EP1499732A2 - Essential and important genes of pseudomonas aeroginosa and the use thereof to design or identify antibacterial agents - Google Patents

Abstract

The invention includes a database of candidate essential genes in Pseudomonas aeruginosa, as well as otherwise important genes that, when mutated, lead to a growth attenuated phenotype. Such genes and mutants of such genes are important for identifying antibacterial agents suitable for treating and preventing Pseudomonas aeruginosa infections. The invention includes methods for confirming the essentially or importance of candidate genes, as well as methods for utilizing those genes to screen for new antibacterial drugs. The invention also includes the antibacterial agents identified using the disclosed methods, as well as methods of using the same for treating and preventing Pseudomonas infection.

Description

ESSENTIAL AND IMPORTANT GENES OF PSEUDOMONAS AERUGINOSA AND THE USE THEREOF TO DESIGN OR IDENTIFY ANTIBACTERIAL

AGENTS

Cross Reference Related to Related Applications

[0001] This application relates to U.S. Provisional Serial No. 60/372,095, filed on April 15, 2002 and which is incorporated in their entirety by reference herein.

Field of Invention

[0002] The present invention relates to the identification of essential and important genes in Pseudomonas aeruginosa, and the use thereof in screening assays and diagnostic methods to identify, evaluate or design antibacterial agents useful for the treatment of Pseudomonas infections. Such agents are particularly useful in preventing and treating opportunistic infections in immunocompromised individuals and for treating and preventing pulmonary infections in patients having cystic fibrosis disease. Also disclosed is a Bayessian statistical model that may be utilized to increase the statistical confidence that any given gene identified using the disclosed methodology is essential.

Background of Invention

[0003] Pseudomonas aeruginosa is a versatile Gram-negative bacterium that is able to adapt to and thrive in many ecological niches, from water and soil to plant and animal tissues. The bacterium is capable of utilizing a wide range of organic compounds as food sources, thus giving it an exceptional ability to colonize ecological niches where nutrients are limited, such as soil, marshes and coastal marine habitats. Hardalo, C. & Edberg, S. C. Pseudomonas aeruginosa: assessment of risk from drinking water. Crit. Rev. Microbiol. 23, 47-75 (1997). It also forms biofilms on wet surfaces such as those of rocks and soil. Costerton, J. W., Stewart, P. S. & Greenberg, E. P. Bacterial biofilms: a common cause of persistent infections. Science 284, 1318- 1322 (1999). Ahearn, D. G., Borazjani, R. N., Simmons, R. B. & Gabriel, M. M. Primary adhesion of Pseudomonas aeruginosa to inanimate surfaces including biomaterials. Methods Enzymol. 310, 551-557 (1999). Analysis of the P. aeruginosa genome has identified genes involved in locomotion, attachment, transport and utilization of nutrients, antibiotic efflux, and two component and other regulatory systems involved in sensing and responding to environmental changes. Because its natural habitat is the soil, where it exposed to bacilli, actinomycetes and molds, it has developed resistance to a variety of their naturally-occurring antibiotics.

[0004] The emergence of P. aeruginosa as a major opportunistic human pathogen during the past century may be a consequence of its resistance to the antibiotics and disinfectants that eliminate other environmental bacteria. P. aeruginosa is now a significant source of bacteraemia in burn victims, urinary-tract infections in catheterized patients, and hospital-acquired pneumonia in patients on respirators. Bodey, G. P., Bolivar, R., Fainstein, N. & Jadeja, L. Infections caused by Pseudomonas aeruginosa. Rev. Infect. Dis. 5, 279-313 (1983). It is also the predominant cause of morbidity and mortality in cystic fibrosis patients, whose abnormal airway epithelia allow long-term colonization of the lungs by P. aeruginosa. Thus, people with cystic fibrosis, burn victims, individuals with cancer and AIDS, and patients requiring extensive stays in intensive care units are particularly at risk of disease resulting from P. aeruginosa infection. P. aeruginosa is also a cause of a variety of different disorders including septicemia, urinary tract infections, pneumonia and chronic lung infections, endocarditis, dermatitis, osteochondritis, ear and eye infections, bone and joint infections, gastrointestinal infections and skin and soft tissue infections, including wound infections, pyoderma and dermatitis.

[0005] Cystic fibrosis is one of the most common fatal genetic disorders in the United States, affecting about 30,000 individuals. A comparable number of people in Europe also have CF. It is most prevalent in the Caucasian population, occurring in one of every 3,300 live births. The gene involved in cystic fibrosis was identified in 1989 and codes for a protein called the cystic fibrosis transmembrane conductance regulator (CFTR). This protein, normally produced in a number of tissues throughout the body, regulates the movement of salt and water in and out of these cells. One hallmark of CF is the presence of a thick mucus secretion that clogs the bronchial tubes in the lungs and plugs the exit passages from pancreas and intestines, leading to loss of function of these organs and resulting in a predisposition toward chronic bacterial infections. Pseudomonas aeruginosa, having a propensity to live in warm, wet environments, is a particular problem for CF patients, whose lungs typically become colonized (inhabited long-term) by P. aeruginosa before their 10th birthday. Although antibiotics can decrease the frequency and duration of these attacks, resistant bacteria are quick to develop and the bacteria are never completely eradicated from the lung. More effective antibiotics are necessary for improving lung function and quality of life for CF patients for extended time periods.

[0006] Pseudomonas aeruginosa is notorious for its resistance to antibiotics and is, therefore, a particularly dangerous and dreaded pathogen. Todor, K. 2000 Pseudomonas aeruginosa, University of Wisconsin-Madison, http://www.bact.wisc.edu/microtextbook/disease/ pseudomonas.html, available on April 25, 2001. The permeability barrier afforded by its outer membrane LPS also contributes to its natural antibiotic resistance, as do the presence of two antibiotic resistance plasmids, both R-factors and RTFs, which are commonly transferred between cells by the bacterial processes of transduction and conjugation. Only a few antibiotics are effective against Pseudomonas, including tobramyocin (TOBI; Chiron), fluoroquinolone, gentamicin and imipenem, and even these antibiotics are not effective against all strains.

[0007] Pseudomonas aeruginosa disease generally begins with some alteration or circumvention of normal host defenses and may involve several different virulence determinants. Todor, 2000, supra. The ultimate Pseudomonas infection may be seen as composed of three distinct stages: (1) bacterial attachment and colonization; (2) local invasion; (3) disseminated systemic disease. Particular bacterial determinants of virulence mediate each of these stages and are ultimately responsible for the characteristic syndromes that accompany the disease. For instance, Pseudomonas utilize fimbriae or pili to adhere to the epithelial cells, apparently via binding to specific galactose or mannose or sialic acid receptors on epithelial cells. Fimbrial adherence may be an important step in Pseudomonas keratitis and urinary tract infections, as well as infections of the respiratory tract. Mucoid strains, which produce an a exopolysaccharide (alginate) have an additional or alternative adhesin which attaches to the tracheobronchial mucin (N-acetylglucosamine). Therefore, mucoid strains of P. aeruginosa are commonly seen in lung infections.

[0008] The ability of P. aeruginosa to invade tissues depends upon its resistance to phagocytosis and the host immune defenses, and the extracellular enzymes and toxins that break down physical barriers and otherwise contribute to bacterial invasion. Todor, 2000, supra. For instance, Pseudomonas elastase cleaves collagen, IgG, IgA, and complement, and also lyses fibronectin to expose receptors for bacterial attachment on the mucosa of the lung. Alkaline protease interferes with fibrin formation and lyses fibrin. Together, elastase and alkaline protease destroy the ground substance of the cornea and other supporting structures composed of fibrin and elastin. Elastase and alkaline protease together are also reported to cause the inactivation of gamma Interferon (IFN) and Tumor Necrosis Factor (TNF).

[0009] P. aeruginosa produces three other soluble proteins involved in invasion, including a cytotoxin (MW 25,000) and two hemolysins. Todor, 2000, supra. The cytotoxin is a pore-forming protein originally named leukocidin because of its effect on neutrophils, but it appears to be cytotoxic for most eukaryotic cells. Of the two hemolysins, one is a phospholipase and the other is a lecithinase. They appear to act synergistically to break down lipids and lecithin. The cytotoxin and hemolysins contribute to invasion through their cytotoxic effects on eukaryotic cells.

[0010] Pseudomonas aeruginosa also produces two extracellular protein toxins, Exoenzyme S and Exotoxin A. Exoenzyme S may act to impair the function of phagocytic cells in the bloodstream and internal organs to prepare for invasion by P. aeruginosa, and is typically produced by bacteria growing in burned tissue. Exotoxin A is partially identical to diphtheria toxin, and exhibits a necrotizing activity at the site of bacterial colonization and is thereby thought to contribute to the colonization process. Indirect evidence involving the role of exotoxin A in disease is seen in the increased chance of survival in patients with Pseudomonas septicemia that is correlated with the titer of anti-exotoxin A antibodies in the serum.

[0011] While therapeutic measures aimed at any of the above virulence factors may help to slow the progression of an infection and may be useful in combined therapeutic regimens, given the variety of virulence factors of P. aeruginosa, antibacterial agents that inhibit growing bacteria by interacting with essential genes and essential gene products are necessary. Although, this is not to say that genes encoding virulence factors would not be essential to survival in particular niches or environments, emphasizing the importance of screening for gene essentiality in various pathogenic environments. See, e.g., Coulter et al., 1998, Staphylococcus aureus genetic loci impacting growth and survival in multiple infection environments, Mol. Microbiol. 30(2): 393-404. However, as P. aeruginosa becomes more and more resistant to existing antibacterial agents, new compounds are required.

[0012] Indeed, reports of bacterial strains resistant to the most powerful known antibiotics are becoming more common, signaling that new antibiotics are needed for all bacteria, not only P. aeruginosa. For instance, the United States Center for Disease Control recently announced that one of the most powerful known antibiotics, vancomycin, was unable to treat an infection of Staphylococcus aureus (staph), an organism commonly found in the environment and responsible for many nosocomial infections. If this trend continues, some have warned that we could return to a time when a common bacterial infection is a life threatening matter. See Zyskind et al., WO 00/44906, published August 3, 2000.

[0013] Historically, however, the identification of new antibacterial drugs has been painstaking and laborious with no guarantee of success. Traditional methods involve blindly and randomly testing potential drug candidate molecules, with the hopes that one might be effective. Today, the average cost to discover and develop a new drug is nearly $500 million, and the average time is 15 years from laboratory to patient. New identification and screening methods that shorten and improve this process are much needed.

[0014] A newly emerging technique for identifying new antibacterial agents is to first identify gene sequences and proteins required for the proliferation of bacteria, or "essential" genes and proteins, and then conduct a biochemical and structural analysis of that target gene or protein in order to derive compounds that interact with the target. Such methodology employs molecular modeling techniques, combinatorial chemistry and other means to design candidate drugs, and offers a more directed alternative to merely screening random compounds with the hope that one might be suitable for a particular bacterium.

[0015] Nevertheless, even this preferred approach presents obstacles including the identification of essential genes and proteins, and the design of new assays for the genes thus identified in order to efficiently screen candidate compounds. Several groups have proposed systems for the identification of essential genes. For instance, Zyskind and colleagues propose a method of identifying essential genes in Escherichia coli by subcloning a library of E. coli nucleic acid sequences into an inducible expression vector, introducing the vectors into a population of E. coli cells, isolating those vectors that, upon activation and expression, negatively impact the growth of the E. coli cell, and characterizing the nucleic acid sequences and open reading frames contained on the subclones identified. See WO 00/44906, herein incorporated by reference. The disadvantage of this method is that the overexpression of nonessential genes can also negatively impact the cell, particularly the overexpression of membrane proteins and sugar transport proteins that are not necessary for growth where alternative carbon sources exist. Such proteins typically become trapped in membrane export systems when the cell is overloaded, and would be identified by this methodology. See Muller, FEMS Microbiol. Lett. 1999 Jul l;176(l):219-27.

[0016] Another group proposes the identification of growth conditional mutants, and more specifically temperature sensitive (ts) mutants, as a means to identify essential genes in Staphylococcus aureus. See Benton et al., U.S. Patent 6,037,123, issued March 14, 2000, herein incorporated by reference. Each gene is identified by isolating recombinant bacteria derived from growth conditional mutant strains, i.e., following introduction of a vector containing a library of nucleic acid sequences, which would grow under non-permissive conditions but which were not revertants. These recombinant bacteria were found to contain DNA inserts that encoded wild type gene products that replaced the function of the mutated gene under non-permissive growth conditions. By this method, Benton and colleagues were able to identify 38 loci on the S. aureus chromosome, each consisting of at least one essential gene. [0017] The disadvantages of this method are first, the chemical employed to induce mutagenesis (diethyl sulfate, DES) is capable of causing several mutations in the same cell, thereby complicating interpretation of the results. Second, the method is particularly labor intensive in that one must painstakingly analyze replica plates of individual colonies grown at permissive and non-permissive temperatures, where replica plates include both mutant and non-mutant cells. Thus, employing the appropriate level of mutagen to achieve a balance between minimizing the number of non-mutant colonies one must screen in order to identify one mutant, while at the same time avoiding multiple mutations in the same cell, may be an arduous task.

[0018] Another group has proposed a transposon mutagenesis system for identifying essential genes called "GAMBIT" ("genomic analysis and mapping by in vitro transposition"), and has used the system to identify essential genes first in the gram positive bacteria Haemophilus influenzae and Streptococcus pneumoniae, and more recently in Pseudomonas aeruginosa. See Akerley et al., Systematic identification of essential genes by In vitro mariner mutagenesis, Proc. Natl. Acad. Sci USA 95(15): 8927-32; Wong and Mekalanos, 2000, Proc. Natl. Acad. Sci. USA 97(18): 10191-96; and Mekalanos et al., U.S. Patent No. 6,207,384, issued March 27, 2001, herein incorporated by reference. GAMBIT involves first isolating and purifying specific genomic segments of approximately 10 kilobases using extended-length PCR, and creating a high density transposon insertion map of the isolated region using Himarl transposon mutagenesis. The transposon insertions are then transferred to the chromosome following transformation of the bacteria with the transposon containing vectors, and selection for the antibiotic resistance marker on the transposon. The position of each transposon insertion with respect to a given PCR primer is then determined by genetic footprinting, i.e., by amplifying sub-PCR products using one of the original PCR primers and a primer that recognizes an internal site in the Himarl transposon. By analyzing the length of PCR fragments thus identified, it is possible to identify regions that are devoid of transposon insertions, thereby signaling regions that might contain essential genes.

[0019] While the GAMBIT method is a good technique for looking at a small region of the genome for essential genes, it would be extremely labor intensive to use this method for analyzing the entire genome. This is particularly true for P. aeruginosa, whose genome (~6 megabases) is about 70% greater in size than the H. influenzae genome (-1.8 megabases). Furthermore, GAMBIT would not be readily applicable to use in organisms that are less recombinogenic than H. influenzae. Indeed, while the H. influenzae genome contains about 1700 protein coding genes, P. aeruginosa contains about 5570. According to U.S. Patent 6,207,384, one would need to clone and mutagenize the 6 million base pair genome of P. aeruginosa in 10,000 base pair fragments, isolating and characterizing 400-800 mutants per 10,000 base pair fragment. Generating 6 X IO⁵ mutants and characterizing them via PCR on gels would require a significant investment of labor, materials and time.

[0020] Another group at Abbott Laboratories has proposed a genome scanning method for identification of putative essential genes in H. influenzae, whereby random transposon insertions are mapped and analyzed to identify open reading frames containing no insertion in order to identify putative essential genes. Reich et al., 1999, Genome Scanning in Haemophilus influenzae for Identification of Essential Genes, J. Bacteriol. 181(16): 4961-68. However, even though transposon insertions were isolated that spanned the whole genome, the authors employed a genomic footprinting technique similar to that used in GAMBIT to map insertions in a short contiguous region of the chromosome. The method further employs the methods of mutation exclusion and zero time analysis in order to monitor the fate of individual insertions after transformation in growing culture, which looks at individual insertions on a case- by-case basis. Again, such techniques would be extremely labor-intensive for the P. aeruginosa genome, which is 70% larger than the genome of H. influenzae.

[0021] Wong and Mekalanos also proposed identifying essential genes in P. aeruginosa by starting with the knowledge of three essential genes in H. influenzae and using genetic footprint analysis to determine if the homologues of these genes are essential in P. aeruginosa. Of three homologues tested, only one was unable to accommodate a transposon insertion. See Wong and Mekalanos, supra. Such results underscore the fact that a gene that is shown to be essential in one species will not necessarily be essential in another, given that some gene products may fulfill different functional roles in different species. Furthermore, given the larger coding capacity of the P. aeruginosa genome relative to that of other bacteria, it would not be surprising for P. aeruginosa to possess an increase in redundant gene functions, thereby decreasing the actual number of essential genes, and making them more difficult to identify.

[0022] Another method is entitled Transposon Mediated Differential Hybridisation (TMDH), which is disclosed in WO 01/07651, herein incorporated by reference. This method entails (i) providing a library of transposon mutants of the target organism; (ii) isolating polynucleotide sequences from the library which flank inserted transposons; (iii) hybridising said polynucleotide sequences with a polynucleotide library from said organism; and (iv) identifying a polynucleotide in the polynucleotide library to which said polynucleotide sequences do not hybridise in order to identify an essential gene of the organism. However, the problem with this methodology is that it has a high propensity to lead to false positives, and many essential genes will be missed. Furthermore, the method does not yield any detailed information regarding the loci disrupted by transposons, or whether they were hit more than once.

[0023] Thus, there is a great need for more efficient methods to identify essential genes, particularly in P. aeruginosa, so that new antibacterial agents may be designed therefrom for use in treatment of P. aeruginosa infections.

Summary of Invention

[0024] The present inventors have devised a database of potential essential or otherwise important genes in P. aeruginosa, which may be used to verify essentiality and design antibacterial agents active against the targets thus identified. In particular, the inventors have isolated and mapped a library of at least about 5,000 to at least about 14,000 transposon insertions in the genome of P. aeruginosa, and more preferably a library of at least about 8000 to at least about 14,000 transposon insertions, and even more preferably a library of at least about 10,000 to at least about 14,000 transposon insertions, using the recently published P. aeruginosa gene sequence. The map thus generated was used to form a database of approximately 1500 to 3000 open reading frames, or more preferably about 1500 to 2000 open reading frames, for which no transposon insertions could be obtained, each of which possibly represents an essential gene required for growth and proliferation of P. aeruginosa on rich media, or an important gene, the mutation of which results in an attenuated growth mutant. Also disclosed is a Bayessian statistical model that may be utilized to increase the statistical confidence that any given gene identified using the disclosed methodology is essential.

[0025] Thus, one aspect of the invention is a database of putative essential or otherwise important genes, defined by the absence of transposon insertions in those genes in a High Throughput Transposon Insertion Map (HTTIM) database comprising about 10,000 to about 14,000 transposon insertions in the genome of Pseudomonas aeruginosa. Minimally, such a database comprises approximately 1800 open reading frames (ORFs), each of which may be further tested for essentiality using a variety of tests disclosed herein. However, predictions of essentiality or importance may be bolstered based on length of the ORF and predicted function and other statistical factors, thereby providing for more narrow databases of putative essential genes. Thus, the invention also includes databases that are more narrow and comprise only those genes for which essentiality or importance may be predicted with at least an 80% confidence level, and include at least about 850 to about 875 genes. The invention also includes databases assigned a confidence level of about 85% and including at least about 675 to about 700 genes. The invention further includes databases assigned a confidence level of about 90% including at least about 475 to about 500 genes. Further, the invention includes databases assigned a confidence level of about 95% and including at least about 200 to 250 genes.

[0026] The transposon insertion map and database of putative essential or otherwise important open reading frames (ORFs) obtained may be used to confirm the essentiality or importance of genes, for example by integration knock outs in the presence of chromosomal complementation or by integration and activation of a regulatable promoter. An "essential" gene is one that cannot be "knocked out," i.e. for which null mutants having complete absence of the gene product are not viable. This does not mean, however, that such genes could not tolerate point mutations or truncations that preserve sufficient gene product function so as to enable cell growth and survival. Essential genes are to be distinguished from "important" genes, which are also included in the present invention, in that a "knock out" of an important gene does not lead to cell death but rather results in an attenuated growth mutant. Such genes may be included in the database of open reading frames not hit by random transposon mutagenesis as described herein, because attenuated growth colonies may be significantly smaller than the average P. aeruginosa colony and may have been overlooked when transposon insertion mutants were picked to generate the high throughput transposon insertion database (HTTIM).

[0027] Nevertheless, important gene products may interact with or regulate other genes, gene products or cellular processes that are essential, thereby making such gene products appropriate targets for drug design. Moreover, most drugs don't effectively kill all the pathogenic bacteria in the body; rather, they kill or growth attenuate a portion of the bacteria, empowering the immune system to target the remainder. Hence, important genes that, when targeted with an antibacterial agent, result in attenuated growth, are also targets for the antibacterial drugs of the present invention.

[0028] The invention also includes a database of attenuated growth mutants identified from the HTTIM transposon database. The genes marked by such mutations are of the same class of importance as the "important" genes identified in the no-hit database of genes, except that the growth attenuated nature of such transposon mutants was discovered at the transposon mutagenesis stage, rather than at the stage where essentiality is tested via targeted knock out. Thus, genes that when mutated confer attenuated growth may be identified from two sources: (1) from the library of open reading frames that did not receive a transposon insertion during HTTIM but were subsequently identified as an important gene when essentiality was tested via knock out and/or promoter swap strategies, and (2) from the HTTIM database itself when in the process of accumulating transposon insertion mutants it was observed that a particular insertion conferred an attenuated growth phenotype.

[0029] Such attenuated mutants grow more slowly than wild type, and may grow more slowly due to reduced expression of an essential gene, i.e., transposon is in gene that regulates expression of an essential gene, or due to expression of a truncated form of an essential gene, i.e., transposon is in the essential gene itself and leads to expression of a truncated mRNA. For example, mutants that show a higher drug susceptibility could be the result of insertions in a gene that potentiates resistance, such an efflux pump, or due to reduced expression of essential genes involved in the mechanism of action of the drug. Expression of mutated forms of essential and important genes may make the cell more susceptible to compounds that inhibit that particular gene or gene product, and may allow the identification of antibacterial agents with greater sensitivity. Furthermore, screening in whole cells overcomes the potential problems of uptake and efflux that are sometimes an issue for compounds identified via enzyme-based assays.

[0030] The essential and important genes of the invention may be used to design, screen for and evaluate potential antibacterial agents for the purpose of developing new treatments for P. aeruginosa infection. Antibacterial agents identified according to the invention may have activity against the gene or against the corresponding gene product or metabolic pathways requiring the gene product. For instance, antibacterial agents according to the invention may include antisense nucleic acids or regulatory proteins that bind to open reading frames, to upstream polar sequences or to promoters that drive expression of the genes encoded by such open reading frames. Active agents according to the invention may also include antibodies or proteins that bind to proteins encoded by open reading frames, or to transcriptional or translational regulators of such genes or proteins, or to binding partners of such proteins. Agents may also be chemical compounds designed following molecular modeling of essential gene products according to the invention, or mutant proteins designed therefrom that compete with the essential wild type protein for reactive cell components or for interacting nutrients, as well as agents from random chemical.

[0031] The present invention therefore includes methods and assays for identifying antibacterial agents having specificity for the essential or important open reading frames identified, or to genes and proteins that interact with such open reading frames or the products encoded thereby. Once essential and important open reading frames are identified, antibacterial agents may be identified using the assays and methods described herein, or by any suitable assay. Such assays may vary depending on the function delineated for each essential locus, as would be apparent to those of skill in the art. For instance, enzyme assays may be designed based on the predicted function of essential and important genes in order to define classes of inhibitors to be tested. Also, random chemical libraries may be screened for activity against the isolated genes or gene products. Cell lines may be designed or isolated that demonstrate reduced expression of essential genes, thereby providing a sensitive screening tool for inhibitors that effect the activity of that gene or gene product as it functions in the cell. Such cell lines may be devised from cells having transposon insertions that lead to attenuated growth, or may be constructed by the promoter swap techniques described herein, by using a regulatable promoter that can be used to increase gene expression, allowing for confirmation of target specificity. Here, the minimal inhibitory concentration of the inhibitor is directly related to the expression level of the target gene, such that under low expression, an attenuated growth cell is more susceptible to an inhibitor than the wild type strain, and as you raise the expression level, the minimum inhibitory concentration (MIC) increases. The MIC shift will be consistent when the inhibitor acts on the regulated target.

[0032] Active agents and compounds can be formulated into pharmaceutical compounds and compositions, effective for treating and preventing Pseudomonas infections in accordance with the methods of the invention. Such therapy will be particularly useful in the hospital setting for preventing and treating nosocomial infections, and for administering to cystic fibrosis patients to improve lung function and quality of life. Depending on the activity of the essential or important gene targeted, such agents could also be useful in treating all types of Pseudomonas infections ranging from bacteraemia and septicemia, urinary-tract infections, pneumonia and chronic lung infections, burn infections, cancer, AIDS, endocarditis, dermatitis, osteochondritis, ear and eye infections, bone and joint infections, gastrointestinal infections and skin and soft tissue infections, including wound infections, pyoderma and dermatitis. Further, the invention provides pharmaceutical compositions appropriate for use in methods of treating bacterial infections described above. Brief Description of the Drawings

[0033] Figure 1. Depiction of a single crossover recombination event resulting in integration of a plasmid into the bacterial chromosome. Isolation of such recombinants indicates that the targeted gene is not essential.

[0034] Figure 2. Single crossover and integration of a plasmid resulting in the replacement of a wild type promoter with a regulatable promoter.

[0035] Figure 3. Depiction of the 'promoter swap' strategy, using transformation of pBEMlO into P. aeruginosa in order to replace the IpxC promoter with the arabinose rαBAD promoter, thereby allowing modulation of its IpxC expression by the use of a simple sugar, arabinose.

[0036] Figure 4. Graph showing the susceptibility or non-susceptibility of various E. coli and P. aeruginosa strains to the inhibitor LI 61,240.

[0037] Figure 5. Graph depicting the effect of tetracycline and LI 61,240 on the growth of P. aeruginosa strain PA01 with and without polymixin permeabilization.

[0038] Figure 6. Sensitivity of various E. coli and P. aeruginosa strains to inhibitor LI 61, 240 following promoter swap and transformation with vector expressing E. coli IpxC or P. aeruginosa IpxC. E. coli "swaps" refer to P. aeruginosa containing a vector comprising E. coli IpxC, and "PA swaps" refer to P. aeruginosa containing a vector comprising P. aeruginosa IpxC.

[0039] Figure 7. Graph illustrating ORF coverage by Tn5 achieved in High- Throughput Transposon Insertion Mapping (HTTIM), wherein 30% of the genes in the genome are candidate essential genes where ORF size is not taken into account in predicting essentiality.

[0040] Figure 8. Graph depicting the probability of identifying an essential gene given no transposon insertion, as a function of gene size.

[0041] Figure 9. A circular map of the P. aeruginosa genome showing distribution of transposon insertion sites constituting a HTTIM of the invention, and demonstrating the random nature of the transposon employed. The length of the bars radiating outward from the center of the circular map reflect the number of transposon insertions per non- overlapping kilobase.

[0042] Figure 10. Histogram depicting the number of ORFs in the P. aeruginosa genome of (a) up to 4000 base pairs and (b) from 4000 up to 16884 base pairs.

[0043] Figure 11. Graph showing likelihood and accumulative likelihood gains.

[0044] Figure 12. Trajectory of the algorithm projected in a subspace spanned by two gene sizes. The x-axis represents genes of sizes 151-160 DNA base-pairs and y-axis represents genes of sizes 171- 180 DNA base-pairs. Here n=(2,l) and M=(7,9). The median gene size of each group is used as the gene size. At iteration number 66, the likelihood gain is maximum in the direction of increasing the number of nonessential genes by one for genes with size 171-180 DNA base-pairs. At iteration number 443, the largest likelihood gain is obtained in the direction of increasing one nonessential genes for genes of sizes 151-160 DNA base pair. At any point, moving backwards has a negative likelihood gain.

[0045] Figure 13. More trajectories of the searching algorithm projected in different subspaces.

[0046] Figure 14. Plot of likelihood for different initial values.

[0047] Figure 15. Trajectories of the algorithm with different starting values projected in the subspace spanned by two gene sizes: 1101-1150 DNA base-pairs for X-axis and 921-930 DNA base-pairs for y-axis.

[0048] Figure 16. Top: (A) The top line is M , number of genes, the bottom line is 5 , the number of genes with at least one observed insertion; the line in the middle is N , the number of estimated nonessential genes. For demonstration purpose, a cubic spline smooth is applied to the data. Bottom: Histogram of resamples of γ (B) and λ (C).

[0049] Figure 17. Plot of NJM, . The doted line is the value of N M,. and the solid line is a moving average smooth. [0050] The essential and important open reading frames identified in the present invention were originally part of a library of putative nucleic acid sequences generated from P. aeruginosa strains PA01 and PAK. See Table 1. Nevertheless, it is expected that the genes identified will also be essential or important in related P. aeruginosa strains as well as other Pseudomonas species, given the low sequence diversity that exists between P. aeruginosa strains of widely diverse environments and the pronounced structural and functional homology of gene products. See, e.g., Spangenberg et al., 1998, Structural and functional implications of sequence diversity of Pseudomonas aeruginosa genes oriT, ampC dfliC, Electrophoresis 19(4): 545-50; Ruimy et al., 2001, Genetic diversity of Pseudomonas aeruginosa strains isolated from ventilated patients with nosocomial pneumonia, cancer patients, bacteremia, and environmental water, Infect. Immun. 69(1): 584-8. For instance, comparative sequencing of several P. aeruginosa genes from several environmental and clinical isolates revealed the sequence diversity to be about one order of magnitude lower than in comparable housekeeping genes from Salmonella. See Kiewitz and Tummler, 2000, Sequence diversity of Pseudomonas aeruginosa: impact on population structure and genome evolution, J. Bacteriol. 182(11): 3125-35. Thus, it is expected that agents identified as antibacterial based on their interaction with genes or gene products of P. aeruginosa PA01 or PAK will be broadly applicable as antibacterial agents against a variety of Pseudomonas species as well as other bacteria including but not limited to Escherichia, Hemophilus, Vibrio, Borrelia, Enterococcus, Heliobacter, Legionella, Mycobacterium, Mycoplasma, Neisseria, Staphylococcus, Streptococcus, etc.

[0051] Thus, the present invention encompasses an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide having at least 80% sequence identity to a polypeptide encoded by a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1. More preferably, the present invention encompasses an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide having at least about 85 to 90% sequence identity to a polypeptide encoded by a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1. Even more preferably, the present invention encompasses an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide having at least about 90 to about 95% sequence identity to a polypeptide encoded by a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1.

[0052] In particular, the invention encompasses isolated nucleic acid molecules comprising nucleic acid sequences encoding polypeptides having at least 80% sequence identity, or more preferably at least about 85 to 90 to 95% identity, to a polypeptide encoded by an essential or important nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1, wherein essentiality or importance of said nucleic acid sequence is determined by integration knock-out coupled with extra-chromosomal complementation. Likewise, the invention encompasses isolated nucleic acid molecules comprising nucleic acid sequences encoding polypeptides having at least 80% sequence identity, or more preferably at least about 85 to 90 to 95% identity, to a polypeptide encoded by an essential nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1, wherein essentiality or importance of said nucleic acid sequence is determined by integration of a regulatable promoter into the gene, or via any other suitable method.

[0053] In one embodiment, the polynucleotides of the invention are recombinant. Recombinant polynucleotides of the invention include proteins of genomic, cDNA, semisynthetic, or synthetic origin, which, by virtue of its origin or manipulation (1) is not associated with all or a portion of a polynucleotide with which it is associated in nature; (2) is linked to a polynucleotide other than that to which it is linked in nature; or (3) does not occur in nature.

[0054] Given that the library of nucleic acid sequences encompassed in Table 1 provides an unprecedented tool useful for the identification of essential and otherwise important genes in Pseudomonas and the construction and isolation of attentuated mutants, the present invention includes a library of nucleic acid sequences consisting essentially of nucleic acid sequences having at least 70% sequence identity, or more preferably at least about 80 to 90 to 95% identity, to a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1, wherein said library of nucleic acid sequences is employed to identify essential or otherwise important genes or to construct or isolate attenuated mutants in Pseudomonas.

[0055] Also encompassed in the invention is a map of at least about 10,000 to about 14,000 transposon insertions in the genome of Pseudomonas aeruginosa (High- Throughput Transposon Insertion Database or HTTIM), wherein said map is useful for identifying genes that are essential or important for survival of said Pseudomonas aeruginosa, i.e., by permitting the generation of a database of open reading frames that do not contain a transposon insertion. Figure 9 contains a circular map of the P. aeruginosa genome depicting 12,000 to 13,000 transposon insertion sites constituting a HTTIM of the invention, and demonstrates the random nature of the transposon employed. The length of the bars radiating outward from the center of the circular map reflect the number of transposon insertions per non-overlapping kilobase. Table 3 contains a list of 13,515 specific Tn5 transposon insertion sites generated in either PAK or PA01, with the 473 mutants 12516-13043 being identified as attenuated for growth.

[0056] Thus, the databases and libraries disclosed herein may be used to formulate useful subsets of these libraries and databases. Accordingly, the invention includes subsets of the databases and libraries disclosed. For instance, mutants 12516-13043 are identified as attenuated for growth and as such, the genes in this subset could be useful drug targets. Accordingly, this group of 473 mutants from the HTTIM database of 13,515 transposon hits provides a useful subset database for comparing homologies with essential genes of other organisms, for computer modeling of potential antibacterial agents, etc. A particularly useful database subset is one containing essential genes from P. aeruginosa that are also identified as essential in other Gram negative or Gram positive bacteria. Indeed, genes that have essential homologs in other bugs are likely to provide useful targets for broad spectrum antibacterial agents, i.e., agents that have broad spectrum activity as an antibacterial agent. Genes in the putative essential or important gene database have already been identified via BLAST or other database analyses, and constitute an exemplary subset database of the present invention. See Table 4.

[0057] Further, the databases and subset databases of the present invention may also be used as comparative tools with other like databases or database subsets to identify broad spectrum. For instance, particularly envisioned is an embodiment wherein the database of putative essential and important genes identified in P. aeruginosa is cross- referenced with a similar database formed from S. aureus, wherein homologues present in both databases signal a potential target for a broad spectrum antibacterial agent. Cross-referencing between P. aeruginosa and S. aureus in particular will identify antibacterial targets for identifying broad spectrum antibiotics active against both Gram negative and Gram positive bacteria. However, databases derived from any bacteria could be employed in such comparisons, as well as databases formed from yeast, fungi, mycoplasma, and other potential pathogens.

[0058] Also encompassed in the invention is the use of essential and important genes and the corresponding proteins expressed thereto in the design of vaccines for eliciting prophylactic or therapeutic immune responses against Pseudomonas aeruginosa.

[0059] Such vaccines will typically comprise a Pseudomonas aeruginosa protein antigen or fragment or variant thereof encoded by an essential gene. Additionally, such antigens will preferably be a protein expressed on the surface of the bacteria.

[0060] Such vaccines will typically comprise a Pseudomonas aeruginosa protein antigen or fragment or derivative thereof encoded by an essential or important gene. Preferably, the protein antigen expressed from a recombinant polynucleotide.

[0061] Where the invention is directed to a fragment of a protein encoded by an essential or important gene, said fragment is preferably at least 8 to 12 amino acids long, and even more preferably at least about 20 to 30 amino acids long. Preferably, the fragment comprises either a B cell or a T cell epitope.

[0062] Where the invention is directed to a derivative of a protein encoded by an essential or important gene, said derivative contains one or more amino acid substitutions, additions or deletions. Preferably, the amino acid substitutions are conservative amino acid replacements. Conservative amino acid replacements are those that take place within a family of amino acids that are related in their side chains. Genetically encoded amino acids are generally divided into four families: (1) acidic = aspartate, glutamate; (2) basic = lysine, arginine, histidine; (3) non-polar = alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar = glycine, asparagine, glutamine, cystine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids. For example, it is reasonably predictable that an isolated replacement of a leucine with an isoleucine or valine, an asparate with glutamate, a threonine with a serine, or a similar conservative replacement of an amino acid with a structurally related amino acid will not have a major effect on the biological activity. Polypeptide molecules having substantially the same amino acid sequence as the protein by possessing minor amino acid substitutions that do not substantially affect the functional aspects are encompassed with the scope of derivatives of the proteins of the invention.

[0063] The polypeptide fragment or derivative is preferably immunologically identifiable with the polypeptide encoded by the essential or important gene. The polypeptide fragment or derivative is preferably immunogenic and is able to cause a humoral and/or cellular immune response, either alone or when linked to a carrier, in the presence or absence of an adjuvant. The polypeptide fragment or derivative may be fused to or incorporated into another polypeptide sequence. This other polypeptide sequence may include one or more other proteins, fragments or derivatives thereof encoded by an essential or important gene. The other polypeptide sequence may also include a polypeptide sequence which allows for presentation of the polypeptide fragment or derivative.

[0064] Accordingly, the present invention encompasses an isolated polypeptide and fragments and derivatives thereof, wherein said polypeptide has at least 80% sequence identity to a polypeptide encoded by a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1. More preferably, the present invention encompasses an isolated polypeptide and fragments and derivatives thereof, wherein said polypeptide has at least about 85 to 90% sequence identity to a polypeptide encoded by a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1. Even more preferably, the present invention encompasses an isolated polypeptide and fragments and derivatives thereof, wherein said polypeptide has at least about 90% to about 95% sequence identity to a polypeptide encoded by a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1.

[0065] In particular, the invention encompasses isolated polypeptides and fragments and derivatives thereof, wherein said polypeptides have at least 80% sequence identity, or more preferably at least about 85 to 90 to 95% identity, to a polypeptide encoded by an essential or important nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1, wherein the essentiality or importance of said nucleic acid sequence is determined by integration knock-out couple with extra-chromosomal complementation. Likewise, the invention encompasses isolated polypeptides and fragments and derivatives thereof, wherein said polypeptides have at least 80% sequence identify, or more preferably at least about 85 to 90 to 95% identity, to a polypeptide encoded by an essential nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1, wherein essentiality or importance of said nucleic acid sequence is determined by integration of a regulatable promoter into the gene, or via any other suitable method.

[0066] Also encompassed in the invention are therapeutic and prophylactic vaccines that comprise ligands that specifically bind antigens encoded by essential or important genes identified according to the invention, for use in, for instance, passive immunization. Preferred ligands are antibodies and antibody fragments that specifically bind the antigen encoded by the essential gene. Such antibodies may be polyclonal or monoclonal. Types of antibodies and antibody fragments include by way of examples murine antibodies, chimeric, antibodies, humanized antibodies, Fab fragments, Fab₂ fragments and human antibodies and scFv's. Methods for producing antibodies and antibody fragments by recombinant and non-recombinant methods are well known to those skilled in the art. In some embodiments the antigen used in such passive immunization may be attached to a cytotoxic moiety, e.g., a radionuclide or other agent that is cytotoxic against the bacteria.

[0067] Further encompassed within the scope of the invention are cells or viral vectors that express on their surface a Pseudomonas aeruginosa essential gene, fragment or variant identified according to the invention.

[0068] In the case of prophylactic vaccines, the vaccine will comprise an immunogenic composition comprising a prophylactically effective amount of an antigen, antibody, cells or vector expressing an antigen encoded by an essential or important gene and will be formulated such that upon administration it elicits a protective immune response. In the case of therapeutic vaccines, the vaccine will comprise an immunogenic composition comprising a therapeutically effective amount of an antigen, antibody, cells or vectors expressing an antigen encoded by an essential or important gene and will be formulated such that upon administration it elicits a therapeutic immune response. Dosage effective amounts of prophylactic and therapeutic vaccines will be determined by known methods and will typically vary from about 0.00001 g/kg body weight to about 5-10 g/kg body weight.

[0069] The immunogenic compositions of the invention can be administered by known methods, i.e., mucosally or parenterally.

[0070] Suitable routes of mucosal administration include oral, intranasal (IN), intragastric, pulmonary, intestinal, rectal, ocular, and vaginal routes. Preferably, mucosal administration is oral or intranasal.

[0071] Where mucosal administration is used, the immunogenic composition is preferably adapted for mucosal administration. For instance, where the composition is administered orally, it may be in the form of tablets or capsules (optionally enteric- coated), liquid, transgenic plants, etc. Where the composition is administered intranasally, it may be in the form of a nasal spray, nasal drops, gel or powder. Where the antigen composition is adapted for mucosal administration, it may further be formulated such that the antigen remains stable, for instance by the use of carriers and excipients. [0072] The immunogenic compositions of the invention can further comprise a mucosal adjuvant. Mucosal adjuvants suitable for use in the invention include (a) E.coli heat-labile enterotoxin ("LT"), or detoxified mutants thereof, such as the K63 or R72 mutants; (B) cholera toxin ("CT"), or detoxified mutants thereof; or (C) microparticles (i.e., a particle of ~100nm to ~150μm in diameter, more preferably ~200nm to ~30μm in diameter, and most preferably ~500nm to ~10μm in diameter) formed from materials that are biodegradable and non-toxic (e.g. a poly(α-hydroxy acid), a polyhydroxybutyric acid, a polyorthoester, a polyanhydride, a polycaprolactone etc.); (D) a polyoxyethylene ether or a polyoxyethylene ester (see International patent application WO 99/52549); (E) a polyoxyethylene sorbitan ester surfactant in combination with an octoxynol (see International patent application WO 01/21207) or a polyoxyethylene alkyl ether or ester surfactant in combination with at least one additional non-ionic surfactant such as an octoxynol (see International patent application WO 01/21152); (F) chitosan (e.g. International patent application WO 99/27960) and (G) an immunostimulatory oligonucleotide (e.g. a CpG oligonucleotide) and a saponin (see International patent application WO 00/62800). Other mucosal adjuvants are also available (e.g. see chapter 7 of Vaccine design: the subunit and adjuvant aproach, eds. Powell & Newman, Plenum Press 1995 (ISBN 0-306-44867-X).

[0073] Mutants of LT are preferred mucosal adjuvants, in particular the "K63" and "R72" mutants (e.g. see International patent application WO 98/18928), as these result in an enhanced immune response.

[0073] Microparticles are also preferred mucosal adjuvants. These are preferably derived from a poly(α-hydroxy acid), in particular, from a poly(lactide) ("PLA"), a copolymer of D,L-lactide and glycolide or glycolic acid, such as a poly(D,L-lactide-co- glycolide) ("PLG" or "PLGA"), or a copolymer of D,L-lactide and caprolactone. The microparticles may be derived from any of various polymeric starting materials which have a variety of molecular weights and, in the case of the copolymers such as PLG, a variety of lactide: glycolide ratios, the selection of which will be largely a matter of choice, depending in part on the coadministered antigen. [0074] Antigen may be entrapped within the microparticles, or may be adsorbed to them.

[0075] Entrapment within PLG microparticles is preferred. PLG microparticles are discussed in further detail in Morris et al., (1994), Vaccine, 12:5 - 11, in chapter 13 of Mucosal Vaccines, eds. Kiyono et al., Academic Press 1996 (ISBN 012410587), and in chapters 16 & 18 of Vaccine design: the subunit and adjuvant aproach, eds. Powell & Newman, Plenum Press 1995 (ISBN 0-306-44867-X).

[0076] LT mutants may advantageously be used in combination with microparticle- entrapped antigen, resulting in significantly enhanced immune responses.

[0077] Suitable routes of parenteral administration include intramuscular (IM), subcutaneous, intravenous, intraperitoneal, intradermal, transcutaneous, and transdermal (see e.g., International patent application WO 98/20734) routes, as well as delivery to the interstitial space of a tissue.

[0078] The immunogenic compositions of the invention may be adapted for parenteral administration (e.g., in the form of an injectable, which will typically be sterile and pyrogen-free).

[0079] The immunogenic composition may further comprise a parenteral adjuvant. Parenteral adjuvants suitable for use in the invention include: (A) aluminum compounds (e.g. aluminum hydroxide, aluminum phosphate, aluminum hydroxyphosphate, oxyhydroxide, orthophosphate, sulfate etc. (e.g. see chapters 8 & 9 of Vaccine design: the subunit and adjuvant aproach, eds. Powell & Newman, Plenum Press 1995 (ISBN 0-306-44867-X) (hereinafter "Vaccine design"), or mixtures of different aluminum compounds, with the compounds taking any suitable form (e.g. gel, crystalline, amorphous etc.), and with adsorption being preferred; (B) MF59 (5% Squalene, 0.5% Tween 80, and 0.5% Span 85, formulated into submicron particles using a microfluidizer) (see Chapter 10 of Vaccine design; see also International patent application WO 90/14837); (C) liposomes (see Chapters 13 and 14 of Vaccine design); (D) ISCOMs (see Chapter 23 of Vaccine design); (E) SAP, containing 10% Squalane, 0.4% Tween 80, 5% pluronic-block polymer L121, and thr-MDP, either microfluidized into a submicron emulsion or vortexed to generate a larger particle size emulsion (see Chapter 12 of Vaccine design); (F) Ribi™ adjuvant system (RAS), (Ribi Immunochem) containing 2% Squalene, 0.2% Tween 80, and one or more bacterial cell wall components from the group consisting of monophosphorylipid A (MPL), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL + CWS (Detox™); (G) saponin adjuvants, such as QuilA or QS21 (see Chapter 22 of Vaccine design), also known as Stimulon™; (H) ISCOMs, which may be devoid of additional detergent (International patent application WO 00/07621); (I) complete Freund's adjuvant (CFA) and incomplete Freund's adjuvant (IF A); (J) cytokines, such as interleukins (e.g. IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12, etc.), interferons (e.g. interferon-γ), macrophage colony stimulating factor, tumor necrosis factor, etc. (see Chapters 27 & 28 of Vaccine design); (K) microparticles (see above); (L) monophosphoryl lipid A (MPL) or 3-O- deacylated MPL (3dMPL) (e.g. chapter 21 of Vaccine design); (M) combinations of 3dMPL with, for example, QS21 and/or oil-in- water emulsions (European patent applications 0835318, 0735898 and 0761231); (N) oligonucleotides comprising CpG motifs (see Krieg (2000) Vaccine, 19:618 - 622; Krieg (2001) Curr. Opin. Mol. Ther., 2001, 3:15 - 24; WO 96/02555, WO 98/16247, WO 98/18810, WO 98/40100, WO 98/55495, WO 98/37919 and WO 98/52581, etc.) i.e. containing at least one CG dinucleotide, with 5-methylcytosine optionally being used in place of cytosine; (O) a polyoxyethylene ether or a polyoxyethylene ester (International patent application WO 99/52549); (P) a polyoxyethylene sorbitan ester surfactant in combination with an octoxynol (International patent application WO 01/21207) or a polyoxyethylene alkyl ether or ester surfactant in combination with at least one additional non-ionic surfactant such as an octoxynol (International patent application WO 01/21152); (Q) an immunostimulatory oligonucleotide (e.g. a CpG oligonucleotide) and a saponin (International patent application WO 00/62800); (R) an immunostimulant and a particle of metal salt (International patent application WO 00/23105); (S) a saponin and an oil- in-water emulsion (International patent application WO 99/11241); (T) a saponin (e.g. QS21) + 3dMPL + IL-12 (optionally + a sterol) (International patent application WO 98/57659); and (U) other substances that act as immunostimulating agents to enhance the effectiveness of the composition (e.g. see Chapter 7 of Vaccine design).

[0080] Aluminium compounds and MF59 are preferred adjuvants for parenteral use. [0081] The immunognic compositions of the invention may be administered in a single dose, or as part of an administration regime. The regime may include priming and boosting doses, which may be administered mucosally, parenterally, or various combinations thereof.

[0082] In some instances the vaccines of the invention may comprise several antigens, fragments or variants encoded by essential genes identified according to the invention. Alternatively, the vaccine may further comprise antigens identified by other methods, or specific to other bacteria, e.g., in order to provide multivalent vaccines.

[0083] With respect to libraries according to the invention, a library of polynucleotides or a library of transposon insertion sites is a collection of sequence information, which information is provided in either biochemical form (e.g., as a collection of polynucleotide molecules), or in electronic form (e.g., as a collection of polynucleotide sequences stored in a computer-readable form, as in a computer system and/or as part of a computer program). The sequence information of the polynucleotides can be used in a variety of ways, for instance as a resource for gene discovery, i.e., for identifying and verifying essential and important genes in P. aeruginosa, or for identifying essential or important homologues in other genera or species. A polynucleotide sequence in a library can be a polynucleotide that represents an mRNA, polypeptide, or other gene product encoded by the polynucleotide, and accordingly such a polynucleotide library could be used to formulate corresponding RNA or amino acid libraries according to the sequences of the library members.

[0084] The nucleotide sequence information of the library can be embodied in any suitable form, e.g., electronic or biochemical forms. For example, a library of sequence information embodied in electronic form comprises an accessible computer data file (or, in biochemical form, a collection of nucleic acid molecules) that contains the representative nucleotide sequences of essential and important genes and/or insertion mutants that are differentially expressed (e.g., attenuated growth mutants). Other combinations and comparisons of cells affected by various diseases or stages of disease will be readily apparent to the ordinarily skilled artisan. Biochemical embodiments of the library include a collection of nucleic acids that have the sequences of the genes or transposon insertion sites in the library, where the nucleic acids can correspond to the entire gene in the library or to a fragment thereof, as described in greater detail below.

[0085] The polynucleotide libraries of the subject invention generally comprise sequence information of a plurality of polynucleotide sequences, where at least one of the polynucleotides has a sequence of any of the sequences in Tables 1-3. By plurality is meant at least 2, usually at least 3 and can include up to all of the sequences included in these tables. The length and number of polynucleotides in the library will vary with the nature of the library, e.g., if the library is an oligonucleotide array, a cDNA array, a computer database of the sequence information, etc.

[0086] Where the library is an electronic library, the nucleic acid sequence information can be present in a variety of media. "Media" refers to a manufacture, other than an isolated nucleic acid molecule, that contains the sequence information of the present invention. Such a manufacture provides the genome sequence or a subset thereof in a form that can be examined by means not directly applicable to the sequence as it exists in a nucleic acid. For example, the nucleotide sequence of the present invention, e.g. the nucleic acid sequences of any of the polynucleotides of Tables 1-3, can be recorded on computer readable media, e.g. any medium that can be read and accessed directly by a computer. Such media include, but are not limited to: magnetic storage media, such as a floppy disc, a hard disc storage medium, and a magnetic tape; optical storage media such as CD-ROM; electrical storage media such as RAM and ROM; and hybrids of these categories such as magnetic/optical storage media. One of skill in the art can readily appreciate how any of the presently known computer readable mediums can be used to create a manufacture comprising a recording of the present sequence information. "Recorded" refers to a process for storing information on computer readable medium, using any such methods as known in the art. Any convenient data storage structure can be chosen, based on the means used to access the stored information. A variety of data processor programs and formats can be used for storage, e.g. word processing text file, database format, etc. In addition to the sequence information, electronic versions of the libraries of the invention can be provided in conjunction or connection with other computer-readable information and/or other types of computer-readable files (e.g., searchable files, executable files, etc, including, but not87 limited to, for example, search program software, etc.).

[0087] By providing the nucleotide sequence in computer readable form, the information can be accessed for a variety of purposes. Computer software to access sequence information is publicly available. For example, the gapped BLAST (Altschul et al. Nucleic Acids Res. (1997) 25:3389-3402) and BLAZE (Brutlag et al. Comp. Chem. (1993) 17:203) search algorithms on a Sybase system can be used to identify open reading frames (ORFs) within the genome that contain homology to ORFs from other organisms.

[0088] As used herein, "a computer-based system" refers to the hardware means, software means, and data storage means used to analyze the nucleotide sequence information of the present invention. The minimum hardware of the computer-based systems of the present invention comprises a central processing unit (CPU), input means, output means, and data storage means. A skilled artisan can readily appreciate that any one of the currently available computer-based system are suitable for use in the present invention. The data storage means can comprise any manufacture comprising a recording of the present sequence information as described above, or a memory access means that can access such a manufacture.

[0089] "Search means" refers to one or more programs implemented on the computer-based system, to compare a target sequence or target structural motif, or expression levels of a polynucleotide in a sample, with the stored sequence information. Search means can be used to identify fragments or regions of the genome that match a particular target sequence or target motif. A variety of known algorithms are publicly known and commercially available, e.g. MacPattern (EMBL), BLASTN and BLASTX (NCBI). A "target sequence" can be any polynucleotide or amino acid sequence of six or more contiguous nucleotides or two or more amino acids, preferably from about 10 to 100 amino acids or from about 30 to 300 nucleotides. A variety of comparing means can be used to accomplish comparison of sequence information from a sample (e.g., to analyze target sequences, target motifs, or relative expression levels) with the data storage means. A skilled artisan can readily recognize that any one of the publicly available homology search programs can be used as the search means for the computer based systems of the present invention to accomplish comparison of target sequences and motifs. Computer programs to analyze expression levels in a sample and in controls are also known in the art.

[0090] A "target structural motif," or "target motif," refers to any rationally selected sequence or combination of sequences in which the sequence(s) are chosen based on a three-dimensional configuration that is formed upon the folding of the target motif, or on consensus sequences of regulatory or active sites. There are a variety of target motifs known in the art. Protein target motifs include, but arc not limited to, enzyme active sites and signal sequences. Nucleic acid target motifs include, but are not limited to, hairpin structures, promoter sequences and other expression elements such as binding sites for transcription factors.

[0091] The present invention encompasses the use of the library of essential and important genes to search for polynucleotide and amino acid sequences in common among the essential and important genes. Such identified sequences can be used to design and develop antibacterial agents and vaccines against Pseudomonas aeruginosa.

[0092] A variety of structural formats for the input and output means can be used to input and output the information in the computer-based systems of the present invention. One format for an output means ranks the relative expression levels of different polynucleotides. Such presentation provides a skilled artisan with a ranking of relative expression levels to determine a gene expression profile.

[0093] As discussed above, the "library" as used herein also encompasses biochemical libraries of the polynucleotides of Tables 1-3, e.g., collections of nucleic acids representing the provided polynucleotides. The biochemical libraries can take a variety of forms, e.g., a solution of cD As, a pattern of probe nucleic acids stably associated with a surface of a solid support (i.e., an array) and the like. Of particular interest are nucleic acid arrays in which one or more of the sequences of Tables 1-3 is represented on the array. By "array" is meant a an article of manufacture that has at least a substrate with at least two distinct nucleic acid targets on one of its surfaces, where the number of distinct nucleic acids can be considerably higher, typically being at least 10 nt, usually at least 20 nt and often at least 25 nt. A variety of different array formats have been developed and are known to those of skill in the art. The arrays of the subject invention find use in a variety of applications, including gene expression analysis, drug screening, mutation analysis and the like, as disclosed in the above-listed exemplary patent documents.

[0094] In addition to the above nucleic acid libraries, analogous libraries of polypeptides are also provided, where the polypeptides of the library will represent at least a portion of the polypeptides encoded by a gene corresponding to one or more of the sequences in Tables 1-3.

[0095] "Identity" as it is used in the present invention should be distinguished from "homology" or "homologous." In the context of the coding sequences and genes of this invention, "homologous" refers to genes whose expression results in expression products which have a combination of amino acid sequence similarity (or base sequence similarity for transcript products) and functional equivalence, and are therefore homologous genes. In general such genes also have a high level of DNA sequence similarity (i.e., greater than 80% identity when such sequences are identified among members of the same genus, but lower when these similarities are noted across bacterial genera), but are not identical. Relationships across bacterial genera between homologous genes are more easily identified at the polypeptide (i.e., the gene product) rather than the DNA level. The combination of functional equivalence and sequence similarity means that if one gene is useful, e.g., as a target for an antibacterial agent, or for screening for such agents, then the homologous gene is probably also useful, but may not react in the same manner or to the same degree to the activity of a specific antibacterial agent.

[0096] Nevertheless, the identification of one such gene serves to identify a homologous gene through the same relationships as indicated above, and can serve as a starting point to determine whether the homologous gene is also essential, whether it responds to the same antibacterial agents, etc. Typically, such homologous genes are found in other bacterial species, especially, but not restricted to, closely related species. Due to the DNA sequence similarity, homologous genes are often identified by hybridizing with probes from the initially identified gene under hybridizing conditions that allow stable binding under appropriately stringent conditions. For instance, nucleic acids having sequence similarity are detected by hybridization under low stringency conditions, for example, at 50°C and lOXSSC (0.9 M saline/0.09 M sodium citrate) and remain bound when subjected to washing at 55°C in 1XSSC. Sequence identity can be determined by hybridization under stringent conditions, for example, at 50°C or higher and 0.1XSSC (9 mM saline/0.9 mM sodium citrate). Hybridization methods and conditions are well known in the art, see, e.g., USPN 5,707,829. Nucleic acids that are substantially identical to the provided polynucleotide sequences, e.g. allelic variants, genetically altered versions of the gene, etc., bind to the provided polynucleotide sequences under stringent hybridization conditions. By using probes, particularly labeled probes of DNA sequences, one can isolate homologous or related or substantially identical genes. The equivalent function of the product is then verified using appropriate biological and/or biochemical assays.

[0097] Using such hybridization technique for the identification of homologous genes, it will be possible to screen other species of bacteria, particularly other genera of gram negative pathogenic bacteria although gram positive bacteria may also be screened, to determine if any essential or important gene identified herein has a homologue in that particular genus of bacteria. If so, such gene could be cloned and isolated for essentiality in the particular genus, and further tested for sensitivity or susceptibility to the antibacterial agents and inhibitors identified herein. Specific genera of bacteria particularly appropriate for hybridization screening for the presence of homologues of essential and important genes include Escherichia, Hemophϊlus, Vibrio, Borrelia, Enterococcus, Heliobacter, Legionella, Mycobacterium, Mycoplasma, Neisseria, Staphylococcus, Streptococcus, etc.

[0098] "Identity," on the other hand, is gauged from the starting point of complete homology. Thereafter, identity may be described in terms of percentages according to the number of base changes in the DNA sequence taking into account any gaps. For purposes of the present invention, variants of the invention have a sequence identity greater than at least about 65%, preferably at least about 75%, more preferably at least about 85%, and can be greater than at least about 90% or more as determined by the Smith- Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular). A preferred method of calculating percent identity is the Smith- Waterman algorithm, using the following. Global DNA sequence identity must be greater than 65% as determined by the Smith- Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular) using an affine gap search with the following search parameters: gap open penalty, 12; and gap extension penalty, 1.

[0099] Amino acid sequence variants are also included in the invention. Preferably, naturally or non-naturally occurring protein variants have amino acid sequences which are at least 85%, 90%, or 95% identical to the amino acid sequences identified herein, or to a shorter portion of these sequences. More preferably, the molecules are 98% or 99% identical. Percent sequence identity is determined using the Smith- Waterman homology search algorithm using an affine gap search with a gap open penalty of 12 and a gap extension penalty of 2, BLOSUM matrix of 62. The Smith- Waterman homology search algorithm is taught in Smith and Waterman, Adv. Appl. Math. (1981) 2:482-489.

[0100] Also included in the invention are fragments of the nucleic acid sequences and amino acid sequences identified herein, as well as RNAs and RNA fragments corresponding to the DNA sequences disclosed. Such nucleic acid fragments are at least about 10 nucleotides, more preferably at least about 20 to 25 nucleotides, and more preferably at least about 50 to 100 nucleotides, and can include any fragment or variant of a fragment. Such nucleic acid fragments may be used as probes for identifying similar or substantially identical or identical nucleic acid sequences in other genera, or as tools in constructing nucleic acid vectors for knock out and promoter swap experiments. Such amino acid fragments are at least about four amino acids in length, more preferably at least about 8 to 12 amino acids in length, and more preferably at least about 20 to 30 amino acids in length, and may be used as agonists or antagonists to test binding interactions of the proteins disclosed herein, or alternatively as immunogens to isolate antibodies that recognize and bind to specific epitopes of a target protein. [0101] Once a gene is identified as being essential or important for Pseudomonas growth on rich media or in any specific environment, the invention also encompasses the identification of antibacterial agents that have specific activity against the essential or important genes or their gene products or the biochemical pathways in which they are involved. In this context, the term "biochemical pathway" refers to a connected series of biochemical reactions normally occurring in a cell, or more broadly a cellular event such as cellular division or DNA replication. Typically, the steps in such a biochemical pathway act in a coordinated fashion to produce a specific product or products or to produce some other particular biochemical action. Such a biochemical pathway requires the expression product of a gene if the absence of that expression product either directly or indirectly prevents the completion of one or more steps in that pathway, thereby preventing or significantly reducing the production of one or more normal products or effects of that pathway.

[0102] Thus, an agent specifically inhibits such a biochemical pathway requiring the expression product of a particular gene if the presence of the agent stops or substantially reduces the completion of the series of steps in that pathway. Such an agent, may, but does not necessarily, act directly on the expression product of that particular gene. An "expression product" of a gene means that, in a bacterial cell of interest, the gene is transcribed to form RNA molecules. For those genes that are transcribed into mRNAs, the mRNA is translated to form polypeptides. More generally, in this context, "expressed" means that a gene product is formed at the biological level that would normally have the relevant biological activity (i.e., RNA or polypeptide level).

[0103] Thus, the invention includes a method of screening for an antibacterial agent, comprising determining whether a test compound is active against an essential or important bacterial gene identified by the methods herein. The invention also includes a method of screening for an antibacterial agent, comprising determining whether a test compound is active against a protein encoded by an essential bacterial gene identified herein, or active to inhibit the biochemical pathway that involves said protein. The term "antibacterial agent" refers to both naturally occurring antibiotics produced by microorganisms to suppress the growth of other microorganisms, and agents synthesized or modified in the laboratory which have either bactericidal or bacteriostatic activity. An "active" agent in this context will inhibit the growth of P. aeruginosa and possibly related species. The term "inhibiting the growth" indicates that the rate of increase in the numbers of a population of a particular bacterium is reduced. Thus, the term includes situations in which the bacterial population increases but at a reduced rate, as well as situations where the growth of the population is stopped, as well as situations where the numbers of the bacteria in the population are reduced or the population even eliminated. If an enzyme activity assay is used to screen for inhibitors, one can make modifications in uptake/efflux, solubility, half life, etc. to compounds in order to correlate enzyme inhibition with growth inhibition.

[0104] Assays may include any suitable method and may be expected to vary on the type of essential gene or protein involved. For instance, one embodiment is a method comprising the steps of:

a) contacting said protein or a biologically active fragment thereof with a test compound; and b) determining whether said test compound binds to said essential gene product or protein or fragment of said protein; wherein binding of said test compound to said polypeptide or said fragment is indicative that said test compound is an antibacterial agent. It is quite common in identifying antibacterial agents, to assay for binding of a compound to a particular polypeptide where binding is an indication of a compound which is active to modulate the activity of the polypeptide. Binding may be determined by any means according to the agent tested and techniques known in the art.

[0105] Also, agents that inhibit binding of two proteins or polypeptides may also be identified, for instance using a yeast two-hybrid system. Such a system will entail cloning the genes encoding each protein and expressing each in a reporter cell system such that interaction between the two proteins is monitored by observing the expression of a reporter gene. For instance, cDNAs cloned in a yeast two-hybrid expression system (Chien et al. (1991) Proc. Natl. Acad. Sci. (U.S.A.) 88: 9578; Zervos et al. (1993) Cell 72: 233) can be used to identify other cDNAs encoding proteins that interact with the protein encoded by the first, thereby produce expression of the GAL4- dependent reporter gene. Thereafter, cells expressing both proteins leading to expression of the reporter gene are used to screen for agents that interact with either protein, or the gene encoding either protein. Such systems are well known in the art and are well within the realm of ordinary skill.

[0106] Another embodiment is a method for evaluating a test agent for inhibition of expression of an essential gene identified according to the methods herein, comprising: a) contacting a cell expressing said essential gene with said agent; and b) determining the amount or level of expression of said essential gene in said sample.

[0107] The exact determination method will be expected to vary depending on the characteristics of the expression product as would be readily apparent to one of ordinary skill in the art. Such methods can include, for example, antibody binding methods, enzymatic activity determinations, and substrate analog binding assays. Such level of expression could be monitored by monitoring the level of the product of the essential gene in the cell, i.e., by SDS-PAGE, or by colorimetric assays using, for example, a lacZ gene or protein fusion and detection on media using X-Gal or spectrophotometric detection.

[0108] When such fusions are employed, fusions may be designed using the chromosomal gene so long as the fusion does not disrupt the function of the essential gene, i.e., as with a gene fusion where lacZ is inserted just downstream of the essential gene and is expressed from the same promoter as the essential gene. Alternatively, one could employ an extrachromosomal fusion constmct whereby the wild type chromosomal copy of the gene is not dismpted. In this case, one could employ a protein fusion, i.e., where a portion of lacZ sufficient to be detected with a colorimetric test is fused in frame with the coding region of the essential gene such that a fusion protein is obtained. Other detectable or measurable proteins commonly used in the art may be used as an alternative to lacZ, for instance, phoA, Lux/luciferase, etc.

[0109] Another method of the invention for evaluating an potential antibacterial agent, comprises the steps of: a) providing a bacterial strain comprising a mutant or normal form of the essential or important gene, wherein said mutant form of the gene confers a growth conditional phenotype; b) contacting bacteria of said bacterial strain with a test compound in semi- permissive or permissive growth conditions; and c) determining whether the growth of said bacterial strain comprising said mutant form of a gene is reduced in the presence of said test compound to a greater extent than a comparison bacteria comprising a normal form of said gene.

[0110] In this context, a "mutant form" of a gene is a gene which has been altered, either naturally or artificially, changing the base sequence of the gene, which results in a change in the amino acid sequence of an encoded polypeptide. The change in the base sequence may be of several different types, including changes of one or more bases for different bases, small deletions, and small insertions. Mutations may also include transposon insertions that lead to attenuated activity, i.e., by resulting in expression of a truncated protein. By contrast, a normal form of a gene is a form commonly found in a natural population of a bacterial strain. Commonly a single form of a gene will predominate in natural populations. In general, such a gene is suitable as a normal form of a gene, however, other forms which provide similar functional characteristics may also be used as a normal gene. In particular, a normal form of a gene does not confer a growth conditional phenotype on the bacterial strain having that gene, while a mutant form of a gene suitable for use in these methods does provide such a growth conditional phenotype.

[0111] As used in the present disclosure, the term "growth conditional phenotype" indicates that a bacterial strain having such a phenotype exhibits a significantly greater difference in growth rates in response to a change in one or more of the culture parameters than an otherwise similar strain not having a growth conditional phenotype. Typically, a growth conditional phenotype is described with respect to a single growth culture parameter, such as temperature. Thus, a temperature (or heat-sensitive) mutant (i.e., a bacterial strain having a heat-sensitive phenotype) exhibits significantly reduced growth, and preferably no growth, under non-permissive temperature conditions as compared to growth under permissive conditions. In addition, such mutants preferably also show intermediate growth rates at intermediate, or semi-permissive, temperatures. Similar responses also result from the appropriate growth changes for other types of growth conditional phenotypes. A growth conditional phenotype can also be conferred by cloning an essential or important gene behind a regulatable promoter, for instance, a promoter that is only active, or only leads to transcription, under particular environmental conditions or in response to a specific environmental stimulus. Such growth conditional promoter mutants may be isolated according to the promoter swap strategies described herein.

[0112] "Semi-permissive conditions" are conditions in which the relevant culture parameter for a particular growth conditional phenotype is intermediate between permissive conditions and non-permissive conditions. Consequently, in semi- permissive conditions the bacteria having a growth conditional phenotype will exhibit growth rates intermediate between those shown in permissive conditions and non- permissive conditions. In general, such intermediate growth rate is due to a mutant cellular component which is partially functional under semi-permissive conditions, essentially fully functional under permissive conditions, and is non-functional or has very low function under non-permissive conditions, where the level of function of that component is related to the growth rate of the bacteria.

[0113] The term "method of screening" means that the method is suitable, and is typically used, for testing for a particular property or effect in a large number of compounds. Therefore, the method requires only a small amount of time for each compound tested; typically more than one compound may be tested simultaneously (as in a 96-well microtiter plate, or in a series of replica plates), and preferably significant portions of the procedure can be automated. "Method of screening" also refers to determining a set of different properties or effects of one compound simultaneously.

[0114] Because the essential and important genes identified herein can be readily isolated and the genes cloned into a variety of vectors known in the art, the invention also encompasses vectors comprising the nucleic acid sequences, open reading frames and genes of the invention, as well as host cells containing such vectors. Because the essential genes identified herein can be readily isolated and the encoded gene products expressed by routine methods, the invention also provides the polypeptides encoded by those genes, as well as genes having at least about 50%, or more preferably about 60%, or more preferably about 70%, or more preferably about 80%, or more preferably about 90%, or most preferably about 95% protein sequence identity.

[0115] Thus, by identifying certain essential and/or important genes, this invention provides a method of screening for an antibacterial agent by contacting a polypeptide encoded by one of the identified essential or important genes, or a biologically active fragment of such a polypeptide, with a test compound, and determining whether the test compound binds to the polypeptide or polypeptide fragment. In addition, to simple binding determinations, the invention provides a method for identifying or evaluating an agent active on one of the identified essential genes. The method involves contacting a sample containing an expression product of one of the identified genes with the known or potential agent, and determining the amount or level of activity of the expression product in the sample.

[0116] In particular, antibodies to essential and important gene products are anticipated to be suitable diagnostic binding and antibacterial agents. Thus, antibodies to the proteins encoded by the essential and important genes identified by the methods described herein are also included in the invention. Such antibodies may be isolated according to well known techniques in the art, i.e., Kohler and Milstein for monoclonal antibodies. Also included are polyclonal antibodies and antibody fragments such as Fv, Fab and Fab₂ fragments, as well as chimeric and humanized antibodies, and human antibodies, i.e., made using a Xeno mouse.

[0117] In a further aspect, this invention provides a method of diagnosing the presence of a bacterial strain having one of the genes identified above, by probing with an oligonucleotide at least 15 nucleotides in length, which specifically hybridizes to a nucleotide sequence which is the same as or complementary to the sequence of one of the bacterial genes identified above. In some cases, it is practical to detect the presence of a particular bacterial strain by direct hybridization of a labeled oligonucleotide to the particular gene. In other cases, it is preferable to first amplify the gene or a portion of the gene before hybridizing labeled oligonucleotides to those amplified copies.

[0118] In a related aspect, this invention provides a method of diagnosing the presence of a bacterial strain by specifically detecting the presence of the transcriptional or translational product of the gene. Typically, a transcriptional (RNA) product is detected by hybridizing a labeled RNA or DNA probe to the transcript. Detection of a specific translational (protein) product can be performed by a variety of different tests depending on the specific protein product. Examples would be binding of the product by specific labeled antibodies and, in some cases, detection of a specific reaction involving the protein product. Diagnostic assays find particular use in assaying tissue and fluid samples of patients suspect of having a Pseudomonas infection.

[0119] Antibacterial agents identified according to the methods of the invention may be employed in pharmaceutical compositions. Such compositions may be administered to patients in order to treat an infection by or involving P. aeruginosa, either alone or in combination with secondary agents targeted at, for instance virulence factors of P. aeruginosa, or other bacteria that may be present in addition to P. aeruginosa. In this context, the term "administration" or "administering" refers to a method of giving a dosage of an antibacterial pharmaceutical composition to a mammal, where the method is, e.g., topical, oral, intranasal, inhaled, intravenous, transdermal, intraperitoneal, or intramuscular. The preferred method of administration can vary depending on various factors, e.g., the components of the pharmaceutical composition, the site of the potential or actual bacterial infection, the bacterium involved, and the severity of an actual bacterial infection.

[0120] As used above and throughout this application, "hybridize" has its usual meaning from molecular biology. It refers to the formation of a base-paired interaction between nucleotide polymers. The presence of base pairing implies that at least an appreciable fraction of the nucleotides in each of two nucleotide sequences are complementary to the other according to the usual base pairing rales. The exact fraction of the nucleotides which must be complementary in order to obtain stable hybridization will vary with a number of factors, including nucleotide sequence, salt concentration of the solution, temperature, and pH.

[0121] The term, "DNA molecule", should be understood to refer to a linear polymer of deoxyribonucleotides, as well as to the linear polymer, base-paired with its complementary strand, forming double-strand DNA (dsDNA). The term is used as equivalent to "DNA chain" or "a DNA" or "DNA polymer" or "DNA sequence", so this description of the term meaning applies to those terms also. The term does not necessarily imply that the specified "DNA molecule" is a discrete entity with no bonding with other entities. The specified DNA molecule may have H-bonding interactions with other DNA molecules, as well as a variety of interactions with other molecules, including RNA molecules. In addition, the specified DNA molecule may be covalently linked in a longer DNA chain at one, or both ends. Any such DNA molecule can be identified in a variety of ways, including, by its particular nucleotide sequence, by its ability to base pair under stringent conditions with another DNA or RNA molecule having a specified sequence, or by a method of isolation which includes hybridization under stringent conditions with another DNA or RNA molecule having a specified sequence.

[0122] References to a "portion" of a DNA or RNA chain mean a linear chain which has a nucleotide sequence which is the same as a sequential subset of the sequence of the chain to which the portion refers. Such a subset may contain all of the sequence of the primary chain or may contain only a shorter sequence. The subset will contain at least 15 bases in a single strand. However, by "same" is meant "substantially the same"; deletions, additions, or substitutions of specific nucleotides of the sequence, or a combination of these changes, which affect a small percentage of the full sequence will still leave the sequences substantially the same. Preferably this percentage of change will be less than 20%, more preferably less than 10%, and even more preferably less than 3%. "Same" is therefore distinguished from "identical"; for identical sequences there cannot be any difference in nucleotide sequences.

[0123] As used in reference to nucleotide sequences, "complementary" has its usual meaning from molecular biology. Two nucleotide sequences or strands are complementary if they have sequences that would allow base pairing between the strands according to the usual pairing rales. This does not require that the strands would necessarily base pair at every nucleotide; two sequences can still be complementary with a low level of base mismatch such as that created by deletion, addition, or substitution of one or a few (up to 5 in a linear chain of 25 bases) nucleotides, or a combination of such changes.

[0124] Other embodiments of the invention will be immediately envisaged by those of skill in the art upon reading the methods and examples to follow. Such examples are merely illustrative of the invention, and should not be construed as limiting the scope of the invention in any way.

Methodology

Generation of Transposon Library

[0125] Transposon insertions were generated using an improved transposon system for P. aeruginosa that utilizes a mini-Tn5-type transposon on a delivery vector that does not replicate in Pseudomonas. The delivery vector contains a modified transposase gene with three amino acid substitutions that have been shown to increase the frequency of Tn5 insertions. Weinreich et al., 1994, Evidence that cis preference of the Tn5 transposase is caused by nonproductive multimerization, Genes Dev. 8(19): 2363-74. The Tn5 transposase was placed under control of a lac promoter and the complete transposable element was minimized to 1.7 kilobases in length, including a tetracycline resistance marker and transcription terminator to prevent read-through into the genome. The transposon vector is delivered to P. aeruginosa via conjugation from a suitable E. coli host (e.g. SMltøφir). Following conjugation, transposon mutants are selected by resistance to tetracycline conferred by the trasnposable element.

[0126] Libraries were created in both P. aeruginosa PAK and PA01. The average diversity of the libraries created using this strategy is estimated to be -40,000 to ~50,000 independent mutants per conjugation. Care is taken to minimize passage of each transposon conjugation before plating for mutant selection in an effort to minimize the potential for siblings, i.e., by stopping the conjugation after sufficient time for a single round of conjugation events.

High-Throughput Transposon Insertion Mapping (HTTIM)

[0127] Precise transposon insertion sites were determined by an anchored, semi- random PCR method for amplification of the transposase/genome junction region. O'Toole and Kolter, 1998, Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signaling pathways: a genetic analysis, Mol. Microbiol. 28(3): 449-61. The technique, HTTIM, uses both Tn5 specific and semi-random primers with conserved primer tails. A small aliquot of transposon mutant liquid culture is used as a template and amplification of a fragment containing an insertion site is achieved in a two-step process. The PCR product is then sequenced and the insertion site is entered into an Oracle database for analysis. To date, more than 10,000 to 14,000 insertions have been mapped, each insertion representing the disruption of a gene or intergenic region that is not essential for survival on rich media.

[0128] With every insertion added to the map, the regions of the genome containing essential genes, and particularly those containing operons containing essential genes (because of potential polar effects of insertions in upstream genes), begin to become apparent because these regions will not be able to accommodate transposon insertions. Table 1 shows a listing of the open reading frames identified as existing between transposon insertions, as well as an indication of whether the gene has homologues that have been identified in other bacteria pursuant to BLAST sequence database analysis. Open reading frames were tentatively assigned names prior to being identified pursuant to HTTIM analysis, as disclosed in the Pseudomonas genome project, and reported in Stover et al., Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen, August 21, 2000, Nature 406: 959-964, herein incorporated by reference in its entirety.

[0128] For instance, the predicted ORFs were examined individually for (1) identity with known genes of P. aeruginosa with sequences deposited in GenBank, (2) similarity with well-characterized genes from other bacteria, or (3) presence of known functional motifs (see http://www.pseudomonas.com for complete list). In each case the literature was searched to ensure that the proteins encoded by the homologous genes were functionally characterized to avoid the perpetuation of poorly supported functional assignments. In addition, 61 researchers who were members of the P. aeruginosa research community or had experience in particular aspects of bacterial physiology were enlisted for the Pseudomonas Community Annotation Project (PseudoCAP) to provide expert assistance and confirmatory information in the genome project for the analysis of identified ORFs and assigned functions.

[0129] The genome project was able to assign a functional class to 54.2% of ORFs. As in other bacterial genomes, a large proportion of the genome (45.8% of ORFs) consists of genes for which no function could be determined or proposed (confidence level 4). Of these, nearly a third (769 ORFs) possess homology to genes of unknown function predicted in other bacterial genomes, and the remainder (32% of ORFs) do not have strong homology with any reported sequence. The 372 ORFs from the entire genome analysis that are known P. aeruginosa genes with demonstrated functions (confidence level 1) are primarily genes encoding lipopolysaccharide biosynthetic enzymes, virulence factors, such as exoenzymes and the systems that secrete them, and proteins involved in motility and adhesion. ORFs with strong homology to genes in other organisms with demonstrated functions (confidence level 2; 1,059 ORFs) include those required for DNA replication, protein synthesis, cell-wall biosynthesis and intermediary metabolism.

[0130] The ORFs that provided the most new information about P. aeruginosa biology via the genome annotation were those that could be assigned a probable function on the basis of similarity to established sequence motifs, but could not be assigned a definite name (confidence level 3; 1,590 ORFs). Most of these genes encode products that are in one of three functional classes: putative enzymes (405 genes), transcriptional regulators (341 genes) or transporters of small molecules (408 genes). In some cases genomic context provided additional information, allowing us to identify loci that appear to encode systems such as metabolic pathways and secretion systems, although the substrates for such systems could not be identified. The system for assigning name and putative function to each essential or important gene was gleaned from the Pseudomonas genome project data already available.

Statistical Analysis of Putative Essential and Important Genes

[0131] The open reading frames listed in Table 1 are also presented in Table 2, wherein the ORFs are listed in order of length of base pairs from longest to shortest. Also listed in Table 2 is the probability of essentiality assigned to each of the open reading frames. Probability correlates with length of the ORF, such that the longer the ORF, the higher the probability of hitting the ORF in a random transposon mutagenesis experiment, and the higher the confidence level that the ORF represents an essential or an important gene given that no transposon insertions therein were isolated. Statistical confidence levels in essentiality or importance can help narrow the focus in the screening of specific genes, thereby shortening the verification process and the subsequent identification of antibacterial agents specific for that gene or gene product. Thus, one of the benefits of the HTTIM approach is that it is a quantitative approach that lends itself well to statistical analysis.

[0132] The High-Throughput Transposon Insertion Mapping (HTTIM) strategy utilizes a transposon, which is a small, mobile DNA element that randomly inserts into the chromosome. Although HTTIM was performed using a Tn5 transposon, any transposon may be employed so long as its insertion into the chromosome is random, i.e., devoid of hot spots. Reznikoff, W.S., 1993, The Tn5 transposon, Annu. Rev. Microbiol. 47: 945-63. Although the Tn5 derivative employed here contained a modified transposase gene with three amino acid substitutions that have been shown to increase the frequency of Tn5 insertions (see supra), the frequency of insertion is generally quite low. For instance, mutants with even one insertion occur at a rate of only 1 in 10⁵ or IO⁶ bacteria, and must be specifically selected from a background of cells with no insertions. Because the frequency of a single insertion is so low, the frequency of a double insertion is so low as to be insignificant.

[0133] When the transposon insertion disrupts one of the 5570 genes in the Pseudomonas genome, the function of that gene is lost. If the disrupted gene is essential for growth, the transposon insertion mutant dies and cannot be characterized. If the transposon disrupts a gene that is non-essential, the mutant survives, grows and the transposon insertion site is mapped. By examining the insertion sites of a large number of transposon mutants, all, of the non-essential P. aeruginosa genes can be identified, and by implication, all of the essential genes may be identified as well. Characterization of over 13,000 transposon insertions revealed insertions in 3890 genes and resulted in an even distribution of insertions across the entire length of the genome. The remaining 1658 genes, in which a transposon insertion has never been observed, are candidates of essential genes (30%). See Figure 7, showing a graph illustrating ORF coverage by Tn5 achieved in High-Throughput Transposon Insertion Mapping (HTTIM), wherein 30% of the genes in the genome are candidate essential genes where ORF size is not taken into account in predicting essentiality.

[0134] Because insertion of the transposon used here into the chromosome was proposed to be random, it was possible that some of the 1658 genes that did not receive a transposon insertion were simply not hit by random chance. One cannot truly know that a transposon has no hot spots and is entirely random until the data is analyzed, and the data here confirmed that the Tn5 derivative employed underwent random insertion in P. aeruginosa. Thus, the chance that a gene will not be hit by the transposon as a matter of random chance increases as the length of the gene decreases, particularly for very small genes (< 600 base pairs). See Figure 8, Probability of Being an Essential Gene Given No Hit. Thus, by deleting smaller ORFs (< 600 base pairs) in which there is a lower confidence in essentiality, the probability of essentiality goes up while the number of predicted essential genes decreases. Further, the curve in the graph depicted in Figure 8 should level off faster. Thus, in predicting the essentiality of genes from the HTTIM candidate set, the closer one can come to a probability of 1.0 as depicted in Figure 8, the higher the confidence level of essentiality that can be assigned to each gene in the candidate subset. For a representation of the number of ORFs of various lengths in P. aeruginosa, see the histogram in Figure 9.

[0135] A Bayessian statistical model for truncated counting data was applied to the candidate essential gene set, and permitted a determination that 16 to 17 percent of P. aeruginosa genes are essential. Such a model may therefore be utilized to increase the statistical confidence that a given gene in the candidate subset is essential. An exemplary statistical model is provided in Example 1.

Physical Methods for Target Gene Validation

[0136] While the above methodology and the database of putative essential and important gene candidates established thereby is believed to be superior to existing methods with regard to the quantity of experimentation required to identify essential and important genes in Pseudomonas aeruginosa and the degree of confidence conferred, it should be understood that the methodology described herein can be incorporated into combined protocols with technology known in the art. For instance, the methods for verifying essentiality disclose in WO 01/07651, herein incorporated by reference in its entirety, would be useful as a secondary method to be utilized in combination with the methods described in this disclosure. Alternatively or additionally, one of several approaches may be used to determine whether a particular gene is essential (absolutely required for survival on rich medium) or important (the absence of which results in attenuated growth) to P. aeruginosa.

Integration Knockouts

[0137] This is the simplest and most rapid strategy. PCR is used to amplify a small (200-500 base pairs) portion of the coding sequence, or open reading frame (ORF) of the gene of interest. This gene fragment must be centrally located within the ORF— it cannot include either termini of the gene's coding region. This fragment is cloned into a plasmid vector that can replicate in E. coli, but not in Pseudomonas. The vector used should have a drug resistance marker that is suitable for selection in Pseudomonas, and an origin for conjugal transfer. This feature allows the plasmid to be transferred by conjugation from a suitable E. coli donor strain to a Pseudomonas strain when the two are co-cultured under the appropriate conditions. [0138] Following conjugation the co-cultured mixture is harvested and plated on media which selects against the E. coli donor and for Pseudomonas which contain the plasmid. Since the plasmid is incapable of extra-chromosomal replication in Pseudomonas, colonies that arise are the result of homologous recombination between the Pseudomonas chromosome and the cloned gene fragment on the plasmid. This is referred to as single-crossover recombination; a single recombination event takes place between the plasmid and the chromosome. The result is integration of the plasmid into the bacterial chromosome and disruption of the gene from which the fragment was amplified (Fig. 1).

[0139] Variations of this approach are possible. For instance, one could clone out the entire locus and isolate transposon insertion mutants in E.coli using known techniques, i.e., by transposition from the E. coli genome, selecting plasmid insertions by mobilizing the vector into a recipient cell that does not contain the transposon or the antibiotic resistance marker encoded by the transposon, and screening the plasmid for insertions in the cloned gene. Thereafter, a similar assay could be performed by screening for double crossover events in P. aeruginosa that result in recombination of the transposon into the chromosomal locus from a suicide vector.

[0140] Integration of the plasmid or other insertion at the locus can be confirmed by a relatively rapid PCR-based screen of recombinant colonies. The advantage of this strategy, particularly the plasmid single crossover strategy, is that it requires only amplification of a short stretch of DNA followed by a single cloning step before recombination experiments can be performed. The disadvantage is that if the target gene is essential, no recombinants can be obtained. Failure to obtain recombinants as proof of essentiality is pretty thin evidence. However, if a gene is in fact non-essential, this method will demonstrate that quickly. Integration Knockouts with Extra-chromosomal Complementation

[0141] This variation of the above method provides more convincing data when the target gene is essential. It employs the same type of non-replicating integration plasmid described above, but recombinations are performed in strains already carrying a second copy of the target gene on an extra-chromosomal plasmid. This second copy can then supply the essential function when the chromosomal copy is disrupted. If disruptions can only be obtained when a complementing plasmid is present and not when a control plasmid is present, this is rather strong evidence that the target gene is essential. The advantage of this method is that you obtain colonies even when your gene is essential. The disadvantage is that construction and sequencing of the complementation plasmid takes additional time.

Integration with a Regulatable Promoter (Promoter Swap)

[0142] This approach also involves selecting for chromosomal integration of non- replicating plasmids via homologous recombination. However, the design of the integrating plasmid is different. In this case, the N-terminal coding sequence (300-500 base pairs) of the target gene is PCR amplified and cloned into a vector downstream of a regulatable promoter, i.e., a lac promoter, which is inducible in the presence of IPTG, or an arabinose promoter (pABD), inducible in the presence of arabinose. The activity of the promoter can be modulated by the presence of a specific inducer molecule. The plasmid is conjugated into Pseudomonas and integration selected for under conditions where the regulatable promoter is active. The resulting chromosomal integration replaces the target gene's natural promoter with the regulatable promoter from the plasmid (Fig. 2). If the target gene is essential, recombinants can only survive when the inducer molecule is present in their growth media to stimulate gene expression. If the gene is non-essential, the recombinant's growth is independent of the addition of the inducer. The advantage of this strategy is that it requires only amplification of a short stretch of DNA followed by a single cloning step before recombination experiments can be performed. Examples: Essential Genes Identified

Example 1 : A Bayessian Statistical Model for Increasing Statistical Confidence of Essentiality

[0143] When the Tn5 transposon inserts into the Pseudomonas DNA, one of three things happen: 1) The insertion disrupts a nonessential gene. The cell survives to be characterized and the location of the insertion is determined. 2) The insertion disrupts an essential gene. The cell does not survive and the insertion site is not determined. 3) The insertion is in an intergenic region (between genes) and no information is gained. Genes with identified insertions are nonessential genes. However, genes without identified insertions could be essential genes or nonessential genes with zero transposon insertion. To determine the number of essential genes, we have developed a multivariate Bayession model for truncated Poisson data and applied it to the Pseudomonas genome data set. A likelihood gain based searching algorithm was developed to obtain maximum likelihood estimates. The property of the algorithm was studied. Different approaches were compared for both multivariate and univariate approaches.

A. Structure of the Data and Preliminary Considerations

[0144] A transposon Tn5 insertion mutagenesis library was constructed in

Pseudomonas aeruginosa strains PAK and PAO1. Mutants were randomly picked and their genomic insertion site sequence determined through polymerase chain reaction (PCR) and automated DNA sequencing. BLASTN analysis of transposon/genome junction sequences was used to map the location of the insertions relative to the completed strain PAO1 genome sequence. More than 20,000 mutants were analyzed which resulted in 12,219 independent insertions being mapped. In order to identify essential genes, transposon insertion sites were analyzed with respect to the protein- encoding genes in this organism. A data set consists of the ID of genes, their length in DNA base-pairs, and the number of transposon insertions were obtained from experiments. The data set consists of 5570 genes with 881 different sizes ranging from 72 to 16884 DNA base-pairs. The distribution of the gene sizes are extremely skewed to the right with majority of the genes being smaller than 2000 DNA base-pairs as shown in Figure 10.

[0145] A randomly selected subset of the data is shown in Table 4, where δ is gene size, x is the observed number of transposon insertions. Insertions to essential genes are not observable since the insertion mutants can not survive for characterization when the transposon is inserted into an essential gene. Therefore, a gene with zero observed transposon insertions can either be an essential gene or a nonessential gene with zero transposon insertion. Consequently, the count of transposon insertions x is truncated with the truncation region being a single element {0}.

Table 4: A sample of the gene data set

Gene id x

298 1359 3

4047 618 0

1170 735 1

4953 1044 1

5526 213 0

4624 1707 4

5069 426 3 [0146] Since the insertion into the chromosome of Pseudomonas aeruginosa is random (Reznikoff WS. 1993), and the probability of receiving an insertion for a given gene is proportional to its size measured in DNA base-pairs, the number of transposon insertions into a gene is distributed as truncated Poisson with parameter λδ, where δ is the size of the gene and λ is an unknown parameter, which is independent of gene size.

B. A Bayessian Model

[0147] Let R be a measurable subset of the probability space Ω such that a random variable X is observable only if Xe Ω\R. In this example, no observations can be obtained from essential genes, whereas only nonzero observations can be obtained from nonessential genes, the set R consists of a single element {0}. 1. a. One Gene Size

[0148] Assume all genes in a genome have same size, δ, and let N be the number of nonessential genes in this genome. Then the observations X_ls X_2j ... , X_N from the N nonessential genes are i.i.d. Poisson(λ-δ), of which, all observations of value zero are truncated. The product λ-δ indicates that the probability of a gene receiving an insertion is proportional to its size.

[0149] Let denote the subset of all nonzero observations. Then this subset composes a random sample of size n from a truncated Poisson distribution whose distribution function can be written as

f(x,λ-δ)= e r_**(£*y /(ι- ^β-~), = 1,2,- (3.1) [0150] Let q = \-e ^λδ denote the probability that an observation from Poisson(λ-δ) is not truncated, and let p = \-q = e^~λδ . Then, conditional on the parameters n and N, the likelihood function of the j oint distribution of { X^* , X₂ ^* , • ■ ■ , X_n' } can be written as

[0151] Let S = x;+X₂' + -+X (3.3) denote the sum of all nonzero observations and notice that n follows a binomial distribution B(N, q). The likelihood function of the joint distribution of conditional on the parameter N, can be obtained as

[0152] The Bayesian model consists of the conditional model (2.4) and a prior distribution of the parameter N. Assuming N, the number of nonessential genes, is binomial B(M, γ), where M is the total number of genes of size δ, which is known, and γ is the portion of nonessential genes which is unknown and is independent of gene size, we can write the likelihood function of the joint distribution of {n,N,xl,X₂ ^*,-~,X_n ^*} as

[0153] This is the likelihood function of n nonzero observations from M genes of the same size δ, of which N genes are nonessential. It is easy to see that (3.5) is proportional to the likelihood function of the posterior distribution of N given observations n and S.

2.

b. Multiple Gene Sizes [0154] For a given genome consists of genes of different sizes, let δ = (δ δ₂,---,δ_g) denote the vector of g different gene sizes, and let M = (M₁,M₂,—,M_gf the vector of known numbers of total genes, N = N ,N₂,---,N_g) the unknown numbers of nonessential genes, « = («,, n₂,—,n^) the numbers of nonzero observations from the nonessential genes, and S = (s S₂,---,S_s) the sums of nonzero observations, as defined in (3.3).

[0155] The likelihood function of the joint distribution of lή,N,s} can be written as

where 11*11 is the Lt norm of a vector, and δ^r-N = ∑δ,- N, .

[0156] Let 3 = ln(l) . Then up to an additive constant, the log likelihood function of the joint distribution of { ,N,s) can be written as

+ ||S ||.ln(A)-A-(<5^r- iV) (3.7)

-fln(( , -_V,)l)- tln((N, -«,)•')>

where [γ,λ,N\ are the parameters of interests. The vector N is defined on {n, ≤N, ≤ M, -. i= l,2,---,g) and %(γ,λ,N is proportional to the likelihood function of the posterior distribution of N given and § . [0157] When g is large, say, in the order of hundreds as in the situation we are dealing with in this paper, obtaining the maximum likelihood (ML) estimate of

N = (N_i,N₂,---,N_g) from (3.7) in such a high dimensional parameter space is a very difficult task both theoretically and computationally. In the next section, we will present a stepwise, maximum likelihood gain based method to obtain the ML estimation.

C. ML ESTIMATION OF PARAMETERS

[0158] For any = (iv^" _],iV_2;...,N_g)^r, it is easy to verify using (3.7) that the ML estimations of the parameters γ and λ are

and

respectively. Substituting (4.1) and (4.2) for γ and λ in (3.7), we have

[0159] For l≤ i≤ g , define

Δ_;3^*(N) = 3^*(N+ϊ,.)-3^*( ) (4.4)

for any Ne {«, < N,. < M,., «,. < iV,. < M, : i ≠ j) . In equation (4.4), j^ =(0,...0,l,0,...,0)^r with 1 at the i position. For notational purpose, let

η(k)= k- \n(k) + (\\ M\\-k} hι(\\ M\\-k) (4.5) for || ή ||< k <\\ M || . Then, (3.4) can be written as

[0160] To obtain ML estimation of N, we define an operator, θ, between the observed vector and any integer k with 0 < k <|| M || - 1| )| as follows:

«®0 = «, n®k = n®(k-\))®\ for k>2.

We also define a likelihood-gain function G with G(0)=0 and

G(k) = 3^*(n® k)-^(n@(k-\)) (4.8)

for l</t<|| ||-||«|

[0161] Using this likelihood-gain function, we can search the ML estimation for N as follows:

1. Start with the observation 5 as the initial estimate of J , and denote it as N° . 2. For each gene size δ; with nj < Mj, i=l, 2, ..., g, calculate a likelihood difference Δ,3^*(N°) = 3^*(N⁰ +Ϊ,)-3^*(N⁰) by set N^ = «, +l and N° = «, for allj≠i.

3. Update the initial values N° by setting N° = N° + 1 such that Δ,3^*( °) = max Δ ^*(iV⁰),₇ = l,2,...,g] . This maximum likelihood difference is the likelihood gain defined in (4.8).

4. Repeat the process until it converges. By convergence we mean that either the estimated number of nonessential genes equals to the number of genes in each size group or when increasing the number of nonessential genes in any size groups will result in a loss of likelihood.

[0162] This algorithm searches the ML estimator in a high dimensional space (881 in our study) along a path such that at each iteration, it moves in a direction (that is, increases the number of nonessential genes in this size group by one) along which the likelihood gain is maximum among all possible directions. Because the searching algorithm prohibits reversal of previous moves at any later iteration, it moves towards the ML estimator along the shortest path with the deepest ascending (maximum likelihood gain) at each step. Table 5 and Figures 11 and 12 show the values of likelihood gains in each iteration. With very few exceptions where the monotonous is violated only at the fourth or fifth decimal places that probably can be attributed to rounding errors, the likelihood gain is a monotonously decreasing function.

Table 5. A Sample of Likelihood Gains at Each Iteration

Iteration id δ M n N(Ϊ) G(i)

ϊ 28 2Ϊ0 13 2 3 2.67559

2 60 306 14 3 4 2.41082 44 258 14 5 6 2.34388

63 315 15 5 6 2.29243

18 32 222 7 2.05160

19 81 369 11 2 2.05166

774 122 492 12 8 11 0.00692

775 266 924 16 14 15 0.00544

776 85 381 14 3 11 0.00531

The following three theorems show that the estimates obtained through the above algorithm are indeed the maximum likelihood estimates.

THEOREM 1: if

δ-\\S^{v λ}

∑l «, - exp >o, (4.9)

K ^gT'" JJ

then G(1)>0.

Proof: If G(l) <0, then by (4.5), Δ,3^*(«)<0for all l≤i≤g, which leads to

⁷(ll^»ll⁺ⁱ)-'⁷(ll^«ll)-ll5^||-^/«(^l+ (^^'"))^+ln( '-^;7')^≤0

IMHH-i

M. — n. W¥M

(|| fi II)"*¹- (|| ||- 1| n ||)'

||M|H|3||-1 ll^i+i/ ll '^.fi+i/tll il-II Il))¹

Using the facts that (l+l/xf <e, (1+1/ΛΓ) >e, and (l-V )^{* >e~} for any x>0, we obtain

exp ll^l. ≥ n -e-e"= n δ^τ-n j

This is contradictory to condition (4.9).

For g=l, (4.9) becomes ln(«)>( ₁ + X₂+--.+X_M)/«. Hence, when the mean of the observed transposon insertions is less than the log of the number of nonzero observations, the vector «can not be the ML estimator of N and there must be truncated observations from nonessential genes. THEOREM 2:

Δ,3^*(JV)>Δ,3^*(N-T_J) for all i≠] (4.10)

Proof: By definition in (4.5),

for any 0<x<\\M\\. Hence ??(||N||+l)-?7(||N||) is an increase function of ||N||. Using this result, we have

Δ,3^*(N)-Δ,3^*(N-Ϊ,) = (^(||N||+l)-^(||N||))-(^(||JV||)-₇(||N||-l)) -IISII.^l+^ ^-ivJJ+IISII-lnfl+^/^-N-^))

THEOREM 3: Under (4.9), for any l < j ≤ g and 1 < k ≤ K' ._.

with K' = max{ k^* ≥ 0 : G(k) ≥ forallO≤k≤ k^*} ,

if N = n® k- ϊ_j e {w < N, ≤ M_}), then

3^*(n®k)>3^*(n®k-l_J) (4.11) Proof: This is obviously true when k=l. Assume (3.11) is true for integers 1,2,... , k. For integer k+1, we have

3^*(«Θ(Jfc+l)-ϊ,)-3^*(ϋ®*)

= [3^,(nθ(Λ + l)-ϊ,)-3^*(ήθ *-!,)]+

[3^*(wθ*-ϊ_j)-3^*(»Θ ifc)] < [3^*(«®(A + l)- l,)-3^*(n® A- l,)]

By theorem 2,

Z'(n®(k + k-ϊ_j)<5'(n®(k + k)

Therefore

3^*(w®(A + l))>3^*(we(it + l)- l )

Combining theorems 1-3, we obtain

THEOREM 4: If the likelihood function defined in (3.7) has an unique solution, the ML estimator of N is:

N = n®K (4.12) [0163] Theorem 3 guarantees that the trajectory of the searching algorithm follows the shortest path in the sense that a reversal of a previous move (that is, removal of a previously added nonessential gene of any gene size) at any later state will result in a loss of likelihood. This property is illustrated in Figure 4 which shows the trajectory of the searching algorithm projected in a subspace spanned by two different gene sizes. For illustration purpose, genes are grouped into 143 groups by grouping genes with similar sizes together to increase the length of the trajectory. As indicated in the plot, at any state, moving backwards in any direction results in a loss of likelihood. Figure 13 shows more trajectories projected in different subspaces.

[0164] Now we need to demonstrate that the likelihood function (3.7), which is defined in a high dimensional discrete space, has an unique solution. This can be established if the same estimations are obtained from different initial values. Since the initial values can be any value between the observation 5 and the total number of genes M , we need to extend the searching algorithm (4.7) as follows:

For any initial value JN° : «,. < N° < M,. /or z = 1,2,- .., } and any integer k with

JV° ® 0 = JV°, 0 < £<|| M ||- || N° |l Such that (4-13)

N°®k = {N° ®(k-i))®l for k≥l.

The likelihood gain function is extended similarly as G(0)=0 and

G(k) = Z^*(N° ®k)-3^*(N°®(k-lj) (4.14)

for 1< £<||M|H| ° || .

[0165] Algorithm (4.13) preserves all the properties of algorithm (4.7) and it searches the ML estimator the same way as that of algorithm (4.7) with two exceptions. Unlike algorithm (4.7), which uses fi as initial values of N and at each iteration, the number of nonessential genes is increased by one in gene groups of size δ; to find the maximum likelihood gain, this algorithm uses N° as initial values of N which can be greater than the ML estimator. Therefore, at each iteration, the number of nonessential genes in a group with size δ; can be either increased or decreased by one such that the likelihood gain is maximum.

[0166] Randomly selected initial values N° were used for data with grouped gene sizes and data with exact gene sizes. The estimations of all parameters are exactly the same and the final likelihood for all initial values N° are exactly the same as indicated in Figure 14, which plots twenty seven different initial values of ° . The line in the far left represents the likelihood when N° = fi , and the lines in the middle are randomly selected. Figure 15 is the trajectory projected into a subspace spanned by two gene sizes. Each circle represents the projection of a different initial value N° . Regardless of the initial values, the trajectories all converge to the ML estimator.

D. ANALYSIS OF PSEUDOMONAS AERUGINOSA DATA

1. Multivariate Model with Exact Gene Sizes

[0167] The data considered here consist of observations from 5570 genes in 881 different sizes, ranging from 72 to 16884 DNA base-pairs. Distribution of gene size is severely skewed to the right as indicated in Figure 10. For many sizes, especially for sizes smaller than 200 or greater than 2000 DNA base-pairs, there is only one gene in a given size and the observation of transposon insertions for small genes are usually truncated. Since all genes are modeled simultaneously in a single model with a prior γ enforcing the essentialness of a gene being independent of its size, the sparseness of the data does not impose limitations on the computation. However, as discussed in the next section, the prior may play a dominating role for small genes where data are sparse. The estimations of γ and λ, together with the 95 percent BCa confidence intervals are presented in Table 6 and the estimation of N is presented in Figure 16.

Table 6. Parameter Estimation of γ and λ

Estimate Bias SE BCa Confidence Intervals

0.8434 3.942xl0^"3 9.893xl0^"3 (0.818, 0.859)

λ 2.547xl0^"3 -1.027xl0^"5 4.392x10 (0.00247, 0.00264)

Here the bias and standard error are estimated with bootstrap

2. Multivariate Model With Grouped Gene Sizes

[0168] The prior γ plays an important role in enforcing the fact that the essentialness of a gene is independent of its size. It also made possible to estimate the number of essential genes where data are very sparse. However, for small genes where data are extremely sparse, the prior γ becomes the dominating source of information. In order to moderate the dominance of the prior on small genes with sparse observations, we grouped the genes into 143 groups according to their sizes, using the median size of each group as the gene size. Table 7 is a sample of estimated N based on grouped and exact gene sizes. In the table, m is the number of unique sizes in each group; Ni is estimated using grouped data and N₂ is estimated using ungrouped data. Table 7: Estimated N with Grouped and Exact Gene Sizes

[72, 120] 6 7 3 2 6 1

(120, 150] 4 7 3 2 6 7

(150, 160] 3 7 2 2 6 7

(160, 170] 2 8 0 0 7 7

(170, 180] 3 9 1 1 8 8

(180, 190] 3 9 1 1 8 8

(190, 200] 3 12 4 4 11 11

(200, 210] 4 27 7 7 23 24

(210, 220] 3 19 7 5 16 17

[0169] We see that here N₂ ≥Η . However, this is true only for data in the above table where the ungrouped data are extremely sparse and most of the data are truncated. The estimated proportion of non-essential genes, γ, is actually larger for grouped data which is presented in Table 8. Grouping genes with similar sizes reduces the sparseness of the data and consequently, the dominance of the prior. Another obvious advantage of grouping is dimension reduction of the parameter space, and therefore, drastic reduction of computation time. Of cause, such grouping introduces another source of variation, and the algorithm could be unrobust against different grouping. In our study, however, different grouping resulted only in slight difference in estimates. 3. Conditional Maximum Likelihood Estimates

For a given gene size δ_j, the likelihood function (3.4) can be written differently as

(N. t-Ar- N,)- ' tiP^H Ylf(*)M (5.1) 'l J

[0170] Here /(. , .) is defined in (3.1), and X^* „JC^* ₂,---,X^*„ are the n_j nonzero observations from N, genes of size δ_j. Assume there are g different gene sizes, the likelihood function can be written as

π (N.

\ ^nj J W J ππ/«.><v = L,- L₂ (5.2)

with

J~l

[0171] Assuming the number of observations n_j for each gene size δj being fixed, we can obtain the conditional maximum likelihood estimate of λ by maximize L₂ as

where ||S||=∑∑ * ; j=\ 1=1 1=1

Equation (5.3) reduces to equation (4.2) if we estimate N, by N_} = l-e -λδ.

The proportion of truncated nonessential genes can be calculated as

p = P(x = 0) non essential) = je^{~ δ}dF(δ) . (5.4)

Ω

[0172] Here Ω is the set of nonessential genes, which can be approximated by the set of all untruncated genes.

Therefore,

Estimations from the three approaches are very similar as shown in Table 8. If the primary interest is to estimate λ and γ, the conditional MLE approach has the advantage of simplicity. However, in estimating λ, this approach omitted information of M , and γ is estimated separately after λ is estimated. Another obvious limitation of this approach is that it can only estimate || N ||, the total number of nonessential genes by || n . The estimation of N by njγ is not reasonable because even though γ is independent of gene size, we can not assume the proportion of non-essential genes in different sizes being the same as shown in Figure 17.

Table 8. Estimates of γ and λ with the Three Approaches

Estimates Bias SE 95% BCa

Confidence intervals

Multivariate Model with

0.843 3.942xl0^"j 9.893x10^"-

Exact Gene Sizes (0.818, 0.859)

2.547x10 ,-°3 - ₁1.0 A2_O4_/ x.110Λ-°5 (2.473, 2.642) xlO^"-

Multivariate Model with

Grouped Gene Sizes 0.853 7.221x10^"* 8.051x10^"" (0.835, 0.867)

λ 2.524xl0-³ 2.803xl0-⁶ 4.063x10°^" (2.451, 2.610) xlO -3

Conditional Maximum

Likelihood Estimates 0.828 -7.621x10°^" 7.273xl0^"3 (0.815, 0.843)

λ 2.539x10 ι-°3 m 9.7i1i3„xi1n0--7' 4i . n05cc8„xι1n0-°5 (2.455, 2.618) xlO^""

E. DISCUSSION OF ONE DIMENTSIONAL CASE

[0173] When the model does not depend on gene size, which can happen for example, when we study a subset of genes with a fixed size, or in other settings where the distribution is identical, model (2.6) reduces to (2.5). Blumenthal, Dayhiya, and Gross (1978) studies estimations of complete sample size from an incomplete Poisson sample using conditional, unconditional, and modified maximum likelihood functions. The modified likelihood estimation weights the likelihood function and maximizes it. This approach is similar to providing priors to λ and N. Table 9 presents four types of estimations of N using data randomly selected from the 143 grouped genes. Here M and n are number of genes and number of genes with at least one observed transposon insertions. N_m-b is a subset of N_t in Table 7, which is estimated using model (2.6) with grouped data; N_b is estimated with model (2.5); N_c and N_u are conditional and unconditional estimates of N as described in Blumenthal., Dayhiya, and Gross (1978).

Table 9: Comparison of Estimations with Different Methods

Gene size M n N_m-b Nb N_u N_c

[72, 120] 7 2 6 2 3 2

(400-410] 44 31 40 37 36 36

(430-440] 46 22 38 25 25 26

(470-480] 80 42 66 57 56 57

(500-510] 54 30 45 39 39 39

(610-620] 47 29 39 33 33 34

(640-650] 54 35 45 44 43 43

(710-720] 50 35 42 41 41 41

(750-760] 56 37 46 39 46 40

(770-780] 61 43 51 53 52 52

(910-920] 60 47 52 53 53 52

(980-990] 57 45 49 52 51 51 (1050 - 1100] 137 107 115 117 115 117

(1200 - 1250] 129 100 106 106 106 106

(1400 - 1450] 121 110 111 112 112 112

(2100 -2150] 23 20 20 20 20 20

[0174] We see that the estimations from the three univariate models are very similar. For fairly large genes, estimations from the multivariate model are similar to those of the univariate models. However, for small genes with high trancation rate, estimations from the multivariate model are larger than estimations from the univariate models. In the univariate models, only the information related to a particular gene size is used and the estimations are obtained separately for each gene size. This approach tends to underestimate N for small genes with sparse observations. The multivariate model uses a prior to enforce the fact that the essentialness of a gene is independent of its size and maximizes the likelihood jointly for all genes. Therefore, it alleviates the underestimation of N for small genes with high truncation rate.

Example 2: IpxC

[0175] Lipid A constitutes the outer layer of the outer membranes of gram-negative bacteria and is essential for bacterial growth. This makes all the enzymes involved in the biosynthesis of this molecule essential for bacterial growth, and therefore ideal targets for drug design. A series of synthetic molecules was previously identified that inhibited the first committed step in lipid A biosynthesis. Onishi H. R., B. A. Pelak, L. S. Gerckens, L. L. Silver, F. M Kahan, M-H Chen, A. A. Patchett, S. M. Galloway, S. A. Hyland, M. S. Anderson, and C. R. H. Raetz. 1996. Science. 274: 980-982. This step is catalyzed by a unique deacetylase (UDP-3-O -[R -3-hydroxymyristoyl]-Glc Ac deacetylase), LpxC.

[0176] UDP-3-0 -[R -3-hydroxymyristoyl]-GlcNAc deacetylase (LpxC) is a deacetylase that catalyzes the first committed step of lipopolysaccharide (LPS) biosynthesis in gram negative bacteria. This is the second step following the first acylation of N-Acetylglucosamine (GlcNAc). This enzyme functions to deacetylate the UDP-3-0 -[R -3-hydroxymyristoyl]-GlcNAc. This step was shown to be essential for growth in E. coli wherein a point mutant (EnvAI) expresses an LpxC protein that has reduced activity. Beall B. and J. Lutkenhaus, 1987. Sequence analysis, transcriptional organization, and insertional mutagenesis of the env A gene of Escherichia coli. J. Bacteriol. 169: 5408-5415. A 30% reduction in the amount of LPS on the cell wall of such mutants results in hypersensitivity to antibiotics. Attempts to create null mutants in IpxC were unsuccessful in a number of pathogenic bacteria, indicating that inhibitors of LpxC would be effective antibiotics for a number of gram negative organisms.

[0177] Previously identified inhibitors are chiral hydroxamic acids that had unique hydrophobic aromatic moieties, and were suspected to bind a metal in the active site of the deacetylase. The most potent inhibitor, L-161,240, displayed a minimal inhibitory concentration of about 1 microgram per milliliter against E. coli, caused three logs of bacterial killing in 4 hours, and cured mice infected with a lethal intraperitoneal dose of E. coli. Considering the very high degree of homology between the E. coli and P. aeruginosa enzymes, it was initially presumed that an inhibitor of the E. coli enzyme might also inhibit the P. aeruginosa enzyme. However, this molecule inhibited LpxC from P. aeruginosa only at very high concentrations, and even then it did so poorly. It had no effect on bacterial growth in this organism. Thus, there was some question as to whether the IpxC homologue had the same function in P. aeruginosa, and whether it was essential to P. aeruginosa given its decreased sensitivity to the L, 161,240 inhibitor.

[0178] Nevertheless, P. aeruginosa IpxC was one nucleic acid identified as being unable to accommodate a transposon insertion in the library depicted in Table 1 (PA4406). To test the essentiality of P. aeruginosa IpxC, we first tested the sensitivity of P. aeruginosa transformants expressing E. coli LpxC following a "promoter swap" integration. Using this technique, we completely shut off expression of the native P. aeruginosa IpxC, while expressing only the E. coli enzyme encoded on a plasmid. This strategy resulted in a P. aeruginosa mutant that was more sensitive to L-161,240. This suggested that the E coli IpxC gene was substituting for the function of the P. aeruginosa gene, and moreover, that there were no duplicate functional homologues in P. aeruginosa that were active in the absence of IpxC. [0179] Materials. Pseudomonas aeruginosa PAO1 was grown at 37°C in Luria- Bertani (LB) broth (Difco) or plated on sheep blood agar (Remel). Tetracycline at 100 μg/ml in LB media was used to maintain the selection of the integrated plasmid pBEMlO in PAO1. LB broth or agar with 10 μg/ml of tetracycline was used for growing E. coli DH5α (Gibco BRL) and E. coli S- 17 transformants. Plasmids pPS 72 and pBADHisB were from Promega and Invitrogen, respectively. EDTA, bis-tri buffer, sucrose, arabinose, and DMSO were purchased from Sigma as Ultrapure agents. Yeast extract and Tryptone were obtained from Difco. Restriction enzymes, and T4 DNA Ligase, and their reaction buffers were from New England Biolabs. Polymixin B nonapeptide was from Sigma. The antibiotics, tetracycline, ampicillin, carbenicillin, gentamicin, and kanamycin were all purchased from Sigma. DNA and deduced amino acid information were analyzed using a family of programs included in the Dnastar package. BLASTP was used to search for amino acid similarities among a host of protein databases available on-line through the National Library of Medicine (USA). Altschul, T. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment tool. J. Mol. Biol. 215: 403-410.

[0180] DNA manipulations. Standard recombinant DNA procedures were used. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a Laboratory Manual, 2ⁿ Edition. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Primers were designed to the N- and C-terminal regions of the E. coli or P. aeruginosa IpxC gene that encompassed only the coding region and included Ndel and EcoRI restriction sites for subsequent cloning. For the E. coli gene the primers were (5'- GGGAATTCCATATGATCAAACAAAGGACACTTAAACGT-3' and 5'- CCGGAATTCTTATGCCAGTACAGCTGAAGGCGCT-3*) and for P. aeruginosa gene they were (5'-

GGGAATTCCATATGATGATCAAACAACGCACCTTGAAGAACAT-3' and 5'- CCGGAATTCCTACACTGCCGCCGCCGGGCGCATATAG-3'). These primers were used in a polymerase chain reaction (PCR) containing either P. aeruginosa genomic DNA (10-50 μg) or plasmid pKD6 containing the E. coli IpxC gene (1.0 μg ) as template (Sorensen, P. G., J. Lutkenhaus, K. Young, S. S. Eveland, M. S. Anderson, and C. R. H. Raetz. 1996. Regulation of UDP-3-O-[R-hydroxymyristoyl]-N- acetylglucosamine deacetylase in Escherichia coli. The second enzymatic step of lipid A biosynthesis. J. Biol. Chem. 271 (42): 25898-25905). The IpxC genes were amplified using Pwo DΝA polymerase (Roche) in a 100 μl reaction mixture containing 200 μM concentration of each dΝTP and 0.5 μM concentration of each primer for 30 cycles (94° C denaturation, 55°C annealing, and 72° C polymerization (according to the manufacturer's instructions). The PCR products were purified with the Qiaquick PCR Purification Kit from Qiagen (according to the manufacturer's instructions) and digested with Ndel and EcoRI restriction enzymes at sites introduced by the primer sequences. Bands of the correct sizes predicted for the IpxC genes were separated by gel electrophoresis, and the excised DΝA purified using the Qiaquick Gel Extraction Kit from Qiagen (according to the manufacturer's instructions). The purified DΝA was ligated into the T7 expression vector (Studier, F. W., A. H. Rosenberg, J.J. Dunn, and J. W. Dubendorff. 1990. Use of T7 RΝA polymerase to direct expression of cloned genes. Methods Enzymol. 185: 60-89) pET21b (Νovagen), that had been cut in the multiple cloning site with the same enzymes, transformed into DH5 and plated on LB agar containing ampicillin (250 μg/ml). The resulting clones had their DΝA sequenced to confirm the fidelity of the PCR reactions before it could be transferred into the expression strain. Subcloning of these fragments into other vectors was carried out as needed for expression in various backgrounds. These included pEX18T (cbR) for allelic exchange mutagenesis in P. aeruginosa (Schweizer, H. P and T. T. Hoang. 1995. An improved system for gene replacement and xylE fusion analysis in Pseudomonas aeruginosa. Gene 158 (1): 15-22), pDΝ19 (tetR) for low copy number complementation of E. coli JBK-1 (Nunn, D., S. Bergman, and S. Lory. 1990. Products of three accessory genes, pil ,pilC, εaxdpilD, are required for biogenesis of Pseudomonas aeruginosa pili. J. Bacteriol. 172 (6): 2911-2919), and pUCP30T (gmK) for P. aeruginosa 'promoter swap' mutant complementation (Schweizer, H. P., T. R. Classen, and T. Hoang. 1996. Improved methods for gene analysis and expression in Pseudomonas. In: Nakazawa, T., K Furakawa, D. Haas, S. Silver. (Eds.) Molecular Biology of Pseudomonas. American Society for Microbiology, Washington, DC. pp. 229-237). [0181] Construction of pBEMlO and 'promoter swap' mutagenesis. Plasmid pPWIOl was made by ligating oπ^'T, the region that encodes conjugative plasmid transfer, into pSP72 (Promega). orϊϊ had been amplified from plasmid pEXlOOT (Schweizer and Hoang, 1995, supra) with an introduction of an Ndel and wciAatll restriction sites. To create the IpxC 'promoter swap' vector, pBEMlO, the following different DNA pieces were amplified and sequentially ligated into pPWIOl. These included the tetracycline resistance marker (tetR) from plasmid pUCP26 (Olsen, R. H., G. DeBusscher and R. R. McCombie. 1982. Development of broad-host-range vectors and gene banks: self-cloning of the Pseudomonas aeruginosa PAO chromosome. J. Bacteriol. 150: 60-69), the araBAD promoter from the plasmid pBAD HisB (Invitrogen) with an altered ribosome binding site (rbs) (Guzman, L.M., D. Belin , M. J. Carson , and J. Beckwith. 1995. Tight regulation, modulation, and high-level expression by vectors containing the arabinose pBAD promoter. J Bacteriol. 177 (14):4121-4130), the araC gene, also from pBAD HisB (Lee, N. 1980. Molecular aspects of ara regulation. In The Operon. J. H. Miller and W. S. Reznikoff, eds. Cold Spring Harbor, NY. Cold Spring Harbor Laboratory, pp. 389-410; and Schleif, R. S. 1992. DNA looping. Ann. Rev. Biochem. 61: 199-223), and the first 340 base pairs of the P. aeruginosa IpxC gene. The tetR marker was amplified using a forward primer that introduced a BgKl site (5'- AGATCTCAAGGGTTGGTTTGCGCA-3') and a reverse primer that introduced an EcoRI site (5'-

GAATTCTAATTCTCATGTTTGACA-3'). The αr BAD promoter and araC gene were amplified as one piece from the pB AD HisB vector. The forward primer introduced an /røl site (5'-CTCGAGGCATGCATAATGTGCCTGTC-3') and the reverse primer introduced a Hindlll site (5'-

AAGCTTCTCCTGTTAGCCCAAAAAAACG-3'). The rbs was altered from its original AGGAG to CTTCT. The following primer set was used to make these changes and introduced an upstream BssHll site (5'- GCGCGCGGACGAAAGTAAACCCAC

TGG-3') and a downstream Hindlll site (5'- AAGCTTATTCAGAAGGTTAGCCCAAAA AAACGGG-3')- The first 340 bases of PAOl IpxC were amplified from PAOl genomic DNA. The forward primer introduced a Hindlll site (5'-AAGCTTATGATCAAACAACGCACCTT-3') and the reverse primer introduced mXbal site (5'-TCTAGAAGCGCTGCCATCCATGATCGG-3'). These pieces were then ligated into pPWIOl to form the final product, pBEMlO, which was used for the 'promoter swap' mutagenesis of IpxC The 'promoter swap' scheme is a homologous recombination strategy, whereby transformation of pBEMlO into P. aeruginosa removed the native IpxC promoter and placed the tightly regulated arάBAD promoter upstream of the chromosomal copy of IpxC, allowing modulation of its expression by the use of a simple sugar, arabinose (Figure 3). In the absence of arabinose the IpxC was effectively shut off, and expression was inducible by addition of arabinose. Such mutants were selected in the presence of arabinose, and if IpxC is essential, these mutants would not be viable in media that is not supplemented with arabinose, but fully capable of growth in the presence of arabinose.

[0182] Growth curves. Bacterial cultures were prepared by diluting stationary phase overnight cultures to an OD₆oo of 0.1 in 5 ml of LB. The inhibitor, L-161,240, was resuspended in DMSO to a final concentration of lOmg/ml and added to the bacterial cultures to a final concentration of 50 μg/ml or 10 μg/ml. In the samples without inhibitor, DMSO was added to keep the final concentration of DMSO equivalent between samples. The cultures were incubated with shaking and 0.8 ml was taken for OD₆oo readings over the course of the experiment. DH5α, PAOl, and PA0200 (Schweizer, H. P. 1998. Intrinsic resistance to inhibitors of fatty acid biosynthesis in Pseudomonas aeruginosa is due to efflux: application of a novel technique for generation of unmarked chromosomal mutations for the study of efflux systems. Antimicrob. Agents Chemother. 42: 394-398) were all grown at 37°C. In the cases where temperature sensitive JBK strains were being assayed, the cultures were grown at 42° C for both the overnight and the time course cultures.

[0183] Outer membrane permeabilization. Polymixin B nonapeptide (Sigma) was prepared as a suspension in DMSO at 3 mg/ml final concentration. Erythromycin and Tetracycline were resuspended in DMSO to a final concentration of 250 mg/ml and 125 mg/ml, respectively. L-161,240 was prepared as above in DMSO to a final concentration of lOmg/ml. These DMSO antibiotic solutions were individually added to LB to the appropriate final concentration and mixed. Polymixin B nonapeptide was then added to the appropriate samples and mixed. DMSO was added to each sample to keep the final concentration of DMSO equivalent between samples. A stationary phase overnight culture of PAOl was added to each sample to bring the final concentration to 0.1 OD₆oo. Samples were removed for OD₆oo determinations every 1-2 hours for 6.5 hours and the data from these time points were plotted.

[0184] MIC determinations for 'promoter swapped' mutants. Single colonies of DH5α, PAOl and each promoter swap strain were picked and grown in LB at 37°C with shaking for approximately 4 hours. Assuming that an OD₆oo reading of 1.0 is equivalent to 10⁹ cells/ml, dilutions were made of all cultures to 5x10^s cells/ml. 200 μl of each diluted culture was added to each well where a two-fold serial dilution of inhibitor had been placed. The 96-well plates were incubated at 37°C overnight and their OD₆oo determined using the Spectramax Plus (Molecular Devices) plate reader.

[0185] To confirm the effect of the arabinose-sensitive promoter in regulating the IpxC expression in the swapped mutants, MIC determinations were performed as above, except that arabinose was added to induce expression of the chromosomal locus and override the effects of the plasmid borne IpxC. In this case the stationary-phase overnight bacterial culture was diluted to 5x10^s cells/ml in LB containing Arabinose to a final concentration of 0.2% (a 20% stock made up in water).

RESULTS AND DISCUSSION:

[0186] Homology between the E. coli and the P. aeruginosa LpxC enzymes. Using protein analysis software, this study and others have compared the deduced amino acid sequence of LpxC from both E. coli and P. aeruginosa (Hyland, S.A., S. S. Eveland, and M. S. Anderson. 1997. Cloning, expression, and Purification of UDP-3-O-Acyl- GlcNAc Deacetylase from Pseudomonas aeruginosa: a metalloamidase of the lipid A biosynthesis pathway. J. Bacteriol. 179 (6): 2029-2037). This comparison revealed 82% similarity and 57% identity shared between the two sequences. This homology was found over the entire length of the protein sequence (data not shown). Significant homology with other known acetyl- or acyltransferases was not found, suggesting that LpxC is unique among acetyltranferases. The two proteins also share a total of five fully conserved Histidine residues that are presumed to be responsible for the zinc metal cofactor coordination. It was therefore expected that an inhibitor that functions by chelating the metal cofactor away would affect both enzymes similarly.

[0187] LpxC is essential for growth in P. aeruginosa. Since the hydroxamate inhibitor was effective in preventing growth of E. coli, but completely ineffective against P. aeruginosa, there was a possibility that LpxC was not essential in P. aeruginosa. This could be as a result of the presence of another enzyme that catalyzed a similar function. If that were the case, elimination of the LpxC function should be possible without inhibiting bacterial growth. A thorough analysis of the P. aeruginosa genome sequence revealed only one LpxC homologue. An attempt to disrupt the function of this LpxC homologue was made by conjugating wild type PAOl with a suicide vector (pEXl 8T) carrying IpxC whose BamHl - Sail fragment had been replaced with a gentamicin cassette. However, P. aeruginosa null mutants could not be established by this method. In several attempts a few gentamicin resistant trans- conjugants were obtained, but in all these cases allelic replacement of the chromosomal IpxC by the defective copy had not occurred. Instead, a gene duplication had occurred, placing the suicide vector and the disrupted copy next to the wild type allele (data not shown). This could be demonstrated by the carbenicillin resistance and sucrose sensitivity acquired by these trans-conjugants, both of which are encoded on the suicide vector. These data indicated a strong negative selection for the sought after disruption of IpxC suggesting that IpxC is essential for growth. To confirm this, an experiment was carried out whereby the trans-conjugants were transformed with either IpxC on a low copy, replicating vector, or vector alone. In 100% of IpxC transformants, resolution of the gene duplication as demonstrated by the loss of carbenicillin resistance and sucrose sensitivity was observed, as opposed to no such resolution among those transformed with vector alone. These results suggested that the wild type genomic allele could be disrupted if a functional copy was present on the transforming plasmid.

[0187] In another attempt at demonstrating essentiality of LpxC in P. aeruginosa, the 'promoter swap' strategy as described in materials and methods was carried out. 'Promoter swapped' pseudomonas mutants were fully capable of growth in the presence of arabinose when the arabinose sensitive IpxC promoter was turned on, but completely incapable of growth in the absence of this inducer. This further confirmed that in P. aeruginosa, just as in E. coli, LpxC is essential for growth.

[0188] E. coli expressing LpxC from P. aeruginosa is more resistant to L-161, 240. The E. coli strain JBK-1 /pKD6 contains the chromosomal IpxC gene disrupted with a kan element and a wild type copy of E. coli IpxC on the temperature-sensitive replicon pKD6. The strain was constructed as described by Sorensen et al, 1996. Since IpxC is essential for growth, this strain is not viable at 42° C because the functional copy is on the temperature sensitive replicon. Transforming JBK-1 /pKD6 with IpxC from either E. coli or P. aeruginosa on a non-temperature-sensitive replicon (pKD19, 7etR) and selecting at 42° C, produced transformants that were viable at 42° C, tetracycline resistant, and kanamycin sensitive. This result indicated that IpxC from P. aeruginosa could be expressed in the E. coli background, and was capable of substituting for the missing chromosomal copy. An unexpected result was that whereas the JBK-1 carrying the IpxC copy from E. coli was still sensitive to killing by a slightly higher concentration of L-161,240, the JBK-1 carrying the IpxC copy from P. aeruginosa was resistant to up to 50 μg/ml, about 50 times above the MIC of the wild type organisms (data not shown). This suggested that the P. aeruginosa enzyme was uniquely resistant to this inhibitor. It also meant that this resistance was the reason for the failure to inhibit growth of P. aeruginosa, and not reduced permeability, or efflux or modification of drug by the pseudomonal enzymes. This, in turn, suggests that a program designed to search for inhibitors for the pseudomonal enzyme should be based on screening directly on that enzyme, and not the surrogate enzyme from E. coli. [0189] L-161, 240 is a substrate for the major drug efflux pump of P. aeruginosa.

The completed P. aeruginosa genome reveals genes for at least nine homologous, multicomponent, multidrug efflux systems (Stover et al., 2000, Complete genome sequence of Pseudomonas aeruginosa PAOl, an opportunistic pathogen, Nature 406: 959-64). However the only one that is constitutively expressed to a high degree in the wild type strains is MexAB-OprM (Kohler, T., M. Michea-Hamzehpour, and U. Henze. 1997. Characterization of MexE-MexF-OprN, a positively regulated multidrug efflux system of Pseudomonas aeruginosa. Mol. Microbiol. 23: 345-354). Therefore, mutants of this efflux system can be used to evaluate the consequences of diminished efflux pump activity. These mutants would be expected to be highly sensitive to a number of antibiotics. Such a mutant, PAO 200, has been isolated (Schweizer, 1998, supra), and whereas it shows a higher level of sensitivity to a number of antibiotics (Westbrock- Wadman, S. D. R. Sherman, M. J. Hickey, S. N. Coulter, Y. Q. Zhu, P. Warrener, L. Y. Nguyen, R. M. Shawar, K. R. Folger, and C. K. Stover . 1999. Characterization of a Pseudomonas aeruginosa Efflux Pump Contributing to Aminoglycoside Impermeability. Antimicrobial Agents and Chemotherapy. 43 (12): 2975-2983), it was not more sensitive to L-161,240 (Figure 4). This suggests that this drug compound is not a substrate for this efflux system in P. aeruginosa.

[0190] P. aeruginosa is not less permeable to L-161,240. Low permeability of the outer membrane is a major contributing factor to the observed high levels of intrinsic drug resistance in P. aeruginosa (Nikaido, H. 1998. The role of outer membrane and efflux pumps in the resistance of gram-negative bacteria. Can we improve access? Drug Resistance Updates. 1: 93-98). This low permeability is due to the fact that P. aeruginosa lacks the homolog of the relatively efficient, trimeric porins like OmpF. P. aeruginosa has, instead, OprF, the OmpA homolog, which produces channels only when it is folded into a rare conformation, and only a small fraction of these channels occurs in the open conformation. As is usually the case with P. aeruginosa it was assumed that the reason L-161,240 was ineffective against P. aeruginosa was the lack of permeability of the outer membrane to this inhibitor. Polymixin B nonapeptide (PMBN), a derivative of Polymixin B that lacks the fatty acid tail, is capable of binding to the polyanionic LPS molecules and disrupting the bilayer structure, thus increasing the permeability of the outer membrane. PMBN has been used this way to permeabilize the outer membrane of many gram-negative bacteria (Vaara, M. and T. Naara. 1983. Sensitization of gram-negative bacteria to antibiotics and complement by a nontoxic oligopeptide. Nature 303: 526-528), including P. aeruginosa (Nilianen, P. and M. Naara, 1984. Susceptibility of gram-negative bacteria to polymixin B nonapeptide. Antimicro Agents Chemother. 25: 701-705) and effectively sensitize them to lipophilic antibiotics. Unlike the acylated polymixin B, PMBΝ is not cidal. In order to determine the effect of outer membrane exclusion of L-161,240, we exposed P. aeruginosa to PMBΝ in combination with L-161,240, and with other lipophilic antibiotics as positive controls. Whereas PMBΝ lowered the MIC of tetracycline for P. aeruginosa more than 16 fold, the sensitivity towards L-161,240 remained unchanged (Figure 5). This, together with the E. coli expression data indicated that permeability was not a major factor causing the inability of L-161,240 to inhibit pseudomonal growth.

[0191] P. aeruginosa expressing only E. coli LpxC is more sensitive to L161-240 than wild type. Using the 'promoter swap' technique as described in the methods, it was possible to replace expression from the wild type chromosomal copy of P. aeruginosa IpxC, with expression solely from a plasmid borne copy. For this experiment, 'promoter swapped¹ P. aeruginosa was transformed with either vector containing P. aeruginosa IpxC ("PA Swap #1"), or vector containing E. coli IpxC ("PA Swap #2'). The transformants were then exposed to various concentrations of L- 161,240 for MIC determination. Transformants expressing the E. coli enzyme only were much more sensitive to the inhibitor compared to organisms expressing the P. aeruginosa enzyme (Figure 6). These transformants were sensitive enough to be comparable with the sensitivity seen in E. coli. Since the validity of this observation relied on the un-induced arabinose-sensitive promoter to shut down expression from the chromosomal copy of IpxC, it was necessary to demonstrate how effectively this happens. To do that, MIC determinations were performed as above, except that arabinose was added to induce expression of the chromosomal locus. For this experiment stationary-phase overnight bacterial cultures were diluted to 5xl0⁵ cells/ml in LB containing 0.2% arabinose. In this case all the transformants, regardless of what gene the vector contained, were resistant to killing due to the expression of the chromosomal copy of P. aeruginosa IpxC. This confirmed that certain intrinsic properties of the P. aeruginosa enzyme are resistant to inhibition by this hydroxamate inhibitor. It also confirmed that neither reduced uptake, efflux, nor modification of the inhibitor play a significant role in this observed resistance. Considering the very high similarity between the two enzymes, this finding was not expected.

[0192] But on further examination and analysis of existing data, it was possible to recognize some inherent differences that might explain this finding. Whereas both these enzymes share five conserved Histidine residues, the E. coli enzyme has two more Histidines that have no counterparts in the P. aeruginosa enzyme. This is an important difference because these residues are probably involved in the metal cofactor coordination. It was also observed earlier that whereas the E. coli enzyme is not sensitive to EDTA, the P. aeruginosa enzyme was significantly inhibited by as little as 2 μM EDTA. Evidence that the E. coli enzyme is also a metalloenzyme is that the envAl mutation, which has one of the conserved Histidines (His 19) replaced by a Serine, is sensitive to EDTA. It was because of these observations that these investigators suggested that the E. coli enzyme has a more stably bound metal than that of the EnvAl mutant protein, and thus it is less accessible to EDTA than the wild type P. aeruginosa enzyme. These observations suggest that the Histidine 'patch' that is involved in the metal coordination is not similar between the two enzymes. It is conceivable therefore that since the inhibitor works by chelating the metal cofactor away from the enzyme, each 'patch' has unique features that result in disparate reactivities towards the inhibitor. It is also important to consider the findings of Wyckoff et al., 1998. Hydrocarbon rulers in UDP-N-acetylglucosamine acyltransferases. J. Biol. Chem. 273 (49): 32369-32372. These investigators found that LpxA, the first enzyme of lipid A biosynthesis, is very selective for the length of its acyl donor substrates. Whereas E. coli LpxA prefers R-3-hydroxymyristoyl-ACP to R- 3-hydroxydecanoyl-ACP, P. aeruginosa LpxA prefers the opposite. The products of the LpxA reaction therefore differ in the carbon chain length of their lipid moieties between the two bacteria. Since the product of the LpxA reaction is the substrate of the LpxC reaction, this observation suggests that the two LpxCs would have substrate binding pockets of different sizes to accommodate the different size substrate. That would, in turn, suggest that inhibitors that have to occupy that active site would be unique for each enzyme.

Examples 3-7: ispA, ispB, uppS, aroC, aroK, and metK

[0193] Several more candidate genes from the HTTIM gene database were tested for essentiality using a single crossover knock-out strategy. The Pseudomonas genes targeted for knocking out were ispA, ispB, uppS, metK, aroC, and aroK. To attempt knock-outs, regions of about 300 bp were cloned into the vector pPW120. These regions were selected so that known active site residues (or highly conserved residues likely to be essential for enzyme function) would be separated after generation of a single-crossover knock-out. The regions were (numbering from the start codon): ispA, 283-594; ispB, 319-610; uppS, 103-402; metK, 415-732; aroC, 385-684; aroK, 175- 375.

[0194] The pPW120 vector carries an E. coli origin of replication, but not a Pseudomonas origin of replication, making it a suicide vector. It also carries an origin of conjugal transfer and antibiotic resistance genes for tetracycline and ampicillin. An E. coli donor strain (SM10) carrying the pPW120 knockout constructs was incubated with Pseudomonas strain PAOl to allow conjugal transfer, and recombinants were selected by plating onto media containing tetracycline at 100 μg/mL and chloramphenicol at 10 μg/mL. Pseudomonas recombinants will be resistant to this antibiotic mixture while wild-type PAOl and the E. coli donor strain will be sensitive. Aromatic amino acid recombinants (aroC and aroK) were then tested for auxotrophy by plating onto minimal media with and without phenylalanine, tryptophan, tyrosine, and folic acid at 100 μg/mL while maintaining tetracycline selection. The genes ispB, uppS and metK did not yield recombinants, demonstrating that they are essential genes in all media conditions, while ispA yielded slow-growing recombinants (suggesting that this gene may nevertheless be an "important" gene according to the invention).

[0195] For ispA, ispB, uppS, and metK, the conjugation procedure was also done in the presence of the complementing plasmid pBAD/HisP. This plasmid has both E. coli and Pseudomonas origins of replication, an antibiotic resistance gene for carbenicillin, and an arabinose-inducible copy of the full-length wild-type gene. In this way, recombinants with the chromosomal copies of ispA, ispB, uppS, and metK knocked out could be isolated since the vector copy would provide complementation.

[0196] The genes ispB, uppS, and metK are novel with regard to P. aeruginosa. The gene ispB (PA4569, ranging from 5116864 to 5117832 in the genome), has 67% similarity/52% identity to IspB in E. coli, and was assigned to the function class concerned with biosynthesis of cofactors, protein groups and carriers, and energy metabolism, with a confidence level of 2. It is thought to be involved in the pathway of ubiquinone biosynthesis.

[0197] The gene uppS (PA3652, ranging from 4091654 to 4090899), coding for undecaprenyl pyrophosphate synthetase, has 69% similarity/57% identity to the uppS gene in E. coli, and was assigned to the function class involved in biosynthesis of cofactors, protein groups and carriers, cell wall and capsule, with a confidence level of 2. It is separated by one gene (cdsA) from dxr, which is involved in the synthesis of isopentenyl diphosphate, a precursor of undecaprenol phosphate.

[0198] The gene metK (PA0546, ranging from 604896 to 603706) had never been characterized in P. aeruginosa, although it is 82% similar/72% identical to MetK in E. coli. The gene encodes methionine adenosyltransferase (adomet synthetase) which is involved specifically in methionine metabolism, and was originally assigned to a function class of amino acid biosynthesis and metabolism and central intermediate metabolism with a confidence level of 2.

Example 8: rrF

[0199] The essentiality of the P. aeruginosa rrF (PA3653, ranging from 4092227 to 4091670) gene was tested using the promoter swap methodology disclosed herein. The N-terminus region (position 1-327) of the gene encoding the ribosome recycling factor (frr) was cloned into the plasmid vector pBEMlO. A single crossover was constructed as described above for IpxC. Recombinants were unable to grow in the absence of arabinose, confirming the essentiality of this gene. The rr/gene encodes ribosome recycling factor, alternatively known as ribosome releasing factor, assigned to the functional class pertaining to translation, post-translational modification and degradation with a confidence level of 1. Although this gene was previously known in Pseudomonas aeruginosa, confirming the essentiality of known genes using the methods disclosed herein will reveal new utilities for such genes as targets for the identification and design of new antibacterial drugs.

PA0563 9946432 j conserved hypothetical protein

PA0565 9946434 ) conserved hypothetical protein

PA0567^" 9946437 -conserved hypothetical protein syqaE

PA0570 99464401 hypothetical protein

PA0571 9946441~; hypothetical protein

PA0574 ^" 9946444 j hypothetical protein

PA0578 9946449! conserved hypothetical pro ein

!PA0704 9946587 'probable amidase

PA0904 9946806 jaspartate kinase alpha and beta chain ^"H sC ask; akaB PA0905 ^" 9946807 'carbon storage regulator _ __ ^!csrA SPA09Q6^" 99468081 probable transcriptionaf regulato r ;PA0908 9946810 hypothetical protein ;^"PA0909^" 9946811 hypothetical protein ΪPA0913 99468151 probable Mg transporter MgtE^~ mgtE

PA0922 9946825 ; hypothetical protein

PA0927 9946831 D-lactate dehydrogenase (fermentative) sldhA IdhD

PA0932 9946836 cysteine synthase B [cysM

PA0937 9946842 conserved hypothetical protein iyaiL

PA0939 9946844 hypothetical protein

JPA0944 , 99468491 phosphoribosylaminoimidazole synthetase _tpjj[N I PA0945^" ~ 9946850[phos horibos laminoimidazole s nthetase ^s urM

■ PA1089 9947005; conserved hypothetical protein

:PA1090 Z-7 9947006 i hypothetical protein _____ fPA1095 ~ ^"" " ^{" "} 9947012'hypothetical protein ^"_____ ^' _^" • fliS

JPA1098 9947015}two-component sensor ^"fleS

^"PA1102^" 994701 Qlfiagellar motor switch protein FΪiG ^"flΪG

^:PA1105 ^" 9947022 jflagellar protein FliJ ^{"" "} fliJ

IPA1250 9947181 ' alkaline proteinase inhibitor Apr! aprl .PA1261 9947193 iprobable transcriptional regulator PA1269 9947202 Iprobable transcriptional regulator PA1280^" 9947214; hypothetical protein cobC

[PAΪ285^"' 9j_47220 ; probable transcriptional regulator

;PA129^"5 9947231 j conserved hypothetical protein S

^•PA1298 ^' 9947234; conserved hypothetical protein yohL

PA1475 _ 9947428. heme exporter protein Cc A ccmA ^'#NAME?

;PA1476 9947429; heme exporter protein CcmB _ccmB . yH9._' ^cy^cY ιl2?J „

PA1477 99474311 1 heme exporter protein CcmC ccmC ■ pfcytl cycZ HeJC^

;PA1478^" 9947432 i hypothetical protein pfcyt2 ccmD cycX ieΪD s PA 1480 9947434 {cytochrome C-type biogenesis protein CcmF ccmF cycK; cell

1PA1481 9947435 i cytochrome C biogenesis protein CcmG ;ccmG dsbE

1PA1482 9947436! cytochrome C-type biogenesis protein CcmH iccmH ccl2 cycL ! PAl 488^"" 9947442 {hypothetical protein ___ PA148_f 99474431 hypothetical protein JPA1492 9947447 j hypothetical protein [ 1PA1496 9947451 iprobable potassium channel lPA1504_ 9947460 probable transcriptional regulator i^"PA1508 9947464 hypothetical protein

PA1509 9947465 hypothetical protein

PA1514 9947471 conserved hypothetical protein 'ybbT

PA1517 9947474 conserved hypothetical protein

PA1518 9947475 conserved hypothetical protein

PA1526 9947484 probable transcriptional regulator

PA1528 9947486 cell division protein ZipA zipA

PA1529 9947487 DNA ligase jd_naL__ljgA

PA1532 9947490 DNA polymerase subunits gamma and tau dnaX

PA1533 9947491 conserved hypothetical protein

PA1535 9947494 probable acyl-CoA dehydrogenase

PA1539 9947498 hypothetical protein

PA1540 9947499 conserved hypothetical protein

PA1541 9947500 probable drug efflux transporter

PA1548 9947508 conserved hypothetical protein ifixS

PA1551 9947511 probable ferredoxin fixG

PA1555 9947515 probable cytochrome c jfixP ccoP

PA1558 9947519 hypothetical protein

PA1559 9947520 {hypothetical protein

PA1560 9947521 1 hypothetical protein .._!

PA1564 9947526 S conserved hypothetical protein

PA1568 9947530 {conserved hypothetical protein _ __

PA1571 9947533 hypothetical protein

PA1581 9947544 succinate dehydrogenase (C subunit) sdhC jcybA

PA1582 9947545 succinate dehydrogenase (D subunit) sdhD

PA1583 9947546 succinate dehydrogenase (A subunit) sdhA

PA1584 9947547 succinate dehydrogenase (B subunit) sdhB

PA1587 9947550 lipoamide dehydrogenase-glc jlpdG llpdA

PA1588 9947552 succinyl-CoA synthetase beta chain sucC

PA1589 9947553 succinyl-CoA synthetase alpha chain ;sucD

PA1591 9947555 hypothetical protein

PA1592 9947556 hypothetical protein -_ _ i

PA1593~^""7~^{" "}9947557 hypothetical protein

PA1594 9947558 hypothetical protein

PA1595 9947559 hypothetical protein

PA1610 9947576 beta-hydroxydecanoyl-ACP dehydrase fabA

PA1618 9947584 conserved hypothetical protein !ybdB_

PA1619 9947585 {probable transcriptional regulator

IPA1622 9947589 , probable hydrolase

PA1623 99475901 conserved hypothetical protein

^•PA1825 9947811.hypothetical protein

JPA1830 9947816, hypothetical protein IPA1835^" 9947821 j hypothetical protein

JPA1837 9947823 [hypothetical protein I PAl 840 9947827 ■ hypothetical protein

1PA1842 9947829ihypothetical protein IPA1845 ^' 9947832 i hypothetical protein

PA2329 9948364. probable ATP-binding component of ABC trans

PA2331 9948366; hypothetical protein __ ,_

PA2336 994837 l^"tTrypothetical protein ___ _ _ ^' ~

PA2338 99483741 probable binding protein component of ABC m 'mtlE

PA2343 9948379;xylύTose kinase ^{" ~"} mtlY

PA2347 9948384 [hypothetical protein

;PA2507 9948561 jcatechol 1,2-dioxygenase _:catA

JPA2515^" 9948569 jcis-1 ,2-dihydroxycyclohexa-3,4-d ie e ca rbox_yJ y_l __

:^'PA2517 9948571 toluate 1 ,2-dioxygenase beta subunit jxylY

JPA2521^" 9948576- RND divalent metal cation efflux membrane fu, czcB

IPA2536^{"" "'} 9948593[probable phosphatidate cytidylyltransferase ynbB

■PA2538 9948595 j hypothetical protein

{PA2539 9948596! conserved hypothetical protein ynbD

IPA2544 ^"9948602 {hypothetical protein ^"_ _^" ___ _ ^"" _^"

JPA2549^"" 99486081 conserved hypothetical protein ! ^', ZygjT !

;PA2551 9948610 probable transcriptional regulator 1 - .1

PA2552 9948611 probable acyl-CoA dehydrogenase iacdB

PA2553 9948612 probable acyl-CoA thiolase PA2554^" 9948613 probable short-chain dehydrogenase

PA2577 9948639 probable transcriptional regulator

PA2584 9948647 CDP-diacylglycerol--glycerol-3-phosphate 3-pήpgsA

PA2591 9948655 probable transcriptional regulator

PA2602 9948667 hypothetical protein

PA2605 9948670 conserved hypothetical protein •yheN

PA2606 9948671 conserved hypothetical protein jyheM

PA2607 9948672 conserved hypothetical protein

PA2608 9948673 conserved hypothetical protein lyccK

PA2612 9948677 seryl-tRNA synthetase serS

PA2614 9948680 periplasmic chaperone LolA lolA

PA2615 9948681 cell division protein FtsK ftsK

PA2617 9948683 leucyl/phenylalanyl-tRNA-protein transferase aat

PA2619 9948685 initiation factor infA

PA2621 9948687 conserved hypothetical protein

PA2626 . J _. 9948693 tRNA methyitransferase |trmU__ asuE

PA2629 9948696 adenylosuccinate lyase jpϋrB^"

PA2638 9948706 NADH dehydrogenase I chain B InuoB

PA2641 9948709 NADH dehydrogenase I chain F InuoF

PA2645 9948714 NADH dehydrogenase I chain J inuoJ

PA2646 9948715 j NADH dehydrogenase i chain K tnuoK

PA2658 9948728 hypothetical protein

PA2663 9948734 hypothetical protein

PA2666 9948737 probable 6-pyruvoyl tetrahydrobiopterin syntha; IptpS

IPA2667 9948738 conserved hypothetical protein

PA2668 99487391 hypothetical protein

PA2673 9948744 probable type 11 secretion system protein hplV

PA2674 9948745 probable type II secretion system protein hplU

PA2675 9948746 probable type II secretion system protein hplT

PA2678 9948749 iprobable permease of ABC-2 transporter

PA2681 9948753 probable transcriptional regulator

PA2683 9948755 probable serine/threonine dehydratase, degrad tdcB

PA2689 9948762 hypothetical protein

PA2690 9948763 probable transposase

PA2694 9948767 probable thioredoxin

PA2697 9948771 hypothetical protein

PA2703 9948777 hypothetical protein sPA2706 9948780 hypothetical protein

PA2715 99487901 probable ferredoxin

PA2719 9948795 i hypothetical protein PA2720 9948796 -hypothetical protein

PA2721 ^"9948797 '.hypothetical protein

PA2722 ^" 9948798 hypothetical protein

^■PA2723 9948799 hypothetical protein ^!PA2726 ^' 99488021 probable radical activating enzyme

PA2730 9948807 {hypothetical protein

iPA2843 9948930; probable aldolase

!^'PA2845^{~ ""} 99489321 hypothetical protein ^~~ ___^{" "}_^""_ ^""

.PA2851 ^"9948938|translation elongation factor P ^""" _„ efp

JPA2852 __^{" ■}_ ^"""9948939 {hypothetical protein 171^"™ _.7. - .._.

SPA2853 9948941 [outer membrane lipoprotein Oprl precursor .oprl

JPA2854 ^" '^{" """}9948942I conserved hypothetical protein .erfK

PA3159 9949274 iprobable UDP-glucose/GDP-mannose dehydro/vbpA

;PA3338 9949470 s hypothetical protein

PA3523 9949671 iprobable RND efflux membrane fusion protein; 'PA3528^"" 9949677. ribonuclease T ( Hit ■ PA3530^" 9949679 j conserved hypothetica I prote i n_ ^,bfd ^•PA3_533^" 9949682J conserved hypothetical protein iydhD PA3542^* 9949693 j alginate biosynthesis protein Alg44 aϊg44 ^■PA3550 99497021 alginate o-acetyltransferase AlgF _ algF PA3558 99497101 hypothetical protein IPA3566 9949719|conserved hypothetica i _r_rote i n lyciE

PA4210 9950423 probable phenazine biosynthesis protein rphzA1_ PA4211^" 9950424' probable phenazine biosynthesis protein IphzBI ■PA4212^' 9950425 i phenazine biosynthesis protein PhzC fphzcT ^!PA4215 9950428 iprobable phenazine biosynthesis protein phzF1

1PA4216 9950430; probable pyridoxamine 5'-phosph^~ate oxidase ^"iphzG

PA4219 99504331 hypothetical protein lyfpB

ill

IPA4611 9950862; hypothetical protein

PA4617 _ 9950868; conserved hypothetical protein i jo,. ._

JPA4630 9950883 [hypothetical proteirT^"

^•PA4636 99508901 hypothetical protein

PA4757 9951020ι conserved hypothetical protein yeaS_ ;PA4759^~ 9951022;dihydrodipicoϊinate reductase ___ idapB .PA4762 9951026 heat shock protein GrpE Is έ ;PA4764 9951028 ferric uptake regulation prate i n jfur___

PA4765 9951029 outer membrane lipoprotein OmlA ^"omΪA ioprX

PA4767 9951031 j conserved hypothetical protein G ^"

ΪPA5128 9951427isecretion protein SecB secB ^'PA5129^" 9951428 iglutaredoxin grx ;PA5130^" 9951429 i conserved hypothetical protein yibN PA5131^" 9951430 iphosphoglycerate mutase <pgm ,yibO

;PA5132 9951431 ; hypothetical protein

;PA5336 9951655 sguanylate kinase _:gmk

JPA5339 9951658^!conserved hypothetical protein

PA5347 99516671 hypothetical protein JPA5350^" 9951670 jrubredoxin >PA5351^" 995167l1rubredoxin

PA5358 9951678 '^'4-hydroxybenzoate-octaprenyl transferase lubiA

^•PA5364 9951685iprobable two-component response regulator 'PA5381^" 9951704 'hypothetical protein

j Protein secretion/export apparatus 417527! 418894]

^Transcriptional regulators 420683 421537' j Hypothetical, unclassified, unknown 421602 422207 j Hypothetical, unclassified, unknown 423460] 423660 ι Hypothetical, unclassified, unknown 427120 f ^" 426863;

I Hypothetical, unclassified, unknown 439991 440395! i Nucleotide biosynthesis and metabolism 445691 ! 444687.

jAmino acid biosynthesis and metabolism 989590' 990828 JTranscriptional regulators 991013; 991198.

Transcriptional regulators 992543! 991830

Hypothetical, unclassified, unknown 993409 -4' — 993783 ι Hypothetical, unclassified, unknown 993776! 994051

Transport of small molecules 996038 i 997486 !

Hypothetical, unclassified, unknown 1007548] 1007234

Carbon compound catabolism 1012972i 1011983

[Transcriptional regulators 1370092^', 1369418

; Biosynthesis of cofactors, prosthetic grouj 2171989' 2172903

jTransport of small molecules 3943806! 3942649.

[Secreted Factors (toxins, enzymes, algina 4713795; 47142831

Secreted Factors (toxins, enzymes, alg i n a 4714313] 4714801 : iSecreted Factors (toxins, enzymes, algina 4714825 4716042

Secreted Factors (toxins, enzymes, algina 4718556 4719392,

Secreted Factors (toxins, enzymes, algina 4719418 4720062;

Hypothetical, unclassified, unknown 4724034 4722850!

Transport of small molecules 4744818 4745123;

DNA replication, recombination, modificat 4747136 4746639,

Translation, post-translational modification 4754378 4753989;

Transcription, RNA processing and degra] 4755423 4754422 ^:

Translation, post-translational modification 4756066 4755446!

Translation post-translational modification 4756472 4756083;

Translation post-translational modification 4756847 4756491 ;

Translation post-translational modification 4757094 4756978

Protein secretion/export apparatus 4758451 4757123

Translation post-translational modification 4758886 4758452

Translation post-translational modification 4759066 4758890

Translation post-translational modification 4759569 4759069

Translation post-translational modification 4759923 4759573

Translation post-translational modificatio|r 4760467 4759934

Translation post-translational modification 4760871 4760479

Translation post-translational modification 4761366 4761061

Translation post-translational modification 4761919 4761380

Translation post-translational modification 4762253 4761939

Translation post-translational modificatioh 4762634 4762266

Translation post-translational modification 4762924 4762658

Translation post-translational modification 4763118 4762927

Translation post-translational modification 4763531 4763118

Translation post-translational modification 4764229 4763543

Translation post-translational modificatioh 4764574 4764242

Translation post-translational modification 4764862 4764587

Translation post-translational modification 4765700 4764879

Translation post-translational modification 4766011 4765712

Translation post-translational modification 4766610 4766008

Translation post-translational modification 4767259 4766624

Translation post-translational modification 4767653 4767342

Translation post-translational modification 4771655 4771185

Translation, post-translational modification 4772126 4771755

Transcription, RNA processing and degra; 4776477 4772278

Transcription, RNA processing and degr 4780616 4776543

Translation, post-translational modificatioh 4781206 4780838

Translation, post-translational modification 4781785 4781285!

Translation, post-translational modificatioh 4782679 4781984]

Translation, post-translational modificatioh 4783110 4782679

Transcription, RNA processing and degra. 4783760 4783227

Protein secretion/export apparatus 4784138 4783770

Hypothetical, unclassified, unknown 4787479 4786733

Hypothetical, unclassified, unknown 4819927 4820409

Two-component regulatory systems 4820531 4821358

Hypothetical, unclassified, unknown 4823363 4823079

Hypothetical, unclassified, unknown 4824123 4823386

Hypothetical, unclassified, unknown _!_ 4830553 4829642;

3445 972 0.922564

probable acetyltransferase

, penicillin-binding protein 3

■conserved hypothetical protein

{probable oxidoreductase __ ___ _ acetolactate synthase large subunit

■single-stranded-DNA-specific exonuclease RecJ ,prolyl-tRNA synthetase jurease alpha subunit type 4 fimbrial biogenesis protein PilB 30S ribosomal protein S1 glutaminyl-tRNA synthetase glucose-6-phosphate isomerase hypothetical protein electron transfer flavoprotein-ubiquinone oxidoreductase

GroEL protein

CTP synthase probable chemotaxis transducer arylsulfatase conserved hypothetical protein

GMP synthase hypothetical protein probable carbohydrate kinase phosphoglycerate mutase conserved hypothetical protein chromosomal replication initiator protein DnaA

ATP synthase alpha chain hypothetical protein apolipoprotein N-acyltransferase hypothetical protein xylulose kinase general secretion pathway protein E sodium/proton antiporter NhaB probable colicin-like toxin methylmalonate-semialdehyde dehydrogenase

RNA polymerase sigma-54 factor probable transporter

N utilization substance protein A hypothetical protein probable flavin-binding monooxygenase conserved hypothetical protein

UDP-N-acetylmuramoylalanyl-D-glutamate-2, 6-diaminopimelate ligase hypothetical protein probable amidase outer membrane protein OprM precursor

RND divalent metal cation efflux membrane fusion protein CzcB precursor

Glu-tRNA(Gln) amidotransferase subunit A pyruvate kinase II probable Mg transporter MgtE

Glu-tRNA(Gln) amidotransferase subunit B

UDP-N-acetylmuramate-alanine ligase lipoamide dehydrogenase-glc probable transporter {membrane subunit) conserved hypothetical protein

^; probable outer membrane protein

; probable ferredoxin iglutamine synthetase probable type 11 secretion system protein itrite extrusion protein 2

^• probable amidase soluble pyridine nucleotide transhydrogenase ■ replicative DNA helicase jprobable glyceraldehyde-3-phosphate dehydrogenase ! cysteinyl-tRNA synthetase exodeoxyribonuclease VII large subunit

UDP-N-acetylmuramoylalanyl-D-glutamyl-2, 6-diaminopimelate--D-alanyl-D-alanyl ligase

ATP synthase beta chain signal recognition particle protein Ffh adenylosuccinate lyase signal recognition particle receptor FtsY probable 2-isopropylmalate synthase conserved hypothetical protein hypothetical protein hypothetical protein probable dicarboxylate transporter biotin carboxylase tryptophanyl-tRNA synthetase

UDP-N-acetylmuramoylalanine-D-glutamate ligase

NADH dehydrogenase I chain F probable aldolase hypothetical protein two-component response regulator PilR phosphoglucosamine mutase aminopeptidase P probable cytochrome P450 conserved hypothetical protein secretion protein SecY hypothetical protein probable MFS transporter hypothetical protein probable MFS transporter porin O precursor

B-band O-antigen polymerase I conserved hypothetical protein probable UDP-glucose/GDP-mannose dehydrogenase WbpA probable binding protein component of ABC maltose/mannitol transporter

C4-dicarboxylate transport protein conserved hypothetical protein hypothetical protein conserved hypothetical protein

TolB protein hypothetical protein adenylosuccinate synthetase

•peptidyl-prolyl cis-trans isomerase SurA_ ienolase hypothetical protein glutamate-1 -semialdehyde 2, 1 -aminomutase _ seryl-tRNA synthetase

3-deoxy-D-manno-octulosonic-acιd (KDO) transferase hypothetical protein

3-oxoacyl-acyl carrier protein synthase II

■ glutamyl-tRNA reductase

UDP-N-acetylglucosamine 1-carboxyvinyltransferase {hypothetical protein jtranscription termination factor Rho j icell division protein FtsA I

I hypothetical protein

! conserved hypothetical protein

] ribonucleoside reductase, small chain jprobable glycosyl transferase WbpJ

] hypothetical protein i ^as artate kinase alpha and beta chain

O-antigen translocase hypothetical protein hypothetical protein probable transporter (membrane subunit) conserved hypothetical protein j probable MFS transporter jconserved hypothetical protein j probable hydrolase l hypothetical protein

GTP-binding protein Obg ~ j probable FAD-depende nt monooxygenase hypothetical protein phenazine biosynthesis protein PhzC probable type II secretion system protein probable MFS transporter conserved hypothetical protein nitrate transporter probable cytochrome b hypothetical protein

DNA/pantothenate metabolism flavoprotein membrane protein OpdE two-component sensor probable acyl-CoA thiolase j8-amino-7-oxononanoate synthase conserved hypothetical protein jcell division protein FtsW hypothetical protein probable FAD-dependent monooxygenase conserved hypothetical protein probable MFS transporter probable acyl-CoA thiolase hypothetical protein j 1-deoxy-d-xylulose 5-phosphate reductoisomerase i methionine adenosyltransferase i

Jcell divisjon protein_FtsZ s .hypothetical protein probable pyridoxal-phosphate dependent enzyme acetyl-CoA acetyltransferase iprobable molybdopterin biosynthesis protein MoeB

.conserved hypothetical protein hypothetical protein alginate biosynthesis protein Alg44

.hypothetical protein . ____ probable hydrolase succinyl-CoA synthetase beta chain hypothetical protein } probable ATP-binding component of ABC transporter probable acyl-CoA dehydrogenase j phosphoglycerate kinase | hypothetical protein | hypothetical protein probable RND efflux membrane fusion protein precursor probable peptidic bond hydrolase probable multidrug resistance efflux pump succinyl-diaminopimelate desuccinylase conserved hypothetical protein 1 probable acyl-CoA dehydrogenase > general secretion pathway protein L ] probable permease of ABC transporter erythronate-4-phosphate dehydrogenase conserved hypothetical protein hypothetical protein | probable acyl-CoA thiolase | conserved hypothetical protein 1 lipid A-disaccharide synthase

LPS biosynthesis protein WbpG hypothetical protein tRNA methyltransferase probable acyl-CoA dehydrogenase conserved hypothetical protein conserved hypothetical protein still frameshift type 4 fimbrial biogenesis protein PilC cytochrome c oxidase, subunit II conserved hypothetical protein riboflavin-specific deaminase/reductase probable glycosyltransferase WbpH 1 glycine cleavage system protein T2 * muconate cycloisomerase 1 j

UDP-glucose:(heptosyl) LPS alpha 1,3-glucosyltransferase WaaG j hypothetical protein I glutamate 5-kinase I conserved hypothetical protein hypothetical protein conserved hypothetical protein 1 hypothetical protein i aspartate semialdehyde dehydrogenase j rod shape-determining protein ( alcohol dehydrogenase (Zn-dependent)

TonB protein

'O-sialoglycoprotein endopeptidase jferrochelatase j conserved hypothetical protein ¹ probable aminotransferase

Iprobable transmembrane sensor j UDP-N-acetylpyruvoylglucosamine reductase

! hypothetical protein jacetoin catabolism protein AcoB^" conserved hypothetical protein probable oxidoreductase hypothetical protein glycosyltransferase WbpL hypothetical protein probable transposase flagellar motor switch protein FliG hypothetical protein probable transposase probable transposase probable transposase probable transposase phenylalanyl-tRNA synthetase, alpha-subunit probable permease of ABC transporter hypothetical protein hypothetical protein fructose-1 ,6-bisphosphatase conserved hypothetical protein probable ATP-binding component of ABC transporter conserved hypothetical protein hypothetical protein probable O-methyltransferase aspartate carbamoyltransferase glyceraldehyde 3-phosphate dehydrogenase conserved hypothetical protein

DNA-directed RNA polymerase alpha chain probable pyruvate dehydrogenase E1 component, beta chain tetraacyldisaccharide 4^*-kinase rod shape-determining protein MreC

D-lactate dehydrogenase (fermentative) sulfate transport protein CysA probable nucleoside hydrolase pyridoxal phosphate biosynthetic protein PdxA probable transmembrane sensor jDNA polymerase III, deita prime subunit

L-asparaginase I hypothetical protein probable bacteriophage integrase lipoate synthase hypothetical protein conserved hypothetical protein hypothetical protein probable transcriptional regulator conserved hypothetical protein conserved hypothetical protein delta 2-isopentenylpyrophosphate transferase octaprenyl-diphosphate synthase , hypothetical protein

; hypothetical protein

'probable enoyl-CoA hydratase/isomerase 'thiamine monophosphate kinase

; hypothetical protein j hypothetical protein

1 hypothetical protein

. probable serine/threonine dehydratase, degradative pseudouridine synthase conserved hypothetical protein hypothetical protein ribosomal large subunit pseudouridine synthase C probable transcriptional regulator hypothetical protein probable transmembrane sensor hypothetical protein probable transcriptional regulator probable transcriptional regulator glutathione synthetase hypothetical protein probable adhesion protein acetyl-coenzyme A carboxylase carboxyl transferase (alpha subunit) probable transcriptional regulator probable NAD-dependent epimerase/dehydratase WbpK probable oxidoreductase WpbB probable transmembrane sensor hypothetical protein glycyl-tRNA synthetase alpha chain probable lipase

LytB protein conserved hypothetical protein probable hydrolase ribose-phosphate pyrophosphokinase hypothetical protein conserved hypothetical protein porphobilinogen deaminase probable transcriptional regulator probable lauroyl acyltransferase transcriptional regulator PtxR probable transcriptional regulator hypothetical protein malonyl-CoA-[acyl-carrier-protein] transacylase J riboflavin kinase/FAD synthase conserved hypothetical protein conserved hypothetical protein probable phosphatidate cytidylyltransferase hypothetical protein icarbamate kinase hypothetical protein

' probable transcriptional regulator icatechol 1 ,2-dioxygenase

]D-alanyl-D-alanine-endopeptidase ^! probable transcriptional regulator

{hypothetical protein

'probable epimerase jlipase LipC j probable transcriptional regulator

| electron transfer flavoprotein alpha-subunit

FdhE protein j hypothetical protein hypothetical protein conserved hypothetical protein probable ATP-binding component of ABC transporter probable cytochrome c probable transcriptional regulator hypothetical protein probable transcriptional regulator probable permease of ABC transporter hypothetical protein probable transcriptional regulator probable transcriptional regulator probable transcriptional regulator

GTP-binding protein Era probable transcriptional regulator pyrroloquinoline quinone biosynthesis protein B probable cytochrome c oxidase assembly factor hypothetical protein hypothetical protein probable short chain dehydrogenase hypothetical protein hypothetical protein hypothetical protein hypothetical protein

UDP-3-O-acyl-N-acetylglucosamine deacetylase probable transcriptional regulator probable transcriptional regulator conserved hypothetical protein probable binding protein component of ABC transporter dTDP-4-dehydrorhamnose reductase conserved hypothetical protein probable transcriptional regulator hypothetical protein_ hypothetical protein probable transcriptional regulator probable transferase probable two-component response regulator probable transcriptional regulator hypothetical protein cysteine synthase B probablejjlycosyj transferase .hypothetical protein

.probable transcriptional regulator probable transcriptional regulator j probable transcriptional regulator ^j probable transcriptional regulator iprobable transcriptional regulator

.cytochrome o ubiquinol oxidase protein CyoE probable 3-hydroxyisobutyrate dehydrogenase .probable transcriptional regulator

4-hydroxybenzoate-octaprenyl transferase probable chemotaxis protein conserved hypothetical protein probable 2-OH-lauroyltransferase probable transcriptional regulator succinyl-CoA synthetase alpha chain conserved hypothetical protein geranyltranstransferase hypothetical protein ribosomal protein L11 methyltransferase glucose-1 -phosphate thymidylyltran sferase conserved hypothetical protein hypothetical protein dihydrodipicolinate synthase heat shock protein HtpX methyltransferase PilK probable transcriptional regulator conserved hypothetical protein hypothetical protein __ _ ___ _„ _ J chromosome partitioning protein SpoOJ hypothetical protein acetyl-CoA carboxylase beta subunit elongation factor Ts cell division protein ZipA

ATP synthase A chain outer membrane protein PopN lipase modulator protein hypothetical protein probable transcriptional regulator conserved hypothetical protein hypothetical protein ι cell division protein FtsQ malonate decarboxylase beta subunit

ATP synthase gamma chain probable hydrolase _ _ _ _ _ — ' hypothetical protein probable short-chain dehydrogenase spermidine synthase probable ATP-binding component of ABC transporter hypothetical protein hypothetical protein probable ATP-binding component of ABC transporter hypothetical protein .probable transcriptional regulator

,5,10-methylene-tetrahydrofolate dehydrogenase / cyclohydrolase

, sigma factor RpoH

;signal peptidase I — - - - -I hypothetical protein formyltetrahydrofolate deformylase dihydropteroate synthase conserved hypothetical protein » probable potassium channel isopentenyl monophosphate kinase . ^' hypothetical protein hypothetical protein ^'. nicotinate-nucleotide pyrophosphorylase 1 conserved hypothetical protein I hypothetical protein

2-dehydro-3-deoxyphosphooctonate aldolase j probable transmembrane sensor I urease accessory protein flagellar synthesis regulator FleN probable ATP-binding component of ABC transporter probable phenazine biosynthesis protein

ATP-binding component of ABC phosphonate transporter probable ATP-binding component of ABC transporter probable permease of ABC transporter probable short-chain dehydrogenase diaminopimelate epimerase ! probable two-component response regulator j conserved hypothetical protein 1

NH3-dependent NAD synthetase

NosY protein probable biotin synthesis protein BioC j probable transcriptional regulator : type 4 fimbrial biogenesis protein PilW j probable chemotaxis protein methyltransferase j conserved hypothetical protein

50S ribosomal protein L2 hypothetical protein probable oxidoreductase probable permease of ABC taurine transporter j conserved hypothetical protein hypothetical protein hypothetical protein phosphatidate cytidylyltransferase j phosphatidylserine synthase hypothetical protein 1 thiosulfate sulfurtransferase hypothetical protein conserved hypothetical protein J hypothetical protein ϊ hypothetical protein ) hypothetical protein probable transcriptional regulator \ robable permease of ABC transporter 'conserved hypothetical protein jprobable transcriptional regulator 1 hypothetical protein

'dϊhydrodipicolinate reductase ______

1 hypothetical protein jlipopolysaccharide core biosynthesis protein WaaP jtryptophan synthase alpha chain j probable ATP-binding component of ABC transporter hypothetical protein probable permease of ABC-2 transporter probable transcriptional regulator conserved hypothetical protein prolipoprotein diacylglyceryl transferase

3-methyl-2-oxobutanoate hydroxymethyltransferase glutamate racemase conserved hypothetical protein probable permease of ABC transporter probable permease of ABC transporter probable enoyl-CoA hydratase/isomerase probable transcriptional regulator conserved hypothetical protein thymidylate synthase hypothetical protein hypothetical protein probable enoyl-CoA hydratase/isomerase translocation protein in type 111 secretio n hypothetical protein probable pili assembly chaperone probable transcriptional regulator probable plasmid partitioning protein probable permease of ABC transporter conserved hypothetical protein methionine aminopeptidase conserved hypothetical protein hypothetical protein hypothetical protein probable transcriptional regulator probable permease of ABC-2 transporter probable NAD(P)H dehydrogenase conserved hypothetical protein hypothetical protein

1 UDP-N-acetylglucosamine acyltransferase ferredoxin-NADP+ reductase probable permease of ABC transporter conserved hypothetical protein probable enoyl-CoA hydratase/isomerase polyamine transport protein PotC ubiquinone biosynthesis methyltransferase UbiE hypothetical protein transcriptional regulator PrtR

; conserved hypothetical protein iprobable transcriptional regulator lconserved hypothetical protein iprobable exopolysaccharide transporter probable ATP-binding component of ABC transporter hypothetical protein probable short-chain dehydrogenase conserved hypothetical protein

3-deoxy-manno-octulosonate cytidylyltransferase

Iprobable transporter conserved hypothetical protein probable transcriptional regulator probable thioesterase hypothetical protein hypothetical protein hypothetical protein cis-1 ,2-dihydroxycyclohexa-3,4-diene carboxylate dehydrogenase probable enoyl-CoA hydratase/isomerase molybdopterin biosynthesis MoeB protein probable short-chain dehydrogenase conserved hypothetical protein heme exporter protein CcmC hypothetical protein tRNA (guanine-N 1 )-methyltransferase type 4 fimbrial biogenesis protein PilF imidazoleglycerol-phosphate synthase, cyclase subunit conserved hypothetical protein triosephosphate isomerase uroporphyrinogen-lll synthetase undecaprenyl pyrophosphate synthetase hypothetical protein probable cobalamin biosynthetic protein hypothetical protein hypothetical protein hypothetical protein probable short-chain dehyd rogenase hypothetical protein electron transfer flavoprotein beta-subunit conserved hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein j hypothetical protein

3-oxoacyl-[acyl-carrier-protein] reductase hypothetical protein hypothetical protein iprobable pili assembly chaperone

I DNA polymerase III, epsilon chain ]30S ribosomal protein S2 _

; hypothetical protein i hypothetical protein

• probable nucleoside phosphorylase hypothetical protein

; probable acetyltransferase hypothetical protein

TolQ protein hypothetical protein conserved hypothetical protein

.hypothetical protein

'probable pseudouridylate synthase cytidylate kinase hypothetical protein two-component response regulator

30S ribosomal protein S3 hypothetical protein probable transcriptional regulator dethiobiotin synthase molybdenum transport protein ModB transcriptional regulator Dnr hypothetical protein probable ATP-binding component of ABC transporter leucyl/phenylalanyl-tRNA-protein transferase conserved hypothetical protein

NADH dehydrogenase I chain B probable two-component response regulator hypothetical protein probable transcriptional regulator

Na+-translocating NADH:uniquinone oxidoreductase subunit Nqr4 ribonuclease T hypothetical protein conserved hypothetical protein

DNA repair protein RadC ribulose-phosphate 3-epimerase hypothetical protein

{hypothetical protein

;heme exporter protein CcmB j hypothetical protein

[urease accessory protein UreF {ribose 5-p osphate isomerase

[ phosphoribosylaminoimidazole synthetase Iprobable transcriptional regulator iprobable transcriptional regulator Iprobable transcriptional regulator

I hypothetical protein

I conserved hypothetical protein

'probable acetyltransferase

[probable transcriptional regulator iprobable two-component response regulator j conserved hypothetical protein

^! 2-keto-3-deoxy-6-phosphogluconate aldolase Iprobable permease of ABC transporter

] hypothetical protein

; hypothetical protein

Iprobable transcriptional regulator i hypothetical protein ^{"" """} j hypothetical protein _ _ -„ jriboflavin synthase alpha chain

■conserved hypothetical protein -- -- hiopurine methyltransferase iprobable permease of ABC transporter

■ alginate o-acetyltransferase AlgF conserved hypothetical protein . _ j conserved hypothetical protein i probable transcriptional regulator pyridoxine 5'-phosphate oxidase hypothetical protein hypothetical protein probable carboxylesterase pyoverdine biosynthesis protein PvcD probable transcriptional regulator probable carbonic anhydrase conserved hypothetical protein probable pyridoxamine δ'-phosphate oxidase probable pyridoxamine 5'-phosphate oxidase

— - hypothetical protein probable glutathione S-transferase hypothetical protein transcriptional regulator Vfr hypothetical protein orotate phosphoribosyltransferase glutamine amidotransferase ' hypothetical protein j hypothetical protein 1 maleylacetoacetate isomerase i probable radical activating enzyme \ hypothetical protein ; uracil phosphoribosyltransferase { hypothetical protein J endonuclease III ^'* probable transcriptional regulator 1 i probable antioxidant protein j hypothetical protein ; conserved hypothetical protein ' hypothetical protein i probable tolQ-type transport protein pseudouridine synthase RluA conserved hypothetical protein >.

50S ribosomal protein L3 j conserved hypothetical protein hypothetical protein ; hypothetical protein probable two-component response regulator thymidylate kinase conserved hypothetical protein ] conserved hypothetical protein ! probable aromatic acid decarboxylase 1 'hypothetical protein

; probable nuclease ψeriplasmic chaperone LolA [hypothetical protein^" ___ probable oxidoreductase hypothetical protein hypothetical protein cell division protein FtsJ hypothetical protein hypothetical protein hypothetical protein

30S ribosomal protein S4 homoserine kinase hypothetical protein probable lipoprotein localization protein LolB stringent starvation protein A hypothetical protein

GTP cyclohydrolase II hypothetical protein heme acquisition protein HasAp probable transcriptional regulator probable peptide chain release factor probable ribosomal protein L25 hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein conserved hypothetical protein guanylate kinase glutamine amidotransferase conserved hypothetical protein hypothetical protein protocatechuate 3,4-dioxygenase, alpha subunit hypothetical protein autoinducer synthesis protein Lasl probable Clp-family ATP-dependent protease hypothetical protein

50S ribosomal protein L4 conserved hypothetical protein probable nitroreductase hypothetical protein hypothetical protein hypothetical protein conserved hypothetical protein probable molybdopterin-guanine dinucleotide biosynthesis protein MobA hypothetical protein cytochrome c-type protein NapC conserved hypothetical protein j hypothetical protein i hypothetical protein i probable phosphoheptose isomerase i probable type II secretion system protei n

^■hypothetical protein

I hypothetical protein

; hypothetical protein __ ___ ____

^hypothetical protein

■ hypothetical protein

.type 4 fimbrial biogenesis protein PilX_ ; conserved hypothetical jjrotein

,anti-sigma factor MucA

[probable transcriptional regulator j hypothetical protein conserved hypothetical p/otein conserved hypothetical protein hypothetical protein peptidyl-tRNA hydrolase hypothetical protein ! superoxide dismutase hypothetical protein hypothetical protein conserved hypothetical protein hypothetical protein hypothetical protein probable DNA invertase probable acetyltransferase WbpD hypothetical protein hypothetical protein hypothetical protein conserved hypothetical protein hypothetical protein conserved hypothetical protein J ribosomal protein alanine acetyltransferase

I probable transcriptional reg ulator

[hypothetical protein

[conserved hypothetical protein , [conserved hypothetical protein translatioTTelongation factor P j conserved hypothetical protein j hypothetical protein transcriptional regulator NfxB i probable transcriptional regulator Iprobable protease ! j alkyl hydroperoxide reductase subunit C i j peptidyl-prolyl cis-trans isomerase A j

[hypothetical protein __ ^{" —} ~ ~ hypothetical protein ^{" "} ~ | hypothetical protein

GTP cyclohydrolase I precursor probable transcriptional regulator heat shock protein GrpE

CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase conserved hypothetical protein conserved hypothetica] protein ribosome recycling factor

^■conserved hypothetical protein _ hypothetical protein

{hypothetical protein ^j hypothetical protein

Iprobable transcriptional regulator ^•conserved hypothetical protein

I hypothetical protein s translation initiation factor 1F-3 potassium-transporting ATPase, C chain probable transcriptional regulator conserved hypothetical protein conserved hypothetical protein adenine phosphoribosyltransferase conserved hypothetical protein dTDP-4-dehydrorhamnose 3,5-epimerase hypothetical protein probable sigma-70 factor, ECF subfamily

GTP cyclohydrolase I precursor hypothetical protein cytochrome C biogenesis protein CcmG conserved hypothetical protein

50S ribosomal protein L5 hypothetical protein conserved hypothetical protein conserved hypothetical protein

ATP synthase delta chain

NosL protein conserved hypothetical protein conserved hypothetical protein conserved hypothetical protein

50S ribosomal protein L6 conserved hypothetical protein conserved hypothetical protein transcription antitermination protein NusG hypothetical protein hypothetical protein conserved hypothetical protein lactoylglutathione lyase outer membrane lipoprotein OmlA hypothetical protein inorganic pyrophosphatase probable sigma-70 factor, ECF subfamily conserved hypothetical protein conserved hypothetical protein hypothetical protein

16S rRNA processing protein hypothetical protein hypothetical protein iheme d1 biosynthesis protein NirL hypothetical protein

[hypothetical protein ~

ATP synthase B chain

;30S ribosomal protein S7

,cyanate lyase biotin carboxyl carrier prote n (BCCP) probable dna-binding stress protein 'hypothetical protein

'conserved hypothetical protein i hypothetical protein j hypothetical protein

■ cytochrome C-type biogenesis protein CcmH hypothetical protein j hypothetical protein hypothetical protein probable thioredoxin conserved hypothetical protein hypothetical protein nitrogen regulatory 1IA protein hypothetical protein conserved hypothetical protein phosphotyrosine protein phosphatase probable HIT family protein conserved hypothetical protein hypothetical protein hypothetical protein conserved hypothetical protein i conserved hypothetical protein ^"] conserved hypothetical protein hypothetical protein probable deaminase conserved hypothetical protein conserved hypothetical protein osmotically inducible protein OsmC deoxyuridine 5'-triphosphate nucleotidohydrolase conserved hypothetical protein hypothetical protein hypothetical protein hypothetical protein molybdopterin converting factor, large subunit conserved hypothetical protein conserved hypothetical protein conserved hypothetical protein probable type II secretion system protein type 4 fimbrial precursor PilA probable transcriptional regulator hypothetical protein hypothetical protein

3-dehydroquinate dehydratase ribonuclease H hypothetical protein hypothetical protein probable peptide deformylase probable tfanscriptional regulator . _j flagellar protein FliJ ~ ^{" "" ~} ~ ~

;TolR protein conserved hypothetical protein

<(3R)-hydroxymyristoyl-[acyl carrier protein] dehydratase hypothetical protein ---- -- —

'hypothetical protein

■conserved hypothetical protein conserved hypothetical protein 'probable transcriptional regulator conserved hypothetical protein » hypothetical protein exoenzyme S synthesis protein C precursor , probable transcriptional regulator ] hypothetical protein | hypothetical protein i

50S ribosomal protein L15 i hypothetical protein i conserved hypothetical protein hypothetical protein conserved hypothetical protein conserved hypothetical protein hypothetical protein i probable type II secretion system protein | helix destabilizing protein of bacteriophage Pfl | hypothetical protein | nucleoside diphosphate kinase j

50S ribosomal protein L11 I hypothetical protein j hypothetical protein ]

50S ribosomal protein L13 hypothetical protein hypothetical protein hypothetical protein conserved hypothetical protein probable transcriptional regulator j hypothetical protein probable type II secretion system protein hypothetical protein

ATP synthase epsilon chain hypothetical protein conserved hypothetical protein hypothetical protein j hypothetical protein j conserved hypothetical protein j conserved hypothetical protein conserved hypothetical protein conserved hypothetical protein hypothetical protein

30S ribosomal protein S6 hypothetical protein ι hypothetical protein | conserved hypothetical protein j conserved hypothetical protein ■ hypothetical protein j hypothetical protein hypothetical protein i conserved hypothetical protein j hypothetical protein i hypothetical protein

(^"conserved hypothetical protein

{hypothetical protein

Ϊ50S ribosomal protein L16 i hypothetical protein iprobable type II secretion systern protein [hypothetical protein cytochrome c5 hypothetical protein hypothetical protein hypothetical protein ribonuclease P protein component stringent starvation protein B probable fosfomycin resistance protein hypothetical protein hypothetical protein hypothetical protein ferric uptake regulation protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein probable transcriptional regulator iprobable NADH-ubiquinone/plastoquinone oxidoreductase

{ hypothetical protein s conserved hypothetical protein j hypothetical protein j hypothetical protein j hypothetical protein probable transcriptional regulator __ ___ _ hypothetical protein ___ ^" j

[hypothetical protein ( alkaline proteinase inhibitor Aprl lactoylglutathione lyase hypothetical protein j hypothetical protein

| hypothetical protein iprobable heat shock protein

[hypothetical protein

[conserved hypothetical protein hypothetical protein hypothetical protein

|30S ribosomal protein S8 hypothetical protein

■5-carboxymethyl-2-hydroxymuconate isomerase ^•30S ribosomal protein S9 ; hypothetical protein ^■hypothetical protein

.probable cytochrome c(mono-heme type) 130S ribosomal protein S11 »50S ribosomal protein L17

! secretion protein SecG i hypothetical protein j hypothetical protein ! hypothetical protein probable iron-binding protein IscU succinate dehydrogenase (C subunit) hypothetical protein hypothetical protein

[conserved hypothetical protein conserved hypothetical protein glycine cleavage system protein H2

[hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein aspartate 1-decarboxylase precursor hypothetical protein hypothetical protein conserved hypothetical protein probable ring-cleaving dioxygenase hypothetical protein

ATP synthase protein I conserved hypothetical protein conserved hypothetical protein hypothetical protein hypothetical protein conserved hypothetical protein conserved hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein conserved hypothetical protein hypothetical protein hypothetical protein conserved hypothetical protein probable type II secretion system protein hypothetical protein two-component response regulator CheY hypothetical protein hypothetical protein transcriptional regulator MvaT, P16 subunit d-erythro-7,8-dihydroneopterin triphosphate epimerase

J30S ribosomal protein S12

[conserved hypothetical protein [hypothetical protein __

■conserved hypothetical protein hypothetical protein

.conserved hypothetical protein

' hypothetical protein

'hypothetical protein

1 hypothetical protein i conserved hypothetical protein j conserved hypothetical protein

^■hypothetical protein

[conserved hypothetical protein hypothetical protein hypothetical protein_ hypothetical protein probable ferredoxin nitrogen regulatory protein P-ll 2 ferredoxin [2Fe-2S] conserved hypothetical protein conserved hypothetical protein type III export protein Pscl hypothetical protein conserved hypothetical protein conserved hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein conserved hypothetical protein phosphoribosyl-ATP pyrophosphohydrolase conserved hypothetical protein

50S ribosomal protein L22

SMR multidrug efflux transporter hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein j conserved hypothetical protein

[conserved hypothetical protein

{hypothetical protein conserved hypothetical protein in type III secretion [conserved hypothetical protein _____

[hypothetical protein

[hypothetical protein

; assimilatory nitrite reductase small subunit hypothetical protein conserved hypothetical protein probable thioredoxin thioredoxin probable bacteriophage protein

'conserved hypothetical protein 'hypothetical protein

[probable transporter hypothetical protein hypothetical protein hypothetical protein hypothetical protein probable iron-binding protein IscA hypothetical protein

DNA-binding protein Fis hypothetical protein conserved hypothetical protein hypothetical protein hypothetical protein hypothetical protein sarcosine oxidase delta subunit hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein transcriptional regulator PrtN

50S ribosomal protein L24 hypothetical protein hypothetical protein conserved hypothetical protein hypothetical protein hypothetical protein conserved hypothetical protein

30S ribosomal protein S10 probable transcriptional regulator

50S ribosomal protein L21 hypothetical protein hypothetical protein

NADH dehydrogenase I chain K conserved hypothetical protein conserved hypothetical protein conserved hypothetical protein hypothetical protein conserved hypothetical protein probable transporter hypothetical protein conserved hypothetical protein hypothetical protein hypothetical protein s salicylate biosynthesis protein PchB hypothetical protein conserved hypothetical protein

30S ribosomal protein S14 conserved hypothetical protein morphogene protein BolA hypothetical protein

[hypothetical protein

[hypothetical protein

( hypothetical protein [integration host factor, alpha subun i t_ [conserved hypothetical protein

[hypothetical protein

J50~S ribosomal protein L23

[hypothetical protein

[hypothetical protein i conserved hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein regulator in type 111 secretion hypothetical protein cell division protein FtsL

GroES protein conserved hypothetical protein conserved hypothetical protein hypothetical protein hypothetical protein

Glu-tRNA(Gln) amidotransferase subunit C hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein conserved hypothetical protein hypothetical protein hypothetical protein hypothetical protein conserved hypothetical protein integration host factor beta subunit hypothetical protein hypothetical protein conserved hypothetical protein hypothetical protein hypothetical protein hypothetical protein probable DNA binding protein peptidyl-prolyl cis-trans isomerase C2 hypothetical protein hypothetical protein hypothetical protein pyrroloquinoline quinone biosynthesis protein D peptidyl-prolyl cis-trans isomerase C1 hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein

130S ribosomal protein S2Q i hypothetical protein 30S ribosomal protein S19 hypothetical protein probable acylphosphatase

• hypothetical protein conserved hypothetical protein _______ conserved hypothetical protein _

■ hypothetical protein

.probable phosphoryl cajrier protein

.hypothetical protein hypothetical protein hy poth etical protein flagellar biosynthetic protein FliQ hypothetical protein

30S ribosomal protein S15 conserved hypothetical protein conserved hypothetical protein

J30S ribosomal protein S17 hypothetical protein hypothetical protein hypothetical protein conserved hypothetical protein hypothetical protein conserved hypothetical protein pyocin S2 immunity protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein type III export protein PscF atp synthase C chain hypothetical protein hypothetical protein

50S ribosomal protein L27 conserved hypothetical protein hypothetical protein glutaredoxin hypothetical protein hypothetical protein hypothetical protein hypothetical protein cell division topological specificity factor MinE molybdopterin converting factor, small subunit major outer membrane Npoprotein precursor

[hypothetical protein

30S ribosomal protein S16 __

[ferredoxin [4Fe-4S]

[conserved hypothetical protein

I conserved hypothetical protein probable biotin-requiring enzyme

[translocation protein TatA conserved hypothetcafprotein I hypothetical protein hypothetical protein [hypothetical protein .probable ferredoxin conserved hypothetical protein

[hypotheticai protein _

(hypothetical protein i regulatory protein RsaL

{conserved hypothetical protein i hypothetical protein

[conserved hypothetical protein [probable acyl carrier protein conserved hypothetical protein probable acyl carrier protein hypothetical protein conserved hypothetical protein hypothetical protein

50S ribosomal protein L28 acyl carrier protein hypothetical protein hypothetical protein conserved hypothetical protein hypothetical protein hypothetical protein

30S ribosomal protein S18 hypothetical protein hypothetical protein hypothetical protein j hypothetical protein s hypothetical protein hypothetical protein hypothetical protein conserved hypothetical protein hypothetical protein conserved hypothetical protein hypothetical protein hypothetical protein conserved hypothetical protein hypothetical protein hypothetical protein hypothetical protein conserved hypothetical protein hypothetical protein conserved hypothetical protein initiation factor hypothetical protein hypothetical protein hypothetical protein hypothetical protein

30S ribosomal protein S21 hypothetical protein of bacteriophage Pf1_

'ribosome modulation factor i hypothetical protein hypothetical protein - - - --

. hypothetical protein hypothetical protein ^" ~ ^"

'conserved hypothetical protein

- -

'hypothetical protein ~

^■probable cold-shock protein hypothetical protein

; hypothetical protein i hypothetical protein hypothetical protein i probable cold-shock protein 1 cold acclimation protein B s hypothetical protein > conserved hypothetical protein 1 probable transcriptional regulator j probable transcriptional regulator I type III export protein PscE I conserved hypothetical protein j conserved hypothetical protein ( hypothetical protein J conserved hypothetical protein hypothetical protein j conserved hypothetical protein j hypothetical protein ! hypothetical protein j hypothetical protein ; hypothetical protein *

50S ribosomal protein L35 j hypothetical protein

50S ribosomal protein L29 hypothetical protein carbon storage regulator ] hypothetical protein ] hypothetical protein j conserved hypothetical protein j conserved hypothetical protein ! hypothetical protein

50S ribosomal protein L32 hypothetical protein hypothetical protein ] hypothetical protein hypothetical protein i hypothetical protein |

50S ribosomal protein L30 j hypothetical protein j hypothetical protein j hypothetical protein j hypothetical protein | periplasmic nitrate reductase protein NapE | rubredoxin 1 rubredoxin j conserved hypothetical protein 1 hypothetical protein

'hypothetical protein ^•hypothetical protein i conserved hypothetical protein ^'hypothetical protein conserved hypothetical protein conserved hypothetical protein ■ hypothetical protein j hypothetical protein lipopeptide precursor hypothetical protein

50S ribosomal protein L34 hypothetical protein hypothetical protein

50S ribosomal protein L36

KdpF protein pyrroloquinoline quinone biosynthesis protein A

012B01 3690219, PAK

.!^■ .„„tι ιι„,;ι !ι, ,„ «" ".'I' ,.!!„ 'Ir;!.'

019E09 5392754* PAK

019E1 1 ; 5938984! PAK

019F01 ! 4396977! PAK

019F02 I 1747643! PAK

'-— - 019F03 I 6029230! PAK

, 019F04 ] 4444027! PAK

028E09 619752! PAK

030B11 2551514' PAK

041B10 328219 PAK

041B11 6103841 PAK

056F06 1146439; PAK

069G04 i 2715493] PAK pili- ^;

069G05 ; 1287218! PAK pili- '

069G06 ; 4212743! PAK pili-

069G07 442295! PAK pili- , 069G08 ; 3816790! PAK pili-

069G09 i 4573179! PAK pili-

069G10 ; 5582901! PAK pili-

139D07 1280009! PAK

139D08 953023! PAK

159G04 ! 4985650! PA01

159G05 ! 2598751! PA01

159G06 | 1636680: PA01

162D11 2043785! PA01

162D12 3019863] PA01

172G08 3515481! PA01

172G09 5373814! PA01

193F03 2057629] PA01

223A08 5242954' PA01

] 223A09 i 800304: PA01

223A11 4194332; PA01

223A12 i 973842! PA01 ! 223B01 ! 2022761] PA01

223B03 ; 1832265] PA01

223B05 3876264! PA01

Medline Ul Gene Organism PAJD~l

94049123 metK Escherichia coli 546

97075927 rpoD Rhodobacter capsulatus 576

98414051 ygjo Escherichia coli 580

90330537 surA Escherichia coli 594

88262245 era Escherichia coli 771

97295239 era Salmonella typhimurium ^' 771

97113525 tolQ Pseudomonas aeruginosa 969

97113525 tolR Pseudomonas aeruginosa 970

97113525 tolA Pseudomonas aeruginosa 971

92355498 dapE Escherichia coli 1162

95095976 flhA Paracoccus denitrificans 1452

98414051 ycfB Escherichia coli 1678

98429489 clpP Caulobacter crescentus 1801

98429489 clpX Caulobacter crescentus 1802

93224448 Ion Myxococcus xanthus 1803

99065127 lolA Escherichia coli 2614

94110226 infA Escherichia coli 2619

98241618 IpxK Escherichia coli 2981

91348525 metZ Escherichia coli.;,. 3107

92193258 folC Escherichia cόli 31-11

96405645 htrB Escherichia coli 3242

95014035 surE Escherichia coli 3625

94240115 frr Escherichia coli 3653

93077430 smbA Escherichia coli 3654

96228708 ispA Shigella flexneri 4043

88163790 tufA Escherichia coli 4265

^' 90264268 rpoB Escherichia coli 4270

96107188 IpxC Escherichia coli 4406

84236117 ftsZ Escherichia coli 4407

84236117 ftsA Escherichia coli 4408

93003529 murG Bacillus subtilis 4412

97361813 ftsW Escherichia coli 4413

99047598 mraY Escherichia coli 4415

99029898 rluD Escherichia coli 4544

99000128 bg Streptomyces coelicolor 4566

97284515 ispB Escherichia coli 4569

93259941 muri Escherichia coli 4662

91311678 infB Escherichia coli 4744

92355498 dnaj Escherichia coli 4760

92355498 dnak Escherichia coli 4761

98414051 yjeQ Escherichia coli 4952

96070892 kdtA Escherichia coli 4988

96405645 msbA Escherichia coli 4997

96347399 trxA Synechocytis 5240

97177775 trxA Rhodobacter sphaeroides 5240

93125123 polA Streptococcus pneumoniae 5493

94012475 glmU Escherichia coli 5552 REFERENCES

Hardalo, C, Edberg, S. (1991), " Pseudomonas aeruginosa: assessment of risk from drinking water", Critical Reviews in Microbiology; 23(1), 47-75.

Stover, K., Pham, X., Erwin, L., Mizoguchi, D., Warrener, P., Hickey, J., Brinkman, S., Hufnagle, W., Kowalik, J., Lagrou, M., Garber, L., Goltry, L., Tolentino, E., Westbrock-Wadman, S., Yuan, Y., Brody, L., Coulter, N., Folger, K, Kas, A., Larbig, K., Lim, R., Smith, K., Spencer, D., Wong, G, Wu, Z., Paulsen, I. (2000), "Complete genome sequence of Pseudomonas aeruginosa PAOl, an opportunistic pathogen," Nature. 406 (6799), 959-964.

Bodey, G., Bolivar, R., Fainstein, N., Jadeja, L. (1983), "Infections caused by Pseudomonas Aeruginosa," Reviews of Infectious Diseases, 5(2), 279-313.

Tummler, B., Bosshammer, J., Breitenstein, S., Brockhausen, I., Gudowius, P., Herrmann, C, Herrmann, S., Heuer, T., Kubesch, P. Mekus, F, Romling, U., Schmidt, K, Spangenberg, C, Walter, S. (1997), "Infections with Pseudomonas aeruginosa in patients with cystic fibrosis," Behring Institute Mitteilungen, 98 249-55.

Reznikoff ,W. (1993), "The Tn5 Transposon," Annual Review of Microbiology; 47, 945-63.

Blumenthal, S.,Dayhiya, R. C, and Gross, A. j. (1978), "Estimating the Complete Sample Size from an Incomplete Possion Sample," Journal of American Statistical Association, 73, 182-187.

Claims

What is claimed:

1. An isolated nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide having at least 80% sequence identity to a polypeptide encoded by a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1.

2. The isolated nucleic acid molecule of claim wherein the sequence encodes a polypeptide having at least 90% sequence identity to said nucleic acid sequence.

3. The isolated nucleic acid sequence of claim 1 wherein the sequence encodes a polypeptide having at least 95% sequence identity to said nucleic acid sequence.

4. An isolated nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide having at least 80% sequence identity to a polypeptide encoded by an essential or important nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1, wherein said essential or important nucleic acid sequence is identified as being essential or important by integration knock-out coupled with extra-chromosomal complementation.

5. The isolated nucleic acid sequence of claim 4 wherein the sequence encodes a polypeptide having at least 90% sequence identity to said essential polypeptide.

6. The isolated nucleic acid sequence of claim 5 wherein the sequence encodes a polypeptide having at least 95% sequence identity to said essential polypeptide.

7. An isolated nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide having at least 80% sequence identity to a polypeptide encoded by an essential or important nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1, wherein said essential or important nucleic acid sequence is identified as being essential by integration of a regulatable promoter into the gene.

8. The isolated nucleic acid sequence of claim 7 which encodes a polypeptide having at least 90% sequence identity to said polypeptide.

9. The isolated nucleic acid sequence of claim 8 which encodes a polypeptide having at least 95% sequence identity to said polypeptide.

10. A method of screening for an antibacterial agent, comprising determining whether a test compound is active against the bacterial gene of claim 1.

11. A method of screening for an antibacterial agent, comprising determining whether a test compound is active against the bacterial gene of claim 2

12. A method of screening for an antibacterial agent, comprising determining whether a test compound is active against the bacterial gene of claim 3.

13. A method of screening for an antibacterial agent, comprising determining whether a test compound is active against the protein encoded by the bacterial gene of claim 1.

14. A method of screening for an antibacterial agent, comprising determining whether a test compound is active against the protein encoded by the bacterial gene of claim 2.

15. A method of screening for an antibacterial agent, comprising determining whether a test compound is active against the protein encoded by the bacterial gene of claim 3.

16. A method of screening for an antibacterial agent, comprising determining whether a test compound is active against the essential or important bacterial gene of claim 4.

17. A method of screening for an antibacterial agent, comprising determining whether a test compound is active against the essential or important bacterial gene of claim 5.

18. A method of screening for an antibacterial agent, comprising determining whether a test compound is active against the essential or important bacterial gene of claim 6.

19. A method of screening for an antibacterial agent, comprising determining whether a test compound is active against the protein encoded by the essential or important bacterial gene of claim 4.

20. A method of screening for an antibacterial agent, comprising determining whether a test compound is active against the protein encoded by the essential or important bacterial gene of claim 5.

21. A method of screening for an antibacterial agent, comprising determining whether a test compound is active against the protein encoded by the essential or important bacterial gene of claim 6.

22. A method of screening for an antibacterial agent, comprising determining whether a test compound is active against the essential or important bacterial gene of claim 7.

23. A method of screening for an antibacterial agent, comprising determining whether a test compound is active against the essential or important bacterial gene of claim 8.

24. A method of screening for an antibacterial agent, comprising determining whether a test compound is active against the essential or important bacterial gene of claim 9.

25. A method of screening for an antibacterial agent, comprising determining whether a test compound is active against the protein encoded by the essential or important bacterial gene of claim 7.

26. A method of screening for an antibacterial agent, comprising determining whether a test compound is active against the essential or important bacterial gene of claim 8.

27. A method of screening for an antibacterial agent, comprising determining whether a test compound is active against the essential or important bacterial gene of claim 9.

28. The method of claim 13, comprising the steps of: a) contacting said protein or a biologically active fragment thereof with a test compound; and b) determining whether said test compound binds to said protein or said fragment; wherein binding of said test compound to said polypeptide or said fragment is indicative that said test compound is an antibacterial agent.

29. The method of claim 14, comprising the steps of: a) contacting said protein or a biologically active fragment thereof with a test compound; and b) determining whether said test compound binds to said protein or said fragment; wherein binding of said test compound to said polypeptide or said fragment is indicative that said test compound is an antibacterial agent.

30. The method of claim 15, comprising the steps of: a) contacting said protein or a biologically active fragment thereof with a test compound; and b) determining whether said test compound binds to said protein or said fragment; wherein binding of said test compound to said polypeptide or said fragment is indicative that said test compound is an antibacterial agent.

31. The method of claim 19, comprising the steps of: a) contacting said protein or a biologically active fragment thereof with a test compound; and b) determining whether said test compound binds to said protein or said fragment; wherein binding of said test compound to said polypeptide or said fragment is indicative that said test compound is an antibacterial agent.

32. The method of claim 20, comprising the steps of: a) contacting said protein or a biologically active fragment thereof with a test compound; and b) determining whether said test compound binds to said protein or said fragment; wherein binding of said test compound to said polypeptide or said fragment is indicative that said test compound is an antibacterial agent.

33. The method of claim 21 , comprising the steps of: a) contacting said protein or a biologically active fragment thereof with a test compound; and b) determining whether said test compound binds to said protein or said fragment; wherein binding of said test compound to said polypeptide or said fragment is indicative that said test compound is an antibacterial agent.

34. The method of claim 25, comprising the steps of: a) contacting said protein or a biologically active fragment thereof with a test compound; and b) determining whether said test compound binds to said protein or said fragment; wherein binding of said test compound to said polypeptide or said fragment is indicative that said test compound is an antibacterial agent.

35. The method of claim 26, comprising the steps of: a) contacting said protein or a biologically active fragment thereof with a test compound; and b) determining whether said test compound binds to said protein or said fragment; wherein binding of said test compound to said polypeptide or said fragment is indicative that said test compound is an antibacterial agent.

36. The method of claim 27, comprising the steps of: a) contacting said protein or a biologically active fragment thereof with a test compound; and b) determining whether said test compound binds to said protein or said fragment; wherein binding of said test compound to said polypeptide or said fragment is indicative that said test compound is an antibacterial agent.

37. A method for evaluating a test agent for inhibition of expression of the gene of claim 1, comprising: a) contacting a cell expressing said gene with said agent; and b) determining the amount or level of expression of said essential gene in said sample.

38. A method for evaluating a test agent for inhibition of expression of the gene of claim 2, comprising: a) contacting a cell expressing said gene with said agent; and b) determining the amount or level of expression of said essential gene in said sample.

39. A method for evaluating a test agent for inhibition of expression of the gene of claim 3, comprising: a) contacting a cell expressing said gene with said agent; and b) determining the amount or level of expression of said essential gene in said sample.

40. A method for evaluating a test agent for inhibition of expression of the essential or important gene of claim 4, comprising: a) contacting a cell expressing said essential or important gene with said agent; and b) determining the amount or level of expression of said essential or important gene in said sample.

41. A method for evaluating a test agent for inhibition of expression of the gene of claim 5, comprising: a) contacting a cell expressing said gene with said agent; and b) determining the amount or level of expression of said essential gene in said sample.

42. A method for evaluating a test agent for inhibition of expression of the gene of claim 6, comprising: a) contacting a cell expressing said gene with said agent; and b) determining the amount or level of expression of said essential gene in said sample.

43. A method for evaluating a test agent for inhibition of expression of the essential or important gene of claim 7, comprising: a) contacting a cell expressing said essential or important gene with said agent; and b) determining the amount or level of expression of said essential or important gene in said sample.

44. A method for evaluating a test agent for inhibition of expression of the gene of claim 8, comprising: a) contacting a cell expressing said gene with said agent; and b) determining the amount or level of expression of said essential gene in said sample.

45. A method for evaluating a test agent for inhibition of expression of the gene of claim 9, comprising: a) contacting a cell expressing said gene with said agent; and b) determining the amount or level of expression of said essential gene in said sample.

46. The method of claim 37, wherein said level of expression is measured by measuring the amount of expression product in said cell relative to a cell that has not been contacted with said agent.

47. A method for evaluating a test agent for inhibition of expression of the gene of claim 38, comprising: a) contacting a cell expressing said gene with said agent; and b) determining the amount or level of expression of said essential gene in said sample.

48. A method for evaluating a test agent for inhibition of expression of the gene of claim 39, comprising: a) contacting a cell expressing said gene with said agent; and b) determining the amount or level of expression of said essential gene in said sample.

49. The method of claim 37, wherein said level of expression is measured by measuring the level of expression of a gene fusion to said gene relative to a cell containing said gene fusion that has not been contacted with said agent.

50. The method of claim 38, wherein said level of expression is measured by measuring the level of expression of a gene fusion to said gene relative to a cell containing said gene fusion that has not been contacted with said agent.

51. The method of claim 39, wherein said level of expression is measured by measuring the level of expression of a gene fusion to said gene relative to a cell containing said gene fusion that has not been contacted with said agent.

52. The method of claim 37, wherein said level of expression is measured by measuring the level of expression of a protein fusion to said gene relative to a cell containing said protein fusion that has not been contacted with said agent.

53. The method of claim 38, wherein said level of expression is measured by measuring the level of expression of a gene fusion to said gene relative to a cell containing said gene fusion that has not been contacted with said agent.

54. The method of claim 39, wherein said level of expression is measured by measuring the level of expression of a gene fusion to said gene relative to a cell containing said gene fusion that has not been contacted with said agent.

55. A method for evaluating an potential antibacterial agent, comprising the steps of: a)providing a bacterial strain comprising a mutant form of the gene of claim 1, wherein said mutant form of the gene confers a growth conditional or attenuated growth phenotype; b)contacting bacteria of said bacterial strain with said test compound in semi-permissive or permissive growth conditions; and c)determining whether the growth of said bacterial strain comprising said mutant form of a gene is reduced in the presence of said test compound to a greater extent than a comparison bacteria comprising a normal form of said gene.

56. A method for evaluating an potential antibacterial agent, comprising the steps of: a)providing a bacterial strain comprising a mutant form of the gene of claim 2, wherein said mutant form of the gene confers a growth conditional or attenuated growth phenotype; b)contacting bacteria of said bacterial strain with said test compound in semi-permissive or permissive growth conditions; and c)determining whether the growth of said bacterial strain comprising said mutant form of a gene is reduced in the presence of said test compound to a greater extent than a comparison bacteria comprising a normal form of said gene.

57. A method for evaluating an potential antibacterial agent, comprising the steps of: a)providing a bacterial strain comprising a mutant form of the gene of claim 3, wherein said mutant form of the gene confers a growth conditional or attenuated growth phenotype; b)contacting bacteria of said bacterial strain with said test compound in semi-permissive or permissive growth conditions; and c)determining whether the growth of said bacterial strain comprising said mutant form of a gene is reduced in the presence of said test compound to a greater extent than a comparison bacteria comprising a normal form of said gene.

58. A library of nucleic acid sequences consisting essentially of nucleic acid sequences having at least 80% protein sequence identity to a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1, wherein said library of nucleic acid sequences is employed to identify essential genes in Pseudomonas.

59. The library of 58 wherein said nucleic acid sequences encode proteins having at least 90% sequence identity to the open reading frames in Table 1.

60. The library of 58 wherein said nucleic acid sequences encode proteins having at least 95% sequence identity to the open reading frames in Table 1.

61. A map of at least about 10,000 to about 14,000 transposon insertions in the genome of Pseudomonas aeruginosa, wherein said map is useful for identifying genes that are essential or important for survival of said Pseudomonas aeruginosa.

62. A vector comprising a promoter operably linked to the nucleic acid sequence of claim 1.

63. A vector comprising a promoter operably linked to the nucleic acid sequence of claim 2.

64. A vector comprising a promoter operably linked to the nucleic acid sequence of claim 3.

65. The vector of claim 62, wherein said promoter is active in Pseudomonas aeruginosa, Escherichia coli, Staphylococcus aureus, Hemophilus influenzae, Neisseria gonorrhea, Klebsiella pneumoniae, and Streptocooci.

66. The vector of claim 63 , wherein said promoter is active in Pseudomonas aeruginosa, Escherichia coli, Staphylococcus aureus, Hemophilus influenzae, Neisseria gonorrhea, Klebsiella pneumoniae, and Streptocooci.

61. The vector of claim 64, wherein said promoter is active in Pseudomonas aeruginosa, Escherichia coli, Staphylococcus aureus, Hemophilus influenzae, Neisseria gonorrhea, Klebsiella pneumoniae, and Streptocooci.

68. A host cell comprising the vector of claim 65.

69. A host cell comprising the vector of claim 66.

70. A host cell comprising the vector of claim 67.

71. A fragment of the nucleic acid of claim 1 , 2 or 3 said fragment comprising at least 10, at least 20, at least 25, at least 30, or at least 50 consecutive bases of said nucleic acid.

72. A protein having at least about 80% sequence identity to the protein encoded by the nucleic acid of claim 1, 2 or 3.

73. A protein having at least about 80% sequence identity to the protein encoded by the nucleic acid of claim 4, 5 or 6.

74. A protein having at least about 80% sequence identity to the protein encoded by the nucleic acid of claim 7, 8 or 9.

75. An antibody or antibody fragment capable of specifically binding the protein of claim 72.

76. An antibody or antibody fragment capable of specifically binding the protein of claim 73.

77. An antibody or antibody fragment capable of specifically binding the protein of claim 74.

78. An agent identified as having anti-bacterial activity by any of the methods of claims 10-57.

79. A method for inhibiting the growth or survival of Pseudomonas aeruginosa comprising contacting said bacteria with an agent identified by a method as set forth in any one of claims 10-57 so as to inhibit growth or survival.

80. A pharmaceutical composition comprising an agent according to claim 78.

81. A method for treating a patient having a Pseudomonas aeruginosa infection, comprising administering to said patient an amount of an agent according to claim 78 effective to reduce or inhibit growth or survival of said Pseudomonas aeruginosa.

82. A method of protecting a patient against a Pseudomonas aeruginosa infection, comprising administering to said patient an amount of an agent according to claim 78 effective to prevent said patient from acquiring a Pseudomonas aeruginosa infection.

83. The isolated nucleic acid molecule of claim 4, 5 or 6 , wherein said nucleic acid contains an essential gene selected from the group consisting of Pseudomonas aeruginosa uppS, ispB and metK.

84. The isolated nucleic acid molecule of claim 4, 5 or 6, wherein said nucleic acid comprises the Pseudomonas aeruginosa ispA gene.

85. The nucleic acid library of claim 58, 59 or 60, wherein said map is in electronic form.

86. The library of claim 85, wherein said electronic form is selected from the group consisting of magnetic storage media, such as a floppy disc, a hard disc storage medium, and a magnetic tape; optical storage media such as CD-ROM; electrical storage media such as RAM and ROM; hybrids of these categories such as magnetic/optical storage media; computer readable forms such as a word processing text file, database format, searchable files, executable files and search program software.

87. The transposon insertion map of claim 61 , wherein said map is in electronic form.

88. The map of claim 85, wherein said electronic form is selected from the group consisting of magnetic storage media, such as a floppy disc, a hard disc storage medium, and a magnetic tape; optical storage media such as CD-ROM; electrical storage media such as RAM and ROM; hybrids of these categories such as magnetic/optical storage media; computer readable forms such as a word processing text file, database format, searchable files, executable files and search program software.

89. A method for identifying a library of putative essential or important genes using a High Throughput Transposon Insertion Database (HTTIM), comprising:

(a) mutagenizing a bacterial genome with a transposon such that individual cells containing at least one transposon insertion are isolated;

(b) collecting and mapping said at least one transposon insertion in each individual cell so as to form a database of transposon insertion sites, or an HTTIM;

(c) comparing said database of transposon insertion sites with a database comprising the genomic sequence of the bacterium to identify open reading frames in said genomic sequence database that are not disrupted by a transposon insertion;

(d) forming a library from said putative essential or important genes that are not disrupted by a transposon.

90. The method of claim 89, wherein said bacteria is P. aeruginosa or S. aureus.

91. The method of claim 89, wherein said transposon inserts randomly into the target genome.

92. The method of claim 91, wherein said transposon is Tn5.

93. The method of claim 91, wherein said HTTIM comprises at least about 5000 transposon insertion sites.

94. The method of claim 91, wherein said HTTIM comprises at least about 10000 transposon insertion sites.

95. The method of claim 91, wherein said HTTIM comprises at least about 13000 transposon insertion sites.

96. The library of putative essential or important genes identified by the method of claim 91, wherein said library comprises at most about 3000 genes.

97. The library of putative essential or important genes identified by the method of claim 91, wherein said library comprises at most about 2500 genes.

98. The library of putative essential or important genes identified by the method of claim 91, wherein said library comprises at most about 2000 genes.

99. The library of putative essential or important genes identified by the method of claim 91, wherein said library comprises at most about 1700 genes.

100. The method of claim 91 , further comprising a statistical calculation for identifying putative essential or important genes.

101. The method of claim 100, further comprising the statistical method applied herein.

102. The method of claim 91 , further comprising a physical mutagenesis experiment in order to verify essential or important genes.

103. The method of claim 102, wherein said physical mutagenesis comprises knocking out a putative essential or important gene or creating a promoter swap mutant.

104. An essential or important gene identified by the method of claim 102.

105. An antibacterial agent that targets the gene of claim 104, or the gene product encoded by said gene.

106. A pharmaceutical composition comprising said antibacterial agent of claim 105.

107. A method of identifying a nucleic acid motif associated with a Pseudomonas aeruginosa infection, comprising screening the library of claim 58, 59 or 60 for conserved nucleic acid fragments.