EP1506231A2

EP1506231A2 - Hybrid and fusion polypeptide subunits of k+ channels

Info

Publication number: EP1506231A2
Application number: EP02772547A
Authority: EP
Inventors: J. O.; c/o Centre for Neurobiochemistry DOLLY; S.; c/o Centre for Neurobiochemistry AKHTAR; O.; c/o Centre for Neurobiochemistry SHAMOTIENKO
Original assignee: Imperial College Innovations Ltd
Current assignee: Ip2ipo Innovations Ltd
Priority date: 2001-10-25
Filing date: 2002-10-25
Publication date: 2005-02-16
Also published as: WO2003035690A3; GB0125636D0; WO2003035690A2; AU2002337309A1

Abstract

A method for preparing a K+ channel comprising alpha subunits and beta subunits, the method comprising the step of providing the alpha subunits and beta subunits of said channel, wherein at least two said subunits, which subunits are naturally encoded as separate polypeptides, are provided as a fusion polypeptide comprising the said at least two subunits. A method for preparing a K+ channel comprising more than one subunit, the method comprising the step of providing the subunits of said channel, wherein at least two said subunits, which subunits are naturally encoded as separate polypeptides, are provided as a fusion polypeptide comprising the said at least two subunits and wherein the said fusion polypeptide is provided by expressing the fusion polypeptide in a mammalian cell from a recombinant polynucleotide encoding the said fusion polypeptide. A chimaeric Kv1.1 polypeptide comprising the C-terminal region of Kv1.1, wherein the N-terminal assembly-regulating region of Kv1.1 is replaced by the N-terminal assembly-regulating region of Kv1.2. The methods and chimaeric polypeptide are useful in preparing K+ channels equivalent to naturally occuring K+ channels, which are useful in identification and characterisation of physiologically relevant K+ channels, drug screening and diagnosis.

Description

OLIGOMERIC POLYPEPTIDES

The present invention relates to K+ channels, particularly voltage-gated K+ channels, and expression, screening and therapeutic methods and molecules related thereto.

K⁺ channels are found in the membranes of both excitable and inexcitable cells (see, for example, Hille et al (1984) Ionic Channels in Excitable Membranes Sinauer, Sunderland MA; Latorre et al (1984) Ann Rev Physiol 46, 485-495; Lewis & Cahalan (1988) Trends Neurol Sci 11, 214-218, where they are involved in setting the membrane potential and regulating the electrical excitability of the cell. Several subtypes of K channels with different functional and pharmacological properties may be expressed in most cell types (Moczydlowski et al (1988) J Membrane Biol 105, 95-111; Rudy (1988) Neurosci 25, 729-750).

K⁺ channels are also reviewed in, for example, Jan & Jan (1997) Ann Rev Neurosci 20, 91-123; Jan & Jan (1997) Curr Biol 9, 155-160; Wei et al (1996) Neuropharmacol 35, 805-829.

Voltage-gated K channels are involved in the maintenance of resting membrane potential, control of action potential frequency and tlπeshold of excitation (1). At least four types of voltage-activated K⁺ currents (which flow through such channels) have been distinguished electrophysiologically in mammalian neurones (reviewed in Halliwell (1990) in Potassium Channels: Structure, Classification and Therapeutic Potential (Cook, NS, Ed), Ellis Horwood, Chichester, pp 348-381 and in [3]). At least four subfamilies of channel have been identified (Kvl -4) based on the sequences of transmembrane channel forming α subunits (reviewed in, for example [3], Gutman & Chandy (1993) Semi Neurosci 5, 101-106) and Salkoff et al (1992) Trends Neurosci 15, 161-166).

Members of the Shaker-related subfamily (Kvl) are sialoglycoprotein complexes (Mr~400 K) consisting of 4 transmembrane channel-forming α subunits (Kvl .1-1.6) and 4 cytoplasmic regulatory β (Kvβ_1-3) proteins [(2); reviewed in (3)]. Heterologously-expressed Kvl members assemble via their N-terminal domain (NAB) (4) into homo- or hetero-multimeric channels with distinct electrophysiological and pharmacological properties (3, 5, 6), though the subunit stoichiometries in the plasmalemma used for the recordings have not been determined. Co-expression of Kvβi or β₃ with Kvl α subunits accelerates inactivation of the K currents (2, 7), whilst β₂ increases surface expression (8-10).

Authentic Kvl channel proteins were first identified (11) using α and k/δ dendrotoxin (DTX) which inhibit these currents with a rank order of potency Kvl .2>l.l>1.6 and Kvl.l, respectively (12). Sequential immunoprecipitation, using subunit-specific antibodies, and affinity chromatography on immobilized αDTX and/or DTX (13-16) unveiled a limited repertoire of subtypes: Kv(l .2) and those containing Kvl .1/1.2/1.6, 1.2/1.3/1.4/1.6 or 1.1/1.2/1.3/1.4. Also, data from immunocytochemistry and in situ hybridisation established that Kvl.l, 1.2 and Kvβ2.1 are the most abundant subunits found together in channel complexes (14, 15, 17, 18). These subunits are co-localised in juxta-paranodal region of the nodes of Ranvier, as well as in the axons and terminals of cerebellar basket cells of rat brain (19). So far, heterologous expression of Kvl α and β subunits have failed to mimic the characteristics of neuronal K⁺ currents, highlighting the need to reproduce native K channels. Additionally, certain neurological conditions are associated with changes in Kvl channel multimers. For example, an increase in the number of αDTX binding sites occurs in demyelinated brain plaques from patients with multiple sclerosis (20), whilst the content of αDTX and DTX acceptors are decreased in hippocampus from ageing patients or those with Alzheimer's disease (21). Furthermore, several mutations in Kvl.l are associated with human disorders (e.g. episodic ataxia I and myokymia) (1, 22, 23) whereas mutations in certain other genes can distort expression and localisation of Kvl.l and 1.2, thereby, inducing abnormal phenotypes (e.g. mouse strains Trembler and Shiverer) (24).

Shamotienko et al (1999) describes the expression of α subunit monomers with a β subunit in mammalian cells. Mclntosh et al (1997) Eur J Physiol 435, 43-54 describes the expression of α subunit monomers with a β subunit in oocytes.

Expression of constructs encoding tandem fusions of α subunits is described in, for example, D'Adamo et al (1998) EMBO J 17, 1200-1207; Isacoff et al (1990) Nature 345, 530-534; Nunoki et al (1994) JBiol Chem 269, 24188-24142 and Liman et al (1992) Neuron 9, 861-871). However, the extent to which the encoded polypeptides are actually expressed and assembled appears to be very low. These recombinant channels have not been fully characterised biochemically and only electrophysiological data is available on some of the K channel subtypes. Most of the channels do not correspond to channels which exist in vivo.

We provide methods, polypeptides and polynucleotides useful in the study of K⁺ channels, particularly voltage-gated K channels and diseases affecting such channels, and in the identification or development of compounds affecting such channels.

A first aspect of the invention provides a method for preparing a K channel, preferably a voltage-gated K channel, comprising alpha subunits and beta subunits, the method comprising the step of providing the alpha subunits and beta subunits of said channel, wherein at least two said subunits, which subunits are naturally encoded as separate polypeptides, are provided as a fusion polypeptide comprising the said at least two subunits.

The method allows the preparation of K⁺ channels that correspond in their subunit composition to naturally occurring K channels. We have demonstrated that using the method the subunits assemble in an active form in quantities suitable for detailed biochemical analysis or for use in drug screening methods.

It is preferred that the voltage-gated K channel is a Kvl channel. The term "Kvl" channel is well known to those skilled in the art. Characteristics of Kvl channels are noted above and include the presence of polypeptides corresponding to the four transmembrane channel-forming (membrane- spanning) α subunits found in naturally occurring Kvl channels and polypeptides corresponding to the four cytoplasmic regulatory β subunits found in naturally occurring Kvl channels. The α subunits are considered to be members of the "Shaker" gene family on the basis of sequence similarity to the Drosophila Shaker gene.

Alternatively, the voltage-gated K⁺ channel may be a Kv2, Kv3 or Kv4 channel. The terms "Kv2", "Kv3" and "Kv4" channel are well known to those skilled in the art. Characteristics of Kv2, Kv3 and Kv4 channels are noted above and include the presence of polypeptides corresponding to the four transmembrane channel-forming α subunits found or thought to occur in naturally occurring Kv2, Kv3 or Kv4 channels. Due to the lack of specific ligands for Kv2, Kv3 and Kv4 channels, they have not been purified in their natural state and are therefore not fully characterised. The α subunits of Kv2 channels are considered to be members of the "Shab" gene family on the basis of sequence similarity to the Drosophila Shab gene. The α subunits of Kv3 channels are considered to be members of the "Shaw" gene family on the basis of sequence similarity to the Drosophila Shaw gene. The α subunits of Kv4 channels are considered to be members of the "Shal" gene family on the basis of sequence similarity to the Drosophila Shal gene.

It is considered that Kvl subunits assemble only with other Kvl subunits; Kv2 subunits assemble only with other Kv2 subunits; Kv3 assemble only with other Kv3 subunits and Kv4 subunits assemble only with other Kv4 subunits.

It is preferred that the subunits of the channel are provided by expressing the subunits of the channel, wherein at least two said subunits, which are naturally encoded as separate polypeptides, are expressed from a recombinant polynucleotide encoding a fusion polypeptide comprising the said two subunits.

Thus, the invention provides a method for preparing a K channel, preferably a voltage-gated K channel, comprising alpha subunits and beta subunits, the method comprising the step of expressing the alpha subunits and beta subunits of said channel in a cell, wherein at least two said subunits, which subunits are naturally encoded as separate polypeptides, are expressed from a recombinant polynucleotide encoding a fusion polypeptide comprising the said at least two subunits. It is preferred that the fusion polypeptide comprises or consists of two or more α subunits (including any appropriate linkers); or comprises or consists of two or more β subunits (including any appropriate linkers). It is preferred that all of the subunits of the channel are expressed from one or more recombinant polynucleotides.

It is preferred that the subunits/fusion protein(s) are expressed in a cell. It is further preferred that the subunits/fusion protein(s) are assembled into a channel in the cell. Thus the cell may contain the channel in the plasma membrane.

The cell may be an oocyte, for example a Xenopus oocyte. Methods of obtaining and handling such oocytes are well known to those skilled in the art, for example as described in the Examples and references cited herein.

Alternatively, the cell may be a mammalian cell, for example BHK (Baby Hamster Kidney) cells, Chinese hamster ovary (CHO) cells. Suitable cell lines are commercially available, for example from the American Type Culture Collection (ATCC) of Rockville, MD, USA.

BHK cells are particularly preferred, for example for channel characterisation or for drug screening. Good expression may be obtained in such cells, as shown in Example 1. The cell may be a plant cell, particularly if the K⁺ channel is a plant K channel.

It is preferred that the cell does not naturally express the type of K channel under investigation. For example, it is preferred that the cell does not naturally express voltage-gated K⁺ channels or subunits thereof when the K channel is a voltage-gated K channel. Thus, it is preferred that the cell is not naturally an excitable cell. Expression may alternatively or additionally be judged by methods well known to those skilled in the art, for example using PCR.

The cell may be in a human or non-human animal body (or in a plant). Alternatively, the method may be performed in vitro, ie on cells in tissue culture.

A further aspect ofthe invention provides a method for preparing a voltage- gated K channel comprising more than one subunit, the method comprising the step of providing the subunits of said channel, wherein at least two said subunits, which subunits are naturally encoded as separate polypeptides, are provided as a fusion polypeptide comprising the said at least two subunits and wherein the said fusion polypeptide is provided by expressing the fusion polypeptide in a mammalian cell from a recombinant polynucleotide encoding the said fusion polypeptide.

It is preferred that all of the subunits are expressed in a mammalian cell. Still more preferably, the method is performed in a mammalian cell, ie the channel is assembled in the mammalian cell, as discussed above. The cell may be in a human or non-human animal body, or the method may be performed in vitro, ie using cells in tissue culture. The following preferences apply to both the first and second aspects of the invention.

It is preferred in relation to the first or second aspect of the invention that the subunits or fusion protein are expressed using a Semliki Forest Virus (SFV) expression system, for example as described in Example 1. As well known to those skilled in the art, a SFV particle has a single copy of an ssR A genome surrounded by a nucleocapsid and a lipid bilayer carrying further viral polypeptides. The RNA genome is 5' capped and 3' polyadenylated and has positive polarity, so that it functions as an mRNA. Naked RNA is able to start an infection when introduced into a cell.

The expression system employs an expression vector (for example pSFVl or pSFV3) based on the full-length cDNA clone of SFV with the coding region (but not the promoter) of the 26S structural genes deleted to make way for heterologous inserts. PSFVl and pSFV3 differ in the position of the polylinker cassette. A control expression construct is pSFV3-/ cZ, which has a heterologous insert encoding E. coli β-galactosidase, though other control constructs (expressing polypeptides which may easily be assayed or detected) may be used.

The expression vector is used in conjunction with a helper construct, which encodes the structural proteins needed for the assembly of virus particles, but which does not have the RNA sequence signals required for assembly into virus particles.

cRNA from the expression vector and the helper vector is used to co- transfect animal cells, which then produce recombinant virus particles which contain only recombinant genomes (which include the heterologous insert but not the coding region of the 26S structural genes). The recombinant virus particles may then be used to infect further cells. The recombinant RNA is replicated and expressed in the infected cells without producing further viral particles.

Cells may be infected with more than one type of recombinant SFV particles, for example having different heterologous inserts. Thus, a cell may be infected with SFV particles encoding one or more α subunits and with SFV particles encoding one or more β subunits.

Alternatively, a cell may be infected with SFV particles encoding both α and β subunit(s) , so that the channel subunits may be expressed from a single SFV construct. For example, the same promoter may be used for the coding regions for the α and β subunits. This would enable the two types of subunits to be translated independently but in similar, comparable (and compatible) amounts.

References which discuss the SVF expression system include the following: Blasey et al (1997) Cytotechnology 24, 65-72; Lundsfrom et al (2001) FEBS Lett 25116, 1-5; Lundsfrom et al (1997) J Recept Signal Transduct Res 17, 115-126.

Suitable cell types for use with a Semliki Forest Virus expression system include the following: BHK (for example BHK-21); Vero (monkey kidney);

CV1 (monkey kidney); COS (monkey kidney); CEF (chicken embryo fibroblast); CHO; C^Λ (rat glial tumour); B103 (rat neuroblastoma); HOS

(human osteaosarcoma); mouse myeloma; rat myoblasts; IB-4 (human lymphoblasotid/EBV immortalised); human embryonal fϊbroblasts; C6/36

(mosquito/ Aedes Albopictus); MCDK (canine); rat hippocampal neurons;

Weri-27RB (human retinoblastoma); HeLa (human epithelial); MOLT-4

(human CD4⁺, T-cell human lymphocytes).

In an embodiment, the fusion polypeptide comprises at least two α subunits. α subunits, as noted above, are capable of assembling to form a membrane channel. It is particularly preferred that the fusion polypeptide consists of two or four α subunits (including linker sequences).

We have surprisingly found that it is possible to express a fusion polypeptide consisting of two or more, for example four, α subunits in quantities and with a consistency of channel subunit composition suitable for biochemical analysis or drug screening. In view of, for example, the size and structural complexity of the subunits (for example, number of transmembrane domains), it was surprising that intact fusion polypeptides were expressed and assembled in significant quantities.

Methods of determining whether a polypeptide can be considered to be a K⁺ channel, for example voltage-gated K channel, for example Kvl channel, subunit, for example an α subunit or a β subunit, will be well known to those skilled in the art, and include sequence comparisons. Other methods may include functional tests, for example determination of the ability of the polypeptide to assemble with other channel subunits to form a functional channel, which may be assessed using methods including those described or reviewed in Example 1. Thus, the ability of the subunit to cooperate in supporting a K current may be measured, for example using known techniques for measuring ion currents, for example as described in Example 1. It is preferred that the subunit is capable of performing the function of a naturally occuring K⁺ channel subunit, for example is capable of cooperating in providing a K channel, to at least (in order of preference) 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% of the level (for example of K⁺ current) achieved by a naturally occuring K⁺ channel subunit.

The channel subunit may be a naturally occurring channel subunit, for example a Kvl channel α subunit, or may be a variant, fragment, derivative or fusion of a naturally occurring channel subunit, for example a Kvl channel α subunit.

It is preferred that an α subunit is able to interact with other (identical or different) α subunits and with β subunits to form a functional K channel, for example a functional voltage-gated K⁺ channel.

By "variants" of a polypeptide, for example of naturally occurring Kvl.l, Kvl.2, Kvl.3, Kvl .4, Kvl.5 or Kvl.6, Kvβ_l5 Kvβ₂ or Kvβ₃, we include insertions, deletions and substitutions, either conservative or non- conservative. In particular we include variants of the polypeptide where such changes do not substantially alter the activity of the said polypeptide, for example the ability of the channel polypeptide to participate in a channel structure comprising other channel subunits, which is capable of supporting a K current (preferably voltage-gated), as described above, in Example 1 and below.

By "conservative substitutions" is intended combinations such as Gly, Ala; Val, He, Leu; Asp, Glu; Asn, Gin; Ser, Thr; Lys, Arg; and Phe, Tyr. It is particularly preferred if the subunit variant has an amino acid sequence which has at least 45% identity with the amino acid sequence of a rat or human channel subunit, particularly a rat Kvl channel subunit (see Stuhmer et al (1989) EMBO J 8, 3235-3244) or human Kvl channel subunit, for example the amino acid sequence of human Kvl .l (Ramashwami et al (1990) Mol Cell Neurosci 1, 214-223); Kvl.2 (see NCBI Annotation Project Submission 23 August 2001); Kvl.3 (Attali et al (1992) J Biol Chem 267, 8650-8657); Kvl .4 (Ramashwami et al (1990) Mol Cell Neurosci 1, 214-223); Kvl.5 (see NCBI Annotation Project Submission 23 August 2001); Kvl.6 (see NCBI Annotation Project Submission 23 August 2001), for example as shown in Figure 4; Kvβl (Leicher et al (1996) Neuropharmacol 35, 787-795); Kvβ2 or Kvβ3 (see references in Coleman et al (1999) J Neurochemistry 73, 849-858) more preferably at least 50%, 55%, 60%, 65%, 70%, still more preferably at least 75%, yet still more preferably at least 80%, in further preference at least 85%>, in still further preference at least 90% and most preferably at least 95% or 97% identity with the amino acid sequence defined above.

The percent sequence identity between two polypeptides may be determined using suitable computer programs, for example the GAP program of the University of Wisconsin Genetic Computing Group and it will be appreciated that percent identity is calculated in relation to polypeptides whose sequence has been aligned optimally.

The alignment may alternatively be carried out using the Clustal W program (Thompson et al (1994) Nucl Acid Res 22, 4673-4680). The parameters used may be as follows: Fast pairwise alignment parameters: K-tuple(word) size; 1, window size; 5, gap penalty; 3, number of top diagonals; 5. Scoring method: x percent. Multiple alignment parameters: gap open penalty; 10, gap extension penalty; 0.05. Scoring matrix: BLOSUM.

"Variations" of the polypeptide also include a polypeptide in which relatively short stretches (for example 5 to 20 amino acids) have a high degree of homology (at least 80% and preferably at least 90 or 95%) with equivalent stretches of the polypeptide even though the overall homology between the two polypeptides may be much less. This is because important active or binding sites may be shared even when the general architecture of the protein is different, as indicated above.

It is preferred that the subunit polypeptide, for example Kvl channel subunit polypeptide, for example α subunit or β subunit, is a polypeptide which consists ofthe amino acid sequence ofthe relevant polypeptide given in a reference indicated above, or naturally occurring allelic variants, fragments or fusions or fusions of fragments thereof.

It is preferred that an α subunit polypeptide has structural features present in naturally occuring α subunits. For example, it is preferred that an α subunit polypeptide has six putative transmembrane domains (S1-S6). It is further preferred that the "voltage sensor" positively-charged repeat motif (Arg/Lys XX) found in S4 is present. It preferred that possible phosphorylation sites and N-glycosylation motif and/or any residues required for sialoglycosylation of a naturally occuring channel subunit are retained in any variant, fragment, fusion or fusion of fragment thereof. It is preferred that the cytosolic N-terminal region (particularly residues equivalent to residues 83-196 of Shaker B or 66-194 of Kvl.l) of a naturally occurring α subunit is retained. This region may be involved in determining the specificity of assembly of K⁺ channel α subunits. However, it may not be necessary for all (or any) of the α subunit to have the cytosolic N-terminal region or sequences. It may be useful to replace the cytosolic N-terminal region or sequence by the equivalent region of a closely related α subunit. For example, the N-terminal region of Kvl.l may be replaced by the N-terminal region of Kvl .2, as discussed in the Examples.

By "residue equivalent to" a particular residue, for example the residue X of full-length Kvl.l, for example mouse or human Kvl.l, is included the meaning that the amino acid residue occupies a position in the native two or tliree dimensional structure of a polypeptide, for example a Kvl.l homologue or variant, corresponding to the position occupied by the said particular residue, for example X, in the native two or three dimensional structure of full-length Kvl .1.

The residue equivalent to a particular residue, for example the residue X of full-length Kvl .l, may be identified by alignment of the sequence of the polypeptide with that of full-length Kvl.l in such a way as to maximise the match between the sequences. The alignment may be carried out by visual inspection and/or by the use of suitable computer programs, for example the GAP program of the University of Wisconsin Genetic Computing Group, which will also allow the percent identity of the polypeptides to be calculated. The Align program (Pearson (1994) in: Methods in Molecular Biology, Computer Analysis of Sequence Data, Part II (Griffin, AM and Griffin, HG eds) pp 365-389, Humana Press, Clifton). Thus, residues identified in this manner are also "equivalent residues".

It will be appreciated that in the case of truncated forms of Kvl.l or in forms where simple replacements of amino acids have occurred it is facile to identify the "equivalent residue".

The sequence for human Kvl.l is given in, for example Ramashwami et al (1990) Mol Cell Neurosci 1, 214-223.

The three-letter and one-letter amino acid code of the IUPAC-IUB Biochemical Nomenclature Commission is used herein. The sequence of polypeptides are given N-terminal to C-terminal as is conventional. In particular, Xaa represents any amino acid. It is preferred that the amino acids are L-amino acids, but they may be D-amino acid residues.

In a preferred embodiment, the fusion polypeptide may comprise or consist of two Kvl.l subunits or two Kvl .2 subunits (including appropriate linkers). The fusion polypeptide may comprise or consist of a Kvl.l subunit and a Kvl.2 subunit (including appropriate linkers).

It is preferred that the fusion polypeptide has two or four α subunits present therein. It is strongly preferred that the fusion polypeptide has no more than four α subunits present therein. It is also preferred that the fusion polypeptide does not have three α subunits present therein. For example, the fusion polypeptide may preferably have two Kvl.l subunits (Kvl.1-1.1), two Kvl .2 subunits (Kvl.2-1.2), one Kvl.l subunit and one Kvl .2 subunit (Kvl.1-1.2 or Kvl.2-1.1), or one Kvl.l subunit and three Kvl .2 subunits (for example Kvl.l-(1.2)₃) or three Kvl.l subunits and one Kvl .2 subunit (for example Kvl .2-(l .1)₃).

The subunits within the fusion protein may be separated by a linker region, which is preferably hydrophilic, for example a sequence derived from the 5' UTR (untranslated region) of the Xenopus β-globin gene, for example DTQKETLNFGRSTLEI. This sequence acts as a good linker because it is hydrophilic and because it is consistent with expression at a high level; the β-globin gene expresses at a high level.

It is preferred that the codon encoding the N-terminal methionine of each subunit making up a fusion polypeptide, other than the most N-terminal, is deleted or mutated. This is demonstrated in Example 1 and Example 2. If the (now internal) "N-terminal" methionine codons are not removed, there may be significant expression from these codons, leading to the presence (in the case of a tetrameric α subunit fusion protein) of α subunit monomers, dimers and trimers. This is undesirable, particularly in the context of drug screening or investigation of biochemical properties, as it means that a mixture of channels with different subunit stoichiometries may be present.

It is also desirable for conditions of expression to be selected which minimise proteolysis of the fusion protein, for example to monomers, dimers or trimers. For example, the multiplicity of infection or time at which the cells are harvested may require careful selection or monitoring in order to maximise expression of channels with homogeneous subunit compositions. This is discussed in Examples 1 and 2.

The K⁺ channel (preferably voltage-gated K channel) may comprise a Kvβ] or Kvβ₂ subunit. Alternatively, it may comprise a Kvβ₃ subunit. The channel may comprise more than one type of β subunit.

The fusion protein may comprise a Kvβ subunit, either with a second (or more) Kvβ subunit (which may be the same type of Kvβ subunit or different) and/or with an α subunit. A fusion polypeptide comprising Kvβ_2-1 and Kvβ subunits may be useful, as this combination of β subunits is considered to occur naturally.

It is preferred that the fusion protein comprises only α subunits or only β subunits, ie fusion proteins comprising one or more β subunit and one or more α subunits are not preferred, because it is considered that such a fusion protein may not fold or assemble correctly; or may have altered (non-physiological) properties.

The channel may be assembled from two or more fusion proteins. For example, the channel may be assembled from two copies of a fusion protein containing two α subunits, as described in Example 1. Alternatively, the channel may be assembled from copies of two or more different fusion proteins. However, this may lead to a mixed population of channels, due to possible difficulties in controlling assembly of a channel, which may not be desirable. Thus, it may be preferred that the channel is assembled from a single or multiple copies of a single type of polypeptide providing α subunits and a single or multiple copies of a single type of polypeptide providing β subunits.

A further aspect of the invention provides a K channel, preferably a voltage-gated K⁺ channel, obtainable by the method of either of the preceding aspects of the invention. Preferably, the channel is obtainable by a method according to the first aspect of the invention. It is considered that a channel expressed from given constract(s) in a mammalian cell will differ from the channel expressed from the same construct(s) in, for example, a Xenopus oocyte in relation to its glycosylation state.

A further aspect of the invention provides a cell comprising a K channel, preferably a voltage-gated K⁺ channel, obtainable by the method of either of the preceding aspects of the invention. It is particularly preferred that the K channel corresponds to (ie has the same subunit content) as a naturally occurring K⁺ channel, particularly a K channel that is characteristic of a particular tissue, disease or condition.

A further aspect of the invention provides a method for identifying a compound which modulates the activity of a K channel, for example a voltage-gated K channel, the method comprising the step of exposing a K⁺ channel or cell according to the preceding aspects of the invention to a test compound and determining whether the compound binds to the said K⁺ channel (preferably voltage-gated) or K⁺ channel (preferably voltage-gated) in the said cell and/or whether the compound affects the channel activity.

The method may further comprise the steps of exposing at least one further type of recombinant K channel or cell expressing a recombinant K⁺ channel to the test compound and selecting a compound which binds and/or affects the channel activity of the first and at least one further K channels or cells to different extents. It is preferred that the further K⁺ channel or cell expressing a recombinant K channel is a K channel or cell of the invention but this is not essential. For example, the effect of a compound on a K⁺ channel assembled from an α-subunit tetramer (for example (Kvl.l)₃Kvl.2) may be compared with the effect of the compound on a K channel which is assembled from four individual α subunits (for example (Kvl .2)₄). It is preferred that each channel is assembled in a manner that results in a defined subunit stoichiometry. For example, the channel may be assembled from multiple copies of one type of α subunit and multiple copies of one type of β subunit. It is preferred that each K⁺ channel corresponds to a naturally occurring K channel, for example as identified in Coleman et al (1999) JNeurochem 73, 849-858.

The method may further comprise the step of synthesising therapeutically useful quantities of the compound.

A further aspect of the invention provides a compound identifiable by the method. A still further aspect provides a compound identifiable by the method for use in medicine. The compound is not Dendrotoxin_k or α- Dendrotoxin.

A further aspect of the invention provides a method of treating a patient with a neurological disease or condition, or other disease or condition in which a K channel defect is involved, wherein the patient is administered a compound identifiable by the method. A still further aspect of the invention provides the use of a compound identifiable by the method in the manufacture of a medicament for treating a patient with a neurological disease, or other disease or condition in which a K⁺ channel defect is involved.

Diseases or conditions in which a K channel defect is involved may be termed potassium channelopathies, and include the following: episodic ataxia with myokymia, long QT syndrome, Bartter's syndrome (all human conditions) and weaver ataxia in mice. Potassium channelopathies are reviewed in, for example, Sanguinetti & Spector (1997) Neuropharmacol 36, 755-762. The following references also relate to diseases or conditions linked with K channel defects, for which a method of treatment of the invention may be appropriate: Smart et al (1998) Neuron 20, 809-819 (link between Kvl.l deficiency and epilepsy); Singh et al (1998) Nature Genet 18, 25-29 (link between a mutation in Kvl .2 and epilepsy); Adelman et al (1995) Neuron 15, 1449-1454 (link between Kvl.l mutation and episodic ataxia); Browne et al (1995) Hum Mol Genet 4, 1671-1672 (link between Kvl.l mutations and episodic ataxia/myokymia); Wang et al (1995) Neuron 15, 1337-1347 (changes in K⁺ channel expression in mice with mutations in myelin or associated proteins, leading to dysmyelination).

For example, the chimaeric Kvl.l polypeptide of the invention (or polynucleotide encoding it) may be useful in patients with a defect in the Kvl.l gene, for example a patient with episodic ataxia with myokymia.

By a K channel defect is included aberrant over-expression or increased activity, as well as reduced expression (including absence) or activity, of a particular channel in a particular cell or tissue type. As discussed in Example 1, comparison of K⁺ channels with defined subunit stoichiometries, prepared using methods and constructs of the invention, has clearly revealed for the first time that channels with similar but different subunit compositions have distinct pharmacological, electrophysiological and biochemical properties, including distinct binding affinities for inhibitors. The present invention provides K channels of homogeneous, defined subunit composition which correspond to native K channels, in suitable quantities for performing drug screening. Because different native K⁺ channels appear to have distinct, different tissue/cell distribution, the ability to conduct differential screens in relation to multiple K channels of defined subunit composition may be very useful in developing compounds that act selectively on particular K⁺ channels and hence particular tissues/cells. Further, the characterisation of channels present in a cell or tissue of interest by comparison of properties with K⁺ channels with a defined subunit stoichiometry, particularly K⁺ channels of the invention, allows the correct K⁺ channels to be selected for screening in relation to a particular disease or condition.

Preferably, the method comprises the step of determining the effect of the compound on the K⁺ current of a cell of the invention. It is preferred that the cell is a mammalian cell, preferably a stable cell line expressing the K⁺ channel. However, the cell may alternatively transiently express the K⁺ channel; for example, the cell may be a Xenopus oocyte that transiently expresses the K channel from introduced cRNA, as discussed in the Examples.

It is strongly preferred that the K channel is equivalent to a naturally occurring K channel, ie has a subunit composition equivalent to a naturally occurring K channel (even though at least two subunits of the naturally occurring K⁺ channel ofthe invention are considered to be present in the K channel of the invention (or at least during its formation) as a fusion polypeptide). For example, it is preferred that the K⁺ channel comprises β subunits.

Screens may be performed on cells using intracellular dyes whose properties alter depending on the membrane potential ofthe cell. The effect of compounds on changes in membrane potential arising from recombinant K channels may be measured. Suitable techniques and compounds are described in, for example, Chanda & Mathew (1999) Biochim Biophys Ada 1416, 92-100. For example, the carbocyanide dye JC-1 (5',5',6',6'- Tetrachloro-l,l,3,3'-tetraethylbenzimadazolylcarbocyanine iodide) may be used. The intensity of the fluorescence signal of the dye changes with changes in membrane potential.

A further aspect of the invention provides a method for determining the type of K channel, preferably voltage-gated K channel, still more preferably Kvl -type voltage-gated K channel, in a cell comprising the steps of investigating one or more channel characteristics, for example selected from

(i) binding of the channel or cell to an interacting compound, for example dendrotoxin); and

(ii) cell K⁺ current properties and comparing the determined characteristic(s) with characteristics determined for a channel or cell according to the invention.

A further aspect of the invention provides a method for diagnosis of neuronal disease wherein a method according to the preceding aspect of the invention is used. For example, the method may be used to determine whether abnormal channels are being assembled at a significant level in a patient's tissue. This may be useful in determining the cause of a defect or condition and/or in determining what compounds may be useful in treating the patient. The method may be used in conjunction with other methods of diagnosis useful in relation to neuronal disease.

A further aspect of the invention provides a mammalian cell comprising a recombinant polynucleotide encoding a fusion protein as defined in relation to the preceding aspects of the invention ie comprising at least two subunits of a K⁺ channel, preferably a voltage gated K channel.

A further aspect of the invention provides a fusion polypeptide comprising one Kvl.l subunit and three Kvl .2 subunits (preferably consisting of these subunits (including any appropriate linkers)). A still further aspect of the invention provides a recombinant polynucleotide encoding a fusion polypeptide comprising one Kvl.l subunit and three Kvl .2 subunits (preferably consisting of these subunits (including any appropriate linkers)). Examples of such fusion polypeptides and recombinant polynucleotides are described in Example 1. Channels comprising one Kvl.l subunit and tliree Kvl .2 subunits are considered to occur naturally.

The polynucleotide may be DNA or RNA, preferably DNA. The polynucleotide may or may not contain introns in the coding sequence; preferably the polynucleotide is a cDNA or cRNA.

A still further aspect of the invention provides a Semliki Forest virus expression vector (for example pSFVl or pSFV3) or cRNA or infectious virus particle comprising a polynucleotide sequence encoding a fusion protein as defined in relation to the preceding aspects of the invention ie comprising at least two subunits of a K⁺ channel, preferably a voltage gated K⁺ channel. The expression vector or cRNA or infectious virus particle may comprise a polynucleotide sequence encoding all subunits of the intended K⁺ channel; for example the polynucleotide sequence may encode α subunits and β subunits. A further aspect ofthe invention provides a host cell comprising such a vector or cRNA of such a vector. The host cell may further comprise a SFV helper vector as discussed above or may be a cell infected with an infectious virus particle of the invention with the intention of expressing the fusion protein in the cell. Such a cell may further comprise a SFV expression vector or cRNA or be infected with an infectious virus particle which encodes further subunits ofthe K channel.

A further aspect of the invention provides a chimaeric Kvl.l polypeptide comprising the C-terminal region of Kvl.l, wherein the N-terminal assembly-regulating region of Kvl.l is replaced by the N-terminal assembly-regulating region of Kvl .2. Expression of the Kvl.l polypeptide in useful quantities is difficult in the absence of other types of Kv α subunit; such a chimaeric Kvl.l polypeptide is considered to give a satisfactory yield of surface-expressed, stable protein, suitable for biochemical characterisation, which also retains the pharmacological properties ofthe Kvl.l channel.

A further aspect of the invention therefore provides a K⁺ channel comprising such a chimaeric Kvl .l polypeptide. A still further aspect of the invention provides a host cell comprising a K channel comprising such a chimaeric Kvl.l polypeptide.

We have found that channels with four Kvl.l subunits are found in plaques taken from post-mortem samples of patients suffering from Multiple Schlerosis (MS). Channels with four Kvl.l subunits have not previously been found in normal brain. These channels may act to weaken nerve signal transmission. Accordingly, compounds that are able selectively to modulate (Kvl.l)₄ channel activity, preferably inhibit or change the properties of (Kvl.l)₄ channels to more closely resemble those of channel types found in normal brain, may be useful in treating MS.

A further aspect of the invention provides a method for identifying a compound which modulates the activity of a voltage-gated K channel comprising a Kvl.l α subunit, comprising the step of exposing a chimaeric Kvl.l subunit of the invention (or, more preferably a channel or host cell comprising such a chimaeric subunit, preferably in a (Kvl.l)₄ channel) to a test compound and determining whether the compound binds to the said chimaeric subunit or channel or cell and/or whether the compound affects the channel activity. The method may be useful for identifying a compound for administering to a patient with or at risk of MS.

The method may further comprise the step of determining the effect of the test compound on, or ability of the test compound to bind to, other K⁺ channels (preferably voltage-gated K channels), and selecting a compound that affects only or preferentially the Kvl.l subunit or (Kvl.l)₄ channel.

A further aspect of the invention provides a compound identified or identifiable by the screening method. A still further aspect of the invention provides a compound identified or identifiable by the screening method for use in medicine.

A still further aspect ofthe invention provides the use of a compound which modulates the activity (preferably selectively modulates the activity) of a (Kvl.1)₄ K⁺ channel in the manufacture of a medicament for the treatment of a patient with or at risk of MS. The compound may be identified or identifiable by the above method ofthe invention.

A further aspect of the invention provides a method of treating a patient with MS comprising administering to the patient a compound which modulates the activity (preferably selectively modulates the activity) of a (Kvl.1)₄ K channel. The compound may be identified or identifiable by the above method ofthe invention.

Suitably, the chimaeric Kvl .l polypeptide comprises 158 amino acids derivable from Kvl.2 and 333 amino acids derivable from Kvl.l.

Such a polypeptide and polynucleotide encoding it may be prepared by methods well known to those skilled in the art, for example as described in Example 1.

Accordingly, a further aspect of the invention provides a polynucleotide encoding the chimaeric Kvl.l polypeptide ofthe invention. Preferences for such a polynucleotide are as indicated in relation to other polynucleotides of the invention.

A further aspect of the invention provides a replicable vector comprising a polynucleotide encoding the chimaeric Kvl.l polypeptide of the invention. The vector may be a SFV expression vector.

A variety of methods have been developed to operably link polynucleotides, especially DNA, to vectors for example via complementary cohesive termini. For instance, complementary homopolymer tracts can be added to the DNA segment to be inserted to the vector DNA. The vector and DNA segment are then joined by hydrogen bonding between the complementary homopolymeric tails to form recombinant DNA molecules.

Synthetic linkers containing one or more restriction sites provide an alternative method of joining the DNA segment to vectors. The DNA segment, generated by endonuclease restriction digestion as described earlier, is treated with bacteriophage T4 DNA polymerase or E. coli DNA polymerase I, enzymes that remove protruding, 3 '-single-stranded termini with their 3'-5'-exonucleolytic activities, and fill in recessed 3'-ends with their polymerizing activities.

The combination of these activities therefore generates blunt-ended DNA segments. The blunt-ended segments are then incubated with a large molar excess of linker molecules in the presence of an enzyme that is able to catalyze the ligation of blunt-ended DNA molecules, such as bacteriophage T4 DNA ligase. Thus, the products of the reaction are DNA segments carrying polymeric linker sequences at their ends. These DNA segments are then cleaved with the appropriate restriction enzyme and ligated to an expression vector that has been cleaved with an enzyme that produces termini compatible with those ofthe DNA segment.

Synthetic linkers containing a variety of restriction endonuclease sites are commercially available from a number of sources including International Biotechnologies Inc, New Haven, CN, USA.

A desirable way to modify the DNA encoding the polypeptide of the invention is to use the polymerase chain reaction as disclosed by Saiki et al (1988) Science 239, 487-491. This method may be used for introducing the DNA into a suitable vector, for example by engineering in suitable restriction sites, or it may be used to modify the DNA in other useful ways as is known in the art.

In this method the DNA to be enzymatically amplified is flanked by two specific primers which themselves become incoφorated into the amplified DNA. The said specific primers may contain restriction endonuclease recognition sites which can be used for cloning into expression vectors using methods known in the art.

The DNA (or in the case of retroviral vectors, RNA) is then expressed in a suitable host to produce a polypeptide comprising the compound of the invention. Thus, the DNA encoding the polypeptide of the invention may be used in accordance with known techniques, appropriately modified in view of the teachings contained herein, to construct an expression vector, which is then used to transform an appropriate host cell for the expression and production of the polypeptide of the invention. Such techniques include those disclosed in US Patent Nos. 4,440,859 issued 3 April 1984 to Rutter et al, 4,530,901 issued 23 July 1985 to Weissman, 4,582,800 issued 15 April 1986 to Crowl, 4,677,063 issued 30 June 1987 to Mark et al, 4,678,751 issued 7 July 1987 to Goeddel, 4,704,362 issued 3 November 1987 to Itakura et al, 4,710,463 issued 1 December 1987 to Murray, 4,757,006 issued 12 July 1988 to Toole, Jr. et al, 4,766,075 issued 23 August 1988 to Goeddel et al and 4,810,648 issued 7 March 1989 to Stalker, all of which are incorporated herein by reference.

The DNA (or in the case of retroviral vectors, RNA) encoding the polypeptide constituting the compound of the invention may be joined to a wide variety of other DNA sequences for introduction into an appropriate host. The companion DNA will depend upon the nature of the host, the manner of the introduction of the DNA into the host, and whether episomal maintenance or integration is desired.

Generally, the DNA is inserted into an expression vector, such as a plasmid, in proper orientation and correct reading frame for expression. If necessary, the DNA may be linked to the appropriate transcriptional and translational regulatory control nucleotide sequences recognised by the desired host, although such controls are generally available in the expression vector. The vector is then introduced into the host through standard techniques. Generally, not all of the hosts will be transformed by the vector. Therefore, it will be necessary to select for transformed host cells. One selection technique involves incorporating into the expression vector a DNA sequence, with any necessary control elements, that codes for a selectable trait in the transformed cell, such as antibiotic resistance. Alternatively, the gene for such selectable trait can be on another vector, which is used to co- transform the desired host cell.

Host cells that have been transformed by the recombinant DNA of the invention are then cultured for a sufficient time and under appropriate conditions known to those skilled in the art in view of the teachings disclosed herein to permit the expression ofthe polypeptide, which can then be recovered.

Many expression systems are known, including bacteria (for example E. coli and Bacillus subtilis), yeasts (for example Saccharomyces cerevisiae), filamentous fungi (for example Aspergillus), plant cells, animal cells and insect cells. The vectors include a prokaryotic replicon, such as the ColEl ori, for propagation in a prokaryote, even if the vector is to be used for expression in other, non-prokaryotic, cell types. The vectors can also include an appropriate promoter such as a prokaryotic promoter capable of directing the expression (transcription and translation) of the genes in a bacterial host cell, such as E. coli, transformed therewith.

A promoter is an expression control element formed by a DNA sequence that permits binding of RNA polymerase and transcription to occur. Promoter sequences compatible with exemplary bacterial hosts are typically provided in plasmid vectors containing convenient restriction sites for insertion of a DNA segment ofthe present invention.

Typical prokaryotic vector plasmids are pUC18, pUC19, pBR322 and pBR329 available from Biorad Laboratories, (Richmond, CA, USA) and p7 c99A andpKK223-3 available from Pharmacia, Piscataway, NJ, USA.

A typical mammalian cell vector plasmid is pSVL available from Pharmacia, Piscataway, NJ, USA. This vector uses the SV40 late promoter to drive expression of cloned genes, the highest level of expression being found in T antigen-producing cells, such as COS-1 cells.

An example of an inducible mammalian expression vector is pMSG, also available from Pharmacia. This vector uses the glucocorticoid-inducible promoter of the mouse mammary tumour virus long terminal repeat to drive expression ofthe cloned gene.

Useful yeast plasmid vectors are ρRS403-406 and pRS413-416 and are generally available from Stratagene Cloning Systems, La Jolla, CA 92037, USA. Plasmids pRS403, pRS404, pRS405 and pRS406 are Yeast Integrating plasmids (Yips) and incoφorate the yeast selectable markers HIS3, TRP1, LEU2 and URA3. Plasmids pRS413-416 are Yeast Centromere plasmids (YCps).

A still further aspect of the invention provides a host cell comprising a replicable vector or polynucleotide of the invention. Preferably the host cell is a mammalian cell suitable for expressing the chimaeric polypeptide. However, the host cell can be either prokaryotic or eukaryotic. Bacterial cells are preferred prokaryotic host cells and typically are a strain of E. coli such as, for example, the E. coli strains DH5 available from Bethesda Research Laboratories Inc., Bethesda, MD, USA, and RR1 available from the American Type Culture Collection (ATCC) of Rockville, MD, USA (No ATCC 31343). Preferred eukaryotic host cells include yeast, insect and mammalian cells, preferably vertebrate cells such as those from a mouse, rat, monkey or human fibroblastic and kidney cell lines. Yeast host cells include YPH499, YPH500 and YPH501 which are generally available from Stratagene Cloning Systems, La Jolla, CA 92037, USA. Preferred mammalian host cells include Chinese hamster ovary (CHO) cells available from the ATCC as CCL61, NIH Swiss mouse embryo cells NIH/3T3 available from the ATCC as CRL 1658, monkey kidney-derived COS-1 cells available from the ATCC as CRL 1650 and 293 cells which are human embryonic kidney cells. Preferred insect cells are Sf9 cells which can be transfected with baculovirus expression vectors.

Transformation of appropriate cell hosts with a DNA construct of the present invention is accomplished by well known methods that typically depend on the type of vector used. With regard to transformation of prokaryotic host cells, see, for example, Cohen et al (1972) Proc. Natl. Acad. Sci. USA 69, 2110 and Sambrook et al (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Transformation of yeast cells is described in Sherman et al (1986) Methods In Yeast Genetics, A Laboratory Manual, Cold Spring Harbor, NY. The method of Beggs (1978) Nature 275, 104-109 is also useful. With regard to vertebrate cells, reagents useful in transfecting such cells, for example calcium phosphate and DEAE-dextran or liposome formulations, are available from Stratagene Cloning Systems, or Life Technologies Inc., Gaithersburg, MD 20877, USA.

Electroporation is also useful for transforming and/or transfecting cells and is well known in the art for transforming yeast cell, bacterial cells, insect cells and vertebrate cells.

For example, many bacterial species may be transformed by the methods described in Luchansky et al (1988) Mol. Microbiol. 2, 637-646 incoφorated herein by reference. The greatest number of transformants is consistently recovered following electroporation of the DNA-cell mixture suspended in 2.5X PEB using 6250V per cm at 25:FD.

Methods for transformation of yeast by electroporation are disclosed in Becker & Guarente (1990) Methods Enzymol. 194, 182.

Successfully transformed cells, ie cells that contain a DNA construct of the present invention, can be identified by well known techniques. For example, cells resulting from the introduction of an expression construct of the present invention can be grown to produce the polypeptide of the invention. Cells can be harvested and lysed and their DNA content examined for the presence of the DNA using a method such as that described by Southern (1975) J. Mol. Biol. 98, 503 or Berent et al (1985) Biotech. 3, 208. Alternatively, the presence of the protein in the supernatant can be detected using antibodies as described below.

In addition to directly assaying for the presence of recombinant DNA, successful transformation can be confirmed by well known immunological methods when the recombinant DNA is capable of directing the expression of the protein. For example, cells successfully transformed with an expression vector produce proteins displaying appropriate antigenicity. ι Samples of cells suspected of being transformed are harvested and assayed for the protein using suitable antibodies.

Thus, in addition to the transformed host cells themselves, the present invention also contemplates a culture of those cells, preferably a clonally homogeneous culture, or a culture derived from clonally homogeneous culture, in a nutrient medium.

A further aspect of the invention provides a method of preparing a fusion protein or chimaeric polypeptide as defined in any of the preceding claims comprising culturing a mammalian cell of the invention and optionally isolating said polypeptide (or membrane comprising said polypeptide), for example as part of an assembled channel, from said mammalian cell. Methods of cultivating host cells and isolating recombinant proteins are well known in the art.

A further aspect of the invention provides a fusion protein or chimaeric polypeptide obtainable by the preceding aspect ofthe invention. It will be appreciated that the above methods may also be used in relation to further polypeptides described above that are useful.

As will be apparent to the skilled person, the above polypeptides may be made by methods well known in the art and as described above and in Example 1, for example using molecular biology methods or automated chemical peptide synthesis methods.

Peptides may be synthesised by the Fmoc-polyamide mode of solid-phase peptide synthesis as disclosed by Lu et al (1981) J. Org. Chem. 46, 3433 and references therein. Temporary N-amino group protection is afforded by the 9-fluorenylmethyloxycarbonyl (Fmoc) group. Repetitive cleavage of this highly base-labile protecting group is effected using 20% piperidine in N,N-dimethylformamide. Side-chain functionalities may be protected as their butyl ethers (in the case of serine threonine and tyrosine), butyl esters (in the case of glutamic acid and aspartic acid), butyloxycarbonyl derivative (in the case of lysine and histidine), trityl derivative (in the case of cysteine) and 4-methoxy-2,3,6-trimethylbenzenesulphonyl derivative (in the case of arginine). Where glutamine or asparagine are C-terminal residues, use is made of the 4,4'-dimethoxybenzhydryl group for protection of the side chain amido functionalities. The solid-phase support is based on a polydimethyl-acrylamide polymer constituted from the three monomers dimethylacrylamide (backbone-monomer), bisacryloylethylene diamine (cross linker) and acryloylsarcosine methyl ester (functionalising agent). The peptide-to-resin cleavable linked agent used is the acid-labile 4- hydroxymethyl-phenoxy acetic acid derivative. All amino acid derivatives are added as their preformed symmetrical anhydride derivatives with the exception of asparagine and glutamine, which are added using a reversed N,N-dicyclohexyl-carbodiimide/l -hydroxybenzotriazole mediated coupling procedure. All coupling and deprotection reactions are monitored using ninhydrin, trinitrobenzene sulphonic acid or isotin test procedures. Upon completion of synthesis, peptides are cleaved from the resin support with concomitant removal of side-chain protecting groups by treatment with 95% trifluoroacetic acid containing a 50% scavenger mix. Scavengers commonly used are ethanedithiol, phenol, anisole and water, the exact choice depending on the constituent amino acids of the peptide being synthesised. Trifluoroacetic acid is removed by evaporation in vacuo, with subsequent trituration with diethyl ether affording the crude peptide. Any scavengers present are removed by a simple extraction procedure which on lyophilisation of the aqueous phase affords the crude peptide free of scavengers. Reagents for peptide synthesis are generally available from Calbiochem-Novabiochem (UK) Ltd, Nottingham NG7 2QJ, UK. Purification may be effected by any one, or a combination of, techniques such as size exclusion chromatography, ion-exchange chromatography and (principally) reverse-phase high performance liquid chromatography. Analysis of peptides may be carried out using thin layer chromatography, reverse-phase high performance liquid chromatography, amino-acid analysis after acid hydrolysis and by fast atom bombardment (FAB) mass spectrometric analysis.

It will be appreciated that peptidomimetic compounds may also be useful. Thus, by "polypeptide" or "peptide" we include not only molecules in which amino acid residues are joined by peptide (-CO-NH-) linkages but also molecules in which the peptide bond is reversed. Such refro-inverso peptidomimetics may be made using methods known in the art, for example such as those described in Mezziere et al (1997) J. Immunol. 159, 3230- 3237, incoφorated herein by reference. This approach involves making pseudopeptides containing changes involving the backbone, and not the orientation of side chains. Mezierre et al (1997) show that, at least for MHC class II and T helper cell responses, these pseudopeptides are useful. Retro-inverse peptides, which contain NH-CO bonds instead of CO-NH peptide bonds, are much more resistant to proteolysis.

Similarly, the peptide bond may be dispensed with altogether provided that an appropriate linker moiety which retains the spacing between the Cα atoms of the amino acid residues is used; it is particularly preferred if the linker moiety has substantially the same charge distribution and substantially the same planarity as a peptide bond.

It will be appreciated that the peptide may conveniently be blocked at its N- or C-terminus so as to help reduce susceptibility to exoproteolytic digestion.

A further aspect ofthe invention provides a fusion polypeptide as defined in relation to preceding aspects of the invention, preferably a fusion polypeptide consisting of four α subunits, still more preferably four Kvl α subunits, yet more preferably one Kvl.l subunit and three Kvl .2 subunits; or a chimaeric Kvl.l polypeptide comprising the C-terminal region of Kvl.l wherein the N-terminal assembly-regulating region of Kvl.l is replaced by the N-terminal assembly-regulating region of Kvl.2 (or a polynucleotide encoding the said fusion polypeptide or chimaeric polypeptide) for use in medicine.

A still further aspect ofthe invention provides a method of treating a patient with a neurological disease or condition, or other disease or condition in which a K channel defect is involved, wherein the patient is administered the said fusion polypeptide, for example a fusion polypeptide consisting of one Kvl.l subunit and three Kvl.2 subunits; or a chimaeric Kvl.l polypeptide comprising the C-terminal region of Kvl.l wherein the N- terminal assembly-regulating region of Kvl.l is replaced by the N-terminal assembly-regulating region of Kvl .2 (or a polynucleotide encoding the said fusion polypeptide or chimaeric polypeptide).

A still further aspect of the invention provides the use of the said fusion polypeptide, for example a fusion polypeptide consisting of one Kvl.l subunit and three Kvl .2 subunits; or a chimaeric Kvl.l polypeptide comprising the C-terminal region of Kvl.l wherein the N-terminal assembly-regulating region of Kvl.l is replaced by the N-terminal assembly-regulating region of Kvl.2 (or a polynucleotide encoding the said fusion polypeptide or chimaeric polypeptide) in the manufacture of a medicament for treating a patient with a neurological disease, or other disease or condition in which a K channel defect is involved.

Appropriate diseases or conditions include diseases or conditions discussed in relation to other methods of treatment or uses ofthe invention. As indicated above, it will be appreciated that the said fusion polypeptide or chimaeric polypeptide may be supplied to the appropriate cells of the patient by means of expression (ie synthesis) of the said fusion polypeptide or chimaeric polypeptide in the cell, for example expression of the said fusion polypeptide or chimaeric polypeptide from a recombinant polynucleotide (ie a recombinant polynucleotide capable of expressing the said fusion polypeptide or chimaeric polypeptide) present in the cell. It will be appreciated that such supply by means of expression of the said fusion polypeptide or chimaeric polypeptide in the target cell may be beneficial; for example, such supply may facilitate targeting of the said fusion polypeptide or chimaeric polypeptide to the desired cell. It may also facilitate temporally-extended presence of the said fusion polypeptide or chimaeric polypeptide or the ability to supply the said fusion polypeptide or chimaeric polypeptide to the cell.

Suitable vectors or constructs which may be used to prepare a suitable recombinant polynucleotide may be described above.

The said fusion polypeptide or chimaeric polypeptide may be expressed from any suitable genetic construct as is described below and delivered to the patient. Typically, the genetic construct which expresses the fusion polypeptide or chimaeric polypeptide comprises the said fusion polypeptide or chimaeric polypeptide coding sequence operatively linked to a promoter which can express the transcribed polynucleotide (eg mRNA) molecule in the cell, which may be translated to synthesise the fusion polypeptide or chimaeric polypeptide. Suitable promoters will be known to those skilled in the art, and may include promoters for ubiquitously expressed, for example housekeeping genes or for tissue-specific genes, depending upon where it is desired to express the fusion polypeptide or chimaeric polypeptide, as discussed further below.

Although the genetic construct can be DNA or RNA it is preferred if it is DNA.

Preferably, the genetic construct is adapted for delivery to a human cell.

Means and methods of introducing a genetic construct into a cell in an animal body are known in the art. For example, the constructs of the invention may be introduced into the cells by any convenient method, for example methods involving retroviruses, so that the construct is inserted into the genome of the (dividing) cell. Targeted retroviruses are available for use in the invention; for example, sequences conferring specific binding affinities may be engineered into pre-existing viral env genes (see Miller & Vile (1995) Faseb J. 9, 190-199 for a review of this and other targeted vectors for gene therapy).

It will be appreciated that retroviral methods, such as those described below, may only be suitable when the cell is a dividing cell. For example, in Kuriyama et al (1991) Cell Struc. and Func. 16, 503-510 purified retroviruses are administered. Retroviral DNA constructs which encode said fusion polypeptide or chimaeric polypeptide may be made using methods well known in the art. To produce active refrovirus from such a construct it is usual to use an ecotropic psi2 packaging cell line grown in Dulbecco's modified Eagle's medium (DMEM) containing 10%> foetal calf serum (FCS). Transfection of the cell line is conveniently by calcium phosphate co-precipitation, and stable transformants are selected by addition of G418 to a final concentration of 1 mg/ml (assuming the retroviral construct contains a neo gene). Independent colonies are isolated and expanded and the culture supernatant removed, filtered through a 0.45 μm pore-size filter and stored at — 70°C. For the introduction of the refrovirus into the target cells, it is convenient to inject directly retroviral supernatant to which 10 μg/ml Polybrene has been added. The injection may be made into the area in which the target cells are present, for example into a muscle or other tissue, or in the vicinity of a nerve, which it is desired to treat. It will be appreciated that retroviral delivery may be a less preferred delivery means in relation to the present invention.

Other methods involve simple delivery of the construct into the cell for expression therein either for a limited time or, following integration into the genome, for a longer time. An example of the latter approach includes liposomes (Nassander et al (1992) Cancer Res. 52, 646-653). Other methods of delivery include adenoviruses carrying external DNA via an antibody-polylysine bridge (see Curiel Prog. Med. Virol. 40, 1-18) and transferrin-polycation conjugates as carriers (Wagner et al (1990) Proc. Natl. Acad. Sci. USA 87, 3410-3414). The DNA may also be delivered by adenovirus wherein it is present within the adenovirus particle. It will be appreciated that "naked DNA" and DNA complexed with cationic and neutral lipids may also be useful in introducing the DNA of the invention into cells of the patient to be treated. Non- viral approaches to gene therapy are described in Ledley (1995) Human Gene Therapy 6, 1129-1144. Alternative targeted delivery systems are also known such as the modified adenovirus system described in WO 94/10323 wherein, typically, the DNA is carried within the adenovirus, or adenovirus-like, particle. Michael et al (1995) Gene Therapy 2, 660-668 describes modification of adenovirus to add a cell-selective moiety into a fibre protein. Mutant adenoviruses which replicate selectively in ρ53-deficient human tumour cells, such as those described in Bischoff et al (1996) Science 274, 373-376 are also useful for delivering the genetic construct of the invention to a cell. Thus, it will be appreciated that a further aspect of the invention provides a virus or virus- like particle comprising a genetic construct of the invention. Other suitable viruses or virus-like particles include HSV, AAV, vaccinia and parvovirus.

Immunoliposom.es (antibody-directed liposomes) are especially useful in targeting to cell types which over-express a cell surface protein for which antibodies are available. For the preparation of immuno-liposomes MPB- PE (N-[4-(p-maleimidophenyl)butyryl]-phosphatidylethanolamine) is synthesised according to the method of Martin & Papahadjopoulos (1982) J. Biol. Chem. 257, 286-288. MPB-PE is incoφorated into the liposomal bilayers to allow a covalent coupling of the antibody, or fragment thereof, to the liposomal surface. The liposome is conveniently loaded with the DNA or other genetic construct of the invention for delivery to the target cells, for example, by forming the said liposomes in a solution of the DNA or other genetic construct, followed by sequential extrusion through polycarbonate membrane filters with 0.6 μm and 0.2 μm pore size under nitrogen pressures up to 0.8 MPa. After extrusion, entrapped DNA construct is separated from free DNA construct by ultracentrifugation at 80 000 x g for 45 min. Freshly prepared MPB-PE-liposomes in deoxygenated buffer are mixed with freshly prepared antibody (or fragment thereof) and the coupling reactions are carried out in a nitrogen atmosphere at 4°C under constant end over end rotation overnight. The immunoliposomes are separated from unconjugated antibodies by ultracentrifugation at 80 000 x g for 45 min. Immunoliposomes may be injected, for example intraperitoneally or directly into a site where the target cells are present.

Other methods of delivery include adenoviruses carrying external DNA via an antibody-polylysine bridge (see Curiel Prog. Med. Virol. 40, 1-18) and transferrin-poly cation conjugates as carriers (Wagner et al (1990) Proc. Natl. Acad. Sci. USA 87, 3410-3414). In the first of these methods a polycation-antibody complex is formed with the DNA construct or other genetic construct of the invention, wherein the antibody is specific for either wild-type adenovirus or a variant adenovirus in which a new epitope has been introduced which binds the antibody. The polycation moiety binds the DNA via electrostatic interactions with the phosphate backbone. The adenovirus, because it contains unaltered fibre and penton proteins, is internalised into the cell and carries into the cell with it the DNA construct ofthe invention. It is preferred if the polycation is pofylysine. The DNA may also be delivered by adenovirus wherein it is present within the adenovirus particle, for example, as described below.

In the second of these methods, a high-efficiency nucleic acid delivery system that uses receptor-mediated endocytosis to carry DNA macromolecules into cells is employed. This is accomplished by conjugating the iron-transport protein transferrin to polycations that bind nucleic acids. Human transferrin, or the chicken homologue conalbumin, or combinations thereof is covalently linked to the small DNA-binding protein protamine or to polylysines of various sizes through a disulfide linkage. These modified transferrin molecules maintain their ability to bind their cognate receptor and to mediate efficient iron transport into the cell. The transferrin-polycation molecules form electrophoretically stable complexes with DNA constructs or other genetic constructs of the invention independent of nucleic acid size (from short ohgonucleotides to DNA of 21 kilobase pairs). When complexes of transferrin-polycation and the DNA constructs or other genetic constructs of the invention are supplied to the target cells, a high level of expression from the construct in the cells is expected.

High-efficiency receptor-mediated delivery of the DNA constructs or other genetic constructs of the invention using the endosome-disruption activity of defective or chemically inactivated adenovirus particles produced by the methods of Gotten et al (1992) Proc. Natl. Acad. Sci. USA 89, 6094-6098 may also be used. This approach appears to rely on the fact that adenoviruses are adapted to allow release of their DNA from an endosome without passage through the lysosome, and in the presence of, for example transferrin linked to the DNA construct or other genetic construct of the invention, the construct is taken up by the cell by the same route as the adenovirus particle.

This approach has the advantages that there is no need to use complex retroviral constructs; there is no permanent modification of the genome as occurs with retroviral infection; and the targeted expression system is coupled with a targeted delivery system, thus reducing toxicity to other cell types.

A transport protein based on a clostridial toxin, as described in W095/32738 may be useful in delivering a polypeptide or genetic construct of the invention to the desired cell. Thus a transport protein derived from a botulinum toxin may be useful in the delivery of a polypeptide or genetic construct to a cell, such as a cholinergic nerve terminal, to which a botulinum toxin is capable of binding. Similarly, a transport protein derived from a tetanus toxin may be useful in the delivery of a polypeptide or genetic construct to a cell, for example a spinal cord cell, to which a tetanus toxin is capable of binding. Details of the targeting specificities of the transporter proteins are given in W095/32738.

For example, a cholinergic BoNT transporter, as discussed above and described in W095/32738, may be employed, for example by making chimeric constructs encoding the transporter and a DNA-binding protein domain, as known to those skilled in the art; the resultant hybrid protein would be complexed with the DNA constructs to be delivered, for example encoding a fusion polypeptide. Alternatively, the non-toxic BoNT transporter protein could be linked to the surface of liposomal or viral delivery vehicle (after deletion of the cell binding domain) to give cholinergic specificity. Such a targeted viral-based approach may be beneficial as many non-virulent systems are commercially available, for example as discussed above, especially those that include membrane fusion elements and allow intracellular delivery of genes. An even higher degree of neuron-specificity may be achieved by placing the genes of interest under the control of a cholinergic specific promoter (see, for example, Naciff et al (1999) J. Neurochem 72, 17-28), as discussed further below.

It may be desirable to locally perfuse an area comprising target cells with the suitable delivery vehicle comprising the genetic construct for a period of time; additionally or alternatively the delivery vehicle or genetic construct can be injected directly into accessible areas comprising target cells.

The genetic constructs of the invention can be prepared using methods well known in the art.

It will be appreciated that it may be desirable to be able to regulate temporally expression of the said fusion polypeptide or chimaeric polypeptide in the cell. Thus, it may be desirable that expression of the said fusion polypeptide or chimaeric polypeptide is directly or indirectly (see below) under the control of a promoter that may be regulated, for example by the concentration of a small molecule that may be administered to the patient when it is desired to activate or repress (depending upon whether the small molecule effects activation or repression of the said promoter) expression of the said fusion polypeptide or chimaeric polypeptide. It will be appreciated that this may be of particular benefit if the expression construct is stable ie capable of expressing the said fusion polypeptide or chimaeric polypeptide (in the presence of any necessary regulatory molecules) in the said cell for a period of at least one week, one, two, three, four, five, six, eight months or one or more years. A preferred construct of the invention may comprise a regulatable promoter. Examples of regulatable promoters include those referred to in the following papers: Rivera et al (1999) Proc Natl Acad Sci USA 96(15), 8657-62 (control by rapamycin, an orally bioavailable drug, using two separate adenovirus or adeno-associated virus (AAV) vectors, one encoding an inducible human growth hormone (hGH) target gene, and the other a bipartite rapamycin- regulated transcription factor); Magari et al (1997) J Clin Invest 100(11), 2865-72 (control by rapamycin); Bueler (1999) Biol Chem 380(6), 613-22 (review of adeno-associated viral vectors); Bohl et al (1998) Blood 92(5), 1512-7 (control by doxycycline in adeno-associated vector); Abruzzese et al (1996) J Mol Med 74(7), 379-92 (reviews induction factors e.g., hormones, growth factors, cytokines, cytostatics, irradiation, heat shock and associated responsive elements). Tetracycline -inducible vectors may also be used. These are are activated by a relatively - non toxic antibiotic that has been shown to be useful for regulating expression in mammalian cell cultures. Also, steroid-based inducers may be useful especially since the steroid receptor complex enters the nucleus where the DNA vector must be segregated prior to transcription.

This system may be further improved by regulating the expression at two levels, for example by using a tissue-specific promoter and a promoter controlled by an exogenous inducer/repressor, for example a small molecule inducer, as discussed above and known to those skilled in the art. Thus, one level of regulation may involve linking the appropriate fusion polypeptide or chimaeric polypeptide gene to an inducible promoter whilst a further level of regulation entails using a tissue-specific promoter to drive the gene encoding the requisite inducible transcription factor (which controls expression ofthe fusion polypeptide or chimaeric polypeptide gene from the inducible promoter). Control may further be improved by cell- type-specific targeting ofthe genetic construct.

Alternatively, or in addition, neuron-specificity may be achieved by placing the genes of interest under the control of a cholinergic specific promoter (see, for example, Naciff et al (1999) J. Neurochem 72, 17-28, which describes the identification of a 6.4-kb DNA fragment from the mouse vesicular acetylcholine transporter (VAChT) gene, encompassing 633 bp of the 5'-flanking region of the mouse vesicular acetylcholine transporter (VAChT), the entire open reading frame of the VAChT gene, contained within the first intron of the CfiAT gene, and sequences upstream of the start coding sequences of the ChAT gene, which is capable of directing cholinergic neuron- specific expression). This system may be further improved by regulating the expression at two levels, for example by using an exogenous inducer, for example a small molecule inducer, as lαiown to those skilled in the art. Only upon addition of the low molecular weight inducer would expression of the fusion polypeptide or chimaeric polypeptide occur; in this way, the time and extent of the protein's production is carefully regulated. One level of regulation may involve linking the appropriate fusion polypeptide or chimaeric polypeptide gene to an inducible promoter whilst a further level of regulation entails using the cholinergic promoter to drive the gene encoding the requisite inducible transcription factor (which controls expression of the fusion polypeptide or chimaeric polypeptide gene from the inducible promoter).

It will be appreciated that the expressed protein must also be produced at an appropriate level relative to other channel subunits for optimal functioning. On some occasions higher fusion polypeptide or chimaeric polypeptide expression maybe useful, for example if a dominant negative mutant subunit is present in the cell, which may compete with the fusion polypeptide or chimaeric polypeptide in assembly with other channel subunits.

It will be appreciated that the methods or constructs or compounds of the invention may be evaluated in, for example, dissociated primary neuronal cell cultures and/or nerve-muscle co-cultures, as known to those skilled in the art, before evaluation in whole animals.

The aforementioned fusion polypeptide or chimaeric polypeptide (or polynucleotide encoding same) or construct or compound of the invention or a formulation thereof may be administered by any conventional method including oral and parenteral (eg subcutaneous or intramuscular) injection. The treatment may consist of a single dose or a plurality of doses over a period of time. It is preferred that the fusion polypeptide or chimaeric polypeptide, polynucleotide, construct, compound or formulation is administered by injection, preferably intramuscular injection. It will be appreciated that an inducer, for example small molecule inducer as discussed above may preferably be administered orally.

Further delivery or targeting strategies may include the following. Ballistic compressed air driven DNA/protein coated nanoparticle penetration (i.e. BioRad device) of cells in culture or in vivo may be used. Plasmids for delivery should have cell-type specific promoters.

Whilst it is possible for a fusion polypeptide or chimaeric polypeptide, polynucleotide, construct or compound of the invention to be administered alone, it is preferable to present it as a pharmaceutical formulation, together with one or more acceptable carriers. The carrier(s) must be "acceptable" in the sense of being compatible with the fusion polypeptide or chimaeric polypeptide, polynucleotide or the compound or construct of the invention and not deleterious to the recipients thereof. Typically, the carriers will be water or saline which will be sterile and pyrogen free.

The formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. Such methods include the step of bringing into association the active ingredient (for example, the construct or compound of the invention) with the carrier which constitutes one or more accessory ingredients. In general the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

Formulations in accordance with the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets, each containing a predetermined amount of the active ingredient; as a powder or granules; as a solution or a suspension in an aqueous liquid or a non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in- oil liquid emulsion. The active ingredient may also be presented as a bolus, electuary or paste.

A tablet may be made by compression or moulding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder (eg povidone, gelatin, hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (eg sodium starch glycolate, cross-linked povidone, cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent. Moulded tablets may be made by moulding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethylcellulose in varying proportions to provide desired release profile.

Formulations suitable for topical administration in the mouth include lozenges comprising the active ingredient in a flavoured basis, usually sucrose and acacia or tragacanth; pastilles comprising the active ingredient in an inert basis such as gelatin and glycerin, or sucrose and acacia; and mouth- washes comprising the active ingredient in a suitable liquid carrier.

Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets ofthe kind previously described.

Preferred unit dosage formulations are those containing a daily dose or unit, daily sub-dose or an appropriate fraction thereof, of an active ingredient. It should be understood that in addition to the ingredients particularly mentioned above the formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question, for example those suitable for oral administration may include flavouring agents.

It will be appreciated that the fusion polypeptide or chimaeric polypeptide or compound or construct of the invention can be delivered to the locus by any means appropriate for localised administration of a drug. For example, a solution of the said construct can be injected directly to the site or can be delivered by infusion using an infusion pump. The construct, for example, also can be incoφorated into an implantable device which when placed at the desired site, permits the construct to be released into the surrounding locus.

The construct, for example, may be administered via a hydrogel material. The hydrogel is non-inflammatory and biodegradable. Many such materials now are known, including those made from natural and synthetic polymers. In a preferred embodiment, the method exploits a hydrogel which is liquid below body temperature but gels to form a shape-retaining semisolid hydrogel at or near body temperature. Preferred hydrogel are polymers of ethylene oxide-propylene oxide repeating units. The properties of the polymer are dependent on the molecular weight of the polymer and the relative percentage of polyethylene oxide and polypropylene oxide in the polymer. Preferred hydrogels contain from about 10% to about 80% by weight ethylene oxide and from about 20% to about 90% by weight propylene oxide. A particularly preferred hydrogel contains about 70% polyethylene oxide and 30% polypropylene oxide. Hydrogels which can be used are available, for example, from BASF Coφ., Parsippany, NJ, under the tradename Pluronic^R.

In this embodiment, the hydrogel is cooled to a liquid state and the construct, for example, is admixed into the liquid to a concentration of about 1 mg nucleic acid per gram of hydrogel. The resulting mixture then is applied onto the surface to be treated, for example by spraying or painting during surgery or using a catheter or endoscopic procedures. As the polymer warms, it solidifies to form a gel, and the construct diffuses out of the gel into the surrounding cells over a period of time defined by the exact composition ofthe gel.

The construct, for example, can be administered by means of other implants that are commercially available or described in the scientific literature, including liposomes, microcapsules and implantable devices. For example, implants made of biodegradable materials such as polyanhydrides, polyorthoesters, polylactic acid and polyglycolic acid and copolymers thereof, collagen, and protein polymers, or non-biodegradable materials such as ethylenevinyl acetate (EVAc), polyvinyl acetate, ethylene vinyl alcohol, and derivatives thereof can be used to locally deliver the construct. The construct can be incoφorated into the material as it is polymerised or solidified, using melt or solvent evaporation techniques, or mechanically mixed with the material. In one embodiment, the ohgonucleotides are mixed into or applied onto coatings for implantable devices such as dextran coated silica beads, stents, or catheters.

The dose of the construct, for example, is dependent on the size of the construct and the prapose for which is it administered. In general, the range is calculated based on the surface area of tissue to be treated. The effective dose of construct may be dependent on the size of the construct and the delivery vehicle/targeting method used and chemical composition of the oligonucleotide but a suitable dose may be determined by the skilled person, for example making use of data from the animal and in vitro test systems indicated above.

The construct, for example, may be administered to the patient systemically for both therapeutic and prophylactic puφoses. The construct, for example may be administered by any effective method, as described above, for example, parenterally (eg intravenously, subcutaneously, intramuscularly) or by oral, nasal or other means which permit the construct, for example, to access and circulate in the patient's bloodstream. Construct administered systemically preferably are given in addition to locally administered construct, but also have utility in the absence of local administration. A dosage in the range of from about 0.1 to about 10 grams per administration to an adult human generally will be effective for this puipose.

All published documents and patent applications referred to herein are hereby incoφorated by reference.

The invention will now be further described by reference to the following, non-limiting, Figures and Examples.

Fig. 1. Analysis of molecular and electrophysiological properties of the different K channels expressed in oocytes

A, Xenopus oocytes were injected with the individual cRNAs (~5 ng), incubated at 16 °C for 48 h and their crude membranes (lanes 1-3), along with synaptic membranes (lane 4), subjected to SDS-PAGE (left 9%> and right 6%> gel). After transfer onto PVDF, the membranes were blocked with 5% (w/v) dried milk before incubation overnight with anti-Kvl.2 monoclonal (lanes 1-5; 1:1000 dilution) or rabbit polyclonal anti-Kvl.l (lanes 6-8; ~1 μg IgG / mL), and detection with the ECL system. Lanes: 1, Kvl.2-1.2; 2, 1.1-1.2; 3, 1.2; 6, 1.1-1.2; 7, 1.1 and 8, 1.1-(1.2)_3. Neither Kvl .2 (lane 5) nor 1.1 (data not shown) was detectable in the controls injected with water. B, K currents were recorded from oocytes 72 h post- injection with cRNAs encoding Kvl.l (I), 1.2 (II), Kvl.2-1.2 (III), 1.1-1.2 (IV) or l.l-( 1.2)₃ (V). Voltage-dependency of activation was measured by voltage pulses of 400 ms duration, from a holding potential of -80 mV to +40 mV in 10 mV increments (VI). C, Activation curves plotted, using a simple Boltzmann function, as the mean conductances (± SEM) for each construct [Kvl.l (■), 1.2 (•), 1.2-1.2 (O), 1.1-1.2 (T) and 1.1-(1.2)₃ (A)] gave the Vi_/2 and slope values (k) in Table 1.

Fig. 2. Analysis at the subunit and oligomeric levels of the K⁺ channels expressed using SFV.

Cells (~ 50 μg), infected with SFV encoding chimeric Kvl.l (A, lane 1), dimeric 1.1-1.2 (A, lane 2; B and C, lane 1) or tetrameric 1.1-(1.2)₃ constructs (B and C, lane 2) were subjected to SDS-PAGE using 9% (A), or 6% gels (B and Q for better resolution, and detected as in Fig. \A using the antibodies specified. D, Another sample was detergent solubilised and chromatographed (10). Fractions were dot-blotted onto PVDF membrane, with visualisation as in Fig. \A using anti Kvl.l and 1.2 IgGs; blots of the peak fractions are shown. The column was calibrated with thyroglobulin, ferritin, catalase and β-amylase; the arrow indicates the common elution position ofthe K channels. Fig. 3. ¹²⁵I-DTX_k and ¹²⁵I-αDTX binding to intact BHK cells expressing the constructed K⁺ channels: competition with DTX_k and αDTX.

Suspensions of BHK cells expressing chimeric Kv(l.l)₄ (A and D), Kv(l.l- 1.2)₂ (B and E) or Kvl.l-(1.2)₃ (C and F) were incubated with ¹²⁵I-DTX_k (A- or ¹²⁵I-αDTX (D-F) at 22°C for 45 min. In A-F, non-saturable binding (T) was determined in the presence of 1 μM of the requisite unlabelled toxin, subtracted from the total (A) to give the saturable component (■). For the competition experiments (G-I), cells expressing chimeric Kv(l .l)₄ (■), Kv(l.l-1.2)₂ (A) and Kvl.l-(1.2)₃ (*) were incubated with 1 nM I-DTX_k in the absence (B₀) and presence of DTX (G) or αDTX (H). In I, 1 nM ¹²⁵I-αDTX was used with Kv(l.l)₄ (■), Kv(l.l-1.2)₂ (A) and Kvl.l-(1.2)₃ (*) channels, with or without DTX_k. Values for non-saturable binding, measured in the presence of 1 μM DTX_k or αDTX, have been subtracted from the means (± S.E.M) of triplicate values plotted.

Fig. 4. Alignment of human Kvl.l to Kvl.6 protein sequences.

Example 1: Characteristics of brain Kvl channels tailored to mimic native counterparts by tandem-linkage of α subunits: implications for K⁺ channelopathies

Most neuronal Kvl channels contain Kvl.l, 1.2 α and β2.1 subunits; yet the influences of their stoichiometries on properties of the (α)₄(β) variants remain undefined. cDNAs were engineered to contain 0, 1, 2 or 4 copies of Kvl.l with the requisite number of Kvl.2, and co-expressed in mammalian cells with Kvβ2.1 to achieve 'native-like' hetero-oligomers. The monomeric [Kvl.l or 1.2], dimeric [Kvl.1-1.2 or 1.2-1.2] and tetrameric [Kvl.l-(1.2)₃] constructs produced proteins of Mr ~ 62, 120 and 240 K, which assembled into (α)₄(β)₄ complexes. Each α cRNA yielded a distinct K⁺ current in oocytes, with voltage-dependency of activation being shifted negatively as the Kvl.l content in tetramers was increased. Channels containing 1, 2 or 4 copies of Kvl.l were blocked by dendrotoxin (DTX)_k with similarly high potencies, whereas Kv(1.2)₄ proved non- susceptible. Accordingly, Kvl.2/β2.1 expressed in BHK cells failed to bind DTX_k; in contrast, oligomers containing only 1 Kvl.l subunit exhibited high affinity, with additional copies causing modest increases. Thus, 1 Kvl.l subunit largely confers high affinity for DTX_k whereas channel electrophysiological properties are tailored by the content of Kvl.l relative to 1.2. This notable advance could explain the diversity of symptoms of human episodic ataxia I and often accompanied myokymia, due to mutated Kvl.l being assembled in different combinations with wild-type and Kvl.2.

Abbreviations: DTX, dendrotoxin; Kvl, voltage-sensitive Shaker-related K channels; SFV, Semliki Forest virus; UTR, untranslated region; PMSF, phenylmethyl sulfonyl fluoride; BHK, baby hamster kidney.

As described further below, α subunits were tandem-linked to recreate subtypes with pre-defined stoichiometries for Kvl.l and 1.2, and to quantitatively relate subunit composition to channel properties. Functional K channels containing different numbers of Kvl.l co-assembled with 1.2 in the presence of β2.1 were generated using Semliki Forest virus (SFV), yielding oligomers resembling those prevalent in neurons. Electrophysiological recording of their respective K currents in oocytes, and analysis of the binding of ¹²⁵I-labelled DTX_k and αDTX to transfected mammalian cells, revealed how varying the proportions of Kvl.l and 1.2 can subtly influence the biophysical and pharmacological properties. Such systematic profiling allows identification of K⁺ channel counteφarts in neurons and their altered phenotypes in diseases.

Materials and Methods Construction of Monomeric, Dimeric and Tetrameric cDNAs.

All constructs were incoφorated into pβut2pA for high expression in Xenopus oocytes (9). Monomeric cDNAs were prepared by PCR amplification of rat Kvl.l and 1.2 subunits, using the respective primer pairs: 5'-CCCTCGAGCCACCATGGCGGTGATG-3 ' and 5'- CTGGTCGACTTTTT AAACATCGGT-3'; 5'-

ACTCCTCGAGCACCATGGCAG-3 ' and 5'-AATAGGTCGACA TCAGACATCAGT-3', to introduce Xhol and Sail sites (underlined) with pAKS Kvl.l or 1.2 cDNA as template (a gift from Prof. O. Pongs; see Stϋhmer et al (1989) EMBO J 8, 3235-3244). After digestion, the products were ligated into pβut2pA similarly cleaved. The Kvl .2-1.2 construct was obtained by joining together the two cDNAs via the 5' untranslated region (UTR) of the Xenopus β-globin gene. For the first position in this tandem, Kvl.2 was amplified from pAKS using primers: 5'- CTGCAACTAGTATGACGGTGATGTCAGGGG-3' and 5'- CAACTCGAGATCAGTTAA CATTTTGGTAA-3' to remove the stop codon and introduce Spel and Xhol sites (underlined). Following digestion, the PCR product was ligated into pβut2pA vector cut with Xbal and Xhol to generate pβut2pA Kvl .2 (-stop codon). For introducing the second constituent of the dimer, a His tag was inserted at the C-terminus of Kvl.2 and its initiation codon removed by PCR to give pβut2pA Kvl.2 (+His₆, - ATG). The latter was amplified using the primer pairs: sense 5'- TTTGTCGACACTCAGAAAGAAACG CTC-3' and anti-sense 5'- CGTAATACGACTCACTATAGGGC-3'. Following digestion with Sail and EcoRI (present downstream of coding sequence), the fragment was subcloned into pβut2ρA Kvl .2 (- stop codon) cut with Xhol and EcoRI, to generate pβut2pA Kvl.2-1.2 (+His₆, -ATG, 16 amino acid linker and a stop codon). pβut2pA Kvl.1-1.2 was designed on the same principle. The coding sequence of rat Kvl.l was PCR amplified from pAKS Kvl.l cDNA, using the primer pair: sense 5'-

CTGCAACTAGTATGACGGTGATGT CAGGGG-3' and anti-sense 5'- CTGGTGCTTCTCGAGAACATCGGTCAGGAG-3 ' , to exclude the stop codon and introduce Spel and Xhol sites (underlined). The digested product was ligated into pβut2pA (Xbal and Xhol) to generate pβut2pA Kvl.l (- stop codon). This was cleaved (Xhol and EcoRI) and the PCR-amplified Kvl .2 (+His₆, -ATG) fragment was subcloned downstream of Kvl.l cDNA, after cutting with Sail and EcoRI. pβut2pA Kvl.l-(1.2)₃ was obtained by joining Kvl .2-1.2 downstream of 1.1-1.2, after manipulations of the two construct. A His₆ sequence and stop codon were removed from C-terminus of the heterodimer and ligated in-frame to homodimer, after ATG was deleted from the first Kvl.2 cDNA, to yield pβut2pA Kvl.l- (l-2)₃.

To prepare a KV1.2_N~1.1_C chimera, the N-terminal region of Kvl.l (487 bp) was replaced with the equivalent domain of Kvl .2 (475 bp). pβut2pA Kvl.l and 1.2 plasmids were digested with HinDIII (outside the coding region) and Sad (487 or 475 bp downstream of Kvl.l and 1.2, respectively). The isolated larger (~ 4500 bp from pβut2pA Kvl.l) and smaller (~ 475 bp from pβut2pA Kvl.2) fragments were ligated to yield pβut2pA KV1.2_N-1.1_C. Every construct made above was verified by restriction digestion and dideoxy DNA sequencing. For expression in the SFV system, all Kvl pβut2pA constructs were subcloned into pSFVl vector, employing HinDIII and Bglll sites to cut out the cDNA fragments which were blunt ended prior to ligation with pSFVl vector (10). cRNAs for each Kvl construct (pβut2pA, pSFVl) and pSFVHl (plasmid encoding viral packaging proteins) was prepared as previously (9, 10).

Electrophysiological and Biochemical Analysis of Recombinant K⁺

Channels.

Oocytes were isolated from mature Xenopus laevis females (Xenopus I,

Blades) and injected with Kvl.l or 1.2 cRNA, as described by Main et al. (25). K⁺ currents were recorded after 72h, using a two-microelectrode voltage-clamp amplifier (TEC-03, NPI) as before (26), during voltage steps to + 20 mV from a holding potential of - 80 mV. DTX_k was applied by superfusion (at a rate of 5 ml/min) and its concentration increased cumulatively. A membrane fraction from the injected and non-injected oocytes was analysed by SDS-PAGE.

Channels were expressed in BHK cells as described earlier (10), and analysed in the native state by gel filtration, or by SDS-PAGE and Western blotting. Saturable binding of ¹²⁵I-labelled αDTX and DTX to intact cells expressing the various constructs was measured in triplicate under established conditions (10), by rapid filtration through GF/F glass microfϊbre filters that had been pre-soaked in 0.5 % (v/v) polyethylenimine. The radioactivity associated with the washed filters was quantified by γ- radiation counting; data presented (±S.E.M) were analysed using the Graph Pad software (Prism 3.0) based on a one-site model.

When constructs (dimers or tetramers) were expressed without excluding the ATG codon, other (shorter) polypeptides (monomers, dimers or trimers) were generated along with the full length protein. This was due to initiation of translation from internal ATG (initiation) codons. Mutation of the ATG from the "downstream" (not N-terminal) α subunit coding sequences resulted in translation of full-length protein only.

Reasonable channel expression was detected 7 hours post-infection. Increasing the incubation time to 16 hours resulted in channel expression with the surface density of about 2 pmol/mg of total cellular protein. When the incubation time was increased from 16 to 24 hours, the level of expression did not changes significantly based on the results of immunoblotting analysis. However, expressed channels were contaminated with significant amounts of degradation products with lower molecular masses. Therefore, the period of post-infection incubation was chosen as 16 hours, in order to optimise the balance between maximising expression and minimising degradation products.

Results

Voltage-Activation of K Channel Subtypes Prominent in Neurons is

Varied by Pre-determining Their Content of Kyl.l and 1.2 Subunits. α Subunit stoichiometries were pre-defined by linking their cDNAs in an open reading frame, using a 16-amino acid sequence (DTQKETLNFGRSTLEI) from 5' UTR of the Xenopus β-globin gene, to yield the constructs shown in Tables 1 and 2. cDNAs encoding the homo- and hetero-dimer were prepared by linking the 3' of Kvl.l or 1.2 (without stop codon) to the 5' of 1.2, whereas the hetero-tetramer was made by ligating the 3' of hetero-dimer (without stop codon) to the 5' of the homo- dimer. Injection into oocytes of cRNAs for the pβutpA Kvl constructs, followed by Western blotting demonstrated that Kvl .1 and 1.2 cRNAs were translated into single subunits of Mr ~ 60 - 64 K whereas the dimers and tetramer gave proteins with Mr ~ 120 and 240 K, respectively (Fig. 1A). Two-electrode voltage-clamp was used to establish the effects of varying the ratio of Kvl .l and 1.2 in expressed tetramers. Since Kvβ2.1 has no appreciable effect on activation of Kvl.l and 1.2 channels (26), it was omitted. Oocytes injected with equivalent amounts of cR As encoding each of the constructs yielded 1-10 μA K⁺ currents after 72 h, establishing that the expressed proteins were inserted into the plasmalemma as functional channels. Kvl.l, 1.2, 1.1-1.2, 1.2-1.2 and 1.1-(1.2)₃ gave outward non-inactivating K⁺ currents with characteristic voltage dependencies (Fig. IB, . Kvl .2 and 1.2-1.2 (homo-dimer) K currents exhibited (Table 1) a similar voltage dependency of activation (threshold - -45 to -40 mV) and half-maximal activation voltage (Vι_/2); the slope (k) values confirmed the near-identical activation kinetics. Therefore, the linker does not exert a significant influence. Kvl.l elicited a fast- activating, slow- inactivating K current which had a more negative activation threshold (-60 to -50 mV) than Kvl.2 (Fig. IB, Q and V_1/2 = -30.8 mV; these values for the homomeric channels are sufficiently different to allow them to be distinguished reliably. The hetero-dimer Kvl .1-1.2 cRNA yielded a current that had properties distinct from either parent (Fig. IB, C); interestingly, this more resembled the Kvl .l than 1.2 current (Table 1) with an activation threshold between -55 and -50 mV and a V_{1 2} = -26.5 mV. Also, the Kvl.l- 1.2 K current proved less susceptible than expected to blockade by tetraethyl ammonium, behaving more like Kvl.2 than 1.1 (data not shown). A similar trend was observed with 1.1-(1.2)₃ which produced a delayed rectifying K⁺ current (Fig. IB), activating at a threshold of -55 to -50 mV (Table 1). Its V ₂ was intermediate between that for the channels made from the homo- and hetero-dimeric constructs (Fig. 1 C, Table 1), and had a slope similar to the other channels. It seems that Kvl.l exerts a more dominant influence on K channel activation, with V_{1 2} shifting negatively upon increasing the number of Kvl.l subunits; on the other hand, their slope factors, an indication of activation kinetics, are not dissimilar, as expected, due to the slope values for the parents being close.

Table 1. Activation parameters and blockade by DTX of K⁺ channels expressed in oocytes using Kvl.l, Kvl.2 and their tandem constructs cRNA injected n V_{1 2}± SD k ± SD IC₅₀ for DTX_k(nM)

Kvl.l 5 -30.8 + 1.59 9.02 + 0.898 <0.05 (n=2)

Kvl.1-1.2 8 -26.5 + 1.67 8.73 + 1.14 0.1 ± 0.05 (n=3)

Kvl.l-(1.2)₃ 13 -22.6 + 1.16 10.1 ± 1.19 0.45 + 0.2 (n=2)

Kvl.2-1.2 7 -16.97 + 0.98 8.3 + 1.13 ND

Kvl.2 10 -15.1 + 1.63 10.8 + 0.934 NI (n=3)

ND = not determined; NI = no inhibition at lOOnM toxin; n= number of oocytes tested

Recreation of Recombinant K Channels with α/β Subunit Stoichiometries Mimicking Major Subtypes in Brain.

To generate adequate amounts of the recombinant channels for biochemical analysis, pSFVl Kvl.l, 1.2, 1.1-1.2 or 1.1-(1.2)₃ were expressed in BHK cells to generate 4 oligomers representing the majority of possible combinations of the most abundant subunits found in central neurons. The expression level was elevated by inclusion of β2.1 which promotes cell surface targeting; to obtain adequate quantities of the poorly expressed Kv(l.l) (13), the N-terminal part was replaced with an analogous moiety of Kvl.2 which regulates the efficiency of assembly (see Introduction). This construct gave increased surface expression in BHK cells (~2-fold relative to the unmodified Kvl.l), yielding a subunit of the expected Mr ~ 60-62 K on immunoblotting (Fig. 2 A). The dimer was twice this size and recognized by both anti-Kvl.l- and 1.2-antibodies (Fig. 2A, B, C), confirming the presence of both α subunits. Kvl.l-(1.2)₃-construct gave a protein of the expected Mr (240 K), again, reactive with anti-Kvl.l- and - 1.2 antibodies (Fig. IB, Q. Thus, the dimer and tetramer cRNAs were correctly and fully translated, without any detectable proteolytic breakdown products; importantly the channels were correctly assembled, inserted into the plasmalemma and functional (Table 2 and detailed later). Direct evidence for the formation of α/β subunit oligomers was provided by the oligomeric sizes of the channels extracted from BHK cells in non- denaturing detergent obtained from gel filtration on Superose 6HR (Fig. 2 D); the similar elution position for the monomer, dimer and tetramer expressed with β2.1 gave an apparent molecular mass for the oligomer- detergent complex of ~ 515 K (Fig. 2 D inset). As this value is very similar to the size for Kv(1.2) (β2.1) (10), it can be concluded that all the Kvl constructs produced proteins which assembled into teframers containing 4 α and 4 β subunits, as observed for neuronal K channel complexes (27).

Table 2. Binding of ¹²⁵I-DTX_k or ¹²⁵I-_αDTX to various K⁺ channels co-expressed with Kvβ2.1 in BHK cells and the toxins' mutual antagonism

Construct K_D Bmax Ki Ki

(no o f Kvl .1 in ( ± SEM, nM) (± SEM, forDTX_k for αDTX the oligomers) pmol/mg ( ± SEM, nM) ( ± SEM, nM) protein)

Kvl.l 0.24 _± 0.05 0.26 + 0.18 4.9 + 3.3

0.20 + 0.01

(4 copies) (n- 9) (n = 9) (n= 9)

Kvl.l -Kvl .2 0.57 + 0.06 1.43 + 0.37 0.35 + 0.06

(2 copies) 0.88 + 0.03 (n= 3) (n = = 12) (n= 9)

Q Kvl.l -(1.2)₃ 0.71 _± 0.03 1.17 + 0.17 0.14 + 0.15

(1 copy) 0.124 + 0.004 (π= 6) (n - 3) (n= 3)

Kvl.2

0

(0 copies) KvO 2.8 + . 0.3 0.15 + 0.03 3.0 + 0.13

(4 copies) 0.71 + 0.03

(n- 6) (n = 3) (n= 3)

X. Kvl.l -Kvl .2 0.5 + 0.1 2.63 + 0.04 H (2 copies) 1.22 + 0.04

(n = 9) (n= 3)

% Kvl.l-(1.2)₃ 0.34 + 0.09 2.39 + 0.06 0.24 + 0.05 a (1 copy) 0.56 + 0.01

(n = 9) (n= 3) (n= 3) Kvl.2 0.6 + 0.07 0.63 + 0.04 (0 copies) 1.36 + 0.06

(n = 3) (n= 3) n represents trie number ot saturation and competitive binding assays. * Bmax values for both radio labelled toxins, for each construct, were calculated using the same batch of BHK cells.

Homomeric Kyl .l and 1.2 Channels Show Different Affinities for DTX_k and αDTX; Their K Currents Exhibit Coπesponding Susceptibilities to DTX_k,

BHK cells expressing Kv(1.2)₄ proved unable to bind ¹²⁵I-DTX_k (Table 2) and, accordingly, the K cuπent generated in oocytes was insensitive to blockade by 100 nM DTX_k (Table 1). In contrast, Kv(l.l)₄ displayed high affinity for ¹²⁵I-DTX_k (Fig. 3 A; Table 2), consistent with its K⁺ current in oocytes being inhibited by low concentrations of DTX_k (Table 1). An avid interaction was reaffirmed for the latter channel by the Ki values of DTX_k competing for the binding of ¹²⁵I-DTX_k (Fig. 3 ) and ¹²⁵I-αDTX (Fig. 31). Such pronounced discrimination by DTX_k between Kvl .l and 1.2 multimers is striking, considering their high homology (72%) (5). Comparison of the binding of both toxins to Kv(l.l) showed that I- αDTX displayed a 12-fold lower affinity than ¹²⁵I-DTX_k (Table 2). On the other hand, ¹²⁵I-αDTX exhibited a ~5-fold higher affinity for Kv(1.2)₄ than Kv(l.l)₄ (Table 2), in agreement with αDTX blocking Kvl.2 K current with greater potency than Kvl .1 or Kvl .6 (5).

One Kyl.l Subunit in K⁺ Channel Oligomers Confers Near-Maximal DTX_k Binding Affinity and Sensitivity of Their K⁺ Currents to Blockade. Decreasing the number of Kvl.l subunits in oligomers from 4 to 1 caused minimal reduction in their affinity for I-DTX ; the K_D values dropped only 2- and 3- fold, respectively, for Kv(l .l-1.2)₂ and Kvl.l-(1.2)₃ (Table 2). Likewise, the modest changes in the Ki values (Fig. 3 G) for DTX_k antagonising I-DTX binding to the latter oligomers relative to that for Kv(l.l)₄ support the above deduction. These binding data were corroborated by the DTX_k sensitivities of the channels when expressed in oocytes; the IC₅₀ values of the Kv(l .l-1.2)₂ and Kvl .l-(1.2)₃ K⁺ currents are only 2- and 9- fold lower than that for Kv(l .l)₄ (Table 1). Thus, based on both toxin binding and functional blockade 1 copy of Kvl.l is adequate to bestow near-maximal affinity for DTX_k and susceptibility to inhibition (see Discussion).

Moreover, behaviour of the channels in binding I-αDTX gave a similar trend with no significant difference in the K_D or Ki values upon increasing the number of copies of Kvl.2 in the (α)₄(β)₄ multimers (Table 2). Likewise, the similar Ki values for αDTX antagonising ¹²⁵I-DTX_k binding to Kv( 1.1-1.2)₂ and Kvl.l-(1.2)₃ (Fig. 3 H) revealed that 2 Kvl .2 subunits is sufficient for binding αDTX with high affinity. As αDTX has a lower affinity for Kv(l.l)₄ than DTX_k, it proved significantly less potent in antagonising ¹²⁵I-DTX binding but this was increased substantially (14-34 -fold) when Kvl.2 subunits were introduced to the channels (Fig. 3 H). As expected, DTX was less effective in displacing ¹²⁵I-αDTX from Kvl .2- containing multimers than Kv(l .1) (Fig. 3 I).

Finally, it is noteworthy that not only can the two toxins discriminate channel subtypes, their B_max values for αDTX were 2-3 fold higher than for DTX_k in the same batch of BHK cells (Table 2, see Discussion).

Discussion

Successful Recreation of the Most Abundant Kyl Hetero-multimers in

Mammalian Neurons.

Kvl .l-, 1.2- and β2.1- containing oligomers predominate in brain (13, 17); Kv(1.2)₄ is also present but Kvl.l always occurs associated with other members (14, 15). Due to their abundance and functional importance (see Introduction), we profiled the characteristics of those having several different proportions of Kvl.l and 1.2, in order to encompass the subtypes found in neurons. All the linked Kvl subunits were expressed in both amphibian and mammalian cells as single, intact proteins without premature translation or degradation products. Their functionality was documented by the K currents recorded after expression in oocytes, with characteristics matching those expected. When co-expressed with Kvβ2.1, each channel co-assembled into (α^(β)₄ complexes and inserted correctly into the plasma membrane of BHK cells, as established from measurement of high-affinity binding of DTX and αDTX, which require α subunits to be assembled into teframers (28). Increasing the Number of Kyl.l Subunits in a Tetramer Gave Commensurate Changes in the Voltage-dependency of Activation of the K Currents.

The teframers containing varying ratios of Kvl.l and Kvl.2 gave slowly- inactivating, outward currents with distinct voltage dependencies of activation which differed from either parent; Vι_/2 values were skewed towards that^' of Kvl.l, indicative of its predominant influence. In this context, it is notable that the first 86 residues of human Kvl.l affect voltage-dependency of channel activation (29, 30). As there is only 18 % identity between Kvl.l and Kvl .2 in this region, a unique Kvl .l domain may underlie the negative shifts in the voltage-dependency of activation being proportional to the number of Kvl.l subunits in the teframers.

A Single Kyl.l Subunit in Teframers Containing Kyl .2 Creates High- affinity Functional Interaction with DTX .

Both saturable binding and competition analysis using intact BHK cells, as well as inhibition of the K⁺ currents in oocytes, confirmed that 1 Kvl.l subunit in an oligomer is enough to confer a high affinity interaction with DTX_k and blockade of the currents. This conclusion from measurements on defined populations of 'native-like' subtypes accords with a deduction from functional studies on biochemically uncharacterised channels - that a single toxin-sensitive subunit can give K currents susceptibility to DTX homologues (6). Mutagenesis of DTX has shown that two domains, 3₁₀ helix and β-turn which are 14 A apart, contribute to interaction with possibly 2 adjacent channel subunits (31). Notably, substitution of residues in the 3₁₀ helix appears to preclude high- affinity binding to subunit(s) other than Kvl.l, whereas altering the β-turn reduced avidity for Kvl.l but to a lesser extent (31). Hence, it was suggested that the latter region could interact with a different subunit of the K channels in synaptic membranes; in the present study, this would be another Kvl.l or 1.2. Thus, the slightly lower DTX_k affinity for Kv(l .l-1.2)₂ and 1.1-(1.2)₃ compared to Kv(l.l)₄ may be attributed to a reduction in the number of 3₁₀ domains and/or decrease in the affinity of β-turn for adjacent subunit (i.e. Kvl.2 instead of Kvl.l). With 2 copies of Kvl.l and 1.2, a significant increase in DTX_k affinity was not observed, possibly because of its access being restricted due to the 2 Kvl.l in some of the oligomer being positioned diagonally rather than adjacently.

Notably, a single high affinity for DTX site was observed regardless ofthe number of Kvl.l subunits, whereas synaptic membranes show high and low binding sites (31). The retention of high affinity for DTX by Kvl.l channels with up to 3 insensitive Kvl.2 subunits provides good evidence for the lower affinity site being due to multimerisation with other subunits (e.g. Kvl.4, 1.3 or 1.6) known to be associated with Kvl .l (13-15, 19) which result in steric hindrance. Since Kv(l.l)₄ does not exist in normal human brain (14) and a majority of native K⁺ channels containing Kvl .2 also have 1.1 (50%) (13, 17), the latter must represent the bulk of the higher-affinity DTX_k sites (31) and, thus, could explain the overlapping location of DTX and αDTX acceptors in rat brain (32).

Kyl.l Channels Apparently Have More Sites for αDTX Than DTX^ The B_max for αDTX binding sites was always 2-3 fold higher than that for DTX_k, in the same batches of cells. This intriguing finding can possibly be explained by structural elements of DTX_k, δDTX (96%> homologous to DTX_k) and αDTX. Similar residues (e.g. Lys 3/6 and 26) in the two domains (3₁₀-helix and β-turn), equivalent to those important for DTX recognition of rat Kvl.l -containing channels (31, 33), have also been identified from scanning mutagenesis and thermodynamic mutant cycle analysis in δ-DTX (34). Mutation ofthe ShaKvl.l channel revealed that δ- DTX binds at some distance from the pore, involving Lys3 and Arg 10 amongst other residues; these with Lys26 form a triangle whose vertices are 20 A apart. This distance would allow interaction with adjacent subunits through Lys3, ArglO (34) and/or Lys26 (31). However, mutations in the Shaker chimeric channel did not yield evidence for a contribution of Lys26 to the strong interaction, possibly because it binds residues not substituted which form part of DTX acceptor site (35, 36). On the other hand, residues at the N-terminus of αDTX are most influential for Kvl interaction (37) and are equivalent to the essential amino acids in the 3₁₀ helix of DTX , though αDTX lacks such a secondary structural feature; this could underlie its less stringent specificity. Furthermore, the contributions of β-turn residues in αDTX are less pronounced than that for DTX (33, 37). Based on the collective findings, DTX_k appears to interact with two Kvl subunits whereas αDTX requires predominantly one interactive domain; hence, twice as many αDTX molecules might be able to bind or, perhaps, not all the channels are folded perfectly and so cannot accommodate the stringent requirements for DTX_k binding.

Functional Properties of the Recombinant Channels in Relation to Those of Neuronal K Currents in Health and Disease.

As Kvl.l and 1.2 subunits exhibit distinct properties, it is not suφrising that changing their ratios resulted in K currents with unique electrophysiological and pharmacological properties. The profiling of their characteristics ought to help molecular entities to be ascribed to the native K channels, a feat not feasible to date. Thus, properties of the recombinant channels were compared with the two types of DTX-sensitive, sustained K currents recorded in neuronal cells. Our data for Kv(l.l-1.2)₂ and 1.1-(1.2)₃ indicate that they resemble a DTX-sensitive, low-threshold current (7_DS) in various neurons, which activates within -50 to -60 mV, and prevents repetitive firing (38, 39). As Kvl.l and 1.2 are the major subunits known to give sustained outward K⁺ currents that are highly sensitive to DTX, their combinations must be responsible for such current phenotypes. Gold et al. (40) have described a similar current (Iκi_t) in rat sensory neurons which may relate to a DTX_k-susceptible current found in the same preparation (41); as with the currents we observed, (IK activates at low thresholds and is fully activated by +20 mV. From the results herein, it seems that 1 Kvl.l subunit in an oligomer with Kvl .2 would be sufficient to give such voltage- sensitivity and DTX susceptibility; moreover, the slowly-inactivating nature of the currents excludes the presence of Kvl.4 and, thereby, implicates either Kvl .1/1.2 or Kvl .1/1.2/1.6 (15).

These properties derived from channels encompassing most combinations of Kvl.1/1.2 give new insights into the molecular basis of the symptoms seen in patients suffering from episodic ataxia I / myokymia (22, 23). As we demonstrated herein that these channels' biophysical parameters show gradual changes proportional to their content of Kvl.l subunits, and a variety of human mutations are known to alter the properties of Kvl.l homomers (23), the diversity of abnormalities in different cases support the existence of several hetero-oligomeric combinations of mutated and wild- type Kvl.l, together with Kvl.2; note that Kv(l .l) does not occur in human neurons (14). Such subtypes would exist in different locations, neurons or compartments (e.g. nerve terminals, axons etc) where each normally serves a pivotal role; thus, a spectrum of abnormalities in individual patients is likely to be due to different stoichiometries of Kvl .2, 1.1 and a variant that could be mutated at one of several residues (22, 23). Importantly, the major advance accomplished herein will allow elucidation ofthe modified properties of all these channel forms constructed by tandem linking Kvl.l, its distinct mutants and Kvl.2 in the various stoichiometries, followed by co-expression with β2.1. Although this strategy has already been found to be informative for dimers of normal and mutated Kvl.l (42), creating the authentic α/β combinations should prove much more pertinent.

References 1. Lehmann-Horn, F. & Jurkat-Rott, K. (1999) Physiol. Rev. 79, 1317- 1372.

2. Heinemann, S. H., Rettig, J., Wunder, F. & Pongs, O. (1995) FEBS Lett. 377, 383-389.

3. Dolly, J. O. & Parcej, D. N. (1996) J. Bioenerg. Biomemb. 28, 231-253. 4. Yu, W. F., Xu, J. & Li, M. (1996) Neuron 16, 441-453.

5. Stuhmer, W., Ruppersberg, J. P., Schroter, K. H., Sakmann, B., Stocker, M., Giese, K. P., Perschke, A., Baumann, A. & Pongs, O. (1989) EMBO J. 8, 3235-3244.

6. Hopkins, W. F. (1998) J. Pharm. Exper. Therap. 285, 1051-1060. 7. Rettig, J., Heinemann, S. H., Wunder, F., Lorra, C, Parcej, D. N., Dolly, J. O. & Pongs, O. (1994) Nature 369, 289-294.

8. Shi, G. Y., Nakahira, K., Hammond, S., Rhodes, K. J., Schechter, L. E. & Trimmer, J. S. (1996) Neuron 16, 843-852.

9. Akhtar, S., Mclntosh, P., Bryan-Sisneros, A., Barratt, L., Robertson, B. & Dolly, J. O. (1999) Biochemistry 38, 16984-16992.

10. Shamotienko, O., Akhtar, S., Sidera, C, Meunier, F. A., Ink, B., Weir, M. & Dolly, J. O. (1999) Biochemistry 38, 16766-16776. 11. Dolly, J. O., Halliwell, J. V., Black, J. D., Williams, R. S., Pelchen- Matthews, A., Breeze, A. L., Mehraban, F., Othman, I. B. & Black, A. R. (1984) J. Physiol. (Paris) 79, 280-303.

12. Pongs, O. (1999) Perspectives in Drug Discovery and Design 16, 215- 225.

13. Shamotienko, O. G., Parcej, D. N. & Dolly, J. O. (1997) Biochemistty 36, 8195-8201.

14. Coleman, S. K., Newcombe, J., Pryke, J. & Dolly, J. O. (1999) J. Neurochem. 73, 849-858. 15. Wang, F. C, Parcej, D. N. & Dolly, J. O. (1999) Eur. J. Biochem. 263, 230-237.

16. Koschak, A., Bugianesi, R. M., Mitterdorfer, J., Kaczorowski, G. J., Garcia, M. L. & Knaus, H. G. (1998) J. Biol Chem. 273, 2639-2644.

17. Scott, V. E. S., Muniz, Z. M., Sewing, S., Lichtinghagen, R., Parcej, D. N., Pongs, O. & Dolly, J. O. (1994) Biochemistry 33, 1617-1623.

18. Rasband, M., Trimmer, J. S., Schwarz, T. L., Levinson, S. R., Ellisman, M. H., Schachner, M. & Shrager, P. (1998) J. Neurosci. 18, 36-47.

19. Rhodes, K. J., Strassle, B. W., Monaghan, M. M., Bekelearcuri, Z., Matos, M. F. & Trimmer, J. S. (1997) J. Neurosci. 17, 8246-8258. 20. Keighley, W. W., Newcombe, J., Templeton, D. & Treherne, J. M.

(1994) J. Physiol. (Lond). 480P, 68-69P.

21. Cochran, S. M. & Pratt, J. A. (1997) Br. J. Pharm. 122, 256P.

22. Browne, D. L., Brunt, E. R., Griggs, R. C, Nutt, J. G., Gancher, S. T.,

Smith, E. A. & Lift, M. (1995) Hum. Mol. Genet. 4, 1671-1672. 23. Adelman, J. P., Bond, C. T., Pessia, M. & Maylie, J. (1995) Neuron 15, 1449-1454.

24. Wang, H, Allen, M. L., Grigg, J. J., Noebels, J. L. & Tempel, B. L.

(1995) Neuron 15, 1337-1347. 25. Main, M. J., Brown, J., Brown, S., Fraser, N. J. & Foord, S. M. (1998) FEBSLett. 441, 6-10.

26. Mclntosh, P., Southan, A. P., Akhtar, S., Sidera, C, Ushkaryov, Y., Dolly, J. O. & Robertson, B. (1997) Pflugers Arch. Eur. J. Physiol. 435, 43- 45.

27. Parcej, D. N., Scott, V. E. S. & Dolly, J. O. (1992) Biochemistry 31, 11084-11088.

28. Tytgat, J., Debont, T., Carmeliet, E. & Daenens, P. (1995) J. Biol. Chem. 270, 24776-24781. 29. Hollerer-Beitz, G., Schonherr, R., Koenen, M. & Heinemann, S. H. (1999) Pflugers Archiv. Eur. J. Physiol. 438, 141-146.

30. Varshney, A. & Mathew, M. K. (2000) Neuroreport 11, 2913-2917.

31. Wang, F. C, Bell, N., Reid, P., Smith, L. A., Mclntosh, P., Robertson, B. & Dolly, J. O. (1999) Eur. J. Biochem. 263, 222-229. 32. Awan, K. & Dolly, J. O. (1991) Neuroscience 40, 29-39.

33. Smith, L. A., Reid, P. F., Wang, F. C, Parcej, D. N., Schmidt, J. J., Olson, M. A. & Dolly, J. O. (1997) Biochemistry 36, 7690-7696.

34. Imredy, J. P. & MacKinnon, R. (2000) J. Mol. Biol. 296, 1283-1294.

35. Hurst, R. S., Busch, A. E., Kavanaugh, M. P., Osborne, P. B., North, R. A. & Adelman, J. P. (1991) Mol. Pharm. 40, 572-576.

36. Stocker, M., Pongs, O., Hoth, M., Heinemann, S. H., Stuhmer, W., Schroter, K. H. & Ruppersberg, J. P. (1991) Proc. Roy. Soc. (Lond) Series B - Biol. Sci. 245, 101-107.

37. Gasparini, S., Danse, J. M., Lecoq, A., Pinkasfeld, S., ZinnJustin, S., Young, L. C, deMedeiros, C. C. L., Rowan, E. G., Harvey, A. L. & Menez,

A. (1998) /. Biol. Chem. 273, 25393-25403.

38. Stansfeld, C. E., Marsh, S. J., Halliwell, J. V. & Brown, D. A. (1986) Neurosci. Lett. 64, 299-304. 39. Gamkrelidze, G., Giaume, C. & Peusner, K. D. (1998) J. Neurosci. 18, 1449_1464.

40. Gold, M. S., Shuster, M. J. & Levine, J. D. (1996) J. Neurophys. 75, 2629-2646. 41. Hall, A., Stow, J., Sorensen, R., Dolly, J. O. & Owen, D. (1994) Brit. J. Pharm. 113, 959-967.

42. D'Adamo, M. C, Liu, Z., Adelman, J. P., Maylie, J. & Pessia, M. (199S) EMBO J. 17, 1200-1207.

Example 2: Further oligomeric constructs

Using the same strategy as that described in Example 1 for producing Kvl.l and 1.2 multimers of predefined stoichiometery, other constructs were made. These include Kvl.1-1.4, Kvl.1-1.4 and Kvl.2- 1.6.

(Kvl.l)₂(Kv 1.4)₂ channels occur naturally. Channels corresponding to these native channels may be expressed in the SFV expression system (as described in Example 1) using the Kvl.1-1.4 construct. These channels may be used in screening methods.

Kvl .2- 1.4 and Kvl.2- 1.6 dimer constructs were tandem linked to the Kvl.1-1.2 dimer construct in order to be able to produce channels corresponding to the naturally-occurring Kvl.1-1.2-1.4 and Kvl.1-1.2-1.6 channels. As for the Kvl.l-(1.2)₃ tetramer described in Example 1, initiation codons (ATG) were removed from all but the most N-terminal Kvl subunit in the teframeric construct. This prevented initiation of translation at positions other than the intended N-terminal ATG, thus leading to translation ofthe intended full-length protein. The Kvl constructs described in this example (and in Example 1) may be subcloned into a pSFV plasmid together with a polynucleotide sequence encoding one or more β subunits, for example β2.1, βl.l or a β2.1/1.1 dimer. This may be useful in ensuring that both α and β subunits are expressed in the same cell.

Claims

1. A method for preparing a K channel comprising alpha subunits and beta subunits, the method comprising the step of providing the alpha subunits and beta subunits of said channel, wherein at least two said subunits, which subunits are naturally encoded as separate polypeptides, are provided as a fusion polypeptide comprising the said at least two subunits.

2. The method of claim 1 wherein the subunits are provided by expressing the subunits of said channel, wherein the at least two said subunits which are provided as a fusion polypeptide are expressed from a recombinant polynucleotide encoding the fusion polypeptide comprising the said at least two subunits.

3. The method of claim 2 wherein the method is perfoπned in a cell.

4. The method of claim 3 wherein the cell is an oocyte.

5. A method for preparing a K⁺ channel comprising more than one subunit, the method comprising the step of providing the subunits of said channel, wherein at least two said subunits, which subunits are naturally encoded as separate polypeptides, are provided as a fusion polypeptide comprising the said at least two subunits and wherein the said fusion polypeptide is provided by expressing the fusion polypeptide in a mammalian cell from a recombinant polynucleotide encoding the said fusion polypeptide.

6. The method of claim 5 wherein the method is performed in a mammalian cell.

7. The method of claim 6 wherein the cell is in a human or non-human animal body.

8. The method of claim 6 or 7 wherein the method is performed in vitro.

9. The method of any one of claims 2 to 8 wherein the subunits or fusion protein are expressed using a Semliki Forest Virus expression construct.

10. The method of any of the preceding claims wherein the K channel is a voltage gated K⁺ channel, preferably a Kvl channel.

11. The method of claim 10 wherein the fusion polypeptide comprises at least two α subunits.

12. The method of claim 11 wherein the fusion polypeptide comprises two Kvl.l subunits.

13. The method of claim 11 wherein the fusion polypeptide comprises two Kvl.2 subunits.

14. The method of claim 11 wherein the fusion polypeptide comprises a Kvl.l subunit and a Kvl.2 subunit.

15. The method of claim 11 wherein the fusion polypeptide comprises three Kvl.l subunits and a Kvl.2 subunit.

16. The method of claim 11 wherein the fusion polypeptide comprises three Kvl.2 subunits and a Kvl .l subunit.

17. The method of any one of claims 10 to 16 wherein the voltage-gated K channel comprises a Kvβ_t or Kvβ₂ subunit.

18. The method of any one of claims 10 to 16 wherein the voltage-gated K channel comprises a Kvβ₃ subunit.

19. The method of any one of claims 10 to 18 wherein the fusion protein comprises a Kvβ subunit.

20. A K channel obtainable by the method of any one of claims 1 to 19.

21. A cell comprising a K channel according to claim 20.

22. A method for identifying a compound which modulates the activity of a K channel, the method comprising the step of exposing a K⁺ channel according to claim 20 or cell according to claim 21 to a test compound and determining whether the compound binds to the said K⁺ channel or K⁺ channel in the said cell and/or whether the compound affects the channel activity.

23. The method of claim 22 comprising the step of determining the effect ofthe compound on the K⁺ current of a cell according to claim 21.

24. A method for determining the type of K channel in a cell comprising the steps of investigating one or more channel characteristics selected from (i) binding of the channel or cell to an interacting compound, for example dendrotoxin); and (ii) cell K current properties and comparing the determined characteristic(s) with characteristics determined for a channel according to claim 20 or cell according to claim

21.

25. A method for diagnosis of neuronal disease wherein a method according to claim 24 is used.

26. A mammalian cell comprising a recombinant polynucleotide encoding a fusion protein as defined in any ofthe preceding claims.

27. A Semliki Forest virus expression vector comprising a recombinant polynucleotide as defined in claim 26.

28. A host cell comprising a vector according to claim 27.

29. A chimaeric Kvl .l polypeptide comprising the C-terminal region of Kvl.l, wherein the N-terminal assembly-regulating region of Kvl .l is replaced by the N-terminal assembly-regulating region of Kvl.2.

30. The chimaeric Kvl.l polypeptide of claim 29 wherein the polypeptide comprises 158 amino acids derivable from Kvl .2 and 333 amino acids derivable from Kvl .1.

31. A polynucleotide encoding the chimaeric Kvl .l polypeptide of claim 29 or 30.

32. A replicable vector comprising a polynucleotide according to claim 31.

33. A host cell comprising a replicable vector according to claim 32.

34. A method of preparing a fusion protein as defined in any of the preceding claims comprising culturing a mammalian cell according to claim 26.

35. A fusion protein obtainable by the method of claim 34.

36. A method for identifying a compound which modulates the activity of a voltage-gated K⁺ channel comprising a Kvl.l ? subunit, comprising the step of exposing a chimaeric Kvl.l subunit according to claim 29 or 30, preferably a channel or host cell comprising such a chimaeric subunit, to a test compound and determining whether the compound binds to the said chimaeric subunit or channel or cell and/or whether the compound affects the channel activity.

37. The method of claim 36 wherein the chimaeric Kvl.l subunit is comprised in a (Kvl .l)₄ channel.

38. The method of claim 36 or 37 wherein the method is for identifying a compound suitable for administering to a patient with or at risk of MS.

39. The method of any one of claims 36 to 38 further comprising the step of determining the effect of the test compound on, or ability of the test compound to bind to, other K⁺ channels, and selecting a compound that affects only or preferentially the Kvl.l subunit or (Kvl.l) channel.

40. A compound identifiable by the method of any one of claims 36 to 39.

41. A compound identifiable by the method of any one of claims 36 to 39 for use in medicine.

42. The use of a compound which modulates the activity of a (Kvl.l)₄ K⁺ channel in the manufacture of a medicament for the treatment of a patient with or at risk of MS.

43. A method of treating a patient with MS comprising administering to the patient a compound which modulates the activity of a (Kvl.l)₄ K⁺ channel..