EP1549765A1 - Method to analyze polymeric nucleic acid sequence variations - Google Patents

Abstract

String Analysis of (complete) Variant Exons, SAVE, provides methods to assess exon-intron boundaries, transcription start points and polyadenylation sites as utilized by a given cell, tissue or organism at a given time or situation (physiological or pathological). SAVE provides methods to link together RNA fragments resulting from RNAse digestion. By using RNA linkers, SAVE also provides methods to generate strings of RNA fragments, to amplify them, to clone them, to sequence them and to purify them for further use.

Description

METHOD TO ANALYZE POLYMERIC NUCLEIC ACID SEQUENCE VARIATIONS

Field of the Invention

The invention relates to a method to analyze polymeric nucleic acid sequence variations, particularly, exon-intron boundaries with a genome-wide range in any organism that utilizes RNA splicing mechanisms. The invention further relates to methods for identifying nucleic acid sequences comprising qualitative differences between RNAs derived from two distinct conditions being compared. The nucleic acid sequences so identified, are useful as, and for the development of, screening tools for identifying molecules of therapeutic interest. The invention can be used or applied in biotechnology and medicine.

Background of the Invention

Many cases of gene regulation through pre-mRNA splicing are classed as alternative splicing (AS). AS is an important mechanism for modulating gene function. It can change how a gene acts in different tissues and developmental states by generating distinct messenger RNA (mRNA) isoforms composed of different selections of exons. Thus, through the selection of a subset of exons, AS causes variations in the expressed protein. Alternative splicing has been implicated in many processes, including sex determination, apoptosis, and acoustic tuning in the ear. Its functional implications can be simple, generating a single alternative form, or can produce remarkable diversity. In the Drosophila gene Dscam, combinatorial alternative splicing of 'cassettes' of exons produces thousands of distinct functional isoforms. This gene, homologous to the human gene for Down's syndrome cell adhesion molecule (DSCAM), appears to be involved in neuronal guidance, where such diversity could be useful as a molecular 'address' (for a recent review on the subject Of alternative splicing, see Smith & Valcάrcel). A variety of approaches have been used to study exon variation. They range from analysis of genome databases using prediction algorithms (Brett et al), to microarray analysis using probes containing gene specific exon-intron boundaries (dubbed boundary probes) (Yeakley et al), or PCR based techniques that use boundary primers. The power of these methods however is notably limited by the self-imposed bias of the studies (only currently known or algorithm-predicted exon-intron boundaries are used in these studies). Additionally, these experimental approaches restrict their scope to expression levels of predetermined exon-intron boundaries. These boundaries are thought to be highly conserved, although in many cases, degenerate boundary sequences can be used. More experimental approaches are thus needed to be able to analyze those cases. Moreover, since exon-intron boundaries can be alternatively used, more systematic approaches are needed to provide sequence definition of real experimental boundaries in physiological or pathological conditions (i.e. in normal versus cancer tissues).

Until recently, few techniques were available to look at differences in global gene expression. Mass approaches such as sequencing very large numbers of independent cDNA libraries were possible but are very expensive. A recently introduced technology, serial analysis of gene expression (SAGE) [US 5,695,937, US 6,383, 743] . has in part overcome this, by generating 15 bp fragments of DNA through a specific restriction enzyme strategy. These fragments are ligated together and sequenced as a string. The frequencies of these fragments in the chimeric sequences narrowly represent an estimate of the frequencies of mRNAs in the population (Velculescu et al). On a similar theme, Gene Calling evaluates restriction patterns of cDNA samples with multiple restriction enzymes such that- each cDNA sample produces a characteristic profile. The identification and quantitation of the peaks for each cDNA molecule indicate the level of gene expression (Shimkets et al).

A new approach to analyze alternative exon expression has been recently described. The method, dubbed DATAS technology, is based on substractive principles. It takes advantage of the ability of the enzyme ribonuclease H to release single stranded RNA (un-hybridized) fragments from mRNA/cDNA hybrids. When the hybrids correspond to two different mRNA sources, those fragments from RNAse H digestion most likely represent alternatively expressed exons. In the DATAS technology, analysis of the differential RNA fragments is completed after synthesis of random primed complementary DNAs. These cDNAs are either sequenced or arrayed and used in a variety of studies that include differential display (Schweighoffer et al) [US 6,251,590].

The DATAS method however has several important drawbacks: 1) This method is inclined to isolate big exonic fragments (bigger than 100 bp) in preference to the smaller ones. Since a great number of exons (around 50% in vertebrates) are smaller than 100 bp, this bias may lead to a huge under-representation of the entire exon population. 2) The method reveals the sequence of variant exons through random priming of RNA fragments; because of that, cDNA individual clones obtained with the DATAS technology, at best, only represent fragmentary information about the 3' exon boundaries. This alone represents a major problem in drawing information from exon libraries. Indeed, often, individual exons entirely code for distinct domains or signatures within the coded protein; thus the difference between knowing the full length exon sequence and knowing only the sequence of a 5' fragment can be dramatic. 3) Typically, cDNA libraries, unless undergoing a major sequencing effort, do not provide reliable expression profile data. In order to draw gene expression information from cDNA libraries, they have to be modified to allow sequencing of a number of genes in a single sequencing event (for general cDNA libraries, this has been accomplished by the SAGE method). 4) The DATAS technology requires a sequencing reaction for each exonic fragment to be analyzed, which, when studying a large number of splicing events, can represent a huge time and money consuming effort.

Here we describe a new method to analyze en masse pools of differentially (or alternatively) expressed exons. We call this method String Analysis of (complete) Variant Exons (SAVE). The approach is based on the isolation of full length RNA exonic fragments of a complete spectrum of different lengths, followed by the ligation in chain of such fragments, and the cloning and sequencing of the resulting libraries. Our approach systematically solves the major problems of current technologies. What follows is a detailed description of the technique, a list of advantages with respect to current methods employed in the study of alternative splicing, as well as an account of examples of possible applications. Summary of the Invention

The present invention comprises a method to investigate the exon-intron boundaries with a genome-wide range in any organism that utilizes RNA splicing mechanisms. SAVE is ideally fitted to the comparative study of two or more sources of RNA that harbour differences in splicing, transcription initiation, poly-adenylation or RNA editing. It represents a clear advantage when compared to currently used methods to study alternative transcripts of the same gene. SAVE affords the isolation, for the first time, of a complete range of exon lengths (specially those having less than 100 bp, for example, between 5 and 50 bp, usually between 10 and 25 bp, typically between 15 and 20 bp). Moreover, it provides a means to isolate full length exons, instead of 5' fragments of different lengths. Because it is based on the string ligation of RNA fragments, SAVE sequences are also indicative of relative abundance of exon expression. The SAVE methods of the invention can be used in methods for analysing or identifying RNA transcripts, alternative exon expression, differential exon expression, differential exon processing, and/or variant exons. Finally, SAVE has additional economic advantages since it provides information of multiple exons in a single sequencing event.

Practically, it starts with the isolation of RNA, for example total RNA or mRNA'from the sources to be compared. These sources can be, among others, blood, tissue culture, tissues or whole organisms. As shown below, a typical comparison can be established between a normal tissue and its diseased counterpart (i.e. normal lung versus lung cancer) or between tissue in different developmental states.

Typical substrates of the SAVE methods are RNA fragments obtained by RNAse digestion after cross-hybridisation between RNAs and cDNAs derived from distinct conditions, e.g. Rnase H digestion derived fragments after RNA-cDNA hybridisation. RNAse digests of RNA/cDNA hybrids from two different sources have been shown to contain differentially spliced RNA. Since RNAse digests contain reactive 5' (phosphate) and 3' (hydroxyl) groups, they are perfect substrates for RNA ligation. Thus a central step in SAVE methods is the chain ligation of pools of RNA fragments from the RNAse, e.g. Rnase H, digestion of RNA/cDNA hybrids. Alternatively, these fragments can be ligated in the presence of a hinge RNA linker that is complementary to the consensus sequence for an endonuclease, such as a low frequency endonuclease (i.e., Not I). The latter version of intercalated chain can be later used for the isolation, purification and sequencing of individual exonic fragments (see below). Either type of chain are later used in a second ligation reaction with 5' and 3' RNA linkers. Addition of a linkers is essential in order to amplify the pool of strings, e.g. by PCR. The amplification reaction product can be sequenced or, prior to sequencing, the amplified exon strings can be cloned into a suitable cloning vector. Individual clones are then sequenced. The sequences are compared with known DNA sequences, e.g. searched against different genetic databases. Typical searches are shown in Figure 9 (Blast™ search of a single sequence) and Figure 10 (Blast™ search of a SAVE string), whereby different segments of a single string of exons display a perfect match to different genes (typical pattern).

As mentioned above, this invention also provides a method for isolating and purifying individual exons from clonal strings. Thus, strings intercalated with restriction hinges (sites) can be digested with the corresponding specific restriction enzyme and the different fragments, each with an individual exon or exons can be isolated, e.g. by agarose electrophoresis and gel purification. Individual fragments can be typically spotted on solid surfaces (i.e. micro-arrays for differential display studies).

Therefore, in an aspect, the invention relates to a method to experimentally analyse boundaries within polymeric deoxy ribonucleic acid (DNA) or ribonucleic acid (RNA) molecules based on a previously mentioned SAVE method.

In another aspect, the invention relates to a method for identifying nucleic acids comprising sequences corresponding to portions of genes that are differentially processed in two biological samples containing nucleic acids, said method being based on the previously defined SAVE method.

A nucleic acid consisting of or comprising a sequence corresponding to a portion of a gene that is differentially processed between two biological samples, consisting of or containing nucleic acid obtained or obtainable according to said method and the applications thereof constitute further aspects of the instant invention.

A peptide encoded by said nucleic acid sequence, applications thereof, antibodies against said peptide and the applications thereof constitute further aspects of the instant invention.

Another aspect of the instant invention relates to a method for identifying nucleic acids or nucleic acid domains distinct to a tumour state based on the previously defined SAVE method.

Another aspect of the instant invention relates to a method of determining or assessing the therapeutic potential of a test compound with respect to a biological sample based on the previously defined SAVE method.

Still another aspect of the instant invention relates to a method of determining or assessing the responsiveness of a patient to a test or treatment based on the previously defined SAVE method.

Further practical applications of the instant invention will become apparent for the skilled person in the art from the description.

Brief Description of the Drawings

Figure 1 depicts the predicted formation of a single stranded RNA loop when a messenger RNA that contains an alternatively spliced exon hybridises with a cDNA missing such an exon. It shows the predicted outcome of adding Rnase H to RNA/cDNA hybrids. Rnase H digestion of RNA/cDNA hybrids harbouring alternate exons leads to the formation of RNA fragments chemically active at both ends.

Figure 2 shows the hinging of RNA strings by intercalating Not I double stranded nucleotide hinges as in the second embodiment of the invention. Not I RNA hinges are ligated to Rnase H digests in order to generate hinged strings. Figure 3 shows the shielding of both hinged or un-hinged RNA strings as in the third embodiment of the invention. Mono-modified linkers (either 3 'OH or 5'P modified RNA linkers) are ligated to the 5' and 3' ends respectively of RNA strings.

Figure 4 depicts a technique to convert shielded RNA strings into their complementary DNA (cDNA). The technique, dubbed RT-SS or RT-PCR, uses DNA primers homologous or complementary to the 3'OH or 5'P modified RNA linkers, respectively.

Figure 5 shows the restriction digestion of the complementary DNA of shielded RNA strings with the appropriate restriction enzyme (for example, EcoRI); these digests are cloned in an equally EcoRI digested suitable vector.

Figure 6 shows the restriction digestion of the cloned complementary DNA of shielded RNA strings with the appropriate hinge restriction enzyme (i.e. Not I).

Figure 7 shows the biotinylation of the complementary DNA of shielded RNA strings. In the example depicted, the Klenow fragment of DNA polymerase is used in the presence of biotinylated dNTPs to fill in restriction nicks.

Figure 8 shows one application of the invention consisting in using biotinylated fragments from Figure 7 to spot an streptavidin conjugated surface.

Figure 9 shows a typical Blast search of sequences from a single gene fragment.

Figure 10 shows a Blast search using an entry sequence from an exon string clone. In the example depicted, the string is composed of three different gene fragments.

Detailed Description of the Invention

1. String Analysis of (complete) Variant Exons (SAVE)

The SAVE method is based on the isolation of full length RNA exonic fragments of a complete spectrum of different lengths, followed by the ligation in chain of such fragments, and the cloning of the resulting libraries. Said method may be applied to the study of differentially processed exons. As used herein, the term "differentially processed exons" refers to RNA fragments that have been subjected to different splicing, transcription initiation, polyadenylation or RNA editing.

Thus, in a first aspect, the invention concerns a method to experimentally analyse boundaries within polymeric deoxy ribonucleic acid (DNA) or ribonucleic acid (RNA) molecules, dubbed String Analysis of (complete) Variant Exons (SAVE).

In a first embodiment, the SAVE method comprises: a) Ligation of RNA fragments with free 5'P and 3'OH groups to form a string, wherein said RNA fragments with free 5'P and 3'OH groups comprise differentially processed exons; b) Ligation of 5' and 3' RNA linkers for subsequent amplification; c) Reverse transcription of the product of reaction (b) ; d) Amplification of the product of reaction (c), preferably by PCR; and optionally, e) Cloning of the product of amplification reaction (d) into a vector.

The SAVE method may further comprise (f) sequencing of the amplification product or, after cloning the amplification products into a vector, preferably a recombinant vector, sequencing of the individual clones, and, optionally, (g) comparing the sequences obtained with known sequences, e.g. in gene databases, in order to identify, characterize and/or map each individual exon included in each sequenced string. Alternatively, after amplification or cloning the amplification reaction products into a recombinant vector, the SAVE method may further comprise (f ) digesting individual exonic strings with an appropriate restriction enzyme that releases individual exons, and, optionally, (g') purifying recombinant exons from (f ).

A simple approach to obtaining RNA fragments having free 5'P and 3'OH groups corresponding to differentially processed exons, useful for forming a string, consists of differential hybridisation followed by RNAse digestion, e.g. by Rnase H digestion. Differential hybridisation between two situations to be compared consists of cross hybridisation, i.e. mixing RNA from . one situation with cDNA from the other one situation to obtain RNA/cDNA hybrids. The different situations may be normal and abnormal samples of a particular tissue e.g. healthy and diseased tissue e.g. normal tissue and tissue derived from tumours of the tissue, or may be samples of a tissue in different developmental states. Hybridisation of complementary species leaves unhybridized single stranded segments of RNA that correspond to differentially processed exons (Figure 1). These asymmetric hybrids (RNA/cDNA hybrids) can be isolated and treated with an enzyme, for example Rnase H, that eliminates all RNA segments that are complementary to the cDNA. This reaction yields free segments of single stranded RNA (ss RNA) that correspond to differentially processed exons. Since products of RNAse digestion, e.g. Rnase H digestion, contain free reactive 5'P and 3'OH ends, we can ligate pools of RNAse digested hybrids with a suitable ligase enzyme, such as the T4 RNA ligase enzyme. T4 RNA ligase welds, i.e. joins, ss RNA fragments through a phosphodiester bond.

The above mentioned ligation reaction constitutes a key step in the SAVE technology. It permits generation of random strings of RNA fragments that are representative of the relative abundance of differential exons. In order to rescue and analyse those fragments, we have developed several strategies.

In a particular embodiment, the ligation of RNA fragments having free 5'P and 3'OH groups to form a string [step (a)] is accomplished with the utilization of molecular hinges that are intercalated between said RNA fragments having free 5'P and 3'OH groups. Typically, an example of a molecular hinge can be represented by a "hinge RNA linker", said hinge RNA linker (i) comprising, or consisting of, a nucleotide sequence which is complementary to the recognition site of a DNA restriction enzyme, preferably, comprising, or consisting of, a nucleotide sequence which is complementary to the recognition site of a low frequency DNA restriction enzyme, and (ii) having free 5'P and 3'OH groups. Virtually any DNA restriction enzyme can be used, preferably a low frequency DNA restriction enzyme; nevertheless, in a particular embodiment, said low frequency DNA restriction enzyme is Not I. Since said hinge RNA linker is not modified in any of its ends 5' and 3' (i.e., it maintains, 5'P and 3'OH ends), said linker is a substrate for a suitable ligase, such as the T4 RNA ligase. The RNA fragments having free 5'P and 3'OH, such as Rnase H digests, can therefore be ligated to said hinge RNA linkers at one or both ends of the RNA fragment. Strings of hinged RNA fragments can be converted into their complementary DNA (cDNA) and eventually digested into the individual fragments by using the appropriate restriction enzyme (e.g., Not I in the example below). One can find many uses to those DNA fragments that are complementary to alternate RNA exons (i.e., differentially processed exons). In an example below we use them to spot solid surfaces such as 96 or 384 microtiter well plates or microarrays to be used in expression profiling and other similar studies.

In another particular embodiment, the ligation of RNA fragments having free 5'P and 3'OH groups to form a string [step (a)] is accomplished in the absence of said hinge RNA linkers.

The strings of RNA (hinged or not) can be submitted to final molecular modifications in order to shield them from further ligations, and/or, to enable the cloning of their cDNAs. In this case, a different class of RNA linkers, hereinafter referred to as "RNA linkers", can be used in conjunction with an appropriate ligase, such as the T4 RNA ligase and pools of RNA strings to create shielded RNA strings. Preferably said RNA linker (i) comprises or consists of, a nucleotide sequence which is complementary to the recognition site of a DNA restriction enzyme, preferably, said RNA linkers comprise or consists of, a nucleotide sequence which is complementary to the recognition site of a low frequency DNA restriction enzyme, thereby enabling the convenient cloning of shielded strings cDNAs into vectors containing the same DNA restriction enzyme site, and (ii) is modified only on one end (i.e., it is either 3'OH or 5'P modified). Virtually any DNA restriction enzyme can be used, preferably a low frequency DNA restriction enzyme; nevertheless, in a particular embodiment, said low frequency DNA restriction enzyme is EcoRI.

Alternatively, RNA fragments having free 5'P and 3'OH groups are ligated by means of the simultaneous use of said hinge RNA linkers and said RNA linkers, in conjunction with an appropriate ligase, in order to obtain a pool of shielded RNA strings.

Shielded RNA strings are converted into their cDNAs by conventional techniques, for example, reverse transcription (RT) in the presence of compatible primers. In a particular embodiment, said primers are oligonucleotides homologous or complementary to the modified 3'OH or 5'P RNA linkers, respectively. cDNAs thus obtained may then be amplified by conventional techniques, e.g. PCR, using the appropriate primers, as illustrated in Figure 4 and in the example included below. Another approach involves a reverse transcription reaction performed upon the shielded RNA strings by using random primers, which will randomly initiate transcription along RNAs. cDNAs thus obtained are then amplified according to conventional molecular biology techniques, for example by PCR using appropriate primers.

Amplification products, e.g. PCR products, can be subsequently cloned into vectors by conventional techniques. Said vectors can be recombinant vectors such as plasmids, cosmids, phages, YAC, HAC, etc. The nucleic acids inserted therein may be stored as such, or introduced into microorganisms compatible with the vector being used, for replication and/or stored in the form of cultures. In a particular embodiment, plasmids with a multicloning site including a unique DNA restriction enzyme site, for example EcoRI, are digested. The cDNA of shielded RNA strings is digested using the same restriction enzyme used to provide insert. Digested vector and insert are subsequently ligated and used to transform a compatible host, for example, a bacteria by conventional methods. . -

In a second embodiment, the SAVE method comprises: a) Ligation of RNA fragments with free 5'P and 3'OH groups, wherein said RNA fragments with free 5'P and 3'OH groups comprise a differentially processed exon or exons, in order to form a string; b) Ligation of RNA fragments as in (a) to hinge RNA linkers intended to intercalate between said RNA fragments; c) Ligation of 5' and 3 ' RNA linkers simultaneously or after the reaction in (a); d) Reverse transcription of the product of reaction (c) using a DNA oligonucleotide primer complementary to the 3 ' RNA linker used in (c); e) Synthesis of a second strand using the product of reaction (d) as a template or, directly; f) Amplification of the product of reaction (e), preferably by PCR; and g) Cloning of the product of reaction (f) into a vector. As in the first embodiment, after cloning the amplification products of reaction (f) into a vector, this second embodiment of the SAVE method may comprise (h) sequencing of the individual clones, and, optionally, (i) comparing the sequences obtained with known sequences e.g. gene databases in order to identify, characterize and/or map each individual exon included in each sequenced string, or alternatively, (h') digesting individual exonic strings with an appropriate restriction enzyme that releases individual exons, and, optionally, (i') purifying recombinant exons from (h').

The different steps of this second embodiment of the SAVE method have been previously discussed in connection with the first embodiment of the SAVE method.

In both embodiments of the SAVE method, clones expressing cDNAs of individual strings may be, if desired, isolated, plasmid purified and used, for examples, as follows:

a) Individual clones can be submitted to a DNA sequencing reaction: sequences obtained with this approach are compared with known sequences e.g. available public gene databases, in order to identify, characterize, and map each individual exon included in each sequenced string; b) Individual clones can be subjected to a restriction digestion using the specific hinge DNA restriction endonuclease (Not I in the example below): this digestion directs the release of individual alternate exonic fragments that can be purified, e.g. by gel purification.

Purified alternate exons can be used as probes in multiple applications. For example, they can be individually spotted, at the adequate concentrations, on solid surfaces such as in 384 and 96 well plate formats as well as microarrays and ultimately used in gene profiling studies. The purified product so obtained constitutes a further aspect of the present invention.

Probes, oligonucleotides or sequence information obtained using the SAVE methods can be applied in the development of in vitro diagnostic nucleic acid-based tests, such as DNA-based tests. These tests can be based on hybridisation techniques (e.g. on plates, microarrays or other surfaces, or in solution), or on DNA polymerisation techniques (generally speaking, PCR or electrophoretic fragment length analysis, as in STR analysis).

Additionally, exonic sequences obtained with the SAVE methods can be analysed for their codon code and thus the amino acid sequence. Alternate exons often code for individual protein domains. A protein domain is a segment of a protein that typically can be separated, synthesized and purified in a functional form. Thus, protein domains encoded in some of the SAVE exons can be, for instance synthesized (either in vitro as in the in vitro synthesis of peptides, or in vivo as in the in vivo expression in a microorganism or a cell of a peptide), purified and used as tools in functional studies, as therapeutic targets, as drugs, or as immunogens to raise specific antibodies against the particular domain encoded by the alternate exon.

The differentially processed exon nucleic acid sequence identified according to the instant invention, may, if desired, be purified. The purified product so obtained constitutes a further aspect of the present invention. Said product, if desired, can be fixed onto a solid surface, such as an array or multi-well plate, for use as a probe for gene expression studies. The peptide encoded by said nucleic acid sequence constitutes a further aspect of the instant invention. Said peptide can be used in generating ligands, for example, peptides and the like, or antibodies against said peptide. The ligands (e.g., peptides) can be obtained by conventional methods, for example, phage display. Antibodies can also be obtained by conventional methods, for example, by immunizing a suitable research animal with said peptides and collecting sera (polyclonal antibodies) or by means of the hybridoma technology (monoclonal antibodies). Said ligands and antibodies constitute further aspects of the present invention. Additionally, said peptide can also be used in a test for therapeutic target discovery and validation. The antibodies so obtained can be used as therapeutics or for in vitro diagnostic tests.

2. Method for identifying nucleic acids comprising sequences corresponding to portions of genes that are differentially processed between two biological samples containing nucleic acids In other aspect, the instant invention concerns methods for identifying differences in gene processing occurring between two distinct conditions, for example, between two distinct physiological or pathological conditions. The methods provided by the instant invention can be used, for example, to identify novel targets or therapeutic products, to devise genetic research and/or diagnostic tools, to construct nucleic acid libraries, and to develop methods for determining the toxicological profile or potency of a compound.

Accordingly, the instant invention provides a method for identifying nucleic acid regions that are differentially processed in two distinct conditions (test and standard conditions) based on the SAVE methods which comprise isolating RNA fragments consisting of or comprising a differentially processed exon or exons derived from the test condition followed by the ligation in chain of such RNA fragments, conversion into cDNAs, optionally cloning said cDNAs and identifying nucleic acids which correspond to differently processed exons between said two distinct conditions. In a particular embodiment, the isolation of said RNA fragments corresponding to differentially processed exons derived from the test condition is carried out by hybridizing RNAs derived from the test condition with cDNAs originating from the standard condition and RNAse digestion.

In this regard, a further 'aspect of the invention concerns " a method for identifying nucleic acids comprising sequences corresponding to portions of genes that are differentially processed between two biological samples containing nucleic acids.

In a first embodiment, the method for identifying nucleic acids comprising sequences corresponding to portions of genes that are differentially processed between two biological samples containing nucleic acids comprises:

a) Hybridization of a plurality of different RNAs derived from a first sample with a plurality of different cDNAs derived from a second sample, to render a plurality of RNA/cDNA hybrids; b) Obtaning, from said RNA/cDNA hybrids of (a), RNA fragments with free 5'P and 3'OH groups, wherein said RNA fragments with free 5'P and 3'OH groups comprise or consist of differentially processed exons; c) Subjecting said fragments with free 5'P and 3'OH groups obtained in (b) to a SAVE method; and d) Identifying nucleic acids comprising sequences corresponding to portions of genes that are differentially processed between said two biological samples containing nucleic acids.

As indicated above, the methods provided by the instant invention are partly based on a step comprising the use of a SAVE method. The substrate for SAVE methods (RNA fragments with free 5'P and 3'OH groups, wherein said RNA fragments with free 5'P and 3 'OH groups are differently processed exons, for example under distinct conditions, such as physiological or pathological conditions) can be obtained by any suitable method. In a particular aspect, said RNA fragments corresponding to a differentially processed exon or exons, for example, derived from the test condition, are obtained by hybridizing RNAs derived from the test condition with cDNAs originating from the standard condition. Said hybridization procedure allows one to demonstrate in a convenient manner unpaired regions, i.e. regions present in RNAs in one condition and not in RNAs from another condition. Such regions essentially correspond to a differentially processed exon or exons, typical of a given condition, and thus form genetic elements or markers of particular use in different fields, such as therapeutics, diagnostics and research.

Thus, the invention provides a method that allows one to generate a nucleic acid population characteristic of differentially processed events that occur in a test condition as compared to the standard (reference) condition. Said population can be used for the cloning and characterization of nucleic acids, including their use in diagnostics, screening, therapeutics and antibody production or synthesis of whole proteins or protein fragments. This population can also be used to generate libraries that may be used in different application fields (medicine, pharmacogenomics, genopharmacology, genotoxicity, etc.).

This method may be applied to all types of biological materials. In particular, the biological material can be any cell (including cell lines), organ, tissue, sample, biopsy material, organism, etc. containing nucleic acids. Of interest are samples derived from organisms, such as research animals (e.g., worms, flies, cebra fishes, rats, mouse, etc.), marine species, human beings, plants, etc. Relevant materials include samples from cell types in different physiological or pathological conditions, for example, samples from tumor cells and samples from non-tumor cells of the same subject, samples from cells treated by a test compound and samples from untreated cells, etc.

Methods can be carried out by using total RNAs or messenger RNAs (mRNAs). These RNAs can be prepared by any molecular biology methods, familiar to those skilled in the art. Such methods generally comprise cell, tissue or sample lysis and RNA recovery by means of extraction procedures. This can be done in particular by treatment with chaotropic agents such as guanidinium thiocyanate followed by RNA extraction with solvents (e.g., phenol, chloroform for instance). These methods may be readily implemented using commercially available kits. Optionally, it is possible to use mRNAs instead of total RNA preparations. These may be isolated, either directly from biological samples or from total RNAs, by means of polyT chains, according to standard methods. In this respect, the preparation of mRNAs can be carried out using commercially available kits. RNAs can also be obtained directly from libraries or other samples prepared beforehand and/or available from collections, stored in suitable conditions. RNA preparations must contain RNA in a sufficient amount so as to be able to carry out a method of the invention, preferably should comprise at least 0,1 μg of RNA.

The cDNA used in the working of the method provided by the instant invention may be obtained by reverse transcription according to conventional molecular biology techniques, by using a reverse transcriptase and a primer under the appropriate operating conditions. Virtually any reverse transcriptase described in the literature and/or commercially available can be used. The primer(s) used for reverse transcription may be of various types. It might be, in particular, a random oligonucleotide comprising preferably from 4 to 10 nucleotides, advantageously 6 nucleotides. Use of this type of random primer has been described in the literature and allows random initiation of reverse transcription at different sites within the RNA molecules. This technique is especially employed for reverse transcribing total RNA (i.e. comprising mRNA, tRNA and rRNA). Where it is desired to carry out reverse transcription of mRNA only, it might be convenient to use an oligo dT-oligonucleotide as primer, which allows initiation of reverse transcription starting from polyA tails specific to messenger RNAs. The oligo dT-oligonucleotide may comprise from 4 to 20-mers, conveniently about 15- ers. In addition, it might be convenient to use a labelled primer for reverse transcription. This allows recognition and/or selection and/or subsequent sorting of RNA by separation from cDNA. This may also allow one to isolate RNA/DNA heteroduplex structures. Labelling of the primer may be carried out by any ligand- receptor based system, i.e. providing affinity mediated separation of molecules bearing the primer. It may consist, for instance, of biotin labelling, which molecule can be captured on any support or substrate (bead, column, plate, etc.) previously coated with streptavidin. Any other labelling system allowing separation without affecting the primer's properties may be likewise utilized. In typical operating conditions, the reverse transcription generates single stranded complementary DNA (cDNA).

Alternatively, reverse transcription is accomplished such that double stranded cDNAs are prepared. This result is achieved by generating, following transcription of the first cDNA strand, the second strand using conventional molecular biology procedures involving enzymes capable of modifying DNA such as DNA polymerase I and T4 phage-derived DNA polymerase.

- In a particular embodiment, the method comprises the hybridization of a plurality of ^• - different RNAs derived from a first sample with a plurality of different cDNAs derived from a second sample, to render a plurality of RNA-cDNA hybrids. Each sample may be representative of a particular condition or situation. In a further embodiment, the method comprises a first hybridization and a second hybridization, conducted in parallel, between RNAs derived from a standard condition and cDNAs derived from the test condition. This variant has great advantage since it allows one to generate two nucleic acid populations, one representing the characteristics of the test condition with respect to the standard condition, while the other representing the characteristics of the standard condition in relation to the test condition. These two populations can be utilized as nucleic acid sources, or as libraries which serve as fingerprints of a particular condition. The cross hybridization step between RNAs and cDNAs derived from distinct conditions may be performed by any conventional technique, such as, for example, in a liquid phase, in phenol emulsion, having one of the partners fixed to a support (cDNA is conveniently immobilized), etc. More detailed information concerning this cross hybridization step can be found in US 6,251,590 which is incorporated herein by reference.

The cross hybridization reactions generate compositions comprising cDNA/RNA hybrids, representing the qualitative properties of each condition being tested. As already noted, in each composition, nucleic acids essentially corresponding to differentially processed exons, specific to each condition, can be identified.

According to step (b), the RNA fragments with free 5'P and 3'OH groups, wherein said RNA fragments with free 5'P and 3'OH groups correspond to differently processed exons, can be obtained from said RNA/cDNA hybrids by any conventional method. In a particular embodiment, said RNA fragments with free 5'P and 3'OH groups are obtained by enzymatic digestion with an appropriate enzyme, for example, by Rnase H . digestion of said RNA/cDNA hybrids.

Step (c) of the above defined methods may be carried out by any particular embodiment of the SAVE method. In a particular embodiment, step (c) comprises:

1) Ligation said RNA fragments with free 5'P,and 3'OH groups obtained in step

(b) to form a string, wherein said RNA fragments with free 5'P and 3'OH groups comprise a differentially processed exon or exons; 2) Ligation of 5' and 3' RNA linkers for subsequent amplification, preferably by PCR; 3) Reverse transcription of the product of reaction (2);

4) Amplification of the product of reaction (3), preferably by PCR; and

5) Cloning of the amplification products of reaction 4 into a vector.

In another embodiment, step (c) comprises:

1) Ligation of said RNA fragments with free 5'P and 3'OH groups obtained in step (b) in order to form a string; 2) Ligation of RNA fragments as in (1) to hinge RNA linkers intended to intercalate between said RNA fragments;

3) Ligation of 5 ' and 3 ' RNA linkers simultaneously or after the reaction in (1);

4) Reverse transcription of the product of reaction (3) using a DNA oligonucleotide primer complementary to the 3 ' RNA linker used in (3);

5) Synthesis of a second strand using the product of reaction (4) as a template or, directly;

6) Amplification of the product of reaction (5), preferably by PCR; and

7) Cloning of the amplification products of reaction 6 into a vector.

Subsequently, the regions characterizing differential processed exons may be identified by any technique known in the art, for example, by sequencing, restriction enzyme digestion, etc.

As indicated above, the invention provides a method for identifying nucleic acids representative of a particular condition, for example, a physiological or pathological condition, hi addition, the nucleic acids identified represent the qualitative characteristics of a given condition in that said nucleic acids are generally involved to a great extent in the condition being observed. Thus, the method provided by the instant invention affords direct exploration of genetic elements and protein products thereof, playing a functional role in the development of a particular condition. Additionally, such a method allows the identification of nucleic acids characteristic of a particular physiological or pathological condition in relation to a standard (reference) physiological condition, that are to be cloned or used for further applications. In a particular embodiment, the instant invention provides a method for identifying within a biological sample differentially processed nucleic acid regions occurring between two distinct physiological or pathological conditions.

3. Nucleic acids and related products

Another aspect of the invention concerns nucleic acids that have been identified and/or cloned by the methods of the invention, as well as related products such as peptides, and the applications thereof. The nucleic acids that can be identified and/or cloned by the methods of the invention may be RNAs or cDNAs and may be single or double stranded. Thus, the invention concerns a nucleic acid composition, essentially comprising nucleic acids corresponding to differentially processed exons which are distinctive of, i.e. can be used to distinguish between, two distinct conditions. More particularly, these nucleic acids correspond to differentially processed exons identified in a biological test sample and not present in a comparable biological sample under a standard (reference) condition. The invention is equally concerned with the use of the nucleic acids thus cloned as therapeutic or diagnostic products, or as screening tools to identify active molecules.

In a particular embodiment, the invention relates to a nucleic acid comprising a sequence corresponding to a portion of a gene that is differentially processed between two biological samples containing nucleic acids obtained according to the above mentioned method for identifying nucleic acids comprising sequences corresponding to portions of genes that are differentially processed between two biological samples ■ containing nucleic acids. Said nucleic acid, if desired may be fixed onto a solid surface, such as an array or multi-well plate, for use as as a probe for gene expression studies.

In a further particular embodiment, the invention relates to a nucleic acid sequence obtained according to the above mentioned method for identifying nucleic acids comprising sequences corresponding to portions of genes that are differentially processed between two biological samples containing nucleic acids, wherein said sequence corresponds to a portion of a gene that is differentially processed between two biological samples containing nucleic acids. Said nucleic acid sequence can be used, for example, in diagnostic or prognostic tests, or in a drug evaluation tests in humans or experimental animals.

The previously mentioned nucleic acids and nucleic acid sequences identified according to the instant invention, if desired, can be purified. The purified product so obtained constitutes a further aspect of the present invention. Said product, if desired, can be fixed onto a solid surface, such as an array or multi-well plate, for use as a probe for gene expression studies. The peptide encoded by said nucleic acid or, preferably, by said nucleic acid sequence, constitutes a further aspect of the instant invention. Said peptide can be used in generating ligands, for example, peptides and the like, or antibodies, against said peptide. The ligands (e.g., peptides) can be obtained by conventional methods, for example, phage display. Antibodies can also be obtained by conventional methods, for example, by immunizing a suitable research animal with said peptides and collecting sera (polyclonal antibodies) or by means of the hybridoma technology (monoclonal antibodies). Said ligands and antibodies constitute further aspects of the present invention. Additionally, said peptide can also be used in a test for therapeutic target discovery and validation. The antibodies so obtained can be used as therapeutics or for in vitro diagnostic tests.

Additionally, the instant invention is directed to the preparation of nucleic acid libraries, to the nucleic acids and libraries thus prepared, as well as to the uses of such materials in all fields, for example, biology, biotechnology, medicine, etc.

The different methods disclosed hereinabove lead to the cloning of cDNA sequences representative of differentially processed exons between two (physiological or pathological) conditions. The whole set of clones derived from said methods makes it thus possible to construct a library representative of qualitative differences occurring between two conditions of interest.

Therefore, the invention further concerns a method for preparing nucleic acid libraries representative of a given condition of a corresponding biological sample. This method comprises cloning nucleic acids representative of differentially processed exons of a given condition but not present in another condition, to generate libraries specific to qualitative differences existing between the two conditions being investigated. These libraries are constituted by cDNA inserted in plasmid or phage vectors, and can be overlaid on nitrocellulose filters or any other support known to those skilled in the art, such as chips or biochips. The choice of initial RNAs will partly determine the particulars of the resulting libraries as mentioned in US 6,251,590. In a particular embodiment, the nucleic acid library is constructed by cross hybridizing RNA arising from the physiological or pathological condition being tested with cDNA derived from the standard physiological condition and selecting nucleic acids of interest by proceeding as previously described. In addition, once such libraries are constructed, it is possible to proceed with a step of clone selection to improve the specificity of the resulting libraries. To achieve this result, the library clones may be hybridized with the cDNA populations occurring in both conditions being investigated. The clones effectively hybridizing with both populations would be considered as non specific and optionally discarded. The clones which hybridize with only one out of two populations are considered as specific and could be selected to construct refined or enriched libraries.

The instant invention further concerns any nucleic acid library comprising nucleic acids specific of differentially processed exons typical of a physiological or pathological condition. These libraries conveniently comprise cDNAs, generally of double stranded nature, corresponding to RNA regions specific of differentially processed exons. Such libraries may be comprised of nucleic acids, generally incorporarated within a cloning vector, or of cell cultures containing said nucleic acids.

The nucleic acid libraries provided by the instant invention can be generated by conventional methods, for example, by spreading, on a solid medium, of a cell culture transformed by the cloned nucleic acids, or alternatively, by transfer the nucleic acids onto biochips or any other suitable device. Additional information concerning the generation of nucleic acid libraries can be found in US 6,251,590 which is incorporated herein as reference. A support material (membrane, filter, biochip, chip, etc) comprising a nucleic acid library as defined above constitutes a further aspect of the instant invention.

4. Particular applications

In a further aspect, the instant invention is concerned with the use of the methods, nucleic acids or libraries previously described for identifying molecules of therapeutic or diagnostic value, more specifically with the use of said methods, nucleic acids or libraries for identifying proteins or protein domains that are altered in such a pathology. One of the major strengths of these techniques is, indeed, the identification, within a messenger, and consequently within the corresponding protein, of the functional domains which are affected in a particular disorder. This makes it possible to assess the importance of a given domain in the development and persistence of a pathological state. A direct advantage of restricting to a given protein domain the impact of a pathological disorder is in that the latter can be viewed as a relevant target for screening small molecules for therapeutic purposes. This information further constitute a key for designing therapeutically active compounds that may be delivered e.g. by gene therapy; such compounds can namely be antibodies or ligands (e.g., peptides) against domains identified by techniques herein described, for example, single chain-antibodies derived from neutralizing antibodies against said domains.

The methods according the invention provide molecules which may be coding sequences derived from alternative exons or which may correspond to non coding sequences born by introns differentially processed between two physiological or pathological conditions. From the foregoing data, different information can be obtained.

Differentially processed exons which discriminate between two pathological or physiological states reflect a regulatory mechanism of gene expression capable of modulating one or a number of functions of a particular protein. Therefore, as the majority of structural and functional domains are encoded by several contiguous exons, two configurations might be considered: (i) the domains are truncated in the pathological condition, what indicates that the pathways involving such domains must be restored for therapeutical purposes; and (ii) the domains are retained in the course of a pathological disorder whereas they are absent from the healthy state, what indicates that these, domains must be considered as screening targets for compounds, e.g. for compounds intended to antagonize signal transduction mediated by such domains.

The differentially processed exons may correspond to non coding regions located 5' or 3' of the coding sequence or to introns occurring between two coding exons. In the non coding regions, the differential splicings could reflect a modification of the messenger stability or translatability. A search for these phenomena should be conducted based on such information and might qualify the corresponding protein as a candidate target in view of its accumulation or disappearance. Retention of an intron in a coding sequence often results in the truncation of the native protein by introducing a stop codon within the reading frame. Before such a stop codon is read, there generally occurs translation of a number of additional codons whereby a specific sequence is appended to the translated portion which behaves as a protein marker of alternative splicing. These additional amino acids can be used to produce antibodies specific to the alternative form inherent to the pathological condition. These antibodies may subsequently be used as diagnostic tools. The truncated protein undergoes a change or even an alteration in properties. Thus enzymes may lose their catalytic or regulatory domain, becoming inactive or constitutively activated. Adaptors may lose their capacity to link different partners of a signal transduction cascade. Splicing products of receptors may lead to the formation of receptors having lost their ability to bind corresponding ligands and may also generate soluble forms of receptor by release of their extracellular domain. In this case, diagnostic tests can be designed, based on the presence of circulating soluble forms of receptor which bind a given ligand in various physiological fluids.

In an embodiment, the invention is directed to a method for identifying nucleic acids or nucleic acid domains involved in a pathological condition based on a SAVE method which comprises:

(a) hybridizing mRNAs of a pathological sample with cDNAs of a healthy sample; and

(b) identifying differentially processed exons which are specific to the pathological condition in relation to the healthy condition,

wherein the identification of differentially processed exons which are specific to the pathological condition in relation to the healthy condition comprises obtaining RNA fragments corresponding to said differentially processed exons from said RNA/cDNA hybrids and subjecting said RNA fragments to a SAVE method.

As mentioned above, SAVE methods may comprise ligating in chain RNA fragments having free 5'P and 3'OH ends to obtain RNA strings, optionally in the presence of hinge RNA linkers, ligating RNA linkers to render shielded RNA strings, converting said shielded RNA strings into cDNAs and optionally cloning said cDNAs in vectors. Any of the particular embodiments of the SAVE method can be used in operating this method. In a particular case, the first embodiment of the SAVE method can be used whereas in another particular case, the second embodiment of the SAVE method can be used.

The above indicated methods can be used to identify nucleic acids or nucleic acid domains involved in virtually any pathological condition, said pathological condition being based on the differential processing of RNAs. Nevertheless, in a particular embodiment, the pathological condition is a tumor, and the invention provides a method for identifying nucleic acids or nucleic acid domains distinct to a tumor state, comprising:

(a) hybridizing a population of different mRNAs of a first, tumor tissue sample, with a population of different cDNAs derived from a second, healthy tissue sample; and

(b) identifying at least a nucleic acid comprising a sequence corresponding to an exon differentially processed between said two samples, and said nucleic acid or a domain thereof being distinct to the tumor state,

wherein the identification of differentially processed exons which are specific to the tumor state in relation to the healthy condition comprises obtaining RNA fragments corresponding to said differentially processed exons from said RNA/cDNA hybrids and subjecting said RNA fragments to a SAVE method.

Any of the particular embodiments of the SAVE methods can be used in operating this method. In a particular case, the first embodiment of the SAVE method can be used whereas in another particular case, the second embodiment of the SAVE method can be used. Additionally, the invention is directed to a method for identifying proteins or protein domains involved in a pathological condition based on the SAVE methods which comprises:

(a) hybridizing mRNAs of a pathological sample with cDNAs of a healthy sample;

(b) identifying differentially processed exons which are specific to the pathological condition in relation to the healthy condition, and,

(c) identifying protein or protein domains corresponding to one or several splicing forms identified in step (b),

wherein the identification of differentially processed exons which are specific to the pathological condition in relation to the healthy condition comprises obtaining RNA fragments corresponding to said differentially processed exons from said RNA/cDNA hybrids and subjecting said RNA fragments to a SAVE method.

Any of the particular embodiments of the SAVE methods can be used in operating this method. In a particular case, the first embodiment of the SAVE method can be used whereas in another particular case, the second embodiment of the SAVE method can be used.

The protein(s) or protein domains may be isolated, sequenced, and used in therapeutic or diagnostic applications, including antibody production.

The instant invention further relates to the exploitation of the resulting information in research, development of screening assays for chemical compounds, for example, low molecular weight chemical compounds, and development of gene therapy or diagnostic tools. In this connection, the invention is concerned with the use of the methods, nucleic acids or libraries described above in deteπnining or assessing the therapeutic potential of a test compound with respect to a biological sample. In this particular use, two standard libraries are established from a control cell culture or organ and counterparts thereof simulating a pathological model. The therapeutic efficiency of a given product may then be evaluated by monitoring its potential to antagonize gene expression, variations of which are specific of the pathological model being considered. This is demonstrated by a change in the hybridization profile of a probe derived from the pathological model with the standard libraries, unless otherwise stated in the absence of treatment, the probe only hybridizes with the library containing the specific splicing markers of the disease. Following treatment with a therapeutically efficient product, the probe, though it is derived from the pathological model, hybridizes preferentially with the other library, which bears the markers of the healthy model equivalent.

Therefore, in this sense, the invention is further directed to a method for determining or assessing the therapeutic efficiency of a test compound upon a given biological sample comprising hybridizing nucleic acid libraries provided by the instant invention typical of said biological sample in a healthy state and in a disease state (or at different developmental stages), with a preparation of nucleic acids originating from the biological sample treated by said test compound, and assessing the therapeutic potential of the test compound by deteπmning to what extent hybridization occurs with the individual libraries prepared.

In a particular embodiment, the invention provides a method of determining or assessing the therapeutic potential of a test compound with respect to a biological sample, comprising:

a) hybridizing a nucleic acid preparation of the biological sample treated by said test compound, with at least a first and second nucleic acid library, wherein said first library comprises nucleic acid molecules comprising sequences corresponding to portions of genes which are differentially processed in the un-treated biological sample as compared to the biological sample treated with a test compound, and said second library comprises nucleic acid molecules comprising sequences corresponding to portions of genes which are differentially processed in the biological sample treated with a standard therapeutic compound as compared to the un-treated sample, wherein said first and second nucleic acid libraries comprise nucleic acid molecules obtained by the method for identifying nucleic acids comprising sequences corresponding to portions of genes that are differentially processed between two biological samples containing nucleic acids provided by the instant invention; and b) assessing the therapeutic potential of said test compound by examining the extent of hybridization of said nucleic acid preparation with said different libraries.

Where a chemical compound is a candidate for pharmaceutical development, this may be tested with the same tissue or cell models. Molecular probes may then be synthesized from mRNA extracts of biological samples treated by the test compound. These probes are then, for example, hybridized on filters bearing cDNA or RNA/cDNA hybrid libraries. For instance, a RNA/cDNA hybrid library may contain sequences specific to the treated sample and another RNA/cDNA library may contain differentially processed exons specific to the un-treated samples. The therapeutic potential of the test compound can be readily assessed by looking at the hybridization profile of said, nucleic acid preparation with said libraries as mentioned above.

This method allows one to assess the efficiency of a test compound intended to treat virtually any pathological condition associated with differential processing of RNAs. However, in a specific embodiment, the method of the invention allows one to assess the efficiency of a neuroprotective test compound by carrying out hybridization with a differential library according to the invention derived from a healthy nervous cell and a neurodegenerative model cell. In a further embodiment, one is interested in testing an anti-cancer compound using differential libraries established from tumor and healthy sample cells. Additionally, the invention is still further directed to the use of the methods, nucleic acids, proteins e.g. peptides or antibodies or libraries described hereinabove in pharmacogenomics, i.e., to assess (predict) the response of a patient to a given test compound or treatment. The procedures described in the instant invention make it possible to establish cDNA libraries that are representative of qualitative differences occurring between a pathological condition which is responsive to a given treatment and another condition which is unresponsive or poorly responsive thereto, and thus may qualify for a different therapeutic strategy. Once these standard libraries are established, they can be hybridized with probes prepared from the patients' mRNAs. The hybridization results allow one to determine which patient has a hybridization profile corresponding to the responsive or non responsive condition and thus refine treatment choice in patient management, h this application, the purpose is on the one hand to suggest, depending on the patient history, the treatment regimen most likely to be successful, and on the other hand, to enroll in a given treatment regimen those patients most likely to benefit therefrom. As with other applications, two qualitative differential screening libraries are prepared: one based on a pathological model or sample known to respond to a given treatment, and another based on a further pathological model or sample which is poorly responsive or unresponsive to therapy. These two libraries are then hybridized with probes arising from mRNAs extracted from biopsy tissues of individual patients. Depending on whether such probes preferentially hybridize with the alternatively spliced forms specific to one particular condition, the patients may be divided into responsive and unresponsive subjects to the standard treatment which initially served to define the models.

Therefore, the invention is also directed to a method for determining or assessing the response of a particular patient to a test compound or treatment comprising hybridizing a library characteristic of a responsive biological sample to said compound/treatment and a library characteristic of an unresponsive or poorly responsive biological sample to said compound/treatment, with, a nucleic acid preparation of a pathological biological sample of the patient, and assessing the responsiveness of the patient by determining the extent of hybridization with those different libraries.

In a particular embodiment, the invention provides a method of determining or assessing the responsiveness of a patient to a test compound or treatment, comprising: a) hybridizing a nucleic acid preparation of the biological sample of the patient, with at least a first and second nucleic acid library, wherein said first library comprises nucleic acid molecules comprising sequences corresponding to portions of genes which are differentially processed in a responsive biological sample as compared to a non-responsive or poorly responsive biological sample, and said second library comprises nucleic acid molecules comprising sequences corresponding to portions of genes which are differentially processed in the non-responsive or poorly responsive biological sample as compared to the responsive biological sample, wherein said first and second nucleic acid libraries comprise nucleic acid molecules obtained by the method for identifying nucleic acids comprising sequences corresponding to portions of genes that are differentially processed between two biological samples containing nucleic acids provided by the instant invention; and b) assessing the responsiveness of the patient by examining the extent of hybridization of said nucleic acid preparation with said different libraries.

This method allows one to determine or assess the responsiveness of a patient to a test compound or treatment for virtually any pathological condition associated with a different processing of RNAs. Nevertheless, in a specific embodiment, the method of the invention allows one to determine or assess the responsiveness of a patient to a test compound or treatment, wherein said test compound or treatment is a neuroprotective compound or an anti-cancer compound or compounds used to treat any medical condition.

Examples

For example purposes, SAVE methods of the invention can be applied to the comparative study of variant exons in samples of human lung cancer. This study requires a minimum of two samples (for example, biopsies; e.g., normal and cancer lung tissues from the same patient) that are processed as follows:

Sample processing and RNA extraction. Tissue samples are dounce lysed using a Douncer (1 min) in the presence of 1 ml of RNA Wiz lysis buffer. Total RNA is purified following standard phenol/chloroform/isopropanol purification methods as is well known in the art.

RT-Second Strand and RT-PCR reactions

For the synthesis of the first strand complementary DNA, 0.5-3 μg total RNA was incubated with lμl of 0.5 μg/μl oligo dT(15)-T7 primer at 70°C for 3-4 min, snap cooled on ice and mixed with 12 μl of a 1^st Strand Master mix (4 μl 5X First strand buffer; 1 μl 1 μg/μl CAPSWITCH primer; 2 μl 0.1M DTT; 1 μl RNaseIN (Promega Cat# N2111); 2 μl lOmM dNTP (Pharmacia Cat# 27-2035-02); 2 μl Superscript II (Gibco BRL Cat# 18064-071). The reaction was carried out at 42°C for 90 min in a thermal cycler.

For the second strand synthesis a total of 128 μl of a 2^nd Strand Master Mix (106 μl DEPC H2O; 15 μl Advantage PCR buffer; 3 μl 10 mM dNTP mix; 1 μl RNase H (2 U/μl Gibco BRL Cat# 18021-071); 3 μ\ Advantage Polymerase (Clontech Cat# 8417-1)) was added to each tube. The samples were then incubated at 37°C for 5 min to digest mRNA, and either 94°C for 2 min to denature, 65°C for 1 min for specific priming and 75°C for 30 min for extension, or Smart PCR with some modifications (essentially, 94°C for 1 min, followed by (94°C 20", 68°C 6') 22 cycles. The reaction was stopped with 7.5 μl 1M NaOH solution containing 2 mM EDTA and incubated at 65°C for 10 min to inactivate the enzyme.

For second strand cleanup, 1 μl 0.1 μg/μl or 1 μg/μl Linear Acrylamide (Ambion Cat# 9520; supplied at 5 μg/μl) and 150 μl Phenol:Chloroform:Isoamyl alcohol 25:24:1 (Boehringer Mannheim Cat #101001) was added to the PCR tube, mixed by pipetting and spun at 14,000 rpm for 5 min at room temperature. The aqueous phase was then transferred to an RNase/DNas e-free tube, 70 μl of 7.5 M ammonium acetate (Sigma Cat# A2706) was added and the solution gently mixed. After adding 1 ml 95% room temperature ethanol, the sample was centrifuged at 14,000 rpm for 20 min at room temperature. The PCR reaction was evaluated by electrophoresis in a 1% agarose gel.

Hybridization Purified samples from the previous step can be used in RNA/cDNA hybridisation reactions. Hybridisation was carried out at RoT values of 5-500, depending on the experiment, in a buffer containing 80% formamide (from a deionized stock), 250 mM NaCl, 25 mM HEPES (pH 7.5), and 5 mMEDTA. Hybridisation was carried out at 37°C in a dry oven with continuous rotation; even volumes as small as 5 μl did not require mineral-oil overlays. After hybridisation, the sample was precipitated by adding 2.5 volumes of absolute ethanol and incubated for 30 min on ice, centrifuged for 10 min at 15,000 rpm and washed once with 70% ethanol; the pellet containing the RNA/cDNA hybrids was carefully resuspended in lO μl of water and kept on ice. In order to eliminate the matched RNA, RNA/cDNA hybrids were usually digested with Rnase H as recommended by the manufacturer (Amersham). Further digestion with Dnase I was optional, but was usually carried out at 37°C for 30 min. Dnase I was inactivated after the reaction by heating the sample at 70°C for 10 min. The sample was then precipitated in the presence of 1 μl 0.1 μg/μl or 1 μg/μl linear acrylamide and 2.5 M ammonium acetate after addition of 2.5 volumes of 95% room temperature ethanol. The precipited (RNA Exon Soup or RES) was vacuum dried and used in RNA ligation experiments.

RNA ligation

The reaction mastermix contained the following:

o 1 μl 1 Ox ligase buffer,

o 1 μl RNase inhibitor

o 0.5 μl T4 RNA ligase (6 U/μl)

Total volume was adjusted to 10 μl/reaction with H₂O and 6 μl of master-mix was added to each reaction tube containing the dried RES, and incubated overnight at 16°C. In some experiments, the sample was divided in two halves. One was directly used as a template in RT-Second strand or RT-PCR reactions as below. The other half was purified in an Rneasy column before use in those reactions.

String Hinging

Hinge ligation. The oligoNotLinkRNA (5'AAUCAGAAGGCGGCCGCAAGA-OH), was in vitro phosphorylated in the presence of T4 polynucleotide kinase (incubating in essentially T4 PNK buffer for 1 hr at 37°C; T4 PNK buffer, 50 mM Tris-Cl pH 7.5, 10 mM MgCl₂, 1 mM DTT, 1 mM ATP, and 10 units of T4 PNK), and purified using a Prepare Bio-6 Chromatograph column (Bio-Rad Cat# 732-6222) as follows: the column was washed once with 700 μl DEPC H2O and spun at 700xg for 2 min at room temperature. Flow-through was removed. The column was spun again at 700xg for 2 min to dry the column completely. A 60 μl sample (10 μl ligation reaction plus 50 μl DEPC water) was loaded onto the center of the Bio-6 column and spun at 700xg for 4min. Samples were transferred to new PCR tubes. The samples were completely dried by speedvac.

For the RNA ligation experiment, pellets- containing the RES were resuspended in an RNA ligation mix containing 1 μl lOx ligase buffer, 1 μl RNase inhibitor, 0.5 μl T4 RNA ligase (6 U/μl), 1 μl NotLinkRNA phosphorylated linker and 6 μl DEPC H2O.

String Shielding and Library Amplification

Modified RNA primers (EcoLinkRNA (P-AAUACCGAGAAUUCCCUUGCG-3'), VRNA (5'-ACUGACAUGGACUGAAGGAGUAG-OH)) were used in ligation reactions in order both to shield RNA strings and to allow cloning of their complementary DNAs. Thus EcoLinkRNA and VRNA primers were used in an RNA ligation mix containing the purified hinged strings. This reaction generated shielded strings with a ligated 5' VRNA linker and a 3' EcoLinkRNA linker. After completion (16°C overnight incubation), the reaction was precipitated in the presence of 1 μl 0.1 μg/μl or 1 μg/μl linear acrylamide and 2.5 M ammonium acetate after addition of 2.5 volumes of 95% room temperature ethanol and the dried pellet used in RT-PCR reactions. The latter reaction was carried out as above except that the primers were EcoLinkPCR instead of the dT-T7 primer and VPCR instead of the CAPSWITCH primer.

Library Cloning and Screening

By way of example, RT-PCR generated complementary DNAs from RNA shielded strings, as well as a suitable plasmid vector were digested with the appropriate restriction enzyme (i.e. EcoRI). The digested insert (library of chained cDNAs) and vector (pGEM-T, Promega Corp.) were gel purified, using methods described in the art, and ligated together in the presence of T4 DNA ligase. The products of such ligation were used ultimately to transform competent E.coli cells, that were grown on ampicillin selection plates. Individual clones from such transformations were grown and lysed and purified plasmid DNA obtained. This DNA was later sequenced or used in other reactions such as digestion with hinge restriction endonuclease and subsequent agarose gel purification of the yielded DNA fragments (individual exonic fragments). Those fragments could be, for example, spotted on solid surfaces for use as probes in, for instance, gene expression studies.

Sequence Validation

Different methods well known in the art are available for this end. These include bioinformatics tools to "blast" i.e. compare string sequences against gene banks, to annotate and map, and to predict exon/intron boundaries, transcription start points, polyadenylation sites or Open Reading Frames.

Materials

Sequence Listing Information

Polymeric Nucleic Acids used as Primers

SEQ ID No: 1 NotLinkRNA (5 '-AAUCAGAAGGCGGCCGCAAGA-OH),

SEQ ID No: 2 NotFlankRNA (P- AACGUGCUCGACUAGAUGAGCGGCCGCAAGUGACGUCUGCACGUCA-OH) SEQ ID No: 3 EcoLinkRNA (P-AAUACCGAGAAUUCCCUUGCG-3'), SEQ ID No: 4 VRNA (5'-ACUGACAUGGACUGAAGGAGUAG-OH), SEQ ID No: 5 EcoLinkPCR (5'-CGCAAGGGAATTCTCGGTATT-3')₅ SEQ ID No: 6 NotLinkPCR (5'-AATCAGAAGGCGGCCGCAAGA-3'), SEQ ID No: 7 dT-T7

(5 ' AAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGCGCT(15)3 '), SEQ ID No: 8 CAPSWITCH (5'-TGCTGCGGAAGACGACAGAAGGG-3')₃ SEQ ID No: 9 TS (5'-AAGCAGTGGTAACAACGCAGAGTACGCGGG-3') SEQ ID No: 10 VPCR (5'-ACTGACATGGACTGAAGGAGTAG-OH), BIBLIOGRAPHY

Brett,D., Hanke,J., Lehmann,G., Haase,S., Delbruck,S., Krueger,S., Reich,J. and Bork,P. (2000) EST comparison indicates 38% of human mRNAs contain possible alternative splice forms. FEBSLet , 474, 83-86 Ewing ,B. and Green,P. (2000) Analysis of expressed sequence tags indicates 35,000 human genes. Nat. Genet., 25, 232-234

Hawkins, J.D. (1988) A survey on intron and exon lengths. Nucleic Acids Res., 16, 9893-9905 Ji, H., Zhou,Q., Wen,F., Xia,H., Lu,X. and Li,Y. (2001) AsMamDB: an alternative splice database of mammals. Nucleic Acids Res. , 29, 260-263

Liang, F., Holt,L, Pertea,G., Karamycheva,S., Salzberg,S.L. and Quackenbush,J. (2000) Gene Index analysis of the human genome estimates approximately 120,000 genes. Nat. Genet, 25, 239-240 Mironov,A.A., Fickett .W. and Gelfand,M.S. (1999) Frequent alternative splicing of human genes. Genome Res., 9, 1288-1293

Νeedleman, S.B. and Wunsch,C.D. (1970) A general method applicable to the search for similarities in the amino acid sequence of two proteins. J. Mol. Biol, 48, 443-453 Relogio A, Schwager C, Richter A, Ansorge W, Valcarcel J. Optimization of oligonucleotide-based DΝA microarrays. Nucleic Acids Res. 2002; 30:e51. Sambrook et al. Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, ΝY, 1989.

Schweighoffer F, Ait-Ikhlef A, Resink AL, Brinkman B, Melle-Milovanovic D, Laurent-Puig P, Kearsey J, Bracco L. Qualitative gene profiling: a novel tool in genomics and in pharmacogenomics that deciphers messenger RΝA isoforms diversity. Pharmacogenomics. 2000; 1:187-97

Sharp ,P.A. (1994) Split genes and RΝA splicing. Cell, 11, 805-815 Shimkets RA, Lowe DG, Tai JT, Sehl P, Jin H, Yang R, Predki PF, Rothberg BE, Murtha MT, Roth ME, Shenoy SG, Windemuth A, Simpson JW, Simons JF, Daley MP, Gold SA, McKenna MP, Hillan K, Went GT, Rothberg JM. Gene expression analysis by transcript profiling coupled to a gene database query. Nat Biotechnol. 1999; 17: 798- 803 Smith CW, Valcarcel J. Alternative pre-mRNA splicing: the logic of combinatorial control. Trends Biochem Sci. 2000; 25: 381-8.

Taveau M, Stockholm D, Spencer M, Richard I. Quantification of splice variants using molecular beacon or scorpion primers. Anal Biochem. 2002; 305: 227-35

Velculescu VE, Zhang L, Vogelstein B, Kinzler KW. Serial analysis of gene expression. Science. 1995; 270: 484-7.

Yeakley JM, Fan JB, Doucet D, Luo L, Wickham E, Ye Z, Chee MS, Fu XD. Profiling alternative splicing on fiber-optic arrays. Nat Biotechnol. 2002; 20: 353-8.

Claims

1. A method to experimentally analyse boundaries within polymeric deoxy ribonucleic acid (DNA) or ribonucleic acid (RNA) molecules, comprising: a) Ligation of RNA fragments with free 5'P and 3'OH groups to form a string, wherein said RNA fragments with free 5'P and 3'OH groups comprise differentially processed exons; b) Ligation of 5 ' and 3 ' RNA linkers for subsequent PCR amplification; c) Reverse transcription of the product of reaction (b); d) PCR amplification of the product of reaction (c); and e) Cloning of the PCR products into a recombinant vector.

2. Method according to claim 1, comprising: a) Ligation of RNA fragments with free 5'P and 3'OH groups, wherein said RNA fragments with free 5'P and 3'OH groups are differentially processed exons, in order to form a string; b) Ligation of RNA fragments as in (a) to hinge RNA linkers intended to intercalate itself between said RNA fragments; c) Ligation of 5' and 3 ' RNA linkers simultaneously or after the reaction in (a); d) Reverse transcription of the product of reaction (c) using a DNA oligonucleotide primer complementary to the 3' RNA linker used in (c); e) Synthesis of a second strand using the product of reaction (d) as a template or, directly; f) PCR amplification of the product of reaction (e); and g) Cloning of the PCR products into a recombinant vector.

3. Method according to claim 1 or 2, wherein the ligation of RNA fragments with free 5'P and 3'OH groups to form a string is carried out in the presence of a hinge RNA linker, said hinge RNA linker (i) comprising, or consisting of, a nucleotide sequence which is complementary to the recognition site of a DNA restriction enzyme, and (ii) having free 5'P and 3'OH groups.

4. Method according to claim 1 or 2, wherein said RNA linker (i) comprises, or consists of, a nucleotide sequence which is complementary to the recognition site of a DNA restriction enzyme, and (ii) is modified only on one end, either the 3' or 5' end.

5. Method according to claim 1, further comprising (f) sequencing of individual clones, and, optionally, (g) comparing the sequences obtained with gene databases in order to identify, characterize and/or map each individual exon included in each sequenced string; or, alternatively, ( ) digestion of individual exonic strings with a suitable restriction enzyme that releases individual exons, and, optionally, (g') purification of recombinant exons from (f ).

6. Method according to claim 2, further comprising (h) sequencing of individual clones, and, optionally, (i) comparing the sequences obtained with gene databases in order to identify, characterize and/or map each individual exon included in each sequenced string; or, alternatively, (h') digestion of individual exonic strings with a convenient restriction enzyme that releases individual exons, and, optionally, (i') purification of recombinant exons from (h').

7. A method for identifying nucleic acids comprising sequences corresponding to portions of genes that are differentially processed between two biological samples containing nucleic acids, said method comprising: a) Hybridization of a plurality of different RNAs derived from a first sample with a plurality of different cDNAs derived from a second sample, to render a plurality of RNA/cDNA hybrids; b) Obtention, from said RNA/cDNA hybrids obtained in step (a), of RNA fragments with free 5'P and 3'OH groups, wherein said RNA fragments with free 5'P and 3'OH groups are differentially processed exons; c) Subjecting said fragments with free 5'P and 3'OH groups obtained in (b) to steps (a)-(e) of claim 1, or alternatively, to steps (a)-(g) of claim 2; and d) Identifying nucleic acids comprising sequences corresponding to portions of genes that are differentially processed between said two biological samples containing nucleic acids.

8. Method according to claim 7, wherein said first or second sample comprises a cell, a tissue, an organ, an organism or a biopsy sample.

9. Method according to claim 8, wherein said first and second samples are from cell types in different physiological or pathological conditions.

10. Method according to claim 9, wherein one of said samples is from tumoral cells and the other of said samples is from non-tumoral cells.

11. Method according to claim 8, wherein one of said samples is from cells treated by a test compound and the other of said samples is from untreated cells.

12. Method according to claim 8, wherein the obtention, from said RNA-cDNA hybrids obtained in step (a), of RNA fragments with free 5'P 3'OH groups, is carried out by RNase H digestion of said RNA-cDNA hybrids.

13. A nucleic acid comprising a sequence corresponding to a portion of a gene that is differentially processed between two biological samples containing nucleic acids obtained according to claim 7, optionally fixed onto a solid surface.

14. The nucleic acid of claim 13, wherein said solid surface is an array or multi-well plate.

15. Use of the nucleic acid according to claim 13 or 14, as a probe for gene expression studies.

16. A nucleic acid sequence obtained according to the method of claim 8, said sequence corresponding to a portion of a gene that is differentially processed between two biological samples containing nucleic acids.

17. Use of a nucleic acid sequence according to claim 16 in a diagnostic or prognostic test, or in a drug evaluation test in humans or experimental animals.

18. The purified product obtained according to claim 5 or 6, optionally fixed onto a solid surface.

19. The product of claim 18, wherein said solid surface is an array or multi- well plate.

20. Use of the purified product according to claim 18 or 19, as a probe for gene expression studies.

21. A peptide encoded by the nucleic acid sequence of claim 16.

22. Use of a peptide according to claim 21 in generating ligands or antibodies against said peptide, or in a test for therapeutic target discovery and validation.

23. An antibody against a peptide according to claim 21.

24. Antibody according to claim 23 as therapeutics.

25. Use of an antibody according to claim 24 for in vitro diagnostic tests.

26. A method for identifying nucleic acids or nucleic acid domains involved in a pathological condition, which comprises:

a) hybridizing mRNAs of a pathological sample with cDNAs of a healthy sample; . and b) identifying differentially processed exons which are specific to the pathological condition in relation to the healthy condition,

wherein the identification of said differentially processed exons which are specific to the pathological condition in relation to the healthy condition comprises obtaining RNA fragments corresponding to said differentially processed exons from said RNA/cDNA hybrids and subjecting said RNA fragments to steps (a)-(e) of claim 1, or alternatively, to steps (a)-(g) of claim 2.

27. A method for identifying nucleic acids or nucleic acid domains distinct to a tumor state, comprising:

a) hybridizing a population of different mRNAs of a first, tumor sample, with a population of different cDNAs derived from a second, healthy sample; and b) identifying at least a nucleic acid comprising a sequence corresponding to an exon differentially processed between said two samples, and said nucleic acid or a domain thereof being distinct to the tumor state,

wherein the identification of differentially processed exons which are specific to the tumor state in relation to the healthy condition comprises obtaining RNA fragments corresponding to said differentially processed exons from said RNA/cDNA hybrids and subjecting said RNA fragments to steps (a)-(e) of claim 1, or alternatively, to steps (a)- (g) of claim 2.

28. A method for identifying proteins or protein domains involved in a pathological condition, which comprises:

a) hybridizing mRNAs of a pathological sample with cDNAs of a healthy sample; b) identifying differentially processed exons which are specific to the pathological condition in relation to the healthy condition, and, c) identifying protein or protein domains corresponding to one or several splicing forms identified in step (b),

wherein the identification of said differentially processed exons which are specific to the pathological condition in relation to the healthy condition comprises obtaining RNA fragments corresponding to said differentially processed exons from said RNA/cDNA hybrids and subjecting said RNA fragments to steps (a)-(e) of claim 1, or alternatively, to steps (a)-(g) of claim 2.

29. A method of determining or assessing the therapeutic potential of a test compound with respect to a biological sample, comprising: a) hybridizing a nucleic acid preparation of the biological sample treated by said test compound, with at least a first and second nucleic acid library, wherein said first library comprises nucleic acid molecules comprising sequences corresponding to portions of genes which are differentially processed in the untreated biological sample as compared to the biological sample treated with a test compound, and said second library comprises nucleic acid molecules comprising sequences corresponding to portions of genes which are differentially processed in the biological sample treated with a therapeutic compound as compared to the un-treated sample, wherein said first and second nucleic acid libraries comprise nucleic acid molecules obtained by the method of claim 7 for identifying nucleic acids comprising sequences corresponding to portions of genes that are differentially processed between two biological samples containing nucleic acids provided by the instant invention; and b) assessing the therapeutic potential of said test compound by examining the extent of hybridization of said nucleic acid preparation with said different libraries.

30. Method according to claim 29, wherein said test compound is an anti-cancer compound or a neuroprotective compound.

31. A method of determining or assessing the responsiveness of a patient to a test compound or treatment, comprising: ^•

a) hybridizing a nucleic acid preparation of the biological sample of the patient, with at least a first and second nucleic acid library, wherein said first library comprises nucleic acid molecules comprising sequences corresponding to portions of genes which are differentially processed in a responsive biological sample as compared to a non-responsive or poorly responsive biological sample, and said second library comprises nucleic acid molecules comprising sequences corresponding to portions of genes which are differentially processed in the non- responsive or poorly responsive biological sample as compared to the responsive biological sample, wherein said first and second nucleic acid libraries comprise nucleic acid molecules obtained by the method of claim 7 for identifying nucleic acids comprising sequences corresponding to portions of genes that are differentially processed between two biological samples containing nucleic acids provided by the instant invention; and b) assessing the responsiveness of the patient by examining the extent of hybridization of said nucleic acid preparation with said different libraries.

32. Method according to claim 31, wherein said test compound is an anti cancer compound or a neuroprotective compound.