EP1485493A1 - Novel method for the production of hybrid maize seeds - Google Patents

Abstract

The invention relates to a method for production and multiplication of maize plants homozygous for a transgene which confers male sterility, useful in the production of hybrid maize seed.

Description

 PROCESS FOR PRODUCING HYBRID CORN SEED

The present invention relates to a method for producing and propagating corn plants homozygous for a transgene conferring male sterility, useful for the production of hybrid corn seeds.

The production of hybrids via "sexual hybridization" of parents with different genetic backgrounds is of great importance in the practice of modern agriculture. Indeed, the crossing between plants of the same species but not related produces a progeny which manifests characteristics, such as yield or resistance to diseases, superior to those of the parents: it is the effect of heterosis or hybrid vigor. Thus, the production of hybrids is often used to improve both the quality and the yield of cultivated plants. In addition, these descendants are genetically uniform, in particular for the characteristics of productivity, sensitivity to pours and drought, vigor at the start and susceptibility to diseases and pests, and therefore interesting for farmers.

Without human intervention, the production of hybrids is limited by self-fertilization phenomena. The production of hybrid seeds therefore requires favoring cross-fertilization by preventing self-pollination by mechanical, chemical or genetic techniques. The different ways to prevent self-fertilization by controlling pollination include - manual, mechanical "castration" or chemical inactivation of the male organs of the plant,

- the use of a modified plant with recessive nuclear male sterility,

- the use of a modified plant with recessive cytopiasmic male sterility,

- the use of a dominant nuclear sterile male plant (artificial male sterility or AMS).

However, some of these techniques are not completely effective and sometimes even difficult to implement. "Castration" is expensive and can cause yield losses in the event of an error.

The effectiveness of the use of cheaper chemical agents depends on the environmental conditions at the time of gametocide application, which leads the seed producer to take considerable risks each season.

The use of a nuclear sterile recessive male plant is not easy to implement, in particular because of the maintenance of the sterile male character which requires the reselection of sterile male plants in the descendants obtained by self-fertilization of a heterozygous plant for the male recessive sterility gene. To be effective, this system therefore involves the use of a marker closely linked to the male sterility gene and easily identifiable.

Male sterility can be "acquired", that is, it is independent of any genetic manipulation by the recombinant DNA pathway. We can distinguish cytoplasmic male sterility from nuclear male sterility.

"Cytoplasmic" male sterility ("CMS") is linked to changes in the organization and expression of the mitochondrial genome, nuclear male sterility results from mutations in the genome of the cell nucleus. However the CMS is not complete, 2/1000 of the plants remaining fertile. The loss of cytoplasmic genetic diversity when breeders use the same cytoplasm in their breeding programs can also be a handicap.

Male sterility can be "artificial" ("AMS"), that is to say it is induced by the expression of a gene conferring male sterility (AMS gene) which is inserted either in the mitochondrial genome (cytoplasmic male sterility), or in the nuclear genome (nuclear male sterility).

The AMS system avoids problems associated with other methods.

In fact, unlike CMS, the AMS system does not depend on the existence of a mutant. Maintaining the sterile character of the male line can be obtained through the use of a dominant male sterility gene linked to a marker gene which allows the selection of artificial sterile male plants.

The problem of maintaining the sterile male character in a plant line has been partially resolved in patent application WO 95/34634 which provides for the crossing between a heterozygous plant for a dominant gene of male sterility and a fertility restorer and then the selection of sterile male seeds. In this application, the use of a marker, linked to the fertility restorer gene, influencing the regulation of the genes encoding the enzymes regulating the synthesis of anthocyanins makes it possible to differentiate by color the sterile male seeds from the fertile male seeds .

However, the sorting system described in this patent application does not allow reliable sorting of hybrid seeds on a large scale.

On the other hand, the general application of this technology is limited to the extent that the choice of the color marker is conditioned by the genotype of the plant containing the fertility restoration gene. In particular, only plants whose genotype does not condition visible production of anthocyanin in seeds can be used.

The present invention therefore provides a process for the production and multiplication of homozygous corn plants for a transgene conferring artificial nuclear male sterility, allowing production of hybrid seeds, and easily applicable on a large scale. An advantage of the proposed method is that its application is not conditioned by the genotype of the plants used.

This approach is based in particular on the association of the fertility trait with a "petit grain" phenotype. The "petit grain" phenotype is preferably obtained by the expression of the shrunken 2 and brittle 2 genes in antisense orientation. The brittle 2 gene codes for one of the 2 subunits of ADP glucose pyrophosphorylase, an enzyme involved in the synthesis of starch. The fragment was obtained by the RT-PCR technique from an extract of total RNA from the ear of corn and from the data of Genbank (acc. No. S72425). This fragment represents an incomplete cDNA of the brittle 2 gene. The shrunken 2 gene codes for the other subunit of ADP glucose pyrophosphoryrlase. The fragment was obtained by the RT-PCR technique from an extract of total RNA from the ear of corn and according to the data from Genbank (ace no. S72425). This fragment contains the complete sequence of the coding region of the shrunken 2 gene.

The inhibition of these two genes of wrinkled mutants of lower size and weight makes it possible to obtain corn grains of density and / or of smaller size. Such grains can be easily sorted by sieving and / or densimetric sorting, for example using a densimetric table or column, or by flotation, which allows. the implementation of a reliable, simple, and automated selection and therefore applicable on a large scale.

In the context of the present invention, the term "heterozygous for the AMS transgene" means a corn plant made male sterile by incorporating into its genome a single copy of a transgene conferring artificial nuclear male sterility ("AMS") . In the absence of any other indication, this plant does not contain the fertility restoration gene linked to a marker of the "small grain" phenotype.

In the context of the present invention, the term “homozygous for the AMS transgene” denotes a corn plant made male sterile by incorporating into its genome two copies located at the same location on each of the sister chromosomes of a transgene conferring male sterility artificial nuclear (AMS). In the absence of any other indication, this plant does not contain the fertility restoration gene linked to a marker of the "small grain" phenotype. By "fertility restoring corn plant comprising in its genome a fertility restoration gene linked to a marker of" small grain "phenotype" is meant a heterozygous or homozygous corn plant for said fertility restoration gene linked to a small grain phenotype marker. Preferably, said corn plant is heterozygous. In the absence of any other indication, this plant does not contain a transgene conferring artificial nuclear male sterility (AMS).

By “corn plant comprising in its genome an AMS transgene” is meant a heterozygous or homozygous corn plant for said AMS transgene.

By "wild genotype corn plant" is meant a corn plant which contains in its genome neither a transgene conferring artificial nuclear male sterility (AMS), nor a fertility restoration gene linked to a phenotype marker " small grain ". Preferably, said corn plant of wild genotype belongs to an elite line.

By "small grain" phenotype is meant grains whose density and / or size and / or mass is (are) less than that of a grain of normal size, preferably 40 to 50% lower. In the context of the present invention, these grains may be called "depressed grains" or "wrinkled grains".

By “marker of small grain phenotype” or “gene which confers a small grain phenotype” or “gene coding a small grain phenotype”, is meant any gene, in sense orientation or in antisense orientation, which, when expressed in the plant gives a "petit grain" phenotype. Among these markers, the shrunken 2, brittle 2, shrunken 1 genes, the miniature locus 1 which codes for an invertase can be cited in particular; and more generally any gene which makes it possible to reduce the starch content and does not alter the viability of the grains. By "grain of normal size" or "grain normal" or "grain of normal phenotype" means in particular a grain whose size and / or density and / or mass has (have not been) changed (s), in particular by integration into the genome of the plant of a marker of "small grain" phenotype.

By "elite line" is meant a line with significant agronomic and commercial potential, at a given period.

By "linkage" or "genetic linkage" is meant a sufficiently small genetic distance so that the frequencies of recombination during meiosis are negligible.

By "protein of interest" is meant a protein of human or animal origin which may be of therapeutic and / or prophylactic interest, such as collagen, gastric lipase, antibodies, etc.

One of the aims of the invention is therefore to propose a method for producing hybrid corn seeds by crossing a heterozygous corn plant for a transgene conferring artificial nuclear male sterility ("AMS") with a corn plant. of wild genotype. The system according to the present invention, which advantageously makes it possible to maintain the sterile male character of corn plants is applicable independently of the genotype of the corn plants used.

The solution provided by the invention consists in first producing corn seeds that are homozygous for a transgene conferring artificial nuclear male sterility ("AMS") and heterozygous for a fertility restoration gene linked to a phenotype marker " small grain ". From these seeds, breeders can easily introgress the homozygous genotype for the AMS transgene and heterozygous for a fertility restoration gene linked to a “small grain” phenotype marker in a wild-type corn line, and in particular in an elite line of interest, by successive backcrosses. A reconverted elite line homozygous for a transgene conferring artificial nuclear male sterility ("AMS") and heterozygous for a gene for restoring fertility linked to a marker of "small grain" phenotype can thus be obtained. Self-fertilization of corn plants from these seeds then makes it possible to produce: seeds homozygous for the AMS transgene generating sterile male corn plants which, crossed with wild genotype corn plants, and in particular plants belonging to a Elite line used for conversion, where appropriate, will produce heterozygous seeds for the AMS transgene. Fertilization ^'of male sterile corn plants grown from these seeds by a wild genotype of corn plant, unrelated, then produces hybrid seeds benefiting from the force effect (heterosis), seeds homozygous for the AMS transgene and heterozygous or homozygous for the fertility restoration gene linked to a “small grain” phenotype marker, generating sterile non-male corn plants whose self-fertilization produces in particular seeds homozygous for the AMS transgene and heterozygotes for the restoration gene fertility linked to a “small grain” phenotype marker, thus ensuring the renewal of sterile male corn plants of interest.

Advantageously, when the AMS transgene is genetically linked to a gene encoding a protein of interest, hybrid seeds homozygous for the AMS transgene prove to be particularly useful for generating corn plants producing said protein of interest.

In the context of the present invention, a selection of corn seeds by the “small grain” phenotype can in particular be implemented by a dimensional or densimetric sorting method.

A dimensional sorting can be carried out so as to separate the grains according to their length, using for example a cell sorter, their width, with for example a disc sorter, or their thickness, using for example a sizer . The principle of a densimetric sorting is based on a separation of the grains according to their density and uses in particular a densimetric column or a densimetric table, or a flotation system.

More specifically, - the cell sorter consists of a horizontal rotating cylinder. The separation is done by centrifugal force. The smallest grains enter the cells (which line the inside of the cylinder) and are held there by centrifugal force. - the disc sorter consists of thick discs arranged vertically and hollowed out in their thickness of cells of suitable size.

- the most conventional calibrators are the calibrators by thickness composed of flat or cylindrical sieves with elongated perforations forcing the seed to appear at its smallest thickness to pass through. The calibrator with round perforations is of the same principle but the round orifices and small "redents" inside the cylinder force the seed to appear vertically to pass through the sieve.

- the densimetric column includes a vibrating distributor which introduces the mixture of grains to be sorted halfway up a hollow column in which a homogeneous air flow rises. Heavy particles descend while the lighter particles rise. The separation is thus carried out.

- a densimetric table makes it possible to separate bodies of the same dimensions but of different specific weight. Test weight is a measure of the mass of a quantity of seeds in relation to its volume. The principle of the device is a work plan (often made up of a wire or textile network) crossed by a uniform air flow which fluidizes the seed mixture and causes it to stratify schematically in two layers. Heavy products stay close to the table, light products above. The separation of the two layers is obtained by adjusting the inclination of the work surface (in two directions) and by a transverse back and forth stirring movement. We can for example use a densimetric table such as that sold by the company Cimbria Heid GmbH (Stockerau, Austria).

- the flotation system is a system which makes it possible to separate the grains according to their density and / or mass based on their capacity of flotation on a liquid, in particular water. The heaviest grains (with the lowest buoyancy) are found at the bottom and the lightest grains (with the highest buoyancy) are found on the surface of the liquid, which allows separation. When this system is used, the seeds must remain as short as possible in contact with water so as not to alter their germination capacity. A drying step may sometimes be necessary.

The present invention therefore provides a method of producing corn seeds homozygous for a transgene conferring artificial nuclear male sterility ("AMS") and heterozygous for a fertility restoration gene linked to a marker of "small grain" phenotype, comprising the steps of; a) cross a sterile male corn plant heterozygous for the AMS transgene with a fertility restoring corn plant comprising in its genome a fertility restoration gene linked to a marker of "small grain" phenotype, b) select by "small grain" phenotype corn seeds comprising in their genome a fertility restoration gene linked to a marker of "small grain" phenotype, c) self-fertilize the corn plants from the seeds selected according to step b), d ) select seeds that are homozygous for the AMS transgene and heterozygous for the fertility restoration gene linked to a “small grain” phenotype marker.

Preferably, at least one step of selecting the method comprises a densimetric sorting, in particular using a densimetric table or column, or a flotation system.

The selection step thus carried out has the advantage of allowing an easily achievable and automated sorting of the grains according to their "small grain" or "normal" phenotype.

According to a particular embodiment, step b) of the method described above can advantageously be replaced by a genotyping step. The present invention therefore also provides a method for producing corn seeds homozygous for a transgene conferring artificial nuclear male sterility ("AMS") and heterozygous for a fertility restoration gene linked to a marker of "small grain" phenotype, comprising the steps of: a) crossing a sterile male corn plant heterozygous for the AMS transgene with a fertility restoring corn plant comprising in its genome a fertility restoration gene linked to a “small grain” phenotype marker, b) genotyping the seeds obtained by crossing according to step a), and selecting corn seeds comprising in their genome a gene for restoration of fertility linked to a marker of "small grain" phenotype, c) self-fertilize the maize plants derived from genσtyped seeds according to step b), d) select seeds homozygous for the AMS transgene and heterozygous for the restoration gene fertility linked to a marker of "small grain" phenotype. According to a particular embodiment, said heterozygous corn plant for a transgene conferring artificial nuclear male sterility further contains a gene encoding a protein of interest, preferably genetically linked to the AMS transgene.

The implementation of the methods described above makes it possible to produce a corn seed that is homozygous for an AMS transgene and heterozygous for a fertility restoration gene linked to a marker of “small grain” phenotype. The present invention therefore relates to a corn seed homozygous for an AMS transgene and heterozygous for a fertility restoration gene linked to a marker of “small grain” phenotype capable of being obtained by one of the preceding methods. Preferably, the homozygous and heterozygous AMS genotype for a fertility restoration gene linked to a marker of “small grain” phenotype can be introgressed in a corn line of wild genotype, and in particular in an elite line of interest. , by successive backcrosses.

The cultivation, then the self-fertilization of the corn plants obtained from seeds above (homozygous for an AMS transgene and heterozygous for a fertility restoration gene linked to a marker of "small grain" phenotype) produces homozygous maize seeds for the AMS transgene, as well as homozygous maize seeds for the AMS transgene and heterozygotes or homozygotes for the fertility restoration gene linked to a "small grain" phenotype marker. Corn seeds homozygous for the AMS transgene are easily differentiable from other seeds thus produced because they alone have grains of normal phenotype.

The present invention therefore provides a process for the production of homozygous corn seeds for a transgene-conferring artificial nuclear male sterility ("AMS"), comprising the steps consisting in: a) self-fertilizing corn plants derived from homozygous seeds for the AMS transgene and heterozygotes for a fertility restoration gene linked to a marker of “small grain” phenotype, capable of being obtained by one of the methods previously described, b) selecting seeds homozygous for the AMS transgene.

Preferably, the selection step comprises a densimetric sorting, in particular using a densimetric table or column, or a flotation system. This step advantageously makes it possible to sort the seeds homozygous for the AMS transgene by their normal grain phenotype. According to another embodiment, the method for producing seeds of homozygous corn for a transgene conferring artificial nuclear male sterility ("AMS"), comprises the steps consisting in: a) crossing a sterile male corn plant heterozygous for the transgene AMS with a fertility restorer corn plant comprising in its genome a fertility restoration gene linked to a marker of "small grain" phenotype, b) selecting by the "small grain" phenotype corn seeds comprising in their genome a fertility restoration gene linked to a “small grain” phenotype marker, c) self-fertilize corn plants from seeds selected according to step b), d) select seeds homozygous for the AMS transgene and heterozygous for the fertility restoration gene linked to a small grain phenotype marker, e) self-fertilize corn plants from seeds according to the step d), f) select seeds homozygous for the AMS transgene. According to a particular embodiment, said heterozygous corn plant for a transgene conferring artificial nuclear male sterility further contains a gene encoding a protein of interest, preferably genetically linked to the AMS transgene. Step e). Of this process could possibly be preceded by a successive backcrossing step with a corn plant of wild genotype, and in particular, a corn plant belonging to an elite line, so as to convert this plant from corn of wild genotype with the homozygous genotype for the AMS transgene and heterozygous for the fertility restoration gene linked to a “small grain” phenotype marker. The seeds from this backcrossing step are then used to continue the process.

Preferably, at least one selection step, and in particular step f), comprises a densimetric sorting, in particular using a densimetric table or column, or a flotation system. This step advantageously makes it possible to sort the seeds homozygous for the AMS transgene by their normal grain phenotype.

According to another variant, step b) of the above method is replaced by a genotyping step. The present invention therefore also relates to a process for producing seeds of homozygous corn for a transgene conferring artificial nuclear male sterility ("AMS") comprising the steps consisting in: a) crossing a sterile male corn plant heterozygous for the transgene AMS with a fertility restorer corn plant comprising in its genome a fertility restoration gene linked to a “small grain” phenotype marker, b) genotyping the seeds obtained by crossing according to step a), and select the corn seeds comprising in their genome a fertility restoration gene linked to a marker of "small grain" phenotype, c) self-fertilize the corn plants derived from the seeds genotyped according to step b), d) select the seeds homozygous for the AMS transgene and heterozygous for the fertility restoration gene linked to a “small grain” phenotype marker, e) self-fertilize corn plants from seeds according to step d), f) select seeds homozygous for the AMS transgene. According to a particular embodiment, said heterozygous corn plant for a transgene conferring artificial nuclear male sterility further contains a gene encoding a protein of interest, preferably genetically linked to the AMS transgene. Step e) of this process may possibly be preceded by a successive backcrossing step with a corn plant of wild genotype, and in particular, a corn plant belonging to an elite line, so as to convert this corn plant wild-type genotype with the homozygous genotype for the AMS transgene and heterozygous for the fertility restoration gene linked to a “small grain” phenotype marker. The seeds from this backcrossing step are then used to continue the process.

Preferably, at least one selection step, and in particular step f), comprises a densimetric sorting, in particular using a densimetric table or column, or a flotation system. This step advantageously makes it possible to sort the seeds homozygous for the AMS transgene by their normal grain phenotype.

The cultivation of seeds homozygous for the AMS transgene then makes it possible to generate sterile male corn plants which, crossed with plants of wild genotype, and in particular with plants belonging to an elite line, produce heterozygous seeds for the transgene AMS. The elite line used for this crossing can in particular be that used for the backcrossing step possibly implemented in the preceding methods. In this case, the seeds produced can be used to produce commercial seeds from a corn hybrid. According to another embodiment, the elite sauvate type line can be replaced by a corn hybrid to obtain seeds which will be used to produce a three-way hybrid.

According to another aspect of the invention, the process for producing corn seeds homozygous for the AMS transgene can be used for the production of proteins of interest, in particular therapeutic and / or prophylactic. The protein of interest can be produced throughout the plant or preferentially concentrated in specific organs, such as seeds. The method according to the invention has the advantage of making it possible to produce such proteins under controlled conditions and on a large scale. It is therefore of great interest in the pharmaceutical field.

To do this, a vector containing the barnase gene, conferring male sterility, under the control of the A9 promoter and a gene of therapeutic interest and / or prophylactic can be built. This vector can be used to obtain plants, containing the gene conferring male sterility and the gene of therapeutic and / or prophylactic interest, which can then be used according to the production system as described in order to produce seeds expressing the protein of therapeutic and / or prophylactic interest.

In particular, such a vector can be used to obtain a heterozygous corn plant for an AMS transgene (and therefore for the gene coding for the protein of interest), which corn plant can then be crossed with a corn plant. genotype fertility restorer (+ / +; SSB / +). Advantageously, the gene of therapeutic and / or prophylactic interest is genetically linked to the AMS transgene.

Such a system makes it possible to produce only the protein of therapeutic and / or prophylactic interest in the seed for example or in an organ of the plant and this whatever the stage of development as a function of the regulatory sequence used in the gene coding said protein of interest, since the protein conferring male sterility is not produced in the organs of the plant. This system thus makes it possible to avoid the dissemination of the transgene of therapeutic and / or prophylactic interest via pollen, since the plants are completely male sterile,

The present invention therefore also relates to a method for producing a heterozygous seed for an AMS transgene comprising the crossing of a corn plant derived from a homozygous seed for an AMS transgene, capable of being obtained by one of the methods for producing a seed homozygous for the AMS transgene described above, with a corn plant of wild genotype.

According to another embodiment, the method for producing a seed heterozygous for an AMS transgene is characterized in that one of the methods for producing a ^• seed homozygous for the AMS transgene described above further comprises the crossing of a corn plant derived from said homozygous seed for an AMS transgene with a corn plant of wild genotype. The fertilization of sterile male corn plants from these seeds by a wild genotype corn plant, unrelated, advantageously produces hybrid seeds benefiting from the vigor effect (heterosis).

According to another aspect, the system proposed by the present invention advantageously makes it possible to maintain corn plants homozygous for an AMS transgene and heterozygous for a fertility restoration gene linked to a marker of "small grain" phenotype. The corn seed production processes homozygous for the AMS transgene described above indeed comprise a final selection of seeds in particular on the basis of their normal grain phenotype. The seeds of the “small grain” phenotype not selected by these methods can be sown, then the plants generated self-fertilizing, thus producing in particular seeds homozygous for the transgene AMS and heterozygous for the gene for restoring fertility linked to a marker. of "petit grain" phenotype.

The invention therefore relates to a method of propagating a corn plant homozygous for an AMS transgene and heterozygous for a fertility restoration gene linked to a marker of “small grain” phenotype comprising the steps consisting in: a) self-fertilizing corn plants homozygous for an AMS transgene and heterozygous for a fertility restoration gene linked to a marker of "small grain" phenotype, capable of being obtained from a seed from one of the homozygous seed production processes for an AMS transgene and heterozygotes for a fertility restoration gene linked to a marker of “small grain” phenotype previously described, b) selecting seeds homozygous for the AMS transgene and of “small grain” phenotype, c) selecting seeds homozygous for the AMS transgene and heterozygous for a fertility restoration gene linked to a marker of "small grain" phenotype obtained by self-fertilization of seedlings of. corn obtained from seeds obtained according to step b). Preferably, step b) of the above method comprises a densimetric sorting, in particular using a densimetric table or column, or a flotation system. The present invention also relates to nucleotide constructs, called expression cassettes, comprising a promoter nucleotide sequence operably linked to at least one gene of interest. Said gene of interest can also be associated with other regulatory elements such as activators and transcription termination sequences (terminators). Other elements such as introns, enhancers, polyadenylation sequences and derivatives "may also be present in the nucleic sequence of interest, to improve the expression or the functioning of the transforming gene. The expression cassette may also contain so-called "leader" 5 'sequences that can improve translation.

Preferably, in the seed production methods described above, the corn plant comprising an AMS transgene conferring artificial nuclear male sterility is characterized in that the AMS transgene, preferably the barase gene (Hartley, 1988; Gene Bank n ° X 12871), is included in an expression cassette, under the control of a promoter specific for pollenogenesis and of a terminator, genetically linked to a gene encoding a selection agent under the control of a promoter and d 'a terminator. Advantageously, said expression casette can also comprise a gene coding for a protein of interest. Preferably, said gene encoding a protein of interest is genetically linked to the AMS transgene, in particular the barnase gene. Even more preferably, the gene encoding a protein of interest is not under the control of said specific promoter of pollenogenesis. The specific promoter of pollenogenesis is in particular a promoter allowing specific expression in the anther chosen from the group consisting of the promoter A3 (WO 92 11379), the promoter A6, the promoter A9 (WO 92 11379), corresponding to the region 5 'non-coding of the A9 gene of Arabidopsis thaliana, and the specific promoters of the anther carpet such as TA29, TA26, TA13 (WO 89 10396) or Mac2 (WO 00 68 403).

Among the genes coding for a selection agent (also called selection marker genes), genes which confer resistance to an antibiotic can be used in particular (Herrera-Estrella et al., 1983), such as hygromycin, kanamycin, bleomycin or streptomycin or herbicides (EP 242 246), such as glufosinate, glyphosate or bromoxynil.

Preferentially, said gene encoding a selection agent is selected from the bar gene (White et al., 1990; Gene Bank No. X 17220), which confers resistance to the herbicide Basta ^® (glufosinate) and the NPTII gene which confers resistance to kanamycin (Bevan et al., 1983).

The excision system for eliminating the gene encoding a selection agent can be a transposition system, such as in particular the Ac / Ds system of corn (WO

02 101061), or a recombination system, such as in particular the Cre / lox system of bacteriophage P1, the FLP / FRT system of yeast (Lyzrik et al., 1997), the Gin recombinase of phage Mu, the Pin recombinase of E. coli or the R RS system of the plasmid pSR1. A co-transformation system (Komari et al., 1996) can also be used. Preferably, the system used will be the Ac / Ds system of corn. According to a preferred mode, said gene is included inside the transposable element Ds (also called dissociating element or mobilizable sequence of a transposon).

The Ds transposon used is described in the publication by Yoder et al., (1993).

The Ds element is an Ac element which has undergone significant mutations or deletions in the sequence encoding the transposase. H can only excise itself from its insertion site in the presence of an active Ac transposase source. It is therefore Ac dependent. A preferred system for eliminating a gene encoding a selection agent can have two components:

- A first plant having no active transposase, in which a construct comprising the expression cassette of the gene of interest and that of the gene coding for a selection agent framed by the mobilizable sequences of a transposon can be integrated therein.

- a second plant containing in its genome a gene encoding an endogenous active transposase. The crossing of these two plants leads to the production of regenerants, obtained from F1 plants or F2 plants selected for the presence of the gene of interest without a gene encoding a selection agent.

Preferably according to the invention, the promoter associated with the gene. encoding a selection agent is a constitutive promoter, such as the Actin-lntron- promoter actin, corresponding to the 5 ′ non-coding region of the actin 1 gene of rice and its first intron (Me Elroy et al., 1991; Gene Bank n ° S 44221). The presence of the first actin intron makes it possible to increase the level of expression of a gene when it is fused 3 'to a promoter. This promoter sequence allows for example the constitutive expression of the bar gene.

Among the terminators which can be used with the AMS transgene of the gene encoding a selection agent, there may be mentioned in particular:

- the 3 'Nos terminator, terminator of nopaline synthase which corresponds to the 3' non-coding region of the nopaline synthase gene originating from the Ti plasmid of Agrobacteirum tumefaciens nopaline strain (Depicker et al.,

1982), and

- the 3 'CaMV terminator, corresponding to the 3' non-coding region of the sequence of the circular double-stranded DNA virus of the cauliflower mosaic producing the 35S transcript (Franck et al. 1980; Gene Bank No. V 00141).

According to another aspect, the present invention relates to an expression cassette comprising a fertility restorer gene genetically linked to at least one gene coding for a "small grain" phenotype, associated with elements allowing their expression in plant cells, in particular a promoter and a transcription terminator.

Among the transcription promoters which can be used in association with the gene coding for a “small grain” phenotype, there may be mentioned in particular:

- The HMWG (High Molecular Weight Glutenin) promoter corresponding to the 5 ′ non-coding region of the wheat glutenin gene (Triicum aesϋvum), an albumen reserve protein. This seed-specific promoter is described in the publication by Robert et al. (1989)

- the promoter B32, described in the publication of Di Fonzo N et ai. (1988).

Preferably, said expression cassette comprising a fertility restorer gene genetically linked to at least one gene coding for a "small grain" phenotype, is characterized in that said fertility restorer gene is the barstar gene (Hartley, 1998 ) placed under the control of a specific promoter of pollenogenesis, in particular a specific promoter of the anther such as pA3, pA6, pA9, pTA29, or of the Mac2 promoter, and of the 3'CaMV terminator or 3'Nos, genetically linked to a gene encoding a selection agent under the control of the Actin-intron actin promoter and the 3'CaMV or 3'Nos terminator.

Among the genes coding for a selection agent, genes which confer resistance to an antibiotic such as hygromycin, kanamycin, bleomycin or streptomycin or to herbicides such as glufosinate, glyphosate or bromoxynil can be used in particular. . Preferentially, said gene encoding a selection agent is selected from the bar gene which confers resistance to the herbicide Basta ^® and the NPTII gene which confers resistance to kanamycin.

Preferably, the gene coding for a “small grain” phenotype is chosen from the shrunken 2 and brittle 2 genes in antisense orientation.

According to another aspect, the invention relates to a vector, in particular a plasmid, characterized in that it contains at least one expression cassette as described above. The invention further relates to a cellular host, in particular a bacterium such as Agrobacterium tumefaciens, transformed by said vector. Such a cell host is useful for transfecting corn cells with a vector according to the invention.

The invention therefore also relates to a corn cell transformed by at least one vector as described above. The transformation of plant cells can be carried out by transfer of the abovementioned vectors into the protoplasts, in particular after incubation of the latter in a polyethylene glycol (PG) solution in the presence of divalent cations (Ca ²⁺ ) according to the method described in the article of Krens et al. (1982). The transformation of plant cells can also be carried out by electroporation, in particular according to the method described in the article by Fromm et al.

(1986).

The transformation of plant cells can also be carried out by using a gene gun allowing the projection, at very high speed, of metallic particles covered with DNA sequences of interest, thus delivering genes inside the cell nucleus , in particular according to the technique described in the article by

Finer et al. (1992).

Another method of transforming plant cells is that of cytoplasmic or nuclear micro-injection. According to a particularly preferred embodiment of the process of the invention, the plant cells are transformed by a vector according to the invention, said cellular host being capable of infecting said plant cells by allowing integration into the genome of the latter, DNA sequences of interest originally contained in the genome of the above vector.

Advantageously, the above-mentioned cell host used is Agrobacterium tumefaciens, in particular according to the methods described in the articles by Bevan (1984) and An et al. (1986), or even Agrobacterium rhizogenes, in particular according to the method described in the article by Jouanin et al, (1987). Preferably, the transformation of plant cells is carried out by the transfer of the T region of the extra-chromosomal circular plasmid inducing Ti tumors of Agrobacterium tumefaciens, using a binary system (Watson

To do this, two vectors are constructed. In one of these vectors, the T-DNA region was deleted, with the exception of the right and left edges, a marker gene being inserted between them to allow selection in plant cells. The other partner of the binary system is a helper Ti plasmid, a modified plasmid which no longer has T-DNA but still contains the virulence genes vir, necessary for the transformation of the plant cell. This plasmid is maintained in Agrobacterium.

Another object of the present invention is to produce transgenic corn plants, plant parts or plant extracts, characterized in that they are regenerated from the transformed plant cell. The invention relates in particular to a fertility restoring corn plant characterized in that it comprises in its genome a fertility restoring gene linked to a marker of "small grain" phenotype or a corn plant homozygous for an AMS transgene and heterozygous for a fertility restoration gene linked to a "small grain" phenotype marker, obtained from a corn seed homozygous for an AMS transgene and heterozygous for a fertility restoration gene linked to a phenotype marker "petit grain".

The invention also relates to a kit for implementing a method of propagating a homozygous corn plant for an AMS transgene and heterozygous for a fertility restoration gene linked to a previously described "small grain" phenotype marker, characterized in that it comprises corn seeds homozygous for an AMS transgene and heterozygotes for a fertility restoration gene linked to a marker of “small grain” phenotype, and oligonucleotides specific for the AMS transgene useful as primers for the detection by PCR of seeds homozygous for an AMS transgene and heterozygotes for a fertility restoration gene linked to a phenotype marker "petit grain".

The following examples and figures illustrate the invention without limiting its scope:

LEGEND OF FIGURES

FIG. 1 represents the block diagram of a succession of steps leading to the production of a hybrid seed according to the invention. 2 shows the plasmid pRec 274 comprising the barnase gene conferring male sterility, and the bar gene conferring resistance to the herbicide Basta ^®.

FIG. 3 represents the donor plasmid pBIOS 274 comprising the spectinomycin resistance gene as well as the T-DNA carrying the barnase gene, under the control of the A9 promoter, and of the bar gene, under the control of the rice actin promoter.

FIG. 4 represents the donor plasmid pBIOS 424 comprising the promoter A9-bamase-terminator 3 'CaMV and the gene for resistance to kanamycin Npt11 in a dissociating element Ds. FIG. 5 represents the plasmid p3222 comprising the antisense sequence of the brittle 2 gene as well as the barstar gene restoring fertility.

Figure 6 represents the plasmid p3223 comprising the antisense sequence of the shrunken 2 gene as well as the barstar fertility restorer gene.

FIG. 7 represents the plasmid p4962 comprising the antisense sequences of the shrunken 2 and brittle 2 genes as well as the barstar fertility restorer gene.

FIG. 8 represents the plasmid pDM 302 comprising the expression cassette for the bar gene. FIG. 9 represents the donor plasmid pBIOS 273 which comprises an expression cassette comprising the rice actin promoter, the Bar gene, and the 3'Nos terminator.

EXAMPLES:

A non-limiting illustration of one of the methods according to the present invention is described in FIG. 1.

The construction of the various plasmids as well as their ligation and the transformation of the Escherichia coli XLI blue bacteria made previously competent, is carried out using the usual recombinant DNA techniques (Sambrook et al., 1989).

The construction of the expression vectors and the transformation techniques used are within the reach of those skilled in the art according to standard techniques.

EXAMPLE 1: Built AMS.

La) Construction of a plasmid (pRec 274) comprising the barnase gene conferring male sterility, linked to the bar gene conferring resistance to the herbicide Basta ^®.

The vector used for the transformation of maize by Agrobacterium tumefaciens is in the form of a superbinary plasmid of approximately 50 kb (pRec 274). The superbinary vector used for the transformation contains:

- an ori region: origin of Col E1 plasmid replication, necessary for the maintenance and multiplication of the plasmid in Escherichia coli. This origin of replication is not functional in Agrobacterium tumefaciens,

- an origin of functional replication in Agrobacterium tumefaciens and in Escherichia coli,

the cos region of the lambda bacteriophage, which may be useful for the manipulation of the vector in vitro,

- the additional virB, virC and virG regions of Agrobacterium tumefaciens which increase the transformation efficiency, - the genes for resistance to tetracycline (Tetra) and to spectinomycin (Spect) which are expressed only in bacteria,

- a T-DNA carrying the barnase gene conferring male sterility, and bar, which confers resistance to the herbicide Basta ^®, both genes being operably linked to elements allowing its transcription. In the present example, the barnase gene is under the control of the A9 promoter and the 3 'CaMV terminator; the bar gene being under the control of the actin-intron rice actin promoter and of the 3 'Nos terminator.

The bar gene of Streptomyces hygroscopicus encodes a Phosphinothricin Acyl Transferase (PAT) which detoxifies phosphinothricin (agent for selection of the herbicide Basta ^® ) by acetylation (White et al., 1990). It is generally used to select transformed plants which contain both the gene of interest and this gene encoding a selection agent, and which are therefore resistant to the herbicide.

The barnase gene, which confers male sterility, codes for a Ribonuclease (RNase). This gene was isolated from Bacillus amyloliquefasciens and is described in the publication by Hartley (1988).

The superbinary plasmid pRec 274 is shown in Figure 2.

This superbinary vector is obtained by homologous recombination of an acceptor plasmid pSB1 (EP 672 752) derived from a Ti plasmid of Agrobacterium tumefaciens with a donor plasmid pBIOS 274 (FIG. 3), derived from pUC (Messing, 1983).

The donor plasmid has the spectinomycin resistance gene as well as the T-DNA carrying the barnase gene, under the control of the A9 promoter, and of the bar gene, which is also a selection gene, under the control of the Actin promoter. rice.

The donor and acceptor plasmids have a region of homology sufficient to allow homologous recombination and to obtain the vector known as superbinary.

The transformation technique with Agrobacterium tumefaciens allows the integration of the only T-DNA consisting of the right (RB) and left (LB) borders surrounding the gene of interest (barnase) and the gene encoding a selection agent. 1.b) Construction of a plasmid (pRec 424) comprising the barnase gene conferring male sterility linked to. NPT-II gene conferring resistance to kanamycin.

The vector used for the transformation of maize by Agrobacterium tumefaciens is in the form of a superbinary plasmid of approximately 50 kb (pRec 424).

The superbinary vector used for the transformation contains:

- an ori region: origin of Col E1 plasmid replication, necessary for maintaining and multiplying the plasmid in Escherichia coli. This origin of replication is not functional in Agrobacterium tumefaciens,

- an origin of functional replication in Agrobacterium tumefaciens and in Eschericia coli,

- the cos region of bacteriophage lambda, which may be useful for the manipulation of the vector in vitro, - the additional virB, virC and virG regions of Agrobacterium tumefaciens which increase the transformation efficiency,

- the genes for resistance to tetracycline (Tetra) and to spectinomycin (Spect) which are expressed only in bacteria,

- A T-DNA carrying the barnase genes, conferring male sterility, and Nptll inserted into a Ds element, conferring resistance to kanamycin, these two genes being operationally linked to elements allowing their transcription. In the present example, the barnase gene is under the control of the A9 promoter and the 3 'CaMV terminator; the Nptll gene inserted into a Ds element being under the control of the Actin promoter and of the 3 'Nos terminator and terminator.

The Npt11 gene was isolated from the Tn5 transposon of Escherichia coli (Berg et al. 1983). This gene codes for the enzyme neomycin phosphotransferase type 11 which catalyzes the O-phosphorylation of aminoglycoside antibiotics such as neomycin, kanamycin, gentamycin and G418 (Davies and Smith, 1978). This gene confers resistance to kanamycin, which is used as a selection agent during plant genetic transformation. It is described by Bevan et al. (Genbank No. U00004).

The barnase gene, which confers male sterility, codes for a Ribonuclease as mentioned in Example 1.a above. This superbinary vector is obtained by homologous recombination of an acceptor plasmid pSB1 (EP. 672 752) derived from a Ti plasmid of Agrobacterium tumefaciens with a donor plasmid pBIOS 424 (FIG. 4) derived from pUC (Messing, 1983).

The donor plasmid pBIOS 424 has the spectinomycin resistance gene as well as the T-DNA carrying the barnase gene under the control of the A9 promoter and of the Npt11 gene placed under the control of the Actin promoter inserted into a Ds element.

The donor plasmid pBIOS 424 (A9 promoter-barnase-terminator 3 'CaMV and the kanamycin resistance gene Npt11 in a dissociative element Ds) was generated in the following way: The fragment containing the A9 promoter cassette - barnase gene - terminator

3 'CaMV was isolated by: a) restriction with hol, b) treatment with T4 DNA Polymerase to generate blunt ends, and c) restriction with XI a from the plasmid pBIOS 274 (FIG. 3). This fragment (X / iol / blunt - Xba \) was then introduced into the vector pBIOS

415 (described below) opened using the restriction enzymes EcoRV and Xσal.

The EcoRV-X al fragment thus generated contains the plasmid sequences of the vector pSB12 (Japan Tobacco, EP 672 752) and the cassette element Ds - Actin promoter - actin intron - NPTII gene - Nos terminator - Ds element.

Plasmid pBIOS 415 contains the GFP gene under the control of the promoter

CsVMV (WO 97/48819) and of the Nos terminator (fragment Xba \ - Xhol) in the acceptor vector pBIOS 340. The vector pBIOS 340 is a vector containing the plasmid sequences of the vector pSB12 (Japan Tobacco, EP 672 752) and the cassette Ds element - Actin promoter - actin intron - NPTII gene - terminator

Our - element Ds. The donor and acceptor plasmids have a region of homology sufficient to allow the production of the so-called superbinary vector by homologous recombination.

The transformation technique with Agrobacterium tumefaciens allows the integration of the only T-DNA consisting of the right (RB) and left (LB) borders surrounding the gene of interest (barnase gene) and the gene coding for a selection agent.

EXAMPLE 2: Constructed Phenotypic Restorer-Marker linked to grain size.

2.a) Construction of a plasmid (p3222, FIG. 5) comprising the antisense sequence of the brittle 2 gene as well as the barstar gene for restoring fertility.

The brittle 2 gene codes for a subunit of ADP Glucose Pyrophosphorylase, an enzyme involved in the synthesis of starch. In antisense orientation, it inhibits the synthesis of this subunit, which produces a mutant phenotype whose grain size is 50% smaller than normal size.

The barstar gene codes for a specific Barnase inhibitor. It was isolated from Bacillus amyloliquefaciens and is described in Hartley (1998) (Genbank N ° X1 5545). Plasmid p3222 carries two individually cloned expression cassettes. The first cassette comprising the HMWG promoter, the brittle 2 gene in antisense orientation and the Nos terminator. The second cassette comprising the A9 promoter, the Barstar gene and the CaMV terminator.

The brittle 2 gene was synthesized by PCR from corn albumen cDNA with the oligonucleotides Bt5 (CCGGATCCATGTGACAGACAGTGTTA, SEQ ID No. 1) containing a BamHI site, and Bt3 (AAGCCCGGGACTTGTACTAACTGTTTC, SEQ ID No. 2) Smal site.

The 600 bp PCR fragment thus obtained was digested with SmaI and BamHI and cloned between the HMWG promoter and the nos terminator region of the plasmid p3214 opened by Smal and BamHI. The plasmid p3215 thus obtained contains the HMWG-brittle 2 promoter expression cassette (antisense orientation) -nos.

A 270 bp fragment containing the barstar gene was amplified by PCR from the plasmid pWP127 with the oligonucleotides BPR5 (TATCGGATCCAAATCATAAGAAAGGAG, SEQ ID No. 3) containing a BamHI site, and BPR4 (GAAGATCTATATTGTTCATCCCATTG, SEQ ID No. 4) Bglll site. The PCR fragment thus obtained was digested with BamHI and Bgl11 and cloned between the A9 promoter and the CaMV terminator region of the plasmid p1415 opened with BamHI. The plasmid p3072 thus obtained contains the barstar gene under the control of the A9 promoter and of the CaMV terminator region.

The plasmid p3222 according to Example 2.a) corresponds to the insertion of the HMWG-brittle 2 promoter cassette (antisense orientation) -nos (Kpnl-Sacl fragment) from p3215 into p3072 opened with Kpnl and Sacl.

2.b) Construction of a plasmid (p3223, FIG. 6) comprising the antisense sequence of the shrunken 2 gene as well as the barstar gene restoring fertility.

The shrunken 2 gene codes for the other subunit of ADP Glucose Pyrophosphorylase, an enzyme involved in the synthesis of starch. In antisense orientation, it inhibits the synthesis of this subunit which produces a mutant phenotype whose grain size is 40% smaller than normal size.

Plasmid p3223 carries two individually cloned expression cassettes. The first cassette comprising the HMWG promoter, the shrunken 2 gene in antiseήs orientation and the Nos terminator. The second cassette comprising the A9 promoter, the Barstar gene and the CaMV terminator.

The shrunken 2 gene was synthesized by PCR from corn albumen cDNA with the oligonucleotides New Sh5 (GCACCCGGG AGGAGATATGCAGTTTG, SEQ ID no 5) containing a Smal site, and Sh3 (GACTGCAGCACAAATGGTCAAG, SEQ ID no 6) containing a Pstl site. The 1800 bp PCR fragment thus obtained was digested with SmaI and PstI and cloned between the HMWG promoter and the nos terminator region of the plasmid p3214 opened by SmaI and PstI. The plasmid p3217 thus obtained contains the HMWG-shrunken 2 promoter expression cassette (antisense orientation) -nos. A 270 bp fragment containing the barstar gene was amplified by PCR from the plasmid pWP127 with the oligonucleotides BPR5 (TATCGGATCCAAATCATAAGAAAGGAG, SEQ ID No. 7) containing a BamHI site, and BPR4 (GAAGATCTATATTGTTCATCCCATTG, SEQ ID No. 8) Bglll site. The PCR fragment thus obtained was digested with BamHI and Bgl11 and cloned between the A9 promoter and the CaMV terminator region of the plasmid p1415 opened with BamHI. The plasmid p3072 thus obtained has the barstar gene under the control of the A9 promoter and of the CaMV terminator region.

The plasmid p3223 according to Example 2.b) corresponds to the insertion of the HMWG-shrunken 2 promoter cassette (antisense orientation) -nos (Kpnl-Sacl fragment) from p3217 into p3072 opened with Kpnl and Sacl.

2.c) Construction of a plasmid (pRec 4962) comprising the antisense sequences of the shrunken 2 and brittle 2 genes as well as the fertility restorer barstar gene.

Plasmid p4962 (Figure 7) carries two individually cloned expression cassettes. The first cassette comprising the HMWG promoter, the shrunken 2 gene in antisense orientation, the brittle 2 gene in antisense orientation and the Nos terminator. The second cassette comprising the Mac2.1 promoter, the Barstar gene and the CaMV terminator. This plasmid was constructed by conventional molecular biology techniques known to those skilled in the art.

The plasmid p4962 is in the form of a donor vector derived from the vector pSB12 (Japan Tobacco, EP 672 752) of approximately 11.7 kb comprising: - an ori region: origin of plasmid replication Col E1, necessary for maintaining and multiplication of the plasmid in the bacteria,

- a spectinomycin resistance gene expressed only in bacteria,

- a T-DNA comprising the male fertility restoration gene (barstar gene) and the antisense sequences of the shrunken 2 and brittle 2 genes conferring a _v phenotype

'petit grain'.

In the present example, the barstar gene is under the control of the Mac2.1 promoter and of the 3'CaMV terminator, the shrunken 2 and brittle 2 genes in antisense orientation being under the control of the HMWG promoter and of the 3'Nos terminator. The superbinary vector pRec 4962 is obtained by homologous recombination of an acceptor plasmid pSB1 (Japan Tobacco, EP 672 752) derived from a Ti plasmid of Agrobacterium tumefaciens with the donor plasmid p4962.

EXAMPLE 3 Selection plasmid

3, a) Construction of a plasmid (PDM 302, Figure 8) comprising the bar gene conferring resistance to the herbicide Basta ^® used as selection plasmid in co-transformation with the plasmid restorer.

As indicated in Example 1, the bar gene is used to select the transformed plants which are resistant to the herbicide Basta ^®.

The plasmid pDM302 (Cao et al., 1992) carries the expression cassette comprising the promoter Actin-lntron-actin, the Bar gene and the terminator Nos.

This plasmid pDM302 was obtained in the following manner:

The coding region of the bar gene of Streptomyces hygroscopicus coding for PAT activity (Phosphinothricin Acetyl Transferase) was excised from the plasmid plJ4104 (White et al., 1990) by the restriction enzyme Smal (fragment of 600 bp) and cloned in the expression vector pCOR113 (McEIroy et al., 1991) behind the 5 ′ fragment (promoter and first intron) of the rice Actin 1 (Act-1) gene. This generated the 4.9 kb plasmid pDM301 containing the Act1-bar expression cassette. The Act1-bar expression cassette of pDM301 was excised as a 2.0 kb Xhol-Xbal restriction fragment and cloned between the SalI and Xbal sites upstream of the terminator sequence of the nos gene coding for nopaline synthase (plasmid pNOS72) . The 4.7 kb plasmid pDM302 thus obtained contains the Act1-bar-nos expression cassette.

3.b) Construction of a plasmid pRec 273 comprising the bar gene conferring resistance to the herbicide Basta ^® used as selection plasmid in co-transformation with the plasmid restorer.

The plasmid pBIOS 273 (FIG. 9) carries an expression cassette comprising the rice actin promoter, the Bar gene, and the 3 'Nos terminator. This plasmid was constructed by conventional molecular biology techniques known to those of skill in the art.

The plasmid pBIOS 273 is in the form of a donor vector derived from the vector pSB12 (Japan Tobacco, EP 672 752), of about 8.6 kb comprising:

- an ori origin: origin of Col E1 plasmid replication, necessary for the maintenance and multiplication of the plasmid in the bacteria,

- a spectinomycin resistance gene expressing itself only in bacteria, - a T-DNA comprising the Bar gene conferring resistance to the herbicide

Basta ^® under the control of the rice promoter Actine and the terminator 3 'Nos.

The plasmid pBIOS 273 was generated in two stages:

- Cloning of the BspDI / Xhol fragment (Actin promoter - Bar gene - Nos terminator) of the vector pDM 302 (Cao et al. 1992) in the SmaI and BspDI sites of the vector pSB12 (Japan Tobacco EP 672 752). The vector resulting from this cloning is called pBIOS 272.

deletion of the Xhol site at position 3363 of the vector pBIOS 272 by partial digestion with Xhol and action of the DNA Polymerase 1, large (Klenow) fragment. The vector obtained, having a unique Xhol site, is named pBIOS 273.

The superbinary vector pRec 273 is obtained by homologous recombination of an acceptor plasmid pSB1 (Japan Tobacco, EP 672 752) derived from a Ti plasmid of Agrobacterium tumefaciens with the donor plasmid pBIOS 273.

EXAMPLE 4 Production of a sterile male corn line heterozygous for the AMS transgene.

4.a) Production of a sterile male corn line heterozygous for the AMS transgene (AMS / +) by transformation of the corn with the plasmid described according to Example 1a (pRec 274). A heterozygous sterile male corn line expressing the barnase (conferring male sterility) and bar (glufosinate resistance) genes respectively under the control of the A9 promoters (Paul et al., 1992) and actin-intron (Me Elroy et al., 1991 ) is obtained by transformation with Agrobacterium tumefaciens according to the method described by Ishida et al. (1996).

In the following example, the sterile heterozygous male corn line (AMS / +) was produced by the transformation method with Agrobacterium tumefaciens. Other transformation techniques known to those skilled in the art can be used.

Obtaining and preparing plant material:

Corn on the cob is decontaminated for 15 to 20 minutes in 20% Domestos with stirring and then rinsed with sterile water before taking the immature embryos which are placed in LSinf medium. The optimal size of immature embryos is 1 to 1.2 mm, which corresponds to 10 +/- 2 days after fertilization. The embryos are then vortexed, the LSinf medium is removed, and rinsing in LSinf medium is performed before vortexing again.

Preparation of the bacteria: Agrobacterium tumefaciens bacteria (strain LBA 4404) containing the super binary plasmid pRec 274 (as described according to example 1a) are cultured in YP medium supplemented with a selective agent suitable for the strain. 2 to 3 days later, the bacteria are suspended in LSinf medium + 100 μM acetosyringone. The concentration of the inoculum is considered to be 1.10 ⁹ bacteria / ml.

Inoculation and coculture:

After eliminating the LSinf medium, the embryos are brought into contact with Agrobacteria. After stirring with a vortex, 50 μl of 1% Pluronic F68 are added and an incubation of 5 minutes at room temperature is carried out. The inoculum is eliminated and the embryos are recovered and placed on medium 1, 5LSAs, scutellum upwards. After sealing the dish, a 5-day incubation at 25 ° C in the dark is carried out. Selection of processed calluses:

At the end of the coculture, the embryos are transferred to LSD5 medium and placed in numbers of 25 per box sealed with Urgopore. Incubation for 2 weeks at 25 ° C in the dark (1 ^st selection) is performed. A 2 ^nd selection involves transferring the embryos on medium LSD10 by cutting germination. Incubation for three weeks is carried out in the same conditions as 1 ^st selection. A 3 ^ee selection is carried out by excising the type I calluses -jolis- so as to obtain fragments of 1-2 mm. A culture on LSD10 medium, then an incubation of 3 weeks under the same conditions as in first and second selection are carried out.

Regeneration of transformed seedlings:

Type I calli proliferated are placed on medium LSZ2 and the cans are sealed with film ^® and placed in a culture chamber at 27 ° C for 2 weeks. The type I calluses which have proliferated are again subcultured, separated and placed on RM + G4C100 medium. The dishes are sealed with scellofrais ^® and placed in a culture chamber at 27 ° C. The regenerated seedlings are subcultured on T1 G4 medium and placed under continuous illumination, at 27 ° C for one to two weeks. The seedlings having reached sufficient development are transferred to the phytotron.

In order to identify seedlings resistant to the herbicide Basta ^® , and therefore having integrated the transgene, a selection step is carried out with a Basta F1 solution (Agri≡vo France). The application of this solution is done by "Leaf Painting" (ie by brushing the leaves) on corn plants at the 4-5 leaf stage. The concentration of ammonium glufosinate in the treatment solution is 0.75 grams per liter.

Resistant plants have a non-necrotic area 5 days after the application of the herbicide. Sensitive plants show necrosis in the treated area; we then observe the death of chlorophyll tissues. The plants thus regenerated are acclimatized and then cultivated in a greenhouse where they can be crossed or self-fertilized. 4.b) Production of a sterile male corn line heterozygous for the AMS transgene (AMS / +) by transformation of the corn with the plasmid described according to Example 1b (pRec 424).

A sterile heterozygous male corn line expressing the barnase gene conferring male sterility, under the control of the A9 promoter (Paul et al., 1992), is obtained by transformation with A. tumefasciens according to the method described by Ishida et al. (1996). The transformation technique with Agrobacterium tumefaciens, non-limiting, used in this example is identical to that used in Example 4. a. Transformation with the A9-Bamase-3'CaMV-Ds :: NPTII expression cassette comprising the barnase gene under the control of the A9 promoter and of the 3'CaMV terminator (according to Example 1 b) on a vector usable in transformation via Agrobacterium and comprising the selection marker "Kanamycin" inside the transposable element Ds has the advantage of eliminating the marker gene which will not be found in the transformed corn line.

In the present example, the identification of the seedlings having integrated the transgene is done as follows:

Regeneration of transformed seedlings: Calluses of type I which have proliferated are placed on LSZ2 medium and the boxes are sealed with scellofrais ^® and placed in a culture chamber at 27 ° C for 2 weeks. The type I calluses which have proliferated are again subcultured, separated and placed on RM + G4C100 medium. The dishes are sealed with scellofrais ^® and placed in a culture chamber at 27 ° C. The regenerated seedlings are subcultured on T1 G4 medium and placed under continuous illumination, at 27 ° C for one to two weeks. The seedlings having reached sufficient development are transferred to the phytotron.

In order to identify the seedlings resistant to kanamycin and therefore having integrated the transgene, a selection step (by the cornet drop test) is carried out with a kanamycin solution at a concentration of 500 mg / l added with 1% of

Tween. 2 to 3 drops of this solution are applied to corn plants at the 4-5 leaf stage. The plants are analyzed 5 days after the application of kanamycin. Sensitive plants show the appearance of whitish areas (death of chlorophyll tissues). Resistant plants do not show the appearance of whitish areas 5 days after the application of kanamycin. The plants thus regenerated are acclimatized and then cultivated in a greenhouse where they can be crossed or self-fertilized.

Once the transformants (including the A9- expression cassette

Barnase-3'CaMV-Ds :: NPTI!) Were isolated by action of the selection agent and / or by molecular analyzes, the gene encoding the selection agent is eliminated. The selected transformants are therefore crossed with an active transposase source

Ac.

Fertilization is carried out manually by a technique known to those skilled in the art by depositing pollen from the source of transposase Ac on the bristles of the transformants, preferably in the sense of the male plant having the transposase in the female plant containing l 'element Ds :: Nptll.

The F1 grains are put to germinate to obtain seedlings. The seedlings are evaluated for their resistance to kanamycin (the resistant plants are preserved) and a PCR test is carried out to detect somatic excisions (somatic excision does not generally affect the gametes and leads to the formation of seeds and chimeric individuals most of whose cells still have the gene encoding the selection agent). The primers used for this PCR test which makes it possible to search for somatic excisions on F1 plants resistant to the selection agent are the following:

The pair of primers Barn5 / EM11 makes it possible to visualize the excision (other suitable primers can also be used). The amplification is different depending on whether or not there has been excision.

The F1 plants where somatic excision has taken place are therefore selected, then crossed with a wild genotype plant (WT). The F2 plants are screened in order to identify the plants with the gene of interest without a gene encoding the selection agent (a germline excision affects the gametes and leads to the formation of seeds and individuals made up of cells which no longer possess the gene encoding the selection agent).

4.c) Molecular characterization of transformants

The Southern methodology (1975) is used to demonstrate the insertion of the transgene into the plant genome and to assess the number of copies and characterize the integration profile.

Plant genomic DNA (8μg) is extracted from plant leaves following a CTAB (cetyltrimethylammonium bromide) extraction protocol, according to the Keller J protocol (DNAP 6701 San Pablo Ave Oakland CA 94608 USA) modified by Bancroft I. (Department of MolecularGenetics, Cambridge Laboratory,

John Innate Center for Plant Science Research, Colney Lane, Norwich, England).

The DNA obtained was digested with different restriction enzymes, separated by agarose gel electrophoresis and transferred to nylon membrane N + hybond and then hybridized with radioactive probes.

The Bar probe for molecular analyzes is prepared in the following manner. The plasmid pDM302 (described in Example 3a) of the present invention) is digested with the enzyme Sma I. The fragment of interest of 0.6 Kb is recovered after migration of the digestion product on electrophoresis gel and purification with the Gene Clean kit (Bio 101, Ozyme). After labeling with P32 30 ng of fragment, this is used as a probe to hybridize the different blots.

The sterile male transformation event (STB27b) is a transformant obtained by transformation via Agrobacterium tumefaciens according to Example 4a) described above, and which has a single copy insertion of the T-DNA as described according to example 1a. The results of hybridization of the DNA digested with different restriction enzymes (Ncol, Spel, EcoR V, Hindlll and Ecor I), then hybridized with the Bar probe show that a single fragment is highlighted whatever the enzyme used. The size of the fragment revealed by Hind III digestion is 1.7 kb. This same type of molecular characterization is carried out for the transformants obtained by transformation via Agrobacterium tumefaciens according to Example 4b).

EXAMPLE 5 Production of a line of corn restoring heterozygous fertility for the gene restoring fertility (SSB / +).

5.a) Production of a Heterozygous Fertility Restoring Corn Line (SSB / +) for the Fertility Restoring Gene by Co-Transformation of Corn with the Plasmids of Examples 2a, 2b (Restoring Plasmids) and 3a) ( selection plasmid pDM 302).

Preferably, a method of genetic transformation is used which leads to the stable integration of the modified genes into the genome of the plant. This method is based on the use of a particle gun. However, other transformation techniques known to those skilled in the art can be used.

Production of immature embryos:

It consists in the self-fertilization of a plant of the Hill line or in the "brother-sister" (sib) crossing of 2 plants of the Hill line. Fertilization takes place on a single date after isolating the reproductive organs.

Ear picking:

The ear samples are taken when the immature embryos have reached a size of 1.5 mm to 2 mm, that is to say 10 to 11 days after fertilization in our culture conditions (temperature of 25 ° C on day and 18 ° C at night, photoperiod 16/8). Disinfection:

The harvested ears are stripped of their husks and their bristles and are then disinfected with Domestos ^® 20% (v / v) for 15 minutes with stirring. The ears of corn will be rinsed three times with sterile water.

Extraction of embryos:

The upper part of the grain is cut to reveal the albumen, then a light pressure on the grain allows to release the albumen. The immature embryo which is still in the grain (against the pericarp) is extracted and then deposited on the N6P6 callogenesis medium, orienting it flat side on the agar. Thirty six embryos per dish are cultured for 4 days in a culture chamber at 26 ° C and in the dark. This is the initiation period.

Genetic transformation: - Preparation of embryos:

After the initiation period, the embryos are deposited 4 hours before firing on the 0.4 M N6P6 osmotic shock medium and are arranged by 36 in a small square of 2 cm ² in the center of the dish. The dishes are sealed with fresh seal and incubated in a culture chamber (dark at 26 ° C).

The plasmids carrying the genes to be introduced (plasmids described in Examples 2a, 2b and 3a) are purified on a Qiagen ^® column according to the manufacturer's instructions. They are then precipitated on tungsten particles (M 10) following the protocol described by Klein (1987). The particles thus coated are projected towards the target cells using the cannon and according to the protocol described by J. Finer (1992).

The embryos bombarded boxes are then sealed using film ^® then cultured in the dark at 27 ° C. The first subculture takes place 24 hours later, then every two weeks for 3 months on medium identical to the initiation medium added with a selective agent, the nature and concentration of which may vary depending on the gene used. Suitable selective agents generally consist of active compounds of certain herbicides (Basta ^®, Roundup ^®) or certain antibiotics (Hygromycin, Kanamycin ...). Preferably, the gene for resistance to the herbicide Basta ^® be used. 11

- Maturation and ^" regeneration of type II calluses:

When we have enough material for an event, we transfer it to the MM + G2 maturation medium which promotes the development of somatic embryos. The callus is spread over the surface of the medium MM + G2. The dishes are placed in a culture chamber in the dark and at 26 ° C. After 15 days (minimum) on the MM + G2 medium, somatic embryos appear. These are subcultured on RM + G2 regeneration medium (20 to 25 per dish) and cultured at 28 ° C and in the light (16h / 24h). It is considered that 4 boxes in regeneration are sufficient to obtain regenerants.

After approximately 15 days on the RM + G2 medium, the embryos have developed into seedlings which are then subcultured in tubes on the T1 + G2 rooting medium. It is considered that 5 seedlings per event are necessary for successful acclimatization to the phytotron and shipments. These seedlings are placed in a culture chamber in the light.

We obtain after 3 months or sometimes earlier, calluses including. growth is not inhibited by the selection agent (ammonium glufosinate), usually and mainly composed of cells resulting from the division of a cell having integrated into its genetic heritage one or more copies of the selection gene. The transformation efficiency is 10%.

These calluses are identified, individualized, amplified and then cultivated so as to regenerate seedlings. In order to avoid any interference with untransformed cells, all these operations are carried out on culture media containing the selective agent. ^"

- Acclimatization:

The acclimatization of the seedlings is carried out when the latter have sufficiently developed on T1 + G2, that is to say when the roots reach the bottom of the tube and when the hill axis is sufficiently rigid and developed. The seedlings are acclimated to the phytotron in pots with slightly enriched potting soil. The buckets are arranged on a shelf located 1.5 meters from the lamps. To maximize the generation of offspring, the acclimatization of 2 seedlings to the phytotron is necessary. On average, two weeks are required for weaning the seedlings. The plants thus regenerated and acclimatized are then cultivated in a greenhouse where they can be crossed or self-fertilized.

This embodiment consisting in producing a heterozygous fertility restoring corn line for the fertility restoring gene (SSB / +) by co-transformation of a corn plant with the plasmids of examples 2a, 2b and 3a is the first embodiment.

A second embodiment consisting in producing a corn line restoring heterozygous fertility for the fertility restoring gene (SSB / +) consists in co-transforming a corn plant with the plasmids of examples 2a and 3a according to the same protocol as described above.

A third embodiment consisting in producing a corn line restoring heterozygous fertility for the fertility restoring gene (SSB / +) consists in co-transforming a corn plant with the plasmids of examples 2b and 3a according to the same protocol as described above.

5.b) Production of a Heterozygous Fertility Restoring Corn Line for the Fertility Restorer Gene (SSB / +) by Co-transformation of Maize with the Plasmids of Examples 2c (pRec 4962 Restorer Plasmid) and 3b (Plasmid pRec 273 selection).

The production of the fertility restoring corn line according to the present example 5b is carried out by co-transformation of a corn plant with the plasmids described according to examples 2c and 3b according to the technique of co-transformation by Agrobacterium tumefaciens known from one skilled in the art.

The bar gene (gene encoding the selection agent) is eliminated during co-transformation. 10% of the transformants obtained contain the 2 expression cassettes contained in the plasmids of Examples 2c and 3b. There will be segregation in the offspring. This embodiment (4 ^th mode) consisting in producing a corn line restoring heterozygous fertility for the fertility restoring gene (SSB / +) is the preferred mode according to the present invention. However, other transformation techniques known to those skilled in the art can be used. 5, c) Molecular characterization of the transformants.

The transformant SSB-001a obtained according to Example 5a) was characterized by the same methodology as that described according to Example 4c of the present invention.

Molecular analysis was performed on the transformant SSB-001a resistant to the herbicide Basta ^® (plant number 12928), on a sister plant resistant to the herbicide Basta ^® (plant number 12929), and on 2 plants sensitive to herbicide (13008 and 13061). These 4 plants come from the ear of the primary transformant SSB-001a. The genomic DNA (14 μg) of the plants was digested with the restriction enzymes Eco RV and Hind III. Three probes were used for the analysis: A9 promoter (pA9), HMWG promoter (pHMWG) and Bar.

The results of the molecular hybridizations with the Bar probe indicate that the molecular profiles are identical for the two plants resistant to the herbicide Basta. Hybridizations with probes pA9 and pHMWG reveal a large number of bands, reflecting an integration in several copies of the plasmids p3222 and p3223. Hybridization with the Bar probe shows a simple profile, a major band is revealed for the 2 enzymes Eco RV and Hind III. The size of the fragment revealed by Hind III digestion is 8 kb. The very low intensity bands correspond to the very intense signals revealed previously with the pA9 and pHMWG probes.

EXAMPLE 6 Crossing of the heterozygous sterile male corn line (AMS / +) with the heterozygous fertility restoring corn line for the fertility restorer gene (SSB / +): obtaining plants F1.

The male-sterile corn line heterozygous (AMS / +) resistant to the herbicide Basta ^® obtained according to Example 4a is crossed with the restorer corn lines heterozygous for the fertility restorer gene of fertility (SSB / +), plant resistant to the herbicide Basta ^®, obtained according to example 5 to obtain F1 plants. The same type of cross can be carried out between the heterozygous sterile male corn line (AMS / +), obtained according to Example 4b, and the heterozygous fertility restoring corn line for the fertility restorer gene (SSB / + ), obtained according to example 5. The fertilization is carried out manually by a technique known to those skilled in the art. The sterile male plant is led to flowering, the pollen of the plant (SSB / +) is deposited on the bristles of the sterile male line.

At the end of this crossing, genetic analyzes are carried out on F1 plants. Genetic analyzes consist of counting, in relation to the presence of the different markers, among the descendants.

All the theoretical frequencies mentioned are true if and only if there is no link between the AMS transgene and the fertility restorer gene.

F1 genetic assessment:

F1 phenotypic assessment

F1 is therefore composed of half of normal grains, the other half being depressed grains (phenotype 'petit grain' caused by the shrunken2 and brittle2 genes in antisense orientation).

For each F1, we evaluated the segregation for glufosinate resistance in order to detect the lots of depressed grains.

The depressed grains are selected by visual sorting on the ear of corn. These grains are all resistant to Basta ^® herbicide.

The depressed seeds, which have the genotype (AMS / +; SSB / +) or (+ / +; SSB / +), are selected, then sown and germinated.

EXAMPLE 7 Self-fertilization of F1 plants for production of F2. F1 plants resistant to Basta ^® herbicide from depressed grains according to Example 6 are self-fertilized in order to obtain the F2 plants.

The F1 plants derived from depressed grains being made up of both genotype plants (SSB / +; + / +) and genotype plants (SSB / +; AMS / +), two cases of self-fertilization then arise:

7. a) Self-fertilization of genotype plants (SSB / +; + / +).

The F1 plants of genotype (SSB / +; + / +) obtained according to Example 6 are self-fertilized. At the end of this self-fertilization, genetic analyzes are carried out on F2 plants:

Genetic balance of F2:

Phenotypic assessment of F2:

This self-fertilization step of plants of genotype (SSB / +; + / +) can be advantageously eliminated by a genotyping step by carrying out a specific PCR of the AMS transgene on F1 plants derived from depressed grains according to Example 6. The depressed kernels are germinated, corn plants self-fertilized, and molecular sorting is performed by PCR. Only plants positive for the detection of the AMS transgene by PCR are conserved. The specific primers of the AMS gene of interest (pA9-Barnase-3'CaMV) allowing its amplification by PCR are the following:

The size of the fragment amplified using the pairs of primers A9A / A9B, Bam1 /

Barn 6 or Bam4 / CaMVoH is 799 bp, 880 bp or 979 bp, respectively.

7.b) Self-fertilization of genotype plants (AMS / +; SSB / +).

The F1 plants of genotype (AMS / +; SSB / +) obtained according to Example 6 are self-fertilized in order to obtain the F2 progeny. At the end of this self-fertilization, genetic analyzes are carried out on the F2 progeny:

Genetic balance of F2:

Phenotypic assessment of F2:

Genetic analysis of the F2 progeny on normal grains (25%) for the expression of the barnase gene with resistance to the herbicide Basta ^® , makes it possible to determine the F1 hybrid plants which exhibited the genotype (SSB / +; AMS / +). In F2 plants from depressed grains, 1/6 have the genotype (AMS / AMS; SSB / +). On F2 plants that have _. normal grains, have the genotype (AMS / AMS; + / +).

7.c) Results.

14 F2 ears were produced. For each of _. these ears, a sorting according to the phenotype of the grain (depressed or not) was carried out. 14 batches of transgenic seeds (from A to N) were therefore analyzed. These 14 seed lots (lot A to lot N) were divided into two according to their normal or depressed phenotype. The code used for the 28 sets of seeds thus prepared is for example for lot A: A 01 = normal grains, A02 = "depressed" grains.

EXAMPLE 8: Sowing of the depressed grains of the F2 progeny and genotyping of the plants (AMS / AMS; SSB / +).

A directed sowing of the F2 grains obtained above, as a function of the depressed or normal phenotype of the grain, then the detection by genotyping of the plants (AMS / AMS; SSB / +) were carried out. 8.a) Sowing of the F2 progeny.

A directed sowing of the 14 families was carried out and at the 3-4 leaf stage a Basta test in spray 0.5% ₀ was carried out. The results of this test are described in the table below:

The results of the test made it possible to eliminate the families B, F, I, J, and L which resulted from the self-fertilization of F1 plants with the genotype (SSB / +; + / +). Families A, C, D, E, G, H, K; M, and N have been kept. These ears were the result of the self-fertilization of F1 plants with the genotype (SSB / +; AMS / +). The genetic and phenotypic assessments of the self-fertilization of these plants were detailed in Example 7b. In these selected families, all plants resistant to Basta ^® herbicide from normal grains (lots ending in 01) and up to 40 plants resistant to Basta ^® herbicide from depressed grains were kept for cultivation.

8.b) Identification by genotyping and Southern blot of genotype plants (AMS / AMS; SSB / +).

Molecular analysis is performed to identify plants that are homozygous for the transgene from STB-27b (AMS / AMS) and heterozygous for the transgene from SSBOOIa (SSB / +). The genomic DNA of the offspring was extracted from 50 mg of leaves according to the protocol and use of the Qiagen Dneasy 96 plant kit extraction kit (Qiagen SA, 91974 Courtaboeuf cedex, France). The Southern methodology is used to identify molecular profiles.

For each individual, we visualize the presence of the two Bar genes: the one coming from STB27b and the one coming from SSBOOIa. For this, the DNAs were digested with the enzyme Hind III and then hybridized with the Bar probe. From the molecular analyzes carried out on the parent transformants, we know that a fragment with a size of 8 kb corresponds to the copy of the Bar gene resulting from the transformant SSBOOIa and a fragment with a size of 1.7 Kb corresponds to the copy of the Bar gene from the transformant STB27b. For a given plant, the intensity of the hybridization signals is also evaluated, this in order to identify the zygosity (heterozygosity or homozygosity) of the plants for the Bar gene considered (SSBOOIa or STB27b).

This analysis therefore allows us to identify the genotype of plants from the SSB x STB cross. According to the preliminary selection of the seeds from which these plants come, 6 genotypes are expected and presented in Table 1. Table 1:

The genotype sought in this study is homozygosity for the T-DNA of STB-27b (“2 copies” of the Bar gene) and heterozygosity for the Bar gene SSB-001a (“1 copy” of the Bar gene).

Southern blots were carried out with the DNA of 8 daughter plants coming from an ear and this, on the 9 selected ears. 58 plants were genotyped according to the protocol described above. All the expected genotypes are represented among the 9 plants analyzed (2 different ears).

A total of 10 plants have the genotype of interest, namely: homozygosity for the T-DNA of STB-27b ("2 copies" of the Bar gene) and heterozygosity for the Bar gene SSB-001 a ("1 copy" of the gene Bar). The observed frequencies are very close to the expected theoretical frequencies whatever the genotype considered (Ta ^' bleau

2). Table 2:

EXAMPLE 9 Obtaining pre-basic seeds (AMS / AMS; + / +), basic seeds (AMS / +; + / +), and hybrid seeds.

Many crosses can be considered to produce pre-basic seeds, basic seeds, and hybrid seeds. The crossings described below are not limiting:

9.a) Self-fertilization of plants (AMS / AMS; SSB / +) in order to obtain pre-basic seeds.

The advantage of this cross is to multiply the line with the genotype (AMS / AMS; SSB / +) as well as to produce seeds with the genotype (AMS / AMS; + / +) or pre-basic seeds.

In fact, self-fertilization produces semen homozygous for the transgene conferring male sterility (at the level of F3, all normal grains will be of genotype (AMS / AMS; + / +)). At the end of this self-fertilization, genetic analyzes are carried out:

Genetic assessment

Phenotypic assessment

All normal grains have the genotype (AMS / AMS; + / +). These are pre-basic seeds. 75% of the depressed grains have the genotype (AMS / AMS; SSB / +). Plants from these depressed seeds can be self-fertilized to multiply (maintain) genotype plants (AMS / AMS; SSB / +). The genotype plant (AMS / AMS; SSB / +) is also called a sterility maintenance plant.

9.b) Crossing of genotype plants (AMS / AMS; SSB / +) with the elite line of wild genotype (WT) in order to obtain seeds of genotype (AMS / +; + / +).

Plants from depressed grains are crossed with an elite WT line. At the end of this crossing, the genetic analyzes are carried out:

Genetic assessment:

Phenotypic assessment:

There are two cases: - in 2/3 of the cases the F2 plants had the genotype (AMS / +; + / +). On these F3 ears only are obtained normal grains with a segregation with the herbicide Basta ^® of 50/50. These ears do not interest us.

- in 1/3 of the F2 plants, had the genotype (AMS / AMS; + / +). On these F3 ears only are obtained normal grains with a genotype (AMS / +; + / +) 100% resistant to the herbicide Basta ^® . These are the ears that interest us. The normal seeds of genotype (AMS / +; + / +) constitute the basic seeds.

20 seeds from each F3 spike are sown and the spikes of interest are identified based on the resistance to the herbicide Basta ^® .

9.c) Crossing of plants of genotype (AMS / AMS; + / +) with the elite line of wild genotype (WT) in order to obtain seeds of genotype (AMS / +; + / +).

Plants from genotype seeds (AMS / AMS; + / +) are crossed with an elite line. Preferably, this elite line is identical to that used in the successive backcrossing step in order to introgress the genotype (AMS / AMS; SSB / +).

The advantage of this cross is to produce basic semen of genotype (ÂMS / +; + / +).

Genetic assessment:

Phenotypic assessment:

All grains (which are normal) have the genotype (AMS / +; + / +) and therefore will give sterile male plants.

9.d) Crossing of genotype plants (AMS / +; + / +) with the male elite line (WT) in order to obtain hybrid seeds.

Plants from genotype seeds (AMS / +; + / +) are crossed with an elite male line. Preferably, the elite line used in this cross is different from that used in the cross described in Example 9.c).

The advantage of this cross is to produce hybrid seed.

Genetic assessment:

Phenotypic assessment

All the grains are normal. Half of them will give sterile male plants, the other half will give fertile male plants thus ensuring pollination and therefore the production of "consumption" corn or "grain" corn. EXAMPLE 10 Sort by densimetric table of depressed grains.

The densimetric table used makes it possible to divide into six fractions, grains of equivalent size and surface quality, but which differ between them by their specific weight.

A densimetric sorting is carried out on a batch of F3 ear seeds, coming from the self-fertilization of plants of genotype (+ / +; SSB / +). Theoretically, these ears have a proportion of 75% of depressed grains and 25% of normal grains. 33 ears were seeded so as to obtain approximately 500 grams of seeds. 6 grain fractions were formed by densimetric sorting.

The table below is a summary of the results obtained (sorting with respect to the grain phenotype and genetic analyzes on the expression of the bar gene conferring resistance to glufosinate).

Sorting according to the grain phenotype (normal or depressed): Fractions 1 and 2 contain only depressed grains. In fractions 3, 4 and 5 we mainly have depressed grains but we also find some normal grains (ie 6.1, 8.2 and 19.1% respectively for fractions 3, 4 and 5).

As for fraction 6 we have almost only normal grains (97%). Fractions 1 to 5 therefore correspond to depressed grains and fraction 6 to normal grains. There is also a small amount of unsorted grain. This small amount corresponds to both normal and depressed grains. However, visually, the depressed grains are larger in number compared. with normal grains.

Results of genetic analyzes (on the expression of the bar gene conferring resistance to the herbicide Basta ^® ):

The results of genetic analyzes confirm those of the sorting done on the grain phenotype for each of the fractions.

So we have in fraction 6 a small part of depressed grains (about 3 to 4%). The latter is completely eliminated by a second pass on the densimetric table.

Fractions 1 to 5 correspond to depressed grains and fraction 6 to normal grains.

Example 11: Evaluation of the various stages of the production of hybrid seeds of corn starting from this new process.

Three types of experiments have been tested for seed production:

• Production of pre-basic seeds

• Production of basic seeds • Production of hybrid seeds

Production of pre-basic seeds:

The production of pre-basic seeds (genotype (AMS / AMS; + / +)) was ensured by the cultivation of plants of genotype (AMS / AMS; SSB / +). These plants have been observed to be fertile males.

Plants of genotype (AMS / AMS; SSB / +) are self-fertilized. About 25% of the grains obtained in the offspring correspond to pre-basic seeds. Basic seed production:

The production of basic seeds (genotype (AMS / +; + / +)) was ensured by the cultivation of plants of genotype (AMS / AMS; + / +). These plants have been observed sterile males and have no deleterious effect on the vegetative aspect of the plant attesting that the use of an AMS transgene in the homozygous state is compatible with the hybrid corn seed production system such as as described in the present invention.

The genotype plants (AMS / AMS; + / +) were crossed with a wild genotype plant. 100% of the grains obtained in the offspring correspond to basic seeds.

Hybrid seed production:

The production of hybrid seeds was obtained by crossing between sterile male plants of genotype (AMS / +; + / +) derived from basic seeds with a wild elite line. All plants of genotype (AMS / +; + / +) did show complete male sterility (100% sterility).

EXAMPLE 12 Production of hybrid seeds.

In seed production, two types of crossings are preferably carried out. These two crosses make it possible to produce hybrid seed.

12.a) Crossing of genotype plants (AMS / AMS; SSB / +) with genotype plants (AMS / AMS; + / +.

Genetic assessment:

Balance phénotypiq ^eu:

50% of the grains obtained are normal and all have the genotype (AMS / AMS;

+ / +). These grains can be separated by a densimetric sorting, preferably using a densimetric table.

12.b) Crossing of genotype plants (AMS / AMS; SSB / +) with an elite line of wild genotype (WT).

Genetic assessment:

AMS; SSB AMS; + AMS; SSB AMS; +

+: + AMS / +; SSB / + AMS / +; + / + AMS / +; SSB / + AMS / +; + / +

Phenotypic assessment

All normal grains have the genotype (AMS / +; + / +). These grains can be separated by densimetric sorting, preferably using a densimetric table. This crossing saves time in obtaining hybrid seeds (6 to 12 months less) compared to the crossing described in the example.

12.a). However, it requires a production area for the maintenance line

(AMS / AMS; SSB / + genotype) larger in size for an equivalent number of hectares of (hybrid) seed.

BIBLIOGRAPHICAL REFERENCES

- Year and ai. (1986) Plant Physiol. 81, 86-91.

- Anderson, O.D., Green, F.C., Yip, R.E., Halford, N.G., Shewry, P.R. and Malpica-Romero, J.-M. (1989) Nucl. Acid. Res. 17, 461.

- Bevan et al. (1984) Nucleic Acid Research, 11, 369-385.

- Cao J., Duan, X., McEIroy, D. and Wu, R. (1992) Plant. Cell. Rep. .11, 586-591.

- Cheng W.H., Taliercio E.W. and Chourey P.S. (1996). The Miniaturel Seed Locus of Maize Encodes a Cell Wall Invertase Required for Normal Development of

Endosperm and Maternai Cells in the Pedicel. Plant Cell., 8 (6): 971-983.

- Chourey P.S., Nelson O.E .. (1976). The enzymatic deficiency conditioned by the shrunken-1 mutations in maize. Biochem Broom, 14 (11-12): 1041-55.

- Depicker et al., (1982) J. Mol. Appl. Broom, 1, 561-573. - Di Fonzo N, et al. (1988) Mol Gen Genêt 212 (3), 481-7.

- Finer J. (1992) Plant Cell Report 11: 323-328.

- Franck et al. (1980) Cell, 21, 285-294.

- Fromm et al. (1986) Nature, 319, 791 -793.

^'- Hartley, RW (1988) J. Mol. Biol. 202, 913-915. - Herrera-Estrella et al (1983), EMBO J. 2, 987-995.

- Ishida Y, Saito H ,. Ohta S, Hiei Y, Komari T, Kumashiro T (1996) Nat. BiotechnolΛ4 (6): 745-5.

- Jouanin et al. (1987) Plant Sci., 53, 53-63.

- Klein (1987) Nature 327 .70-73. - Komari T., Hiei Y., Saito Y., Murai N., Kumashiro T. (1996). Vêctors arrying two separate T-dans for co-transformation of higher plants mediated by Agrobacterium tumefaciens and segregation of transformants free from selection markers. Plant Journal, 10, 165-174.

- Krens et al. (1982) Nature, 296, 72-74. - Lyzrik L. and Hodges T. (1997). FLP mediated recombination of FRT sites in the maize genome. Nucleic Acids Research, 44, 123-132.

- McEIroy D., Blowers, AD, Jeήes, B. and Wu, R. (1991) Mol. Gen. Broom 231, 150-160. - Messing J. et al. (1983) Methods in Enzymology, 101, 20-78.

- Paul.W., et al. (1992) Plant Mol. Biol. 19: 611-622.

- Robert et al. (1989) Plant Cell, 1: 569-578.

- Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor,

New York.

- Southern E.M. (1975) J. Mol Biol. 98: 503-517.

- Watson et al. (1994) Ed. De Boeck University, pp 273-292.

- White, J., Chang S-YP., Bibb, MJ. and Bibb, MJ. (1990) Nucl. Acid. Res. 18, 1062.

- Yoder et al. (1993) Bio / Technology, 12, 263-292.

Claims

1. Method for producing seeds of maize homozygous for a transgene conferring artificial nuclear male sterility ("AMS") and heterozygous for a fertility restoration gene linked to a marker of "small grain" phenotype, comprising the steps consisting to: a) cross a sterile male corn plant heterozygous for the AMS transgene with a fertility restorer corn plant comprising in its genome a fertility restoration gene linked to a marker of "small grain" phenotype, b) select by the “small grain” phenotype corn seeds comprising in their genome a fertility restoration gene linked to a marker of “small grain” phenotype, c) self-fertilize the corn plants from the seeds selected according to step b) , d) select seeds homozygous for the AMS transgene and heterozygous for the fertility restoration gene linked to a phenotype marker " small grain ".

2. Method for producing seeds of maize homozygous for a transgene conferring artificial nuclear male sterility ("AMS") and heterozygous for a gene for restoring fertility linked to a marker of "small grain" phenotype, comprising the steps consisting in: : a) cross a sterile male corn plant heterozygous for the AMS transgene with a fertility restoring corn plant comprising in its genome a fertility restoration gene linked to a marker of "small grain" phenotype, b) making a genotyping of seeds obtained by crossing according to step a), c) self-fertilizing the corn plants derived from seeds genotyped according to step b), d) selecting seeds homozygous for the AMS transgene and heterozygous for the restoration gene fertility linked to a marker of "small grain" phenotype.

3. Corn seed homozygous for an AMS transgene and heterozygous for a fertility restoration gene linked to a marker of “small grain” phenotype, capable of being obtained by the method according to claim 1 or 2.

4. A method for producing homozygous corn seeds for a transgene conferring artificial nuclear male sterility ("AMS"), comprising the steps consisting in:. a) cross a sterile male corn plant heterozygous for the AMS transgene with a fertility restoring corn plant comprising in its genome a fertility restoration gene linked to a marker of "small grain" phenotype, b) select by "small grain" phenotype corn seeds comprising in their genome a fertility restoration gene linked to a marker of "small grain" phenotype, c) self-fertilize the corn plants from the seeds selected according to step b), d ) select seeds homozygous for the AMS transgene and heterozygous for the fertility restoration gene linked to a “small grain” phenotype marker, e) self-fertilize seed corn plants according to step d), f) select seeds homozygous for the AMS transgene.

5. A method for producing homozygous corn seeds for a transgene conferring artificial nuclear male sterility ("AMS") comprising the steps consisting in: a) crossing a sterile male corn plant heterozygous for the AMS transgene with a restorative corn plant of fertility comprising in its genome a gene for restoring fertility linked to a marker of "small grain" phenotype, b) genotyping seeds obtained by crossing according to step a), c) self-fertilizing corn plants from genotype seeds according to step b), d) select seeds which are homozygous for the AMS transgene and heterozygous for the fertility restoration gene linked to a “small grain” phenotype marker, e) self-fertilize corn plants from seeds according to step d), f) select seeds homozygous for the AMS transgene.

6. Method for producing seeds of homozygous corn for an AMS transgene, comprising the steps consisting in: a) self-fertilizing corn plants derived from seeds according to claim 3, b) selecting seeds homozygous for an AMS transgene.

7. Method according to one of claims 1, 2 and 4 to 6, characterized in that at least one selection step comprises a densimetric sorting.

8. Method according to claim 7, characterized in that the densimetric sorting is carried out using a densimetric table.

9. A method of producing a heterozygous seed for an AMS transgene comprising crossing a corn plant from a homozygous seed for an AMS transgene, capable of being obtained by the method according to one of claims 4 to 8, with a wild genotype corn plant.

10. A method of producing a heterozygous seed for an AMS transgene, characterized in that the method according to one of claims 4 to 8 further comprises crossing a corn plant from said homozygous seed for an AMS transgene with a wild genotype corn plant.

11. Method according to one of claims 1, 2 and 4 to 10, wherein the AMS transgene conferring artificial nuclear male sterility is the barnase gene, which is included in an expression cassette, under the control of a promoter specific for pollenogenesis, in particular an anther-specific promoter such as pA3, pA6, pA9, pTA29, or the Mac2 promoter, and of the terminator 3'CaMV or 3'Nos, genetically linked to a gene coding for a selection agent under control of the Actin-intron actin promoter and of the 3'CaMV or 3'Nos terminator.

12. The method of claim 11, characterized in that the expression cassette comprising the barnase gene further comprises a gene encoding a protein of therapeutic and / or prophylactic interest genetically linked to the barnase gene.

13. The method of claim 11 or 12, characterized in that said promoter is the specific promoter of pollenogenesis pA9.

14. Method according to one of claims 11, 12 or 13, characterized in that said gene coding for a selection agent is chosen from the bar gene which confers resistance to the herbicide Basta ^® and the Nptll gene which confers resistance with kanamycin, said gene being included inside the transposable element Ds.

15. Expression cassette comprising a fertility restorer gene genetically linked to at least one gene coding for a 'small grain' phenotype, associated with elements allowing their expression in plant cells, in particular a promoter and a transcription terminator.

16. Expression cassette according to claim 15, characterized in that said fertility restorer gene is the barstar gene placed under the control of a specific promoter of pollenogenesis, in particular a specific promoter of anther such as pA3, pA6, pA9, pTA29, or the Mac2 promoter, and the 3'CaMV or 3'Nos terminator, genetically linked to a gene encoding a selection agent under the control of the actin-intron actin promoter and the 3'CamV or 3 'terminator our

17. Expression cassette according to claim 15 or 16, characterized in that said gene coding for a 'small grain' phenotype is chosen from the shrunken 2 and brittle 2 genes in antisense orientation.

18. Expression cassette according to any one of claims 15 to 17, characterized in that the promoter associated with the gene coding for a 'small grain' phenotype is chosen from the HMWG and B32 promoters.

19. Expression cassette according to any one of claims 15 to 18, characterized in that said terminator is chosen from the 3'Nos terminator and the 3'CaMV terminator.

20. Vector, in particular plasmid, characterized in that it contains at least one expression cassette as described in one of claims 11 to 19.

21. Cell host, in particular bacteria such as Agrobacterium tumefaciens, transformed by a vector according to claim 20.

22. Corn cell transformed by at least one vector according to claim 20.

23. Fertility restoring corn plant characterized in that it includes in its genome a fertility restoring gene linked to a marker of "small grain" phenotype.

24. Corn plant homozygous for an AMS transgene and heterozygous for a fertility restoration gene linked to a “small grain” phenotype marker, obtained from a seed according to claim 3.

25. A method of propagating a corn plant homozygous for an AMS transgene and heterozygous for a fertility restoration gene linked to a marker of “small grain” phenotype, comprising the steps consisting in: a) self-fertilizing corn plants homozygous for an AMS transgene and heterozygous for a fertility restoration gene linked to a “small grain” phenotype marker, capable of being obtained by the method according to one of claims 1 or 2,. b) select seeds homozygous for the AMS transgene and of “small grain” phenotype, c) select seeds homozygous for the AMS transgene and heterozygous for a fertility restoration gene linked to a marker of “small grain” phenotype obtained by self-fertilization of corn plants obtained from seeds obtained according to step b).

26. The method of claim 25, characterized in that step b) comprises a densimetric sorting.

27. Kit for implementing the method according to claim 25 or 26, characterized in that it comprises seeds of maize homozygous for an AMS transgene and heterozygous for a fertility restoration gene linked to a phenotype marker " petit grain ", and oligonucleotides specific for the AMS transgene useful as primers for the detection by PCR of seeds homozygous for an AMS transgene and heterozygous for a fertility restoration gene linked to a marker of phenotype" small grain ".