EP1480995A2 - Cks1 INHIBITORS - Google Patents
Cks1 INHIBITORSInfo
- Publication number
- EP1480995A2 EP1480995A2 EP03711050A EP03711050A EP1480995A2 EP 1480995 A2 EP1480995 A2 EP 1480995A2 EP 03711050 A EP03711050 A EP 03711050A EP 03711050 A EP03711050 A EP 03711050A EP 1480995 A2 EP1480995 A2 EP 1480995A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- cksl
- skp2
- cells
- antisense
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention provides methods and compositions for modulating the expression of Cksl and Skp2, and antisense and ribozyme compounds specifically hybndizable with Cksl or Skp2.
- Cks proteins are low molecular weight (9-18kDa) ubiquitously expressed proteins that directly bind to cyclin-dependent kinase (CDK)/cyclin complexes. They were initially identified as mutants that are able to genetically suppress defective alleles of CDKs in yeast. Human Cksl and Cks2 were cloned 1990 and most of the data indicated a function during mitosis like proteasomal degradation of ubiquitinated cyclin B. Recently, Cksl was shown to be not essential in mice and Cksl-/- cells proliferate more slowly but do not arrest in mitosis.
- Cksl was shown to associate with p45Skp2, a subunit of the SCF ubiquitin ligase which mediates degradation of several cell cycle regulators in Gl/S-phase.
- Analysis of the Cks-/- cells revealed that depletion of Cksl induced an increase in cyclin E and p27Kipl protein levels, indicating that Cksl indeed plays a role in degradation during Gl/S-phase, a function independent of CDKs.
- Skp2 has been implicated in the ubiquitin-mediated degradation of regulators of mammalian Gl progression, including the cyclin-dependent kinase p27.
- p27 is a tumor suppressor protein that works in a dosage-dependent manner. (Fero, M.L. et al., Nature (1998) 395:177-180).
- the present invention provides, in one embodiment, inhibitors of Cksl and Skp2.
- Inventive inhibitors include, but are not limited to, antisense molecules, ribozymes, antibodies or antibody fragments, proteins or polypeptides as well as small molecules.
- Exemplary antisense molecules comprise at least 10, 15 or 20 consecutive nucleotides of or hybridize under stringent conditions to the nucleic acid of SEQ ID NO:l. More preferred are antisense molecules that comprise at least 25 consecutive nucleotides of or hybridize under stringent conditions to the sequence of SEQ ID NO:l.
- Representative antisense molecules are provided herein as SEQ ID NOS:26-30.
- compositions that comprise one or more Cksl or Skp2 inhibitor in a pharmaceutically acceptable carrier.
- Additional embodiments provide methods of decreasing Cksl or Skp2 gene expression or biological activity.
- the invention provides an antisense ohgonucleotide comprising at least one modified internucleoside linkage.
- the invention further provides an antisense ohgonucleotide having a phosphorothioate linkage.
- the invention still further provides an antisense ohgonucleotide comprising at least one modified sugar moiety.
- the invention also provides an antisense ohgonucleotide comprising at least one modified sugar moiety which is a 2'-O-methyl sugar moiety.
- the invention further provides an antisense ohgonucleotide comprising at least one modified nucleobase.
- the invention still further provides an antisense ohgonucleotide having a modified nucleobase wherein the modified nucleobase is 5-methylcytosine.
- the invention also provides an antisense compound wherein the antisense compound is a chimeric ohgonucleotide.
- the invention provides a method of inhibiting the expression of human Cksl or Skp2 in human cells or tissues comprising contacting the cells or tissues in vivo with an antisense compound or a ribozyme of 8 to 35 nucleotides in length targeted to a nucleic acid molecule encoding human Cksl or Skp2 so that expression of human Cksl or Skp2 is inhibited.
- the invention further provides a method of modulating growth of cancer cells comprising contacting the cancer cells in vivo with an antisense compound or ribozyme of 8 to 35 nucleotides in length targeted to a nucleic acid molecule encoding human Cksl or Skp2 so that expression of human Cksl or Skp2 is inhibited.
- the invention still further provides for identifying target regions of Cksl or Skp2 polynucleo tides.
- the invention also provides labeled probes for identifying Cksl or Skp2 polynucleotides by in situ hybridization.
- the invention provides for the use of an Cksl or Skp2 inhibitor according to the invention to prepare a medicament for modulating cell proliferation.
- the invention also provides a pharmaceutical composition for inhibiting expression of the Cksl or Skp2, comprising an antisense ohgonucleotide according to the invention in a mixture with a physiologically acceptable carrier or diluent.
- the invention further provides a ribozyme capable of specifically cleaving Cksl or Skp2 RNA, and a pharmaceutical composition comprising the ribozyme.
- the invention also provides small molecule inhibitors of Cksl wherein the inhibitors are capable of reducing the activity of Cksl or Skp2 or of reducing or preventing the expression of Cksl or Skp2 mRNA.
- the invention therefore provides an isolated Cksl inhibitor selected from the group consisting of an antisense ohgonucleotide, a ribozyme, a protein, a polypeptide, an antibody, and a small molecule.
- the isolated Cksl inhibitor is an antisense molecule.
- the isolated Cksl inhibitor antisense molecule or the complement thereof comprises at least 10 consecutive nucleic acids of the sequence of SEQ ID NO: 1.
- the isolated Cksl inhibitor antisense molecule or the complement thereof hybridizes under high stringency conditions to the sequence of SEQ ID NO:l.
- the isolated Cksl inhibitor antisense molecule comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:26-
- the isolated Cksl inhibitor is a ribozyme, and in yet other embodiments, the isolated Cksl inhibitor is selected from the group consisting of an antibody and an antibody fragment.
- the invention further provides a composition comprising a therapeutically effective amount of a Cksl inhibitor in a pharmaceutically acceptable carrier.
- this composition comprises two or more Cksl inhibitors in the composition, and the Cksl inhibitor is an antisense molecule.
- the invention yet further provides a method of inhibiting the expression of Cksl in a mammalian cell, comprising administering to said cell an Cksl inhibitor selected from the group consisting of an antisense ohgonucleotide, a ribozyme, a protein, a polypeptide, an antibody, and a small molecule.
- an Cksl inhibitor selected from the group consisting of an antisense ohgonucleotide, a ribozyme, a protein, a polypeptide, an antibody, and a small molecule.
- the invention still further provides a method of inhibiting the expression of Cksl gene expression in a subject, comprising administering to said subject, in a pharmaceutically effective vehicle, an amount of an antisense ohgonucleotide which is effective to specifically hybridize to all or part of a selected target nucleic acid sequence derived from said Cksl gene.
- the antisense ohgonucleotide is selected from the group consisting of SEQ ID NO:26-30.
- the invention also provides a method of treating neoplastic disease, comprising administering to a mammalian cell an Cksl inhibitor selected from the group consisting of an antisense ohgonucleotide, a ribozyme, a protein, a polypeptide, an antibody, and a small molecule such that the neoplastic disease is reduced in severity.
- an Cksl inhibitor selected from the group consisting of an antisense ohgonucleotide, a ribozyme, a protein, a polypeptide, an antibody, and a small molecule such that the neoplastic disease is reduced in severity.
- an antisense compound of 8 to 35 nucleotides in length targeted to a nucleic acid molecule encoding human Cksl wherein the antisense compound inhibits the expression of human Cksl, and an isolated polynucleotide with a sequence comprising a transcriptional initiation region and a sequence encoding an antisense ohgonucleotide at least 8 nucleotides or nucleotide analogues and not longer than 35 nucleotides in length comprising a sequence selected from the group consisting of SEQ ID NOS:26-30.
- the isolated Skp2 inhibitor is an antisense molecule.
- the isolated Skp2 inhibitor antisense molecule or the complement thereof comprises at least 10 consecutive nucleic acids of the sequence of SEQ ID NO:3.
- the isolated Skp2 inhibitor antisense molecule or the complement thereof hybridizes under high stringency conditions to the sequence of SEQ ID NO:3.
- the isolated Skp2 inhibitor antisense molecule comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:5, 7, 9, 11, 13, 15, 17, 19, 21 and 23.
- the isolated Skp2 inhibitor is a ribozyme, and in yet other embodiments, the isolated Skp2 inhibitor is selected from the group consisting of an antibody and an antibody fragment.
- the invention further provides a composition comprising a therapeutically effective amount of a Skp2 inhibitor in a pharmaceutically acceptable carrier.
- this composition comprises two or more Skp2 inhibitors in the composition, and the Skp2 inhibitor is an antisense molecule.
- the antisense molecule or the complement thereof comprises at least 10 consecutive nucleic acids of the sequence of
- the antisense molecule comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:5, 1, 9, 11, 13, 15, 17, 19, 21 and 23.
- the invention yet further provides a method of inhibiting the expression of Skp2 in a mammalian cell, comprising administering to said cell a Skp2 inhibitor selected from the group consisting of an antisense ohgonucleotide, a ribozyme, a protein, a polypeptide, an antibody, and a small molecule.
- a Skp2 inhibitor selected from the group consisting of an antisense ohgonucleotide, a ribozyme, a protein, a polypeptide, an antibody, and a small molecule.
- the Skp2 inhibitor is an antisense molecule.
- the invention still further provides a method of inhibiting the expression of Skp2 gene expression in a subject, comprising administering to said subject, in a pharmaceutically effective vehicle, an amount of an antisense ohgonucleotide which is effective to specifically hybridize to all or part of a selected target nucleic acid sequence derived from said Skp2 gene.
- the antisense ohgonucleotide is selected from the group consisting of SEQ ID NO:5, 7, 9, 11, 13, 15, 17, 19, 21 and 23.
- the invention also provides a method of treating neoplastic disease, comprising administering to a mammalian cell an Skp2 inhibitor selected from the group consisting of an antisense ohgonucleotide, a ribozyme, a protein, a polypeptide, an antibody, and a small molecule such that the neoplastic disease is reduced in severity.
- an Skp2 inhibitor selected from the group consisting of an antisense ohgonucleotide, a ribozyme, a protein, a polypeptide, an antibody, and a small molecule such that the neoplastic disease is reduced in severity.
- a recombinant vector comprising a polynucleotide with a sequence comprising a transcriptional initiation region and a sequence encoding an antisense ohgonucleotide at least 8 nucleotides or nucleotide analogues and not longer than 35 nucleotides in length comprising a sequence selected from the group consisting of SEQ ID NOS:5, 7, 9, 11, 13, 15, 17, 19, 21 and 23.
- Figure 1 is a Cksl polynucleotide (SEQ ID NO:l).
- Figure 2 is a Skp2 polynucleotide (SEQ ID NO:3) and polypeptide (SEQ ID NO:4).
- Figure 3 is a bar graph showing expression of Cksl messenger RNA, normalized to actin, in tumor cell lines.
- Figure 4 is a graph showing that Cksl, as well as Cks2, are required for cell proliferation in tumor cells, as shown by treating SW620 cells with antisense oligonucleotides specific for Cksl ( Figure 4A, SEQ ID NO:30) or Cks2 ( Figure 4B, SEQ ID NO: 39).
- Figure 4C shown proliferation of cells treated with SEQ ID NO: 15, specific for Skp2.
- Figure 5 is a bar graph showing that depletion of Cksl inhibits anchorage- independent growth of SW620 cells, using SEQ ID NO:27 and 30.
- Figure 6 is a bar graph showing that Cksl depletion by antisense treatment caused cytotoxicity in MRC9 (Figure 6A) cells and SW620 ( Figure 6B) cells.
- Figure 7 A is a bar graph showing that inhibition of Cksl expression using an antisense ohgonucleotide results in accumulation of p27Kipl.
- Figure 7B is a photograph confirming the accumulation of p27Kipl.
- p34cdc2 is a cell cycle dependent kinase, also known as Ckdl.
- p45Skp2 is protein Skp2.
- Figure 8 shows that depletion of Cksl but not Cks2 affects p27Kipl protein levels in tumor cells.
- Figure 9 shows that Cksl depletion by antisense treatment does not significantly alter the cell cycle profile of asynchronously growing SW620 and MRC9 cells.
- FIG 10 shows that Skp2 depletion did not affect cyclin E degradation directly.
- Skp2AS is SEQ ID NO: 15 and Skp2RC is SEQ ID NO: 16.
- Skp2AS but not Skp2RC decreased Skp2 mRNA levels in treated SW620 colon cancer cells.
- cyclin E levels are not significantly affected by Skp2AS.
- Figure 11 is a bar graph showing that Skp2AS (SEQ ID NO: 15), but not Skp2 RC (SEQ ID NO: 16) decreased Skp2 mRNA levels in normal human fibroblasts.
- Figure 12 is a bar graph showing the effect of Cksl and Skp2 depletion on anchorage independent growth.
- Figure 13 is a bar graph showing that p27 depletion reverses the effect of Cksl antisense on anchorage-independent growth.
- the invention relates to the use of inhibitors, preferably oligonucleotides, such as antisense molecules or ribozymes, to target and modulate the expression of polynucleotides comprising a Cksl nucleotide sequence or a Skp2 nucleotide sequence.
- inhibitors preferably oligonucleotides, such as antisense molecules or ribozymes
- Cksl plays a pivotal role in tumorigenisis. Depletion of Cksl in tumor cells using antisense oligonucleotides targeting Cksl mRNA induced cell death after 2 days, reduced cell proliferation, and inhibited colony formation in soft agar, indicating that Cksl is required for cell survival, cell proliferation, and anchorage independent growth of tumor cells. Cksl inhibition did not affect the cell cycle profile of SW620 cells although it induced the accumulation of the CDK inhibitor p27Kipl as demonstrated by Western blot analysis.
- Cksl directs the ubiquitin-mediated proteolysis of the CDK-bound substrate p27Kipl by the protein ubiquitin ligase (E3) SCF (Skp2).
- E3 SCF protein ubiquitin ligase
- Cksl associates with the F box protein Skp2 and is essential for recognition of the p27Kipl substrate for ubiquitination in vivo and in vitro.
- p27Kipl ubiquitination activity is dependent on Cksl.
- CKS1-/- mice are abnormally small, and cells derived from them proliferate poorly, particularly under limiting mitogen conditions, possibly due to elevated levels of p27Kipl.
- the invention herein demonstrates that antisense oligonucleotides specific for Skp2 polynucleotides inhibit tumor cell growth as well as induce tumor cell death.
- Cksl (CHIR39) mRNA levels are increased in tumors of colon and breast cancer patients compared to normal tissue by 20-40%. Further expression data confirmed overexpression of Cksl in breast and colon cancer cell lines and tissues.
- ohgonucleotide molecules capable of hybridizing with Cksl or Skp2 polynucleotides inhibited the proliferation of colon cancer cell line SW620.
- This cell line is a standard model for cancer cell proliferation and growth in vivo, and the results support in vivo use of the Cksl and Skp2 antisense molecules to ameliorate cancer in humans and other mammals.
- SW620 is an established model system for colon cancer, as recognized by those of skill in the art. These cells are derived from metastasized secondary tumors resected from a single colon cancer patient (Hewitt et al., J. Pathol. (2000) 192:446-54). They are fibroblast-like in appearance and highly tumorigenic; SW620 xenografts form solid sheets of tumor cells. SW620 cells have been used to study the advanced stages of progression of colon cancer (Hewitt et al., J. Pathol. (2000) 792:455-59; Smith et al., J. Nucl. Med (2000) 47:1753-59; O'Connell et al., J. Cell Physiol. (2000) 755:331-38).
- the present invention relates to antisense oligonucleotides directed to Cksl or Skp2 polynucleotides.
- Antisense strategies directed against the other genes in S W620 cells have been disclosed previously. Transfecting SW620 cells with a plasmid encoding antisense FasL cDNA suggests that impairing FasL translation can inhibit tumor progression (Nyhus et al., Gene Ther. (2001) 5:209-14).
- p53 antisense oligonucleotides inhibited the growth of SW620 (Hirota et al., Jpn. J. Cancer Res.
- oligonucleotides capable of hybridizing with Cksl DNA or RNA referred to as the target polynucleotide.
- An ohgonucleotide need not be 100% complementary to the target polynucleotide, as long as specific hybridization is achieved.
- the degree of hybridization to be achieved is that which interferes with the normal function of the target polynucleotide, be it transcription, translation, pairing with a complementary sequence, or binding with another biological component such as a protein.
- An antisense ohgonucleotide can interfere with DNA replication and transcription, and it can interfere with RNA translocation, translation, splicing, and catalytic activity.
- the invention includes within its scope any ohgonucleotide of about 8 to about 35 nucleotides in length, including variations as described herein, wherein the ohgonucleotide hybridizes to a Cksl polynucleotide, including DNA or mRNA, such that an effect on the normal function of the polynucleotide is achieved.
- the ohgonucleotide can be 8, 10, 15, 17, 18, 20, 22, 25, 28, 30, 32, or 35 nucleotides in length.
- the nucleotide sequence of Cksl is shown in Figure 1 (SEQ ID NO:l).
- Preferred antisense oligonucleotides include:
- Control oligonucleotides are as follows:
- the antitumor use of the oligonucleotides disclosed herein is based on the discovery that Cksl antisense oligonucleotides can reduce Cksl mRNA levels in tumor cells, and can inhibit proliferation of cells of two separate tumor cell lines.
- MRC9 cells and SW620 cells were incubated with a transfection mixture of an ohgonucleotide and a carrier, specifically a lipitoid or cholesteroid, although other carriers can be used as is known in the art. After an incubation of 2-24 hours, the transfection mixture was removed and replaced with normal growth media as described in the Examples.
- Examples of preferred antisense compounds useful in the invention are based on SEQ ID NOS:26-30, and include oligonucleotides containing modified backbones or non-natural internucleoside linkages. Oligonucleotides having modified backbones include those retaining a phosphorus atom in the backbone, and those that do not have a phosphorus atom in the backbone.
- Preferred modified ohgonucleotide backbones include phosphorothioates, chiral phosphorothioates, phosphotriesters, aminoalkylphosphotri esters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoroamidates including 3 '-amino phosphoroamidate and aminoalkylphosphoroamidates, thiophosphoroamidates, thioalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3 '-5' linkages, 2 '-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3 '-5' to 5 '-3' or 2 '5' to 5 '-2'.
- Various salts, mixed salts and free acid forms are also included.
- Examples of 20-mer oligonucleotides capable of binding to Cksl polynucleotides include the following oligonucleotides, indicated by polynucleotide positions with reference to SEQ ID NO: 1 :
- Examples of 20-mer oligonucleotides capable of binding to Skp2 polynucleotides include the following oligonucleotides, indicated by polynucleotide positions with reference to SEQ ID NO:25:
- Examples of 25-mer oligonucleotides capable of binding to Skp2 polynucleotides include the following oligonucleotides, indicated by polynucleotide positions with reference to SEQ ID NO:25:
- skp2-l AS AGACAGTATGCCGTGGAGGGTGGAC (SEQ ID NO:5) skp2-2 AS CTTCGCCTTCCAGATTCCCGCTTTG (SEQ ID NO:7) skp2-3 AS CCCCTTGAGACAGCAACCGACCAGT (SEQ ID NO:9) skp2-4 AS AGGACACCCAGGAAGGTTAAGTCGC (SEQ ID NO:ll) skp2-5 AS GGCAATGGTGGTGAAATGGGAGCAA (SEQ ID NO: 13) skp2-6 AS GTTCTCACTGTCGGGCTCCTCTTTC (SEQ ID NO: 15) skp2-7 AS GGCAATCACCCCTTGAGACAGCAAC (SEQ ID NO: 17) skp2-8 AS TGAGACAGTATGCCGTGGAGGGTGG (SEQ ID NO: 19) skp2-9 AS TGGGCTTTTGC AGTGTCAGTCGGC (SEQ ID NO:21 ) skp2-10 AS C
- the antisense compounds of the invention can include modified bases as disclosed in 5,958,773 and patents disclosed therein.
- the antisense oligonucleotides of the invention can also be modified by chemically linking the ohgonucleotide to one or more moieties or conjugates to enhance the activity, cellular distribution, or cellular uptake of the antisense ohgonucleotide.
- moieties or conjugates include lipids such as cholesterol, cholic acid, thioether, aliphatic chains, phospholipids, polyamines, polyethylene glycol (PEG), palmityl moieties, and others as disclosed in, for example, U.S. Patents 5,514,758, 5,565,552, 5,567,810, 5,574,142, 5,585,481, 5,587,371, 5,597,696 and 5,958,773.
- Chimeric antisense oligonucleotides are also within the scope of the invention, and can be prepared from the present inventive oligonucleotides using the methods described in, for example, U.S. Patents 5,013,830, 5,149,797, 5,403,711, 5,491,133, 5,565,350, 5,652,355, 5,700,922 and 5,958,773.
- Preferred antisense oligonucleotides in addition to those of SEQ ID NO:26-30 can be selected by routine experimentation using, for example, assays described in the Examples. Although the inventors are not bound by a particular mechanism of action, it is believed that the antisense oligonucleotides achieve an inhibitory effect by binding to a complementary region of the target polynucleotide within the cell using Watson-Crick base pairing. Where the target polynucleotide is RNA, experimental evidence indicates that the RNA component of the hybrid is cleaved by RNase H (Giles, R.V. et al., Nuc. Acids Res. (1995) 23:954-961; U.S. Patent No. 6,001,653).
- a hybrid containing 10 base pairs is of sufficient length to serve as a substrate for RNase H.
- an antisense molecule of at least 17 nucleotides it is preferable to use an antisense molecule of at least 17 nucleotides, as a sequence of this length is likely to be unique among human genes.
- the ohgonucleotide is selected such that the sequence exhibits suitable energy related characteristics important for ohgonucleotide duplex formation with their complementary templates, and shows a low potential for self-dimerization or self- complementation (Anazodo et al., Biochem. Biophys. Res. Commun. (1996) 229:305- 309).
- the computer program OLIGO Primary Analysis Software, Version 3.4
- OLIGO is used to determined antisense sequence melting temperature, free energy properties, and to estimate potential self-dimer formation and self-complimentarity properties.
- the program allows the determination of a qualitative estimation of these two parameters (potential self-dimer formation and self-complimentary) and provides an indication of "no potential” or "some potential” or “essentially complete potential.” Segments of Cksl polynucleotides are generally selected that have estimates of no potential in these parameters. However, segments can be used that have "some potential” in one of the categories. A balance of the parameters is used in the selection.
- the antisense art a certain degree of routine experimentation is required to select optimal antisense molecules for particular targets. To be effective, the antisense molecule preferably is targeted to an accessible, or exposed, portion of the target RNA molecule.
- this experimentation can be performed routinely by transfecting cells with an antisense ohgonucleotide using methods described in Example 1.
- mRNA levels in the cell can be measured routinely in treated and control cells by reverse transcription of the mRNA and assaying the cDNA levels.
- the biological effect can be determined routinely by measuring cell growth or viability as is known in the art.
- RNA from treated and control cells should be reverse-transcribed and the resulting cDNA populations analyzed.
- cultures of SW620 cells were transfected with five different antisense oligonucleotides designed to target Cksl. These oligonucleotides are shown in SEQ ID NO:26-30.
- SEQ ID NO:26-30 The levels of mRNA corresponding to Cksl were measured in treated and control cells. SEQ ID NO:26-30 caused dramatic decreases in Cksl mRNA when normalized to actin mRNA levels.
- Additional inhibitors include ribozymes, proteins or polypeptides, antibodies or fragments thereof as well as small molecules.
- Each of these Cksl and Skp2 inhibitors share the common feature in that they reduce the expression and/or biological activity of Cksl and Skp2, respectively.
- alternative inhibitors may be obtained through routine experimentation utilizing methodology either specifically disclosed herein or as otherwise readily available to and within the expertise of the skilled artisan.
- Cksl and Skp2 inhibitors may be ribozymes.
- a ribozyme is an RNA molecule that specifically cleaves RNA substrates, such as mRNA, resulting in specific inhibition or interference with cellular gene expression.
- the term ribozymes includes RNA molecules that contain antisense sequences for specific recognition, and an RNA-cleaving enzymatic activity. The catalytic strand cleaves a specific site in a target RNA at greater than stoichiometric concentration.
- ribozymes may be utilized within the context of the present invention, including for example, the hammerhead ribozyme (for example, as described by Forster and Symons, Cell (1987) 45:211-220; Haseloff and Geriach, Nature (1988) 325:596-600; Walbot and Bruening, Nature (1988) 334:196; Haseloff and Geriach, Nature (1988) 334:585); the hairpin ribozyme (for example, as described by Haseloff et al., U.S. Patent No. 5,254,678, issued October 19, 1993 and Hempel et al., European Patent Publication No.
- Ribozymes of the present invention typically consist of RNA, but may also be composed of DNA, nucleic acid analogs (e.g., phosphorothioates), or chimerics thereof (e.g., DNA/RNA/RNA).
- Ribozymes can be targeted to any RNA transcript and can catalytically cleave such transcripts (see, e.g., U.S. Patent No. 5,272,262; U.S. Patent No. 5,144,019; and U.S. Patent Nos. 5,168,053, 5,180,818, 5,116,742 and 5,093,246 to Cech et al.).
- any such Cksl mRNA-specific ribozyme, or a nucleic acid encoding such a ribozyme may be delivered to a host cell to effect inhibition of Cksl gene expression.
- Ribozymes and the like may therefore be delivered to the host cells by DNA encoding the ribozyme linked to a eukaryotic promoter, such as a eukaryotic viral promoter, such that upon introduction into the nucleus, the ribozyme will be directly transcribed.
- a eukaryotic promoter such as a eukaryotic viral promoter
- Cksl inhibitors of the present invention also include proteins or polypeptides that are effective in either reducing Cksl gene expression or in decreasing one or more of Cksl's biological activities.
- Inhibitors of Cksl biological activities and Skp2 biological activities encompass those proteins and/or polypeptides that interfere with Cksl or Skp2 activity. Such interference may occur through direct interaction with Cksl or Skp2 active domain or indirectly through non- or un-competitive inhibition such as via binding to an allosteric site. Accordingly, available methods for identifying proteins and/or polypeptides that bind to Cksl or Skp2 may be employed to identify lead compounds that may, through the methodology disclosed herein, be characterized for their Cksl or Skp2 inhibitory activity.
- Literature is available to the skilled artisan that describes methods for detecting and analyzing protein-protein interactions. Reviewed in Phizicky, E.M. et al., Microbiological Reviews (1995) 59:94-123 incorporated herein by reference. Such methods include, but are not limited to physical methods such as, e.g., protein affinity chromatography, affinity blotting, immunoprecipitation and cross-linking as well as library-based methods such as, e.g., protein probing, phage display and two-hybrid screening. Other methods that may be employed to identify protein-protein interactions include genetic methods such as use of extragenic suppressors, synthetic lethal effects and unlinked noncomplementation. Exemplary methods are described in further detail below.
- Inventive Cksl or Skp2 inhibitors may be identified through biological screening assays that rely on the direct interaction between the Cksl or Skp2 protein and a panel or library of potential inhibitor proteins.
- Biological screening methodologies including the various "n-hybrid technologies," are described in, for example, Vidal, M. et al., Nucl. Acids Res. (1999) 27(4):919-929; Frederickson, R.M., Curr. Opin. Biotechnol. (1998) 9(l):90-6; Brachmann, R.K. et al., Curr. Opin. Biotechnol. (1997) 5(5):561-568; and White, M.A., Proc. Natl. Acad. Sci.
- the two-hybrid screening methodology may be employed to search new or existing target cDNA libraries for Cksl or Skp2 binding proteins that have inhibitory properties.
- the two-hybrid system is a genetic method that detects protein-protein interactions by virtue of increases in transcription of reporter genes.
- the system relies on the fact that site-specific transcriptional activators have a DNA-binding domain and a transcriptional activation domain.
- the DNA-binding domain targets the activation domain to the specific genes to be expressed. Because of the modular nature of transcriptional activators, the DNA-binding domain may be severed covalently from the transcriptional activation domain without loss of activity of either domain.
- two hybrids are constructed to create a functional system.
- the first hybrid i.e., the bait
- the second hybrid is created by the fusion of a transcriptional activation domain with a library of proteins or polypeptides. Interaction between the bait protein and a member of the target library results in the juxtaposition of the DNA- binding domain and the transcriptional activation domain and the consequent up- regulation of reporter gene expression.
- two-hybrid based systems are available to the skilled artisan that most commonly employ either the yeast Gal4 or E.
- coli LexA DNA-binding domain (BD) and the yeast Gal4 or herpes simplex virus VP16 transcriptional activation domain.
- BD yeast Gal4 or herpes simplex virus VP16 transcriptional activation domain.
- Commonly used reporter genes include the E.
- Plasmid vectors such as, e.g., pBTMll ⁇ and pAS2-l, for preparing Cksl and Skp2 bait constructs and target libraries are readily available to the artisan and may be obtained from such commercial sources as, e.g., Clontech (Palo Alto, CA), Invitrogen (Carlsbad, CA) and Stratagene (La Jolla, CA). These plasmid vectors permit the in- frame fusion of cDNAs with the DNA-binding domains as LexA or Gal4BD, respectively.
- Cksl or Skp2 inhibitors of the present invention may alternatively be identified through one of the physical or biochemical methods available in the art for detecting protein-protein interactions.
- lead compounds to be tested as potential Cksl or Skp2 inhibitors may be identified by virtue of their specific retention to Cksl or Skp2 when either covalently or non-covalently coupled to a solid matrix such as, e.g., Sepharose beads.
- a solid matrix such as, e.g., Sepharose beads.
- the preparation of protein affinity columns is described in, for example, Beeckmans, S. et al., Eur. J. Biochem. (1981) 777:527-535 and Formosa, T. et al.. Methods Enzymol. (1991) 208:24-45.
- Cell lysates containing the full complement of cellular proteins may be passed through the Cksl or Skp2 affinity column. Proteins having a high affinity for Cksl or Skp2 will be specifically retained under low-salt conditions while the majority of cellular proteins will pass through the column. Such high affinity proteins may be eluted from the immobilized Cksl or Skp2 under conditions of high-salt, with chao tropic solvents or with sodium dodecyl sulfate (SDS). In some embodiments, it may be preferred to radiolabel the cells prior to preparing the lysate as an aid in identifying the Cksl or Skp2 specific binding proteins. Methods for radiolabeling mammalian cells are well known in the art and are provided, e.g., in Sopta, M. et al., J. Biol. Chem. (1985) 260: 10353-10360.
- Suitable Cksl or Skp2 proteins for affinity chromatography may be fused to a protein or polypeptide to permit rapid purification on an appropriate affinity resin.
- the Cksl or Skp2 cDNA may be fused to the coding region for glutathione S- transferase (GST) which facilitates the adsorption of fusion proteins to glutathione- agarose columns.
- GST glutathione S- transferase
- fusion proteins may include protein A, which can be purified on columns bearing immunoglobulin G; oligohistidine-containing peptides, which can be purified on columns bearing Ni 2+ ; the maltose-binding protein, which can be purified on resins containing amylose; and dihydrofolate reductase, which can be purified on methotrexate columns.
- protein A which can be purified on columns bearing immunoglobulin G
- oligohistidine-containing peptides which can be purified on columns bearing Ni 2+
- the maltose-binding protein which can be purified on resins containing amylose
- dihydrofolate reductase which can be purified on methotrexate columns.
- One exemplary tag suitable for the preparation of Cksl or Skp2 fusion proteins that is presented herein is the epitope for the influenza virus hemagglutinin (HA) against which monoclonal antibodies are readily available and from which antibodies an affinity column may be prepared
- Proteins that are specifically retained on a Cksl or Skp2 affinity column may be identified after subjecting to SDS polyacrylamide gel electrophoresis (SDS-PAGE).
- SDS-PAGE SDS polyacrylamide gel electrophoresis
- proteins having high affinity for Cksl or Skp2 may be detected by autoradiography.
- the identity of Cksl or Skp2 specific binding proteins may be determined by protein sequencing techniques that are readily available to the skilled artisan, such as Mathews, C.K. et al.. Biochemistry, The Benjamin/Cummings Publishing Company, Inc. pp.166-170 (1990).
- Antibodies or Antibody Fragments may be determined by protein sequencing techniques that are readily available to the skilled artisan, such as Mathews, C.K. et al.. Biochemistry, The Benjamin/Cummings Publishing Company, Inc. pp.166-170 (1990).
- Cksl or Skp2 inhibitors of the present invention include antibodies and/or antibody fragments that are effective in reducing Cksl or Skp2 gene expression and/or biological activity.
- Suitable antibodies may be monoclonal, polyclonal or humanized monoclonal antibodies.
- Antibodies may be derived by conventional hybridoma based methodology, from antisera isolated from or Cksl or Skp2 inoculated animals or through recombinant DNA technology. Alternatively, inventive antibodies or antibody fragments may be identified in vitro by use of one or more of the readily available phage display libraries. Exemplary methods are disclosed herein.
- Cksl or Skp2 inhibitors are monoclonal antibodies that may be produced as follows.
- Cksl or Skp2 protein may be produced, for example, by expression of Cksl or Skp2 cDNA in a baculovirus based system.
- Cksl or Skp2 cDNA or a fragment thereof is ligated into a suitable plasmid vector that is subsequently used to transfect Sf9 cells to facilitate protein production.
- Clones of Sf9 cells expressing Cksl or Skp2 are identified, e.g., by enzyme linked immunosorbant assay (ELISA), lysates are prepared and the Cksl or Skp2 protein purified by affinity chromatography and the purified protein is injected, intraperitoneally, into BALB/c mice to induce antibody production. It may be advantageous to add an adjuvant, such as Freund's adjuvant, to increase the resulting immune response.
- an adjuvant such as Freund's adjuvant
- Serum is tested for the production of specific antibodies and spleen cells from animals having a positive specific antibody titer are used for cell fusions with myeloma cells to generate hybridoma clones.
- Supernatants derived from hybridoma clones are tested for the presence of monoclonal antibodies having specificity against Cksl or Skp2.
- monoclonal antibody methodology See, e.g., Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory (1988).
- Cksl or Skp2 protein or polypeptides thereof may be employed for the expression of Cksl or Skp2 protein or polypeptides thereof.
- affinity tags it may be advantageous to utilize one of the commercially available affinity tags to facilitate purification prior to inoculation of the animals.
- the Cksl or Skp2 cDNA or fragment thereof may be isolated by, e.g., agarose gel purification and ligated in frame with a suitable tag protein such as 6-His, glutathione-S-transferase (GST) or other such readily available affinity tag.
- GST glutathione-S-transferase
- Cksl or Skp2 inhibitors are humanized anti-Cksl or Skp2 monoclonal antibodies.
- humanized antibody refers to an antibody derived from a non-human antibody - typically a mouse monoclonal antibody.
- a humanized antibody may be derived from a chimeric antibody that retains or substantially retains the antigen-binding properties of the parental, non-human, antibody but which exhibits diminished immunogenicity as compared to the parental antibody when administered to humans.
- chimeric antibody refers to an antibody containing sequence derived from two different antibodies (see, e.g., U.S. Patent No. 4,816,567) which typically originate from different species. Most typically, chimeric antibodies comprise human and murine antibody fragments, generally human constant and mouse variable regions.
- humanized antibodies are far less immunogenic in humans than the parental mouse monoclonal antibodies, they can be used for the treatment of humans with far less risk of anaphylaxis. Thus, these antibodies may be preferred in therapeutic applications that involve in vivo administration to a human such as, e.g., use as radiation sensitizers for the treatment of neoplastic disease or use in methods to reduce the side effects of, e.g., cancer therapy.
- Humanized antibodies may be achieved by a variety of methods including, for example: (1) grafting the non-human complementarity determining regions (CDRs) onto a human framework and constant region (a process referred to in the art as “humanizing”), or, alternatively, (2) transplanting the entire non-human variable domains, but “cloaking” them with a human-like surface by replacement of surface residues (a process referred to in the art as “veneering”).
- humanized antibodies will include both “humanized” and “veneered” antibodies. These methods are disclosed in, e.g., Jones et al., Nature (1986) 321:522-525; Morrison et al, Proc. Natl. Acad.
- complementarity determining region refers to amino acid sequences which together define the binding affinity and specificity of the natural Fv region of a native immunoglobulin binding site. See, e.g., Chothia et al., J. Mol. Biol. (1987) 796:901-917; Kabat et al., U.S. Dept. of Health and Human Services NIH Publication No. 91-3242 (1991).
- constant region refers to the portion of the antibody molecule that confers effector functions. In the present invention, mouse constant regions are substituted by human constant regions.
- the constant regions of the subject humanized antibodies are derived from human immunoglobulins.
- the heavy chain constant region can be selected from any of the five isotypes: alpha, delta, epsilon, gamma or mu.
- One method of humanizing antibodies comprises aligning the non-human heavy and light chain sequences to human heavy and light chain sequences, selecting and replacing the non-human framework with a human framework based on such alignment, molecular modeling to predict the conformation of the humanized sequence and comparing to the conformation of the parent antibody. This process is followed by repeated back mutation of residues in the CDR region which disturb the structure of the CDRs until the predicted conformation of the humanized sequence model closely approximates the conformation of the non-human CDRs of the parent non-human antibody.
- Such humanized antibodies may be further derivatized to facilitate uptake and clearance, e.g., via Ashwell receptors. See, e.g., U.S. Patent Nos.
- Humanized antibodies to Cksl or Skp2 can also be produced using transgenic animals that are engineered to contain human immunoglobulin loci.
- transgenic animals that are engineered to contain human immunoglobulin loci.
- WO 98/24893 discloses transgenic animals having a human Ig locus wherein the animals do not produce functional endogenous immunoglobulins due to the inactivation of endogenous heavy and light chain loci.
- WO 91/10741 also discloses transgenic non- primate mammalian hosts capable of mounting an immune response to an immunogen, wherein the antibodies have primate constant and/or variable regions, and wherein the endogenous immunoglobulin-encoding loci are substituted or inactivated.
- WO 96/30498 discloses the use of the Cre/Lox system to modify the immunoglobulin locus in a mammal, such as to replace all or a portion of the constant or variable region to form a modified antibody molecule.
- WO 94/02602 discloses non-human mammalian hosts having inactivated endogenous Ig loci and functional human Ig loci.
- U.S. Patent No. 5,939,598 discloses methods of making transgenic mice in which the mice lack endogenous heavy claims, and express an exogenous immunoglobulin locus comprising one or more xenogeneic constant regions.
- an immune response can be produced to a selected antigenic molecule, and antibody-producing cells can be removed from the animal and used to produce hybridomas that secrete human monoclonal antibodies.
- Immunization protocols, adjuvants, and the like are known in the art, and are used in immunization of, for example, a transgenic mouse as described in WO 96/33735.
- This publication discloses monoclonal antibodies against a variety of antigenic molecules including IL-6, IL-8, TNFa, human CD4, L-selectin, gp39, and tetanus toxin.
- the monoclonal antibodies can be tested for the ability to inhibit or neutralize the biological activity or physiological effect of the corresponding protein.
- WO 96/33735 discloses that monoclonal antibodies against IL-8, derived from immune cells of transgenic mice immunized with IL-8, blocked IL-8-induced functions of neutrophils. Human monoclonal antibodies with specificity for the antigen used to immunize transgenic animals are also disclosed in WO 96/34096.
- Cksl or Skp2 polypeptides of the invention and variants thereof are used to immunize a transgenic animal as described above.
- Monoclonal antibodies are made using methods known in the art, and the specificity of the antibodies is tested using isolated Cksl or Skp2 polypeptides. The suitability of the antibodies for clinical use is tested by, for example, exposing SW620 cells to the antibodies and measuring cell growth.
- inhibition of or Cksl or Skp2 expression using antisense oligonucleotides specific for Cksl or Skp2 polynucleotides causes an inhibition of anchorage-independent growth of a colon cancer cell line, SW620.
- the antisense oligonucleotides also inhibited the proliferation of a ovarian cancer cell line, SKOV3.
- Human monoclonal antibodies specific for Cksl or Skp2 or a variant or fragment thereof can be tested for their ability to inhibit proliferation, colony growth, or any other biological parameter indicative of control of tumor growth, migration, or metastasis, particularly tumor cells of epithelial origin. Such antibodies would be suitable for pre-clinical and clinical trials as pharmaceutical agents for preventing or controlling growth of cancer cells.
- Cksl or Skp2 inhibitor antibodies may be readily obtained by other methods commonly known in the art.
- One exemplary methodology for identifying antibodies having a high specificity for Cksl is the phage display technology.
- Phage display libraries for the production of high-affinity antibodies are described in, for example, Hoogenboom, H.R. et al., Immuno techno logy (1998) 4(1):1- 20; Hoogenboom, H.R., Trends Biotechnol. (1997) 75:62-70 and McGuinness, B. et al., Nature Bio. Technol. (1996) 74:1149-1154 each of which is incorporated herein by reference.
- Among the advantages of the phage display technology is the ability to isolate antibodies of human origin that cannot otherwise be easily isolated by conventional hybridoma technology. Furthermore, phage display antibodies may be isolated in vitro without relying on an animal's immune system.
- Antibody phage display libraries may be accomplished, for example, by the method of McCafferty et al, Nature (1990) 345:552-554 which is incorporated herein by reference.
- the coding sequence of the antibody variable region is fused to the amino terminus of a phage minor coat protein (pill).
- pill phage minor coat protein
- Cksl or Skp2 protein suitable for screening a phage library may be obtained by, for example, expression in baculovirus Sf9 cells as described, supra.
- the baculovirus Sf9 cells as described, supra.
- Cksl or Skp2 coding region may be PCR amplified using primers specific to the desired region of the Cksl or Skp2 protein.
- the Cksl protein may be expressed in E. coli or yeast as a fusion with one of the commercially available affinity tags.
- the resulting fusion protein may then be adsorbed to a solid matrix, e.g., a tissue culture plate or bead.
- a solid matrix e.g., a tissue culture plate or bead.
- Phage expressing antibodies having the desired anti-Cksl or Skp2 binding properties may subsequently be isolated by successive panning, in the case of a solid matrix, or by affinity adsorption to a Cksl or Skp2 antigen column.
- Phage having the desired Cksl inhibitory activities may be reintroduced into bacteria by infection and propagated by standard methods known to those skilled in the art See Hoogenboom, H.7?., Trends Biotechnol, supra for a review of methods for screening for positive antibody-pill phage.
- the present invention also provides small molecule Cksl or Skp2 inhibitors that may be readily identified through routine application of high-throughput screening ( ⁇ TS) methodologies.
- ⁇ TS high-throughput screening
- ⁇ TS methods generally refer to those technologies that permit the rapid assaying of lead compounds, such as small molecules, for therapeutic potential.
- ⁇ TS methodology employs robotic handling of test materials, detection of positive signals and interpretation of data. Such methodologies include, e.g., robotic screening technology using soluble molecules as well as cell-based systems such as the two- hybrid system described in detail above.
- ⁇ TS methodology may be employed, e.g., to screen for lead compounds that block one of Cksl's or Skp2's biological activities.
- Cksl or Skp2 protein may be immunoprecipitated from cells expressing the protein and applied to wells on an assay plate suitable for robotic screening. Individual test compounds may then be contacted with the immunoprecipitated protein and the effect of each test compound on Cksl or Skp2 kinase activity assessed by, e.g., incubating in the presence of ⁇ - P-ATP in a suitable buffer system, and measuring the incorporation of P.
- Lead molecules or compounds whether antisense molecules or ribozymes, proteins and/or peptides, antibodies and/or antibody fragments or small molecules, that are identified either by one of the methods described herein or via techniques that are otherwise available in the art, may be further characterized in a variety of in vitro, ex vivo and in vivo animal model assay systems for their ability to inhibit Cksl or Skp2 gene expression or biological activity.
- Cksl or Skp2 inhibitors of the present invention are effective in reducing Cksl or Skp2 expression levels.
- the present invention further discloses methods that permit the skilled artisan to assess the effect of candidate inhibitors.
- Candidate Cksl or Skp2 inhibitors may be tested by administration to cells that either express endogenous Cksl or Skp2 or that are made to express Cksl or Skp2 by transfection of a mammalian cell with a recombinant Cksl or Skp2 plasmid construct.
- Effective Cksl or Skp2 inhibitory molecules will be effective in reducing the levels of Cksl or Skp2 mRNA as determined, e.g., by Northern blot or RT-PCR analysis.
- control molecules include the Cksl or Skp2 oligonucleotides disclosed as SEQ ID NO:31-35 (Cksl) and SEQ ID NO:6, 8, 10, 12, 14, 16, 18, 20, 22 and 24 (Skp2).
- the effect of Cksl or Skp2 inhibitors on the rate of DNA synthesis after challenge with a radiation or chemotherapeutic agent may be assessed by, e.g., the method of Young and Painter. Hum. Genet. (1989) 52:113-117. Briefly, culture cells may be incubated in the presence of 14 C-thymidine prior to exposure to, e.g., X-rays. Immediately after irradiation, cells are incubated for a short period prior to addition of 3 H-thymidine. Cells are washed, treated with perchloric acid and filtered (Whatman GF/C).
- Cksl or Skp2 inhibitors effective in reducing Cksl or Skp2 gene expression by one or more of the methods discussed above may be further characterized in vivo for efficacy in one of the readily available animal model systems.
- Various animal model systems for study of cancer and genetic instability associated genes are disclosed in, for example, Donehower, L.A. Cancer Surveys (1997) 29:329-352 incorporated herein by reference.
- the antisense oligonucleotides and ribozymes of the present invention can be synthesized by any method known in the art for ribonucleic or deoxyribonucleic nucleotides.
- the oligonucleotides can be prepared using solid-phase synthesis such as in an Applied Biosystems 380B DNA synthesizer. Final purity of the oligonucleotides is determined as is known in the art.
- the antisense oligonucleotides identified using the methods of the invention modulate tumor cell proliferation.
- compositions and methods for interfering with cell proliferation, preferably tumor cell proliferation, comprising contacting tissues or cells with one or more of antisense oligonucleotides identified using the methods of the invention.
- an antisense ohgonucleotide having one of SEQ ID NOS:26-30 or SEQ ID NO:5, 7, 9, 11, 13, 15, 17, 19, 21 and 23 is administered.
- the methods and compositions may also be used to treat proliferative disorders including other forms of cancer such as leukemias, lymphomas (Hodgkins and non- Hodgkins), sarcomas, melanomas, adenomas, carcinomas of solid tissue, hypoxic tumors, squamous cell carcinomas of the mouth, throat, larynx, and lung, genitourinary cancers such as cervical and bladder cancer, hematopoietic cancers, colon cancer, pancreatic cancer, head and neck cancers, and nervous system cancers, benign lesions such as papillomas, arthrosclerosis, psoriasis, primary and secondary polythemia, mastocytosis, autoimmune diseases, angiogenesis, bacterial infections, and viral infections, such as HIV infections, hepatitis or herpes infections.
- cancer such as leukemias, lymphomas (Hodgkins and non- Hodgkins), sarcomas, melanomas, adenomas,
- a method for reducing metastasis in a subject comprising administering an amount of an antisense ohgonucleotide of the invention effective to reduce metastasis.
- an antisense ohgonucleotide of the invention is one of SEQ ID NOS:26-30.
- the pharmaceutical composition for inhibiting tumorigenicity of neoplastic cells in a mammal consists of an effective amount of at least one active ingredient selected from antisense oligonucleotides complementary to the Cksl or Skp2 mRNA, including the entire Cksl or Skp2 mRNA or having short sequences as set forth in SEQ ID NOS:26-30 (Cksl) or SEQ ID NO:5, 7, 9, 11, 13, 15, 17, 19, 21 and 23 (Skp2) and a pharmaceutically physiologically acceptable carrier or diluent. Combinations of the active ingredients can be used.
- compositions can be administered orally, subcutaneously or parenterally including intravenous, intraarterial, intramuscular, intraperitoneally, and intranasal administration as well as intrathecal and infusion techniques as required by the malignant cells being treated.
- intrathecal delivery can be used with for example an Ommaya reservoir or other methods known in the art.
- the pharmaceutically acceptable carriers, diluents, adjuvants and vehicles as well as implant carriers generally refer to inert, non-toxic solid or liquid fillers, diluents or encapsulating material not reacting with the active ingredients of the invention. Cationic lipids may also be included in the composition to facilitate ohgonucleotide uptake. Implants of the compounds are also useful. In general, the pharmaceutical compositions are sterile.
- proliferating cells including neoplastic cells are contacted with a growth-inhibiting amount of the bioactive antisense ohgonucleotide for the Cksl or Skp2 mRNA or a fragment thereof shown to have substantially the same effect.
- the mammal to be treated is human but other mammalian species can be treated in veterinary applications.
- bioactive is meant that the ohgonucleotide is biologically active in the cell when delivered directly to the cell and/or is expressed by an appropriate promotor and active when delivered to the cell in a vector as described below.
- Nuclease resistance is provided by any method known in the art that does not substantially interfere with biological activity as described herein.
- Contacting the cell refers to methods of exposing or delivery to a cell of antisense oligonucleotides whether directly or by viral or non-viral vectors and where the antisense ohgonucleotide is bioactive upon delivery.
- the method of delivery will be chosen for the particular cancer being treated. Parameters that affect delivery can include the cell type affected and tumor location as is known in the medical art.
- the treatment generally has a length proportional to the length of the disease process and drug effectiveness and the patient species being treated. It is noted that humans are treated generally longer than the Examples exemplified herein, which treatment has a length proportional to the length of the disease process and drug effectiveness.
- the doses may be single doses or multiple doses as determined by the medical practitioners and treatment courses will be repeated as necessary until diminution of the disease is achieved. Optimal dosing schedules may be calculated using measurements of drug accumulation in the body. Practitioners of ordinary skill in the art can readily determine optimum dosages, dosing methodologies, and repetition rates.
- Optimum dosages may vary depending on the relative potency of the antisense ohgonucleotide, and can generally be determined based on values in in vitro and in vivo animal studies and clinical trials. Variations in the embodiments used may also be utilized. The amount must be effective to achieve improvement including but not limited to decreased tumor growth, or tumor size reduction or to improved survival rate or length or decreased drug resistance or other indicators as are selected as appropriate measures by those skilled in the art. Although some antisense oligonucleotides may not completely abolish tumor cell growth in vitro, these antisense compounds may be clinically useful if they inhibit tumor growth enough to allow complementary treatments, such as chemotherapy, to be effective.
- compositions of the present invention therefore are administered singly or in combination with other drugs, such as cytotoxic agents, immunotoxins, alkyl ating agents, anti-metabolites, anti tumor antibiotics and other anticancer drugs and treatment modalities that are known in the art.
- the composition is administered and dosed in accordance with good medical practice taking into account the clinical condition of the individual patient, the site and method of administration, scheduling of administration, and other factors known to medical practitioners.
- the "effective amount" for growth inhibition is thus determined by such considerations as are known in the art.
- the pharmaceutical composition may contain more than one embodiment of the present invention.
- nucleotide sequences of the present invention can be delivered either directly or with viral or non-viral vectors. When delivered directly the sequences are generally rendered nuclease resistant. Alternatively, the sequences can be incorporated into expression cassettes or constructs such that the sequence is expressed in the cell. Generally, the construct contains the proper regulatory sequence or promotor to allow the sequence to be expressed in the targeted cell.
- the ohgonucleotide sequences can be introduced into cells as is known in the art. Transfection, electroporation, fusion, liposomes, colloidal polymeric particles and viral vectors as well as other means known in the art may be used to deliver the ohgonucleotide sequences to the cell. The method selected will depend at least on the cells to be treated and the location of the cells and will be known to those skilled in the art. Localization can be achieved by liposomes, having specific markers on the surface for directing the liposome, by having injection directly into the tissue containing the target cells, by having depot associated in spatial proximity with the target cells, specific receptor mediated uptake, viral vectors, or the like.
- the present invention provides vectors comprising an expression control sequence operatively linked to the ohgonucleotide sequences of the invention.
- the present invention further provides host cells, selected from suitable eucaryotic and procaryotic cells, which are transformed with these vectors as necessary. Such transformed cells allow the study of the function and the regulation of malignancy and the treatment therapy of the present invention.
- Vectors are known or can be constructed by those skilled in the art and should contain all expression elements necessary to achieve the desired transcription of the sequences. Other beneficial characteristics can also be contained within the vectors such as mechanisms for recovery of the oligonucleotides in a different form. Phagemids are a specific example of such beneficial vectors because they can be used either as plasmids or as bacteriophage vectors. Examples of other vectors include viruses such as bacteriophages, baculoviruses and retroviruses, DNA viruses, liposomes and other recombination vectors. The vectors can also contain elements for use in either procaryotic or eucaryotic host systems. One of ordinary skill in the art will know which host systems are compatible with a particular vector.
- the present invention also provides a method of evaluating if a compound inhibits transcription or translation of an Cksl or Skp2 gene and thereby modulates (i.e., reduces) cell proliferation comprising transfecting a cell with an expression vector comprising a nucleic acid sequence encoding Cksl or Skp2, the necessary elements for the transcription or translation of the nucleic acid; administering a test compound; and comparing the level of expression of the Cksl or Skp2 with the level obtained with a control in the absence of the test compound.
- the present invention provides detectably labeled oligonucleotides for imaging Cksl or Skp2 polynucleotides within a cell. Such oligonucleotides are useful for determining if gene amplification has occurred, and for assaying the expression levels in a cell or tissue using, for example, in situ hybridization as is known in the art. While the present invention has been described with specificity in accordance with certain of its preferred embodiments, the following examples serve only to illustrate the invention and are not intended to limit the invention.
- a carrier molecule comprising either a lipitoid or cholesteroid, was prepared for transfection by diluting to 0.5 mM in water, followed by sonication to produce a uniform solution, and filtration through a 0.45 ⁇ m PVDF membrane.
- the lipitoid or cholesteroid was then diluted into an appropriate volume of OptiMEMTM (Gibco/BRL) such that the final concentration would be approximately 1.5-2 nmol lipitoid per ⁇ g ohgonucleotide.
- the buffer/enzyme mixture was prepared by mixing, in the order listed, 2.5 ⁇ L H 2 O, 2.0 ⁇ L 10X reaction buffer, 10 ⁇ L (20 pmol) oligo dT, 1.0 ⁇ L dNTP mix (10 mM each), 0.5 ⁇ L (20 u) RNAsin® (Ambion, Inc., Hialeah, FL) and 0.5 ⁇ L (50 u) MMLV reverse transcriptase (Ambion, Inc.). The contents of the microfuge tube were mixed by pipetting up and down, and the reaction was incubated for 1 hour at 42°C.
- target genes were amplified using the Roche Light CyclerTM real-time PCR machine.
- 20 ⁇ L aliquots of PCR amplification mixture were prepared by mixing the following components in the order listed: 2 ⁇ L 10X PCR buffer II (containing 10 mM Tris pH 8.3 and 50 mM KC1, Perkin-Elmer, Norwalk, CT) 3 mM MgCl 2 , 140 ⁇ M each dNTP, 0.175 pmol of each Cksl oligo, 1 :50,000 dilution of SYBR® Green, 0.25 mg/mL BSA, 1 unit Taq polymerase, and H 2 0 to 20 ⁇ L.
- SYBR® Green (Molecular Probes, Eugene, OR) is a dye that fluoresces when bound to double- stranded DNA, allowing the amount of PCR product produced in each reaction to be measured directly.
- 2 ⁇ L of completed reverse transcription reaction was added to each 20 ⁇ L aliquot of PCR amplification mixture, and amplification was carried out according to standard protocols. Amounts of amplified target sequences obtained from each PCR reaction were normalized through comparison with an internal control (e.g., beta-actin).
- Table 1 below indicates that Cksl mRNA levels were reduced in SW620 cells following transfection with Cksl antisense oligonucleotides (SEQ ID NO:26-30), relative to control mRNAs.
- the bottom layer consisted of 2 ml of 0.6% agar in media plated fresh within a few hours of layering on the cells.
- cells transfected as described in Example 1 were removed from the plate in 0.05% trypsin and washed twice in media. Cells were counted in coulter counter, and resuspended to 106 per ml in media. 10 ml aliquots were placed with media in 96-well plates (to check counting with WSTl), or diluted further for soft agar assay. 2000 cells were plated in 800 ml 0.4% agar in duplicate wells above 0.6% agar bottom layer.
- Table 2 below indicate that treating SW620 cells with Cksl antisense oligonucleotides reduced anchorage-dependent growth, relative to control cells transfected with the respective reverse complement oligonucleotides.
- a modified protocol was used to generate the data shown in Figure 12.
- the number of colonies was determined by Alamar blue reading and the assays were performed in 96-well format.
- This protocol was used to generate the date shown in Figures 12 and 13.
- the protocol is as follows: 96-well soft agar assay in poly(HEMA) coated plates.
- Soft agar assay monitors the ability of cells to grow in an anchorage-independent manner, a hallmark for transformed phenotype.
- the general design of the assay is to force cells in a 3- dimensional gel structure in a plate without the possibility of adhering to plastic, and to monitor colony formation as a read-out for growth under those conditions.
- a bottom layer of poly(HEMA) prevents cells from attaching to the plastic and a defined number of cells will be embedded in a top thin layer of low percentage agar.
- This assay is simple in set up and takes 6-7 days to completion. It is preferred to include with each set of assays a positive control known to affect growth in soft agar. It is also preferred to include the wild type untransfected cell line into the assay to discriminate between negative transfection impact versus problematic soft agar set up.
- Non-tissue culture treated 96-well plates (Costar ref # 3370) are coated with poly(2-hydroxyethyl methacrylate or poly(HEMA). Sigma ref # P3932).
- Poly(HEMA) is a known anti-adhesive that will prevent cells from attaching to the bottom of the plate. Master solution of Poly(HEMA) is made as follows: 3g powder is dissolved in
- Each well of a 96-well plate is coated with 50ul of the diluted poly(HEMA). Plates are placed on a Labsystem Wellmix shaker set at variable speed, with speed set between 5 and 6, until the plates are dry (approx. 24h). Preferably, the coating is totally translucent. If small holes are still present in a few wells, these can be recoated with 20ul of diluted poly(HEMA) for another 24h.
- Plates are then put in a tissue culture hood overnight under UV to sterilize.
- the final step is to gently wash each well twice with 200ul of PBS IX, using a multichannel pipette.
- the PBS is removed, then the plates are wrapped in Saran plastic and kept at room temperature until use.
- all steps are performed the same day.
- Cells on which the assay is to be run are trypsinized and counted using a hemacytometer. Dilutions are calculated so that (depending on the cell type) 350 to 700 cells/per well are seeded in 50ul media.
- 1 OOul/well of cells are seeded in a regular flat bottom plate (not poly(HEMA) treated) with the same layout as in the poly(HEMA) plate. 50ul is then removed from each well using a multichannel pipette and moved to a poly(HEMA) plate; that plate will be transfected in about 2 hours. It is returned to the incubator for cells to recover.
- the assay set up is similar to a proliferation assay except that there is only 1 plate instead of 4.
- the outer edges of the plate are not used but contain media to avoid edge effects.
- the oligos are tested in triplicate with AS and RC for one gene set in 1 column from row B to row G.
- the blank uses column 1 B-G It is treated identically to wild type cells except that no cells are in these wells. 11 columns are used, as in proliferation assays. Wild type (untransfected cells) are used, as well as a positive control and a negative control. 7 genes/plate remain to be tested in triplicates with AS and RC.
- the type of lipid used depends on the cell type. For SW620 cells, 400 cells/well are transfected with 300nM oligos using lipitoid 2 (L2) at 1 :2.5 ratio. For each oligo only 3 wells are transfected. The final volume in each well after transfection and agar addition is 150ul (50ul of cells + 50ul transfection mix + 50ul agar). The transfection mix is performed in 50ul calculated 3x so that the final concentration of oligo will be 300nM. Once the agar gels, lOOul of media is added on top.
- L2 lipitoid 2
- Agar should be added within 2 hours.
- Noble agar (DIFCO) 4% is melted in the microwave oven, and when fully melted, the agar is placed at 56°C in a waterbath for at least 10 minutes but not longer than 30 minutes. In the 96-well set up, a final concentration of agar at 0.35% is used. 12 x 5ml polystyrene round bottom Falcon tubes are prepared with 840ul media and kept in a heat block at 37°C (37° to 40°C is acceptable).
- Alamar Blue staining After 6-7 days, depending on how quickly the colonies are appearing, 20ul undiluted Alamar blue dye is added to each well including blank. The plate is then gently shaken for 10-15 minutes to insure even penetration in the agar mesh. Then plate is returned to the incubator and fluorescence (Excitation 530nm, Emission 590nm) is monitored after several hours (generally, multiple readings are preferred, at about 3, 5 and 24h). Depending on the number of cells and the transfection effect, statistical significance is reached after approximately 5h and improves with longer incubation times. Alamar Blue is a fluorescent dye that can be used as a growth indicator based on detection of metabolic activity. Fluorescence appears when Alamar Blue is chemically reduced in response to cell growth.
- Figure 10B indicates that the levels of p27Kipl were higher in the antisense-treated cells than in the reverse control-treated cells.
- the Cyclin E levels remained the same as determined by comparison to the p34cdc2 protein levels which served as a gel loading control.
- p34cdc2 protein levels do no change during the cell cycle.
- SW620 cells and MRC9 cells were transformed as described in Example 1 using the antisense ohgonucleotide of SEQ ID NO:30 and the reverse complement (SEQ ID NO:35).
- the LDH assay was performed using a Roche LDH kit.
- SEQ ID NO:30 induced greater cytotoxicity than did the corresponding reverse control ohgonucleotide.
- Bcl-2 and Bcl-2RC are positive control oligonucleotides to validate the experimental conditions.
- 40-1 (SEQ ID NO: 36) and RC40-1 (SEQ ID NO:41) are antisense and reverse control oligonucleotides specific for Cks2.
- PI/RNaseA solution added to 1ml PBS + 1% serum- 20 ul PI stock and 10 ul RNaseA stock.
- 50 x PI stock 0.5 mg/ml propidium iodide in 38 mM Sodium Citrate pH 7.0. Stored in the refrigerator protected from light.
- 100 x RNaseA stock 25 mg/ml RNaseA in Tris/HCl pH 7.5, 15 mM NaCl. If made from powder, it is boiled for 15 minutes, cooled at RT, aliquoted and stored at -20°C. 1 well of a 6-well dish of mammalian cells was used as sample.
- cells are pipetted through a cell strainer into the FACS tube.
- the cells were analyzed within 24 hours, and cells were kept on ice and protected from light until FACS analysis. 10,000 cells were counted using FL2-A as filter.
- Cks depletion by antisense treatment did not significantly alter the cell cycle profile of asynchronously growing SW620 and MRC9 cells.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US35690602P | 2002-02-12 | 2002-02-12 | |
| US356906P | 2002-02-12 | ||
| PCT/US2003/004550 WO2003068939A2 (en) | 2002-02-12 | 2003-02-12 | Cks1 INHIBITORS |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP1480995A2 true EP1480995A2 (en) | 2004-12-01 |
| EP1480995A4 EP1480995A4 (en) | 2006-09-13 |
Family
ID=27734702
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP03711050A Withdrawn EP1480995A4 (en) | 2002-02-12 | 2003-02-12 | Cks1 INHIBITORS |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP1480995A4 (en) |
| JP (1) | JP2005523280A (en) |
| AU (1) | AU2003215235A1 (en) |
| CA (1) | CA2474844A1 (en) |
| WO (1) | WO2003068939A2 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2954896A1 (en) * | 2014-06-13 | 2015-12-16 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Small molecule inhibitors of the E3 Ligase Skp2 in depression and other diseases |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5801015A (en) * | 1995-06-05 | 1998-09-01 | Mitotix, Inc. | Nucleic acid encoding a Candida cell cycle regulatory protein, TYP1 polypeptide |
| US5981702A (en) * | 1995-09-21 | 1999-11-09 | Cold Spring Harbor Laboratory | Cyclin/CDK associated proteins, and uses related thereto |
| WO1998041642A1 (en) * | 1997-03-14 | 1998-09-24 | Cropdesign N.V. | Method and means for modulating plant cell cycle proteins and their use in plant cell growth control |
| US6573094B1 (en) * | 1997-10-16 | 2003-06-03 | Baylor College Of Medicine | F-box genes and proteins |
| AU2002243477B2 (en) * | 2001-01-05 | 2007-12-20 | New York University | Methods to identify compounds useful for the treatment of proliferative and differentiative disorders |
| EP1377596B1 (en) * | 2001-02-21 | 2012-04-11 | Novartis Vaccines and Diagnostics, Inc. | Ttk in diagnosis and as a therapeutic target in cancer |
-
2003
- 2003-02-12 EP EP03711050A patent/EP1480995A4/en not_active Withdrawn
- 2003-02-12 CA CA002474844A patent/CA2474844A1/en not_active Abandoned
- 2003-02-12 JP JP2003568054A patent/JP2005523280A/en active Pending
- 2003-02-12 WO PCT/US2003/004550 patent/WO2003068939A2/en not_active Ceased
- 2003-02-12 AU AU2003215235A patent/AU2003215235A1/en not_active Abandoned
Also Published As
| Publication number | Publication date |
|---|---|
| AU2003215235A8 (en) | 2003-09-04 |
| CA2474844A1 (en) | 2003-08-21 |
| JP2005523280A (en) | 2005-08-04 |
| AU2003215235A1 (en) | 2003-09-04 |
| WO2003068939A3 (en) | 2003-12-31 |
| WO2003068939A2 (en) | 2003-08-21 |
| EP1480995A4 (en) | 2006-09-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yamamoto et al. | Effect of tumor suppressors on cell cycle-regulatory genes: RB suppresses p34cdc2 expression and normal p53 suppresses cyclin A expression | |
| US20080219968A1 (en) | Sos1 inhibitors | |
| Lorković et al. | RBP45 and RBP47, two oligouridylate-specific hnRNP-like proteins interacting with poly (A)+ RNA in nuclei of plant cells. | |
| KR102288857B1 (en) | Novel eukaryotic cells and methods for recombinantly expressing a product of interest | |
| CN111386344A (en) | Functional nucleic acid molecules and their uses | |
| US6809194B1 (en) | Akt3 inhibitors | |
| EP3137595B1 (en) | Novel vertebrate cells and methods for recombinantly expressing a polypeptide of interest | |
| Efiok et al. | A key transcription factor for eukaryotic initiation factor-2 alpha is strongly homologous to developmental transcription factors and may link metabolic genes to cellular growth and development. | |
| JP7096790B2 (en) | Expression cassette | |
| US20070244031A1 (en) | Methods and Compositions for Homozygous Gene Inactivation Using Collections of Pre-Defined Nucleotide Sequences Complementary Chromosomal Transcripts | |
| WO2001093851A2 (en) | Compositions and methods for treating neoplastic disease using inhibitors of laminin5beta3 | |
| EP1315795A1 (en) | Methods for imparting desirable phenotypic traits, including drought, freeze, and high salt tolerance and methods for increasing seed production | |
| JP2008505626A (en) | Novel sequences to improve nucleic acid expression | |
| US20040019003A1 (en) | Nek2 inhibitors | |
| WO2003068939A2 (en) | Cks1 INHIBITORS | |
| WO2002101010A2 (en) | Methods and compositions for modulating telomerase reverse transcriptase (tert) expression | |
| US20060089321A1 (en) | Cks1 inhibitors | |
| AU2017340716A1 (en) | Promoter of Hspa5 gene | |
| WO2002090570A2 (en) | Methods and compositions for modulating telomerase reverse transcriptase (tert) expression | |
| US20090136506A1 (en) | Conserved Membrane Activator of Calcineurin (CMAC), a Novel Therapeutic Protein and Target | |
| WO1996039504A2 (en) | Methods for distinguishing metastatic and non-metastatic cancers, polynucleotides and polypeptides for use therein | |
| US20030039647A1 (en) | Tetraspan protein and uses thereof | |
| WO2006075991A1 (en) | Identification of genes involved in metastatic progression of cancer cells | |
| EP1896495A2 (en) | Dkkl-1 splice product modulators for cancer diagnosis and therapy | |
| JP2022067574A (en) | Dwarfing gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20040907 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT SE SI SK TR |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK RO |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: A61P 35/00 20060101ALI20060727BHEP Ipc: A61K 48/00 20060101ALI20060727BHEP Ipc: C07H 21/02 20060101ALI20060727BHEP Ipc: C07H 21/04 20060101AFI20040915BHEP |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20060810 |
|
| 17Q | First examination report despatched |
Effective date: 20061205 |
|
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: NOVARTIS VACCINES AND DIAGNOSTICS, INC. |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20091215 |