EP1546372A2 - Inducible focal adhesion kinase cell assay - Google Patents

Inducible focal adhesion kinase cell assay

Info

Publication number
EP1546372A2
EP1546372A2 EP03797456A EP03797456A EP1546372A2 EP 1546372 A2 EP1546372 A2 EP 1546372A2 EP 03797456 A EP03797456 A EP 03797456A EP 03797456 A EP03797456 A EP 03797456A EP 1546372 A2 EP1546372 A2 EP 1546372A2
Authority
EP
European Patent Office
Prior art keywords
fak
cells
cell
phosphorylation
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP03797456A
Other languages
German (de)
French (fr)
Other versions
EP1546372A4 (en
Inventor
Walter Gregory Roberts
Pamela Matthews Whalen
Ethan James Tekly Ung
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pfizer Products Inc
Original Assignee
Pfizer Products Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pfizer Products Inc filed Critical Pfizer Products Inc
Publication of EP1546372A2 publication Critical patent/EP1546372A2/en
Publication of EP1546372A4 publication Critical patent/EP1546372A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/48Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10Cells modified by introduction of foreign genetic material
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/573Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90Enzymes; Proenzymes
    • G01N2333/91Transferases (2.)
    • G01N2333/912Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • G01N2333/91205Phosphotransferases in general

Definitions

  • This invention relates to methods and compositions for inducing the expression of the focal adhesion kinase (FAK) gene, which encodes a signaling protein involved in growth factor response and cell migration and is also implicated in disease.
  • the invention is also directed to the identification of FAK inhibitors.
  • FAK focal adhesion kinase
  • FAK is a cytoplasmic, non-receptor tyrosine kinase.
  • FAK transduces signaling from a diverse group of stimuli (e.g. integrins, cytokines, chemokines, and growth factors) to control a variety of cellular pathways and processes including cell proliferation, migration, morphology, and cell survival.
  • stimuli e.g. integrins, cytokines, chemokines, and growth factors
  • FAK is found at elevated levels in most human cancers, particularly in highly invasive metastases. It has been shown that expression of the dominant-negative FAK-related nonkinase (FRNK) in human tumor cells results in rounded morphology of the cells, the irreversible loss of focal plaques, and subsequent cell death.
  • FRNK dominant-negative FAK-related nonkinase
  • the controlled expression of FRNK results in decreased tyrosine phosphorylation of FAK, suggesting that inhibition of FAK phosphorylation may yield a therapeutic
  • FAK enzyme activity resulting in phosphorylation at Y397 is the critical step in integrin signal transduction (Guan, JL, Int. J. Biochem.Cell.Biol. 29: 1085-96, 1997).
  • the transmembrane integrin receptors are important for linking the extracellular matrix (ECM) proteins with the cellular actin cytoskeleton and the nucleus to regulate cell morphology, tissue architecture, and attachment-induced gene expression.
  • An objective of the invention is to design and develop a FAK drug discovery pathway that tracks the biochemical mechanism of FAK.
  • a number of exogenous stimuli can lead to FAK phosphorylation such as (1 ) integrin binding to ECM ligands (e.g. Integrin ⁇ 1 to Fibronectin); (2) cytokine or chemokine stimulation (e.g. Endothelin1/2, Bombesin, or PMA); (3) growth factor stimulation of tyrosine kinase receptors (e.g.
  • PDGFBB PDGFBB
  • integrin antibody cross-linking e.g. Anti- ⁇ 1
  • cell-to-cell and cell-to-ECM contact e.g. cell suspension
  • the invention relates to a method for identifying cell-active inhibitors of focal adhesion kinase (FAK) comprising:
  • An embodiment of the invention provides a method for measuring the cytotoxicity of a test compound comprising, stably transfecting mammalian cells with a gene encoding FAK, wherein said gene is expressed in the presence of an inducing agent; adding an inducing agent to induce the expression of said gene encoding FAK; adding a test compound; adding a cytotoxicity indicator to said cells; and, detecting the cytoxicity of the test compound.
  • the cytoxicity of the test compound is determined by the colorimetric conversion of the cytotoxicity indicator, wherein the amount of converted cytotoxicity indicator is proportional to the number of living cells.
  • An embodiment of the present invention provides a mammalian cell stably transfected with a recombinant nucleic acid molecule, wherein said recombinant nucleic acid molecule is selected from the group consisting of SEQ ID No: 5, SEQ ID No: 6, SEQ ID No: 7 and SEQ ID
  • An embodiment of the invention provides a mammalian cell stably transfected with a recombinant nucleic acid molecule that encodes a protein comprising a sequence selected from the group consisting of SEQ ID NOS: 1 , 2, 3 and 4, and wherein expression of said protein requires the presence of an inducing agent.
  • Figure 1 shows a schematic representation of the detection of phosphorylated FAK using a horseradish peroxidase-conjugated phosphotyrosine antibody (pY54 HRP ).
  • Figure 2 shows a schematic representation of the detection of phosphorylated FAK using an unconjugated phosphotyrosine antibody (pY54) followed by a secondary mouse horseradish peroxidase antibody.
  • FIG. 3 shows a schematic representation of a FAK inducible cell-based assay of the invention.
  • the invention is directed to an inducible cell-based assay for FAK.
  • the cell-based assay exploits the biology of FAK and an inducible gene expression system to exogenously control FAK expression and FAK phosphorylation at the tyrosine residue at position 397 (Y397).
  • Y397 tyrosine residue at position 397
  • the cell- based assay of the present invention is flexible and can measure FAK phosphorylation at Y397, total FAK phosphorylation, identify mutant FAK proteins and measure a combination of protein and phosphotyrosine.
  • the inducible FAK cell-based assay of the present invention is advantageous in that it provides tight control over ectopic-basal level expression of FAK and rapid de-repression of FAK gene expression via an exogenous stimulant.
  • the cell-based assay is flexible such that the final read-out is mechanistically relevant to FAK biology as measured for phosphotyrosine FAK Y397 , total FAK phosphotyrosine profile, FAK or mutant proteins, or some combination of protein and phosphotyrosine.
  • the present invention has been successivefully used to identify a number of FAK inhibitors.
  • the term "tight control” refers to the controlled expression of the FAK gene that occurs in the presence of an exogenous stimulant.
  • the invention provides an inducible gene expression system for FAK, where the expression of FAK is induced in the presence of an appropriate inducible agent.
  • the present invention provides a method for the inducible expression of FAK, wherein the regulated expression of the FAK gene does not adversely affect cell viability.
  • An embodiment of the invention is directed to a cell-based assay for the screening of FAK inhibitors.
  • the cell-based assay exploits the biology of FAK and an inducible gene expression system to exogenously control FAK expression and FAK phosphorylation at the tyrosine residue at position 397 (Y397).
  • the cell-based assay is mechanistically relevant to FAK biology and measures changes in FAK phosphorylation.
  • the cell-based assay of the present invention is flexible and can measure FAK phosphorylation, total FAK phosphorylation, identify mutant FAK proteins and measure a combination of protein and phosphotyrosine.
  • An embodiment of the invention provides a method for identifying cell-active inhibitors of FAK comprising, stably transfecting mammalian cells with a gene encoding FAK, wherein said gene is expressed in the presence of an inducing agent; adding an inducing agent to induce the expression of said gene encoding FAK; adding a test compound; capturing the expressed FAK using a FAK capture agent; exposing the captured FAK to an anti-phospho- tyrosine antibody; and, detecting the phosphorylation of said FAK.
  • the extent of phosphorylation of the FAK is determined by the binding of the anti-phospho- tyrosine antibody to the captured FAK, wherein the amount of anti-phospho-tyrosine antibody binding to the captured FAK is proportional to the amount of phosphorylation of said FAK.
  • the method for identifying cell-active inhibitors of FAK comprises an optional step of coating the mammalian cells on a first solid phase.
  • the first solid phase is preferably a well of a first microtiter plate.
  • the cells coated on the first solid phase are lysed with a lysis buffer, prior to the capture of the expressed FAK.
  • the lysis buffer optionally comprises a solubilizing detergent.
  • the FAK capture agent is coated on a second solid phase, which is preferably a well of a second microtiter plate.
  • the test compound inhibits the phosphorylation of FAK at
  • An embodiment of the invention provides a method for measuring the cytotoxicity of a test compound comprising, stably transfecting mammalian cells with a gene encoding FAK, wherein said gene is expressed in the presence of an inducing agent; adding an inducing agent to induce the expression of said gene encoding FAK; adding a test compound; adding a cytotoxicity indicator to said cells; and, detecting the cytoxicity of the test compound.
  • the cytoxicity of the test compound is determined by the colorimetric conversion of the cytotoxicity indicator, wherein the amount of converted cytotoxicity indicator is proportional to the number of living cells.
  • the method for measuring the cytotoxicity of a test compound comprises an optional step of coating the mammalian cells on a solid phase.
  • the solid phase is preferably a well of a first microtiter plate.
  • An embodiment of the invention provides a method for identifying cell-active inhibitors of focal adhesion kinase (FAK) comprising, coating a first solid phase with a homogeneous population of mammalian cells so that the cells adhere to the first solid phase, wherein said cells are stably transfected with a gene encoding FAK, and wherein said gene is expressed in the presence of an inducing agent; adding an inducing agent to induce the expression of said gene encoding FAK; adding a test compound; solubilizing the adhering cells to release the cell lysate; coating a second solid phase with a FAK capture agent so that the FAK capture agent adheres to the second solid phase; exposing the cell lysate to the adhered FAK capture agent so that the FAK capture agent captures FAK; exposing the captured FAK to an anti-phospho-tyrosine antibody; and, measuring binding of the anti-phospho-tyrosine antibody to the captured FAK, wherein the amount of anti-phospho-tyrosine
  • Another embodiment of the present invention provides a mammalian cell stably transfected with a recombinant nucleic acid molecule, wherein said recombinant nucleic acid molecule is selected from the group consisting of SEQ ID No: 5, SEQ ID No: 6, SEQ ID No: 7 and SEQ ID No: 8, and wherein expression of said sequences requires the presence of an inducing agent.
  • An embodiment of the invention provides a mammalian cell stably transfected with a recombinant nucleic acid molecule, that encodes a protein comprising a sequence selected from the group consisting of SEQ ID NOS: 1 , 2, 3 and 4, and wherein expression of said protein requires the presence of an inducing agent.
  • FAK is also known as the Protein-Tyrosine Kinase 2, PTK2. Any active FAK variant can be employed in the above assay. Inactive mutants can also be used in the assay for various control purposes. Additional variants of FAK that can be employed in the above described assay include, wild type (WT) human FAK at 153012 with 1052 amino acids (SEQ ID NO:1); splice variants of FAK such as described in Andre, E. & Becker-Andre, M., Expression of an N-terminally truncated form of human focal adhesion kinase in brain. Biochem. Biophys. Res. Commun.
  • inducing agent is an agent, compound, or chemical that produces a signal to noise ratio of at least 6-fold.
  • inducing agents include but are not limited to Mifepristone (Ru486) and other antiprogestins such as Org31806 and Org31376. See O'Malley et. al., Cell, 69, 703-713 (1992).
  • capture agent is an agent, compound or chemical that is capable of capturing any form of focal adhesion kinase, including FAK tagged with histidine residues, streptavidin or other comparable affinity tags.
  • the capture agent includes, but is not limited to, the phosphotyrosine FAK Y397 specific antibody, a general phosphotyrosine antibody, anti-FAK antibody, anti-histidine tag antibody and molecules containing biotin which would facilitate the capture of streptavid in-modified FAK.
  • the capture agent includes a combination of one or more antibodies, including but not limited to the combination of goat anti-rabbit antibody and the phosphotyrosine FAK Y397 specific antibody.
  • anti-phospho-tyrosine antibody includes but is not limited to phosphotyrosine FAK Y397 specific antibody as well as general phosphotyrosine antibodies, where the latter are capable of recognizing any phosphorylated tyrosine residue, including but not limited to the tyrosine residue at position 397 of FAK.
  • a cytoxicity indicator is an agent, chemical or compound that is used to assess cell viability.
  • cytoxicity indicators include, but are not limited to tetrazolium salts (e.g. MTT, XTT, WST-1 ) that are especially useful for this type of analysis.
  • MTT is a yellow tetrazolium salt that is cleaved to purple formazan crystals by metabolic active cells.
  • the solubilized formazan product may be spectrophotometrically quantified using an ELISA reader or other spectrophotometric device. The number of living directly correlates to the amount of purple formazan crystals formed, as monitored by the absorbance.
  • an embodiment of the present invention is carried out using a inducible FAK gene expression system having the ability to provide consistent and tight regulation of gene expression.
  • an inducible FAK gene expression system which comprises a system for the regulated expression of a transgene, i.e., FAK.
  • FAK expression is "off” in the absence of an inducing agent, but "on” in its presence.
  • the system consists of two genes: one which codes for a regulatory protein, and the other which codes for the inducible transgene of interest. Expression of the regulatory protein is driven by a constitutive promoter.
  • the inducible FAK transgene has a promoter that consists of a minimal promoter linked to multiple copies of a binding site that is capable of binding the regulatory protein.
  • the regulatory protein is a transcription factor that consists of the yeast GAL4 DNA binding domain, a truncated human progesterone receptor ligand binding domain, and the human p65 activation domain from NF- ⁇ B to facilitate tight regulation of the transgene over basal expression.
  • the plasmid encoding the regulatory protein contains the GAL4 promoter which establishes a positive feedback loop to facilitate rapid response upon ligand treatment.
  • the exogenous control of regulatory protein expression is achieved using a small molecule ligand. Tight regulation is achieved by species selective binding of the regulatory protein to the promoter of the transgene, and through ligand-dependent conformational activation of the regulatory protein.
  • the invention has the following advantages: ⁇ Induction of FAK in cells using an inducible system, which allows for tight repression of gene expression when not induced, resulting in viable cell clones.
  • ⁇ Detection of phosphorylated FAK may be used to identify inhibitors of FAK kinase activity. Some of the methods of detection of phosphorylated FAK include Polyacrylamide gel electrophoresis-based assays and ELISA-based assays for identification of FAK inhibitors. Other suitable detection systems may also be used.
  • the assay allows for detection of total FAK protein, total phosphorylated FAK protein, or FAK protein phosphorylated at a given tyrosine (e.g. tyrosine 397).
  • the cell-based system may be used for in vivo screening of FAK inhibitors, since the transfected cells are tumorigenic and FAK can be induced in vivo by feeding animals Mifepristone. The system's utility in vivo has been demonstrated.
  • ECM-matrigel-induced attachment of cells resulted in no stimulation of FAK phosphorylation as measured by pY54 HRP (Horseradish Peroxidase (HRP)- conjugated phosphotyrosine antibody) detection, and control detection using secondary Anti- Mouse HRP (2°M HRP ) alone resulted in nonspecific increases in assay signal in wells incubated with lysate derived from cells stimulated on matrigel.
  • HRP HapY54 HRP
  • S/N signal and noise ratio
  • Clones were generated that harbored FAK cDNA transcripts that encode either a constitutively active protein (CD2 « FAK), a membrane bound tyrosine-dead protein (CD2'FAK Y397F ), or cytoplasmic FAK mutants that lack key downstream tyrosine residues (e.g., FAK Y86 F , FAK Y925F , and FAK Y861F/Y925F ).
  • a constitutively active protein CD2 « FAK
  • CD2'FAK Y397F membrane bound tyrosine-dead protein
  • cytoplasmic FAK mutants that lack key downstream tyrosine residues (e.g., FAK Y86 F , FAK Y925F , and FAK Y861F/Y925F ).
  • constructs are based on the published sequence for human FAK at GenBank accession number L13616, see Whitney.G.S. et. al., DNA Cell Biol. 12 (9), 823-830 (1993), and each construct was sequence confirmed and aligned against the published sequence.
  • the DNA constructs were engineered to include specific 5' and 3' restriction sites that are unique and distinct over the prior art.
  • the 3' ends of certain constructs were also engineered to include tagged epitopes such as V5 and histidine tags.
  • NIH3T3 NIH Swiss Mouse fibroblast NIH3T3 (ATCC Accession No. CCL-92), the human epidermoid carcinoma A431 (ATCC Accession No. CRL1555), and the human glioblastoma astrocytoma U87MG (ATCC Accession No. HTB-14).
  • Each cell line exhibits unique characteristics that makes its application favorable for overexpression of FAK.
  • NIH3T3 cells offer species specific overexpression of FAK and ease of transfectability
  • A431 cells express moderate levels of endogenous FAK and provide a tumor background more representative of a FAK native environment
  • U87MG cells lack the putative FAK negative regulator PTEN (a tumor suppressor phosphatase).
  • PTEN a tumor suppressor phosphatase
  • the pSwitch regulatory vector was co-transfected with either the pGene Vector V5His, or the pGeneFAK WT V5His, or the pGeneFAK mutants (pGeneFAK K 54R V5His, and pGeneFAK Y397F V5His) into A431 cells.
  • pGeneFAK K 54R V5His pGeneFAK K 54R V5His
  • pGeneFAK Y397F V5His pGeneFAK Y397F V5His
  • NIH3T3:FAK Y397F V5His NIH3T3:Vector, U87MG:FAK WT V5His, and U87MG:FAK Y397F V5His were successfully isolated, selected, confirmed and validated.
  • the FAK inducible assay of this embodiment of the invention measured FAK phosphorylation at Y397.
  • A431:FAK WT V5His cells (about 1.0 x 10 4 to 1.0 x 10 7 cells) are seeded on U-bottom 96-well plates and allowed to attach at 37°C, 5% C0 2 for 4 to 6 hoursprior to overnight incubation in the presence of 0.1 nM Mifepristone.
  • A431 :FAK WT V5His induced cells are either left untreated or treated with inhibitory compounds for 30 minutes at 37°C, 5% C0 2 and lysed in RIPA lysis buffer (50 mM Tris-HCI, pH7.4, 1% NP-40, 0.25% Na-deoxycholate, 150 mM NaCI, 1 mM EDTA, 1 mM Na 3 V0 4 , 1 mM NaF, and one CompleteTM EDTA-free protease inhibitor pellet per 50 ml solution).
  • RIPA lysis buffer 50 mM Tris-HCI, pH7.4, 1% NP-40, 0.25% Na-deoxycholate, 150 mM NaCI, 1 mM EDTA, 1 mM Na 3 V0 4 , 1 mM NaF, and one CompleteTM EDTA-free protease inhibitor pellet per 50 ml solution.
  • NIH3T3:FAK T V5His clones and NIH3T3:FAK Y397F V5His clones were seeded to approximately 80% confluency in T25 flasks and were either left untreated or stimulated with 0.1 nM Mifepristone for approximately 16 hoursat 37°C, 5%C0 .
  • Cell lysates were prepared and immunodepleted of total FAK protein using the Anti-FAK (UBITM, Lake Placid, N.Y.) monoclonal antibody.
  • FAK immunocomplexes were then subject to SDS-Polyacrylamide gel electrophoresis and immunoblotted with Anti-FAK (A17) polyclonal antibody.
  • Table 1 shows densitometric quantitation measured in arbitrary "band light" units of the autoradiographic film and fold changes in FAK protein levels as compared with unstimulated cells.
  • Table 2 shows NIH3T3 clones induced to express FAK T or FAK Y39 F proteins.
  • FAK T and FAK Y397F proteins were captured either to measure total FAK protein or phosphotyrosine FAK Y397 induced by mifepristone.
  • Table 2 Mifepristone induced FAK protein levels as measured by optical density 450 measurements
  • NIH3T3 clones yield a robust phosphotyrosine FAK Y397 and FAK protein signal-to-noise ratio of ⁇ 7 and ⁇ 6, respectively. Both the NIH3T3 tyrosine-dead clone and the vector NIH3T3 transfectants confirm assay specificity for phosphoFAKY397.
  • Table 3 shows A431 :FAK clones assayed under optimized conditions.
  • Table 3 Mifepristone induced FAK protein levels as measured by optical density 450 measurements
  • the A431 :FAK clones yielded a robust phosphotyrosine FAK Y397 and FAK protein signai-to-noise ratio of -17 and -11 , respectively.
  • Both the A431 tyrosine-dead clone and the vector A431 transfectants confirmed assay specificity for phosphoFAKY397.
  • Induction of phosphotyrosine Y397 and FAK proteins were controllable by varying assay conditions such as mifepristone time of incubation, mifepristone concentration, cell density, and antibody concentrations.
  • A431:FAK WT cells were either left untreated or stimulated with mifepristone.
  • a washout experiment was performed to demonstrate a time-dependent decrease in FAK protein and phosphotyrosine Y397 levels (i.e. cells stimulated with mifepristone overnight (16hs) were subsequently cultured in fresh growth media in the absence of mifepristone over time).
  • A431:FAK T cells stimulated with mifepristone were detached and suspended in fresh growth media for 15 minutes followed by re-plating for 4, 24, 48, and 72 hourson tissue culture treated petri dishes.
  • Table 4, experiment A shows densimetric quantitation measured in arbitrary "band light" units of the autoradiographic film and fold changes in FAK phosphorylation as compared to a no stimulation control.
  • FAK may be achieved by re-plating suspended cells to allow cell attachment.
  • Table 4 demonstrates that the mechanism of FAK activation is intact under the regulatory system discussed above. In other words, exogenous stimulation with mifepristone leads to the activation of FAK that is mechanistically relevant.
  • the FAK inducible cell-based assay of the invention was successfully employed in the identification of a number of FAK inhibitors, including PP1 and staurosporin.
  • the assay was used to determine the cytoxicity of particular compounds on FAK-expressing cells.
  • the test compound was placed in contact with FAK-induced or uninduced control cells.
  • Table 5 shows changes in FAK phosphorylation in OD 45 o units upon treatment with increasing concentration of a FAK inhibitor.
  • Table 6 shows densimetric quantitation measured in arbitrary "band light" units of the autoradiographic film and fold changes in FAK phosphorylation in the presence of increasing concentration of the FAK inhibitor.
  • the FAK inducible cell-based assay was used as described in Figure 3 to screen a FAK inhibitor.
  • a 10 ⁇ M curve of an FAK inhibitor was performed in 1/2 log dilutions as shown in Table 5. The % inhibition was determined and the inhibition concentration at 50% (IC 50 ) was calculated.
  • A431 :FAK WT cells were seeded in T25 flask to -80% confluency and were either left untreated or stimulated overnight with 0.1 nM mifepristone. Subsequently, stimulated cells were treated with the same FAK inhibitor as in Table 5 at the same 1/2 log concentrations of a 10 ⁇ M curve for 30 minutes at 37°C, 5% C0 2 . Cell lysates were then prepared and total protein concentration determined by protein assay.
  • the calculated Inhibition Concentration at 50% for the FAK inhibitor was -0.93 uM.
  • Table 6 shows densimetric quantitation measured in arbitrary "band light" units of the autoradiographic film and fold changes in FAK phosphorylation in the presence of increasing concentration of the FAK inhibitor.
  • ECM stimulation of FAK was achieved via plating 2.0x10 5 cells/well (e.g. A2058) on commercially available fibronectin (FN) 96-well plates or on FN 96-well plates prepared in- house. Cells were allowed to attach for 15, 30, 60, or 90 minutes at 37°C, 5%C0 2 to induce integrin engagement and subsequent FAK phosphorylation.
  • FN fibronectin
  • Cells lysates were prepare in RIPA lysis buffer (50 mM Tris-HCI, pH7.4, 1 % NP-40, 0.25% Na-deoxycholate, 150 mM NaCI, 1 mM EDTA, 1 mM Na 3 V0 , 1 mM NaF, and one CompleteTM EDTA-free protease inhibitor pellet per 50 ml solution) and transferred to Anti-FAK coated 96-well plates to capture total FAK protein. Phosphotyrosine FAK proteins were measured using the general phosphotyrosine antibody Py54. Similarly, cells were stimulated on commercially available matrigel coated plates or on matrigel plates prepared in-house.
  • cells were allowed to attach to either commercially available ECM coated flask or to ECM coated flask prepared in-house for the indicated times above.
  • Cell lysates were prepared in RIPA lysis buffer and total and phosphotyrosine FAK proteins were either pull-down or immunodetected using Anti-FAK antibodies or Anti-phosphotyrosine antibodies.
  • Cells e.g. A2058 human metastatic meloanomas
  • Starved Cells (e.g. A2058) were pre-chilled at 4°C for 30 minutes prior to incubation with varying concentrations (1 :100, 1 :330, 1 :1000, 1 :3,300, or 1 :10,000 of stock concentration of 200 ⁇ g/ml) of ⁇ 1-lntegrin antibody (4° C, 30 minutes).
  • ⁇ 1-lntegrin clustering was induced with 1 :500 dilution of Goat anti-mouse secondary antibody for 30 minutes at 4°C.
  • FAK WT and FAK mutants Noninducible and Tet-OnTM/Tet-OffTM Systems
  • the full-length FAK WT cDNA was cloned from a T-cell cDNA library using the primers FAK ⁇ 'Bam: GGATCCATGGCAGCTGCTTACCTTGAC (SEQ ID NO.: 9) and FAK3'Bam: GGATCCTCACTCACTCAGTGTGGTCTCGTCTGCCCA (SEQ ID NO.: 10) in RT-PCR and was sequence confirmed against the accession number L13616.
  • Site-directed mutagenesis of the FAK WT template was performed using the Stratagene QuikChangeTM Site-Directed Mutagenesis Kit.
  • the full-length Focal Adhesion Kinase (FAK WT ) cDNA was cloned from a T-cell cDNA library using the above primers in RT-PCR and was sequence confirmed against the accession number L13616.
  • Site-directed mutagensis of the FAK WT template was performed using the Stratagene QuikChangeTM Site-Directed Mutagenesis Kit.
  • the full-length FAK WT , the tyrosine-dead mutant (FAK Y397F ), and the kinase-dead mutant (FAK K454R ) cDNAs were subcloned into the BamHI-Apal sites of the pGeneV5/His-A plasmid.
  • the dominate-negative FAK-related nonkinase (FRNK) cDNA was subcloned as a Kpnl-Apal insert into the cassette of the pGeneV5/His A-vector. These plasmids were confirmed via DNA sequencing and restriction digestion analysis. Subsequently, these constructs were co-transfected with the pSwitch construct encoding the GeneSwitchTM Protein into NIH3T3, A431, or U87MG cells using Stratagene's GeneJammerTM Transfection reagent.
  • Transfectants were grown and selected in DMEM growth media (10%FBS, Pen/Strep/Glu) spiked with 750 ⁇ g/ml of Zeocin and 50 ⁇ g/ml of hygromycin antibiotics. Hygromycin and Zeocin resistant clones were selected and expanded in culture for screening in both Western and RT-PCR format.
  • A431 « FAK T and A431 « FAK Y397F clones were seeded in T25 flasks to near 80% confluency and were either left untreated or treated with 0.1 nM of Mifepristone ligand overnight ( ⁇ 16hrs).
  • A431 transfectants were then lysed in RIPA lysis buffer (50 mM Tris-HCI, pH7.4, 1 % NP-40, 0.25% Na-deoxycholate, 150 mM NaCI, 1 mM EDTA, 1 mM Na 3 V0 4 , 1 mM NaF, and one CompleteTM EDTA-free protease inhibitor pellet per 50 ml solution) and cell lysates were assayed for total protein concentration.
  • RIPA lysis buffer 50 mM Tris-HCI, pH7.4, 1 % NP-40, 0.25% Na-deoxycholate, 150 mM NaCI, 1 mM EDTA, 1 mM Na 3 V0 4
  • Clones were also screened and verified via RT-PCR. Cytoplasmic mRNA transcripts were isolated and purified from A431 « FAK wild-type and mutant clones for cDNA synthesis using random hexamers. Polymerase chain reactions were subsequently performed on cDNA libraries derived from A431 « FAK transfectants using primers specific to the N-terminus, the internal FAK sequences, and the C-terminus of FAK. Primers specific to the antibiotic transcripts Zeocin or Hygromycin and GAPDH were also used to amplify these genes as internal controls for transfection as well as for the quality of cDNA libraries. Optimization of FAK inducible cell-based System
  • A431 « pGene Vector , A431 « FAK WT , A431 « FAK K454R , and A431 « FAK Y397F clones were seeded in T25 flasks to near 80% confluency and were either left untreated or treated with 0.1 , 10, or 100 nM of Mifepristone ligand overnight ( ⁇ 16hrs).
  • A431 transfectants were then lysed in RIPA lysis buffer (described above) and cell lysates were assayed for total protein concentration. Equivalent total protein concentrations were subject to western analysis immunoblotting for FAK, or FAK mutant, proteins and phosphotyrosine FAK Y397 using standard western blotting techniques. To determine that optimization of Mifepristone concentration in western format translates into an ELISA system, Mifepristone concentration and time of incubation were also optimized in ELISA format.
  • A431'pGene Vector , A431 « FAK WT , and A431 « FAK Y397F clones were seeded in 96-well U-bottom plates at a cell density of 1.2 x 10 6 cells/ml. Cells were allowed to sit at 37°C, 5% C0 2 for 6 to 8 hours prior to FAK induction with Mifepristone ligand. A431 clones were subsequently left untreated or treated with 0.1, 10, 100, or 110 nM of Mifepristone for -0.5, 1.0, 2.0, 4.0 or 24.0 hoursat 37°C, 5% C0 2 .
  • Parameters can be optimized for the particular high thoughput screening system employed, including evaluating the types of 96-well plate (e.g., anti-rabbit, protein A, or protein G), capture antibody concentration, detection antibody concentration, secondary horseradish peroxidase (HRP) antibody concentration, cell density, blocking buffer (e.g. SuperBlock Blocking TBS, 3%BSA blocking), and time of compound treatment.
  • types of 96-well plate e.g., anti-rabbit, protein A, or protein G
  • capture antibody concentration e.g., detection antibody concentration
  • secondary horseradish peroxidase (HRP) antibody concentration e.g. SuperBlock Blocking TBS, 3%BSA blocking
  • cell density e.g. SuperBlock Blocking TBS, 3%BSA blocking
  • blocking buffer e.g. SuperBlock Blocking TBS, 3%BSA blocking
  • A431 FAK WT cells were seeded in T25 flasks to near 80% confluency and were either left untreated or treated with 0.1 nM of Mifepristone ligand overnight ( ⁇ 16hrs).
  • A431 FAK WT uninduced and induced cells were washed with 10 ml of PBS and suspended in 15 ml growth media (DMEM 10%FBS, Pen/Strep/Glu, 750 ⁇ g/ml Zeocin, 50 ug/ml Hygromycin) for 30, 60, 90, or 120 minutes at 37°C, 5% C0 2 .
  • Cells were subsequently lysed in RIPA lysis buffer (described above) and cell lysates were assayed for total protein concentration. Equivalent total protein concentrations were subject to western analysis immunoblotting for FAK or phosphotyrosine FAK Y397 proteins using standard western blotting techniques.
  • A431 « FAK WT and A431 «FAK Y397F clones were seeded in T25 flasks to near 80% confluency and were either left untreated or treated with 0.1 nM of Mifepristone ligand overnight ( ⁇ 16hrs).
  • A431*FAK WT cells were subsequently treated with increasing concentrations of a FAK inhibitor (half-log dilutions of a 10 ⁇ M-starting solution) identified by using the FAK inducible cell-based assay.
  • Cell lysates were then prepared in RIPA lysis buffer and assayed for total protein concentration. Equivalent total protein concentrations were subject to western analysis immunoblotting for FAK, general phosphotyrosine FAK, or phosphotyrosine FAK Y397 proteins using standard western blotting techniques.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Biophysics (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The cell-based assay of the present invention exploits the biology of FAK in conjunction an inducible gene expression system to exogenously control FAK expression and FAK phosphorylation at the tyrosine residue at position 397 (Y<397>). The cell-based assay of the present invention is flexible and can measure FAK phosphorylation at Y397, total FAK phosphorylation, identify mutant FAK proteins and measure a combination of protein and phosphotyrosine.

Description

INDUCIBLE FOCAL ADHESION KINASE CELL ASSAY
Background of the Invention This invention relates to methods and compositions for inducing the expression of the focal adhesion kinase (FAK) gene, which encodes a signaling protein involved in growth factor response and cell migration and is also implicated in disease. The invention is also directed to the identification of FAK inhibitors.
FAK is a cytoplasmic, non-receptor tyrosine kinase. FAK transduces signaling from a diverse group of stimuli (e.g. integrins, cytokines, chemokines, and growth factors) to control a variety of cellular pathways and processes including cell proliferation, migration, morphology, and cell survival. In addition to being expressed in most tissue types, FAK is found at elevated levels in most human cancers, particularly in highly invasive metastases. It has been shown that expression of the dominant-negative FAK-related nonkinase (FRNK) in human tumor cells results in rounded morphology of the cells, the irreversible loss of focal plaques, and subsequent cell death. In addition, the controlled expression of FRNK results in decreased tyrosine phosphorylation of FAK, suggesting that inhibition of FAK phosphorylation may yield a therapeutic index for the treatment of human cancers.
Although the exact mechanisms leading to FAK activation are not well defined, it is believed that FAK enzyme activity resulting in phosphorylation at Y397 (tyrosine residue at position 397) is the critical step in integrin signal transduction (Guan, JL, Int. J. Biochem.Cell.Biol. 29: 1085-96, 1997). The transmembrane integrin receptors are important for linking the extracellular matrix (ECM) proteins with the cellular actin cytoskeleton and the nucleus to regulate cell morphology, tissue architecture, and attachment-induced gene expression. It is believed that colocalization of integrin receptors and FAK to sites of focal adhesion leads to FAK phosphorylation at residue Y397, creating a SH2 docking site for Src- family tyrosine kinases. Src binding to phosphotyrosine FAKY397 leads to preferential phosphorylation of FAK at various downstream tyrosine residues including Y576, Y577, Y861 , and Y925. Phosphorylation of FAK tyrosine residues (Y576/Y577) leads to increased FAK kinase activity and signal transduction to regulate cytoskeletal reorganization, cell proliferation, cell survival, and cell migration. Due to the multiplicity of kinases and substrates involved in the integrin signaling cascade, it is desirable to design assays specific for a particular kinase. An objective of the invention is to design and develop a FAK drug discovery pathway that tracks the biochemical mechanism of FAK. A number of exogenous stimuli can lead to FAK phosphorylation such as (1 ) integrin binding to ECM ligands (e.g. Integrin β1 to Fibronectin); (2) cytokine or chemokine stimulation (e.g. Endothelin1/2, Bombesin, or PMA); (3) growth factor stimulation of tyrosine kinase receptors (e.g. PDGFBB); and (4) integrin antibody cross-linking (e.g. Anti-β1). Conversely, the most feasible exogenous control leading to FAK inactivation is the detachment of cell-to-cell and cell-to-ECM contact (e.g. cell suspension).
SUMMARY OF THE INVENTION The invention relates to a method for identifying cell-active inhibitors of focal adhesion kinase (FAK) comprising:
(a) adding an inducing agent to mammalian cells to induce the expression of a gene encoding FAK, wherein said mammalian cells are stably transfected with said gene, and said gene is expressed in the presence of said inducing agent;
(b) adding a test compound; (c) capturing the expressed FAK using a FAK capture agent; and
(d) detecting phosphorylation of said FAK.
An embodiment of the invention provides a method for measuring the cytotoxicity of a test compound comprising, stably transfecting mammalian cells with a gene encoding FAK, wherein said gene is expressed in the presence of an inducing agent; adding an inducing agent to induce the expression of said gene encoding FAK; adding a test compound; adding a cytotoxicity indicator to said cells; and, detecting the cytoxicity of the test compound. In certain embodiments, the cytoxicity of the test compound is determined by the colorimetric conversion of the cytotoxicity indicator, wherein the amount of converted cytotoxicity indicator is proportional to the number of living cells. An embodiment of the present invention provides a mammalian cell stably transfected with a recombinant nucleic acid molecule, wherein said recombinant nucleic acid molecule is selected from the group consisting of SEQ ID No: 5, SEQ ID No: 6, SEQ ID No: 7 and SEQ ID
No: 8, and wherein expression of said sequences requires the presence of an inducing agent.
An embodiment of the invention provides a mammalian cell stably transfected with a recombinant nucleic acid molecule that encodes a protein comprising a sequence selected from the group consisting of SEQ ID NOS: 1 , 2, 3 and 4, and wherein expression of said protein requires the presence of an inducing agent.
BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows a schematic representation of the detection of phosphorylated FAK using a horseradish peroxidase-conjugated phosphotyrosine antibody (pY54HRP).
Figure 2 shows a schematic representation of the detection of phosphorylated FAK using an unconjugated phosphotyrosine antibody (pY54) followed by a secondary mouse horseradish peroxidase antibody.
Figure 3 shows a schematic representation of a FAK inducible cell-based assay of the invention. DETAILED DESCRIPTION The invention is directed to an inducible cell-based assay for FAK. The cell-based assay exploits the biology of FAK and an inducible gene expression system to exogenously control FAK expression and FAK phosphorylation at the tyrosine residue at position 397 (Y397). By using a FAKY397 phosphorylation-specific cell-based assay, rather than a general phosphotyrosine system, the identification of false-positive inhibitors is avoided. The cell- based assay of the present invention is flexible and can measure FAK phosphorylation at Y397, total FAK phosphorylation, identify mutant FAK proteins and measure a combination of protein and phosphotyrosine. The inducible FAK cell-based assay of the present invention is advantageous in that it provides tight control over ectopic-basal level expression of FAK and rapid de-repression of FAK gene expression via an exogenous stimulant. The cell-based assay is flexible such that the final read-out is mechanistically relevant to FAK biology as measured for phosphotyrosine FAKY397, total FAK phosphotyrosine profile, FAK or mutant proteins, or some combination of protein and phosphotyrosine. In addition, the present invention has been succesfully used to identify a number of FAK inhibitors. As used herein, the term "tight control" refers to the controlled expression of the FAK gene that occurs in the presence of an exogenous stimulant. In other words, the invention provides an inducible gene expression system for FAK, where the expression of FAK is induced in the presence of an appropriate inducible agent. The present invention provides a method for the inducible expression of FAK, wherein the regulated expression of the FAK gene does not adversely affect cell viability.
An embodiment of the invention is directed to a cell-based assay for the screening of FAK inhibitors. The cell-based assay exploits the biology of FAK and an inducible gene expression system to exogenously control FAK expression and FAK phosphorylation at the tyrosine residue at position 397 (Y397). The cell-based assay is mechanistically relevant to FAK biology and measures changes in FAK phosphorylation. By using a FAKY397 phosphorylation-specific cell-based assay, rather than a general phosphotyrosine system, the identification of false-positive inhibitors is avoided. The cell-based assay of the present invention is flexible and can measure FAK phosphorylation, total FAK phosphorylation, identify mutant FAK proteins and measure a combination of protein and phosphotyrosine.
An embodiment of the invention provides a method for identifying cell-active inhibitors of FAK comprising, stably transfecting mammalian cells with a gene encoding FAK, wherein said gene is expressed in the presence of an inducing agent; adding an inducing agent to induce the expression of said gene encoding FAK; adding a test compound; capturing the expressed FAK using a FAK capture agent; exposing the captured FAK to an anti-phospho- tyrosine antibody; and, detecting the phosphorylation of said FAK. In some embodiments, the extent of phosphorylation of the FAK is determined by the binding of the anti-phospho- tyrosine antibody to the captured FAK, wherein the amount of anti-phospho-tyrosine antibody binding to the captured FAK is proportional to the amount of phosphorylation of said FAK.
In certain embodiments of the invention, the method for identifying cell-active inhibitors of FAK comprises an optional step of coating the mammalian cells on a first solid phase. The first solid phase is preferably a well of a first microtiter plate. In other embodiments of the invention, the cells coated on the first solid phase are lysed with a lysis buffer, prior to the capture of the expressed FAK. The lysis buffer optionally comprises a solubilizing detergent. In certain embodiments, the FAK capture agent is coated on a second solid phase, which is preferably a well of a second microtiter plate. In certain embodiments, the test compound inhibits the phosphorylation of FAK at
Y397.
An embodiment of the invention provides a method for measuring the cytotoxicity of a test compound comprising, stably transfecting mammalian cells with a gene encoding FAK, wherein said gene is expressed in the presence of an inducing agent; adding an inducing agent to induce the expression of said gene encoding FAK; adding a test compound; adding a cytotoxicity indicator to said cells; and, detecting the cytoxicity of the test compound. In certain embodiments, the cytoxicity of the test compound is determined by the colorimetric conversion of the cytotoxicity indicator, wherein the amount of converted cytotoxicity indicator is proportional to the number of living cells. In certain embodiments of the invention, the method for measuring the cytotoxicity of a test compound comprises an optional step of coating the mammalian cells on a solid phase. The solid phase is preferably a well of a first microtiter plate.
An embodiment of the invention provides a method for identifying cell-active inhibitors of focal adhesion kinase (FAK) comprising, coating a first solid phase with a homogeneous population of mammalian cells so that the cells adhere to the first solid phase, wherein said cells are stably transfected with a gene encoding FAK, and wherein said gene is expressed in the presence of an inducing agent; adding an inducing agent to induce the expression of said gene encoding FAK; adding a test compound; solubilizing the adhering cells to release the cell lysate; coating a second solid phase with a FAK capture agent so that the FAK capture agent adheres to the second solid phase; exposing the cell lysate to the adhered FAK capture agent so that the FAK capture agent captures FAK; exposing the captured FAK to an anti-phospho-tyrosine antibody; and, measuring binding of the anti-phospho-tyrosine antibody to the captured FAK, wherein the amount of anti-phospho-tyrosine antibody binding to the captured FAK is proportional to the amount of phosphorylation of said FAK. Another embodiment of the present invention provides a mammalian cell stably transfected with a recombinant nucleic acid molecule, wherein said recombinant nucleic acid molecule is selected from the group consisting of SEQ ID No: 5, SEQ ID No: 6, SEQ ID No: 7 and SEQ ID No: 8, and wherein expression of said sequences requires the presence of an inducing agent.
An embodiment of the invention provides a mammalian cell stably transfected with a recombinant nucleic acid molecule, that encodes a protein comprising a sequence selected from the group consisting of SEQ ID NOS: 1 , 2, 3 and 4, and wherein expression of said protein requires the presence of an inducing agent.
FAK is also known as the Protein-Tyrosine Kinase 2, PTK2. Any active FAK variant can be employed in the above assay. Inactive mutants can also be used in the assay for various control purposes. Additional variants of FAK that can be employed in the above described assay include, wild type (WT) human FAK at 153012 with 1052 amino acids (SEQ ID NO:1); splice variants of FAK such as described in Andre, E. & Becker-Andre, M., Expression of an N-terminally truncated form of human focal adhesion kinase in brain. Biochem. Biophys. Res. Commun. 190: 140-147, 1993 (describing an 879 amino acid variant at AAA35819, a 554 amino acid variant at PC1226 and a 431 amino acid variant at PC1227); the 570 catalytic domain of FAK at XP_050337; mouse FAK at NP_032008.1 with 1023/1052 amino acid identity (97%) to human FAK; mouse FAK carboxyl truncated variant at AAH30180.1 with 878/904 amino acid identity (97%) to amino acids 1-903 of human FAK; rat FAK at NP_037213.1 with 1020/1055 amino acid identity (96%) human FAK; FAK variant at JC5494 with 1017/1055 amino acid identity (96%) to human FAK; chicken FAK at Q00944 with 988/1054 amino acid identity (93%) to human FAK; chicken FAK variant at A45388 with 965/1029 amino acid identity (93%) to human FAK; synthetic FAK mutants, including the FAK Y397F (SEQ ID NO:2), K454R (SEQ ID NO:3), FRNK (an amino terminal truncant having FAK residues 694-1052 preceded by an initiator MET) (SEQ ID NO:4), and various phosphorylation mimics including FAK Y397D, Y397E, Y577D, Y577E, Y861D, Y861E, Y925D, Y925E and combinations thereof; CD2-FAK fusion (a constitutively active FAK fusion with CD2) described by in Chan P, et al., J Biol. Chem. (1994); 269 (32): 20567-74.
As used herein, the term "inducing agent" is an agent, compound, or chemical that produces a signal to noise ratio of at least 6-fold. Examples of inducing agents include but are not limited to Mifepristone (Ru486) and other antiprogestins such as Org31806 and Org31376. See O'Malley et. al., Cell, 69, 703-713 (1992). As used herein, the term capture agent is an agent, compound or chemical that is capable of capturing any form of focal adhesion kinase, including FAK tagged with histidine residues, streptavidin or other comparable affinity tags. The capture agent includes, but is not limited to, the phosphotyrosine FAKY397 specific antibody, a general phosphotyrosine antibody, anti-FAK antibody, anti-histidine tag antibody and molecules containing biotin which would facilitate the capture of streptavid in-modified FAK. In certain embodiments of the invention, the capture agent includes a combination of one or more antibodies, including but not limited to the combination of goat anti-rabbit antibody and the phosphotyrosine FAKY397 specific antibody.
As used herein, the term "anti-phospho-tyrosine antibody" includes but is not limited to phosphotyrosine FAKY397 specific antibody as well as general phosphotyrosine antibodies, where the latter are capable of recognizing any phosphorylated tyrosine residue, including but not limited to the tyrosine residue at position 397 of FAK.
As used herein, a cytoxicity indicator is an agent, chemical or compound that is used to assess cell viability. Examples of cytoxicity indicators include, but are not limited to tetrazolium salts (e.g. MTT, XTT, WST-1 ) that are especially useful for this type of analysis. MTT is a yellow tetrazolium salt that is cleaved to purple formazan crystals by metabolic active cells. The solubilized formazan product may be spectrophotometrically quantified using an ELISA reader or other spectrophotometric device. The number of living directly correlates to the amount of purple formazan crystals formed, as monitored by the absorbance. An embodiment of the present invention is carried out using a inducible FAK gene expression system having the ability to provide consistent and tight regulation of gene expression. In an embodiment of the invention, an inducible FAK gene expression system is provided, which comprises a system for the regulated expression of a transgene, i.e., FAK. FAK expression is "off" in the absence of an inducing agent, but "on" in its presence. The system consists of two genes: one which codes for a regulatory protein, and the other which codes for the inducible transgene of interest. Expression of the regulatory protein is driven by a constitutive promoter. The inducible FAK transgene has a promoter that consists of a minimal promoter linked to multiple copies of a binding site that is capable of binding the regulatory protein. In an embodiment of the invention, the regulatory protein is a transcription factor that consists of the yeast GAL4 DNA binding domain, a truncated human progesterone receptor ligand binding domain, and the human p65 activation domain from NF-κB to facilitate tight regulation of the transgene over basal expression. The plasmid encoding the regulatory protein contains the GAL4 promoter which establishes a positive feedback loop to facilitate rapid response upon ligand treatment. The exogenous control of regulatory protein expression is achieved using a small molecule ligand. Tight regulation is achieved by species selective binding of the regulatory protein to the promoter of the transgene, and through ligand-dependent conformational activation of the regulatory protein.
Thus, in certain embodiments, the invention has the following advantages: ■ Induction of FAK in cells using an inducible system, which allows for tight repression of gene expression when not induced, resulting in viable cell clones. ■ Detection of phosphorylated FAK may be used to identify inhibitors of FAK kinase activity. Some of the methods of detection of phosphorylated FAK include Polyacrylamide gel electrophoresis-based assays and ELISA-based assays for identification of FAK inhibitors. Other suitable detection systems may also be used. ■ The assay allows for detection of total FAK protein, total phosphorylated FAK protein, or FAK protein phosphorylated at a given tyrosine (e.g. tyrosine 397).
■ The cell-based system may be used for in vivo screening of FAK inhibitors, since the transfected cells are tumorigenic and FAK can be induced in vivo by feeding animals Mifepristone. The system's utility in vivo has been demonstrated. COMPARATIVE EXAMPLES
Comparative Example 1
Attempts were made to generate stable ectopically expressed FAK or FAK mutant proteins in a variety of cell backgrounds in hopes of improving assay signal and noise. These efforts, however, also proved unsuccessful since most of these cells demonstrated sensitivity to changes in FAK protein levels and never formed viable clones with which to develop a cell- based assay. Cells expressing low to moderate levels of endogenous FAK such as NIH3T3 mouse fibroblast or A2058 human metastatic melanoma cells tolerated no more than two-fold expression of FAK over endogenous levels. Consequently, these clones proved insufficient for development of the assay due to similar reasons described above: poor stimulation and reproducibility, high background noise, and not conducive to drug discovery. Therefore, non- inducible expression of FAK in cells containing native FAK was not found to be suited for studying the induction of FAK expression. Comparative Example 2 In order to develop a FAK cell-based assay that is both conducive to Medium and High Throughput Screening (ELISA system) and tracks the biochemical mechanism of FAK, a number of approaches were taken to exploit FAK biology. For example, attempts were made to mimic adherent cell stimulation of FAK by plating cells on Extracellular matrix proteins (ECM) proteins such as fibronectin, or collagen, or other ECMs such as matrigel, but this approach proved inefficient, resulted in poor stimulation of FAK, and was entirely dependent on cell type. Furthermore, ECM-matrigel-induced attachment of cells resulted in no stimulation of FAK phosphorylation as measured by pY54HRP (Horseradish Peroxidase (HRP)- conjugated phosphotyrosine antibody) detection, and control detection using secondary Anti- MouseHRP (2°MHRP) alone resulted in nonspecific increases in assay signal in wells incubated with lysate derived from cells stimulated on matrigel. The signal and noise ratio (S/N) when using a combination of pY54HRP and 2°MHRP ranged from 1.0 to 1.7, while a combination of pY54 (unconjugated phosphotyrosine antibody) and 2°MHRP yielded a S/N ratio of 1.0 to 2.4. This suggested, and it was confirmed, that the nonspecific increase in assay signal was due to cross-reactivity to some matrigel contaminant(s) in the cell lysate. Hence, the above approach to develop an appropriate FAK cell-based assay was not viable.
Results also demonstrated a modest and suboptimal two- to three-fold signal over noise stimulation of FAK phosphorylation upon cell attachment to either ECM matrigel or fibronectin. Further optimization of these assay conditions either by varying cell number, cell- ECM time for attachment, type of detection and capture antibodies, and combinatorial stimulation using Endothelin-1 and Phorbol 12-Myristate 13-Acetate (PMA) indicated that these non-inducible methods of FAK stimulation were insufficient, irreproducible, and not feasible for assay development. Comparative Example 3
Since integrin clustering leads to FAK phosphorylation, the feasibility of antibody crosslinking of integrin receptors using antibodies specific to β1 integrin was also examined. However these efforts also proved to be unsuccessful because indirect methods of FAK stimulation lead to high variability and irreproducibility. For example, integrin β1 cross-linking proved to be too cumbersome for even medium throughput screening since optimal stimulation required temperature sensitive steps that were time consuming and difficult to manage. Moreover, maintaining cells on polystyrene plates to lower background noise resulted in decrease cell viability due to poor ECM contact, thereby making these non- inducible expression systems infeasible for assay development. Comparative Example 4
To advance the development of the FAK cell-based assay, an attempt was made to generate stable clones expressing either wild-type or mutant FAK proteins in a variety of cell backgrounds. Clones were generated that harbored FAK cDNA transcripts that encode either a constitutively active protein (CD2«FAK), a membrane bound tyrosine-dead protein (CD2'FAKY397F), or cytoplasmic FAK mutants that lack key downstream tyrosine residues (e.g., FAKY86 F, FAKY925F, and FAKY861F/Y925F). These biological tools were strategically designed based on the knowledge of FAK biology in order to address the issues described above and to necessitate the development of a robust and reproducible cell-based assay conducive to drug discovery. Attempts to generate stable clones overexpressing FAKWT were unsuccessful, even though viable control clones expressing either vector construct or the LacZ protein were obtained. Transfection of FAK mutant constructs designed either to shut down downstream phosphorylation of FAK while preserving FAK phosphorylation at Y397 and kinase activity (FAKY861F, FAKY925F, and FAKY861F Y925F), or to bypass the requirement for integrin receptors (CD2«FAKWT and CD2«FAKY397F), also proved unsuccessful. In cells that expressed low to moderate levels of endogenous FAK, such as the human metastatic melanoma A2058, viable clones were identified. However, A2058«FAKWT clones exhibit only an approximate two-fold increase in FAK levels which proved insufficient for development of the FAK cell based assay. In addition to the work on exogenous stimulation, control over basal FAK phosphorylation and attempts to ectopically express FAK clones, FAKWT and tyrosine-dead FAKY397F cDNAs were subjected to tetracycline control using the Tet-On/Tet-Off inducible systems. However, no FAKm or FAKY397F transfectants were detected. Since viable clones could not be identified, the level of "leakiness", i.e., inadequate regulation of basal expression, in the FAKWT or FAKY397F Tet-transfectants could not be determined. The Tet-On™/Tet-Off™ systems demonstrated variable control over target protein expression, and therefore were not suited for the regulation of lethal genes like FAK.
WORKING EXAMPLES The wild-type FAKWT (SEQ ID NO: 5), tyrosine-dead FAKY397F (SEQ ID NO: 6), kinase-dead FAKK454R (SEQ ID NO: 7) and the dominate-negative FAK-related nonkinase (FRNK) (SEQ ID NO: 8) were cloned into the GeneSwitch™ pGeneV5/His A-vector backbone as either BamHI-Apal or Kpnl-Apal inserts. As used herein, the term "gene encoding FAK" includes without limitation, SED ID NOS: 1-4. These constructs are based on the published sequence for human FAK at GenBank accession number L13616, see Whitney.G.S. et. al., DNA Cell Biol. 12 (9), 823-830 (1993), and each construct was sequence confirmed and aligned against the published sequence. The DNA constructs were engineered to include specific 5' and 3' restriction sites that are unique and distinct over the prior art. In addition, the 3' ends of certain constructs were also engineered to include tagged epitopes such as V5 and histidine tags.
Several cell lines were selected for transfection including the NIH Swiss Mouse fibroblast NIH3T3 (ATCC Accession No. CCL-92), the human epidermoid carcinoma A431 (ATCC Accession No. CRL1555), and the human glioblastoma astrocytoma U87MG (ATCC Accession No. HTB-14). Each cell line exhibits unique characteristics that makes its application favorable for overexpression of FAK. For example, NIH3T3 cells offer species specific overexpression of FAK and ease of transfectability, A431 cells express moderate levels of endogenous FAK and provide a tumor background more representative of a FAK native environment, and U87MG cells lack the putative FAK negative regulator PTEN (a tumor suppressor phosphatase). Using Stratagene's GeneJammer™ Transfection reagent, the pSwitch regulatory vector was co-transfected with either the pGeneVectorV5His, or the pGeneFAKWTV5His, or the pGeneFAK mutants (pGeneFAKK 54RV5His, and pGeneFAKY397FV5His) into A431 cells. Similarly, NIH3T3 and U87MG cells were transformed to co-express the pSwitch regulatory protein and the specific pGene construct of interest. Hygromycin and Zeocin resistant clones were selected and expanded in culture for screening via western and RT-PCR analysis. Several inducible clones including, A431 :FAKWTV5His, A431 :FAKY397FV5His, A431 :FAKK454 V5His, A431 :Vector, NIH3T3:FAKWTV5His,
NIH3T3:FAKY397FV5His, NIH3T3:Vector, U87MG:FAKWTV5His, and U87MG:FAKY397FV5His were successfully isolated, selected, confirmed and validated.
The FAK inducible assay of this embodiment of the invention measured FAK phosphorylation at Y397. A431:FAKWTV5His cells (about 1.0 x 104 to 1.0 x 107 cells) are seeded on U-bottom 96-well plates and allowed to attach at 37°C, 5% C02 for 4 to 6 hoursprior to overnight incubation in the presence of 0.1 nM Mifepristone. Subsequently, A431 :FAKWTV5His induced cells are either left untreated or treated with inhibitory compounds for 30 minutes at 37°C, 5% C02 and lysed in RIPA lysis buffer (50 mM Tris-HCI, pH7.4, 1% NP-40, 0.25% Na-deoxycholate, 150 mM NaCI, 1 mM EDTA, 1 mM Na3V04, 1 mM NaF, and one Complete™ EDTA-free protease inhibitor pellet per 50 ml solution). Approximately 45 μg of total protein (100 μl) is then transferred to goat Anti-rabbit plates coated with 0.35 μg/well of Anti-FAK phosphospecific Y397 antibody for the capture and subsequent detection of phosphorylated FAK proteins (See Figure 3).
NIH3T3:FAK TV5His clones and NIH3T3:FAKY397FV5His clones were seeded to approximately 80% confluency in T25 flasks and were either left untreated or stimulated with 0.1 nM Mifepristone for approximately 16 hoursat 37°C, 5%C0 . Cell lysates were prepared and immunodepleted of total FAK protein using the Anti-FAK (UBI™, Lake Placid, N.Y.) monoclonal antibody. FAK immunocomplexes were then subject to SDS-Polyacrylamide gel electrophoresis and immunoblotted with Anti-FAK (A17) polyclonal antibody. Table 1 shows densitometric quantitation measured in arbitrary "band light" units of the autoradiographic film and fold changes in FAK protein levels as compared with unstimulated cells.
Table 1 : Mifepristone induced FAK protein levels as measured by Densimetric Quantitation
It was observed that FAK T inducible clones responded very well to mifepristone stimulation.
The above conditions translated easily to a 96-well ELISA format. Table 2 shows NIH3T3 clones induced to express FAK T or FAKY39 F proteins. FAK T and FAKY397F proteins were captured either to measure total FAK protein or phosphotyrosine FAKY397 induced by mifepristone.
Table 2: Mifepristone induced FAK protein levels as measured by optical density 450 measurements
It was observed that NIH3T3 clones yield a robust phosphotyrosine FAKY397 and FAK protein signal-to-noise ratio of ~7 and ~6, respectively. Both the NIH3T3 tyrosine-dead clone and the vector NIH3T3 transfectants confirm assay specificity for phosphoFAKY397.
Table 3 shows A431 :FAK clones assayed under optimized conditions.
Table 3: Mifepristone induced FAK protein levels as measured by optical density 450 measurements
Under optimal conditions, the A431 :FAK clones yielded a robust phosphotyrosine FAKY397 and FAK protein signai-to-noise ratio of -17 and -11 , respectively. Both the A431 tyrosine-dead clone and the vector A431 transfectants confirmed assay specificity for phosphoFAKY397. Induction of phosphotyrosine Y397 and FAK proteins were controllable by varying assay conditions such as mifepristone time of incubation, mifepristone concentration, cell density, and antibody concentrations.
The mechanism of FAK activation in A431 and other cell backgrounds was studied. A431:FAKWT cells were either left untreated or stimulated with mifepristone. First, a washout experiment was performed to demonstrate a time-dependent decrease in FAK protein and phosphotyrosine Y397 levels (i.e. cells stimulated with mifepristone overnight (16hs) were subsequently cultured in fresh growth media in the absence of mifepristone over time). Second, A431:FAK T cells stimulated with mifepristone were detached and suspended in fresh growth media for 15 minutes followed by re-plating for 4, 24, 48, and 72 hourson tissue culture treated petri dishes. Table 4, experiment A, shows densimetric quantitation measured in arbitrary "band light" units of the autoradiographic film and fold changes in FAK phosphorylation as compared to a no stimulation control.
Table 4: FAK phosphorylation as measured by Densimetric Quantitation
Experiment A
Experiment B
In experiment B, a modest 4-fold induction over untreated cells was observed. However, suspending stimulated cells for 15 minutes in fresh growth media followed by a 4- hour attachment to plastic led to a decrease in phosphoFAK"8'. Moreover, allowing suspended mifepristone-induced cells to re-attach for 24 hours resulted in the re-activation of phosphotyrosine FAKY397, suggesting that the mechanism of FAK activation was intact. Consistent with a time-dependent decrease in FAK protein levels, phosphotyrosine FAKY397 decreased to unstimulated control levels by 72 hours.
Cellular suspension leads to inactivation of FAK phosphorylation. Re-activation of
FAK may be achieved by re-plating suspended cells to allow cell attachment. Table 4 demonstrates that the mechanism of FAK activation is intact under the regulatory system discussed above. In other words, exogenous stimulation with mifepristone leads to the activation of FAK that is mechanistically relevant.
The FAK inducible cell-based assay of the invention was successfully employed in the identification of a number of FAK inhibitors, including PP1 and staurosporin. In addition, the assay was used to determine the cytoxicity of particular compounds on FAK-expressing cells. In these experiments, the test compound was placed in contact with FAK-induced or uninduced control cells. Table 5 shows changes in FAK phosphorylation in OD45o units upon treatment with increasing concentration of a FAK inhibitor. Table 6 shows densimetric quantitation measured in arbitrary "band light" units of the autoradiographic film and fold changes in FAK phosphorylation in the presence of increasing concentration of the FAK inhibitor. Thus, the assay of the invention can be advantageously used in a FAK drug discovery program.
The FAK inducible cell-based assay was used as described in Figure 3 to screen a FAK inhibitor. A 10 μM curve of an FAK inhibitor was performed in 1/2 log dilutions as shown in Table 5. The % inhibition was determined and the inhibition concentration at 50% (IC50) was calculated. A431 :FAKWT cells were seeded in T25 flask to -80% confluency and were either left untreated or stimulated overnight with 0.1 nM mifepristone. Subsequently, stimulated cells were treated with the same FAK inhibitor as in Table 5 at the same 1/2 log concentrations of a 10 μM curve for 30 minutes at 37°C, 5% C02. Cell lysates were then prepared and total protein concentration determined by protein assay. Equivalent amounts of total protein were subject to SDS-Polyacrylamide gel electrophoresis and western analysis using the phosphotyrosine FAKY397 specific antibody, the general phosphotyrosine pY20 antibody, and the Anti-FAK (A17) antibody.
Table 5: FAK phosphorylation as measured by optical density 450 measurements
The calculated Inhibition Concentration at 50% for the FAK inhibitor was -0.93 uM.
Table 6 shows densimetric quantitation measured in arbitrary "band light" units of the autoradiographic film and fold changes in FAK phosphorylation in the presence of increasing concentration of the FAK inhibitor. These experiments further demonstrate the usefulness of the assay of the invention in a FAK drug discovery program.
Table 6: FAK phosphorylation as measured by Densimetric Quantitation
As a control for protein loading, the amounts of FAK protein in experiment A were equivalent and incubation with the FAK inhibitor did not have any effect on FAK expression. In experiment B, consistent with the IC50 reported in Table 5, an Anti-FAKpY397 blot showed an estimated IC50 value in the range of 0.37 and 1.1 uM, where the 50% concentration is closer to 1.1 μM. As seen in experiment C, similarly and consistent with FAK biology, total FAK phosphorylation as measured by an Anti-pY20 immunoblot was inhibited by the inhibitor in an estimate IC50 range of 1.1 to 3.3 μM, where the 50% inhibition concentration was closer to 3.3 μM. Exogenous Control of FAK phosphorylation
ECM stimulation of FAK was achieved via plating 2.0x105 cells/well (e.g. A2058) on commercially available fibronectin (FN) 96-well plates or on FN 96-well plates prepared in- house. Cells were allowed to attach for 15, 30, 60, or 90 minutes at 37°C, 5%C02 to induce integrin engagement and subsequent FAK phosphorylation. Cells lysates were prepare in RIPA lysis buffer (50 mM Tris-HCI, pH7.4, 1 % NP-40, 0.25% Na-deoxycholate, 150 mM NaCI, 1 mM EDTA, 1 mM Na3V0 , 1 mM NaF, and one Complete™ EDTA-free protease inhibitor pellet per 50 ml solution) and transferred to Anti-FAK coated 96-well plates to capture total FAK protein. Phosphotyrosine FAK proteins were measured using the general phosphotyrosine antibody Py54. Similarly, cells were stimulated on commercially available matrigel coated plates or on matrigel plates prepared in-house. For western analysis, cells were allowed to attach to either commercially available ECM coated flask or to ECM coated flask prepared in-house for the indicated times above. Cell lysates were prepared in RIPA lysis buffer and total and phosphotyrosine FAK proteins were either pull-down or immunodetected using Anti-FAK antibodies or Anti-phosphotyrosine antibodies. Cells (e.g. A2058 human metastatic meloanomas) were seeded in growth media
(DMEM10%FBS, Pen/Strep/Glu ) on 96-well plates or T25/T75 flasks and allowed to adhere to tissue culture treated plastic for approximately five hours at 37°C, 5% C02. Subsequently, they were starved in 0.1% FBS DMEM starvation media overnight at 37°C, 5% C02, followed by stimulation via treatment with (up to 100 μM) Endothelin I, (up to 100 nM) Bombesin, or (up to 800 nM) PMA. Exposure to cytokines varied from 10 minutes to as long as 60 minutes at 37°C, 5% C02. Total FAK proteins were either captured in ELISA format or immunoprecipitated using Anti-FAK specific antibodies. Phosphotyrosine FAK proteins were then detected with a general Anti-phopshotyrosine antibody either in ELISA or Western format.
Starved Cells (e.g. A2058) were pre-chilled at 4°C for 30 minutes prior to incubation with varying concentrations (1 :100, 1 :330, 1 :1000, 1 :3,300, or 1 :10,000 of stock concentration of 200 μg/ml) of β1-lntegrin antibody (4° C, 30 minutes). β1-lntegrin clustering was induced with 1 :500 dilution of Goat anti-mouse secondary antibody for 30 minutes at 4°C. Whole cell lysates were then prepared in lysis buffer (10 mM Tris-HCI, 5-mM NaCI, 10 mM EDTA, 2mM Na Vanadate, 1%NP40, protease inhibitors), and total FAK proteins were immunoprecipitated using Anti-FAK antibody. Phosphotyrosine FAK proteins were measured using the Anti- phosphotyrosine antibody Py54.
Cloning of FAKWT and FAK mutants (Noninducible and Tet-On™/Tet-Off™ Systems) The full-length FAKWT cDNA was cloned from a T-cell cDNA library using the primers FAKδ'Bam: GGATCCATGGCAGCTGCTTACCTTGAC (SEQ ID NO.: 9) and FAK3'Bam: GGATCCTCACTCACTCAGTGTGGTCTCGTCTGCCCA (SEQ ID NO.: 10) in RT-PCR and was sequence confirmed against the accession number L13616. Site-directed mutagenesis of the FAKWT template was performed using the Stratagene QuikChange™ Site-Directed Mutagenesis Kit. To generate plasmids for electroporation into Clontech pre-made HeLa or HEK293 tet-On/tet-Off cell lines, the full-length FAKWT, the tyrosine-dead mutant (FAKY397F), and the kinase-dead mutant (FAKK454R) cDNAs were subcloned into the BamHI sites of the pTRE:FLAG vector. The following constructs were generated and electroporated into HeLa Tet-Off, HeLa Tet-On, or 293 Tet-On: pTRE:FLAG Vector, pTRE:FAKOTFLAG, and pTRE:FAKY397FFLAG. G418 resistant clones were selected and expanded in DMEM+100ug/ml G418 growth media. Cloning of FAKWT and FAK mutants (GeneSwitch™ System)
The full-length Focal Adhesion Kinase (FAKWT) cDNA was cloned from a T-cell cDNA library using the above primers in RT-PCR and was sequence confirmed against the accession number L13616. Site-directed mutagensis of the FAKWT template was performed using the Stratagene QuikChange™ Site-Directed Mutagenesis Kit. The full-length FAKWT, the tyrosine-dead mutant (FAKY397F), and the kinase-dead mutant (FAKK454R) cDNAs were subcloned into the BamHI-Apal sites of the pGeneV5/His-A plasmid. The dominate-negative FAK-related nonkinase (FRNK) cDNA was subcloned as a Kpnl-Apal insert into the cassette of the pGeneV5/His A-vector. These plasmids were confirmed via DNA sequencing and restriction digestion analysis. Subsequently, these constructs were co-transfected with the pSwitch construct encoding the GeneSwitch™ Protein into NIH3T3, A431, or U87MG cells using Stratagene's GeneJammer™ Transfection reagent. Transfectants were grown and selected in DMEM growth media (10%FBS, Pen/Strep/Glu) spiked with 750 μg/ml of Zeocin and 50 μg/ml of hygromycin antibiotics. Hygromycin and Zeocin resistant clones were selected and expanded in culture for screening in both Western and RT-PCR format.
Screening of A431»FAK clones
A431«FAK T and A431«FAKY397F clones were seeded in T25 flasks to near 80% confluency and were either left untreated or treated with 0.1 nM of Mifepristone ligand overnight (~16hrs). A431 transfectants were then lysed in RIPA lysis buffer (50 mM Tris-HCI, pH7.4, 1 % NP-40, 0.25% Na-deoxycholate, 150 mM NaCI, 1 mM EDTA, 1 mM Na3V04, 1 mM NaF, and one Complete™ EDTA-free protease inhibitor pellet per 50 ml solution) and cell lysates were assayed for total protein concentration. Equivalent total protein concentrations were subject to western analysis immunoblotting for FAK, or FAK mutant, proteins and phosphotyrosine FAKY397 using standard western blotting techniques. Clones tested positive and exhibit at least 3X induction over endogenous FAK levels were selected for optimization and development of the FAK cell-based assay.
Clones were also screened and verified via RT-PCR. Cytoplasmic mRNA transcripts were isolated and purified from A431 «FAK wild-type and mutant clones for cDNA synthesis using random hexamers. Polymerase chain reactions were subsequently performed on cDNA libraries derived from A431«FAK transfectants using primers specific to the N-terminus, the internal FAK sequences, and the C-terminus of FAK. Primers specific to the antibiotic transcripts Zeocin or Hygromycin and GAPDH were also used to amplify these genes as internal controls for transfection as well as for the quality of cDNA libraries. Optimization of FAK inducible cell-based System
A431«pGeneVector, A431«FAKWT, A431«FAKK454R, and A431«FAKY397F clones were seeded in T25 flasks to near 80% confluency and were either left untreated or treated with 0.1 , 10, or 100 nM of Mifepristone ligand overnight (~16hrs). A431 transfectants were then lysed in RIPA lysis buffer (described above) and cell lysates were assayed for total protein concentration. Equivalent total protein concentrations were subject to western analysis immunoblotting for FAK, or FAK mutant, proteins and phosphotyrosine FAKY397 using standard western blotting techniques. To determine that optimization of Mifepristone concentration in western format translates into an ELISA system, Mifepristone concentration and time of incubation were also optimized in ELISA format.
A431'pGeneVector, A431«FAKWT, and A431«FAKY397F clones were seeded in 96-well U-bottom plates at a cell density of 1.2 x 106 cells/ml. Cells were allowed to sit at 37°C, 5% C02 for 6 to 8 hours prior to FAK induction with Mifepristone ligand. A431 clones were subsequently left untreated or treated with 0.1, 10, 100, or 110 nM of Mifepristone for -0.5, 1.0, 2.0, 4.0 or 24.0 hoursat 37°C, 5% C02. Cells were then lysed in RIPA lysis buffer and 100 μl of cell lysate (45 μg total protein) were transferred to 96 well plates. FAK or FAK mutant proteins and phosphotyrosine FAKY397 were subsequently captured on goat anti- mouse or goat anti-rabbit plates coated with either FAK specific antibodies or phosphotyrosine FAKY397 antibodies, respectively. To capture FAK or FAK mutant proteins, for example, goat anti-mouse plates were coated with 0.5μg/ml of Anti-FAK (UBI) monoclonal antibodies prior to incubation with 100 μl of cell lysate (45 μg total protein). Detection of captured FAK or FAK mutant proteins were then measured by Anti-FAK (A17) polyclonal antibody. Similarly, capture of phosphotyrosine FAKY397 proteins were performed via coating goat anti-rabbit plates with 3.5 μg/ml of Anti-FAKp[Y397] polyclonal antibody, followed by detection using Anti-FAK (UBI) monoclonal antibody.
Parameters can be optimized for the particular high thoughput screening system employed, including evaluating the types of 96-well plate (e.g., anti-rabbit, protein A, or protein G), capture antibody concentration, detection antibody concentration, secondary horseradish peroxidase (HRP) antibody concentration, cell density, blocking buffer (e.g. SuperBlock Blocking TBS, 3%BSA blocking), and time of compound treatment.
Using purified GST'FAK protein that is phosphorylated at residue Y397, optimization of capture antibody concentration was first determined by coating 96-well Anti-rabbit plates with increasing concentrations of anti-FAKp[Y397] phosphospecific antibody. A plot of captured phosphospecific GST*FAKY397 vs. Anti-FAKp[Y397] antibody concentration was generated to determine the optimal capture antibody concentration. Using this preliminary Anti-FAKp[Y397] capture concentration, the other parameters (detection and secondary antibody concentrations, cell density, blocking buffer) were optimized and formatted for High Throughput Screening (HTS). Most of these parameters were optimized or evaluated simultaneously either by establishing a 96-well matrix or by cross-comparing changes in signal-to-noise ratios among a number of permutations. For example, on 96-well Anti-rabbit plates coated with 3.5 μg/ml of Anti-FAKp[Y397] capture antibody, increasing concentrations of Detection and SecondaryHRP antibodies were set-up in a 96-well matrix to detect captured phosphotyrosine FAKY397 proteins to optimized the concentrations of these antibodies. This experiment may be repeated on Protein A plates and/or by varying blocking buffer or other parameters to cross compare the signal-to-noise values among the number of permutations to optimize the system. Validation of FAK cell based assay
A431«FAKWT cells were seeded in T25 flasks to near 80% confluency and were either left untreated or treated with 0.1 nM of Mifepristone ligand overnight (~16hrs). A431»FAKWT uninduced and induced cells were washed with 10 ml of PBS and suspended in 15 ml growth media (DMEM 10%FBS, Pen/Strep/Glu, 750 μg/ml Zeocin, 50 ug/ml Hygromycin) for 30, 60, 90, or 120 minutes at 37°C, 5% C02. Cells were subsequently lysed in RIPA lysis buffer (described above) and cell lysates were assayed for total protein concentration. Equivalent total protein concentrations were subject to western analysis immunoblotting for FAK or phosphotyrosine FAKY397 proteins using standard western blotting techniques.
A431«FAKWT and A431«FAKY397F clones were seeded in T25 flasks to near 80% confluency and were either left untreated or treated with 0.1 nM of Mifepristone ligand overnight (~16hrs). A431*FAKWT cells were subsequently treated with increasing concentrations of a FAK inhibitor (half-log dilutions of a 10 μM-starting solution) identified by using the FAK inducible cell-based assay. Cell lysates were then prepared in RIPA lysis buffer and assayed for total protein concentration. Equivalent total protein concentrations were subject to western analysis immunoblotting for FAK, general phosphotyrosine FAK, or phosphotyrosine FAKY397 proteins using standard western blotting techniques.

Claims

CLAIMSWhat is claimed is:
1. A method for identifying cell-active inhibitors of focal adhesion kinase (FAK) comprising: (a) adding an inducing agent to mammalian cells to induce the expression of a gene encoding FAK, wherein said mammalian cells are stably transfected with said gene, and said gene is expressed in the presence of said inducing agent;
(b) adding a test compound;
(c) capturing the expressed FAK using a FAK capture agent; and (d) detecting phosphorylation of said FAK.
2. The method of claim 1 wherein said mammalian cells are coated on a first solid phase, and wherein phosphorylation of FAK is detected by exposing phosphorylated FAK to an anti-phospho-tyrosine antibody and detecting the presence of said antibody.
3. The method of claim 1 wherein said FAK capture agent comprises one or more types of antibodies.
4. The method of claim 3, wherein said one or more types of antibodies comprise an anti-phospho-tyrosine antibody.
5. The method of claim 1 wherein said phosphorylation is proportional to the binding of anti-phospho-tyrosine antibody to the captured FAK.
6. The method of claim 2 wherein said cells naturally adhere to the first solid phase and wherein said cells are lysed with a lysis buffer prior to capturing the expressed FAK.
7. The method of claim 1 wherein the inducing agent is an agonist for the expression of the gene encoding FAK.
8. The method of claim 1 wherein said test compound inhibits the kinase- dependent phosphorylation of FAK.
9. A method for measuring the cytotoxicity of a test compound comprising:
(a) stably transfecting mammalian cells with a gene encoding FAK, wherein said gene is expressed in the presence of an inducing agent; (b) adding an inducing agent to induce the expression of said gene encoding
FAK;
(c) adding the test compound;
(d) adding a cytotoxicity indicator to said cells; and,
(e) detecting the cytoxicity of the test compound.
10. A mammalian cell stably transfected with a recombinant nucleic acid molecule, that encodes a protein comprising a sequence selected from the group consisting of SEQ ID NOS: 1 , 2, 3 and 4, and wherein expression of said protein requires the presence of an inducing agent.
11. A mammalian cell that is stably transfected with a recombinant nucleic acid that inducibly expresses FAK protein.
12. The mammalian cell of claim 11 , wherein the nucleic acid encodes proteins selected from the group consisting of human FAK splice variants, catalytic domain of human FAK, mouse FAK, rat FAK and chicken FAK.
13. A mammalian cell stably transfected with a recombinant nucleic acid molecule comprising a polynucleotide selected from the group consisting of SEQ ID NOS. 5, 6, 7 and 8, and wherein expression of said polynucleotide requires the presence of an inducing agent.
14. A method for identifying cell-active inhibitors of focal adhesion kinase (FAK) comprising the steps of:
(a) coating a first solid phase with a homogeneous population of mammalian cells so that the cells adhere to the first solid phase, wherein said cells are stably transfected with a gene encoding FAK, and wherein said gene is expressed in the presence of an inducing agent;
(b) adding an inducing agent to induce the expression of said gene encoding FAK; (c) adding a test compound;
(d) solubilizing the adhering cells to release the cell lysate;
(e) coating a second solid phase with a FAK capture agent so that the FAK capture agent adheres to the second solid phase;
(f) exposing the cell lysate to the adhered FAK capture agent so that the FAK capture agent captures FAK;
(g) exposing the captured FAK to an anti-phospho-tyrosine antibody ; and,
(h) measuring binding of the anti-phospho-tyrosine antibody to the captured FAK, wherein the amount of anti-phospho-tyrosine antibody binding to the captured FAK is proportional to the amount of phosphorylation of said FAK.
EP03797456A 2002-09-19 2003-09-08 Inducible focal adhesion kinase cell assay Withdrawn EP1546372A4 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US41207802P 2002-09-19 2002-09-19
US412078P 2002-09-19
PCT/IB2003/003968 WO2004027018A2 (en) 2002-09-19 2003-09-08 Inducible focal adhesion kinase cell assay

Publications (2)

Publication Number Publication Date
EP1546372A2 true EP1546372A2 (en) 2005-06-29
EP1546372A4 EP1546372A4 (en) 2006-08-23

Family

ID=32030798

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03797456A Withdrawn EP1546372A4 (en) 2002-09-19 2003-09-08 Inducible focal adhesion kinase cell assay

Country Status (9)

Country Link
EP (1) EP1546372A4 (en)
JP (1) JP2006500022A (en)
KR (1) KR20050052663A (en)
CN (1) CN1681939A (en)
AU (1) AU2003259498A1 (en)
CA (1) CA2497434A1 (en)
NO (1) NO20051869L (en)
RU (1) RU2005107701A (en)
WO (1) WO2004027018A2 (en)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100934706B1 (en) * 2006-12-07 2009-12-31 재단법인서울대학교산학협력재단 Method for Screening Anti-cancer Compounds Inhibiting Functions of TM4SF5 and Anti-cancer Composition Containing Chalcone Compounds
WO2009046129A2 (en) * 2007-10-01 2009-04-09 Columbia University Methods for treating adult respiratory distress syndrome
CN109112213B (en) * 2017-06-22 2021-01-12 中国科学院动物研究所 PCR primer for detecting focal adhesion kinase structural variant and detection method and application thereof
KR102007450B1 (en) 2018-05-31 2019-08-05 한국과학기술연구원 Screening method for new therapeuric targets of drug discovery for colon cancer and prognostic biomarkers for colon cancer screened by using the same
KR102408538B1 (en) * 2020-10-29 2022-06-15 한국과학기술연구원 Composition, kit and method for screening FAK inhibitor

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6395506B1 (en) * 1991-04-18 2002-05-28 Becton, Dickinson And Company Device for monitoring cells
PT948604E (en) * 1996-12-11 2004-10-29 Univ New York Medical Ct PRODUCTS AND METHODS RELATED TO PYK2
US20010055585A1 (en) * 1997-12-03 2001-12-27 William G. Cance Frnk proteins in the treatment of tumor cells
US6133031A (en) * 1999-08-19 2000-10-17 Isis Pharmaceuticals Inc. Antisense inhibition of focal adhesion kinase expression

Also Published As

Publication number Publication date
KR20050052663A (en) 2005-06-03
WO2004027018A3 (en) 2004-09-16
CN1681939A (en) 2005-10-12
EP1546372A4 (en) 2006-08-23
WO2004027018A2 (en) 2004-04-01
JP2006500022A (en) 2006-01-05
RU2005107701A (en) 2005-08-27
AU2003259498A1 (en) 2004-04-08
NO20051869L (en) 2005-06-16
NO20051869D0 (en) 2005-04-18
CA2497434A1 (en) 2004-04-01

Similar Documents

Publication Publication Date Title
Renshaw et al. Focal adhesion kinase mediates the integrin signaling requirement for growth factor activation of MAP kinase
Michaud et al. 14-3-3 is not essential for Raf-1 function: identification of Raf-1 proteins that are biologically activated in a 14-3-3-and Ras-independent manner
Kovarik et al. Specificity of signaling by STAT1 depends on SH2 and C‐terminal domains that regulate Ser727 phosphorylation, differentially affecting specific target gene expression
Wright et al. The STE20 kinase HGK is broadly expressed in human tumor cells and can modulate cellular transformation, invasion, and adhesion
Lamothe et al. TRAF6 ubiquitin ligase is essential for RANKL signaling and osteoclast differentiation
Bräuner-Osborne et al. Pharmacology of muscarinic acetylcholine receptor subtypes (m1–m5): high throughput assays in mammalian cells
DeMali et al. Integrins enhance platelet-derived growth factor (PDGF)-dependent responses by altering the signal relay enzymes that are recruited to the PDGF β receptor
Salmon et al. The p38 mitogen-activated protein kinase is activated by ligation of the T or B lymphocyte antigen receptors, Fas or CD40, but suppression of kinase activity does not inhibit apoptosis induced by antigen receptors
WO2017121865A1 (en) Mic-1 receptor and uses thereof
Kanamori et al. NF‐κB activator Act1 associates with IL‐1/Toll pathway adaptor molecule TRAF6
Krautwald et al. Involvement of the protein tyrosine phosphatase SHP-1 in Ras-mediated activation of the mitogen-activated protein kinase pathway
Kittanakom et al. CHIP-MYTH: A novel interactive proteomics method for the assessment of agonist-dependent interactions of the human β2-adrenergic receptor
Rahimi et al. EGFR variant‐mediated invasion by enhanced CXCR4 expression through transcriptional and post‐translational mechanisms
US9404080B2 (en) Human taste cells capable of continuous proliferation
EP1546372A2 (en) Inducible focal adhesion kinase cell assay
US5874230A (en) Assays using TRAF2-associated protein kinase polypeptides
AU2018322286B2 (en) Fusion protein of DCTN1 protein with RET protein
Thomas et al. Characterisation and gene expression profiling of a stable cell line expressing a cell cycle GFP sensor
CN114957444B (en) NR1 subunit deletion mutant of NMDAR, mutant cell, construction method and application
JP7027521B2 (en) Evaluation method of test sample
EP0711341A1 (en) Receptor function assays
Boni Successful preservation of BCR-ABL1 protein and direct measure of kinase activity in peripheral blood of CML and Ph+ ALL patients unveil a kinase inhibitory activity present in chronic phase CML cells
Lim et al. Identification of residues which regulate activity of the STE20-related kinase hMINK
Mahlmann et al. Dissection of signaling pathways and cloning of new signal transducers in tyrosine kinase-induced pathways by genetic selection
JP4674332B2 (en) Txk complex and use thereof

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20050419

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20060725

RIC1 Information provided on ipc code assigned before grant

Ipc: C12N 9/12 20060101ALI20060719BHEP

Ipc: G01N 33/68 20060101ALI20060719BHEP

Ipc: G01N 33/50 20060101ALI20060719BHEP

Ipc: G01N 33/573 20060101ALI20060719BHEP

Ipc: C12Q 1/48 20060101AFI20050311BHEP

17Q First examination report despatched

Effective date: 20061207

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20070418