, viruses etc.)
- An intrinsic and essential feature of polysaccharide synthesis is the repetitive addition of sugar monomer units to the growing polymer.
- the glycosyltransferase remains in association with the nascent chain. This feature is particularly relevant for HA biosynthesis as the HA polysaccharide product, in all known cases, is transported out of the cell; if the polymer was released, then the HAS would not have another chance to elongate that particular molecule.
- Three possible mechanisms for maintaining the growing polymer chain at the active site ofthe enzyme are immediately obvious. First, the enzyme possesses a carbohydrate polymer binding pocket or cleft. Second, the nascent chain is covalently attached to the enzyme during its synthesis. Third, the enzyme binds to the nucleotide base or the lipid moiety of the precursor while the nascent polymer chain is still covalently attached.
- pmHAS In the case of pmHAS, it appears that a HA-binding site exists near or at the sugar transferase catalytic site.
- oligosaccharides that vary in size and composition are used to discern the nature ofthe interaction between pmHAS and the sugar chain. For example, it appears that the putative HA-polymer binding pocket of pmHAS will bind and elongate at least an intact HA disaccharide with increased efficiency occurring when a trisaccharide is used (reduced tetramer or a synthetic trisaccharide).
- the glycosyltransferases initiate chain elongation on at least primer monosachharides [more preferably tetrasaccharides such as xylose-galactose-galactose-GlcUA] that are attached to serine residues of proteoglycan core molecules.
- enzyme extracts transfer a single sugar to exogenously added heparin or chondroitin oligosaccharides; unfortunately, the subsequent sugar of the disaccharide unit is usually not added and processive elongation to longer polymers does not occur. Therefore it is likely that some component is altered or missing in the in vitro system.
- heparin biosynthesis a single enzyme transfers both GlcUA and GlcNAc sugars to the glycosaminoglycan chain based on co- purification or expression studies.
- the glycosyltransferase may be stopped and started at different stages of synthesis of the heteropolysaccharide.
- the glycosyltransferase enzymes that produce important homopolysaccharides such as chitin, cellulose, starch, and glycogen.
- pmHAS 1"650 (SEQ. ID NO: 10) can only add single GlcNAc sugars onto the non- reducing end (i.e. HA tetrasaccharide [GlcNAc-GlcUA-GlcNAc-GlcUA]) of an acceptor (i.e. forms the HA pentamer).
- a mutant has been created and called pmHAS 1" 703 -D477N (SEQ.
- membrane preparations from recombinant E. coli containing a pmHAS protein had HA synthase activity as judged by incorporation of radiolabel from UDP-[ 14 C]GlcUA into polymer when co-incubated with both UDP-GlcNAc and Mn ion. Due to the similarity at the amino acid level of pmHAS to several lipopolysaccharide transferases, it was hypothesized that HA oligosaccharides serve as acceptors for GlcUA and GlcNAc transfer.
- pmHAS 1"703 has been shown to add sugars onto a chondroitin pentamer acceptor.
- the pmHAS 1"703 and reagents were prepared in the same manner as shown in Fig.l, except that a chondroitin pentamer was used as the acceptor molecule.
- the results of this experiment are shown in TABLE III.
- the pmHAS 1"703 can utilize molecules other than the naturally occurring acceptors or primer molecules as the basis for forming a polysaccharide polymer chain.
- the HA polymerizing activity of recombinant pmHAS 1"703 is dependent on the simultaneous incubation with both UDP-sugar precursors and a Mn 2+ ion.
- the level of incorporation is dependent on protein concentration, on HA oligosaccharide concentration, and on incubation time as shown in FIG. 2.
- two parallel reactions containing pmHAS 1"703 with even-numbered HA oligosaccharides 105 ⁇ g membrane protein/point with a mixture of HA hexamer, octamer, and decamer, 4.4.
- HA synthesized in the presence or the absence of HA oligosaccharides is sensitive to HA lyase (>95% destroyed) and has a molecular weight of ⁇ l-5xl0 4 Da ( ⁇ 50- 250 monosaccharides). No requirement for a lipid-linked intermediate was observed as neither bacitracin (0.5 mg/ml) nor tunicamycin (0.2 mg/ml) alter the level of incorporation in comparison to parallel reactions with no inhibitor.
- Dextrans of greater than or equal to 80 kDa elute in the void volume (Vo arrow).
- the starting tetramer elutes in the included volume (Vi arrow).
- Membranes 190 ⁇ g total protein
- UDP-GlcUA 200 ⁇ M
- UDP-GlcNAc 600 ⁇ M
- radiolabeled 3 H-HA tetramer 1.1 x 10 5 dpm
- the activity of the native pmHAS 1"703 from P. multocida membranes is not stimulated by the addition of HA oligosaccharides under similar conditions.
- the native pmHAS 1"703 enzyme has an attached or bound nascent HA chain that is initiated in the bacterium prior to membrane isolation.
- the recombinant enzyme on the other hand, lacks such a nascent HA chain since the E. coli host does not produce the UDP-GlcUA precursor needed to make HA polysaccharide. Therefore, the exogenous HA-derived oligosaccharide has access to the active site of pmHAS 1"703 and can be elongated.
- the various recombinant enzymes were tested for their ability to convert HA tetramer into molecular weight products.
- the reactions contained radiolabeled HA tetramer (5-8 x 10 5 dpm), 750 ⁇ M UDP-GlcNAc, 360 ⁇ M UDP-GlcUA, 20 mM XCI 2 , 50 mM Tris, pH 7-7.6 (the respective X cation and pH values used for each enzyme were: pmHAS 1"703 , Mn/7.2; Xenopous DG42, Mg/7.6; Group A streptococcal HasA, Mg/7.0), and enzyme (units/reaction listed).
- FIG.4 demonstrates that pmHAS 1"703 elongated the HA-derived tetramer by a single sugar unit if the next appropriate UDP-sugar precursor was available in the reaction mixture.
- GlcNAc derived from UDP-GlcNAc was added onto the GlcUA residue at the nonreducing terminus of the tetramer acceptor to form a pentamer.
- inclusion of only UDP-GlcUA did not alter the mobility of the oligosaccharide.
- Portions (2.5 ⁇ l) of the supernatant were spotted onto the application zone of a silica TLC plate and developed with solvent (1.25:1: 1 butanol/acetic acid/water).
- the beginning of the analytical layer is marked by an arrow.
- the positions of odd-numbered HA oligosaccharides (S lane) are marked as number of monosaccharide units.
- the autoradiogram of FIG. 4 (4 day exposure) shows the single addition of a GlcNAc sugar onto the HA tetramer acceptor to form a pentamer when only the subsequent precursor is supplied (N).
- a series of truncated versions of pmHAS (normally a 972-residue membrane protein) were created and are tabulated (with functionality) in Table V that produce proteins with altered physical properties (i.e. proteins that are more conducive to high-level expression and purification) and altered function (i.e. single transferase activity).
- Polymerase chain reaction [PCR] was used to amplify a portion of the pmHAS gene using a primer corresponding to the authentic N-terminus sequence and a primer corresponding to an internal coding region which ended in a stop codon.
- the coding regions for the truncated proteins were cloned into an Escherichia coli expression plasmid (pKK223-3; Pharmacia) under control of the tac promoter. The DNA sequence was verified by automated sequencing.
- pmHAS 1"703 a new 80-kDa protein, named pmHAS 1"703 , was produced in large quantities. Furthermore, functional pmHAS 1"703 was present in the soluble fraction of the cell lysate; thus allowing for rapid extraction and assay of the enzyme.
- pmHAS 1"703 was purified by sequential chromatography steps shown in FIG. 6. In FIG. 6, a soluble, active form of the HA synthase was constructed with molecular biological techniques. The recombinant enzyme from E. coli was purified by conventional chromatography with yields of up to 20 mg/liter of cell culture.
- FIG. 6 is a stained electrophoretic gel loaded with samples of pmHAS 1"703 (marked with an arrow) during different stages of chromatography.
- This catalyst (and improved mutant versions) can be used to prepare HA coatings on artificial surfaces or HA extensions on suitable acceptor molecules.
- the pmHAS 1"703 is highly active and at least 95% pure as assessed by denaturing polyacrylamide gel electrophoresis. Mass spectrometric analysis indicates that the pmHAS 1"703 is the desired protein due to the close agreement of the calculated and the observed mass values. A buffer system has also been developed to stabilize the enzymatic activity in the range of 0° to 37°C.
- the mutant enzymes are useful for adding on a single GlcNAc or a single GlcUA onto the appropriate acceptor oligosaccharide. It appears that pmHAS 1"703 has two domains or two modules for transferring each sugar. One of ordinary skill in the art, given this specification, would be able to shift or to combine various domains to create new polysaccharide synthases capable of producing new polysaccharides with altered structures.
- HA oligosaccharide acceptor or primer molecule The critical structural elements of the HA oligosaccharide acceptor or primer molecule are currently being tested and identified.
- the smallest acceptor molecule with activity tested thus far is an HA disaccharide, although it is anticipated that molecules as short as a monosaccharides will be suitable for use with the present invention.
- pmHAS 1"703 enzyme has some flexibility with respect to the identity of the hexosamine group; i.e. other isomers will substitute for the GlcNAc sugar.
- chondroitin pentamer [GalNAc-GlcUA-GalNAc-GlcUA- GalNAc]
- a synthetic molecule consisting of several hydroxyl groups, a pair of negatively charged groups (corresponding to the carboxyl groups of GlcUA sugar), and hydrophobic patches (analog ofthe carbon-rich side of the sugar ring) will work as a functional primer for pmHAS.
- a series of synthetic peptides (1 to 8 residues) terminating with a GlcNAc group using conventional F moc chemistry can be generated.
- Such peptides are particularly promising because they can adopt a variety of conformations and fit within the pmHAS 1"703 HA-binding pocket via an induced fit mechanism.
- Synthetic peptide chemistry is also much less cumbersome than carbohydrate chemistry.
- the amino acids are chosen with the goal of mimicking the properties ofthe GlcNAcGlcUA sugar repeats of HA.
- glutamate or asparatate may be used as a substitute for the acid group of GlcUA
- glutamine or asparagine may be used as a substitute for the amide group of GlcNAc.
- Serine, threonine, or tyrosine can be used as substitutes for the hydroxyl groups and sugar rings in general.
- the peptide library terminates with a GlcNAc or GlcUA sugar group so that the demands on the pmHAS 1"703 enzyme's binding site and catalytic center are not overly burdensome.
- the present invention also encompasses the development of a mutant version of pmHAS that utilizes a simpler molecule than an HA oligosaccharide as a primer.
- Chitopentaose ( ⁇ l,4-GlcNAc homopolymer) is one such variant primer.
- Native pmHASdoes not utilize chitopentaose as a primer, but a mutant pmHAS may elongate chitopentaose, a more readily available substance.
- the chitopentaose primer is attached to the solid phase by reductive amination to an amino-containing plate or to a carrier protein (albumin) for immobilization on a normal plastic plate.
- a carrier protein albumin
- Other mutants could then be screened for function.
- Other potential non-sugar mimics contemplated for use are short poly(ethleneglycol)-based copolymers containing styrene, sulfonate, acrylate, and/
- Photoaffinity labeling is used to cross-link a radioactive HA oligosaccharide analog containing an aryl azide to the pmHAS 1"703 protein.
- the binding site of the pmHAS 1"703 protein is obtained through peptide mapping and Edman sequencing. With this information, mutants are prepared with alterations at the binding site. In the chitopentaose example, removal of some ofthe basic residues ofthe HA-binding site (which normally contact the carboxylate of GlcUA) and substitution of neutral polar residues would be chosen.
- coli K4 kfoC gene DNA DNA.
- a commercial Southern blot kit (Dig Hi-Prime, Roche) was used to label restriction fragments containing pmCS with digoxigenin probe. This probe was used to analyze a Southern blot (FIG. 8) containing a Pstl/EcoKI digest of Type F Pasteurella multocida genomic DNA (a positive control; P lane), a PCR product of the kfoC gene (corresponding to product of Ninomiya et al, 2002; lane K), or Lambda Hin ⁇ lll standard (lane L). The hybridization was carried out at 37 °C overnight in the manufacturer's buffer (Dig Easy Hyb) at 37 °C overnight.
- the blot was washed with 2X SSC, 0.1% SDS at 30 °C for 15 min twice, then for 30 min in 0.5X SSC, 0.1% SDS at 30 °C before using the manufacturer's Dig-antibody protocol for colorimetric detection.
- the kfoC band is apparent (KfoC black arrow) as well as the native Pasteurella gene (white arrow). No spurious hybridization signals were seen from other irrelevant DNA species.
- the knowledge of the pmCS sequence can be used to identify other chondroitin synthase candidates by known standard methodology.
- truncated polypeptides were expressed well in E. coli and the experimentally determined molecular weight corresponded to the predicted size (Fig. 9).
- In vitro assays were utilized to assess the HA synthase activity, or the two half-reactions, either GlcNAc-Tase or GlcUA-Tase, that comprise HA polymerization (Table VIII). Some of the truncations were inactive.
- pmHAS 1"756 SEQ ID NO: 20
- pmHAS 1"703 (SEQ ID NO: 9), which lacks a larger portion of the carboxyl terminus, retained HAS activity but was transformed into a cytoplasmic protein accounting for up to ⁇ 10% of the total cellular protein.
- the carboxyl-terminus especially residues 703-756, is responsible for the association of native pmHAS with the membrane.
- pmHAS ⁇ SEQ ID NO: 10 was still expressed at a high level as a soluble protein, yet was inactive as a HA synthase.
- pmHAS 1"650 was capable of transferring GlcNAc to the nonreducing terminal GlcUA of HA-derived oligosaccharides.
- pmHAS 1"650 did not transfer GlcUA to HA oligosaccharides, which terminated with a GlcNAc residue. Thus residues 650-703 are required, either directly or indirectly, for transferring GlcUA to the HA chain.
- pmHAS 1"567 SEQ ID NO: 21
- pmHAS 152"756 SEQ ID NO: 15
- pmHAS Site-directed mutagenesis of pmHAS 1"703 .
- the only member of Class II, pmHAS possesses motifs similar to two out of the seven putative conserved motifs of Class I HASs; these motifs contain DGS and DxD sequences.
- the pmHAS sequence has a duplication of a ⁇ 100-residue long element in the regions from residue 161-267 and from residue 443-547 with these conserved motifs.
- domain Al and domain A2 Two elements of pmHAS that contain the conserved motif are named domain Al and domain A2, respectively.
- FIG. 10 shows the amino acid alignment of the two putative domains and their relative position in pmHAS 1"703 .
- the above truncation results show that the GlcNAc-transferase activity can be separated from the HA synthase activity of pmHAS. Therefore, the domain Al is responsible for the GlcNAc-transferase function of HA synthase while domain A2 is responsible for GlcUA-transferase activity.
- pmHAS 1"703 a short polypeptide with complete HAS activity, was subjected to site-directed mutagenesis in order to further refine the results.
- pmHAS 1"703 mutants Specific activities of various pmHAS 1"703 mutants. Equivalent amounts of pmHAS 1"703 proteins (based on Western blot) were assayed. The specific activities (average of duplicate determinations) are indicated as the percentage of the wild-type sequence pmHAS 1"703 (set as 100%). The specific activities (picomoles of monosaccharide transfer/mg of protein/min) for wild-type enzyme in the three different assays were: HAS, 37; GlcNAc-Tase, 63; GlcUA- Tase, 76.
- pmHAS 1 703 domain Al mutants containing D196E, D196K or D196N maintained high levels of GlcUA-transferase activity.
- pmHAS 1"703 domain A2 mutants containing D477E, D477K or D477N had high levels of GlcNAc-transferase activity implying that the two aspartate residues were critical for HA synthase function.
- domain Al is the GlcNAc-transferase
- domain A2 is the GlcUA-transferase.
- K M analysis of mutants In order to detect potential interaction or cross-talk between the two putative domains of pmHAS, the apparent affinity of the wild-type and the pmHAS 1"703 mutants were compared for the UDP-GlcNAc or for the UDP-GlcUA substrates by measuring their Michaelis constants (K M ) for the functional transferase activity. Titration of the UDP-sugars in the half assays for the GlcUA and GlcNAc transferases were performed (Table X).
- the standard HA synthesis assay was performed with extracts containing either the truncated wild-type sequence pmHAS 1"703 enzyme, or a GlcNAc-Tase mutant enzyme (D196N) alone, or a GlcUA-Tase mutant enzyme (D477K) alone, or a mixture of the two mutant enzymes. These two mutants were selected as they were the least active in the HA synthase assay (Table IX). Equivalent amounts of wild-type pmHAS 1"703 polypeptide (2 ⁇ g of total protein) or mutant pmHAS 1"703 polypeptide (based on Western blot analysis) were used for these assays.
- each mutant polypeptide was added (equivalent to 4 ⁇ g of total protein of wild-type extract).
- the D196N mutant alone or the D477K mutant alone did not produce detectable amounts of HA chains (FIG. 11), but when the mutant polypeptides were incubated together, along with a HA oligosaccharide acceptor (4-10 sugars long), longer HA polymers were made.
- the amount and the rate of HAS activity of the combination of the two mutants was similar to the parallel reaction containing the wild-type pmHAS 1"703 .
- chondroitin [ ⁇ (l,4)GlcUA- ⁇ (l,3)GalNAc] n heparin/heparan [ ⁇ (l,4)GlcUA- ⁇ (l,4)GlcNAc] ⁇
- chondroitin synthase from P. multocida is described and enabled in copending U.S. Serial No. 09/842,484 which is expressly incorporated herein in its entirety by reference. [000178] Briefly, the glycosyltransferase responsible for polymerizing the chondroitin backbone component of the capsular polysaccharide has also been molecularly cloned and was named pmCS (SEQ ID NO:4). The pmCS enzyme appears to be a close homolog of the pmHAS enzyme (FIG. 12).
- pmHAS one domain, called Al, is responsible for GlcNAc transfer and the other domain, called A2, is responsible for GlcUA transfer.
- A2 the other domain
- GlcUA transfer is responsible for GlcUA transfer.
- the pmCS enzyme transfers a different hexosamine, GalNAc, thus this observation is consistent with the two-domain structure for pmHAS.
- Mutant enzymes derived from the soluble pmCS 1"704 parental dual-action chondroitin synthase were also created with the ability to elongate HA or chondroitin-based oligosaccharides by adding a single ⁇ 3-GalNAc monosaccharide to the non-reducing terminus.
- the mutants were formed by targeting the DXD motif in Domain A2 (also found in pmHAS) by site-directed mutagenesis (same general procedure as with pmHAS); the two aspartate (D) groups were converted into asparagine (N) residues forming the "NXN” mutants.
- Several independent clones producing mutant pmCS 1"704 NXN enzyme were assayed individually for the ability to transfer [ 3 H]GalNAc to HA oligosaccharides using UDP- GalNAc in analogy to pmHAS transferring [ 3 H]GalNAc to HA oligosaccharides using UDP- GlcNAc as described hereinabove.
- the NXN mutants could transfer a single GalNAc sugar like the wild-type sequence pmCS 1"704 enzyme.
- NXN mutants could not, however, make long chondroitin chains when assayed in a different system that only detected the addition of both GlcUA and GalNAc.
- This system utilizes leech hayluronidase-generated HA8-12mer oligosaccharide (this acceptor has a non-reducing end GlcNAc; 1.5 ug), 15 mM UDP-GlcUA, 0.1 mM UDP- [ 3 H]GalNAc (4.4xl0 5 dpm) in 20 ⁇ L reaction mixtures containing 50 mM Tris, pH 7.2, 1 M ethylene glycol, 0.1 M ammonium sulfate, 10 mM MnCI 2 . Extracts containing either the wild-type pmCS 1"704 (CS-WT) or the NXN mutant extracts were assayed for 120 minutes at
- the . labeled polymer produced was quantitated by paper chromatography (polymer at the origin of the paper strip) and liquid scintillation counting.
- NXN mutants (3 different clones: 2, 3, or 7) do not display high incorporation in this assay because these single-action enzymes cannot add the required GlcUA to the acceptor terminus: without prior GlcUA transfer, the radioactive GalNAc is never added (See Table
- the parental dual-action pmCS enzyme can perform GlcUA addition thus allowing the radioactive GalNAc to be added; furthermore, multiple rounds of GlcUA and
- GalNAc addition are possible with wild-type enzyme yielding a very high signal. Overall, such controllable single-action enzymes are useful for bioreactor systems for oligosaccharide syntheses or for construction of sugar libraries.
- pmHAS and pmCS both utilize two relatively independent glycosyltransferase sites. Other sequence motifs are also discussed with respect to their roles in polysaccharide biosynthesis. Hereinafter is the analysis of truncated pmHAS proteins used to delineate essential regions.
- pmHAS 46 703 SEQ ID NO:27, pmHAS 72"703 SEQ ID NO: 28, pmHAS 96"703 SEQ ID NO: 29 and pmHAS 118"703 SEQ ID NO: 30 were produced in E. coli.
- the experimentally determined molecular weights corresponded to the predicted sizes.
- the truncated versions pmHAS 46"703 and pmHAS 72"703 were as active as pmHAS 1"703 , a soluble polypeptide with complete HAS activity.
- pmHAS 118"703 expressed better than pmHAS 96"703 and still elongated HA chains. Therefore, further deletion beyond residue 72 appears to affect the overall folding efficiency ofthe entire polypeptide. Observation of lower molecular weight degradation bands derived from pmHAS 118"703 on Western blots also suggests that improper folding occurs to some extent. Overall, these findings suggest that the amino-terminal 117 residues are not required for HA synthase activity. [000183] It was discussed hereinabove that pmHAS 1"650 (SEQ ID NO: 10) lost its GlcUA-transferase activity.
- the DXD motif is found in many glycosyltransferases.
- pmHAS has two DXD motifs, one in domain Al and another in domain A2 (FIG. 13).
- X-ray crystallography ofthe Bacillus SpsA protein/UDP-complex suggests that the DXD motif is involved in binding metal ion coordinated with the beta phosphate and the ribose moiety of the UDP-sugar.
- the involvement of the individual aspartate residues of DXD in pmHAS therefore, was characterized.
- the aspartate residues (residue 247, 249, 527 or 529) of the two DXD motifs of pmHAS 1"703 were mutated in the two domains.
- Mutants were produced containing the following changes in domain Al - D247E (SEQ ID NO:33), D247N (SEQ ID NO:34), D247K (SEQ ID NO:35), D249E (SEQ ID NO:36), D249N (SEQ ID NO:37), or D249K (SEQ ID NO:38) and in domain A2 - D527N (SEQ ID NO:39), D527E (SEQ ID N0:40), D527K (SEQ ID N0:41), D529E (SEQ ID NO:42), D529N (SEQ ID NO:43), or D529K (SEQ ID NO:44).
- mutants with D247N, D249K, D529E and D527K were found to also have a mutation of D702I that did not affect HAS activity. All of the mutant proteins were produced at similar levels in soluble form. In vitro assays were utilized to assess the HA synthase activity (e.g. polymerization of long HA chains), or the two half-reactions, either GlcNAc-transferase or GlcUA-transferase activity. All of the mutants were inactive as HA synthases except D529E which had only 10% of the wild type activity (Table XII).
- both Ds are mutated to Ns (asparagines): one D can be changed to N but the resulting mutant enzyme may retain some "sloppiness" - i.e. the enzyme may incorporate both natural sugars. As such, it may be preferred to mutate both Ds of the DXD motif to Ns in order to truly "kill" or knock-out the enzymatic activity of the domain.
- pmHAS polypeptide sequence there is a segment similar to portions of mammalian UDP-GalNAc: polypeptide N-acetylgalactosaminyltransferases (ppGaNTransferases) that catalyzes the initial step for making the oligosaccharide moiety on O-linked glycoproteins.
- the W366GGED370 motif which resides between the putative domain Al and domain A2, does not exist in the sequences of other HA synthases from Streptococcus, vertebrates, or Chlorella virus.
- E369 or D370 were mutated.
- E369D (SEQ ID NO:45), E369Q (SEQ ID NO:46), E369H (SEQ ID NO:47), D370E (SEQ ID NO:48), D370N (SEQ ID NO:49), or D370K (SEQ ID NO:50). All the mutants were expressed at comparable levels with the wild type enzyme.
- pmHAS 1"703 WGGED mutants Specific activities of the pmHAS 1"703 WGGED mutants. Equivalent amounts of pmHAS 1"703 proteins (based on Western blot) were assayed. The activities are indicated as the percentage ofthe wild type pmHAS 1"703 (100%). The WGGED motif is involved in the transfer of GlcNAc.
- the chondroitin synthase, pCS, from Type F P. multocida is about 90% identical to pmHAS at the protein level.
- the majority of sequence differences exist in the vicinity ofthe domain Al of pmHAS while their carboxyl-terminal halves are almost identical (described hereinabove). This is to be expected because the carboxyl-terminal half of pmHAS contains domain A2 which has the GlcUA-transferase active site.
- the pmCS also possesses two separate transferase sites with respect to pmCS, but the amino-terminal half is a GalNAc-transferase while the carboxyl-terminal half is a GlcUA-transferase.
- the first aspartate forms a hydrogen bond with the ribose ring and the second aspartate coordinates with the metal cation bound to the phosphate to assist leaving group departure.
- the involvement of the DXD motif in nucleotide binding and in metal ion interaction is supported by several other available glycosyltransferase structures which were solved later, including bovine ⁇ 4-galactosytransferase, rabbit N-acetylglucosaminyltransferase I (in which the motif is in the form of EDD and the last aspartate, D213, makes the only direct interaction with the bound Mn 2+ ), and human ⁇ l,3-glucuronyltansferase I.
- a retaining enzyme, bovine ⁇ l,3-galactosyltransferase contains a DXD motif with a similar structure for UDP-binding.
- each transferase site contains a set of UDP-precursor-binding sites and catalytic residues.
- the two DXD motifs of each site are similar but not identical.
- the two half-activities of pmHAS prefer Mn + , but the two sites differ in their relative preference for Co 2+ and Mg 2+ .
- the underlying reason for this selectivity is not known, but it can be speculated that various metal ions confer different coordination angles and geometry to the sugar nucleotide/enzyme binding site complex. Indeed, the X-ray crystal structure of SpsA showed that the two phosphate groups of UDP are ordered differently in the presence of Mn 2+ or Mg 2+ .
- the WGGED motif was first noted among ⁇ 4-galactosyltransferases and a similar motif, WGXEXXE, was found among UDP-GalNAc: polypeptide N- acetylgalactosaminyltransferases. Residues in this Gal/GalNAcT motif have been shown to be essential for enzyme activity.
- the X-ray crystal structure of bovine ⁇ 4- galactosyltransferase showed that E317D residues in WGGE317D segment are located at the bottom of the proposed UDP-Gal binding pocket.
- Saxena proposed two types of putative domains, Domain A and Domain B, among many beta-giycosyltransferases that use nucleotide diphospho sugars as donors.
- processive enzymes which add a number of sugar residues without releasing the nascent chain, possess both Domains A and B, while those enzymes that add a single sugar residue have only Domain A.
- Domain A resides in the N- terminal half of the polypeptide and possesses two invariant Asp residues
- Domain B resides in the C-terminal half and with an invariant Asp residue along with a characteristic QXXRW motif.
- Saxena etal.
- pmHAS The only known member of Class II HA synthases, pmHAS, possesses two tandem copies of Domain A and does not contain Domain B. Data from the activity analysis of the truncated versions and the point mutants of pmHAS indicate that two active sites coexist in one polypeptide. Overall, pmHAS appears to be a polypeptide with two coordinated but intrinsically nonprocessive activities. Support for this characterization is found in the pmHAS mutant in vitro complementation study; two distinct polypeptide molecules can act together to polymerize HA chains in a rapid fashion. The HA chain must be released by one mutant to be acted on by the other mutant. The distinct Class I HA synthases, however, do not appear to release the nascent chain during synthesis.
- pmCS is 90% identical to pmHAS and possesses two similar sets of putative nucleotide-binding elements. Therefore, pmCS utilizes the same structural organization and general catalytic mechanism as pmHAS. Dissection of the two transferase activities in pmHAS provides direct evidence for a two-active center model (FIG. 13).
- the E. coli K4 chondroitin polymerase (named a "polymerase” rather than "synthase” due to its apparent absolute requirement for an acceptor chain), KfoC, was recently reported (Ninomiya, et al., 2002). This protein is about 60% identical to pmHAS and pmCS, and thus probably utilizes similar motifs and domains.
- FT85 eukaryotic glycosyltransferase
- This bifunctional glycosyltransferase mediates the ordered addition of ⁇ l,3-linked Gal and ⁇ l,2-linked Fuc to the Skpl glycomoiety.
- the overall architecture of FT85 resembles pmHAS in that it contains two glycosyltransferase domains.
- pmHAS or the pmCS polypeptide engages with the polysaccharide export apparatus.
- other proteins may help maintain the interaction of the transferase with the elongating GAG chain.
- the catalytic reaction mechanism and/or the intrinsic nature of pmHAS or pmCS are probably not the major chain retaining mechanisms.
- Pasteurella multocida Type D a causative agent of atrophic rhinitis in swine and pasteurellosis in other domestic animals, produces an extracellular polysaccharide capsule that is a putative virulence factor. It has been reported that the capsule of Type D was removed by treating microbes with heparin lyase III.
- a 617- residue enzyme, pmHSl (SEQ ID NOS: 5 and 70), and a 651-residue enzyme, PmHS2 (SEQ ID NO: 8), which are both authentic heparosan (unsulfated, unepimerized heparin) synthase enzymes have been molecularly cloned and are presently claimed and disclosed in copending U.S. Application Serial No. 10/142,143, incorporated herein previously by reference.
- Recombinant Escherichia co//-derived pmHSl or PmHS2 catalyzes the polymerization ofthe monosaccharides from UDP-GlcNAcand UDP-GlcUA. Other structurally related sugar nucleotides do not substitute.
- Synthase activity was stimulated about 7- to 25-fold by the addition of an exogenous polymer acceptor. Molecules composed of ⁇ 500 to 3,000 sugar residues were produced in vitro. The polysaccharide was sensitive to the action of heparin lyase III but resistant to hyaluronan lyase.
- the sequence of pmHSl enzyme is not very similar to the vertebrate heparin/heparan sulfate glycosyltransferases, EXT1/2 (SEQ ID NOS: 65/66), or to other Pasteurella glycosaminoglycan synthases that produce hyaluronan or chondroitin.
- pmHSl, pmHS2, and KfiA SEQ ID NO: 65
- KfiC SEQ ID NO: 64
- the pmHSl and PmHS2 enzymes are the first microbial dual-action glycosyltransferase to be described that form a polysaccharide composed of ⁇ 4GlcUA- ⁇ 4GlcNAc disaccharide repeats.
- heparosan biosynthesis in E. coli K5 requires at least two separate polypeptides, KfiA and KfiC, to catalyze the same polymerization reaction.
- DcbF The gene annotated as DcbF (SEQ ID NO:62) is truncated at the carboxyl terminus in comparison to the presently claimed and described P. multocida HS clones.
- the truncated (T) or the full-length (FL) open reading frames of DcbF were cloned into the expression system pETBIue-1 vector, as described hereinabove.
- Membranes isolated from the same host strain, E. coli Tuner with the various recombinant plasmids were tested in HS assays with both radiolabeled UDP-sugars. The results of these experiments are summarized in Table XVI.
- PmHSl GeneBank Accession Number AAK024908
- pmHSl pmHSl-7
- SEQ ID NO: 8 Another deduced gene was recently uncovered by the University of Minnesota in their Type A P. multocida genome project, called PmHSl (GenBank Accession Number AAK02498), encoding 651 amino acids that are similar to pmHSl (73% identical in the major overlapping region).
- the PmHS2 gene SEQ ID NO: 7
- SEQ ID NO: 7 is not located in the putative capsule locus.
- This group made no annotation of the function of PmHS2.
- Our studies show that this PmHS2 protein (SEQ ID NO:8) also polymerizes GlcUA and GlcNAc residues to form heparosan.
- a Type D strain and a Type F strain also appear to contain a homologous PmHSl gene as shown by PCR and activity analysis.
- PCR and activity analysis As mentioned before, during the pmHSl cloning project in the present Applicant(s)' laboratory, investigators at the Univ. of Minnesota published the complete genome of a Pasteurella multocida isolate. The fragments of the presently claimed and disclosed pmHSl gene were utilized as the query in a BLAST search against this P. multocida genome. A gene annotated as pmHSl, but with no ascribed, predicted or demonstrated function was found to be very similar to the pmHSl gene. The pmHSl gene is not in the main capsule locus found by either the DeAngelis or the Adler groups.
- the pmHSl open reading frame was obtained from two different encapsulated strains: Type A (P-1059 from a turkey - this strain is not the same as the Univ. of Minnesota strain - clones denoted as "A") and Type D (P-3881 from a cow - clones denoted as "D").
- the pmHSl gene was amplified from chromosomal templates prepared by method of Pitcher et al (Letters in Applied Microbiology, 1989 which is expressly incorporated herein by reference in its entirety). PCR with Taq polymerase (18 cycles) using custom flanking oligonucleotide primers that correspond to the region of the start codon and the stop codon of pmHSl.
- Clones were streak isolated, small cultures were grown, and preparations of the plasmid DNA were made.
- the plasmids were transformed into the expression host, E. coli Tuner (Novagen), and selected on LB with carbenicillin and chloramphenicol.
- E. coli Tuner Novagen
- small cultures were grown at 30°C as the starting inoculum (1:100) for larger cultures (50 ml) for protein expression and activity assay. These cultures were grown in the same LB supplemented with 1% casein amino acids and trace element solution with vigorous shaking (250 rpm) at 30°C.
- the cells were grown to mid-logarithmic phase (2.5 hours), induced with 0.5 mm IPTG, and grown for 4.5 hours.
- PmHS2 is a dual-action synthase capable of sugar biosynthesis as shown by functional expression of activity of one recombinant gene in a foreign host that normally does not make GlcUA/GlcNAc polymers.
- the relaxed specificity of UDP-sugar incorporation of PmHS2 should be of use for the design and production of new polymers with altered characteristics.
- Table XVIII shows PmHS2 Sugar Specificity test results.
- the experiments summarized in Table XVIII are similar to the experiments summarized in Table XVII (with less enzyme) except that other UDP-sugars that are not normally found in heparin or heparosan were also tested (note - 60 minute incubation times, 50 ⁇ l reactions).
- the Type A and the Type D enzymes behave in a similar fashion with relaxed sugar specificity in this test.
- the PmHS2 system can add a glucose instead of a GlcNAc sugar. The ability to co- polymerize the sugars
- Type A and the Type D clones were tested for stimulation by addition of the Type D polysaccharide acceptor (described hereinbefore with respect to pmHSl). Weaker stimulation of activity by acceptor on pmHS2 was observed in comparison to pmHSl (comparison is not shown here).
- P. multocida Type F-derived recombinant pmHS2 is thus also a heparosan synthase. As shown in the following Table XX, the Type F PmHS2 can incorporate the authentic heparin sugars.
- the pmHS2 homolog of P. multocida Type F strain P-4218 was amplified with flanking primers as described for the Type A and D strains.
- the ORF was subcloned into the pETBIue-1 system in E. coli Tuner cells for use as a source of membrane preparations as described.
- Three independent clones (F 3,4,18) were assayed under standard HS assay measuring radiolabeled sugar incorporation with paper chromatography.
- a negative control, membranes from "Blank" vector and a positive control, the Type D pmHS2 clone D7, were tested in parallel. Reactions plus/minus the Type D polymer acceptor were assayed.
- pmHSl is a naturally occurring fusion of two different glycosyltransferase domains.
- the pmHSl is a dual action enzyme that alone makes heparin/heparosan polymers because both sugar transferase sites exist in one polypeptide enzyme.
- pmHSl The amino acid sequence of the heparosan synthase, pmHSl, however, is very different from other Pasteurella GAG synthases, pmHAS and pmCS.
- EXT1 SEQ ID NO: 65
- EXT 2 SEQ ID NO: 66
- Motif I corresponds to the GlcUA transferase portion of the enzyme
- Motif II corresponds to the GlcNAc transferase portion of the enzyme.
- X any residue parentheses enclose a subset of potential residues [separated by a slash] that may be at a particular position (e.g. - (K/R) indicates that either K or R may be found at the position - i.e. there are semiconserved residues at that position.
- the consensus X spacing is shown with the number of residues in subscript (e.g. X 12 . 17 ), but there are weaker constraints on these particular residues, thus spacing may be longer or shorter. conserveed residues may be slightly different in a few places especially if a chemically similar amino acid is substituted (e.g. K for a R, or E for a D).
- pmHAS- catalyzed synthesis in vitro was unique in comparison to all other existing HA synthases of Streptococcus, bacteria, humans or an algal virus.
- recombinant pmHAS can elongate exogenously supplied functional acceptors (described herein) into longer glycosaminoglycans.
- the pmHAS synthase adds monosaccharides one at a time in a step- wise fashion to the growing chain.
- the pmHAS' extraordinarily transfer specificity results in the repeating sugar backbone of the GAG chain.
- pmCS enzyme which is 90% identical at the amino acid level to pmHAS, performs the same synthesis reactions but incorporates GalNAc instead of GlcNAc.
- the pmHSl and PmHS2 enzymes can also add heparosan chains onto exogenous supplied functional acceptors such as long or short heparosan polymers.
- the Pasteurella GAG synthases are very specific glycosyltransferases with respect to the sugar transfer reaction: usually only the authentic sugar is added onto acceptors.
- the epimers or closely structurally related molecules e.g. UDP-glucose
- these GAG synthases from Pasteurella do utilize heterologous acceptor sugars.
- pmHAS elongates short chondroitin acceptors with HA chains.
- pmHSl adds heparosan chains onto HA acceptor oligosaccharides.
- a diverse range of hybrid of chimeric or hybrid GAG oligosaccharides can be made with the disclosed GAG synthases (i.e. pmHAS, pmCS, pmHSl, and PmHS2).
- the chemoenzymatic methodology can be used in either a liquid- phase synthesis of soluble, free sugars or in a solid-phase synthesis to build sugars on surfaces (as disclosed hereinafter).
- chimeric or hybrid GAGS can be made using the Pasteurella GAG synthases of the presently claimed and disclosed invention.
- Table XXI synthetic di- and tri-saccharides of heparosan, and HA can be elongated.
- Naturally derived HA tetramers can also be elongated.
- the reducing end is not required to be in a free state (aglycons are not a problem), therefore, the reducing end can serve as the tether site onto a surface, drug, or other synthetic or natural molecule.
- Exemplary compounds that can be made using the Pasteurella GAGs of the presently claimed and disclosed invention include, but are not limited to:
- HA hyaluronan
- C chondroitin
- CS chondroitin sulfate
- HP heparosan or heparin like molecules.
- pm-EG and pm-IK are not dual-action enzymes and do not have either pmHAS nor pmCS activities.
- pm-FH which possesses pmCS residues 1-258, is an active pmCS, although its remaining part is from pmHAS residues 266-703.
- pmHAS sequence is replaced by pmHAS sequence as in pm-JL enzyme construct (which possesses pmCS residues 1-214 at the amino-terminal and pmHAS residues 222-703 at the carboxyl-terminal)
- the enzyme is converted into a catalyst with HAS activity.
- pmCS 1"214 -HAS 222"265 -CS 258"704 transfers both GlcNAc and GalNAc and GlcN.
- additional residues in the 44-residues region were important for the selectivity between GalNAc and GlcNAc transferase.
- this region was swapped between pmHAS 1"703 and pmCS ⁇ by PCR-overlap-extension.
- Pm-EG and pPmF4A (a library clone containing pmCS gene locus) DNAs were used to create pmCS 1"214 -HAS 222" 65 -CS 258"704 .
- Pm-FH and pPm7A (a C library clone containing pmHAS gene locus) DNAs were used to create pmHAS ⁇ -CS 215"258 - HAS 266 - 03 ( FIG _ 18 )_ pmHAS 1 - ⁇ l -CS 215 - 2S ⁇ -HAS 266 - 703 did not express.
- pmCS 1 " 214 - HAS 222 265 -CS 258"704 could transfer both GlcNAc and GalNAc with preference for UDP-GalNAc as judged by HAS assay and CS assay, supporting our conclusion that this region in pmHAS and pmCS plays a critical role in determination of sugar substrate specificity.
- Standard polymerization assay were performed in the presence of isotope-labeled GlcUA, HA oligosaccharide acceptor, and one of the following sugar substrates.
- the sugar incorporation was indicated as the percentage of the incorporation of UDP- GalNAc.
- Type A Pasteurella multocida produces a hyaluronan [HA] capsule to enhance infection.
- the 972-residue hyaluronan synthase, pmHAS polymerizes the linear HA polysaccharide chain composed of GlcNAc and GlcUA.
- PmHAS possesses two separate glycosyltransferase sites. Protein truncation studies demonstrated that residues 1-117 can be deleted without affecting catalytic activity. The carboxyl-terminal boundary ofthe GlcUA- transferase resides within residues 686-703. Both sites contain a DXD motif. All four aspartate residues are essential for HA synthase activity.
- Type F P. multocida synthesizes an unsulfated chondroitin GalNAc and GlcUA capsule. Domain swapping between pmHAS and the homologous chondroitin synthase, pmCS, was performed. A chimeric or hybrid enzyme consisting of residues 1-427 of pmHAS and residues 421-704 of pmCS was an active HA synthase. On the other hand, the converse chimeric or hybrid enzyme consisting of residues 1-420 of pmCS and residues 428-703 of pmHAS was an active chondroitin synthase. Overall, these findings support the model of two independent transferase sites within a single polypeptide as well as further delineate the site boundaries.
- pmHAS utilizes two separate glycosyltransferase sites to catalyze the transfer of GlcNAc and GlcUA to form the HA polymer.
- pmHAS sequence there is a pair of duplicated domains which are similar to the "Domain A" proposed by Saxena.
- Both domains of pmHAS possess a short sequence motif containing DGS that is conserved among many ⁇ -glycosyltransferases. Changing the aspartate in either motif to asparagines, glutamate, or lysine significantly reduced or eliminated the HAS activity.
- the D196 mutants and the D477 mutants maintain high level of GlcUA-transferase and GlcNAc- transferase activity, respectively.
- pmCS contains 965 amino acid residues and is about 90% identical to pmHAS.
- a soluble recombinant Escherichia co//-derived pmCS 1"704 catalyzes the repetitive addition of sugars from UDP-GalNAc and UDP-GlcUA to chondroitin oligosaccharide acceptors in vitro.
- pmHAS 46"703 pmHAS 72"703 , pmHAS 96"703 and pmHAS 118"703
- the truncated versions pmHAS 46"703 and pmHAS 72"703 were as active as pmHAS 1"703 , a soluble polypeptide with complete HAS activity.
- PmHAS 96"703 expressed at a very low level compared with other constructs but was active.
- PmHAS 118"703 expressed better than pmHAS 96"703 and still elongated HA chains.
- pmHAS 1"650 loses its GlcUA-transferase activity.
- pmHAS 1"668 and pmHAS 1"686 were created. Both mutants also could not polymerize HA due to the loss of GlcUA-transferase activity, indicating that the carboxyl-terminal boundary of the GlcUA-transferase resides between residues 686 and 703.
- HA hyaluronan
- the size of the hyaluronan [HA] polysaccharide dictates its biological effect in many cellular and tissue systems based on many reports in the literature.
- no source of very defined, uniform HA polymers with sizes greater than 5 kDa is currently available. This situation is complicated by the observation that long and short HA polymers appear to have antagonistic or inverse effects on some biological systems. Therefore, HA preparations containing a mixture of both size populations may yield contradictory or paradoxical results.
- One embodiment ofthe novel method ofthe present invention produces HA with very narrow, monodisperse size distributions that are referred to herein as "selectHA.”
- pmHAS The Pasteurella bacterial HA synthase enzyme, pmHAS, catalyzes the synthesis of HA polymers utilizing monosaccharides from UDP-sugar precursors in vivo and in vitro. pmHAS will also elongate exogenously supplied HA oligosaccharide acceptors in vitro; in fact, HA oligosaccharides substantially boost the overall incorporation rate.
- a purified recombinant, pmHAS derivative was employed herein to produce either native composition HA or derivatized HA.
- HA polymers of a desired size were constructed by controlling stoichiometry (i.e. ratio of precursors and acceptor molecules). The polymerization process is synchronized in the presence of acceptor, thus all polymer products are very similar. In contrast, without the use of an acceptor, the polymer products are polydisperse in size.
- stoichiometrically controlled synchronized synthesis reactions yielded a variety of HA preparations in the range of ⁇ 15 kDa to about 1.5 MDa.
- Each specific size class had a polydispersity value in the range of 1.01 for polymers up to 0.5 MDa or ⁇ 1.2 for polymers of ⁇ 1.5 MDa (1 is the ideal monodisperse size distribution) as assessed by size exclusion chromatography/multi-angle laser light scattering analysis.
- the selectHA preparations migrate on electrophoretic gels (agarose or polyacrylamide) as very tight bands.
- a modified acceptor allows the synthesis of selectHA polymers containing radioactive (e.g. 3H, 1251), fluorescent (e.g. fluorescein, rhodamine), detection (i.e., NMR or X-ray), affinity (e.g. biotin) or medicant tags.
- radioactive e.g. 3H, 1251
- fluorescent e.g. fluorescein, rhodamine
- detection i.e., NMR or X-ray
- affinity e.g. biotin
- medicant tags e.g., each molecule has a single detection agent located at the reducing terminus.
- radioactive UDP-sugar precursors allows the synthesis of uniformly labeled selectHA polymers with very high specific activities.
- the selectHA reagents should assist in the elucidation of the numerous roles of HA in health and disease due to their monodisperse size distributions and defined compositions. It must be emphasized that unpredicted kinetic properties of the Pasteurella GAG synthases in a recombinant virgin state in the presence of defined, unnatural reaction conditions facilitates targeted size range production of monodisperse polymers that are not synthesizable by previously reported methods. [000241] Effect of HA acceptor on pmHAS-catalyzed polymerization.
- HA polymerization reactions were performed with purified pmHAS and UDP-sugar precursors under various conditions, and the reaction products were analyzed by agarose gel or acrylamide gel electrophoresis. The size distribution of HA products obtained were observed to be quite different based on the presence or absence of the HA4 acceptor in the reaction (Fig. 20A). When 30 mM of UDP-sugars were present as well as 0.03 ug/ul of HA4, pmHAS synthesized smaller chains with a narrow size distribution. The Mn determined by MALLS is 551.5kDa and its polydispersity (Mw/Mn) is 1.006 (Fig. 20B).
- MALLS MALLS polydispersity
- Size control of HA The polymerization by pmHAS in the presence of HA acceptor is a synchronized process, and thus a more defined HA preparation can be obtained with pmHAS.
- the synthase enzyme will preferentially add available UDP-sugar precursors to the acceptor termini. If there are many acceptors, thus many termini, then a limited amount of UDP-sugars will be distributed among many molecules and thus result in many short polymer chain extensions. Conversely, if there are few acceptors, thus few termini, then the limited amount of UDP-sugars will be distributed among few molecules and thus result in a few long polymer chain extensions (modeled in FIG. 24). It has previously been observed that chain initiation is the rate-limiting step for pmHAS, and the enzyme prefers to transfer sugars onto existing HA chains when acceptor is included in the reaction.
- HA4 should affect the final size of the HA product when the same amount of UDP-sugar is present.
- assays were performed with various levels of HA4 with fixed amount of UDP-sugar and pmHAS (Fig. 25A).
- HA polymer sizes were determined by size exclusion chromatography - Multi Angle Laser Light Scattering (SEC-MALLS, Fig. 25B). Using the same strategy, HA was generated from 27 kDa to 1.3 MDa with polydispersity ranging from 1.001 to 1.2.
- Fig. 25A size exclusion chromatography - Multi Angle Laser Light Scattering
- FIG. 26 demonstrates the monodispersity of the various HA polymers resulting from reaction synchronization [000245] In vitro synthesis of fluorescent HA.
- the in vitro technology for the production of monodisperse glycosaminoglycans also allows the use of modified acceptor to synthesize HA polymers containing various types of foreign moieties.
- An. example is shown using fluorescent HA4 to produce fluorescent monodisperse HA of various sizes (Fig. 27).
- radioactive e.g. 3 H, 125 I
- affinity e.g. biotin
- detection e.g. probe for NMR or X-ray uses or a reporter enzyme
- medicant tagged glycosaminoglycan polymers are possible with the appropriate modified acceptor.
- the invention is not limited to the tags described herein, and other tags known to a person having ordinary skill in the art may be utilized in accordance with the present invention.
- HA tetrasaccharide
- larger HA polymers can be used as starting acceptor for pmHAS; the enzyme will elongate existing chains with more sugars.
- Experiments were performed using 575 kDa HA and 970 kDa HA (synthesized in vitro with pmHAS and HA4 as acceptor, using the previously described methods) and a commercially available HA sample ( ⁇ 2 MDa; Genzyme) as acceptors. The results indicate that the existing HA chains were further elongated (FIG. 28).
- the ⁇ 2 MDa starting material in lane 11 was elongated to produce the larger (i.e., slower migrating) material in lane 10. Therefore, a method for creating higher value longer polymers is also described by the present invention.
- the length of the final product can be controlled stoichiometrically as shown in lanes 7-9; a lower starting acceptor concentration (lane 7) results in longer chains because the same limited amount of UDP-sugars is consumed, making a few long chains instead of many shorter chains (lane 9).
- the molecular weights of naturally existing HA polymers usually range from hundreds of thousands up to several millions of Daltons. For research requiring smaller HA polymers, enzymatic degradation is usually the first choice.
- High molecular HAs are commercially available from animal or bacterial sources. Problems with those include possible contaminants leading to immunological responses as well as broad size distribution (Soltes etc, 2002). Polydispersities (Mw/Mn) are commonly higher than 1.5. Conclusions drawing from experimental data during biological research with these HA could be misleading. Thus there exists a need for uniform HA to perform biological study, as agreed by Uebelhart and Williams (1999). [000249] To determine the exact average molecular mass of HA, MALLS is usually the choice. Yet many people have the need to quickly estimate the mass. For this purpose, some groups investigated the correlation of HA migration on agarose gel with DNA (Lee and Cowman, 1994).
- the drawback of this method is that, first, the HA samples used were not uniform, and second, the migration of HA and DNA on agarose gel changes differently with the change of the concentration of agarose gel.
- the in vitro generated HA of defined size distribution provide excellent series of standards for this purpose (Fig. 29).
- the unique technologies of the present invention allow the generation of a variety of defined, monodisperse HA tools for elucidating the numerous roles of HA in health and disease due to their monodisperse size distributions and defined compositions.
- HA Various amounts of HA were added to the preparations (at various times during reaction as noted) by adding more UDP-sugars.
- lanes 3-6 show hybrids with a constant amount of chondroitin sulfate and increasing HA chain lengths. The starting chondroitin sulfates stain weakly here, and the band position is marked with an arrow. Without the acceptor (lanes 23-26), no such defined bands are seen; after a long period, some HA polymer shows up (lane 26) which results from de novo initiation without acceptor.
- chondroitin sulfate A was elongated with pmHAS, thus adding
- HA chains Various amounts of HA were added to the preparations by controlling the level of chondroitin acceptor (thus changing the UDP-sugar/acceptor ratio) as well as adding more UDP-sugars during the reaction. By changing the UDP-sugar/acceptor ratio, stoichiometric control of the hybrid GAG size was demonstrated.
- chondroitin synthase such as but not limited to pmCS can be used to elongate an existing chondroitin sulfate polymer or HA polymer to produce defined hybrid GAG molecules of various structures. Again, these molecules may have use as surgical aids or tissue engineering scaffolds.
- pmCS and UDP-GlcUA, UDP-GalNAc were reacted with either a 81 kDa HA acceptor (lanes 3-7) or no acceptor (lanes 9-13).
- FIG. 33 Size exclusion (or gel filtration) chromatography analysis coupled with multi-angle laser light scattering detection confirms the monodisperse nature of polymers created by the present invention.
- HA starting MW 81 kDa
- pmCS methoxycellulose
- Mw polydispersity
- Chondroitin sulfate HA extended with HA chains using pmHAS was analyzed and shown in FIG.
- FIG. 34 a 0.7% agarose gel detected with Stains-all compares the monodisperse, 'select HA' to commercially produced HA samples is shown.
- lanes 1-3 the mixture of various monodisperse HAs made by the present invention (separate reaction products that were recombined to run all in one lane; sizes from top to bottom of lane: 1.27 MDa, 946 kDa, 575 kDa, 284 kDa, 27 kDa) run as discrete, tight bands.
- the commercially produced HA samples run as polydisperse smears (lane 4, 1.1 MDa; 5, 810 kDa; 6, 587 kDa; 7, 350 kDa).
- the monodisperse HA bands look almost as narrow as the single-molecule species of DNA present in lane 8 (BIOLINE standard).
- Biomaterials and Methods of Making Same are also play a pivotal role in the field of tissue engineering.
- Biomimetic synthetic polymers have been created to elicit specific cellular functions and to direct cell-cell interactions both in implants that are initially cell-free, which may serve as matrices to conduct tissue regeneration, and in implants to support cell transplantation.
- Biomimetic approaches have been based on polymers endowed with bioadhesive receptor- binding peptides and mono- and oligosaccharides. These materials have been patterned in two- and three-dimensions to generate model multicellular tissue architectures, and this approach may be useful in future efforts to generate complex organizations of multiple cell types.
- Natural polymers have also played an important role in these efforts, and recombinant polymers that combine the beneficial aspects of natural polymers with many of the desirable features of synthetic polymers have been designed and produced.
- Biomaterials have been employed to conduct and accelerate otherwise naturally occurring phenomena, such as tissue regeneration in wound healing in the otherwise healthy subject; to induce cellular responses that might not be normally present, such as healing in a diseased subject or the generation of a new vascular bed to receive a subsequent cell transplant; and to block natural phenomena, such as the immune rejection of cell transplants from other species or the transmission of growth factor signals that stimulate scar formation.
- bioadhesive drug delivery systems were based on so-called mucoadhesive polymers, i.e. natural or synthetic macromolecules, often already well accepted and used as pharmaceutical excipients for other purposes, which show the remarkable ability to 'stick' to humid or wet mucosal tissue surfaces. While these novel dosage forms were mainly expected to allow for a possible prolongation, better localization or intensified contact to mucosal tissue surfaces, it had to be realized that these goals were often not so easily accomplished, at least not by means of such relatively straightforward technology.
- bioadhesive controlled drug delivery is to localize a delivery device within the body to enhance the drug absorption process in a site-specific manner. Bioadhesion is affected by the synergistic action of the biological environment, the properties of the polymeric controlled release device, and the presence of the drug itself. The delivery site and the device design are dictated by the drug's molecular structure and its pharmacological behavior.
- One such bioadhesive known in the art is a fibrin "glue" and compositions which include one or more types of fibrin glue in combination with a medicament have been studied.
- a fibrin glue for example, in order to test the effect on the handling properties of a two component fibrin glue, the viscosity of the fibrin glue was increased with sodium hyaluronate and the glue was applied to a microvascular anastomosis in rats. The femoral artery of each rat was anastomosed with three conventional sutures and then sealed with the fibrin glue.
- the typical properties ofthe bioadhesive fibrin system described above ensue from its physiological properties. Filling the wound enhances natural biological processes of healing. The tissue reaction to the applied tissue fibrin coagulum is favorable. The treated parenchymatous organs, liver and spleen, heal with a smooth scar. The number of adhesions in the peritoneal cavity in all known treated experimental animals after treatment of the spleen was similar. Fewer adhesions are also observed when using a bioadhesive for repairing liver injuries in rabbits. The macroscopic appearance of the scar was similar, the scar was less visible in the liver parenchyma. The histological appearance was similar.
- the bioadhesive did not damage the tissue surrounding the parenchyma and did not act as a foreign body. These results confirm the biocompatibility of the fibrin glue as well as tissue tolerance and satisfactory healing without a reaction to the bioadhesive. After healing the bioadhesive is typically replaced by natural fibrous tissue.
- one embodiment of the present invention is the use of sutures or bandages with HA-chains grafted on the surface or throughout the material in combination with the fibrinogen glue.
- the immobilized HA does not diffuse away as in current formulations, but rather remains at the wound site to enhance and stimulate healing.
- Bioadhesive lattices of water-swollen poly(acrylic acid) nano-and microparticles have been synthesized using an inverse (W/O) emulsion polymerization method. They are stabilized by a co-emulsifier system consisting of SpanTM 80 and TweenTM 80 dispersed in aliphatic hydrocarbons.
- the initial polymerization medium contains emulsion droplets and inverse micelles which solubilize a part ofthe monomer solution.
- the polymerization is then initiated by free radicals, and particle dispersions with a narrow size distribution are obtained. The particle size is dependent on the type of radical initiator used.
- microparticles are obtained in the size range of 1 to 10 micrometer, indicating that these microparticles originate from the emulsion droplets since the droplet sizes of the W/O emulsion show similar distribution.
- lipophilic radical initiators such as azobis-isobutyronitrile
- nanoparticles are generated with diameters in the range of 80 to 150 nm, due to the limited solubility of oligomeric poly(acrylic acid) chains in the lipophilic continuous phase.
- HA or chondroitin chains would be the natural substitute for poly(acrylic-acid) based materials.
- HA is a negatively-charged polymer as is poly(acrylic-acid), but HA is a naturally occurring molecule in the vertebrate body and would not invoke an immune response like a poly(acrylic-acid) material.
- mucoadhesive polymers poly(acrylic acid)
- mucoadhesive polymers may therefore be considered as a novel class of multifunctional macromolecules with a number of desirable properties for their use as biologically active drug delivery adjuvants.
- HA or other glycosaminoglycan polysaccharides are used. As HA is known to interact with numerous proteins (i.e.
- RHAMM, CD44 found throughout the healthy and diseased body, then naturally occurring adhesive interactions can be utilized to effect targeting, stabilization, or other pharmacological parameters.
- chondroitin interacts with a different subset of proteins (i.e. platelet factor 4, thrombin); it is likely that this polymer will yield properties distinct from HA and widen the horizon of this technology.
- bioadhesion probably may be better achieved using specific bioadhesive molecules. Ideally, these bind to surface structures ofthe epithelial cells themselves rather than to mucus by receptor-ligand-iike interactions. Such compounds possibly can be found in the future among plant lectins, novel synthetic polymers, and bacterial or viral adhesion/invasion factors. Apart from the plain fixation of drug carriers within the GI lumen, direct bioadhesive contact to the apical cell membrane possibly can be used to induce active transport processes by membrane-derived vesicles (endo- and transcytosis).
- Bioadhesive systems are presently playing a major role in the medical and biological fields because of their ability to maintain a dosage form at a precise body-site for a prolonged period of time over which the active principle is progressively released. Additional uses for bioadhesives include: bioadhesives/mucoadhesives in drug delivery to the gastrointestinal tract; nanoparticles as a gastroadhesive drug delivery system; mucoadhesive buccal patches for peptide delivery; bioadhesive dosage forms for buccal/gingival administration; semisoiid dosage forms as buccal bioadhesives; bioadhesive dosage forms for nasal administration; ocular bioadhesive delivery systems; nanoparticles as bioadhesive ocular drug delivery systems; and bioadhesive dosage forms for vaginal and intrauterine applications.
- the bioadhesive may also contain liposomes.
- Liposomes are unilamellar or multilamellar lipid vesicles which entrap a significant fraction of aqueous solution.
- the vesicular microreservoirs of liposomes can contain a variety of water-soluble materials, which are thus suspended within the emulsion.
- the preparation of liposomes and the variety of uses of liposomes in biological systems has been disclosed in U.S. Patent Nos. 4,708,861, 4,224,179, and 4,235,871.
- Liposomes are generally formed by mixing long chain carboxylic acids, amines, and cholesterol, as well as phospholipids, in aqueous buffers. The organic components spontaneously form multilamellar. bilayer structures called liposomes. Depending on their composition and storage conditions, liposomes exhibit varying stabilities. Liposomes serve as models of cell membranes and also are used as drug delivery systems.
- liposomes are used as drug delivery vehicles.
- liposomes as entities which circulate in blood, to be taken up by certain cells or tissues in which their degradation would slowly release their internal aqueous drug-containing contents.
- some liposomes have been Atailored® by binding specific antibodies or antigens to the outer surface.
- Liposomes have also been devised as controlled release systems for the delivery of their contents in vivo.
- Compositions in which liposomes containing biologically active agents are maintained and immobilized in polymer matrices, such as methylcellulose, collagen and agarose, for sustained release of he liposome contents, are described in U.S. Patent No. 4,708,861 toffy et al.
- the present invention contemplates a bioadhesive comprising HA or chondroitin or heparin produced from pmHAS, pmCS, pmHSl, or PmHS2.
- the present invention also contemplates a composition containing a bioadhesive comprising HA or chondroitin or heparin produced from pmHAS, pmCS, pmHSl, or PmHS2 and an effective amount of a medicament, wherein the medicament can be entrapped or grafted directly within the HA or chondroitin or heparin bioadhesive or be suspended within a liposome which is entrapped or grafted within the HA or chondroitin or heparin bioadhesive.
- compositions are especially suited to the controlled release of medicaments.
- Such compositions are useful on the tissues, skin, and mucus membranes (mucosa) of an animal body, such as that of a human, to which the compositions adhere.
- the compositions so adhered to the mucosa, skin, or other tissue slowly release the treating agent to the contacted body area for relatively long periods of time, and cause the treating agent to be sorbed (absorbed or adsorbed) at least at the vicinity of the contacted body area.
- Such time periods are longer than the time of release for a similar composition that does not include the HA bioadhesive.
- the treating agents useful herein are selected generally from the classes of medicinal agents and cosmetic agents. Substantially any agent of these two classes of materials that is a solid at ambient temperatures may be used in a composition or method of the present invention. Treating agents that are liquid at ambient temperatures, e.g. nitroglycerine, can be used in a composition of this invention, but are not preferred because of the difficulties presented in their formulation.
- the treating agent may be used singly or as a mixture of two or more such agents.
- One or more adjuvants may also be included with a treating agent, and when so used, an adjuvant is included in the meaning of the phrase "treating agent” or "medicament.”
- exemplary of useful adjuvants are chelating agents such as EDTA that bind calcium ions and assist in passage of medicinal agents through the mucosa and into the blood stream.
- chelating agents such as EDTA that bind calcium ions and assist in passage of medicinal agents through the mucosa and into the blood stream.
- Another illustrative group of adjuvants are the quaternary nitrogen- containing compounds such as benzalkonium chloride that also assist medicinal agents in passing through the mucosa and into the blood stream.
- the treating agent is present in the compositions of this invention in an amount that is sufficient to prevent, cure and/or treat a condition for a desired period of time for which the composition of this invention is to be administered, and such an amount is referred herein as "an effective amount.”
- an effective amount As is well known, particularly in the medicinal arts, effective amounts of medicinal agents vary with the particular agent involved, the condition being treated and the rate at which the composition containing the medicinal agent is eliminated from the body, as well as varying with the animal in which it is being used, and the body weight of that animal. Consequently, effective amounts of treating agents may not be defined for each agent.
- an effective amount is that amount which in a composition of this invention provides a sufficient amount of the treating agent to provide the requisite activity of treating agent in or on the body of the treated animal for the desired period of time, and is typically less than that amount usually used.
- amounts of particular treating agents in the blood stream that are suitable for treating particular conditions are generally known, as are suitable amounts of treating agents used in cosmetics, it is a relatively easy laboratory task to formulate a series of controlled release compositions of this invention containing a range of such treating agent for a particular composition of this invention.
- the second principle ingredient of this embodiment of the present invention is a bioadhesive comprising an amount of hyaluronic acid (HA) from pmHAS or chondroitin from PmCS or heparin from pmHSl or PmHS2.
- HA hyaluronic acid
- Woodfield et al. describe that articular cartilage lesions resulting from trauma or degenerative diseases are commonly encountered clinical problems.
- Cultured epidermal autografts can provide permanent coverage of large area from a skin biopsy. However, 3 weeks are needed for graft cultivation. Cultured epidermal allografts are available immediately and no biopsy is necessary. They can be cryopreserved and banked, but are not currently commercially available.
- a nonliving allogeneic acellular dermal matrix with intact basement membrane complex (Alloderm) is immunologically inert. It prepares the wound bed for grafting allowing improved cultured allograft 'take' and provides an intact basement membrane.
- a nonliving extracellular matrix of collagen and chondroitin-6-sulfate with silicone backing serves to generate neodermis.
- a collagen and glycosaminoglycan dermal matrix inoculated with autologous fibroblasts and keratinocytes has been investigated but is not commercially available. It requires 3 to 4 weeks for cultivation. Dermagraft consists of living allogeneic dermal fibroblasts grown on degradable scaffold. It has good resistance to tearing. An extracellular matrix generated by allogeneic human dermal fibroblasts (TransCyte) serves as a matrix for neodermis generation.
- Apligraf is a living allogeneic bilayered construct containing keratinocytes, fibroblasts and bovine type I collagen. It can be used on an outpatient basis and avoids the need for a donor site wound.
- Another living skin equivalent, composite cultured skin consists of allogeneic fibroblasts and keratinocytes seeded on opposite sides of bilayered matrix of bovine collagen.
- OrCel composite cultured skin
- porcine small intestinal submucosa acellular collagen matrix (Oasis)
- E-Z-Derm acellular xenogeneic collagen matrix
- Both products have a long shelf life.
- Other novel skin substitutes are being investigated. The potential risks and benefits of using tissue-engineered skin need to be further evaluated in clinical trials but it is obvious that they offer a new option for the treatment of wounds.
- the various glycosaminoglycans produced by the methods of the present invention, especially the hybrid or chimeric polymers, are promising components for tissue engineered organs including skin.
- HSPGs heparan sulfate proteoglycans
- ECM extracellular matrix
- the basic HSPG structure consists of a protein core to which several linear heparan sulfate (HS) chains are covalently attached.
- the polysaccharide chains are typically composed of repeating hexuronic and D-glucosamine disaccharide units that are substituted to a varying extent with N- and O-linked sulfate moieties and N-linked acetyl groups.
- HS is involved in basic FGF (bFGF) receptor binding and mitogenic activity and its modulation by species of heparin, HS, and synthetic polyanionic 'heparin-mimicking' compounds.
- bFGF basic FGF
- the results are discussed in relation to the current thoughts on the dual involvement of low and high affinity receptor sites in the growth promoting and angiogenic activities of bFGF and other heparin-binding growth factors.
- the mimetics based on the various glycosaminoglycans produced by the methods of the present invention, including the hybrid or chimeric polymers, are promising due to their inherent abilities to interact, trigger, or bind a variety of molecules including cytokines, receptors, and growth factors. These GAG molecules should thus serve as modulators of cell behavior and/or growth via numerous natural pathways in mammals and humans.
- Iivanainen et al. (2003) disclose that dynamic interactions between endothelial cells and components of their surrounding extracellular matrix are necessary for the invasion, migration, and survival of endothelial cells during angiogenesis. These interactions are mediated by matrix receptors that initiate intracellular signaling cascades in response to binding to specific extracellular matrix molecules. The interactions between endothelial cells and their environment are also modulated by enzymes that degrade different matrix components and thus enable endothelial invasion.
- glypicans are a family of heparan sulfate proteoglycans that are bound to the cell surface by a glycosyl-phosphatidylinositol anchor. Six members of this family have been identified in mammals.
- glypicans are highly expressed during development, and their expression pattern suggests that they are involved in morphogenesis.
- One member of this family, glypican-3 is mutated in the Simpson-Golabi-Behmel syndrome. This syndrome is characterized by overgrowth and various developmental abnormalities that indicate that glypican-3 inhibits proliferation and cell survival in the embryo. It has consequently been proposed that glypicans can regulate the activity of several growth factors that play a critical role in morphogenesis.
- the various glycosaminoglycans produced by the methods of the present invention, especially the hybrid or chimeric polymers, are promising materials for incorporation, either directly or indirectly, onto cell surfaces.
- the polymers may be attached to cell surfaces or devices via acceptor moiety (for example, but not by way of limitation, a lipid conjugate).
- Membrane preparations containing recombinant pmHAS (GenBank AF036004) (SEQ. ID NOS: 1 and 2) were isolated from E. coli SURE(pPmHAS). Membrane preparations containing native pmHAS were obtained from the P. multocida strain P-1059 (ATCC #15742). pmHAS was assayed in 50 mM Tris, pH 7.2, 20 mM MnCl 2 ,and UDP-sugars (UDP- [ 14 C]GlcUA, 0.3 ⁇ Ci/mmol, NEN and UDP-GlcNAc) at 30°C. The reaction products were analyzed by various chromatographic methods as described below. Membrane preparations containing other recombinant HAS enzymes, Group A streptococcal HasA or Xenopus DG42 produced in the yeast Saccharomyces cerevisiae, were prepared.
- Uronic acid was quantitated bythe carbazole method.
- the latter enzyme employs an elimination mechanism to cleave the chain resulting in an unsaturated GlcUA residue at the nonreducing terminus of each fragment.
- coli K5 capsular polysaccharide is ⁇ 4GlcUA- ⁇ 4GlcNAc; this carbohydrate has the same composition as HA but the glycosidic linkages between the monosaccharides are different.
- the chitin-derived oligosaccharides, chitotetraose and chitopentaose are ⁇ 4GlcNAc polymers made of 4 or 5 monosaccharides, respectively.
- oligosaccharides were radiolabeled by reduction with 4 to 6 equivalents of sodium borotritide (20 mM, NEN; 0.2 ⁇ Ci/mmol) in 15 mM NaOH at 30°C for 2 hrs. 3 H-oligosaccharides were desalted on a P-2 column in 0.2 M ammonium formate to remove unincorporated tritium and lyophilized. Some labeled oligosaccharides were further purified preparatively by paper chromatography with Whatman 1 developed in pyridine/ethyl acetate/acetic acid/H 2 0 (5:5:1:3) before use as an acceptor.
- multocida P-1059 (ATCC 15742) were made as described.
- membrane preparations were suspended in RIPA buffer (1% NP-40, 1% sodium deoxycholate and 0.1% SDS in 50 mM Tris, pH 7.2) for 20 minutes at room temperature. After centrifugation at 20,000 x g for 10 minutes, the supernatants were saved and the pellets were resuspended in RIPA buffer. The supernatants and the pellets were analyzed by SDS-polyacrylamide gel electrophoresis and Western blot analysis as described later.
- the specific antipeptide IgG was purified from ammonium sulfate fractionated sera (after third boost) using an immobilized peptide column (internal cysteine coupled to Iodoacetyl beads; Pierce).
- the desired IgG was eluted with 0.1 M glycine, pH 2.5, neutralized, and exchanged into phosphate-buffered saline.
- Immunoreactive bands on Western blots were detected with a protein A-alkaline phosphatase conjugate and were visualized with 5-bromo-4-chloro-3- indolyl phosphate and nitroblue tetrazolium reagent.
- HA polymers were analyzed by chromatography on a Phenomenex PolySep-GFC-P 3000, P 4000 or P5000 column (300x7.8 mm) eluted with 0.2 M sodium nitrate at 0.6 ml/min on a Waters 600E system.
- the column was standardized with various size fluorescent dextrans (580, 50, and 12 kDa). Radioactive components were detected with a LB508 Radioflow Detector (EG & G Berthold) and Zinsser cocktail (1.8 ml/min).
- these 3 minute reactions contained twice the UDP-sugar concentrations, 0.06 ⁇ Ci UDP-[ 14 C]GlcUA, and 0.25 ⁇ g even-numbered HA oligosaccharide. Also, addition of ethylenediamine tetracetic acid (final cone. 22 mM) and boiling (2 min) was employed to terminate the reactions instead of addition of SDS.
- a lambda library of Sau3A partially digested Type F P. multocida P-4679 DNA was made using the BamHI-cleaved "Zap Express" vector system (Stratagene).
- the plaque lifts were screened by hybridization (5x SSC, 50°C; 16 hrs) with the digoxigenin-labeled probe using the manufacturer guidelines for eolorimetric development.
- E. coli XLI-Blue MRP was co-infected with the purified, individual positive lambda clones and ExAssist helper phage to yield phagemids.
- the resulting phagemids were transfected into E. coli XLOLR cells to recover the plasmids. Sequence analysis of the plasmids revealed a novel open reading frame, which we called pmCS, with high homology to pmHAS.
- pmCS ORF a portion of the pmCS ORF (residues 1-704) in the insert of one of the excised lambda clones, pPmF4A, was amplified by 20 cycles of PCR with Taq polymerase.
- the sense primer corresponded to the sequence at the deduced amino terminus of the ORF and the antisense primer encoded the new carboxyl terminus followed by an artificial stop codon.
- the resulting PCR product was purified and concentrated using GeneClean.
- This insert was cloned using the pETBIue-1 Acceptor system (Novagen) according to the manufacturer's instructions.
- the Taq-generated single A overhang is used to facilitate the cloning of the open reading frame downstream of the T7 promoter and the ribosome binding site of the vector.
- the ligated products were transformed into E. coli NovaBlue and plated on LB carbenicillin (50 ⁇ g/ml) under conditions for blue/white screening. White or light blue colonies were analyzed by restriction digestion.
- a clone containing a plasmid with the desired truncated ORF, pPm-CS 1"704 was transformed into E.
- Truncated polypeptides were generated by amplifying the pPm7A insert by 13 cycles of PCR with Taq polymerase (Fisher) and synthetic oligonucleotide primers corresponding to various portions of the pmHAS open reading frame. Except for the construction of pmHAS 1"686 and pmHAS 1"668 , the primers contained EcoRI and Pstl restriction sites to facilitate cloning into the expression plasmid pKK223-3 (tac promoter; Pharmacia). The resulting recombinant constructs were transformed into E. coli TOP IOP cells (Invitrogen) and maintained on Luria-Bertani media with ampicillin selection.
- pmHAS 1"686 and pmHAS 1"668 were cloned into pETBIue-1 plasmid and expressed in Tuner (DE3)pLacI cells (Novagen) according to manufacturing instructions; these cells were maintained on Luria-Bertani media with carbenicillin and chloramphenicol selection.
- Point mutations were made using the QuickChange site-directed mutagenesis method (Stratagene) with the plasmid pKK223/pmHAS 1"703 DNA as template. The sequences of the mutant open reading frames were verified by automated DNA sequencing (Oklahoma State University Recombinant DNA/Protein Resource Facility).
- E. coli were grown in Luria-Bertani media with drug selection until OD 600 was 0.3-0.6 when cells were induced with 0.5 mM isopropyl-1-thio- ⁇ -D- galactoside. Cells were harvested 5 hours after induction.
- E. coli TOP10F' cell cells were extracted with B- PerTM II Bacterial Protein Extraction Reagent (an octylthioglucoside-based solution; Pierce) according to the manufacturer's instruction except that the procedure was performed at 7°C in the presence of protease inhibitors.
- Tuner(DE3)pLacI lysis by ultrasonication followed by subcellular fractionation was performed and the supernatant after centrifugation at 100,000 x g was used.
- chondroitin synthase assay the same conditions as the HA synthase assay were used except that the other hexosamine precursor, UDP-GalNAc, was employed and there is no ammonium sulfate or ethylene glycol in the assay system.
- GalNAc-transferase activity was assayed under the same conditions as the GlcNAc-transferase assay except that 0.3 mM UDP-[ 3 H]GalNAc (0.2 ⁇ Ci; NEN) was used instead of UDP-[ 3 H]GlcNAc. Reactions were terminated by the addition of SDS to 2% (w/v).
- reaction products were separated from substrates by descending paper (Whatman 3M) chromatography with ethanol/1 M ammonium acetate, pH 5.5, development solvent (65:35 for the HAS, chondroitin synthase, and GlcUA-transferase assays; 75:25 for GlcNAc- transferase and GalNAc-transferase assay). All assays were adjusted to be linear with regard to incubation time and to protein concentration. Radiolabeled products were quantitated by liquid scintillation counting (Biosafe II, Research Products International).
- pmHAS polypeptides in membranes and extracts were analyzed using standard 8% polyacrylamide SDS gels and Western blotting utilizing a monospecific antibody directed against a synthetic peptide corresponding to residues 526 to 543 of pmHAS (acetyl-LDSDDYLEPDAVELCLKE-amide) as described hereinabove.
- the DNA encoding different segments of pmHAS-D or pmCS were generated by amplifying the pPm7A insert or pPmF4A insert, respectively, by 15 cycles of PCR with Taq polymerase (Fisher) and synthetic oligonucleotide primers corresponding to various portions of the pmHAS-D or pmCS open reading frame. Each internal primer contained overlaps with the other segment to allow joining ofthe two desired segments.
- the forward and reverse primers for pmCS residue 1-420 (D segment) were PI and P2.
- the chimeric or hybrid synthases were created by 15 cycles of PCR with the gel-purified (GeneClean; BiolOl) segments and outer primers (pm-AC used A and C segments with primer PI and P4; pm-BD used B and D segments with primer PI and P5).
- the purified PCR products were cloned into pETBIue-1 vector and the chimeric or hybrid proteins were expressed in Tuner(DE3)pLacI cells (Novagen).
- the ⁇ 0.3-kb amplicon was generated using Taq DNA polymerase (Fisher), gel-purified, and labeled with digoxigenin (High Prime system, Boehringer Mannheim).
- a lambda library of Sau3A partially digested Type D P. multocida P- 3881 DNA was made using the BsmHI-cleaved ⁇ Zap ExpressTM vector system (Stratagene). The plaque lifts were screened by hybridization (5x SSC, 50°C; 16 hrs) with the digoxigenin-labeled probe using the manufacturer guidelines for colorimetric development. E. coli XLI-Blue MRP was co-infected with the purified, individual positive lambda clones and ExAssist helper phage to yield phagemids. The resulting phagemids were transfected into E.
- ORF (617 amino acids) was amplified from the various Type D genomic DNA template by 18 cycles of PCR with Taq polymerase.
- the sense primer (ATGAGCTTATTTAAACGTGCTACTGAGC - SEQ ID NO: 58) corresponded to the sequence at the deduced amino terminus of the ORF and the antisense primer (TTTACTCGTTATAAAAAGATAAACACGGAATAAG - SEQ ID NO: 59) encoded the carboxyl terminus including the stop codon.
- a truncated version of pmHSl was produced by PCR with the same sense primer but a different antisense primer (TATATTTACAGCAGTATCATTTTCTAAAGG - SEQ ID NO:60) to yield a predicted 501-residue protein, DcbF (SEQ ID NO:61) (GenBank Accession Number AAK17905); this variant corresponds to residues 1- 497 of pmHSl followed by the residues TFRK.
- DcbF SEQ ID NO:61
- the HA4 molecule was converted into a fluorescent derivative in two steps.
- the fractions containing the synthase protein were concentrated by ultrafiltration and exchanged into reaction buffer (1 M ethylene glycol, 50 mM Tris, pH 7.2).
- the syntheses in general contained synthase, UDP-GlcNAc, UDP-GlcUA, and 5mM MnCI2 in reaction buffer. Reactions are incubated at 30°C for 6 to 48 hrs.
- HA in vitro synthesized HA.
- HA are analyzed on agarose gels as described in Lee and Cowman. In brief, agarose gels (0.7-1.2%) in lx TAE buffer were run at 40V. Gels are stained with Stains-All dye (0.005% w/v in ethanol) overnight and destained with water.
- HA was analyzed on acrylamide gels (15-20%) as described in Ikegami-Kawai and Takahashi. To purify HA, pmHAS was removed by choloroform extraction and HA are precipitated with three volumes of ethanol and the pellets were redisolved in water. Alternatively, the unincorporated precursor sugars were removed by ultrafiltration with Microcon units (Millipore). The concentration was determined by carbazole assay (ref) and a glucuronic acid standard.
- DeAngelis, P.L., and CL. White Identification and molecular cloning of a heparosan synthase from Pasteurella multocida type D. J.Biol.Chem. 277(9):7209-13, 2002.
- DeAngelis, P.L. Polysachharide labeling with N-methylisatioic anyhydride: generation of ultraviolet chromophores and blue fluorophores. Anal. Biochem. 284(1): 167-9, 2000.
- KfiA a protein essential for the biosynthesis of the Escherichia coli K5 capsular polysaccharide
- M. Pourhossein E. Gottfridson, T. Lind, K. Lindholt, and LS. Roberts. (2000)
- KfiA a protein essential for the biosynthesis of the Escherichia coli K5 capsular polysaccharide
- the formation of a membrane-associated K5 biosynthetic complex requires KfiA, KfiB, and KfiC. J. Biol. Chem., 275, 27311-27315.
- the DXD motif is required for GM2 synthase activity but is not critical for nucleotide binding. Glycobiology, 11, 217-229.
- Roberts, LS. (1996) The biochemistry and genetics of capsular polysaccharide production in bacteria. Annu. Rev. Microbiol. 50, 285-315. Roberts, I.S., R. Mountford, R. Hodge, K.B. Jann, and G. Boulnois. (1988) J. Bacteriol. 170, 1305-1310.
- HASs active streptococcal hyaluronan synthases
Abstract
Description
Claims
Applications Claiming Priority (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US40435602P | 2002-08-16 | 2002-08-16 | |
US404356P | 2002-08-16 | ||
US47943203P | 2003-06-18 | 2003-06-18 | |
US479432P | 2003-06-18 | ||
PCT/US2003/025750 WO2004032830A2 (en) | 2002-08-16 | 2003-08-14 | Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using same |
Publications (1)
Publication Number | Publication Date |
---|---|
EP1575622A2 true EP1575622A2 (en) | 2005-09-21 |
Family
ID=32096021
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP03808063A Withdrawn EP1575622A2 (en) | 2002-08-16 | 2003-08-14 | Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using same |
Country Status (2)
Country | Link |
---|---|
EP (1) | EP1575622A2 (en) |
CA (1) | CA2536016C (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113785052A (en) * | 2019-02-19 | 2021-12-10 | 维也纳兽医大学 | Novel recombinant diamine oxidase and its use for treating diseases characterized by excessive histamine |
-
2003
- 2003-08-14 EP EP03808063A patent/EP1575622A2/en not_active Withdrawn
- 2003-08-14 CA CA2536016A patent/CA2536016C/en not_active Expired - Fee Related
Non-Patent Citations (1)
Title |
---|
See references of WO2004032830A2 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113785052A (en) * | 2019-02-19 | 2021-12-10 | 维也纳兽医大学 | Novel recombinant diamine oxidase and its use for treating diseases characterized by excessive histamine |
Also Published As
Publication number | Publication date |
---|---|
CA2536016C (en) | 2017-01-10 |
CA2536016A1 (en) | 2004-04-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US7579173B2 (en) | Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using the same | |
US8088604B2 (en) | Production of defined monodisperse heparosan polymers and unnatural polymers with polysaccharide synthases | |
US7741091B2 (en) | Methods of producing hyaluronic acid and chimeric and hybrid glycosaminoglycan polymers | |
US7575904B2 (en) | Polymer grafting by polysaccharide synthases | |
US7534589B2 (en) | Polymer grafting by polysaccharide synthases | |
US20080125393A1 (en) | Methods of selectively treating diseases with specific glycosaminoglycan polymers | |
US20080108110A1 (en) | Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using same | |
WO2003029261A9 (en) | Glycosaminoglycan polymers and methods of making and using same | |
AU2013237670B2 (en) | Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using same | |
WO2004032830A2 (en) | Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using same | |
EP2690178B1 (en) | Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using same | |
CA2536016C (en) | Targeted glycosaminoglycan polymers by polymer grafting and methods of making and using same | |
US20160053290A1 (en) | Production of Defined Monodisperse Heparosan Polymers and Unnatural Polymers with Polysaccharide Synthases | |
US7060469B2 (en) | Polymer grafting by polysaccharide synthases | |
Class et al. | Patent application title: Production of Defined Monodisperse Heparosan Polymers and Unnatural Polymers with Polysaccharide Synthases Inventors: Paul L. Deangelis (Edmond, OK, US) Paul L. Deangelis (Edmond, OK, US) Alison Sismey-Ragatz (Cassville, WI, US) | |
AU1613900A (en) | Polymer grafting by polysaccharide synthases |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20050316 |
|
AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR |
|
AX | Request for extension of the european patent |
Extension state: AL LT LV MK |
|
DAX | Request for extension of the european patent (deleted) | ||
PUAK | Availability of information related to the publication of the international search report |
Free format text: ORIGINAL CODE: 0009015 |
|
17Q | First examination report despatched |
Effective date: 20081029 |
|
RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: THE BOARD OF REGENTS OF THE UNIVERSITY OF OKLAHOMA |
|
RIC1 | Information provided on ipc code assigned before grant |
Ipc: C12P 19/26 20060101AFI20161114BHEP Ipc: C08B 37/08 20060101ALI20161114BHEP |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20180301 |
|
RIC1 | Information provided on ipc code assigned before grant |
Ipc: C08B 37/08 20060101ALI20161114BHEP Ipc: C12P 19/26 20060101AFI20161114BHEP |