EP1506224A1 - Antigene polypeptidique des anticorps neutralisant le vih - Google Patents

Antigene polypeptidique des anticorps neutralisant le vih

Info

Publication number
EP1506224A1
EP1506224A1 EP03752794A EP03752794A EP1506224A1 EP 1506224 A1 EP1506224 A1 EP 1506224A1 EP 03752794 A EP03752794 A EP 03752794A EP 03752794 A EP03752794 A EP 03752794A EP 1506224 A1 EP1506224 A1 EP 1506224A1
Authority
EP
European Patent Office
Prior art keywords
polypeptide
sequence
antibodies
antigen
neutralizing
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP03752794A
Other languages
German (de)
English (en)
Inventor
Florence Boudet
Rapha[Lle El Habib
Tino Krell
Régis SODOYER
Michel Chevalier
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sanofi Pasteur Inc
Original Assignee
Aventis Pasteur SA
Sanofi Pasteur Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aventis Pasteur SA, Sanofi Pasteur Inc filed Critical Aventis Pasteur SA
Publication of EP1506224A1 publication Critical patent/EP1506224A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10RNA viruses
    • C07K16/112Retroviridae (F), e.g. leukemia viruses
    • C07K16/114Lentivirus (G), e.g. human immunodeficiency virus [HIV], feline immunodeficiency virus [FIV] or simian immunodeficiency virus [SIV]
    • C07K16/1145Env proteins, e.g. gp41, gp110/120, gp160, V3, principal neutralising domain [PND] or CD4-binding site
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53DNA (RNA) vaccination
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16111Human Immunodeficiency Virus, HIV concerning HIV env
    • C12N2740/16122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • the present invention relates to a polypeptide antigen derived from the gp41 protein, as well as to its use for immunization against HIV-related infection. This work was co-funded by the ANRS.
  • the HIV envelope glycoprotein which is required to make the virus infectious is the target of neutralizing antibodies. These characteristics have made the latter a subject of intense investigation.
  • the use for vaccine purposes of polypeptides derived from the gp41 protein has been described in WO00 / 40616. According to this request, the N helices can be used alone or in combination with the C helices to induce neutralizing antibodies.
  • the Applicant here proposes a new polypeptide antigen which can be used for therapeutic and prophylactic immunization against HIV-related infection.
  • the Applicant has indeed demonstrated a polypeptide derived from the ectodomain of the protein gp41 which is capable of inducing antibodies neutralizing the primary isolates of HIV.
  • the present invention therefore relates to a polypeptide represented by the formula:
  • N represents the amino acid sequence 25-81 of gp41
  • N represents SEQ ID No. 1
  • C represents SEQ ID N 0 2.
  • the polypeptide consists of the sequence SEQ
  • the polypeptide as defined above further comprises a sequence containing the ERDRD epitope.
  • the polypeptide as defined above comprises an additional sequence of formula (G) aS- (H) b in which G represents a glycine residue, H represents a histidine residue, a is greater than or equal to 4 and b is greater than or equal to 6, said sequence being linked by a friend link from to the NH 2 - or COOH-terminal end of the polypeptide.
  • polypeptide according to the present invention consists of the sequence SEQ ID No. 4.
  • the present invention also relates to a conjugate comprising a polypeptide as defined above, conjugated to a protein or a carrier peptide.
  • the present invention also relates to a DNA sequence coding for a polypeptide or for a conjugate as defined above.
  • the present invention also relates to an expression vector comprising said DNA sequence.
  • the DNA codes for a polypeptide as defined above which further comprises a sequence containing the ERDRD epitope.
  • the present invention also relates to a host cell containing the vector as defined above.
  • the present invention relates to a process for the preparation of a polypeptide as defined above comprising the expression of said polypeptide from a host cell as defined above.
  • the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising at least one polypeptide, or at least one conjugate, or at least one expression vector as defined above, a pharmaceutically acceptable excipient and optionally an adjuvant.
  • the pharmaceutical composition comprises a polypeptide of sequence SEQ ID No. 4 and an adjuvant selected from the group consisting of DC-Chol and aluminum gel.
  • the present invention also relates to the polypeptide as defined above for its use as a medicament, in particular for the induction of specific neutralizing antibodies in a mammal.
  • the present invention also relates to a method of induction of specific neutralizing antibodies in a mammal comprising the administration of a pharmaceutical composition as defined above and the induction of said antibodies.
  • the administration is carried out by oral or intramuscular route.
  • the Applicant has surprisingly demonstrated that the polypeptide according to the invention induces specific IgG antibodies neutralizing the primary HIV isolates.
  • the induction of antibodies neutralizing primary isolates can be determined by the neutralization test as described in the article by C. Moog et al (AIDS Research and human retroviruses, vol. 13 (1), 13-27, 1997 ) to which one can refer for a complete description of the latter. It is estimated in the context of the present invention that neutralizing antibodies have been induced by the antigen tested according to the C. Moog technique when the serum diluted at least 1/4 in the presence of HIV results in a reduction by a factor of 10. of the viral titer in comparison to HIV alone, the viral titer being evaluated by the amount of p24 produced in the culture supernatant.
  • the induction of antibodies neutralizing the primary isolates can also be determined by the D. Montefiori neutralization test as described in J. Infect. Dis. 1996, 173: 60-67.
  • the neutralizing titer is expressed by the percentage reduction in p24 antigen produced in the culture supernatants when the virus is incubated in the presence of serum diluted with V ⁇ compared to the virus in the absence of serum. It is considered in the context of the present invention that neutralizing antibodies have been induced when the reduction in the level of p24 produced reaches at least 80% with a serum diluted with V ⁇ .
  • the antibodies induced by the polypeptide according to the invention are neutralizing if a neutralizing activity is detected for a given isolate in at least one of the two tests above.
  • the induction of antibodies neutralizing the HIV-1 MN laboratory strain can be estimated using the MT-2 cell line according to the method of D. Montefiori, described in: DC Montefiori et al. J Clin Microbiol. 1988, 26: 231-5).
  • the neutralizing titer is expressed as the inverse of the dilution of the serum (in arithmetic value) protecting at least 50% of cells from the cytopathogenic effect of the HIV virus.
  • the N and C sequences constituting the polypeptide according to the present invention can be derived from any HIV gp41 protein, including strains VEU and HIV2, including laboratory strains and primary isolates.
  • the constituent sequences are derived from a V ⁇ U strain and in particular from an HIV 1 LAI strain.
  • the numbering of the amino acids is done by reference to the sequence of the fragment of gp41 SEQ ID No 8 in which the first amino acid A is number 1.
  • N represents SEQ ID No 1
  • C represents SEQ ID # 2.
  • the nucleotide and peptide sequences of a large number of gp41 proteins are known and available for example on the Internet on the site http://hiv-web.lanl.gov/ as well as in the corresponding compendiums of Los Alamos. It is clear that any sequence into which one or more conservative mutations which do not substantially alter immunogenicity have been introduced is also included within the scope of the present invention.
  • the N and C sequences are linked to each other via an L-linking peptide sequence comprising from 2 to 30 amino acids. This linkage sequence L is a loop allowing the pairing of the sequences N and C with one another in an anti-parallel orientation.
  • the polypeptide according to the present invention is a trimer consisting of 3 NLC monomers forming a bundle in which the N helices are paired together and the C helices are paired with the N helices in an anti-parallel orientation.
  • L sequences in the context of the present invention can be selected by using secondary structure prediction software GOR (Garnier, Osguthorpe and Robson (1078), J. Mol. Biol., 120, 97-120; http : //molbiol.soton.ac.uk/compute/GOR.html) on the NLC sequence by specifying in the windows "propeller” and "extended” the unknown notion.
  • the percentage of helix in the prediction of the secondary structure of L must be less than 10.
  • the L sequences advantageously have a weak hydrophobic character, preferably hydrophilic to facilitate the purification of the corresponding polypeptide.
  • the hydrophilic character can be obtained by the use of amino acid having a hydrophilic character such as serine which can be associated with glycines.
  • the polypeptide according to the invention has the sequence SEQ ID No. 3. This sequence can advantageously be modified to reduce its hydrophobic character, for example by introducing at least one of the following mutations: W85D; L91K; I92K and W103D and preferably by the introduction of at least any 2 mutations selected from the group of the 4 mutations proposed above, or even all of said mutations.
  • the polypeptide of formula NLC as defined above further comprises a sequence containing the Kennedy ERDRD epitope.
  • the ERDRD sequence can be linked in N- or C-terminal of the polypeptide, directly or from preferably via a flexible link.
  • a flexible link typically comprises around ten amino acids, preferably of a hydrophilic nature. Sequences comprising glycines and serines such as GGR are, for example, perfectly suitable.
  • the ERDRD epitope can also be inserted at the L sequence of the polypeptide. In such a scenario, the epitope will preferably be surrounded by linkage sequences ensuring the junction with the N and C sequences.
  • sequences comprising the ERDRD epitope is therefore understood in the context of the present invention to consist of: the ERDRD epitope, possibly of a flexible link and possibly of some additional amino acids which would result from the process of construction of the plasmids expressing the polypeptide due to the use of the restriction sites. This is the case, for example, of the amino acids RSGGGGS present at the C-terminal of the constructs tested in Example 4.
  • the polypeptide according to the invention can be obtained by any conventional technique of chemical synthesis or genetic engineering.
  • the polypeptide according to the invention can be synthesized in the form of a single sequence, or in the form of several sequences which are then linked to each other.
  • Chemical synthesis can be carried out in solid phase or in solution, these two synthesis techniques being well known to those skilled in the art. These techniques are described in particular by Atherton and Shepard in "solid phase peptide synthesis (IRL press Oxford, 1989) and by Houbenweyl in” method der organischen chemie "edited by E.
  • the polypeptide according to the invention can also be produced by genetic engineering techniques well known to those skilled in the art.
  • the polypeptide according to the invention comprises at the NH2-terminal end an additional methionine residue corresponding to the translation of the first initiation codon.
  • these techniques are described in detail in Molecular Cloning: a molecular manual by Maniatis et al, Cold Spring Harbor, 1989.
  • the PCR technique is used to produce the DNA sequence coding for the polypeptide according to the invention in a form insertable into a vector of expression.
  • the DNA sequence thus obtained is then inserted into an expression vector.
  • the expression vector containing the sequence of interest is then used to transform a host cell allowing the expression of the sequence of interest.
  • the polypeptide produced is then isolated from the culture medium by conventional chromatography techniques well known to those skilled in the art.
  • HPLC high performance liquid chromatography
  • the cells are collected at the end of the culture by centrifugation and taken up in a neutral buffer, to be broken by any suitable means.
  • the cell lysate is then centrifuged at approximately 10000 g to separate the soluble material from the insoluble material. SDS-PAGE analysis of the supernatant and the centrifugation pellet will reveal whether or not the polypeptide is soluble.
  • the solubilization is obtained by means of a buffer containing urea, guanidine or other solubilizing agents.
  • the next step consists in loading the solubilized molecule onto an affinity column, which can be of the metal chelate type, if a polyhistidine tail is integrated on the polypeptide of interest.
  • the system which allows the purification by affinity can be of varied nature, like immunoaffinity, affinity on blue of cibachron, etc ...
  • the protein presents a level of purity close to or higher than 80%, as one can be determined by SDS PAGE electrophoresis followed by staining with coomassie blue.
  • An additional chromatography step can be added for polishing the polypeptide, mention may be made, for example, of gel filtration and reverse phase chromatography.
  • the polypeptide according to the invention can thus be obtained in purified form on. in a form having a purity level of at least 80%.
  • the level of purity is defined in relation to the other proteins present in the mixture which are considered to be contaminants. This rate is evaluated by colorimetry of an SDS-PAGE using coomassie blue. A densitometric measurement of the bands makes it possible to quantify the level of purity.
  • the measurement of the purity rate can also be done by reverse phase HPLC by measuring the area of the different peaks.
  • any expression vector conventionally used for the expression of a recombinant protein can be used in the context of the present invention.
  • This term therefore includes both so-called “living” expression vectors such as viruses and bacteria as well as expression vectors of the plasmid type.
  • Vectors are preferably used in which the DNA sequence of the polypeptide according to the invention is dependent on a strong promoter, inducible or non-inducible.
  • a promoter which can be used, mention may be made of the T7 TARN polymerase promoter.
  • Expression vectors preferably include at least one selection marker.
  • markers include, for example, the dihydrofolate reductase gene or the neomycin resistance gene for culture of eukaryotic cells and the kanamycin, tetracycline or ampicillin resistance genes for culture in E. coli and other bacteria.
  • polypeptide according to the present invention is produced in the form of a fusion peptide comprising an additional sequence of formula
  • G aS- (H) b in which G represents a glycine residue, H represents a histidine residue, and preferably a is greater than or equal to 4 and b is greater than or equal to 6 linked by an amide bond at the end NH2- or COOH- terminal of the polypeptide.
  • This sequence allows rapid purification by immunoaffinity of the polypeptide according to the invention.
  • any host cell conventionally used in association with the expression vectors described above can be used.
  • the following expression vector / cell system will be used in the context of the present invention: pET (Cer) / BL21LamdaDE3, or BL211amdaDE3 (RIL).
  • the polypeptides of the present invention may be glycosylated or non-glycosylated.
  • the polypeptides according to the invention may also include an additional methionine residue at the N-terminal.
  • a subject of the present invention is also the conjugates comprising a polypeptide according to the invention and a carrier protein or a carrier peptide.
  • the carrier protein (or peptide) (eur) strengthens the immunogenicity of the polypeptide according to the invention in particular by increasing the production of specific antibodies.
  • Said carrier protein (or peptide) (eur) preferably comprises one or more T helper epitope (s).
  • helper T epitope is meant a chain of amino acids which, in the context of one or more molecules of MHC class II, activates the helper T lymphocytes.
  • the carrier protein (or peptide) (eur) used improves the water solubility of the polypeptide according to the invention.
  • phage surface proteins such as the pIII or pVLII protein of phage Ml 3 can be used, for example bacterial surface proteins such as LamB, OmpC, ompA, ompF and PhoE proteins. coli, the CotC or CotD protein of B. Subtilis, bacterial porins such as the PI porin of Neisseria gonorrheae, the PI or P2 porin of H. influenzae B, porin class I of N. meningitidis B, porin P40 of K. pneumoniae, lipoproteins such as OspA from B. bugdorfi, PspA from S. pneumoniae, TBP2 from N.
  • bacterial porins such as the PI porin of Neisseria gonorrheae, the PI or P2 porin of H. influenzae B, porin class I of N. meningitidis B, porin P40 of K. pneumoniae, lipoproteins such as OspA
  • meningitidis B TraT from E. coli as well as adhesin A from S. pneumoniae; “heat shock” proteins such as Hsp65 or Hsp71 from M. tuberculosis or bovis or Hin 47 from H. infuenzae type B.
  • detoxified bacterial toxins such as tetanus or diphtheria toxoid, the B subunit of cholera toxin, the B subunit of cholera toxin, the B subunit endotoxin A from P. aeruginosa or exotoxin A from S. aureus.
  • carrier peptide As carrier peptide, it is possible to use, for example in the context of the present invention, the peptides p24E, p24N, p24H and p24M described in WO94 / 29339 as well as the PADRE peptides as described by Del guercio et al (Vaccine (1997); voll5 / 4, p441-448).
  • the carrier protein (or peptide) (eur) is linked to the N or C terminal end of the polypeptide according to the invention by any conjugation method well known to those skilled in the art.
  • sequence coding for the protein (or peptide) carrier can advantageously be fused to the sequence coding for the polypeptide according to the invention and the resulting sequence can be expressed in the form of a fusion protein by any conventional method. All the genetic engineering techniques useful for doing this are described in Maniatis et al. said conjugates can be isolated by any conventional purification method well known to those skilled in the art.
  • the subject of the present invention is also the DNA sequences coding for the polypeptides and the conjugates according to the invention as well as the expression vectors comprising said sequences and the host cells transformed by said vectors.
  • the DNA sequences coding for the polypeptides according to the invention can be easily produced by PCR using as template the nucleotide sequence of a gp41 protein.
  • the expression vector is devoid of a marker and preferably corresponds to a viral vector, in particular a poxvirus such as ALVAC or NYVAC.
  • a viral vector in particular a poxvirus such as ALVAC or NYVAC.
  • Such a vector can also contain at least one other sequence coding for a HTV antigen.
  • the expression vector according to the invention preferably comprises a sequence coding for a polypeptide of formula NLC as defined above, further comprising a sequence comprising the ERDRD epitope as defined above which is linked at the end N- or C-terminal of said polypeptide.
  • the expression vector comprises a sequence coding for the polypeptide of formula: AA25-AA157-GGRERDRDRSGGGGS.
  • the present invention also relates to antibodies directed against the polypeptides and conjugates as described above.
  • the preparation of such antibodies is carried out by conventional techniques for obtaining polyclonal and monoclonal antibodies well known to those skilled in the art.
  • These antibodies are particularly suitable for use in a passive immunization scheme.
  • the present invention also relates to pharmaceutical compositions which can be used for therapeutic and prophylactic immunization against HIV-related infection.
  • the compositions according to the present invention comprise at least one polypeptide, at least at least one conjugate or at least one expression vector as defined above in an amount suitable for inducing a specific humoral response, a pharmaceutically acceptable excipient or diluent and optionally an adjuvant.
  • the amount of polypeptide, conjugate or vector in the composition according to the present invention depends on many parameters as will be understood by those skilled in the art, such as the nature of the carrier protein, the vector used or, the route of administration.
  • An appropriate amount is an amount such that a specific humoral immune response is induced after administration of said composition.
  • the quantity of polypeptide to be administered is of the order of 10 ⁇ g to 5 mg, the quantity selected varying according to the route of administration.
  • the amount of conjugate to be administered will be deducted from the amounts indicated above, taking into account the MW of the carrier protein.
  • the amount of expression vector to be administered is of the order of 10 to 5000 ⁇ g in the case of a non-viral vector and of the order of 10 E 4 to 10 E 8 TCID50 in the case of a viral vector .
  • compositions according to the present invention can also contain an adjuvant.
  • Any pharmaceutically acceptable adjuvant or mixture of adjuvants conventionally used in the field of vaccines can be used for this purpose.
  • suitable adjuvants include aluminum salts such as aluminum hydroxide or aluminum phosphate and DC-Chol.
  • Conventional auxiliary agents such as wetting agents, fillers, emulsifiers, buffers, etc. can also be added to the composition according to the invention.
  • compositions according to the present invention can be prepared by any conventional method known to those skilled in the art.
  • the antigens according to the invention ie polypeptide, conjugate or vector
  • a pharmaceutically acceptable excipient or diluent such as water or phosphate-buffered saline.
  • the excipient or diluent will be selected according to the dosage form chosen, the mode and the route of administration as well as pharmaceutical practice.
  • the appropriate excipients or diluents as well as the pharmaceutical formulation requirements are described in detail in Remington's Pharmaceutical Sciences, which represents a reference work in this field.
  • compositions mentioned above can be administered by any conventional route, usually used in the field of vaccines, such as the parenteral route (intramuscular, subcutaneous, etc.).
  • parenteral route intramuscular, subcutaneous, etc.
  • intramuscular administration will preferably be used for the injectable compositions.
  • Such a administration can advantageously be carried out in the thigh or arm muscles.
  • the compositions according to the present invention can also advantageously be administered orally.
  • Administration via the nasal, vaginal or rectal mucosa can also be recommended in the context of the present invention.
  • the administration can be carried out by the administration of a single dose or of repeated doses, for example at OJ, at 1 month, at 3 months, at 6 months and at 12 months.
  • the OJ, 1 month and 3 month injections should preferably be used with a reminder, the frequency of which can be easily determined by the attending physician.
  • the pharmaceutical composition according to the present invention can advantageously be administered according to a dosage regimen comprising the co-administration of an expression vector according to the invention and of a polypeptide according to the invention or according to a "prime-boost" scheme wherein the vector according to the invention is administered first and the polypeptide as a booster injection.
  • the expression vector according to the invention can be replaced by any expression vector expressing one or more antigens or epitopes of HIV different from the polypeptide according to the invention, and in particular by a poxvirus preferably ALVAC or NYVAC.
  • vector ALVAC and NYVAC which can be used for this purpose, mention may be made of the vectors described in US Patents 5,942,235, US 5,756,103 and US 5,990,091; EP 83286, US 5,494,807 and US 5,762,938. It is also advantageously possible to use, in the context of compositions which can be administered orally, the bacterial vectors such as lactobacillus or salmonella expressing the polypeptide according to the invention and / or other antigens of HIV, such as those conventionally used in the poxviruses described in US patents above.
  • the bacterial vectors such as lactobacillus or salmonella expressing the polypeptide according to the invention and / or other antigens of HIV, such as those conventionally used in the poxviruses described in US patents above.
  • the present invention also intends to cover a polypeptide, a conjugate or a vector as defined above and the pharmaceutical composition containing these compounds for their use as a medicament, in particular for the induction of specific neutralizing antibodies in a mammal. Since the antibodies induced have the property of neutralizing the primary isolates of HIV, the polypeptide according to the invention is therefore an antigen of interest for the prophylactic and therapeutic immunization of the human body against infection linked to HIV
  • the present invention therefore relates to a method of induction of specific neutralizing antibodies in a mammal, preferably a human, comprising the administration of a pharmaceutical composition as defined above and the induction of said specific humoral response.
  • a specific humoral response is understood to mean a response comprising the production of antibodies directed specifically against the polypeptide according to the invention.
  • the specific humoral response includes the production of specific IgAs when the composition according to the invention is administered via the mucosa.
  • the production of specific antibodies can be readily determined by standard techniques well known to those skilled in the art such as ELIS A, RIA, Western Blot.
  • the antibodies induced by the polypeptide according to the invention are capable of neutralizing many primary isolates of HIV. This property can be determined by the neutralization test of C. Moog or D. Montefiori.
  • polypeptide according to the invention is capable, after administration, of inducing antibodies capable of neutralizing primary isolates of HCV. Said polypeptide therefore represents a valuable candidate for the development of a vaccine usable for the protection and / or treatment of a large number of subjects at risk or infected with HIV.
  • the subject of the invention is also a diagnostic method comprising bringing a polypeptide according to the invention into contact with a biological sample and detecting the antibody / polypeptide complexes which have formed.
  • HIV + subjects contain serum anti-gp41 antibodies.
  • An immunological test such as an ELIS A test in which the polypeptide according to the invention is fixed on the test plate and then brought into contact with the serum to be tested and the antibody / polypeptide complexes are then detected by colorimetry using a second labeled antibody
  • ELIS A test in which the polypeptide according to the invention is fixed on the test plate and then brought into contact with the serum to be tested and the antibody / polypeptide complexes are then detected by colorimetry using a second labeled antibody
  • the DNA sequence coding for the polypeptide SEQ ID No. 4 has been cloned into an inducible expression system.
  • the vector used is the Pet -cer which is constructed from the pET28 vector from Novagen.
  • the commercial vector pET28c was amplified by PCR using 2 primers located on either side of the region corresponding to the origin FI, so that the amplified product corresponds to almost all of the original vector less the region comprising the origin FI.
  • the unique restriction sites Ascl and Pacl are provided respectively by the 2 primers which served for the amplification.
  • the cer fragment is amplified using 2 primers which make it possible to obtain this fragment framed by the Ascl and Pacl sites.
  • Vector and Cer fragment are digested by the enzymes Ascl and Pacl and then ligated together.
  • This vector comprises in particular an expression cassette under the control of the T7 promoter, a polylinker downstream of the T7 promoter for the cloning of the gene of interest, the CER fragment located downstream of the polylinker, making it possible to reduce the multimerization of the plasmids, a T7 term transcription terminator and the kanamycin resistance gene.
  • the upregulation of the promoter is obtained in the presence of T7 RNA polymerase.
  • SEQ ID No. 3 is obtained by PCR from a plasmid containing the sequence coding for the gpl60 of HIV-1 LAI.
  • the BspHI and Xhol restriction sites, used for cloning, are provided respectively by the 5 '(5' gp41 SPF BspHI) and 3 '(3'gp41TMBR / HSX) PCR primers.
  • the 3 'primer also contains the sequences coding for the poly histidine linkage and the flexible link which connects it to the polypeptide.
  • the PCR amplified fragment was digested with the enzymes BspE ⁇ and Xhol and inserted into the expression vector digested with Ncol and Xhol (the Ncol and BspHI sites produce ends
  • the PCR amplification conditions are as follows: 97 ° C / 30 s; 55 ° C / 1 min; 72 ° C / 50s;
  • restriction sites BspHI and Xhol are indicated in italics, the initiation codons ATG and of termination TAG (complementary strand) are underlined and in bold characters.
  • the construction was characterized by restriction mapping, sequencing of the 5 'and 3' junctions as well as of the entire inserted fragment.
  • the expression of the plasmid thus obtained is carried out in E. coli BL21 lambda DE3
  • the cells of E. coli are transformed with approximately 1 ng of the plasmid.
  • the culture of E. coli BL21 DE 3 expressing the polypeptide is produced in TB medium in the presence of kanamycin (25 ⁇ g / ml at the end) with an induction lasting 4 hours at 37 ° C. which starts by adding lmM of IPTG when the OD is around 0.9.
  • Expression of the polypeptide leads to approximately 30 mg of purified polypeptide / 1 of culture.
  • the bacteria are broken by sonication (4x2min.) Avoiding heating the bacterial extracts.
  • the polypeptide is then found as an inclusion body.
  • Example 2 Determination of humoral immunity after parenteral administration The polypeptide SEQ ID No. 4 was tested in guinea pigs, in rabbits and in the Cynomolgus macaque according to the protocols described below.
  • Guinea pigs groups of 5 guinea pigs were injected 3 times, 3 weeks apart, into the thighs (biceps femoris muscle) with 20 ⁇ g per dose of antigen. On each injection, the animals received 0.5 ml of the formulation (0.25 ml in each thigh). The animal sera were taken for the analysis of the antibodies before immunization, then 3 and 2 weeks after the 2 nd and 3 rd immunizations, respectively.
  • antigen + alum aluminum phosphate, 6 mg per dose
  • antigen + alginate and antigen in arginine + alginate buffer were prepared as follows: a- for formulations adjuvanted with aluminum phosphate: the antigen is in 50mM formate medium, pH 2.5.
  • the formulations are obtained by adding alum to the antigen composition and incubation with gentle shaking for 30 minutes, the mixture is then centrifuged (5 minutes at 3000 rpm), the supernatant being removed and replaced with PB S buffer of so as to obtain 500 ⁇ l / dose in the end. Resuspension is carried out using an ultrasonic bath.
  • the antigen is in 50mM formate medium, pH 2.5.
  • a filtered alginate solution, 1% (LVM grade, PRONOVA) in PBS buffer is added to be 1.4: 1 (vol. Antigen / vol. Alginate).
  • the mixture is completed with a Tween 80 solution, 0.67% by weight in PBS buffer, so as to obtain 500 ⁇ l / dose in the end.
  • arginine + alginate the antigen is found in 1M arginine medium, PBS, pH 7.4. The preparation is the same as described in b-, with the use in this case of a ratio 2.75: 1 (vol. Antigen: vol. Alginate).
  • S Rabbits groups of 2 rabbits were injected 3 times, 3 weeks apart, into the thighs with 40 ⁇ g per dose of antigen. At each injection, the animals received 1 ml of the formulation.
  • antigen + alum aluminum phosphate, 6 mg per dose
  • the composition tested here was prepared in the following manner: to the antigen, in 50 mM formate medium, pH 2.5, aluminum phosphate is added, the whole being incubated for 30 minutes at + 4 ° C. with gentle agitation (mobile wheel).
  • the tubes containing these preparations are then centrifuged (5 minutes at 3000 rpm), the supernatant being removed and replaced with PBS buffer so as to obtain 1 ml / dose in the end. Resuspension is carried out using an ultrasonic bath.
  • Rhesus macaques (macaca fascicularis): Groups of 2 macaques were injected 3 times at 1 month intervals into the thighs (reclus femoris muscle) with 100 ⁇ g per dose of antigen adsorbed on 6 mg of alum (phosphate of aluminum). On each injection, the animals received 1 ml of the formulation.
  • antigen + alum was prepared in the following manner: to the antigen, in 50 mM formate medium, pH 2.5, aluminum phosphate is added, the whole being incubated for 30 minutes at + 4 ° C. weak agitation (moving wheel). The tubes containing these preparations are then centrifuged (5 minutes at 3000 rpm), the supernatant being removed and replaced with PBS buffer so as to obtain 1 ml / dose in the end. Resuspension is carried out using an ultrasonic bath.
  • the polypeptide induces significant, homogeneous and specific levels of ELIS A antibodies against the polypeptide according to the invention and gpl60 MN / LAI-2 (hybrid glycoprotein in which the gpl20 subunit derives from 'isolate ⁇ TH-1 MN and the gp41 subunit derives from the isolate VEH-1 LAI).
  • gpl60 MN / LAI-2 hybrid glycoprotein in which the gpl20 subunit derives from 'isolate ⁇ TH-1 MN and the gp41 subunit derives from the isolate VEH-1 LAI.
  • These IgG responses almost reach a plateau from the 2nd injection (table 1).
  • the alginate formulation appears to be 10 times less effective, in terms of the level of specific antibodies induced, than the alum formulation.
  • NB all the pre-immune sera tested are below the detection threshold (i.e. 1.9 log for ELISA anti-gpl60 and 1.0 log for ELISA anti-polypeptide).
  • NB all the pre-immune sera tested are below the positivity threshold (either, according to the methods: ⁇ 20 for the strain " VTH-1 MN and ⁇ 80% or ⁇ 4 for the primary isolates).
  • Example 3 Determination of the humoral immunogenicity of the polypeptide according to the invention administered by mucous route.
  • polypeptide SEQ ID No. 4 was tested in BALB / c mice according to the protocol described below.
  • mice groups of 6 to 7 mice were administered by intraoral or intragastric route 3 times, 2 weeks apart, and 1 time 1 month later, with 50 ⁇ g per dose of antigen alone or formulated with 5 ⁇ g of cholera toxin (CT).
  • CT cholera toxin
  • Gpl60 MN / LAI-2 was added as a control formulated with 5 ⁇ g of cholera toxin (CT).
  • CT cholera toxin
  • the animals received either 20 ⁇ l, for the intraoral route, or 500 ⁇ l, for the intragastric route, of the formulation.
  • compositions tested were prepared as follows: for the gp 160 antigen: the necessary volume of a CT solution at 2 mg / ml of H 2 O is added, which is completed with PBS buffer so as to have 20 or 500 ⁇ l / dose in the end.
  • the antigen SEQ ID No. 4, in 50mM formate medium, pH 2.5, is first diluted in 50mM formate and then added with a CT solution at 2 mg / ml of H 2 O so as to have 20 or 500 ⁇ l / dose in the end.
  • Sera and vaginal secretions of animals were collected for analysis of antibodies before immunization and 2 weeks after the 4 th immunization.
  • the polypeptide according to the invention induced specific serum IgG responses after administration by the gastric or buccal route.
  • the antibody titers are approximately 10 times higher when the polypeptide is administered in the presence of CT compared to the antigen alone.
  • a significant humoral response is induced by the polypeptide.
  • the buccal route was found to be more immunogenic overall than the gastric route. Unlike the polypeptide, gpl60 MNLAI-2 in the presence of CT did not or almost not induce antibodies against the various antigens tested (polypeptide, gpl20 MN [produced by Agmed] and V3 MN), whatever the route of immunization.
  • the polypeptide according to the invention elicited specific IgA and / or IgG responses in the mucous secretions tested.
  • the polypeptide administered either by the buccal route or by the gastric route was able, with or without CT, to elicit IgA and IgG responses, the responses being however more frequent in the presence of CT.
  • the gpl60 MN / LAI-2 + CT has elicited little or no mucosal responses, as observed at the serum level.
  • the polypeptide according to the invention is capable of inducing, in all the animal species tested after parenteral administration, significant specific serum IgG responses with respect to the polypeptide and gpl60 MN / LAI-2.
  • the antibodies induced have an activity capable of neutralizing several primary isolates of HTV.
  • the polypeptide according to the invention is capable of inducing, after administration by the mucous route, serum IgG antibodies and mucosal IgG and IgA antibodies at the level of vaginal secretions.
  • Example 4 Determination of the humoral immunogenicity of plasmid DNA vectors coding for a polypeptide according to the invention administered intramuscularly.
  • PCA TPA gp41 PK (antigen tested from N- to C-terminal: AA1-AA157- GGRERDRDRSGGGGS)
  • PCA TPA gp41 SPF PK tested antigen from N- to C- terminal: AA25-AA157- GGRERDRDRSGGGGS
  • PCA TPA gp41 tested antigen from N- to C- terminal: AA1-AA157
  • PCA TPA gp41 SPF (antigen tested from N- to C- terminal: AA25-AA157)
  • TPA signal sequence of human tPA, SPF for: without fusion peptide
  • PK for: the Kennedy neutralizing epitope ie ERDRD located in the intracytoplasmic portion of gp41 at position 746-750, within the sequence known as' peptide Kennedy 'located between residues 731-752 [(Kennedy et al, 1986, Science, 231: 1556-59; (Vella et al, 1993, J General Virology, 74: 2603-07]
  • the sequences coding for the tested polypeptides were amplified by PCR and cloned into a derivative of the expression vector pCAMycHis (Invitrogen).
  • the modified vector used is obtained by replacing the existing polylinker with a different "polylinker” containing the restriction sites Xbal and BamHI into which is inserted the sequence coding for the antigen tested.
  • the expression of the cloned gene is under the control of the CMV promoter.
  • the DNA is prepared after transformation of a strain of E coli XL-1 blue. A culture of 2 liters (LB medium + Carbenicillin at 100 mg / ml) makes it possible to obtain approximately 10 mg of plasmid. After alkaline lysis, the plasmid is purified on a Qiagen column (Gigaprep) according to the protocol indicated by the supplier.
  • the immunogenicity of the constructions thus obtained is evaluated in guinea pigs according to the following protocol: Groups of 5 guinea pigs were injected 4 times, 1 month apart, in the thighs (biceps femoris muscle) with 200 ⁇ g per dose of plasmid . On each injection, the animals received 1 ml of the formulation (0.5 ml in each thigh). The sera of the animals were taken for analysis of antibodies before immunization, and 1 month after the 4 th immunization.
  • the PCA plasmid TPA gp41 SPF PK was found to be the most immunogenic, capable of inducing significant levels of antibodies specific for the polypeptide according to the invention, also recognizing gpl60 MN / LAI-2.
  • the humoral responses induced by the other constructs tested were found to be weaker.
  • NB all the pre-immune sera tested are below the detection threshold (i.e. 1.9 log for ELISA anti-gpl60 and 1.0 logw for ELISA anti-polypeptide).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention a pour objet un polypeptide représenté par la formule :N-L-C-, dans la quelle : N représente la séquence des acides aminés 25-81 de la gp41, C représente la séquence des acides aminés 112-157 de la gp41, et L représente une séquence de liaison flexible comprenant de 2 à 30 acides aminés, pour la préparation d'une composition pharmaceutique pour l'induction d'anticorps neutralisant les isolats primaires du HIV.

Description

Antigène polypeptidique induisant des anticorps neutralisant le VIH
La présente invention se rapporte à un antigène polypeptidique dérivant de la protéine gp41, ainsi qu'à son utilisation pour l'immunisation contre l'infection liée au VIH. Ces travaux ont été co-financés par l'ANRS.
La mise au point d'une méthode d'immunisation contre le VIH est aujourd'hui l'une des priorités de la recherche scientifique.
Les obstacles majeurs que sont la grande variabilité génétique du virus et la faible exposition au système immunitaire d'épitopes viraux neutralisants conservés freinent considérablement le développement d'un vaccin capable de neutraliser les isolats primaires du VIH.
La glycoprotéine d'enveloppe du VIH qui est requise pour conférer au virus son caractère infectieux représente la cible d'anticorps neutralisants. Ces caractéristiques ont fait de cette dernière un sujet d'investigations intenses. L'utilisation à des fins vaccinales de polypeptides dérivant de la protéine gp41 a été décrite dans WO00/40616. Selon cette demande, les hélices N peuvent être utilisées seules ou en association avec les hélices C pour induire des anticorps neutralisants.
La demanderesse propose ici un nouvel antigène polypeptidique utilisable pour l'immunisation thérapeutique et prophylactique contre l'infection liée au VIH. La demanderesse a en effet mis en évidence un polypeptide dérivant de l'ectodomaine de la protéine gp41 qui est capable d'induire des anticorps neutralisant les isolats primaires du VIH. La présente invention concerne donc un polypeptide représenté par la formule :
N-L-C Dans laquelle : N représente la séquence des acides aminés 25-81 de la gp41,
C représente la séquence des acides aminés 112-157 de la gp41, et L représente une séquence de liaison flexible comprenant de 2 à 30 acides aminés. Selon un mode de réalisation particulier, N représente SEQ ID N°l et C représente SEQ ID N02. Selon un mode de réalisation préféré, le polypeptide est constitué de la séquence SEQ
ID °3.
Selon un autre mode de réalisation, le polypeptide tel que défini ci-dessus comprend en outre une séquence contenant l'épitope ERDRD. Selon un mode de réalisation particulier, le polypeptide tel que défini ci-dessus comprend une séquence supplémentaire de formule (G)a-S-(H)b dans laquelle G représente un résidu glycine, H représente un résidu histidine, a est supérieur ou égal à 4 et b est supérieur ou égal à 6, ladite séquence étant liée par liaison ami de à l'extrémité NH2- ou COOH-terminale du polypeptide.
Selon un mode de réalisation particulièrement préféré, le polypeptide selon la présente invention est constitué de la séquence SEQ ID N°4.
La présente invention a également pour objet un conjugué comprenant un polypeptide tel que défini ci-dessus, conjugué à une protéine ou un peptide porteur. La présente invention concerne également une séquence d'ADN codant pour un polypeptide ou pour un conjugué tel que défini ci-dessus.
La présente invention a également pour objet un vecteur d'expression comprenant ladite séquence d'ADN.
Selon un mode de réalisation préféré l'ADN code pour un polypeptide tel que défini ci- dessus qui comprend en outre une séquence contenant l'épitope ERDRD.
La présente invention a également pour objet une cellule hôte contenant le vecteur tel que défini ci-dessus.
Selon un autre aspect, la présente invention concerne un procédé de préparation d'un polypeptide tel que défini ci-dessus comprenant l'expression dudit polypeptide à partir d'une cellule hôte telle que définie ci-dessus.
Selon un autre aspect, la présente invention concerne une composition pharmaceutique comprenant au moins un polypeptide, ou au moins un conjugué, ou au moins un vecteur d'expression tel que défini ci-dessus, un excipient pharmaceutiquement acceptable et éventuellement un adjuvant. Selon un mode de réalisation particulier, la composition pharmaceutique comprend un polypeptide de séquence SEQ ID N°4 et un adjuvant sélectionné dans le groupe consistant en DC-Chol et gel d'aluminium.
La présente invention a également pour objet le polypeptide tel que défini ci-dessus pour son utilisation en tant que médicament, en particulier pour l'induction d'anticorps spécifiques neutralisants chez un mammifère.
La présente invention concerne également une méthode d'induction d'anticorps spécifiques neutralisants chez un mammifère comprenant l'administration d'une composition pharmaceutique telle que définie ci-dessus et l'induction desdits anticorps. Selon un mode de réalisation préféré, l'administration est réalisée par voie orale ou intramusculaire.
L'invention est décrite plus en détails dans la description qui suit.
La demanderesse a mis en évidence de façon surprenante que le polypeptide selon l'invention induisait des anticorps IgG spécifiques neutralisant les isolats primaires du VIH.
L'induction d'anticorps neutralisant les isolats primaires peut être déterminée par le test de neutralisation tel que décrit dans l'article de C. Moog et al (AIDS Research and human retroviruses, vol. 13(1), 13-27, 1997) auquel on pourra se référer pour un descriptif complet de ce dernier. On estime dans le cadre de la présente invention que des anticorps neutralisants ont été induits par l'antigène testé selon la technique de C. Moog lorsque le sérum dilué au moins au 1/4 en présence de VIH entraîne une réduction d'un facteur 10 du titre viral en comparaison au VIH seul, le titre viral étant évalué par la quantité de p24 produite dans le surnageant de culture.
L'induction d'anticorps neutralisant les isolats primaires peut également être déterminée par le test de neutralisation de D. Montefiori tel que décrit dans J. Infect. Dis. 1996, 173:60-67. Dans ce test, le titre neutralisant est exprimé par le pourcentage de réduction d'antigène p24 produit dans les surnageants de culture lorsque le virus est incubé en présence de sérum dilué au VΛ par comparaison au virus en absence de sérum. On considère dans le cadre de la présente invention que des anticorps neutralisants ont été induits lorsque la réduction du taux de p24 produit atteint au moins 80% avec un sérum dilué au VΛ.
On considère dans le cadre de la présente invention que les anticorps induits par le polypeptide selon l'invention sont neutralisants si une activité neutralisante est détectée pour un isolât donné dans au moins un des deux tests ci-dessus.
L'induction d'anticorps neutralisant la souche VIH-1 de laboratoire MN peut être estimée en utilisant la lignée cellulaire MT-2 selon la méthode de D. Montefiori, décrite dans : DC Montefiori et al. J Clin Microbiol. 1988, 26: 231-5). Dans cette méthode, le titre neutralisant est exprimé comme l'inverse de la dilution du sérum (en valeur arithmétique) protégeant au moins 50% de cellules de l'effet cytopathogène du virus VIH.
Les séquences N et C constitutives du polypeptide selon la présente invention peuvent être issues de toute protéine gp41 du VIH, incluant les souches VŒU et VIH2, incluant les souches de laboratoire et les isolats primaires. De préférence les séquences constitutives sont issues d'une souche VŒU et en particulier d'une souche VIH 1 LAI. La numérotation des acides aminés est faite par référence à la séquence du fragment de gp41 SEQ ID No 8 dans lequel le premier acide aminé A porte le numéro 1. Selon un mode de réalisation préféré, N représente SEQ ID N°l et C représente SEQ ID N°2. Les séquences nucléotidiques et peptidiques d'un grand nombre de protéine gp41 sont connues et disponibles par exemple sur Internet sur le site http://hiv-web.lanl.gov/ ainsi que dans les compendium correspondants de Los Alamos. Il est clair que toute séquence dans laquelle une ou plusieurs mutations conservatives qui n'altèrent pas substantiellement l'immunogénicité ont été introduites est également incluse dans le cadre de la présente invention. Les séquences N et C sont liées entre elles via une séquence peptidique de liaison L comprenant de 2 à 30 acides aminés. Cette séquence de liaison L est une boucle permettant l'appariement des séquences N et C entre elles selon une orientation anti-parallèle. Le polypeptide selon la présente invention est un trimère constitué de 3 monomères N-L-C formant un faisceau dans lequel les hélices N sont appariées entre elles et les hélices C sont appariées aux hélices N selon une orientation anti-parallèle.
Les séquences L appropriées dans le cadre de la présente invention peuvent être sélectionnées par utilisation d'un logiciel de prédiction de structure secondaire GOR (Garnier, Osguthorpe and Robson (1078), J. Mol. Biol., 120, 97-120 ; http://molbiol.soton.ac.uk/compute/GOR.html) sur la séquence N-L-C en spécifiant dans les fenêtres « hélice » et « étendue » la notion inconnue. Le pourcentage d'hélice dans la prédiction de la structure secondaire de L doit être inférieur à 10. Les séquences L présentent avantageusement un caractère faiblement hydrophobe, de préférence hydrophile pour faciliter la purification du polypeptide correspondant. Le caractère hydrophile peut être obtenu par utilisation d'acide aminé ayant un caractère hydrophile tel que la serine qui peut être associé avec des glycines. Selon un mode de réalisation préféré, le polypeptide selon l'invention présente la séquence SEQ ID N°3. Cette séquence peut avantageusement être modifiée pour diminuer son caractère hydrophobe par exemple par introduction d'au moins l'une des mutations suivantes : W85D ; L91K ; I92K et W103D et de préférence par l'introduction d'au moins 2 mutations quelconques sélectionnées dans le groupe des 4 mutations proposées ci- dessus, voire de l'ensemble desdites mutations.
Selon un mode de réalisation particulier, le polypeptide de formule N-L-C tel que défini ci-dessus comprend en outre une séquence contenant l'épitope ERDRD de Kennedy. La séquence ERDRD peut être liée en N- ou C-terminal du polypeptide, directement ou de préférence via un lien flexible. Un tel lien flexible comprend typiquement une dizaine d'acides aminés environ de préférence à caractère hydrophile. Des séquences comprenant des glycines et serines telles que GGR, sont par exemple parfaitement appropriées. L'épitope ERDRD peut également être insérée au niveau de la séquence L du polypeptide. Dans un tel cas de figure, l'épitope sera préférentiellement encadré de séquences de liaison assurant la jonction avec les séquences N et C. La nature de ces séquences est facilement déterminable par l'utilisation du logiciel de prédiction de structure secondaire GOR mentionné ci-dessus, l'objectif étant que la séquence de liaison L permette l'appariement anti-parallèle des hélices N et C. On entend donc par « une séquence comprenant l'épitope ERDRD » dans le cadre de la présente invention une séquence constituée : de l'épitope ERDRD , éventuellement d'un lien flexible et éventuellement de quelques acides aminés supplémentaires qui résulteraient du procédé de construction des plasmides exprimant le polypeptide du fait de l'utilisation des sites de restriction. C'est le cas par exemple des acides aminés RSGGGGS présents en C-terminal des constructions testés dans l'exemple 4. Le polypeptide selon l'invention peut être obtenu par toute technique classique de synthèse chimique ou de génie génétique.
Lorsque le polypeptide est produit par synthèse chimique, le polypeptide selon l'invention peut être synthétisé sous la forme d'une séquence unique, ou sous la forme de plusieurs séquences qui sont ensuite liées les unes aux autres. La synthèse chimique peut être réalisée en phase solide ou en solution, ces deux techniques de synthèse étant bien connues de l'homme de l'art. Ces techniques sont décrites notamment par Atherton et Shepard dans « solid phase peptide synthesis (IRL press Oxford, 1989) et par Houbenweyl dans « method der organischen chemie » édité par E.Wunsch vol, 15-1 et II thieme, Stuttgart, 1974, ainsi que dans les articles suivants dont l'intégralité est incorporée ici à titre de référence : Dawson PE et al (Science 1994 ; 266(5186):776-9);Kochendoerfer GG et al (1999 ;3(6):665-71); et Dawson PE et al, Annu Rev Biochem 2000 ; 69:923-60.
Le polypeptide selon l'invention peut être également produit par les techniques de génie génétique bien connues de l'homme de l'art. Lorsque le polypeptide selon l'invention est produit par génie génétique il comprend à l'extrémité NH2-terminale un résidu méthionine supplémentaire correspondant à la traduction du premier codon d'initiation. Ces techniques sont décrites en détails dans Molecular Cloning : a molecular manual de Maniatis et al, Cold Spring Harbor, 1989. Classiquement, la technique de PCR est utilisée pour produire la séquence d'ADN codant pour le polypeptide selon l'invention sous une forme insérable dans un vecteur d' expression. La séquence d'ADN ainsi obtenue est ensuite insérée dans un vecteur d'expression. Le vecteur d'expression renfermant la séquence d'intérêt est alors utilisé pour transformer une cellule hôte permettant l'expression de la séquence d'intérêt. Le polypeptide produit est ensuite isolé du milieu de culture par des techniques classiques de chromatographie bien connues de l'homme de l'art. De préférence, la chromatographie liquide à haute performance (HPLC) est utilisée dans la purification. Typiquement, les cellules sont collectées à la fin de la culture par centrifugation et reprises dans un tampon neutre, pour être cassées par tout moyen approprié. Le lysat cellulaire est alors centrifugé à environ 10000g pour séparer le matériel soluble du matériel insoluble. Une analyse par SDS-PAGE du surnageant et du culot de centrifugation fera apparaître si le polypeptide est soluble ou non. Dans le cas où le polypeptide n'est pas soluble, la solubilisation est obtenue grâce à un tampon contenant de l'urée, de la guanidine ou d'autres agents solubilisants. Une centrifugation à cette étape permet de se débarrasser des débris et des autres produits insolubles qui gêneraient la chromatographie. L'étape suivante consiste à charger la molécule solubilisée sur une colonne d'affinité, qui peut être de type métal chélate, si une queue polyhistidine est intégrée sur le polypeptide d'intérêt. Le système qui permet la purification par affinité peut être de nature variée, comme l'immunoaffmité, l'affinité sur bleu de cibachron, etc... A ce stade la protéine présente un taux de pureté voisin ou supérieur à 80%, comme on peut le déterminer par électrophorèse SDS PAGE suivi d'une coloration au bleu de coomassie. Une étape supplémentaire de chromatographie peut être ajoutée pour le polissage du polypeptide, on peut citer à titre d'exemple la filtration sur gel, la chromatographie en phase inverse.
Le polypeptide selon l'invention peut ainsi être obtenu sous forme purifiée le. sous une forme présentant un taux de pureté d'au moins 80%. Le taux de pureté est défini par rapport aux autres protéines présentes dans le mélange qui sont considérées comme des contaminants. Ce taux est évalué par colorimétrie d'un SDS-PAGE en utilisant du bleu de coomassie. Une mesure densitométrique des bandes permet de quantifier le taux de pureté. La mesure du taux de pureté peut également se faire par HPLC en phase inverse par la mesure de l'aire des différents pics.
Pour mettre en oeuvre la synthèse du polypeptide, tout vecteur d'expression classiquement utilisé pour l'expression d'une protéine recombinante peut être utilisé dans le cadre de la présente invention. Ce terme englobe donc aussi bien les vecteurs d'expression dits « vivants » tels que les virus et les bactéries que les vecteurs d'expression de type plasmidiques. On utilise de préférence des vecteurs dans lesquels la séquence d'ADN du polypeptide selon l'invention est sous la dépendance d'un promoteur fort, inductible ou non inductible. On peut citer à titre d'exemple de promoteur utilisable, le promoteur de TARN polymérase T7.
Les vecteurs d'expression incluent de préférence au moins un marqueur de sélection. De tels marqueurs incluent, par exemple, le gène de la dihydrofolate réductase ou le gène de résistance à la néomycine pour la culture des cellules d'eucaryote et les gènes de résistance à la kanamycine, tétracycline ou ampicilline pour la culture dans E. coli et des autres bactéries.
On peut citer à titre de vecteur d'expression utilisable dans le cadre de la présente invention les plasmides pET28 (Novagen) ou pBAD (Invitrogen) par exemple ; les vecteurs viraux tels que : baculovirus, poxvirus en particulier les poxvirus décrits dans les brevets
US 5,942,235, US 5,756,103 et US 5,990,091 dont l'intégralité est incorporée ici à titre de référence, les virus de la vaccine recombinants, en particulier les virus recombinants décrits dans les brevets EP 83286, US 5,494,807 et US 5,762,938 dans lesquels est clone la séquence d'ADN codant pour un polypeptide selon l'invention. Pour favoriser l'expression et la purification du polypeptide, ce dernier peut être exprimé dans une forme modifiée, telle qu'une protéine de fusion, et peut inclure non seulement des signaux de sécrétion, mais aussi des régions fonctionnelles hétérologues supplémentaires.
Par exemple, une région d'acides aminés supplémentaires, particulièrement des acides aminés chargés, peut être ajoutée au N-terminal du polypeptide pour améliorer la stabilité et le maintien dans la cellule hôte. De façon avantageuse le polypeptide selon la présente invention est produit sous la forme d'un peptide de fusion comprenant une séquence supplémentaire de formule
(G)a-S-(H)b dans laquelle G représente un résidu glycine, H représente un résidu histidine, et de préférence a est supérieur ou égal à 4 et b est supérieur ou égal à 6 liée par une liaison amide à l'extrémité NH2- ou COOH- terminal du polypeptide. Cette séquence permet une purification rapide par immunoaffinité du polypeptide selon l'invention.
Pour l'expression du polypeptide, toute cellule hôte classiquement utilisée en association avec les vecteurs d'expression décrits ci-dessus peut être utilisée.
On peut citer à titre d'exemple non limitatif les cellules de E. coli, BL21 (lamdaDE3), HB101, Top 10, CAG 1139, Bacillus, les cellules eucaryotes telles que CHO ou Vero. De préférence on utilisera dans le cadre de la présente invention le système vecteur d'expression /cellule suivant : pET(Cer) /BL21LamdaDE3, ou BL211amdaDE3(RIL). En fonction de la cellule hôte utilisée pour l'expression du polypeptide, les polypeptides de la présente invention pourront être glycosylés ou non-glycosylés. De plus, les polypeptides selon l'invention pourront aussi inclure un résidu de méthionine supplémentaire en N-terminal. La présente invention a également pour objet les conjugués comprenant un polypeptide selon l'invention et une protéine porteuse ou un peptide porteur.
La protéine (ou peptide) porteuse (eur) renforce l'immunogénicité du polypeptide selon l'invention notamment en augmentant la production d'anticorps spécifiques. Ladite protéine (ou peptide) porteuse (eur) comprend de préférence un ou plusieurs épitope(s) T helper. Par « épitope T helper », on entend un enchaînement d'acides aminés qui, dans le contexte d'une ou de plusieurs molécules du MHC classe II, active les lymphocytes T helper. Selon un mode de réalisation avantageux, la protéine (ou peptide) porteuse (eur) utilisée améliore la solubilité dans l'eau du polypeptide selon l'invention.
Comme protéine porteuse on peut utiliser par exemple les protéines de surface de phages comme la protéine pIII ou pVLII du phage Ml 3, les protéines de surface bactériennes comme les protéines LamB, OmpC, ompA, ompF et PhoE d'E. coli, la protéine CotC ou CotD de B. Subtilis, les porines bactériennes comme la porine PI de Neisseria gonorrheae, la porine PI ou P2 d'H. influenzae B, la porine de classe I de N. meningitidis B, la porine P40 de K. pneumoniae, des lipoprotéines telles que OspA de B. bugdorfi, PspA de S. pneumoniae, TBP2 de N. meningitidis B, TraT d'E. coli ainsi que l'adhésine A de S. pneumoniae ; les « heat shock » protéines telles que Hsp65 ou Hsp71 de M. tuberculosis ou bovis ou Hin 47 d'H. infuenzae type B. Sont également particulièrement appropriées dans le cadre de la présente invention, les toxines bactériennes détoxifiées comme l'anatoxine tétanique ou diphtérique, la sous unité B de la toxine cholérique, la sous unité B de la toxine cholérique, la sous unité B de l'endotoxine A de P. aeruginosa ou l'exotoxine A de S. aureus. Comme peptide porteur on peut utiliser par exemple dans le cadre de la présente invention les peptides p24E, p24N, p24H et p24M décrits dans WO94/29339 ainsi que les peptides PADRE tels que décrits par Del guercio et al (Vaccine (1997) ; voll5/4, p441-448).
La protéine (ou peptide) porteuse (eur) est liée à l'extrémité N ou C terminale du polypeptide selon l'invention par tout procédé de conjugaison bien connu de l'homme de l'art. De plus, la séquence codant pour la protéine (ou peptide) porteur peut avantageusement être fusionnée à la séquence codant pour le polypeptide selon l'invention et la séquence résultante peut être exprimée sous la forme d'une protéine de fusion par tout procédé classique. Toutes les techniques de génie génétique utiles pour ce faire sont décrites dans le Maniatis et al. Lesdits conjugués peuvent être isolés par tout procédé classique de purification bien connus de l'homme de l'art.
La présente invention a également pour objet les séquences d'ADN codant pour les polypeptides et les conjugués selon l'invention ainsi que les vecteurs d'expression comprenant lesdites séquences et les cellules hôtes transformées par lesdits vecteurs. Les séquences d'ADN codant pour les polypeptides selon l'invention peuvent être aisément produites par PCR en utilisant comme matrice la séquence nucléotidique d'une protéine gp41.
Plutôt que d'extraire et de purifier le polypeptide ou le conjugué exprimé par le vecteur d'expression il est souvent plus facile et parfois plus avantageux d'utiliser le vecteur d'expression lui-même dans le vaccin selon l'invention. La présente invention a donc également pour objet tout vecteur d'expression tel que défini ci-dessus. Dans un tel cas de figure, le vecteur d'expression est dépourvu de marqueur et correspond de préférence à un vecteur viral, en particulier un poxvirus tel que ALVAC ou NYVAC. Un tel vecteur peut également contenir au moins un autre séquence codant pour un antigène du VTH. On peut citer à titre d'exemple les séquences des antigènes du VIH qui sont classiquement utilisées dans les vecteurs décrits dans les brevets US5942235, US5756103 et US5762938.
Le vecteur d'expression selon l'invention comprend de préférence une séquence codant pour un polypeptide de formule N-L-C telle que défini ci-dessus comprenant en outre une séquence comprenant l'épitope ERDRD telle que définie ci-dessus qui est liée à l'extrémité N- ou C- terminale dudit polypeptide. Selon un mode de réalisation particulièrement préféré, le vecteur d'expression comprend une séquence codant pour le polypeptide de formule : AA25- AA157-GGRERDRDRSGGGGS.
Toute cellule hôte telle que définie ci-dessus transformée par un tel vecteur d'expression est également incluse dans le cadre de la présente invention. La présente invention a également pour objet les anticorps dirigés contre les polypeptides et conjugués tels que décrits ci-dessus. La préparation de tels anticorps est mise en œuvre par les techniques classiques d'obtention d'anticorps polyclonaux et monoclonaux bien connues de l'homme de l'art.
Ces anticorps sont particulièrement appropriés pour être utilisés dans un schéma d'immunisation passive.
La présente invention a également pour objet des compositions pharmaceutiques utilisables à des fins d'immunisation thérapeutique et prophylactique contre l'infection liée au VIH. Les compositions selon la présente invention comprennent au moins un polypeptide, au moins un conjugué ou au moins un vecteur d'expression tel que défini ci-dessus en une quantité appropriée pour induire une réponse humorale spécifique, un excipient ou diluant pharmaceutiquement acceptable et éventuellement un adjuvant.
La quantité de polypeptide, de conjugué ou de vecteur dans la composition selon la présente invention dépend de nombreux paramètres comme le comprendra l'homme de l'art, tels que la nature de la protéine porteuse, le vecteur utilisé ou, la voie d'administration. Une quantité appropriée est une quantité telle qu'une réponse immunitaire humorale spécifique est induite après administration de ladite composition. La quantité de polypeptide à administrer est de l'ordre de lOμg à 5mg , la quantité sélectionnée variant en fonction de la voie d'administration. La quantité de conjugué à administrer sera déduite des quantités indiquées ci- dessus en tenant compte du PM de la protéine porteuse. La quantité de vecteur d'expression à administrer est de l'ordre de 10 à 5000 μg dans le cas d'un vecteur non viral et de l'ordre de 10E4 à 10E8 TCID50 dans le cas d'un vecteur viral.
Les compositions pharmaceutiques selon la présente invention peuvent également contenir un adjuvant. Tout adjuvant ou mélange d'adjuvants pharmaceutiquement acceptable classiquement utilisé dans le domaine des vaccins peut être utilisé à cette fin. On peut citer à titre d'exemple d'adjuvant appropriés les sels d'aluminium tels que l'hydroxyde d'aluminium ou le phosphate d'aluminium et le DC-Chol. Des agents auxiliaires classiques tels que agents mouillants, charges, émulsifiants, tampons etc.. peuvent également être additionnés à la composition selon l'invention.
Les compositions selon la présente invention peuvent être préparées par tout procédé classique connu de l'homme de d'art. Classiquement les antigènes selon l'invention (i.e polypeptide, conjugué ou vecteur) sont mélangés avec un excipient ou diluant pharmaceutiquement acceptable, tel que eau ou solution saline tamponnée au phosphate. L'excipient ou diluant va être sélectionné en fonction de la forme galénique choisie, du mode et de la voie d'administration ainsi que de la pratique pharmaceutique. Les excipients ou diluants appropriés ainsi que les exigences en matière de formulation pharmaceutique sont décrits en détails dans Remington's Pharmaceutical Sciences, représentant un ouvrage de référence dans ce domaine. Les compositions mentionnées ci-dessus peuvent être administrées par toute voie classique, habituellement utilisée dans le domaine des vaccins, telle que la voie parentérale (intramusculaire, sous-cutanée, etc.). On utilisera de préférence dans le cadre de la présente invention pour les compositions injectables une administration intramusculaire. Une telle administration peut être réalisée avantageusement au niveau des muscles de la cuisse ou du bras. Les compositions selon la présente invention peuvent également avantageusement être administrées par voie orale.
En effet, la demanderesse a mis en évidence que le polypeptide selon l'invention est très stable en milieu fortement acide (pH< ou = à 3). Cette propriété fait du polypeptide selon l'invention un antigène vaccinal de choix pour une administration par voie orale. Dans ce cas là il est possible d'administrer le polypeptide sous la forme d'une solution présentant un pH < ou = à 3 et contenant ou non un adjuvant. Dans le cas des polypeptides comprenant une séquence L à caractère faiblement hydrophobe ou à caractère hydrophile un pH plus élevé peut être utilisé. La demanderesse a en effet montré que la stabilité des formes comportant des boucles plus hydrophiles était obtenue sur une plus large gamme de pH. Les polypeptides comportant de telles boucles pourront donc avantageusement être utilisés pour une administration par voie parentérale. Une administration via la muqueuse nasale, vaginale ou rectale peut être également recommandée dans le cadre de la présente invention. L'administration peut être réalisée par l'administration d'une dose unique ou de doses répétées, par exemple à JO, à 1 mois, à 3 mois, à 6 mois et à 12 mois. On utilisera de préférence les injections à JO , à 1 mois et à 3 mois avec un rappel dont la périodicité pourra être aisément déterminée par le médecin traitant.
La composition pharmaceutique selon la présente invention peut avantageusement être administrée selon un schéma posologique comprenant la co-administration d'un vecteur d'expression selon l'invention et d'un polypeptide selon l'invention ou selon un schéma de « prime-boost » dans lequel le vecteur selon l'invention est administré en premier et le polypeptide en tant qu'injection de rappel. Dans ces deux schémas posologiques, le vecteur d'expression selon l'invention peut être remplacé par tout vecteur d'expression exprimant un ou plusieurs antigènes ou épitopes du VIH différents du polypeptide selon l'invention, et en particulier par un poxvirus de préférence ALVAC ou NYVAC. On peut citer à titre d'exemple de vecteur ALVAC et NYVAC utilisables à cette fin les vecteurs décrits dans les brevets US 5,942,235, US 5,756,103 et US 5,990,091 ; EP 83286, US 5,494,807 et US 5,762,938. On peut également avantageusement utiliser dans le cadre des compositions administrables par voie orale les vecteurs bactériens tels que lactobacillus ou salmonella exprimant le polypeptide selon l'invention et/ou d'autres antigènes du HIV, tels que ceux utilisés classiquement dans les poxvirus décrits dans les brevets US ci-dessus. L'utilisation de ces vecteurs bactériens à des fins d'immunisation est décrite en détail dans International Journal of Food Microbiology 41 (1998) 155-167 de P.H. Pouwels et al et Cell vol 91, 765-775, Dec, 1997 de A. Daiji et al auxquels on pourra se référer pour plus de détails.
La présente invention entend également couvrir un polypeptide, un conjugué ou un vecteur tel que défini ci-dessus et la composition pharmaceutique contenant ces composés pour leur utilisation comme médicament, en particulier pour l'induction d'anticorps spécifiques neutralisants chez un mammifère. Les anticorps induits ayant la propriété de neutraliser les isolats primaires du VIH, le polypeptide selon l'invention est donc un antigène intérêt pour l'immunisation prophylactique et thérapeutique du corps humain contre l'infection liée au VIH
La présente invention concerne donc une méthode d'induction d'anticorps spécifiques neutralisants chez un mammifère, de préférence l'homme, comprenant l'administration d'une composition pharmaceutique telle que définie ci-dessus et l'induction de ladite réponse humorale spécifique.
On entend par « une réponse humorale spécifique» une réponse comprenant la production d'anticorps dirigés spécifiquement contre le polypeptide selon l'invention. La réponse humorale spécifique comprend la production d'IgA spécifiques lorsque la composition selon l'invention est administrée par voie muqueuse. La production d'anticorps spécifiques peut être aisément déterminée par des techniques classiques bien connues de l'homme de l'art telles que ELIS A, RIA, Western Blot. Les anticorps induits par le polypeptide selon l'invention sont capables de neutraliser de nombreux isolats primaires du VIH. Cette propriété peut être déterminée par le test de neutralisation de C. Moog ou de D. Montefiori.
La demanderesse a mis en évidence de façon surprenante que le polypeptide selon l'invention était capable après administration d'induire des anticorps susceptibles de neutraliser des isolats primaires du VCH. Ledit polypeptide représente donc un candidat de valeur pour l'élaboration d'un vaccin utilisable pour la protection et/ou le traitement d'un grand nombre de sujets à risques ou infectés par le VIH.
L'invention a également pour objet une méthode de diagnostic comprenant la mise en contact d'un polypeptide selon l'invention avec un échantillon biologique et la détection des complexes anticorps/polypeptide qui se sont formés. Les sujets VIH+ contiennent en effet des anticorps sériques anti-gp41. Un test immunologique (tel qu'un test ELIS A dans lequel le polypeptide selon l'invention est fixé sur la plaque de test puis mis en contact avec le sérum à tester et les complexes anticorps/polypeptide sont ensuite détectés par colorimétrie par utilisation d'un second anticorps marqué) permettrait donc de diagnostiquer les sujets infectés. La présente invention va être décrite de façon plus détaillée dans les exemples qui suivent qui sont donnés à titre purement illustratif de l'invention et ne peuvent en aucun cas être considérés comme limitant la portée de cette dernière.
Exemple 1 : Purification du polypeptide selon l'invention
Clonage :
La séquence d'ADN codant pour le polypeptide SEQ ID N°4 a été clonée dans un système d'expression inductible.
Le vecteur utilisé est le Pet -cer qui est construit à partir du vecteur pET28 de Novagen. Le vecteur commercial pET28c a été amplifié par PCR à l'aide de 2 amorces situées de part et d'autre de la région correspondant à l'origine FI, de sorte que le produit amplifié corresponde à la quasi totalité du vecteur d'origine moins la région comprenant l'origine FI. Les sites de restriction uniques Ascl et Pacl sont apportés respectivement par les 2 amorces ayant servi à l'amplification. Parallèlement le fragment cer est amplifié à l'aide de 2 amorces qui permettent d'obtenir ce fragment encadré par les sites Ascl et Pacl.
Vecteur et fragment Cer sont digérés par les enzymes Ascl et Pacl puis ligués entre eux.
Ce vecteur comprend en particulier une cassette d'expression sous le contrôle du promoteur T7, un polylinker en aval du promoteur T7 pour le clonage du gène d'intérêt, le fragment CER situé en aval du polylinker , permettant de diminuer la multimérisation des plasmides, un terminateur de transcription T7 term et le gène de résistance à la kanamycine.
La régulation positive du promoteur est obtenue en présence de la T7 RNA polymérase.
Un fragment d'ADN d'environ 0.5 Kb contenant la séquence codant pour la séquence
SEQ ID N°3 est obtenu par PCR à partir d'un plasmide contenant la séquence codant pour la gpl60 du VIH-1 LAI. Les sites de restriction BspHI and Xhol, utilisés pour le clonage, sont respectivement apportés par les amorces PCR 5' (5' gp41 SPF BspHI ) and 3' (3'gp41TMBR/HSX). L'amorce 3' contient également les séquences codant pour l'enchaînement poly histidine et le lien flexible qui le relie au polypeptide.
Le fragment amplifié par PCR a été digéré par les enzymes BspEŒ et Xhol et inséré dans le vecteur d'expression digéré par Ncol et Xhol (les sites Ncol et BspHI produisent des extrémités
5' débordantes compatibles après digestion).
Les conditions d'amplification PCR sont les suivantes : 97°C / 30 s ; 55°C / 1 mn ; 72°C / 50s;
Taq DNA polymérase - 25 cycles Amorce 5 ' : 5 ' .... TCATGA CGCTGACGGTACAGGCC 3 '
Amorce 3': 5' CCGCrCG GCTAATGGTGATGGTGATGGTGTGACCCTCCCCCTCC ACTTGCCCATTTATCTAA 3'
Les sites de restriction BspHI et Xhol sont indiqués en italique, les codons d'initiation ATG et de terminaison TAG (brin complémentaire) sont soulignés et en caractères gras.
La construction a été caractérisée par cartographie de restriction, séquençage des jonctions 5' et 3' ainsi que de la totalité du fragment inséré.
Des essais d'expression dans des conditions classiques ont permis d'obtenir et de visualiser aussi bien après coloration au bleu de Coomassie qu'analyse en western blot à l'aide d'un anticorps anti-polyhistidine un produit d'un poids moléculaire apparent conforme au résultat attendu.
Expression et purification :
L'expression du plasmide ainsi obtenu est réalisé chez E. coli BL21 lambda DE3 Les cellules d'E. coli sont transformées par environ 1 ng du plasmide. La culture d'E. coli BL21 DE 3 exprimant le polypeptide est réalisé en milieu TB en présence de kanamycine (25 μg/ml en final) avec une induction d'une durée de 4 heures à 37°C qui démarre par addition d lmM d'IPTG quand la DO est d'environ 0.9. L'expression du polypeptide conduit à environ 30 mg de polypeptide purifié/ 1 de culture. Le cassage des bactéries est effectué par sonication (4x2min.) en évitant de chauffer les extraits bactériens. Le polypeptide se trouve alors sous forme de corps d'inclusion. Ceux ci sont récupérés par centrifugation (pendant 30 min à 10000g, à 4°C), puis ils sont solubilisés dans un tampon Tris 50mM à pH8 contenant de l'urée 6M et du NaCl 500mM. La solution est filtrée sur un filtre de 0,45 μm de porosité (Millex HV, Millipore) avant chromatoghraphie sur colonne de Nickel-Sepharose (Hi-trap, Pharmacia). Le polypeptide est chargé sur la colonne en présence de lOmM imidazole dans le tampon Tris-Urée. La colonne est lavée dans les mêmes conditions, puis le polypeptide purifié est élue par injection d'une solution d'imidazole 0,5M dans le même tampon. Le polypeptide est alors dialyse dans un tampon formate 50 mM à pH2.5 avant chromatographie sur colonne de phase inverse en HPLC dont le rôle est d'éliminer les endotoxines résiduelles.
Après chargement du polypeptide, un gradient de 20 à 80% d'acétonitrile contenant 0,1% de TFA circule sur la colonne semi préparative (214TP510, Vydac). Le polypeptide est élue entre 40 et 60% d'acétonitrile. Les solvants sont ensuite éliminés par évaporation sous vide, puis par dialyse en tampon formate à pH2.5. Le polypeptide obtenu, dont le taux de pureté est supérieur à 80%, est complètement débarrassé des endotoxines. Il est conservé à -45°C. Exemple 2 : Détermination de l'immunité humorale après administration par voie parentérale Le polypeptide SEQ ID N°4 a été testé chez le cobaye, chez le lapin et chez le macaque Cynomolgus selon les protocoles décrits ci-dessous.
Cobayes : des groupes de 5 cobayes ont été injectés 3 fois, à 3 semaines d'intervalle, dans les cuisses (muscle biceps femoris) avec 20 μg par dose d'antigène. A chaque injection, les animaux ont reçu 0,5 ml de la formulation (0,25 ml dans chaque cuisse). Les sérums des animaux ont été prélevés pour l'analyse des anticorps avant immunisation, puis 3 et 2 semaines après les 2πde et 3eme immunisations, respectivement.
Les trois compositions testées : antigène + alum (phosphate d'aluminium, 6 mg par dose); antigène + alginate et antigène en tampon arginine + alginate ont été préparées de la façon suivante : a- pour les formulations adjuvées avec le phosphate d'aluminium : l'antigène se trouve en milieu formate 50mM, pH 2.5. Les formulations sont obtenues par ajout de l'alum à la composition d'antigène et incubation sous agitation douce pendant 30 minutes, le mélange est ensuite centrifugé (5 minutes à 3000 rpm), le surnageant étant prélevé et remplacé par du tampon PB S de sorte à obtenir 500μl/dose en final. La remise en suspension est réalisée à l' aide d'un bain à ultrasons. b- Pour la formulation en alginate : l'antigène se trouve en milieu formate 50mM, pH 2.5. Il est additionné d'une solution filtrée d'alginate, 1% (grade LVM, PRONOVA) en tampon PBS pour être à 1.4 :1 (vol . antigène/vol. alginate). Après incubation à température ambiante (5 minutes), le mélange est complété avec une solution de Tween 80, 0.67% en poids en tampon PBS, de sorte à obtenir 500μl/dose en final.
L'homogénéisation est réalisée par un léger vortex. c- Pour la formulation en arginine + alginate : l'antigène se trouve en milieu arginine 1M, PBS, pH 7.4. La préparation est la même que décrite en b-, avec utilisation dans ce cas d'un rapport 2.75 :1 (vol. antigène :vol. alginate). •S Lapins : des groupes de 2 lapins ont été injectés 3 fois, à 3 semaines d'intervalle, dans les cuisses avec 40 μg par dose d'antigène A chaque injection, les animaux ont reçu 1 ml de la formulation.
Les sérums des animaux ont été prélevés pour analyses anticorps avant immunisation, puis 3 et 2 semaines après les 2nde and 3eme immunisations, respectivement. d- La composition testée ici : antigène + alum (phosphate d'aluminium, 6 mg par dose); a été préparée de la façon suivante : à l'antigène, en milieu formate 50mM, pH 2.5, est ajouté du phosphate d'aluminium, l'ensemble étant incubé 30 minutes à +4°C sous faible agitation (roue mobile). Les tubes contenant ces préparations sont ensuite centrifugés (5 minutes à 3000 rpm), le surnageant étant prélevé et remplacé par du tampon PBS de sorte à obtenir 1 ml/dose en final. La remise en suspension est réalisée à l'aide d'un bain à ultrasons.
Macaques Rhésus (macaca fascicularis) : Des groupes de 2 macaques ont été injectés 3 fois à 1 mois d'intervalle dans les cuisses (muscle reclus femoris) avec 100 μg par dose d'antigène adsorbés sur 6 mg d'alum (phosphate d'aluminium). A chaque injection, les animaux ont reçu 1 ml de la formulation.
Les sérums des animaux ont été prélevés pour analyses anticorps avant immunisation, puis 4 et 2 semaines après les 2nde and 3eme immunisations, respectivement. La composition testée ici : antigène + alum a été préparée de la façon suivante : à l'antigène, en milieu formate 50mM, pH 2.5, est ajouté du phosphate d'aluminium, l'ensemble étant incubé 30 minutes à +4°C sous faible agitation (roue mobile). Les tubes contenant ces préparations sont ensuite centrifugés (5 minutes à 3000 rpm), le surnageant étant prélevé et remplacé par du tampon PBS de sorte à obtenir 1 ml/dose en final. La remise en suspension est réalisée à l'aide d'un bain à ultrasons.
Les résultats sont donnés dans les tableaux ci-dessous :
Comme le montre le tableau 1, le polypeptide induit des taux d'anticorps ELIS A significatifs, homogènes et spécifiques contre le polypeptide selon l'invention et la gpl60 MN/LAI-2 (glycoprotéine hybride dans laquelle la sous-unité gpl20 dérive de l'isolât \TH-1 MN et la sous-unité gp41 dérive de l'isolât VEH-l LAI). Ces réponses IgG atteignent quasiment un plateau dès la 2ème injection (tableau 1). La formulation en alginate apparaît 10 fois moins efficace, en termes de taux d'anticorps spécifiques induits, que la formulation en alum.
Tableau 1 - Test cobaye - Réponses anticorps en ELISA
* Moyenne géométrique + déviation standard (logio)
NB : tous les sérums préimmuns testés sont inférieurs au seuil de détection (soit 1.9 logio pour l'ELISA anti-gpl60 et 1.0 logio pour l'ELISA anti-polypeptide).
L'activité neutralisante des sérums post-3° immunisation a ensuite été évaluée dans un 1er temps vis à vis de la souche de laboratoire VIH-1 MN sur des sérums individuels (chez DC Montefiori). Comme le montrent les résultats obtenus, aucune neutralisation de la souche MN n'a été observée
L'activité neutralisante des sérums post-3 a également été évaluée vis à vis de souches de VEH- 1 primaires (laboratoires de C. Moog et de D. Montefiori) (tableau 2). L'analyse a été réalisée sur des sérums individuels. De manière intéressante, contrairement à ce qui a été observé pour la souche MN, les cobayes ont montré des activités neutralisantes significatives contre plusieurs des souches virales testées. Tableau 2 - Test cobaye - Réponses anticorps neutralisantes anti-VTH-1
§ Lab. D. Montefiori : résultats donnés pour les sérums post-3 (valeur arithmétique ou %) α Lab. C. Moog : résultats donnés pour les sérums post-3 (valeur arithmétique)
NT : non testé
NB : tous les sérums préimmuns testés sont inférieurs au seuil de positivité (soit, suivant les méthodes : < 20 pour la souche "VTH-1 MN et < 80% ou < 4 pour les isolats primaires).
Tableau 3 - Test lapin - Réponses anticorps ELIS A
Tableau 4 - Test macaque - Réponses anticorps ELISA
NB : les sérums préimmuns testés s'avèrent sont inférieurs au seuil de positivité (1.0 logio). Les résultats donnés ci-dessus montrent clairement que le polypeptide selon l'invention est capable d'induire des taux d'anticorps ELISA spécifiques significatifs chez toutes les espèces animales testées. Ces réponses IgG ont augmenté faiblement entre la 2eme et la 3eme injection
Ces anticorps qui ont la propriété de neutraliser les isolats primaires font du polypeptide selon l'invention un candidat de valeur pour une immunisation chez l'homme.
Exemple 3 : Détermination de l'immunogénicité humorale du polypeptide selon l'invention administré par voie muqueuse.
Le polypeptide SEQ ID N°4 a été testé chez la souris BALB/c selon le protocole décrit ci- dessous.
S Souris BALB/c : des groupes de 6 à 7 souris ont été administrés par voie intrabuccale ou intragastrique 3 fois, à 2 semaines d'intervalle, et 1 fois 1 mois plus tard, avec 50 μg par dose d'antigène seul ou formulé avec 5 μg de toxine cholérique (CT). La gpl60 MN/LAI-2 a été ajoutée en contrôle formulée avec 5 μg de toxine cholérique (CT). A chaque administration, les animaux ont reçu soit 20 μl, pour la voie intrabuccale, soit 500 μl, pour la voie intragastrique, de la formulation.
Les compositions testées ont été préparées de la façon suivante : pour l'antigène gp 160 : on additionne le volume nécessaire d'une solution de CT à 2mg/ml en H2O, que l'on complète avec du tampon PBS de sorte à avoir les 20 ou 500μl/dose en final. L'antigène SEQ ID N°4, en milieu formate 50mM, pH 2.5, est d'abord dilué en formate 50mM puis additionné d'une solution de CT à 2mg/ml en H2O de sorte à avoir les 20 ou 500μl/dose en final.
Les sérums et les sécrétions vaginales des animaux ont été prélevés pour l'analyse des anticorps avant immunisation, puis 2 semaines après la 4eme immunisation.
Les réponses IgG et IgA induites dans les sécrétions vaginales, spécifiques du polypeptide ont été évaluées par ELISA, et normalisées respectivement par les IgG et IgA totales contenues dans ces prélèvements muqueux. Les réponses anticorps IgG spécifiques du polypeptide induites dans les sérums ont également été évaluées par ELISA. Comme le montre le tableau 5 ci-dessous, le polypeptide selon l'invention a induit des réponses IgG sériques spécifiques après administration par voie gastrique ou buccale. Pour ces 2 voies, les titres anticorps sont environ 10 fois supérieurs lorsque le polypeptide est administré en présence de CT comparativement à l'antigène seul. Toutefois, il est intéressant de noter que, même en absence de CT, une réponse humorale significative est induite par le polypeptide. La voie buccale s'est avérée globalement plus immunogène que la voie gastrique. Contrairement au polypeptide, la gpl60 MNLAI-2 en présence de CT n'a pas ou quasiment pas induit d'anticorps contre les différents antigènes testés (polypeptide, gpl20 MN [produit par Agmed] et V3 MN), et ce, quelle que soit la voie d'immunisation.
Tableau 5 - Test souris - Réponses anticorps ELISA dans les sérums
* Moyenne géométrique + déviation standard (logio) ; NT : non testé NB : tous les sérums préimmuns testés sont inférieurs au seuil de détection (soit 1.9 logio pour l'ELISA anti-gpl20 et 1.0 logio pour les ELISA anti-polypeptide et anti-V3).
Comme le montre le tableau 6 ci-dessous, le polypeptide selon l'invention a suscité des réponses spécifiques IgA et/ou IgG dans les sécrétions muqueuses testées. Au niveau des sécrétions vaginales, le polypeptide administré soit par voie buccale, soit par voie gastrique, a été capable, avec ou sans CT, de susciter des réponses IgA et IgG, les réponses étant cependant plus fréquentes en présence de CT. On peut noter que la gpl60 MN/LAI-2 + CT n'a pas ou très peu suscitée de réponses muqueuses, comme observé au niveau sérique.
Tableau 6 - Test souris - Réponses anticorps ELISA dans les sécrétions muqueuses
* Moyenne des ratios des souris de chaque groupe x 103, le ratio étant défini comme le titre IgG ou IgA anti-polypeptide (en unités arbitraires) divisé par le titre IgG ou IgA totales (en ng/ml), respectivement.
Les exemples ci-dessus montrent que le polypeptide selon l'invention est capable d'induire, chez toutes les espèces animales testées après administration parentérale, des réponses IgG sériques spécifiques significatives vis à vis du polypeptide et de la gpl60 MN/LAI-2. Les anticorps induits ont une activité susceptible de neutraliser plusieurs isolats primaires du VTH. Les exemples ci-dessus montrent également que le polypeptide selon l'invention est capable d'induire après administration par voie muqueuse, des anticorps IgG sériques et IgG et IgA muqueux au niveau des sécrétions vaginales. Exemple 4 : Détermination de l'immunogénicité humorale de vecteurs ADN plasmidiques codant pour un polypeptide selon l'invention administré par voie intramusculaire.
Quatre plasmides différents ont été préparés et testés pour déterminer leur immunogénicité. Ces plasmides sont :
PCA TPA gp41 PK (antigène testé du N- au C-terminal: AA1-AA157- GGRERDRDRSGGGGS)
PCA TPA gp41 SPF PK (antigène testé du N- au C- terminal: AA25-AA157- GGRERDRDRSGGGGS) PCA TPA gp41 (antigène testé du N- au C- terminal: AA1-AA157)
PCA TPA gp41 SPF (antigène testé du N- au C- terminal: AA25-AA157)
avec TPA pour : séquence signal du tPA humain, SPF pour : sans peptide de fusion, PK pour : l'épitope neutralisant Kennedy i.e ERDRD situé dans la portion intracytoplasmique de la gp41 en position 746-750, au sein de la séquence dite 'peptide Kennedy' localisée entre les résidus 731-752 [(Kennedy et al, 1986, Science, 231 : 1556-59 ; (Vella et al, 1993, J General Virology, 74 : 2603-07 ]
Les séquences codant pour les polypeptides testés ont été amplifiées par PCR et clonées dans un dérivé du vecteur d'expression pCAMycHis (Invitrogen). Le vecteur modifié utilisé est obtenu par remplacement du polylinker existant par un "polylinker" différent contenant les sites de restriction Xbal et BamHI dans lesquels est insérée la séquence codant pour l'antigène testé. L'expression du gène clone est sous le contrôle du promoteur CMV. L'ADN est préparé après transformation d'une souche de E coli XL-1 blue. Une culture de 2 litres (milieu LB + Carbénicilline à 100 mg/ml) permet d'obtenir environ 10 mg de plasmide. Après lyse alcaline, le plasmide est purifié sur colonne Qiagen (Gigaprep) selon le protocole indiqué par le fournisseur.
L'immunogénicité des constructions ainsi obtenues est évaluée chez le cobaye selon le protocole suivant : Des groupes de 5 cobayes ont été injectés 4 fois, à 1 mois d'intervalle, dans les cuisses (muscle biceps femoris) avec 200 μg par dose de plasmide. A chaque injection, les animaux ont reçu 1 ml de la formulation (0,5 ml dans chaque cuisse). Les sérums des animaux ont été prélevés pour l'analyse des anticorps avant immunisation, puis 1 mois après la 4eme immunisation.
Les résultats sont donnés dans les tableaux ci-dessous :
Comme le montre le tableau 7, le plasmide PCA TPA gp41 SPF PK s'est avéré le plus immunogène, capable d'induire des taux significatifs d'anticorps spécifiques du polypeptide selon l'invention, reconnaissant également la gpl60 MN/LAI-2. Les réponses humorales induites par les autres constructions testées se sont avérées plus faibles. Ces résultats indiquent que l'absence de peptide de fusion et l'ajout de l'épitope neutralisant du peptide Kennedy semblent jouer tous deux un rôle important dans l'immunogénicité humorale du plasmide.
Tableau 7 - Test cobaye - Réponses anticorps en ELISA
* Moyenne géométrique ± déviation standard (log^)
NB : tous les sérums préimmuns testés sont inférieurs au seuil de détection (soit 1.9 logio pour l'ELISA anti-gpl60 et 1.0 logw pour l'ELISA anti-polypeptide).
Les résultats de neutralisation d'isolats primaires indiqués dans le tableau 8 ci-dessous montrent que le plasmide PCA TPA gp41 SPF PK est le plus performant en terme de neutralisation. Les meilleurs résulats étant obtenus avec les constructions dépourvues du peptide de fusion de gp41. Tableau 8 - Test cobaye - Réponses anticorps neutralisante anti-VTH-1
sa Lab. C. Moog : résultats donnés pour les sérums post-3 (valeur arithmétiques)
NT : Non testé.

Claims

Revendications.
1. Utilisation d'un polypeptide représenté par la formule : N-L-C
Dans la quelle :
N représente la séquence des acides aminés 25-81 de la gp41, C représente la séquence des acides aminés 112-157 de la gp41, et L représente une séquence de liaison flexible comprenant de 2 à 30 acides aminés, pour la préparation d'une composition pharmaceutique pour l'induction d'anticorps neutralisant les isolats primaires du HIV.
2. L'utilisation selon la revendication 1 dans laquelle N représente SEQ ID N°l et C représente SEQ ID N°2.
3. L'utilisation selon la revendication 1 ou 2 dans laquelle le polypeptide a la séquence SEQ ID N03.
4. L'utilisation selon l'une quelconque des revendications précédentes dans laquelle le polypeptide comprend en outre une séquence contenant l'épitope ERDRD à son extrémité
N ou COOH-terminale.
5. L'utilisation selon la revendication 4, dans laquelle le polypeptide a la séquence SEQ ID N°4.
6. Vecteur d'expression comprenant la séquence d'ADN codant pour le polypeptide selon la revendication 4.
EP03752794A 2002-05-17 2003-05-12 Antigene polypeptidique des anticorps neutralisant le vih Withdrawn EP1506224A1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
FR0206062A FR2839721B1 (fr) 2002-05-17 2002-05-17 Antigene polypeptidique induisant des anticorps neutralisant le vih
FR0206062 2002-05-17
PCT/FR2003/001439 WO2003097676A1 (fr) 2002-05-17 2003-05-12 Antigene polypeptidique des anticorps neutralisant le vih

Publications (1)

Publication Number Publication Date
EP1506224A1 true EP1506224A1 (fr) 2005-02-16

Family

ID=29286562

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03752794A Withdrawn EP1506224A1 (fr) 2002-05-17 2003-05-12 Antigene polypeptidique des anticorps neutralisant le vih

Country Status (5)

Country Link
EP (1) EP1506224A1 (fr)
AU (1) AU2003249403A1 (fr)
CA (1) CA2485453A1 (fr)
FR (1) FR2839721B1 (fr)
WO (1) WO2003097676A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2078726A1 (fr) * 2008-01-09 2009-07-15 Vision 7 GmbH Peptides inhibiteurs à entrée HIV à sécrétion pour la thérapie des infections au HIV

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2359892A1 (fr) * 1999-01-08 2000-07-13 Panacos Pharmaceuticals, Inc. Techniques d'elicitation d'anticorps neutralisants ciblant gp41 du vih-1

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO03097676A1 *

Also Published As

Publication number Publication date
FR2839721A1 (fr) 2003-11-21
WO2003097676A1 (fr) 2003-11-27
AU2003249403A1 (en) 2003-12-02
CA2485453A1 (fr) 2003-11-27
FR2839721B1 (fr) 2005-02-11

Similar Documents

Publication Publication Date Title
EP1326635B1 (fr) Composition pharmaceutique pour l&#39;immunisation contre le sida
LV11866B (en) Induction of cytotoxic t-lymphocyte responses
JP3938935B2 (ja) 粘膜免疫応答の誘導方法および組成物
Fernando et al. Peptide polymerisation facilitates incorporation into ISCOMs and increases antigen-specific IgG2a production
US7056519B2 (en) Methods for inducing HIV-neutralizing antibodies
US7063849B1 (en) Use of HIV-1 gp120 and gp160 proteins modified in the v3 loop for the preparation of vaccine compositions and formulations containing the same
CA2169453A1 (fr) Inhibition de l&#39;infection des muqueuses par le vih
CA2704059A1 (fr) Complexes antigene-anticorps en tant que vaccins contre le vih-1
EP0783038B1 (fr) Pseudo-particules virales recombinantes et applications vaccinales et antitumorales
CN102365095A (zh) 分裂gp41
EP1368478B1 (fr) Polypeptide induisant des anticorps neutralisant le vih
EP1506224A1 (fr) Antigene polypeptidique des anticorps neutralisant le vih
CA2057040A1 (fr) Induction d&#39;une protection contre une infection virale par la synergie entre la glycoproteine d&#39;enveloppe du virus et des peptides correspondant a des epitopes de neutralisation de la glycoproteine
Grange et al. Induction of neutralizing antibodies against HTLV-I envelope proteins after combined genetic and protein immunizations in mice
EP1442124B1 (fr) ANTIGENE POLYPEPTIDIQUE FORMANT UNE STRUCTURE MIMANT L&#39;ETAT INTERMEDIAIRE DE gp41
US20080102073A1 (en) Antigen-Antibody Complexes as HIV-1 Vaccines
US8105600B2 (en) Method of inducing high-titer neutralizing antibody responses in a host by administering immune complexes comprising anti-HIV-1 Env antibodies and the HIV-1 Env
EP1087788A1 (fr) Immunisation a ciblage mucosal
WO1999066046A1 (fr) Mimotopes du virus hiv
FR2851165A1 (fr) Antigene derivant de l&#39;helice c de la proteine gp41
FR2830534A1 (fr) Antigene polypeptidique formant une structure mimant l&#39;etat intermediaire de gp41.
WO1992000098A1 (fr) Methodes destinees a provoquer une reponse immunitaire au virus du sida
US6861253B2 (en) Polypeptide inducing antibodies neutralizing HIV
AU751970B2 (en) Mucosal targeting immunisation
FR2819256A1 (fr) Polypeptide induisant des anticorps neutralisant le vih

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20041217

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: SANOFI PASTEUR

DAX Request for extension of the european patent (deleted)
RIN1 Information on inventor provided before grant (corrected)

Inventor name: CHEVALIER, MICHEL

Inventor name: SODOYER, REGIS

Inventor name: KRELL, TINO

Inventor name: EL HABIB, RAPHAELLE

Inventor name: BOUDET, FLORENCE

RIN1 Information on inventor provided before grant (corrected)

Inventor name: CHEVALIER, MICHEL

Inventor name: SODOYER, REGIS

Inventor name: KRELL, TINO

Inventor name: EL HABIB, RAPHAELLE

Inventor name: BOUDET, FLORENCE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20091201