Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
  • C12N9/18—Carboxylic ester hydrolases (3.1.1)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y301/00—Hydrolases acting on ester bonds (3.1)
  • C12Y301/01—Carboxylic ester hydrolases (3.1.1)
  • C12Y301/01007—Acetylcholinesterase (3.1.1.7)

Definitions

• the present invention relates to a new acetylcholinesterase gene responsible for resistance to insecticides, in particular in mosquitoes, to the products of this gene (cDNA, protein) and to their applications, in particular for the screening of new insecticides and genetic detection of resistance to organophosphates and / or carbamates in mosquito populations.
• Acetylcholinesterase (AChE, E.C. 3.1.1.7) is an essential enzyme which hydrolyzes acetylcholine in synapses, thereby ending cholinergic transmissions at neuronal or neuromuscular junctions. The inhibition of AChE prevents the deactivation of the synaptic signal, thus leading to a loss of control of cholinergic transmission.
• the first ace gene was identified in Drosophila (Drosophila melanogaster), by reverse genetics (Hall et al., EMBO J., 1986, 5, 2949-2954). Evidence that this gene was involved in insecticide resistance was provided by the demonstration of amino acid substitutions in the AChE of resistant Drosophila, conferring insensitivity to cholinergic insecticides (Mutéro et al., PNAS, 1994 , 91, 5922-5926). Studies in D. melanogaster therefore seemed to indicate the presence of a single ace gene in insects, coding for the AChE target of cholinergic insecticides.
• Musca domestica (Williamson et al., 1992, In Multidisciplinary approaches to cholinesterase functions, Eds Schaffer an A. & Velan B., Plénum Press, New York, pp 83 -86; Walsh et al., Biochem. J., 2001, 359, 175-181; Kozaki et al., Insect. Biochem. Mol.
• a second ace gene has been isolated from arachnids; however, this gene is not involved in resistance to insecticides (Hernandez et al., Baxter et al., cited above). - A second ace gene could not be isolated from insects despite numerous attempts in different species (Menozzi et al., Tomita et al., Mori et al, cited above; Severson et al, J. Hered., 1997, 88 , 520-524).
• the inventors identified a new locus of the ace gene in the genome of Anopheles gambiae and of 15 different species of mosquitoes and they showed that this new locus, non-homologous to the locus previously described in D. melanogaster, was involved in resistance. insecticides in mosquitoes.
• the inventors have also shown that resistance to insecticides, at least in mosquitoes of the species Culex pipiens and Anopheles gambiae, was linked to a single mutation in the acetylcholinesterase sequence encoded by this new gene, located in the vicinity of the catalytic site of the enzyme.
• This new gene represents a diagnostic tool for the genetic detection of resistance to insecticides (organophosphates, carbamates) in mosquito populations.
• the AChE encoded by this gene represents a target for the screening of new active molecules on mosquito populations resistant to the insecticides currently used.
• a subject of the present invention is therefore a protein, characterized in that it comprises a central catalytic region which has an amino acid sequence selected from the group consisting of the sequence SEQ ID NO: 1 and the sequences having at least 60% identity or 70% similarity with the sequence SEQ ID NO: 1, excluding the NCBI sequence AAK0973 corresponding to the acetylcholinesterase of Schizaphis graminum.
• the protein according to the invention represents a new insect acetylcholinesterase, hereinafter referred to as AchEl, responsible for resistance to organophosphates and / or to carbamates, at least in mosquitoes, in particular in C.
• ace-1 the locus coding for said AchEl is hereinafter called ace-1
• ace-2 represents the second ace locus, which is not involved in insecticide resistance in mosquitoes.
• said central catalytic region contains the catalytic domain of AChE and corresponds to that located at positions 70 and 593 of the AChEl sequence of Anopheles gambiae (SEQ ID NO: 3, 643 amino acids ); it corresponds to that located respectively at positions 100 and 629 of the AChEl sequence of Schizaphis graminum (NCBI AAK0973), 60 and 582 of the AChE 1 sequence of Culex pipiens (SEQ ID NO: 7), 34 and 593 of the sequence of Anopheles gambiae AChE2 (FIG. 1, SEQ ID NO: 53), and 41 and 601 of the AChE2 sequence of Drosophila melanogaster (NCBI AAF54915).
• This central region which contains the catalytic domain is conserved in vertebrates and invertebrates while the N- and C-terminal ends show a high variability between the different species.
• the identity of a sequence with respect to a reference sequence is assessed as a function of the percentage of amino acid residues which are identical, when the sequences corresponding to the catalytic region as defined above are aligned, so as to obtain the maximum correspondence between them.
• a protein having an amino acid sequence having at least X% identity with the reference sequence SEQ ID NO: 1 is defined, in the present invention as a protein whose sequence corresponds to the central catalytic region as defined above. above may include up to 100-X alterations per 100 amino acids of the sequence SEQ BD NO: 1.
• alteration includes deletions, substitutions or consecutive or dispersed insertions of amino acids in the reference sequence. This definition applies, by analogy, to nucleic acid molecules.
• the similarity of a sequence with respect to the reference sequence SEQ ID NO 1 is assessed according to the percentage of amino acid residues which are identical or which differ by conservative substitutions, when the sequences corresponding to the central catalytic region as defined above are aligned so as to obtain the maximum of conespondance between them.
• conservative substitution is intended to mean the substitution of one amino acid with another which has similar chemical properties (size, charge or polarity), which generally does not modify the functional properties of the protein.
• a protein having an amino acid sequence having at least X% similarity to the sequence SEQ ID NO: 1 is defined, in the present invention as a protein, the sequence of which corresponds to the central catalytic region as defined above. may include up to 100-X non-conservative alterations per 100 amino acids of the reference sequence.
• non-conservative alterations includes deletions, non-conservative substitutions or consecutive or dispersed insertions of amino acids in the sequence SEQ ID NO: 1.
• insect AChEl sequences have 65-97% identity (79-98% similarity) between them,
• the insect AChE2 sequences have 58-99% identity (73-99% similarity) to each other.
• the phylogenetic analysis of the AChEs of the different animal species shows that the protein sequences of AChEl form a significant autonomous group (bootstrap 795/1000), and that the insect AChEl form a significant distinct subgroup (bootstrap 856/1000).
• the AChE 1 comprises patterns characteristic of the AChE (FIG. 1) located at the following positions, respectively in the sequence SEQ ID NO: 3 and in the reference sequence of Tor proceedingsdo californica (SWISSPROT P04058): a canonical motif of the FGESAG type around the serine in position 266 (200), which is characteristic of the active site of AchE, a choline binding site (Tryptophan residue in position 151 (84)), three residues of the catalytic triad (residues serine, glutamic acid and histidine, respectively in positions 266 (200), 392 (327) and 506 (440)), six cysteine residues potentially involved in conserved disulfide bridges ( C ⁇ 34 ( tf7) -Ci6i (-; C 32 o (254) -C 333 (2, 15); 4 68 (02) - 5 s9 (52i)), aromatic residues bordering the throat of the active site (10 residues) and a phen
• AChE 1 is distinguished from the AChE of Drosophila
• the invention encompasses insect AChEl sensitive or resistant to organophosphates and / or carbamates.
• the AChEl sequences include both the primary sequences, as well as the secondary and tertiary sequences of said AChEl.
• sensitive AChE means an AChE whose acetylcholinesterase activity is inhibited in the presence of organophosphates or carbamates.
• resistant AChE means an AChE whose activity is not inhibited by concentrations of organophosphates or carbamates which inhibit 100% of the activity of the corresponding "sensitive AChE” of an individual of the same species; this "resistant AChE” differs from the previous one by the presence of one or more mutations in its amino acid sequence (amino acid substitutions) which modify its sensitivity to acetylcholinesterase inhibitors; among these mutations, the following can be cited F78S, I129V, G227A, F288Y, the amino acids being numbered with reference to the AChE sequence of Torpedo californica (SWISSPROT P04058).
• acetylcholinesterase activity and the catalytic parameters of AChE are measured by standard enzymatic techniques such as those described in Bourguet et al., Cited above.
• the proteins according to the invention include any natural, synthetic, semi-synthetic or recombinant protein of any prokaryotic or eukaryotic organism, comprising or consisting of an amino acid sequence of an AChEl protein as defined above. above. They include proteins isolated from any insect species, as well as recombinant proteins produced in an appropriate expression system.
• said AChEl corresponds to that of an insect which belongs to the order of diptera (Diptera); preferably, said insect is chosen from the family Culicidae, from the genera Culex, Aedes and Anopheles.
• said AChEl consists of the sequences SEQ ID NO: 3, SEQ ID NO: 5 and SEQ ID NO: 126 dAnopheles gambiae and the sequence SEQ ID NO: 7 of Culex pipiens (strain S - LAB), sensitive to organophosphates and / or carbamates.
• said central catalytic region of AChE 1 comprises a sequence selected from the group consisting of sequences SEQ ID NO: 8 to 21 representing a fragment of approximately 91 amino acids (fragment K , Figure 1), corresponding to that located between positions 445 and 535 of the sequence SEQ ID NO: 3.
• said AChEl is an acetylcholinesterase resistant to insecticides from the class of organophosphates and carbamates including a mutation of the glycine located in position 119, into serine (mutation or substitution of type G119S); said position being indicated with reference to the AChE sequence of Torpedo califomica (SWISSPROT P04058).
• the inventors have shown that the residue in position 119 is close to the residues of the catalytic site (serine 200 and histidine 440) and that the replacement of the glycine of AChE 1 of sensitive mosquitoes by a serine, in AChE 1 resistant mosquitoes, reduces the space of the catalytic site and prevents the insecticide from interacting with the catalytic serine (S200), due to the steric hindrance of the Van der Waals bonds of the side chain of the serine in position 119.
• the role of the Gl 19S mutation in insecticide resistance was confirmed by analysis of the acetylcholinesterase activity of the recombinant AChEl proteins produced from the cDNA of sensitive Culex pipiens (strain S-LAB having an AChEl including a glycine in position 119) or resistant (strain SR whose AchEl differs from the previous one only by the presence of a serine in position 119) against insecticides; 90% of the AChE 1 activity of the sensitive strain is inhibited in the presence of 10 ⁇ 3 M propoxur whereas the AChE 1 of the resistant strain retains 75% of its activity in the presence of concentrations 100 times higher of this insecticide (10 "1 M propoxur).
• this embodiment of said resistant AChEl corresponds to that of an insect (resistant to insecticides) which belongs to the order of diptera (Diptera); preferably, said insect is chosen from the family Culicidae, from the genera Culex, Aedes and Anopheles.
• said resistant AChEl has a sequence selected from the group consisting of:
• said AChEl is an acetylcholinesterase sensitive to insecticides from the class of organophosphates and carbamates comprising a sequence selected from the group consisting of SEQ ID NO: 91, 92, 96, 102 to 112, 114, 115 and 117 to 119, representing a fragment of approximately 150 amino acids of the third exon coding for the ace-1 gene derived from an insect as defined above, sensitive to insecticides, said fragment including a glycine in position 119 with reference to the AChE sequence of Toroutheasterndo califomica (SWISSPROT P04058).
• the present invention also relates to a peptide, characterized in that it consists of a fragment of at least 7 amino acids of the protein AChEl, as defined above; these fragments are particularly useful for the production of antibodies specifically recognizing the AChE1 protein.
• the present invention also relates to antibodies, characterized in that they are directed against the AChEl protein or a fragment thereof, as defined above.
• said antibodies are either monoclonal antibodies or polyclonal antibodies.
• the present invention also relates to an isolated nucleic acid molecule, characterized in that it has a sequence selected from the group consisting of:
• the invention encompasses the sequences of the alleles of the ace-1 gene from any insect, as well as the sequences of natural mutants (sensitive and resistant alleles) or artificial mutants of the ace-1 gene coding for a sensitive AChEl protein. or resistant, as defined above.
• said sequence coding for an AChE1 protein is selected from the group consisting of: a) the sequences SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 125,
• SEQ ID NO: 6, SEQ ID NO: 56 and SEQ ID NO: 121 which correspond to the cDNA of the amino acid sequence protein AChEl, respectively SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 126, SEQ ID NO: 7, SEQ ID NO: 57 and SEQ ID NO: 122, as defined above, b) the sequences SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 127 which correspond the ace-1 gene of Anopheles gambiae encoding AChEl as defined above, which gene has an exon-infron organization comprising at least 9 exons (Table I), and C) the sequences comprising the sequence SEQ ID NO: 120 which corresponds to the almost complete sequence of the ace-1 gene of Anopheles gambiae encoding the resistant AChEl of sequence SEQ ID NO: 122, as defined above.
• ace-1 gene corresponds to that which is located between intron 4 and intron 5 in the sequence of An, gambiae (Table I), that is to say, in positions 7854 and 8393 of the sequence SEQ ID NO : 127.
• said fragment is selected from the group consisting of primers of sequence SEQ BD NO: 39 to 50, 54, 55, 58, 59, 123, 124, 128 and 129 and the fragments of sequences SEQ ID NO: 24 to 38 and 60 to 89.
• the nucleic acid molecules according to the invention are obtained by the conventional methods, known in themselves, by following standard protocols such as those described in Current Protocols in Molecular Biology (Frederick M. AUSUBEL, 2000, Wiley and son Inc , Library of Congress, USA). For example, they can be obtained by amplification of a nucleic sequence by PCR or RT-PCR, by screening of genomic DNA libraries by hybridization with a homologous probe, or else by total or partial chemical synthesis.
• the nucleic acid molecules as defined above can be used as probes or as primers to isolate the ace-1 gene from other species or alleles of this gene, in particular by screening a genomic DNA library or cDNA, as well as to detect / amplify nucleic acid molecules (mRNA or genomic DNA) encoding an AChEl protein as defined above.
• mRNA or genomic DNA mRNA or genomic DNA
• the subject of the present invention is also a method for detecting insects carrying resistance to insecticides of the organophosphate and carbamate class, characterized in that it comprises:
• Said detection is carried out by conventional techniques which are known in themselves, for example: (i) by amplification of a region of said ace-1 gene capable of containing a mutation, then detection of said mutation by sequencing or by digestion with a appropriate restriction enzyme, of the PCR product obtained, or else (ii) by hybridization with a labeled probe specific for a region of said ace-1 gene capable of containing a mutation, then direct detection of the mismatches and / or digestion by an enzyme appropriate restriction.
• a fragment of approximately 320 bp is amplified using the primers SEQ LD NO: 39 and SEQ CD NO: 40.
• SEQ LD NO: 39 and SEQ CD NO: 40 For example, in mosquitoes one obtains a fragment of sequence SEQ BD NO: 24 to 38 which exhibits mutations between mosquitoes sensitive and resistant to insecticides.
• SEQ BD NO: 24 to 38 which exhibits mutations between mosquitoes sensitive and resistant to insecticides.
• C. pipiens there are 3 substitutions in the sequence of resistant individuals, one of which introduces an EcoRI site.
• the analysis of the restriction profile after PCR amplification of the fragment K and digestion of the products obtained by EcoRI makes it possible to rapidly detect the ace-1 genotype in a population of C.
• RR resistant homozygotes
• SS homozygous sensitive
• RS heterozygous resistant individuals
• the mutation G119S in the third exon encoding the ace-1 gene which is responsible for the resistance to insecticides of the organophosphorus and carbamate class in mosquitoes is detected according to one of the following alternatives, respectively in mosquitoes of the species C. pipiens and An. gambiae:
• a 520 bp fragment of the third coding exon is amplified from genomic DNA, by PCR using the pair of primers Ex3dir and Ex3rev (SEQ ID NO: 58 and 59); the PCR fragment is digested with Alu I and the digestion product is separated by agarose gel electrophoresis, then the restriction profile thus obtained is analyzed: the presence of a 520 bp fragment corresponds to homozygous SS sensitive individuals, the presence of two fragments (357 bp and 163 bp) correspond to RR resistant homozygous individuals and the presence of 3 fragments (520 bp, 357 bp and 163 bp) correspond to RS resistant heterozygous individuals,
• a 541 bp fragment of the third coding exon is amplified from genomic DNA, by PCR using the pair of primers Ex3AGdir and Ex3AGrev (SEQ ID NO: 123 and 124); the PCR fragment is digested with Alu I and the digestion product is separated by agarose gel electrophoresis, then the restriction profile thus obtained is analyzed: the presence of two fragments (403 bp and 138 bp) is suitable for sensitive homozygous individuals SS, the presence of 3 fragments (253 bp, 150 bp and 138 bp) corresponds to homozygous individuals resistant to RR and the presence of 4 fragments (403 bp, 253 bp, 150 bp and 138 bp) corresponds to heterozygous individuals resistant to RS; since the 150 bp and 138 bp fragments co-migrate, the resistant homozygous and heterozygous individuals are detected respectively by
• a 194 bp fragment containing codon 119 of the third coding exon is amplified from genomic DNA by PCR using the pair of primers Moustdirl and Moustrevl (SEQ ID NO: 128 and 129); the PCR fragment is digested with Alu I and the digestion product is separated by agarose gel electrophoresis, then the restriction profile thus obtained is analyzed: the presence of two fragments (74 bp and 120 bp) correspond to homozygous RR resistant individuals, the presence of a single fragment (no digestion) corresponds to SS homozygous susceptible individuals and the presence of three fragments (194 bp, 74 bp and 120 bp) corresponds to heterozygous RS resistant individuals.
• the present invention also relates to a reagent for detecting insects carrying a resistance to organophosphates and / or to carbamates, characterized in that it is selected from the group consisting of: nucleic acid molecules and their fragments as defined above (probes, primers) and antibodies as defined above.
• the present invention also relates to a recombinant vector, characterized in that it comprises an insert selected from the group consisting of the nucleic acid molecules encoding an AChEl protein and their fragments as defined above.
• said recombinant vector is an expression vector in which said nucleic acid molecule or one of its fragments are placed under the control of regulatory elements for appropriate transcription and translation.
• vectors are constructed and introduced into host cells by conventional recombinant DNA and genetic engineering methods, which are known per se.
• Many vectors into which a nucleic acid molecule of interest can be inserted in order to introduce and maintain it in a eukaryotic or prokaryotic host cell are known in themselves; the choice of an appropriate vector depends on the intended use for this vector (for example replication of the sequence of interest, expression of this sequence, maintenance of the sequence in extrachromosomal form or else integration into the chromosomal material of the host ), as well as the nature of the host cell.
• viral vectors such as baculoviruses or non-viral vectors such as plasmids can be used.
• the ace-1 cDNA can be placed under the control of a constitutive promoter such as the 5C actin promoter, in an appropriate vector and said recombinant vector is introduced into cells of insect such as Drosophila cells (Schneider S2 cells).
• a constitutive promoter such as the 5C actin promoter
• the present invention also relates to prokaryotic or eukaryotic cells, modified by a recombinant vector as defined above; preferably these cells are insect cells.
• the recombinant vectors and the modified cells as defined above are useful in particular for the production of the proteins and peptides AChE1 according to the invention.
• the present invention also relates to a transgenic invertebrate animal, characterized in that it contains cells modified with at least one nucleic acid molecule as defined above; preferably said animal is an insect.
• Transgenic animals and modified cells as defined above are useful in particular for the screening of insecticidal substances and for the biological control against vectors of pathogens and harmful insects.
• the present invention also relates to a method of screening an insecticidal substance, characterized in that it comprises: a) bringing the test substance into contact with an AChEl protein selected from: an AChEl protein isolated according to invention, an extract of modified cells or a biological sample of a transgenic animal containing said protein AChEl, as defined above, in the presence of acetylcholine or one of its derivatives, b) measurement by any suitable means , of the acetylcholinesterase activity of the mixture obtained in a), and c) the selection of the substances capable of inhibiting said activity.
• an AChEl protein selected from: an AChEl protein isolated according to invention, an extract of modified cells or a biological sample of a transgenic animal containing said protein AChEl, as defined above, in the presence of acetylcholine or one of its derivatives
• b) measurement by any suitable means of the acetylcholinesterase activity of the mixture obtained in a
• the selection of the substances capable of inhibiting said activity
• the present invention also relates to a method of screening for an insecticidal substance, characterized in that it comprises:
• said screening methods use AChEl resistant to organophosphates or to carbamates or else cells or transgenic animals containing them.
• the present invention also relates to a reagent for screening for insecticidal substances, characterized in that it is selected from the group consisting of AChEl proteins, recombinant vectors, modified cells and transgenic animals as defined above.
• Insecticidal substances capable of inhibiting the acetylcholinesterase activity of AChEl proteins resistant to insecticides of the organophosphorus and carbamate class commonly used have applications: in human and animal health, to combat vectors of pathogens (for example Aedes aegypti, vector of arboviruses such as dengue and yellow fever, Culex pipiens vector of the West-Nile virus, Anopheles gambiae African vector of the malaria agent, etc.) and in the field of agriculture, to fight against harmful insects which devastate crops (for example the Colorado potato beetle (Leptinotarsa decemlineata) which attacks potatoes, aphid pests such as Aphis gossypii and Myzus persicae, etc.).
• the invention further relates to a detection and / or screening kit for the implementation of the methods as defined above, characterized in that it includes at least one reagent as defined above.
• the present invention also relates to a method of screening for inhibitors of an AChEl as defined above, characterized in that it comprises:
• step (b) isolating the potential inhibitors identified in step (a);
• step (c) bringing the substance isolated in step (b) into contact with an AChEl as defined above, an extract of modified cells, a biological sample from a transgenic animal as defined above or a insect extract sensitive or resistant to the aforementioned insecticides, in the presence of acetylcholine or one of its derivatives;
• the method according to the invention comprises a step (step (a)) of computer simulation aimed at identifying peptide or chemical structures having a significant probability of binding to a target protein.
• step (c) of the process It is thus possible to isolate potential inhibitors of the resistant AChEl form without biochemically having the protein, then to directly test the inhibition capacity of each candidate on the AChEl activity of an extract of sensitive insects or resistant (step (c) of the process). This approach can therefore completely dispense with the purification and / or production of target protein.
• the significance of a probability of binding cannot be defined in an absolute manner: it may depend on the type of amino acids involved in the interaction, as well as on the software used for modeling. More precisely, the most commonly used methods select, for a given site of a target molecule, the compounds having the lowest binding energy. In general, the energy calculation takes into account the “hydrogen” bonds, the van der Waals, electrostatic and hydrophobic interactions, as well as the entropy penalties. It is therefore a priori impossible to give a limit of significance in absolute value beyond which a potential ligand will be accepted or rejected, since the energy will depend on the atoms engaged in the bond. However, three selection criteria can be applied: 1. an arbitrary selection of the compounds of lower binding energy. In general, the limit is set between 1% and 5% of the number of compounds tested.
• an estimate of the affinity of the bond based on energy calculations.
• An acceptable value as a starting point could be understood between 1 and 300 micromolar.
• the onchidal, an AChE inhibitor has an apparent affinity of 300 ⁇ M (Abramson et al., Mol. Pharmacol., 1989, 36, 349).
• the invention also comprises other arrangements which will emerge from the description which follows, which refers to examples of implementation of the ace-1 gene and its products (cDNA, protein) according to the present invention as well as the table summarizing the sequences of the Application and the accompanying drawings in which: - Figure 1 illustrates the alignment of the amino acid sequences of the AChEl proteins of Anopheles gambiae, Schizaphis graminum, An.
• amino acids are numbered with reference to the AChE sequence of torpedo fish (Tor proceedingsdo califomica; SWISSPROT P04058). The N- and C-terminal sequences are not shown because of their variability.
• Amino acids stored between AChEl and AChE2 are shown in gray. The specific amino acids of AChE2 are indicated in black.
• the 3 residues representing the catalytic triad (S 200 , E 32 and H 440 ) are framed.
• the choline binding site (W 84 ) is underlined.
• the circles represent the position of the 14 aromatic residues bordering the throat of the active site in the AChE of Toroutheasterndo, 10 of which are present in all the AChEl and AChE2 (solid circles), the others not being conserved (empty circles). Three intramolecular disulfide bonds between cysteine residues are indicated.
• the horizontal arrow indicates the position of fragment K (amplified using the primers PdirAGSG and PrevAGSG). The hypervariable region of ACbE2 which is absent in AChEl is surrounded.
• FIG. 2 illustrates the genetic detection of mosquitoes resistant to organophosphates and / or to carbamates by PCR-RFLP: .
• FIG. 2A represents the comparison of the amino acid sequence of the K fragment of different mosquito species: Cx Pip (Culex pipiens), Ae alb ( ⁇ edes albopictus), Ae aeg (Aedes aegypti), An alb (Anopheles albimanus), An gamb (Anopheles gambiae), An fun (Anopheles funestus), An nil (Anopheles nili), An sac (Anopheles sacharovi), An pse (Anopheles pseudopunctipennis).
• Variant amino acids are grayed out.
• the following sequences are identical: An. Darlingi and An. Albimanus; An. Sundaicus, An. Gambiae and An. Arbiensis; An. Moucheti, An. Funestus and An. Minimus; An. Stephensi and An. Saccharovi.
• FIG. 2B illustrates the comparison of the nucleotide sequences corresponding to the fragment K of the sensitive (S-LAB) and resistant (SR) strains.
• the variant nucleotides are grayed out (t - »c in position 3; a -» g in position 84: the site.
• FIG. 2C illustrates the restriction profiles obtained after agarose gel electrophoresis of the EcoRI digestion products of the fragment K amplified by PCR.
• the homozygous susceptible strain S-LAB has a profile characterized by 2 bands (214 bp and 106 bp), the resistant homozygous strain has a profile characterized by a single band of 320 bp and the resistant mosquitoes from the back crossing have a heterozygous profile characterized by 3 bands (320 bp, 214 bp and 106 bp).
• - Figure 3 illustrates the phylogenetic tree of AChE proteins.
• Lcup Lucilia cuprina: Mdom: Musca domestica: Ldec: Leptinotarsa decemli- neata; Amel Apis mellifera: Ncin: Nephotettix cincticeps; Sgra: Schizaphis grami- num; Rapp: Rhipicephalus appendiculatus; Bmic: Boophilus microplus; Bdec: Boophilus decoloratus; Hsap: Homo sapiens; Btau: Bos taurus; Fcat: Félix catus; Ocunus Oryctus Rnor: Rattus norvegicus; Mmus: Mus musculus; Ggal: Gallus gallus; Drer: Danio reno; Eele: Electrophorus electricus; Tamr.- Tortigdo marmorata; Tcal: Tor proceedingsdo califomica; Bfas: Bungarus fasciatus; Mglu: Myxine glutinosa; Bflo
• FIG. 4 illustrates the cladogram of proteins AChEl and AChE2.
• the sequences of the proteins AChE1 and AChE2 were treated as in FIG. 1.
• the sequence Bmic was added as an external sequence to define the origin of the tree.
• the boxes marked with an asterisk represent proteins encoded by a gene that segregates with resistance to insecticides.
• the empty boxes represent the proteins encoded by a gene that does not segregate with resistance to insecticides.
• the scale corresponds to a divergence of 10%.
• FIGS. 1 illustrates the comparison of the amino acid sequences of the AChEl protein of C. pipiens, infers a strain sensitive (S-LAB) and a strain resistant (SR) to insecticides.
• S-LAB strain sensitive
• SR strain resistant
• the unique glycine 247 (// 9) -> serine 24 (y / P ) mutation (shown in gray) is responsible for resistance to insecticides in mosquitoes of the species C. pipiens; it corresponds to the substitution of the glycine located at position 247 of the AChEl sequence of C. pipiens (or at position 119, with reference to the AChE sequence of torpedo fish), by a serine.
• FIGS. 6A and 6B illustrate the comparison of the nucleotide sequences coding for the AChEl protein of C. pipiens, between a strain sensitive (S-LAB) and a strain resistant (SR) to insecticides; all mutations are silent with the exception of the mutation in position 739 (G - »A) which results, on the one hand, in the substitution of the glycine codon (GGC) in position 247 of the sequence of the protein AchEl of the sensitive strain (S-LAB) by a serine codon (AGC) responsible for resistance to insecticides in the strain SR, and on the other hand, the appearance of an Alu I site (AGCT) in the sequence of the resistant strain, useful for the detection of the mutation.
• GGC glycine codon
• AAC serine codon
• FIG. 7A illustrates (i) the overall structure of the two proteins and (ii) and the steric hindrance of the Van der Waals bonds of serine 200 and histidine 440 of the catalytic site of the enzyme, as well as that of the amino acid at position 119 which is mutated in the case of resistance; the residue in position 119 is close to the residues S 20 o and H 440 of the catalytic site.
• FIGS. 7B and 7C illustrate the comparison of the steric hindrance of the Van der Waals bonds of the amino acids glycine (FIG. 7C) and serine (FIG. 7B) in position 119, of the sensitive and resistant strain respectively.
• the size of the side chain of Serine in position 119 in the resistant strain reduces the space of the catalytic site which probably prevents the insecticide from interacting with catalytic serine (S 200 ).
• FIG. 8 illustrates the detection by PCR-RFLP of the glycine -> serine mutation in the third exon coding for the ace-1 gene, in mosquitoes of the species C.
• 1 band (520 bp) is detected in SS homozygous susceptible individuals, 2 bands (357 bp and 163 bp) are detected in RR resistant homozygous individuals and 3 bands (520 bp, 357 bp and 163 bp) are detected in RS resistant heterozygous individuals.
• FIGS 9A and 9B illustrate the comparison of the sequences of the ace-1 gene of An, gambiae, infers a strain sensitive (KISUMU) and a strain resistant (YAO) to insecticides; all mutations are silent with the exception of two mutations: the first involves the replacement of valine (CGT) in position 33 of the AChEl sequence of the sensitive strain (SEQ ED NO: 5) with an alanine (CGC) in the resistant strain and the second is the same glycine mutation (GGC) - »serine (AGC) as that found in Culex pipiens.
• CCT valine
• CGC alanine
• GGC glycine mutation
• AAC glycine mutation
• the glycine (GGC) ⁇ serine (AGC) mutation causes the appearance of a second Alu I site (AGCT) in the sequence of the third exon encoding the resistant strain, useful for detecting the mutation.
• the coding sequences of the ace-1 gene are indicated in bold and the mutations are indicated in gray.
• the sequences of the primers Ex3AGdir and Ex3Agrev used to detect the glycine mutation (GGC) - ⁇ - serine (AGC), as well as the Alu I sites of the fried exon coding are indicated in bold and underlined.
• FIG. 10 illustrates the quantification of the acetylcholinesterase activity of the AChEl recombinant proteins of Culex pipiens, sensitive (S-LAB, white banas) and resistant (SR, gray banas), produced in S2 insect cells, by comparison with that shredded C. pipiens strain S-LAB (hatched white bananas) and strain SR (shaded gray bars).
• the acetylcholinesterase activity of the cell extracts and of the mosquito grinds was measured in the absence (C) and in the presence of ÎO ⁇ M and 10 "2 M of propoxur.
• the only glycine 247 mutation (7 / 9d -> serine 24 (7 / 9d makes acetylcholinesterase insensitive to insecticide.
• FIG. 11 illustrates the detection by PCR-RFLP of the glycine - »serine mutation in the third exon coding for the ace-1 gene, in mosquitoes of the species Culex pipiens, Anopheles gambiae and Anopheles albimanus: 1 band (194 bp ) is detected in homozygous susceptible SS individuals, 2 bands (74 bp and 120 bp) are detected in homozygous RR resistant individuals and 3 bands (194 bp, 74 bp and 120 bp) are detected in heterozygous SS resistant individuals.
• FIG. 12 illustrates the quantification of the acetylcholinesterase activity of the AChEl proteins of respectively Culex pipiens, Anopheles gambiae and Anopheles albimanus sensitive (SS, gray stripes) and resistant (RS, black bands and RR, white bands).
• FIG. 13 shows the alignment of the nucleotide sequences of the 194 bp fragment of Anopheles gambiae, Culex pipiens and Anopheles albimanus, sensitive (S) or resistant (R).
• Light gray background sequences corresponding to the primers Moustdirl and Moustrevl.
• Gray background Alu I site.
• Dark gray background Guanine from the Gly codon of susceptible individuals.
• FIG. 14 shows the nucleotide sequences of the 194 bp fragment of sensitive (S) and resistant (R) Anopheles albimanus.
• the codon specifying Gly (GGC) and Ser (AGC) is in bold.
• the Alu I site is underlined. Table II; List of sequences
• SEQ ID NO: 1 fragment of the central region of the AChEl protein Anopheles gambiae (positions 70 to 593 of SEQ ID NO: 3).
• SEQ ID NO: 7 AChEl protein Culex pipiens strain S-LAB (complete sequence)
• SEQ ID NO: 26 nucleotide fragment K AChEl Aedes aegypti
• SEQ ID NO: 28 nucleotide fragment K AChEl Anopheles darlingi (AJ 438599)
• SEQ ID NO: 37 nucleotide fragment K AChEl An. Albimanus (AJ 538608)
• SEQ ID NO: 38 nucleotide fragment K AChEl An. ⁇ /// (AJ 538609)
• SEQ ID NO: 64 Nucleotide fragment of the third exon encoding the Praias-P-R strain
• SEQ ID NO: 65 Nucleotide fragment of the third exon encoding Supercar-Q-R strain
• SEQ ID NO: 70 Nucleotide fragment of the third exon coding strain Martinique-Q-R
• SEQ ID NO 90 (D SEQ ID NO 91 (D SEQ ID NO 92 (D SEQ ID NO 93 (D
• nucleotide sequences SEQ ED NO: 27 to 38
• corresponding peptide sequences SEQ ED NO: 10 to 21
• EXAMPLE 1 Materials and Methods a) Strains and Crosses Five strains of C. pipiens were used: S-LAB, a standard strain sensitive to insecticides (Georghiou et al., 1966, Bull. Wld. Hlth Org., 35, 691 -708), SA1, SA4 and EDIT which have a single AChE sensitive to insecticides, and SR which is homozygous for an AChE insensitive to insecticides (Berticat et al., Genêt. Res., 2002, 79, 41-47). The strains having a sensitive and insensitive AChE are called respectively S and R.
• ace-1 represents the locus coding for a cholinergic AChE responsible for resistance to organophosphates and / or to carbamates in C. pipiens (AChEl), previously called Ace.l (Raymond et al., Genetica, 2001, 112/113, 287-296).
• ace-2 represents the second ace locus, which is not involved in insecticide resistance in C. pipiens (previously called Ace.2), whose function is unknown in C. pipiens.
• the unique ace gene present in Drosophila melanogaster, which is homologous to ace-2, is therefore also named.
• the AChE genomic sequences of sea squirts were assembled from raw sequences deposited in the databases of the NCBI (Ciona savignyi) and the Doe Joint Institute (Ciona intestinalis, http://www.igi.doe.gov/ programs / ciona / ciona mainage.html
• the searches in the Drosophila databases were carried out using Flybase (http://www.fruitfly.org/) e) Sequence comparisons
• sequences of the AChEl and AChE2 proteins of Anopheles gambiae deduced from the genomic sequences and the peptide sequences deduced from PCR fragments of C. pipiens and A. aegypti were aligned with those of the known AChEs, using the ClustalW software, using a BLOSUM matrix and default parameters (Thompson et al., NAR, 1994, 22, 4673-4680).
• a phylogenetic tree was constructed using the neighbor-joining algorithm of the DDBJ version of Clustal W (http: //hypernig.nig.ac.ip/homology/ex_clustalw-e.shtml). Bootstrap analysis (1000 counts and 111 input values) was used to assess the confidence levels for the tree topology. The construction of the trees was carried out using Treeview software (vl.6.6). f) Accession numbers
• sequence numbers used for genetic analysis are as follows.
• - Craniata Homo sapiens: NP_00046; Bos taurus: P23795; Félix catus: 06763; Oryctolagus cuniculus: Q29499; Rattus norvegicus: P36136; Mus musculus: P21836; Gallus gallus: CAC37792; Danio reno: Q9DDE3; Electrophorus electricus: 6730113; Tordozensdo marmorata: P07692; Tor proceedingsdo califomica: P04058; Bungarus fasciatus: Q92035; Hagfish glutinosa: Q92081.
• - Cephalocordates Branchiostoma ⁇ oridae: 076998 and 076999;
• Branchiostoma lanceolatum Q95000 and Q95001.
• Ciona intestinalis SEQ ID NO: 51
• Ciona savignyi SEQ ID NO: 52.
• Caenorhabditis elegans (1 to 4): P38433, 061371, 061459 and 061372; Caenorhabditis briggsae (1 to 4) Q27459, O61378Q9NDG9 and
• Anopheles gambiae (1 and 2): SEQ ED NO: 3 and SEQ ED NO: 53 (BM 629847 and BM 627478); Aedes aegypti (1 and 2): SEQ ID NO: 9 and AAB3500; An.
• 30 PCR amplification cycles were carried out under the following conditions: 94 ° C for 30 s, 50 ° C for 30 s to and 72 ° C for 30 s.
• the sequences were determined directly on the PCR products on an ABI prism 310 sequencer, using the Big Dye Terminator kit.
• the genotyping of ace-1 in Culex is carried out under the following conditions: The K fragments obtained as described above are digested with EcoRI and the digestion product is separated by electrophoresis on a 2% agarose gel. The restriction profiles show: 1 band (320 bp) in homozygous RR resistant mosquitoes, 2 bands (106 bp and 214 bp) in SS homozygous mosquitoes and 3 bands (103 bp, 214 bp and 320 bp) in heterozygous RS mosquitoes. h) Cloning of the ace-1 cDNA in sensitive and resistant individuals
• Culex pipiens ace-1 gene cDNA was obtained from RNA extracted from individuals of the sensitive reference strain S-LAB and the resistant strain SR, at the very early stage of L1 larval development. Reverse transcription was performed with an 18T oligonucleotide and SuperScriptlERNaseH (EN VITROGEN), according to the conditions recommended by the manufacturer.
• Two cDNA fragments were amplified by PCR using degenerate oligonucleotides obtained from the alignment of the sequences of the ace-1 genes of Anopheles gambiae and Schizaphis graminum:
• fragments b and k thus obtained were then cloned and sequenced, according to conventional techniques known in themselves to those skilled in the art, as described in Cunent Protocols in Molecular Biology (Frederick M. AUSUBEL, 2000, Wiley and son Inc, Library ofCongress, USA).
• a larger cDNA fragment was amplified by PCR, using primers specific for Culex pipiens deduced from the sequences of fragments b and k previously obtained. To know :
• the ends of the cDNAs were amplified by the RACE technique (Rapid Amplification ofcDNA Ends), using a commercial kit (from the Gene Racer kit (IN VITROGEN) according to the conditions indicated in the user manual. were cloned and then sequenced, as above, - strain SR
• the complete sequence of the cDNA of the ace-1 gene of the resistant strain SR was amplified by PCR using the primers culex-5'dir (5 - CCACACGCCAGAAGAAAAGA-3 ', SEQ ID NO: 54) and culex- 3'dir (5'- AAAAACGGGAACGGGAAAG-3, SEQ ID NO: 55) and the 2497 bp fragment thus obtained was cloned and sequenced, as above, i) Cloning of the ace-1 gene in susceptible and resistant individuals
• - fragment A (1130 bp) was amplified using the pair of primers AGl-Adir (5'CGACGCCACCTTCACA3 ⁇ SEQ ED NO: 45) and AGl-Arev (5'GATGGCCCGCTGGAACAGAT3 ', SEQ ED NO: 46), - fragment B (1167 bp) was amplified using the pair of primers AGl-Bdir (5'GGGTGCGGGACAACATTCAC3 ', SEQ BD NO: 47) and AGl-Brev (5'CCCCGACCGACGAAGGA3 ⁇ SEQ ED NO: 48), and
• sequences of fragments A, B and C were determined directly on the PCR products, using internal oligonucleotides, included in these fragments, using the Big Dye Terminator kit and an ABI prism 310 sequencer. J) detection of the mutation of the third coding exon responsible for resistance to insecticides in mosquitoes of the species C. pipiens and An. gambiae
• the mosquito DNA was extracted as described in Rogers et al., Supra, then a fragment of the crumbling exon coding was amplified by PCR, sequence and the mutation in the coding sequence of the third coding exon was detected by PCR-RFLP , according to the principle as described above for fragment K.
• a 520 bp fragment of the third coding exon was amplified from the genomic DNA of several mosquitoes, by PCR using the pair of primers: - Ex3dir 5 * -CGACTCGGACCCACTGGT-3 '(SEQ ED NO: 58 ) and
• the fragment thus obtained was digested with Alu I and the digestion product separated by electrophoresis on a 2% agarose gel.
• the expected restriction profiles are as follows: 1 fragment (520 bp) in SS-sensitive homozygous individuals, 2 fragments (357 bp and 163 bp) in RR-resistant homozygous individuals and 3 fragments (520 bp, 357 bp and 163 bp) in RS resistant heterozygous individuals.
• a 541 bp fragment of the third coding exon was amplified from the genomic DNA of several individuals, by PCR using the pair of primers:
• the fragment thus obtained was digested with Alu I and the product separated by elecfrophoresis on a 2% agarose gel.
• the expected restriction profiles are as follows: 2 fragments (403 bp and 138 bp) in SS homozygous susceptible individuals, 3 fragments (253 bp, 150 bp and 138 bp) in RR resistant homozygous individuals and 4 fragments (403 bp, 253 bp, 150 bp and 138 bp) in heterozygous individuals resistant to RS; since the 150 bp and 138 bp fragments co-migrate, the resistant homozygous and heterozygous individuals are detected respectively by the presence of 2 bands (253 bp and approximately 150 bp) and 3 bands (403 bp, 253 bp and approximately 150 bp) in agarose gel.
• a 174 bp fragment of the third coding exon was amplified from the genomic DNA of several mosquitoes, by PCR using the pair of primers: - Moustdirl: 5 'CCGGGNGCSACYATGTGGAA 3' (SEQ ED
• the fragment thus obtained was digested with Alu I and the digestion product separated by elecfrophoresis on a 2% agarose gel.
• the expected restriction profiles are as follows: 1 fragment (194 bp) in SS-sensitive homozygous individuals, 2 fragments (74 bp and 120 bp) in RR-resistant homozygous individuals and 3 fragments (194 bp, 74 bp and 120 bp) in RS resistant heterozygous individuals. The results are illustrated in Figure 11.
• FIG. 12 shows that the same inhibitory characteristics with propoxur are obtained with resistant mosquitoes An. Albimanus by conventional biochemical test as for the mosquitos An. Gambiae and C. pipiens.
• the cDNAs encoding the AchE1s of the S-LAB strain and the SR strain respectively were cloned into the eukaryotic expression vector pAc5.1 / V5-His (ENVITROGEN), according to conventional recombinant DNA techniques according to standard protocols. such as those described in Current Protocols in Molecular Biology, supra.
• Drosophila cells (Schneider S2 cells) were transfected with the recombinant vectors thus obtained, using the Fugen® reagent (ROCHE), following the manufacturer's instructions. 24 hours after transfection, the cells were harvested by centrifugation and then lysed in 0.25M phosphate buffer containing 1% Triton X-100.
• acetylcholinesterase activity of the cell extracts obtained was measured, in the presence or in the absence of insecticide (propoxur), by the method as described in Bourguet et al., Biochemical Genetics, 1996, 34, 351-362.
• Amino acid sequence analysis confirms that the AChEl and AChE2 proteins are very homologous to Drosophila AChE (BLASTP: P ⁇ e " 18 °) and contain a canonical FGESAG motif around the serine at position 200, with reference to the sequence of the Ache de Torcherdo (S 20 o figure 1), which is characteristic of the active AchE site.
• AChE characteristic patterns of AChE were also found in the two sequences (AChEl and AChE2): the choline binding site (Tryptophan residue at position 84, W84), the three residues of the catalytic triad (serine residues , glutamic acid and histidine, respectively in positions 200, 327 and 440: S 200 , E 327 and H 440 ), the six cysteine residues potentially involved in conserved disulfide bridges (C 67 -C 94 ; C 254 -C 265 ; C 4 o 2 -C 521 ), and aromatic residues bordering the throat of the active site (10 and 11 residues, respectively for AChEl and AChE2).
• the proteins AChEl and AChE2 of An, gambiae have 53% similarity between them and show respectively: 76% and 55% of similarity with the AChE of Schizaphis graminum (accession number NCBI AAK09373 or GENBANK 12958609), 53% and 98% similarity with AChE from An, stephensi (GENBANK 2494391), 54% and 95% similarity with AChE from Aedes aegypti (GENBANK 2133626), 52% and 83% similarity with AChE from Drosophila (GENBANK 17136862).
• EXAMPLE 4 Demonstration of at least two ace genes in other mosquito species
• the presence of the ace-1 gene in the genome of other mosquito species was analyzed by PCR using degenerate oligonucleotides (PdirAGSG and PrevAGSG, SEQ BD NO: 39 and 40) making it possible to amplify an exonic fragment (fragment K, of approximately 320 bp in figure 1), corresponding to sequences conserved between the AChEl sequences of An, gambiae and Schizaphis graminum but divergent violates the AChEl and AChE2 sequences of An, gambiae.
• degenerate oligonucleotides PdirAGSG and PrevAGSG, SEQ BD NO: 39 and 40
• EXAMPLE 5 Analysis of the binding between the ace-1 gene and insecticide resistance
• the fragment K amplified from the genomic DNA of C. resistant pipiens (strain R) has been sequenced.
• the comparison of the sequences of fragment K between the strains S and R shows differences at the level of 3 nucleotides (silent substitutions, FIG. 2B).
• the link between the ace-1 gene and resistance to propoxur was studied, in triplicate, as follows: back-crossing larvae (S x R) x S were treated with a lethal dose for individuals susceptible and the ace-1 genotype was analyzed in the survivors by PCR-RFLP.
• Phylogenetic trees were constructed from the sequences of the conserved regions of the AChEs of An gambiae (SEQ ED NO: 1 and fragment 34-393 of the sequence SEQ ED NO: 53, FIG. 1), K fragments of C. pipiens and Aedes aegypti (SEQ ED NO: 8 and 9) and 33 AChE sequences available in GENBANK, using the neighbor-joining method, as described in the materials and methods.
• Figure 3 illustrates the heterogeneity of the number of ace genes during the evolution of the animal kingdom. In strings, cephalocords have at least two ace genes while urocords have only one, as deduced from the analysis of their genome.
• the dipterans In arthropods, the dipterans have either a single ace gene (Drosophila of the suborder Brachycera) or two ace genes (mosquitoes of the Suborder nematocera). The topology of the tree shows that these two ace genes duplicated very early during evolution, probably before the separation between the protostomes and the deuterostomes. These results are supported by the fact that the AChE of molluscs, nematodes and arthropods branch out from the sequences of the cords (craniatia, cephalocordates and urocordes). The results show that arthropods and nematodes have a related AChE.
• the ace-1 cDNA was cloned from two strains of Anopheles gambiae (strain KISUMU sensitive and strain YAO resistant) and two strains of Culex pipiens (strain S-LAB sensitive and strain SR resistant), as described in materials and methods.
• the complete sequence of the cDNA of the KISUMU strain corresponds to the sequence SEQ ID NO: 125 which codes for a protein of 737 amino acids (SEQ ID NO: 126).
• the complete sequence of the cDNA and of the AChEl protein of the YAO strain corresponds respectively to the sequences SEQ BD NO: 121 and SEQ ED NO: 122.
• sequences SEQ ED NO: 4 and SEQ ED NO: 5 correspond to the quasi sequence -complete (with the exception of the first exon coding for the ace-1 gene), respectively of the cDNA and of the AChEl protein of the KISUMU strain.
• the complete cDNA sequence of the S-LAB and SR strains of C. pipiens corresponds respectively to the sequences SEQ ID NO: 6 and SEQ ID NO: 56 which code for a protein of 702 amino acids (SEQ ED NO: 7 and SEQ ID NO: 57, respectively for the strain S-LAB and the strain SR).
• EXAMPLE 8 Determination of the sequence of the ace-1 gene
• the sequence of the ace-1 gene was determined from the genomic DNA of two strains of Anopheles gambiae, the sensitive reference strain of West Africa (strain KISUMU) and a resistant strain of Côte d ' ivory (YAO strain), as described in the materials and methods.
• the complete sequence of An, gambiae corresponds to the sequence SEQ
• ID NO: 127 which presents an intron-exon organization comprising at least 9 exons and including two 5 'non-coding exons (Table I)
• the almost complete sequence (with the exception of the first two non-coding 5 ′ exons) of the ace-1 gene of the KISUMU strain corresponds to the sequence SEQ JD NO: 23.
• the almost complete sequence (with the exception of the first two 5 'non-coding exons and the first coding exon) of the ace-1 gene of the YAO strain corresponds to the sequence SEQ ED NO: 120.
• EXAMPLE 9 Identification of mutation (s) in the amino acid sequence of the protein AChEl, responsible for resistance to insecticides in mosquitoes of the species Culex pipiens e Anophactuates gambiae.
• the nucleotide sequence encoding the AChEl protein was determined from two strains of Anopheles gambiae (strain KISUMU sensitive and strain YAO resistant) and two strains of Culex pipiens (strain S-LAB sensitive and strain SR), as described in Example 7.
• FIG. 7A shows that the amino acid in position 119 is close to the residues of the catalytic site (S 00 and H 440 ).
• FIG. 7C shows that, by comparison with the glycine of the sensitive strain (FIG. 7B), the size of the side chain of the serine of the resistant strain, reduces the space of the catalytic site, which probably prevents the insecticide d '' interact with catalytic serine (S 200 ).
• GGC glycine
• APC glycine- serine
• Table III Strains and populations of the species C. pipiens analyzed
• Table IV Analysis of the origin of the glycine - serine mutation responsible for resistance to insecticides in mosquitoes of the species C. pipiens
• Sensitive strains KISUMU (sensitive reference strain from East Africa) and VK-PER (reference strain KDR from West Africa) as well as sensitive populations from the Yaoundé region were tested by the PCR-RFLP test as described above.
• the recombinant AchE1s of the S-LAB strain and the SR strain respectively were expressed in insect cells and the acetylcholinesterase activity was measured from the cell extracts as described in Example 1.

Landscapes

• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• General Engineering & Computer Science (AREA)
• Microbiology (AREA)
• Biotechnology (AREA)
• Biomedical Technology (AREA)
• Molecular Biology (AREA)
• Medicinal Chemistry (AREA)
• Agricultural Chemicals And Associated Chemicals (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Enzymes And Modification Thereof (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Applications Claiming Priority (5)

Publications (1)

Family

ID=30001928

Family Applications (1)

Country Status (5)

Families Citing this family (4)

Citations (1)

• 2003
  • 2003-06-19 AU AU2003263246A patent/AU2003263246A1/en not_active Abandoned
  • 2003-06-19 US US10/518,072 patent/US8198061B2/en not_active Expired - Fee Related
  • 2003-06-19 WO PCT/FR2003/001876 patent/WO2004000994A2/fr not_active Ceased
  • 2003-06-19 CA CA002489617A patent/CA2489617A1/fr not_active Abandoned
  • 2003-06-19 EP EP03760744A patent/EP1521836A2/de not_active Withdrawn

Patent Citations (1)

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events