EP1476460A2 - A nucleic acid encoding a g-protein-coupled receptor; and uses thereof - Google Patents

A nucleic acid encoding a g-protein-coupled receptor; and uses thereof

Info

Publication number
EP1476460A2
EP1476460A2 EP03709093A EP03709093A EP1476460A2 EP 1476460 A2 EP1476460 A2 EP 1476460A2 EP 03709093 A EP03709093 A EP 03709093A EP 03709093 A EP03709093 A EP 03709093A EP 1476460 A2 EP1476460 A2 EP 1476460A2
Authority
EP
European Patent Office
Prior art keywords
gave
protein
nucleic acid
gave19
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP03709093A
Other languages
German (de)
French (fr)
Other versions
EP1476460A4 (en
Inventor
Haifeng Eishingdrelo
Holly Dressler
Jidong Cai
Paul Wright
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aventis Pharmaceuticals Inc
Original Assignee
Aventis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB0219574.1A external-priority patent/GB0219574D0/en
Application filed by Aventis Pharmaceuticals Inc filed Critical Aventis Pharmaceuticals Inc
Publication of EP1476460A2 publication Critical patent/EP1476460A2/en
Publication of EP1476460A4 publication Critical patent/EP1476460A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/08Antiallergic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/10Antioedematous agents; Diuretics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/72Assays involving receptors, cell surface antigens or cell surface determinants for hormones
    • G01N2333/726G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/04Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/10Screening for compounds of potential therapeutic value involving cells

Definitions

  • the present invention relates generally to a novel nucleic acid molecule that encodes for GAVE 19, a heretofore unknown G-protein-coupled receptor, along with uses of the nucleic acid molecule and GAVE 19.
  • GPCRs G protein-coupled receptors
  • GPCRs are a large family of integral membrane proteins that are involved in cellular signal transduction. GPCRs respond to a variety of extracellular signals, including neurotransmitters, hormones, odorants and light, and are capable of transducing signals so as to initiate a second messenger response within the cell. Many therapeutic drugs target GPCRs because those receptors mediate a wide variety of physiological responses, including inflammation, vasodilation, heart rate, bronchodilation, endocrine secretion and peristalsis.
  • GPCRs are characterized by extracellular domains, seven transmembrane domains and intracellular domains. Some of the functions the receptors perform, such as binding ligands and interacting with G proteins, are related to the presence of certain amino acids in critical positions. For example, a variety of studies have shown that differences in amino acid sequence in GPCRs account for differences in affinity to either a natural ligand or a small molecule agonist or antagonist. In other words, minor differences in sequence can account for different binding affinities and activities.
  • the action of the binding of an endogenous ligand to a receptor results in a change in the conformation of the intracellular domain(s) of the receptor allowing for coupling between the intracellular domain(s) and an intracellular component, a G-protein.
  • G proteins exist, such as G q , G s , Gi, G z and G 0 (see, e.g. Dessauer et al., Clin Sci (Colch) (1996) 91(5):527-37).
  • the IC-3 loop as well as the carboxy terminus of the receptor interact with the G proteins (Pauwels et al., Mol Neurobiol (1998) 17(1-3): 109-135 and Wonerow et. al., supra).
  • Some GPCRs are "promiscuous" with respect to G proteins, i e , a GPCR can interact with more than one G protein (see, e g , Kenakm, Life Sciences (1988) 43: 1095).
  • Ligand activated GPCR coupling with G protein begins a signaling cascade process (referred to as “signal transduction"). Such signal transduction ultimately results in cellular activation or cellular inhibition.
  • GPCRs exist in the cell membrane in equilibrium between two different conformations: an "inactive" and an “active” state.
  • a receptor in an inactive state is unable to link to the intracellular signaling transduction pathway to produce a biological response (exceptions exist, such as during over- expression of receptor in transduced cells, see e g , www creighton eHn/PharTna ⁇ ology/inversfi htrn ).
  • Modulation of the conformation to the active state allows linkage to the transduction pathway (via the G protein) and produces a biological response. Agonists bind and make the active conformation much more likely.
  • receptors that may be transfected into patients to treat disease
  • the activity of such receptors may be fine-tuned with inverse agonists discovered by such assays.
  • Diseases such as asthma, chronic obstructive pulmonary disease (COPD) and rheumatoid arthritis (RA) generally are considered to have an inflammatory etiology involving T helper cells, monocyte-macrophages and eosmophils.
  • Current anti-inflammatory therapy with corticosteroids is effective in asthma but is associated with metabolic and endocrine side effects The same is possibly true for inhaled formulations that can be absorbed through lung or nasal mucosa. Satisfactory oral therapies for RA or COPD currently are lacking.
  • Interleuk ⁇ n-5 is an eosinophil growth and activating cytokine. Studies have shown IL-5 to be necessary for tissue eosinophiha and for eosmophil-mediated tissue damage resulting in airway hyperresponsiveness (Chang et al., J Allergy Clin Immunol (1996) 98(5 pt 1):922-931 and Duez et al., Am J Respir C ⁇ t Care Med (2000) 161(l).200-206). IL-5 is made by T-helper-2 cells (Th2) following allergen (e.g house dust mite antigen) exposure in atopic asthma.
  • Th2 T-helper-2 cells
  • Interferon ⁇ is a T-helper-1 (Thl) cell-derived cytokine with numerous proinflammatory properties It is the most potent macrophage activating cytokine and induces MHC class II gene transcription contributing to a dendritic cell-like phenotype.
  • LPS Lipopolysaccharide
  • TNFa tumor necrosis factor
  • lung epithelium can be an important source for inflammatory cell chemoattractants and other inflammatory cell-activating agents (see, for example, Thomas et al., J Virol (2000) 74(18):8425-8433; Lamkhioued et al., Am J Respir C ⁇ t Care Med (2000) 162(2 Pt. l):723-732; and Sekiya et al., J Immunol (2000) 165(4):2205-2213).
  • GPCRs Given the role GPCRs have in disease and the ability to treat diseases by modulating the activity of GPCRs, identification and characterization of previously unknown GPCRs can provide for the development of new compositions and methods for treating disease states that involve the activity of a GPCR. Accordingly, what is needed is the discovery, isolation and characterization of novel and useful nucleic acid molecules that encode for heretofore unknown GPCRs. What is also needed are assays that utilize such heretofore unknown GPCRs to identify molecules that can serve potential agonists or antagonists of GPCRS. These molecules may readily have applications as therapeutic agents for modulating the activity of GPCRs in vivo, and thus, treat a plethora of diseases related to GPCR activity.
  • the instant invention identifies and characterizes the expression of a novel constitutively active murme GPCR, GAVE 19, and provides compositions and methods for applying the discovery to the identification and treatment of related diseases
  • the present invention extends to an isolated nucleic acid molecule comprising a DNA sequence of Figure 1 (SEQ ED NO: 1), a variant thereof, a fragment thereof, or an analog or a derivative thereof.
  • a variant of the present invention may be an allehc variant, a degenerate variant, or an allehc variant that results in a degenerate change in the sequence.
  • the present invention extends to an isolated nucleic acid molecule hyb ⁇ dizable to the isolated nucleic acid molecule of SEQ ID NO:l, or a variant thereof, under stringent hybridization conditions. Yet further, the present invention extends to an isolated nucleic acid molecule hyb ⁇ dizable to a nucleic acid molecule that is complementary to the DNA sequence of SEQ ID NO- 1 under stringent hybridization conditions. Stringent hybridization conditions are described infra.
  • the present invention extends to an isolated nucleic acid molecule comprising a DNA sequence that encodes a polypeptide comprising an amino acid sequence of SEQ ID NO:2.
  • an isolated nucleic acid molecule of the present invention as described above may be detectably labeled.
  • detectable labels having applications herein include, but certainly are not limited to an enzyme, a radioactive isotope, or a chemical which fluoresces. Particular examples of detectable labels are described infra
  • polypeptides are also encompassed within the present invention.
  • the present invention extends to a purified polypeptide comprising the ammo acid sequence of SEQ ID NO:2, a conservative variant thereof, or an analog or derivative thereof.
  • a polypeptide of the present invention may be detectably labeled
  • the present invention extends to antibodies wherein a polypeptide of the present invention is the lmmunogen used in production of the antibodies.
  • These antibodies can be monoclonal or polyclonal.
  • the antibodies can be "chime ⁇ c" as, for example, they may comprise protein domains of antibodies raised against a purified polypeptide of the present invention in different species.
  • an antibody of the present invention may be detectably labeled. Particular examples of detectable labels having applications herein are described infra
  • an expression vector of the present invention may comprise an isolated nucleic acid molecule hyb ⁇ dizable under stringent hybridization conditions to an isolated nucleic acid molecule comprising a DNA sequence of SEQ ID NO.1, operatively associated with an expression control element, or is hyb ⁇ dizable under stringent hybridization conditions to a hybridization probe that is complementary to an isolated nucleic acid molecule comprising a DNA sequence of SEQ ID NO: l, wherein the hybridization probe is operatively associated with an expression control element.
  • a particular example of an expression control element having applications herein is a promoter.
  • promoters applicable to the present invention include, but are not limited to early promoters of hCMV, early promoters of SV40, early promoters of adenovirus, early promoters of vaccinia, early promoters of polyoma, late promoters of SV40, late promoters of adenovirus, late promoters of vaccinia, late promoters of polyoma, the lac system, the trp system, the TAC system, the TRC system, the major operator and promoter regions of phage lambda, control regions of fd coat protein, 3- phosphoglycerate kinase promoter, acid phosphatase promoter, or promoters of yeast ⁇ mating factor, to name only a few.
  • an expression vector of the present invention one may transfect or transform a host cell and produce a polypeptide comprising an ammo acid sequence of SEQ ID NO 2, or a variant thereof.
  • the host cell may be either a prokaryotic cell or a eukaryotic cell.
  • Particular examples of unicellular hosts having applications herein include E coli, Pseudonomas, Bacillus, Strepomyces, yeast, CHO, RI 1, B- W, L-M, COS1, COS7, BSC1, BSC40, BMT10 and Sf9 cells, etc.
  • the present invention further extends to a method for producing a purified polypeptide comprising the amino acid sequence of SEQ ID NO:2, a variant thereof, or a fragment thereof.
  • a method for producing a purified polypeptide comprising the amino acid sequence of SEQ ID NO:2, a variant thereof, or a fragment thereof.
  • Such a method comprises cultu ⁇ ng a host cell transformed or transfected with an expression vector of the present invention under conditions that provide for expression of the purified polypeptide, and then recovering the purified polypeptide from the unicellular host, the culture surrounding the host cell, or from both.
  • the present invention also extends to assays for identifying compounds that can modulate the activity of GAVE 19.
  • Such compounds can be an agonist, an antagonist, or an inverse agonist of GAVE 19.
  • the present invention extends to a method for identifying an agonist of GAVE 19 comprising contacting a potential agonist with a cell expressing GAVE 19 in the presence of an endogenous ligand, and determining whether the signaling activity of GAVE 19 is increased when the potential agonist is present, relative to the signaling activity of GAVE 19 in the absence of the potential agonist.
  • the present invention extends to a method for identifying an inverse agonist of GAVE 19
  • a method for identifying an inverse agonist of GAVE 19 comprises contacting a potential inverse agonist with a cell expressing GAVE19, and determining whether the signaling activity of GAVE 19 in the presence of the potential inverse agonist and an endogenous ligand or agonist is decreased relative to the signaling activity of GAVE 19 under conditions in which the presence of an endogenous ligand or agonist, but in absence of potential inverse agonist, and is decreased in the presence of an endogenous ligand or agonist
  • the present invention extends to methods for identifying an antagonist of GAVE 19.
  • Such a method comprises the steps of contacting a potential antagonist with a cell expressing GAVE 19, and determining whether in the presence of said potential antagonist the signaling activity of GAVE19 is decreased relative to the activity of GAVE 19 in the presence of an endogenous ligand or agonist.
  • nucleic acid sequence which encodes a GAVE19 protein, a fragment thereof, or a variant thereof
  • Yet another aspect of the present invention involves methods for identify compounds that can modulate the activity of GAVE19 protein
  • modulators may be an antagonist of GAVE19, an agonist of GAVE19, or inverse agonist of GAVE19.
  • compounds that modulate the expression or activity of GAVE 19 in mice may well have applications in treating a plethora of diseases or disorders such as various inflammatory diseases, asthma, chronic obstructive pulmonary disease (COPD), and rheumatoid arthritis, to name only a few.
  • COPD chronic obstructive pulmonary disease
  • FIGURE 1 DNA sequence that encodes GAVE19 (SEQ ID NO: 1)
  • FIGURE 2 Ammo acid sequence of GAVE 19 (SEQ ID NO.2)
  • FIGURE 3 GAVE 19 Expression Profile on MPD 1.1.2
  • FIGURE 4 Comparison of the ammo acid sequence of GAVE19 (SEQ ID NO:2) with the human ortholog GAVE18 (SEQ ID NO:7).
  • the present invention relates to the surprising and unexpected discovery of a heretofore unknown murine nucleic acid molecule that encodes a heretofore unknown G protein-coupled receptor referred to herein as GAVE 19
  • GAVE 19 is expressed in immune tissues or organs, such as the kidney, liver and small intestine.
  • GAVE 19 can readily serve as a target for the development of pharmaceutical compositions to treat a variety inflammation diseases, such as asthma, rheumatoid arthritis, COPD, etc.
  • Various terms and phrases used throughout the instant Specification and Claims to describe the present invention are set forth below
  • modulator refers to a moiety (e.g., but not limited to a ligand and a candidate compound) that modulates the activity of GAVE 19.
  • a modulator of the present invention may be an agonist, a partial agonist, an antagonist, or an inverse agonist of GAVE 19
  • agonist refers to moieties (e.g., but not limited to ligands and candidate compounds) that activate the intracellular response when bound to the receptor, or enhance GTP binding to membranes.
  • partial agonist refers to moieties (e.g., but not limited to ligands and candidate compounds) that activate the intracellular response when bound to the receptor to a lesser degree/extent than do agonists, or enhance GTP binding to membranes to a lesser degree/extent than do agonists.
  • an antagonist refers moieties (e.g., but not limited to ligands and candidate compounds) that competitively bind to the receptor at the same site as does an agonist
  • an antagonist does not activate the intracellular response initiated by the active form of the receptor and thereby can inhibit the intracellular responses by agonists or partial agonists.
  • antagonists do not diminish the baseline intracellular response in the absence of an agonist or partial agonist.
  • inverse agonist refers to moieties (e.g , but not limited to ligand and candidate compound) that bind to a constitutively active receptor and inhibit the baseline intracellular response.
  • the baseline response is initiated by the active form of the receptor below the normal base level of activity that is observed in the absence of agonists or partial agonists, or decrease of GTP binding to membranes.
  • the term “candidate compound” refers to a moiety (e g , but not limited to a chemical compound) that is amenable to a screening technique. In one embodiment, the term does not include compounds that were publicly known to be compounds selected from the group consisting of agonist, partial agonist, inverse agonist or antagonist of GAVE 19. Those compounds were identified by traditional drug discovery processes involving identification of an endogenous ligand specific for a receptor, and/or screening of candidate compounds against a receptor wherein such a screening requires a competitive assay to assess efficacy.
  • constitutively activated receptor or “autonomously active receptor,” are used herein interchangeably, and refer to a receptor subject to activation in the absence of ligand.
  • Such constitutively active receptors can be endogenous (e.g , GAVE 19) or non-endogenous; i.e., GPCRs that can be modified by recombinant means to produce mutant constitutive forms of wild-type GPCRs (e.g, see EP 1071701; WO 00/22129, WO 00/22131; and U.S Pat. Nos. 6,150,393 and 6,140,509 which are hereby incorporated by reference herein in their entireties.
  • the term “constitutive receptor activation” refers to the stabilization of a receptor in the active state by means other than binding of the receptor with the endogenous ligand or chemical equivalent thereof.
  • ligand refers to a moiety that binds to another molecule, wherein the moiety includes, but certainly is not limited to a hormone or a neurotransmitter, and further, wherein the moiety stereoselectively binds to a receptor.
  • family when referring to a protein or a nucleic acid molecule of the invention, is intended to mean two or more proteins or nucleic acid molecules having a seemingly common structural domain and having sufficient amino acid or nucleotide sequence identity as defined herein Such family members can be naturally occurring and can be from either the same or different species.
  • a family can contain a first protein of human origin and a homologue of that protein of murine origin, as well as a second, distinct protein of human origin and a murine homologue of that second protein.
  • Members of a family also may have common functional characteristics.
  • GAVE 19 activity refers to an activity exerted by a GAVE 19 protein, polypeptide or nucleic acid molecule on a GAVE 19 responsive cell as determined in vivo or in vitro, according to standard techniques.
  • a GAVE 19 activity can be a direct activity, such as an association with or an enzymatic activity on a second protein or an indirect activity, such as a cellular signaling activity mediated by interaction of the GAVE 19 protein with a second protein.
  • a GAVE19 activity includes, but is not limited to at least one or more of the following activities: (I) the ability to interact with proteins in the GAVE 19 signaling pathway; (n) the ability to interact with a GAVE19 ligand; and (in) the ability to interact with an intracellular target protein.
  • a “vector” is a rephcon, such as plasmid, phage or cosmid, to name only a few, to which another DNA segment may be attached so as to bring about the replication of the attached segment
  • a "rephcon” is any genetic element (e.g, plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo, i.e., capable of replication under its own control. Particular examples of vectors are described infra.
  • a "cassette” refers to a segment of DNA that can be inserted into a vector at specific restriction sites.
  • the segment of DNA encodes a polypeptide of interest, and the cassette and restriction sites are designed to ensure insertion of the cassette in the proper reading frame for transcription and translation.
  • a cell has been "transfected” by exogenous or heterologous DNA when such DNA has been introduced inside the cell.
  • a cell has been "transformed” by exogenous or heterologous DNA when the transfected DNA effects a phenotypic change.
  • the transforming DNA should be integrated (covalently linked) into chromosomal DNA making up the genome of the cell.
  • Heterologous DNA refers to DNA not naturally located in the cell, or in a chromosomal site of the cell.
  • the heterologous DNA includes a gene foreign to the cell.
  • "Homologous recombination” refers to the insertion of a foreign DNA sequence of a vector into a chromosome.
  • the vector targets a specific chromosomal site for homologous recombination.
  • the vector will contain sufficiently long regions of homology to sequences of the chromosome to allow complementary binding and incorporation of the vector into the chromosome Longer regions of homology, and greater degrees of sequence similarity, may increase the efficiency of homologous recombination
  • the present invention extends to an isolated nucleic acid molecule comprising DNA sequence of Figure 1 (SEQ ID NO 1), a variant thereof, a fragment thereof, or an analog or derivative thereof.
  • nucleic acid molecule refers to the phosphate ester polymeric form of nbonucleosides (adenosme, guanosine, undine or cytidme, "RNA molecules”) or deoxynbonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidme, or deoxycytidine; "DNA molecules”), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible.
  • nucleic acid molecule refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms Thus, this term includes double-stranded DNA found, inter aha, in linear or circular DNA molecules (e g , restriction fragments), plasmids, and chromosomes.
  • a "recombinant DNA molecule” is a DNA molecule that has undergone a molecular biological manipulation.
  • an “isolated” nucleic acid molecule is one that is separated from other nucleic acid molecules present in the natural source of the nucleic acid
  • an “isolated” nucleic acid is free of sequences that naturally flank the nucleic acid encoding GAVE19 (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived.
  • the isolated GAVE19 nucleic acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0 5 kb or 0.1 kb of nucleotide sequences that naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived.
  • an "isolated" nucleic acid molecule such as a cDNA molecule, can be substantially free of other cellular material or culture medium when produced by recombinant techniques or substantially free of chemical precursors or other chemicals when synthesized chemically.
  • a nucleic acid molecule of the present invention e.g, a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 1 or a fragment or complement of any of that nucleotide sequence, or an analog or derivative thereof, can be isolated using standard molecular biology techniques and the sequence information provided herein. Using all or a portion of the nucleic acid sequence of SEQ ID NO: 1 as a hybridization probe, GAVE19 nucleic acid molecules can be isolated using standard hybridization and cloning techniques (e.g, as described in Sambrook et al).
  • a nucleic acid molecule of the invention can be amplified using cDNA, mRNA or genomic DNA as a template and appropriate ohgonucleotide primers according to standard PCR amplification techniques. Such primers may be readily made using information set forth in SEQ DO NO: 1, and routine laboratory techniques.
  • the nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis
  • oligonucleotides corresponding to GAVE 19 nucleotide sequences can be prepared by standard synthetic techniques, e.g, using an automated DNA synthesizer.
  • the present invention further extends to isolated nucleic acid molecules hybndizable to GAVE19 DNA, hybndizable to a hybridization probe that is complementary under stringent hybridization conditions to GAVE 19 DNA, or hybndizable under stringent hybridization conditions to both
  • the present invention extends to an isolated nucleic acid molecule that is hybndizable under stringent hybridization conditions to a nucleic acid molecule comprising a DNA sequence of SEQ ID NO.l, or to a probe that is complementary to an isolated nucleic acid molecule comprising a DNA sequence of SEQ ID NO: 1.
  • a nucleic acid molecule is "hybndizable" to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to another nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength (see
  • low stringency hybridization conditions corresponding to a T m of 55° C
  • Moderate stringency hybridization conditions correspond to a higher T m , e g , 40% formamide, with 5x or 6x SSC.
  • High stringency hybridization conditions correspond to the highest T m , e.g., 50% formamide, 5x or 6x SSC.
  • Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible.
  • the appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of T m for hybrids of nucleic acids having those sequences.
  • the relative stability (corresponding to higher T m ) of nucleic acid hybridizations decreases m the following order: RNA:RNA, DNA:RNA, DNA:DNA.
  • a minimum length for a hybndizable nucleic acid molecule is at least about 20 nucleotides; particularly at least about 30 nucleotides; more particularly at least about 40 nucleotides, even more particularly about 50 nucleotides, and yet more particularly at least about 60 nucleotides.
  • a hybndizable nucleic acid molecule of the invention is at least 300, 325, 350, 375, 400, 425, 450, 500, 550, 600, 650, 700, 800, 900, 1000 or 1100 nucleotides in length and hybridizes under stringent conditions to the nucleic acid molecule comprising the nucleotide sequence, preferably the coding sequence, of SEQ ID NO:l a complement thereof, or a fragment thereof.
  • hybridizes under stringent conditions is intended to describe conditions for hybridization and washing under which nucleotide sequences at least 55%, 60%, 65%, 70% and preferably 75% or more complementary to each other typically remain hybridized.
  • stringent conditions are known to those skilled in the art and can be found in "Current Protocols in Molecular Biology", John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
  • a preferred, non-hmitmg example of stringent hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45° C, followed by one or more washes in 0.2X SSC, 0.1% SDS at 50-65° C.
  • SSC sodium chloride/sodium citrate
  • an isolated nucleic acid molecule of the invention that hybridizes under stringent conditions to the sequence of SEQ ID NO:l or the complement thereof corresponds to a naturally occurring nucleic acid molecule.
  • a "naturally-occurring" nucleic acid molecule refers to an RNA or DNA molecule having a nucleotide sequence that occurs in nature (e.g, encodes a natural protein).
  • sequence-specific variables e.g, length, G-C richness etc.
  • the invention contemplates encompassing nucleic acid fragments of GAVE 19 that are diagnostic of GAVE19-l ⁇ ke molecules that have similar properties.
  • the diagnostic fragments can arise from any portion of the GAVE 19 gene including flanking sequences.
  • the fragments can be used as probe of a library practicing known methods.
  • a nucleic acid molecule of the invention can comprise only a portion of a nucleic acid sequence encoding GAVE19, for example, a fragment that can be used as a probe or primer, or a fragment encoding a biologically active portion of GAVE 19.
  • a fragment can comprise, but is not limited to, a region encoding amino acid residues about 1 to about 14 of SEQ ID NO'2.
  • the nucleotide sequence determined from the cloning of the human GAVE19 gene allows for the generation of probes and primers for identifying and/or cloning GAVE 19 homologues in other cell types, e g, from other tissues, as well as GAVE19 homologues from other mammals.
  • the probe/primer typically comprises substantially purified ohgonucleotide.
  • the ohgonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 12, preferably about 25, more preferably about 50, 75, 100, 125, 150, 175, 200, 250, 300, 350 or 400 consecutive nucleotides of the sense or anti-sense sequence of SEQ ID NO: l or of a naturally occurring mutant of SEQ ID NO.1.
  • Probes based on a GAVE 19 nucleotide sequence can be used to detect transcripts or genomic sequences encoding the similar or identical proteins.
  • fragment or "portion” of an isolated nucleic acid molecule of the present invention comprise at least 12, particularly about 25, more particularly about 50, 75, 100, 125, 150, 175, 200, 250, 300, 350 or 400 consecutive nucleotides Consequently, a "fragment” of an isolated nucleic acid molecule of the present invention is not merely 1 or 2 nucleotides.
  • a "fragment" or "portion” of a polypeptide of the present invention comprises at least 9 contiguous ammo acid residues.
  • a particular example of a fragment of a polypeptide of the present invention comprises an epitope to which a GAVE 19 antibody, or fragment thereof, binds.
  • a nucleic acid fragment encoding a "biologically active portion of GAVE 19" can be prepared by isolating a portion of SEQ ID NO: 1 that encodes a polypeptide having a GAVE 19 biological activity, expressing the encoded portion of GAVE 19 protein (e.g, by recombinant expression in vitro) and assessing the activity of the encoded portion of GAVE 19.
  • the invention further encompasses nucleic acid molecules that differ from the nucleotide sequence of SEQ ID NO:l due to degeneracy of the genetic code, and thus encode the same GAVE 19 protein as that encoded by the nucleotide sequence shown in SEQ ID NO: 1.
  • the present invention further extends to an isolated nucleic acid molecule that is homologous to a GAVE19 DNA molecule, e.g, is homologous to an isolated nucleic acid molecule having a DNA sequence of SEQ ID NO: 1.
  • Two DNA sequences are "substantially homologous” or “substantially similar” when at least about 50% (preferably at least about 75%, and most preferably at least about 90 or 95%) of the nucleotides match over the defined length of the DNA sequences. Sequences that are substantially homologous can be identified by comparing the sequences using standard software available in sequence data banks using default parameters, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system.
  • nucleic acid molecules encoding GAVE 19 proteins from other species with a nucleotide sequence that differs from that of a human GAVE 19, are intended to be within the scope of the invention.
  • variants of an Isolated Nucleic acid Molecule of the present Invention further extends to variants of an isolated nucleic acid molecule comprising a DNA sequence of SEQ ID NO: 1.
  • variants can be degenerate, allehc, or a combination thereof.
  • Nucleic acid molecules corresponding to natural allehc variants and homologues of the GAVE 19 cDNA of the invention can be isolated based on identity with the murine GAVE19 nucleic acids disclosed herein using the murine cDNA or a portion thereof, as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions.
  • corresponding to is used herein to refer similar or homologous sequences, whether the exact position is identical or different from the molecule to which the similarity or homology is measured.
  • corresponding to refers to the sequence similarity, and not the numbering of the amino acid residues or nucleotide bases.
  • a GAVE19 protein of the present invention can be encoded by numerous isolated nucleic acid molecules. "Degenerate nature” refers to the use of different three-letter codons to specify a particular amino acid pursuant to the genetic code.
  • codons specified above are for RNA sequences.
  • the corresponding codons for DNA have a T substituted for U.
  • GAVE19 nucleotide sequence shown in SEQ ID NO:l
  • DNA sequence polymorphisms that lead to changes in the amino acid sequences of GAVE 19 may exist withm a population.
  • Such genetic polymorphism in the GAVE 19 gene may exist among individuals within a population due to natural allehc variation.
  • An allele is one of a group of genes that occur alternatively at a given genetic locus.
  • the terms "gene” and “recombinant gene” refer to nucleic acid molecules comprising an open reading frame encoding a GAVE 19 protein, preferably a mammalian GAVE 19 protein.
  • allehc variant refers to a nucleotide sequence that occurs at a GAVE 19 locus or to a polypeptide encoded by the nucleotide sequence.
  • Alternative alleles can be identified by sequencing the gene of interest in a number of different individuals. That can be carried out readily by using hybridization probes to identify the same genetic locus in a variety of individuals. Any and all such nucleotide variations and resulting amino acid polymorphisms or variations in GAVE 19 that are the result of natural allehc variation and that do not alter the functional activity of GAVE 19 are intended to be withm the scope of the invention
  • variants of an isolated nucleic acid molecule of the present invention can be readily made by one of ordinary skill in the art using routine laboratory techniques, e.g, site -directed mutagenesis.
  • Antisense Nucleotide Sequences The instant invention also extends to antisense nucleic acid molecules, i.e., molecules that are complementary to a sense nucleic acid encoding a protein, e.g , complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence. Accordingly, an antisense nucleic acid can hydrogen bond to a sense nucleic acid.
  • the antisense nucleic acid can be complementary to an entire GAVE 19 coding strand or to only a portion thereof, e.g, all or part of the protein coding region (or open reading frame).
  • An antisense nucleic acid molecule can be antisense to a noncoding region of the coding strand of a nucleotide sequence encoding GAVE 19.
  • the noncodmg regions (“5' and 3' untranslated regions") are the 5' and 3' sequences that flank the coding region and are not translated into amino acids
  • antisense nucleic acids of the invention can be designed according to the rules of Watson & Crick base pairing.
  • the antisense nucleic acid molecule can be complementary to the entire coding region of GAVE 19 mRNA, but more preferably is an ohgonucleotide that is antisense to only a portion of the coding or noncoding region of GAVE 19 mRNA.
  • the antisense ohgonucleotide can be complementary to the region surrounding the translation start site of GAVE 19 mRNA.
  • An antisense ohgonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length.
  • An antisense nucleic acid of the invention can be constructed using chemical synthesis and enzymatic hgation reactions using procedures known in the art.
  • an antisense nucleic acid e.g, an antisense ohgonucleotide
  • an antisense nucleic acid can be synthesized chemically using naturally occurring nucleotides or various chemically modified nucleotides designed to increase the biological stability of the molecules, or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g, phosphorothioate derivatives, phosphonate derivatives and ac ⁇ dme-substituted nucleotides can be used.
  • modified nucleotides that can be used to generate the antisense nucleic acid include 5-fluorourac ⁇ l, 5-bromourac ⁇ l, 5-chlorourac ⁇ l, 5- ⁇ odourac ⁇ l, hypoxanthine, xanthine, 4-acetylcytosme, 5-(carboxyhydroxylmethyl)urac ⁇ l, 5-carboxymethylammomethyl-2-th ⁇ ou ⁇ dme, 5-carboxymethylam ⁇ nomethylurac ⁇ l, dihydrouracil, ⁇ -D-galactosylqueosme, inosine, N 6 - ⁇ sopentenyladen ⁇ ne, 1 -methylguanme, 1-methyhnos ⁇ ne, 2,2-d ⁇ methylguanme, 2-methyladen ⁇ ne, 2-methylguan ⁇ ne, 3-methylcytos ⁇ ne, 5-methylcytosme, N -adenme, 7-methylguanme, 5-methylam ⁇ nomethylurac ⁇ l, 5-methoxyam ⁇ n
  • the antisense nucleic acid molecules of the invention typically are administered to a subject or generated in situ so as to hybridize with or bind to cellular mRNA and/or genomic DNA encoding a GAVE19 protein thereby to inhibit expression of the protein, e.g, by inhibiting transcription and/or translation
  • the hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule that binds to DNA duplexes, through specific interactions in the major groove of the double helix, or to a regulatory region of GAVE 19.
  • antisense nucleic acid molecules of the invention includes direct injection at a tissue site
  • antisense nucleic acid molecules can be modified to target selected cells and then administered systemically.
  • antisense molecules can be modified such that the molecules specifically bind to receptors or antigens expressed on a selected cell surface, e.g , by linking the antisense nucleic acid molecules to peptides or antibodies that bind to cell surface receptors or antigens.
  • the antisense nucleic acid molecules also can be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of the antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol HJ promoter are preferred.
  • An antisense nucleic acid molecule of the invention can be an ⁇ -anome ⁇ c nucleic acid molecule.
  • An ⁇ -anome ⁇ c nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in that the strands run parallel to each other (Gaultier et al. Nucleic Acids Res (1987)15.6625-6641)
  • the antisense nucleic acid molecule also can comprise a methyl ⁇ bonucleotide (Inoue et al. Nucleic Acids Res (1987) 15:6131-6148) or a chime ⁇ c RNA-DNA analogue (Inoue et al, FEBS Lett (1987) 215.327-330).
  • Rihozymes The invention also encompasses ⁇ bozymes.
  • Ribozymes are catalytic RNA molecules with ribonuclease activity that are capable of cleaving a smgle-stranded nucleic acid, such as an mRNA, that hybridizes to the ⁇ bozyme.
  • ribozymes e.g, hammerhead ribozymes (described in Haselhoff et al. Nature (1988) 334:585-591)
  • a nbozyme having specificity for a GAVE19-encodmg nucleic acid can be designed based on the nucleotide sequence of a GAVE 19 DNA disclosed herein (e.g, SEQ ED NO: 1).
  • a derivative of a Tetrahymena L-19 IVS RNA can be constructed so that the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a GAVE19-encod ⁇ ng mRNA, see, e.g, U.S. Patent Nos. 4,987,071 and 5,116,742.
  • GAVE19 mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules, see, e.g, Bartel et al. Science (1993) 261:1411-1418.
  • the invention also encompasses nucleic acid molecules that form triple helical structures.
  • GAVE 19 gene expression can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the GAVE19 (e.g, the GAVE19 promoter and/or enhancers) to form triple helical structures that prevent transcription of the GAVE 19 gene in target cells, see generally, Helene, Anticancer Drug Des (1991) 6(6):569; Helene Ann NY Acad Sci (1992) 660:27, and Maher, Bioassays (1992) 14(12):807.
  • the nucleic acid molecules of the invention can be modified at the base moiety, sugar moiety or phosphate backbone to improve, e.g, the stability, hybridization or solubility of the molecule.
  • the deoxynbose phosphate backbone of the nucleic acids can be modified to generate peptide nucleic acids (see Hyrup et al, Bioorganic & Medicinal Chemistry (1996) 4:5).
  • the terms "peptide nucleic acids” or "PNAs” refer to nucleic acid mimics, e.g, DNA mimics, in that the deoxynbose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained.
  • PNAs The neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength.
  • the synthesis of PNA ohgomers can be performed using standard solid phase peptide synthesis protocols as described in Hyrup et al. (1996) supra; Perry-O'Keefe et al, Proc Natl Acad Sci USA (1996) 93:14670.
  • PNAs of GAVE19 can also be used in therapeutic and diagnostic applications.
  • PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, e.g, inducing transcription or translation arrest or inhibiting replication.
  • PNAs of GAVE 19 also can be used.
  • a PNA can be used in the analysis of single base pair mutations in a gene by, e.g, PNA-directed PCR clamping; as artificial restriction enzymes when used in combination with other enzymes, e.g, SI nucleases (Hyrup et al. (1996) supra) or as probes or primers for DNA sequence and hybridization (Hyrup et al. (1996) supra; Perry-O'Keefe et al. (1996) supra).
  • PNAs of GAVE19 can be modified, e.g, to enhance stability, specificity or cellular uptake, by attaching lipophihc or other helper groups to the PNA, by the formation of PNA-DNA chimeras or by the use of liposomes or other techniques of drug delivery known in the art.
  • the synthesis of PNA-DNA chimeras can be performed as described in Hyrup et al. (1996) supra, Finn et al. Nucleic Acids Res (1996) 24(17):3357-63, Mag et al. Nucleic Acids Res (1989) 17:5973; and Peterser et al, Bioorganic Med Chem Lett (1975) 5:1119.
  • the present invention extends to an isolated polypeptide comprising the ammo acid sequence of Figure 2 (SEQ ID NO:2), a variant thereof, a fragment thereof or an analog or derivative thereof.
  • An isolated nucleic acid molecule encoding a GAVE 19 protein having a sequence that differs from that of SEQ ED NO'2, e.g. a variant, can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of SEQ ED NO:l such that one or more ammo acid substitutions, additions or deletions are introduced into the encoded protein.
  • a mutant GAVE19 protein can be assayed for: (1) the ability to form proteimprotein interactions with proteins in the GAVE 19 signaling pathway; (2) the ability to bind a GAVE 19 ligand; or (3) the ability to bind to an intracellular target protein.
  • a mutant GAVE19 can be assayed for the ability to modulate cellular proliferation or cellular differentiation.
  • Native GAVE19 proteins can be isolated from cells or tissue sources by an appropriate purification scheme using standard protein purification techniques Alternatively, GAVE 19 proteins can readily be produced by recombinant DNA techniques.
  • Yet another alternative encompassed by the present invention is the chemical synthesis of a GAVE 19 protein or polypeptide using standard peptide synthesis techniques
  • an “isolated” or “purified” protein, or biologically active portion thereof, is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the GAVE19 protein is derived, or is substantially free of chemical precursors or other chemicals when chemically synthesized
  • substantially free of cellular material includes preparations of GAVE 19 protein in which the protein is separated from cellular components of the cells from which the protein is isolated or recombmantly produced.
  • GAVE19 protein that is substantially free of cellular material includes preparations of GAVE19 protein having less than about 30%, 20%, 10% or 5% or less (by dry weight) of non-GAVE19 protein (also referred to herein as a "contaminating protein").
  • GAVE 19 protein or biologically active portion thereof when produced recombmantly, it also is preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, 10% or 5% or less of the volume of the protein preparation.
  • culture medium represents less than about 20%, 10% or 5% or less of the volume of the protein preparation.
  • GAVE 19 protein is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals that are involved in the synthesis of the protein. Accordingly, such preparations of GAVE 19 protein have less than about 30%, 20%, 10% or 5% or less (by dry weight) of chemical precursors or non-GAVE19 chemicals.
  • Biologically active portions or fragments of a GAVE 19 protein include peptides comprising ammo acid sequences sufficiently identical to or derived from the amino acid sequence of the GAVE 19 protein (e.g, the amino acid sequence shown in SEQ D NO:2), that include fewer ammo acids than the full length GAVE 19 protein and exhibit at least one activity of a GAVE 19 protein.
  • biologically active portions comprise a domain or motif with at least one activity of a GAVE 19 protein.
  • a biologically active portion of a GAVE 19 protein can be a polypeptide that is, for example, 10, 25, 50, 100 or more ammo acids in length.
  • Particular biologically active polypeptides include one or more identified GAVE 19 structural domains.
  • GAVE 19 proteins are substantially identical to SEQ ID NO:2 and retain a functional activity of the protein of SEQ ID NO.2 yet differ in amino acid sequence due to natural allehc variation or mutagenesis.
  • GAVE19 proteins and polypeptides possess at least one biological activity described herein.
  • a useful GAVE 19 protein is a protein that includes an amino acid sequence at least about 45%, preferably 55%, 65%, 75%, 85%, 95%, 99% or 100% ⁇ dent ⁇ cal to the amino acid sequence of SEQ ID NO:2 and retains a functional activity of a GAVE 19 protein of SEQ ED NO:2 In a particular embodiment, the GAVE 19 protein retains a functional activity of the GAVE 19 protein of SEQ ID NO.2.
  • sequences are aligned for optimal comparison purposes (e.g, gaps can be introduced in the sequence of a first ammo acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence).
  • the ammo acid residues or nucleotides at corresponding amino acid positions or nucleotide positions then are compared When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position m the second sequence, then the molecules are considered identical at that position
  • the determination of percent identity between two sequences can be accomplished using a mathematical algorithm.
  • a particular, non-hmitmg example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karhn et al, Proc Natl Acad Sci USA (1990) 87:2264, modified as in Karhn et al, Proc Natl Acad Sci USA (1993) 90:5873-5877.
  • Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al, J Mol Bio (1990) 215:403.
  • Gapped BLAST can be utilized as described in Altschul et al. Nucleic Acids Res (1997) 25 3389.
  • PSI-Blast can be used to perform an iterated search that detects distant relationships between molecules. Altschul et al. (1997) supra.
  • a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers et al, CABIOS (1988) 4: 11-17. Such an algorithm is incorporated into the ALIGN program (version 2.0) that is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM 120 weight residue table, a gap length penalty of 12 and a gap penalty of 4 may be used.
  • the percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, only exact matches are counted.
  • the present invention further extends to GAVE19 chimenc or fusion proteins.
  • GAVE19 chimenc or fusion proteins As used herein, a
  • GAVE 19 "chimenc protein” or “fusion protein” comprises a GAVE 19 polypeptide operably linked to a non-GAVE19 polypeptide.
  • a “GAVE19 polypeptide refers to a polypeptide having an ammo acid sequence corresponding to GAVE19.
  • a “non-GAVE 19 polypeptide” refers to a polypeptide having an ammo acid sequence corresponding to a protein that is not substantially identical to the GAVE 19 protein, e.g, a protein that is different from the GAVE19 protein and is derived from the same or a different organism.
  • the GAVE19 polypeptide can correspond to all or a portion of a GAVE 19 protein, preferably at least one biologically active portion of a GAVE 19 protein.
  • the term "operably linked" is intended to indicate that the GAVE 19 polypeptide and the non-GAVE 19 polypeptide are fused m-frame to each other.
  • the non-GAVE 19 polypeptide can be fused to the N-termmus or C-terminus of a GAVE 19 polypeptide.
  • One useful fusion protein is GST-GAVE 19 in which a GAVE 19 sequence is fused to the C-terminus of glutathione-S-transferase (GST). Such fusion proteins can facilitate the purification of recombinant GAVE 19.
  • a fusion protein of the present invention extends to a
  • GAVE19- ⁇ mmunoglobuhn fusion protein in which all or part of GAVE19 is fused to sequences derived from a member of the immunoglobulin protein family.
  • the GAVE19-immunoglobuhn fusion proteins of the invention can be incorporated into pharmaceutical compositions and administered to a subject to inhibit an interaction between a GAVE 19 ligand and a GAVE 19 protein on the surface of a cell, thereby to suppress GAVE19-med ⁇ ated signal transduction in vivo.
  • the GAVE19- ⁇ mmunoglobulm fusion proteins can be used to affect the bioavailabihty of a GAVE 19 cognate ligand.
  • GAVE19 hgand-GAVE19 interaction may be useful therapeutically, both for treating proliferative and differentiative disorders and for modulating (e.g. promoting or inhibiting) cell survival.
  • the GAVE 19- ⁇ mmunoglobuhn fusion proteins of the invention can be used as immunogens to produce ant ⁇ -GAVE19 antibodies in a subject, to purify GAVE 19 ligands and in screening assays to identify molecules that inhibit the interaction of GAVE 19 with a GAVE 19 ligand.
  • a GAVE 19 chimenc or fusion protein of the present invention is produced by standard recombinant DNA techniques.
  • DNA fragments coding for the different polypeptide sequences are hgated together in-frame in accordance with conventional techniques, for example, by employing blunt-ended or stagger-ended termini for hgation, restriction enzyme digestion to provide for appropriate termini, fillmg-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining and enzymatic hgation.
  • the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers.
  • PCR amplification of gene fragments can be carried out using anchor primers that give rise to complementary overhangs between two consecutive gene fragments that subsequently can be annealed and reamphfied to generate a chimenc gene sequence (see e.g, Ausubel et al, supra).
  • anchor primers that give rise to complementary overhangs between two consecutive gene fragments that subsequently can be annealed and reamphfied to generate a chimenc gene sequence
  • many expression vectors are commercially available that already encode a fusion moiety (e.g , a GST polypeptide).
  • a GAVE19-encodmg nucleic acid can be cloned into such an expression vector so that the fusion moiety is linked m-frame to the GAVE 19 protein.
  • variants of the GAVE19 protein further extends to variants of the GAVE19 protein.
  • mutations may be introduced into the ammo acid sequence of SEQ ED NO:2 using standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis.
  • conservative amino acid substitutions can be made at one or more predicted non-essential amino acid residues.
  • a "conservative ammo acid substitution” is one in which the ammo acid residue is replaced with an amino acid residue having a similar side chain.
  • one or more amino acids can be substituted by another ammo acid of a similar polarity, which acts as a functional equivalent, resulting in a silent alteration.
  • Substitutes for an amino acid within the ammo acid sequence of a polypeptide of the present invention may be selected from other members of the class to which the ammo acid belongs.
  • the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine
  • Ammo acids containing aromatic ring structures are phenylalanine, tryptophan, and tyrosine.
  • the polar neutral ammo acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine.
  • the positively charged (basic) ammo acids include arginine, lysine and histidine
  • the negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Such alterations will not be expected to effect apparent molecular weight as determined by polyacrylamide gel electrophoresis, or lsoelect ⁇ c point.
  • amino acid substitutions may also be introduced to substitute an amino acid with a particularly preferable property.
  • a Cys may be introduced for a potential site for disulfide bridges with another Cys.
  • a His may be introduced as a particularly "catalytic" site (1 e , His can act as an acid or base and is the most common amino acid in biochemical catalysis).
  • Pro may be introduced because of its particularly planar structure, which induces 3-turns in the protein's structure.
  • Mutations can also be introduced randomly along all or part of a GAVE 19 coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for GAVE19 biological activity to identify mutants that retain activity. Following mutagenesis, the encoded protein can be expressed recombmantly and the activity of the protein can be determined.
  • Variants of the present invention can function as a GAVE 19 agonist (mimetic) or as GAVE 19 antagonist.
  • Variants of the GAVE19 protein can be generated by mutagenesis, e.g, discrete point mutation or truncation of the GAVE19 protein.
  • An agonist of the GAVE19 protein can retain substantially the same or a subset of the biological activities of the naturally occurring GAVE 19 protein
  • an antagonist of the GAVE 19 protein can competitively bind to a downstream or upstream member of a cellular signaling cascade that includes the GAVE 19 protein, and thus inhibit one or more of the activities of the naturally occurring form of the GAVE 19 protein.
  • specific biological effects can be elicited by treatment with a variant of limited function.
  • GAVE 19 protein that function as either GAVE 19 agonists (mimetics) or as GAVE 19 antagonists can be identified by screening combinatorial libraries of mutants, e.g, truncation mutants, of the GAVE 19 protein for GAVE 19 agonist or antagonist activity.
  • a variegated library of GAVE 19 variants is generated by combinatorial mutagenesis at the nucleic acid level, and is encoded by a variegated gene library.
  • a variegated library of GAVE 19 variants can be produced by, for example, enzymatically ligatmg a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential GAVE 19 sequences is expressed as individual polypeptides or alternatively, as a set of larger fusion proteins (e.g, for phage display) containing the set of GAVE19 sequences therein.
  • enzymatically ligatmg a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential GAVE 19 sequences is expressed as individual polypeptides or alternatively, as a set of larger fusion proteins (e.g, for phage display) containing the set of GAVE19 sequences therein.
  • methods that can be used to produce libraries of potential GAVE19 variants from a degenerate ohgonucleotide sequence. Chemical synthesis of a degenerate gene sequence can be performed in an automated DNA synthe
  • degenerate set of genes allows for the provision, in one mixture, of all of the sequences encoding the desired set of potential GAVE 19 sequences.
  • Methods for synthesizing degenerate oligonucleotides are known in the art (see, e.g, Narang, Tetrahedron (1983) 39:3; Itakura et al, Ann Rev Biochem (1984) 53:323; Itakura et al. Science (1984) 198- 1056; Ike et al. Nucleic Acid Res (1983) 1 1 :477).
  • libraries of fragments of the GAVE 19 protein coding sequence can be used to generate a variegated population of GAVE19 fragments for screening and subsequent selection of variants of a GAVE19 protein.
  • a library of coding sequence fragments can be generated by treating a double-stranded PCR fragment of a GAVE19 coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double-stranded DNA, renatu ⁇ ng the DNA to form double-stranded DNA that can include sense/antisense pairs from different nicked products, removing single-stranded portions from reformed duplexes by treatment with SI nuclease and ligatmg the resulting fragment library into an expression vector.
  • an expression library can be derived that encodes N-termmal and internal fragments of various sizes of the GAVE 19 protein.
  • REM Recursive ensemble mutagenesis
  • the present invention also includes derivatives or analogs of GAVE 19 produced from a chemical modification.
  • a GAVE 19 protein of the present invention may be derivatized by the attachment of one or more chemical moieties to the protein moiety.
  • the chemical moieties suitable for derivatization may be selected from among water soluble polymers so that the GAVE 19 analog or derivative does not precipitate in an aqueous environment, such as a physiological environment.
  • the polymer will be pharmaceutically acceptable.
  • One skilled in the art will be able to select the desired polymer based on such considerations as whether the polymer/component conjugate will be used therapeutically, and if so, the desired dosage, circulation time, resistance to proteolysis, and other considerations. For GAVE 19, these may be ascertained using the assays provided herein.
  • water soluble polymers having applications herein include, but are not limited to, polyethylene glycol, copolymers of ethylene glycol/propylene glycol, carboxymethylcellulose, dextran, polyvinyl alcohol, polyvmyl pyrrohdone, poly-1, 3-d ⁇ oxolane, poly-l,3,6-t ⁇ oxane, ethylene/maleic anhydride copolymer, polyaminoacids (either homopolymers or random copolymers), dextran, poly(n-v ⁇ nyl pyrrohdone)polyethylene glycol, propropylene glycol homopolymers, polypropylene oxide/ethylene oxide co- polymers, polyoxyethylated polyols or polyvinyl alcohol.
  • Polyethylene glycol propionaldenhyde may have advantages in manufacturing due to its stability in water.
  • the polymer may be of any molecular weight, and may be branched or unbranched.
  • the preferred molecular weight is between about 2 kDa and about 100 kDa (the term "about” indicating that in preparations of polyethylene glycol, some molecules will weigh more, some less, than the stated molecular weight) for ease in handling and manufacturing.
  • Other sizes may be used, depending on the desired therapeutic profile (e g , the duration of sustained release desired, the effects if any, on biological activity, the ease in handling, the degree or lack of antigenicity and other known effects of the polyethylene glycol to a therapeutic protein or analog).
  • the number of polymer molecules so attached to GAVE 19 may vary, and one skilled in the art will be able to ascertain the effect on function One may mono-de ⁇ vatize, or may provide for a di-, t ⁇ -, tetra- or some combination of derivatization, with the same or different chemical moieties (e g , polymers, such as different weights of polyethylene glycols).
  • the proportion of polymer molecules to GAVE 19 molecules will vary, as will their concentrations in the reaction mixture.
  • the optimum ratio in terms of efficiency of reaction in that there is no excess unreacted component or components and polymer
  • the desired degree of derivatization e g , mono, di-, t ⁇ -, etc.
  • the molecular weight of the polymer selected whether the polymer is branched or unbranched, and the reaction conditions.
  • polyethylene glycol molecules should be attached to GAVE 19 with consideration of effects on functional or antigenic domains of GAVE 19.
  • attachment methods available to those skilled in the art, e g , EP 0 401 384 herein incorporated by reference (coupling PEG to G-CSF), see also Malik et al, 1992, Exp. Hematol. 20:1028-1035 (reporting pegylation of GM-CSF using tresyl chloride)
  • polyethylene glycol may be covalently bound through amino acid residues via a reactive group, such as a free ammo or carboxyl group. Reactive groups are those to which an activated polyethylene glycol molecule may be bound.
  • ammo acid residues having a free amino group include lysme residues and the N- terminal ammo acid residues; those having a free carboxyl group include aspartic acid residues, glutamic acid residues and the C-terminal ammo acid residue.
  • Sulfhydryl groups may also be used as a reactive group for attaching the polyethylene glycol molecule(s). Preferred for therapeutic purposes is attachment at an amino group, such as attachment at the N-terminus or lysine group
  • polyethylene glycol as an illustration of the present compositions, one may select from a variety of polyethylene glycol molecules (by molecular weight, branching, etc.), the proportion of polyethylene glycol molecules to GAVE 19 molecules in the reaction mix, the type of pegylation reaction to be performed, and the method of obtaining the selected N-termmally pegylated protein.
  • the method of obtaining the N- terminally pegylated preparation (l e , separating this moiety from other monopegylated moieties if necessary) may be by purification of the N-termmally pegylated material from a population of pegylated protein molecules.
  • Selective N-termmal chemical modification may be accomplished by reductive alkylation which exploits differential reactivity of different types of primary ammo groups (lysine versus the N-termmal) available for derivatization in GAVE 19.
  • substantially selective derivatization of GAVE 19 at the N-terminus with a carbonyl group containing polymer is achieved.
  • one may selectively N-terminally pegylate GAVE 19 by performing the reaction at a pH which allows one to take advantage of the pK a differences between the e-ammo groups of the lysine residues and that of the ⁇ -ammo group of the N-termmal residue of GAVE19.
  • the water soluble polymer may be of the type described above, and should have a single reactive aldehyde for coupling to GAVE 19.
  • Polyethylene glycol propnonaldehyde, containing a single reactive aldehyde, may be used.
  • Antibodies of GAVE1 can be used as an immunogen to generate antibodies that bind GAVE 19 using standard techniques for polyclonal and monoclonal antibody preparation.
  • the term "antibody” as used herein refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen-bindmg site that specifically binds an antigen, such as GAVE 19, or a fragment thereof.
  • a molecule that specifically binds to GAVE 19 is a molecule that binds GAVE 19, but does not substantially bind other molecules in a sample, e.g, a biological sample that naturally contains GAVE 19.
  • immunologically active portions of immunoglobulin molecules include F( a b> and F(ab')2 fragments that can be generated by treating the antibody with an enzyme such as pepsin.
  • the invention provides polyclonal, monoclonal and chimenc antibodies that have GAVE 19, a variant thereof, a fragment thereof, or an analog or derivative thereof, as an immunogen
  • the full-length GAVE 19 protein can be used or, alternatively, the invention provides antigenic peptide fragments of GAVE19 for use as immunogens.
  • the antigenic peptide of GAVE19 comprises at least 8 (preferably 10, 15, 20, 30 or more) ammo acid residues of the amino acid sequence shown in SEQ ED NO'2 and encompasses an epitope of GAVE19 such that an antibody raised against the peptide forms a specific immune complex with GAVE 19.
  • a GAVE 19 immunogen typically is used to prepare antibodies by immunizing a suitable subject, (e g , rabbit, goat, mouse or other mammal) with the immunogen.
  • a suitable subject e g , rabbit, goat, mouse or other mammal
  • An appropriate immunogenic preparation can contain, for example, recombmantly expressed GAVE 19 protein or a chemically synthesized
  • GAVE 19 polypeptide The preparation further can include an adjuvant, such as Freund's complete or incomplete adjuvant or similar immunostimulatory agent. Immunization of a suitable subject with an immunogenic GAVE19 preparation induces a polyclonal ant ⁇ -GAVE19 antibody response.
  • An antibody of the present invention can be a monoclonal antibody, a polyclonal antibody, or a chimenc antibody.
  • Polyclonal ant ⁇ -GAVE19 antibodies can be prepared as described above by immunizing a suitable subject with a GAVE 19 immunogen
  • the ant ⁇ -GAVE19 antibody titer in the immunized subject can be monitored over time by standard techniques, such as with an enzyme-linked immunosorbent assay (ELISA) using immobilized GAVE 19.
  • ELISA enzyme-linked immunosorbent assay
  • the antibody molecules directed against GAVE 19 can be isolated from the mammal (e.g, from the blood) and further purified by well-known techniques, such as protein A chromatography, to obtain the IgG fraction.
  • antibody-producing cells can be obtained from the subject and used to prepare monoclonal antibodies by standard techniques, such as the hybridoma technique originally described by Kohler et al. Nature (1975) 256:495-497, the human B cell hybridoma technique (Kohler et al, Immunol Today (1983) 4:72), the EBV hybridoma technique (Cole et al. Monoclonal Antibodies and Cancer Therapy, (1985), Alan R. Liss, Inc., pp. 77-96) or t ⁇ oma techniques.
  • standard techniques such as the hybridoma technique originally described by Kohler et al. Nature (1975) 256:495-497, the human B cell hybridoma technique (Kohler et al, Immunol Today (1983) 4:72), the EBV hybridoma technique (Cole et al. Monoclonal Antibodies and Cancer Therapy, (1985), Alan R. Liss, Inc., pp. 77-96) or t ⁇ om
  • hybridomas The technology for producing hybridomas is well known (see generally Current Protocols in Immunology (1994) Cohgan et al, eds, John Wiley & Sons, Inc., New York, NY) Briefly, an immortal cell line (typically a myeloma) is fused to lymphocytes (typically splenocytes) from a mammal immunized with a GAVE 19 immunogen as described above and the culture supernatants of the resulting hybridoma cells are screened to identify a hybridoma producing a monoclonal antibody that binds GAVE19.
  • an immortal cell line typically a myeloma
  • lymphocytes typically splenocytes
  • the immortal cell line (e.g , a myeloma cell line) is derived from the same mammalian species as the lymphocytes.
  • murine hybridomas can be made by fusing lymphocytes from a mouse immunized with an immunogenic preparation of the instant invention with an immortalized mouse cell line, e.g, a myeloma cell line that is sensitive to culture medium containing hypoxanthine, ammopte ⁇ n and thymidine ("HAT medium").
  • myeloma cell lines can be used as a fusion partner according to standard techniques, e.g, the P3-NSl/l-Ag4-l, P3-x63-Ag8.653 or Sp2/0-Agl4 myeloma lines.
  • the myeloma lines are available from ATCC.
  • HAT-sensitive mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol ("PEG").
  • Hybridoma cells resulting from the fusion then are selected using HAT medium that kills unfused and unproductively fused myeloma cells (unfused splenocytes die after several days because they are not transformed).
  • Hybridoma cells producing a monoclonal antibody of the invention are detected by screening the hybridoma culture supernatants for antibodies that bind GAVE 19, e.g, using a standard ELISA assay.
  • a monoclonal ant ⁇ -GAVE19 antibody can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e.g, an antibody phage display library) with GAVE 19 thereby to isolate immunoglobulin library members that bind GAVE 19.
  • Kits for generating and screening phage display libraries are commercially available (e.g, the Pharmacia Recombinant Phage Antibody System, Catalog No. 27-9400-01; and the Stratagene "SURFZAP" Phage Display Kit, Catalog No. 240612).
  • recombinant ant ⁇ -GAVE19 antibodies can be made using standard recombinant DNA techniques.
  • Such antibodies can be produced by recombinant DNA techniques known in the art, for example using methods described in PCT Publication No. WO 87/02671; Europe Patent Application No. 184,187; Europe Patent Application No. 171,496; Europe Patent Application No. 173,494; PCT Publication No. WO 86/01533; U.S. Patent No. 4,816,567; Europe Patent Application No. 125,023; Better et al.
  • An ant ⁇ -GAVE19 antibody (e.g, monoclonal antibody) can be used to isolate GAVE19 by standard techniques, such as affinity chromatography or lmmunoprecipitation.
  • An ant ⁇ -GAVE19 antibody can facilitate the purification of natural GAVE19 from cells and of recombmantly produced GAVE19 expressed in host cells.
  • an ant ⁇ -GAVE19 antibody can be used to detect GAVE19 protein (e.g, in a cellular lysate or cell supernatant) to evaluate the abundance and pattern of expression of the GAVE19 protein.
  • Ant ⁇ -GAVE19 antibodies can be used diagnostically to monitor protein levels in tissue as part of a clinical testing procedure, for example, to determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling the antibody to a detectable substance, which are described infra.
  • isolated nucleic acid molecules of the present invention, polypeptides of the present invention, and antibodies of the present invention, as well as fragments of such moieties may be detectably labeled.
  • suitable labels include enzymes, fluorophores (e g , fluorescene isothiocyanate (FITC), phycoerythnn (PE), Texas red (TR), rhodamine, free or chelated lanthamde series salts, especially Eu + , to name a few fluorophores), chromophores, radioisotopes, chelating agents, dyes, colloidal gold, latex particles, ligands (e g , biotin), bioluminescent materials, and chemiluminescent agents
  • FITC fluorescene isothiocyanate
  • PE phycoerythnn
  • TR Texas red
  • rhodamine free or chelated lanthamde series salts, especially Eu + , to name a few fluorophores
  • radioactive label such as the isotopes 3 H, l4 C, 32 P, 35 S, 36 C1, 51 Cr, 57 Co, 58 Co, 59 Fe, 90 Y, l25 I, 13I I, and 186 Re
  • known currently available counting procedures may be utilized
  • detection may be accomplished by any of the presently utilized colo ⁇ met ⁇ c, spectrophotomet ⁇ c, fluorospectrophotomet ⁇ c, amperomet ⁇ c or gasomet ⁇ c techniques known in the art.
  • Direct labels are one example of labels which can be used according to the present invention.
  • a direct label has been defined as an entity, which in its natural state, is readily visible, either to the naked eye, or with the aid of an optical filter and/or applied stimulation, e.g. U.V. light to promote fluorescence.
  • colored labels include metallic sol particles, for example, gold sol particles such as those described by Leuve ⁇ ng (U.S. Patent 4,313,734); dye sole particles such as described by Gnbnau et al. (U.S. Patent 4,373,932) and May et al.
  • direct labels include a radionucleotide, a fluorescent moiety or a luminescent moiety.
  • indirect labels comprising enzymes can also be used according to the present invention.
  • enzyme linked lmmunoassays are well known in the art, for example, alkaline phosphatase and horseradish peroxidase, lysozyme, glucose-6- phosphate dehydrogenase, lactate dehydrogenase, urease, these and others have been discussed in detail by Eva Engvall in Enzyme Immunoassay ELISA and EMIT in Methods in Enzymology, 70. 419- 439, 1980 and m U.S. Patent 4,857,453.
  • labels for use in the invention include magnetic beads or magnetic resonance imaging labels.
  • a phosphorylation site can be created on an isolated polypeptide of the present invention, an antibody of the present invention, or a fragment thereof, for labeling with P, e g , as described in European Patent No. 0372707 or U.S. Patent No. 5,459,240, issued October 17, 1995 to Foxwell et al.
  • proteins can be labeled by metabolic labeling.
  • Metabolic labeling occurs during in vitro incubation of the cells that express the protein m the presence of culture medium supplemented with a metabolic label, such as [ S]-meth ⁇ onme or [ P]- orthophosphate.
  • a metabolic label such as [ S]-meth ⁇ onme or [ P]- orthophosphate.
  • the invention further contemplates labeling with [ C]-ammo acids and [ H]-ammo acids (with the tritium substituted at non-labile positions).
  • vectors preferably expression vectors, containing a nucleic acid encoding GAVE 19 (or a portion thereof).
  • a vector preferably expression vectors, containing a nucleic acid encoding GAVE 19 (or a portion thereof).
  • plasmid refers to a circular double-stranded DNA loop into which additional DNA segments can be ligated.
  • viral vector is another type of vector, wherein additional DNA segments can be ligated into a viral genome.
  • Certain vectors are capable of autonomous replication in a host cell (e.g, bacterial vectors having a bacterial origin of replication and episomal mammalian vectors).
  • vectors e.g, non-episomal mammalian vectors
  • expression vectors are capable of directing the expression of genes operably linked thereto.
  • expression vectors of utility in recombinant DNA techniques are often in the form of plasmids (vectors).
  • the invention is intended to include other forms of expression vectors, such as viral vectors (e.g, replication defective retroviruses, adenoviruses and adeno-associated viruses), that serve equivalent functions.
  • a recombinant expression vector of the invention comprises a nucleic acid molecule of the present invention in a form suitable for expression of the nucleic acid in a host cell. That means a recombinant expression vector of the present invention includes one or more regulatory sequences, selected on the basis of the host cells to be used for expression, that is operably linked to the nucleic acid to be expressed within a recombinant expression vector, "operably linked” is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner that allows for expression of the nucleotide sequence (e.g, in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).
  • regulatory sequence is intended to include promoters, enhancers and other expression control elements (e.g, polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology:
  • Regulatory sequences include those that direct constitutive expression of the nucleotide sequence m many types of host cells (e.g, tissue specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of host cell to be transformed, the level of expression of protein desired etc.
  • the expression vectors of the invention can be introduced into host cells to produce proteins or peptides encoded by nucleic acids as described herein (e.g , GAVE 19 proteins, mutant forms of GAVE 19, fusion proteins etc.).
  • a recombinant expression vector of the invention can be designed for expression of GAVE 19 in prokaryotic or eukaryotic cells, e.g, bacterial cells such as E coli, insect cells (using baculovirus expression vectors), yeast cells or mammalian cells. Suitable host cells are discussed further in Goeddel, supra.
  • the recombinant expression vector can be transcribed and translated in vitro, for example using phage regulatory elements and proteins, such as, a T7 promoter and/or a T7 polymerase.
  • Fusion vectors add a number of amino acids to a protein encoded therein, usually to the ammo terminus of the recombinant protein.
  • Such fusion vectors typically serve three purposes: 1) to increase expression of recombinant protein; 2) to increase the solubility of the recombinant protein; and 3) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification.
  • a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein.
  • enzymes and the cognate recognition sequences include Factor Xa, thrombin and enterokinase.
  • Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith et al.
  • GST glutathione 5 -transferase
  • Suitable inducible non-fusion E. coh expression vectors include pTrc (Amann et al. Gene (1988) 69:301-315) and pET 1 Id (Studier et al. Gene Expression Technology: Methods in Enzymology, Academic Press, San Diego, California (1990) 185:60-89).
  • Target gene expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-lac fusion promoter.
  • One strategy to maximize recombinant protein expression in E. coli is to express the protein in a host with impaired capacity to cleave proteolytically the recombinant protein (Gottesman, Gene Expression Technology: Methods in Enzymology, Academic Press, San Diego, California (1990) 185:119-128).
  • Another strategy is to alter the nucleic acid sequence of the nucleic acid molecule to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in E coli (Wada et al. Nucleic Acids Res (1992) 20:2111-2118). Such alteration of nucleic acid sequences of the invention can be carried out by standard DNA synthesis techniques.
  • the GAVE 19 expression vector is a yeast expression vector.
  • yeast expression vectors for expression in yeast such as S. cerevisiae include pYepSecl (Baldan et al, EMBO J (1987) 6-229-234), pMFa (Kurjan et al. Cell (1982) 30:933-943), pJRY88 (Schultz et al. Gene (1987) 54:113-123), pYES2 (Lnvitrogen Corporation, San Diego, CA) and pPicZ (Invitrogen Corp, San Diego, CA).
  • GAVE19 can be expressed in insect cells using baculovirus expression vectors.
  • Baculovirus vectors available for expression of proteins in cultured insect cells include the pAc series (Smith et al, Mol Cell Biol (1983) 3:2156-2165) and the pVL series (Lucklow et al. Virology (1989) 170:31-39).
  • a nucleic acid of the invention is expressed in mammalian cells using a mammalian expression vector.
  • mammalian expression vectors having applications herein include, but certainly are not limited to pCDM8 (Seed, Nature (1987) 329:840) and pMT2PC (Kaufman et al, EMBO J (1987) 6: 187-195).
  • control functions of the expression vector often are provided by viral regulatory elements.
  • promoters are derived from polyoma, adenovirus 2, cytomegalovirus and simian virus 40.
  • suitable expression systems for both prokaryotic and eukaryotic cells see chapters 16 and 17 of Sambrook et al , supra.
  • a recombinant mammalian expression vector of the present invention is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g, tissue-specific regulatory elements are used to express the nucleic acid).
  • tissue-specific regulatory elements are known in the art.
  • suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert et al.
  • lymphoid-specific promoters Calame et al, Adv Immunol (1988) 43:235-275
  • promoters of T cell receptors Winoto et al, EMBO J (1989) 8:729-733
  • immunoglobulins Bonerji et al. Cell (1983) 33:729-740; Queen et al. Cell (1983) 33:741-748
  • neuron-specific promoters e.g, the neurofilament promoter; Byrne et al, Proc Natl Acad Sci USA (1989) 86:5473-5477
  • pancreas-specific promoters Edlund et al. Science (1985) 230:912-916
  • mammary gland-specific promoters e.g, milk whey promoter; U.S. Patent No. 4,873,316 and Europe Application No. 264,166.
  • promoters also are encompassed, for example the murine hox promoters (Kessel et al. Science (1990) 249:374-379) and the ⁇ -fetoprotein promoter (Campes et al. Genes Dev (1989) 3:537-546).
  • the invention further provides a recombinant expression vector comprising a DNA molecule of the invention cloned into an expression vector in an antisense orientation. That is, the DNA molecule is operably linked to a regulatory sequence in a manner that allows for expression (by transcription of the DNA molecule) of an RNA molecule that is antisense to GAVE 19 mRNA. Regulatory sequences operably linked to a nucleic acid cloned in the antisense orientation can be chosen that direct the continuous expression of the antisense RNA molecule in a variety of cell types. For example, viral promoters and/or enhancers or regulatory sequences can be chosen that direct constitutive, tissue-specific or cell type-specific expression of antisense RNA.
  • the antisense expression vector can be in the form of a recombinant plasmid, phagemid or attenuated virus in which antisense nucleic acids are produced under the control of a high efficiency regulatory region, the activity of which can be determined by the cell type into which the vector is introduced.
  • host cell and "recombinant host cell” are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but also to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but still are included within the scope of the term as used herein
  • a host cell can be any prokaryotic or eukaryotic cell.
  • GAVE 19 protein can be expressed in bacterial cells such as E coh, insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO), 293 cells or COS cells). Other suitable host cells are known to those skilled in the art.
  • Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques.
  • transformation and “transfection” are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g, DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, transduction, DEAE-dextran-mediated transfection, pofection or electroporation.
  • foreign nucleic acid e.g, DNA
  • a gene that encodes a selectable marker (e.g, for resistance to antibiotics) generally is introduced into the host cells along with the gene of interest
  • Preferred selectable markers include those that confer resistance to drugs, such as G418, hygromycm and methotrexate.
  • Nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as that encoding GAVE 19 or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e g, cells that have incorporated the selectable marker gene will survive, while the other cells die).
  • a host cell of the present invention such as a prokaryotic or eukaryotic host cell in culture, can be used to produce (i.e., express) GAVE19 protein
  • the invention further provides methods for producing GAVE19 protein using the host cells of the invention
  • the method comprises cultu ⁇ ng a host cell of the present invention (into which a recombinant expression vector encoding GAVE 19 has been introduced) in a suitable medium such that GAVE 19 protein is produced.
  • the method further comprises isolating GAVE 19 from the medium or the host cell.
  • GAVE 19 comprises an inducible expression system for the recombinant expression of other proteins subcloned in modified expression vectors.
  • host cells comprising a mutated G protein (e g, yeast cells, Y2 adrenocortical cells and eye " S49, see U.S. Pat. Nos.
  • a second expression vector is used to transduce the GAVE19-comp ⁇ s ⁇ ng host cells.
  • the second vector comprises a structural gene that complements the G protein mutation of the host cell (i.e., functional mammalian or yeast G s , G complicat G 0 , or G q , e.g, see PCT Publication No. WO 97/48820; U.S. Pat. Nos. 6,168,927 Bl, 5,739,029 and 5,482,835) in addition to the gene of interest to be expressed by the inducible system.
  • the complementary structural gene of the second vector is inducible; i.e., under the control of an exogenously added component (e.g, tetracyclme, EPTG, small molecules etc, see Sambrook et al. supra) that activates a promoter which is operably linked to the complementary structural gene.
  • an exogenously added component e.g, tetracyclme, EPTG, small molecules etc, see Sambrook et al. supra
  • the protein encoded by the complementary structural gene is functionally expressed such that the constitutively active GAVE 19 now will form a complex that leads to appropriate downstream pathway activation (e.g, second messenger formation).
  • the gene of interest comprising the second vector possesses an operably linked promoter that is activated by the appropriate second messenger (e.g, CREB, API elements).
  • the appropriate second messenger e.g, CREB, API elements
  • the host cells for the inducible expression system include, but are not limited to, S49 (eye " ) cells. While cell lines are contemplated that comprise G-protem mutations, suitable mutants may be artificially produced/constructed (see U.S. Pat. Nos. 6,168,927 Bl, 5,739,029 and 5,482,835 for yeast cells).
  • the cells are transfected with a vector operably linked to a cDNA comprising a sequence encoding a protein as set forth in SEQ ID NO:2.
  • the first and second vectors comprising said system are contemplated to include, but are not limited to, pCDM8 (Seed, Nature (1987) 329:840) and pMT2PC (Kaufman et al, EMBO J (1987) 6: 187-195), pYepSecl (Baldan et al, EMBO J (1987) 6:229-234), pMFa (Kurjan et al. Cell (1982) 30:933-943), pJRY88 (Schultz et al.
  • the host cells may be transfected by such suitable means, wherein transfection results in the expression of a functional GAVE19 protein (e.g, Sambrook et al, supra, and K ⁇ egler, Gene Transfer and Expression: A Laboratory Manual, Stockton Press, New York, NY, 1990).
  • functional proteins include, but are not limited to, proteins that once expressed, form complexes with G-protems, where the G-protems regulate second messenger formation.
  • transfecting host cells include, but certainly are not limited to transfection, electroporation, micromjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, hpofection (lysosome fusion), use of a gene gun, or a DNA vector transporter (see, e g, Wu et al, 1992, J. Biol. Chem. 267:963-967; Wu and Wu, 1988, J. Biol. Chem. 263:14621- 14624; Hartmut et al, Canadian Patent Application No. 2,012,311, filed March 15, 1990).
  • promoters have applications in the present invention. Indeed, expression of a polypeptide of the present invention may be controlled by any promoter/enhancer element known in the art, but these regulatory elements must be functional in the host selected for expression. Promoters which may be used to control GAVE 19 expression include, but are not limited to, the SV40 early promoter region (Benoist and Chambon, 1981 , Nature 290:304-310), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto, et al, 1980, Cell 22:787- 797), the herpes thymidme kinase promoter (Wagner et al, 1981, Proc. Natl. Acad. Sci.
  • mouse mammary tumor virus control region which is active in testicular, breast, lymphoid and mast cells (Leder et al, 1986, Cell 45:485-495), albumin gene control region which is active in liver (Pinkert et al, 1987, Genes and Devel. 1 :268-276), alpha-fetoprotein gene control region which is active in liver (Krumlauf et al, 1985, Mol. Cell. Biol. 5:1639-1648; Hammer et al, 1987, Science 235:53-58), alpha 1 -anti trypsin gene control region which is active in the liver (Kelsey et al, 1987, Genes and Devel.
  • beta-globin gene control region which is active in myeloid cells (Mogram et al, 1985, Nature 315:338-340; Kolhas et al, 1986, Cell 46:89-94), myelin basic protein gene control region which is active m ohgodendrocyte cells in the bram (Readhead et al, 1987, Cell 48:703-712), myosin light cham-2 gene control region which is active in skeletal muscle (Sam, 1985, Nature 314:283-286), and gonadotropic releasing hormone gene control region which is active in the hypothalamus (Mason et al, 1986, Science 234:1372-1378).
  • Expression vectors containing a nucleic acid molecule of the invention can be identified by four general approaches: (a) PCR amplification of the desired plasmid DNA or specific mRNA, (b) nucleic acid hybridization, (c) presence or absence of selection marker gene functions, and (d) expression of inserted sequences.
  • the nucleic acids can be amplified by PCR to provide for detection of the amplified product.
  • the presence of a foreign gene inserted in an expression vector can be detected by nucleic acid hybridization using probes comprising sequences that are homologous to an inserted marker gene.
  • the recombinant vector/host system can be identified and selected based upon the presence or absence of certain "selection marker" gene functions (e.g., 3-galactos ⁇ dase activity, thymidme kinase activity, resistance to antibiotics, transformation phenotype, occlusion body formation in baculovirus, etc.) caused by the insertion of foreign genes in the vector.
  • selection marker e.g., 3-galactos ⁇ dase activity, thymidme kinase activity, resistance to antibiotics, transformation phenotype, occlusion body formation in baculovirus, etc.
  • the recombmants containing the insert can be identified by the absence of the GAVE 19 gene function.
  • recombinant expression vectors can be identified by assaying for the activity, biochemical, or immunological characteristics of the gene product expressed by the recombinant, provided that the expressed protein assumes a functionally active conformation.
  • a wide variety of host/expression vector combinations may be employed in expressing the DNA sequences of this invention.
  • Useful expression vectors may consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences.
  • Suitable vectors include derivatives of SV40 and known bacterial plasmids, e.g, E coh plasmids col El, pCRl, pBR322, pMal-C2, pET, pGEX (Smith et al , 1988, Gene 67:31-40), pMB9 and their derivatives, plasmids such as RP4; phage DNAS, e.g, the numerous derivatives of phage ⁇ , e.g, NM989, and other phage DNA, e.g.
  • yeast plasmids such as the 2 ⁇ plasmid or derivatives thereof
  • vectors useful in eukaryotic cells such as vectors useful in insect or mammalian cells
  • vectors derived from combinations of plasmids and phage DNAs such as plasmids that have been modified to employ phage DNA or other expression control sequences; and the like.
  • both non-fusion transfer vectors such as but not limited to pVL941 (BamHl cloning site; Summers), pVL1393 (BamHl, Sma ⁇ , Xba ⁇ , EcoRl, Notl, Xmam, BgHI, and Pstl cloning site; Invitrogen), pVL1392 (BglU, Pstl, Notl, XmaUl, EcoRl, Xbal, Smal, and BamHl cloning site, Summers and Invitrogen), and pBluc ⁇ cIII (BamR ⁇ , Bgl ⁇ , Pstl, Ncol, and HindlU cloning site, with blue/white recombinant screening possible; Invitrogen), and fusion transfer vectors, such as but not limited to pAc700 (BamHl and Kpnl cloning site, in which the Bam
  • Mammalian expression vectors contemplated for use in the invention include vectors with inducible promoters, such as the dihydrofolate reductase (DHFR) promoter, e g , any expression vector with a DHFR expression vector, or a .DH R/mefhotrexate co-amplification vector, such as pED (Pstl, Sail, Sbal, Smal, and EcoRl cloning site, with the vector expressing both the cloned gene and DHFR; see Kaufman, Current Protocols in Molecular Biology, 16.12 (1991).
  • DHFR dihydrofolate reductase
  • a glutamine synthetase/methionine sulfoximme co-amplification vector such as pEE14 (Hindm, J ⁇ al, Smal, Sbal, EcoRl, and Bell cloning site, in which the vector expresses glutamine synthase and the cloned gene, Celltech).
  • a vector that directs episomal expression under control of Epstein Barr Virus can be used, such as pREP4 (BamHl, Sf ⁇ l, Xhol, Notl, Nhel, Hindm, Nhel, PvuU, and Kpnl cloning site, constitutive RSV-LTR promoter, hygromycin selectable marker; Invitrogen), pCEP4 (BamHl, Sfil, Xhol, Notl, Nhel, HindQl, Nhel, Pvull, and Kpnl cloning site, constitutive hCMV immediate early gene, hygromycin selectable marker; Invitrogen), pMEP4 (Kpnl, Pvul, Nhel, HindlU, Notl, Xhol, Sfil, Bam ⁇ l cloning site, inducible metallothionein Iia gene promoter, hygromycin selectable marker: Invitrogen), p
  • Selectable mammalian expression vectors for use in the invention include pRc/CMV (Hindm, BstXl, Notl, Sbal, and Apal cloning site, G418 selection; Invitrogen), pRc/RSV (Hindm, Spel, BstXl, Notl, Xbal cloning site, G418 selection; Invitrogen), and others.
  • Vaccinia virus mammalian expression vectors for use according to the invention include but are not limited to pSCl 1 (Smal cloning site, TK- and /3-gal selection), pMJ601 (Sail, Smal, Afil, Narl, BspMU, BamHl, Apal, Nhel, Sacll, Kpnl, and Hindlll cloning site; TK- and /3-gal selection), and pTKgptFIS (EcoRl, Pstl, Sail, Accl, HindR, Sbal, BamHl, and Hpa cloning site, TK or XPRT selection).
  • pSCl 1 Mal cloning site, TK- and /3-gal selection
  • pMJ601 Smal, Afil, Narl, BspMU, BamHl, Apal, Nhel, Sacll, Kpnl, and Hindlll cloning site
  • TKgptFIS
  • Yeast expression systems can also be used according to the invention to express GAVE 19 protein, a variant thereof, or an analog or derivative thereof.
  • the non-fusion pYES2 vector (Xbal, Sphl, Shol, Notl, GstXl, EcoRl, BstXl, BamHl, Sacl, Kpnl, and Hindlll cloning sit; Invitrogen) or the fusion pYESHisA, B, C (Xbal, Sphl, Shol, Notl, BstXl, EcoRl, BamHl, Sacl, Kpnl, and Hindm cloning site, N-termmal peptide purified with ProBond resin and cleaved with enterokinase; Invitrogen), to mention just two, can be employed according to the invention.
  • recombinant expression vectors can be propagated and prepared in quantity.
  • the expression vectors that can be used include, but are not limited to, the following vectors or their derivatives: human or animal viruses such as vaccinia virus or adenovirus; insect viruses such as baculovirus; yeast vectors; bacte ⁇ ophage vectors (e.g , lambda), and plasmid and cosmid DNA vectors, to name but a few.
  • a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired.
  • Different host cells have characteristic and specific mechanisms for the translational and post-translational processing and modification (e.g., glycosylation, cleavage [e.g., of signal sequence]) of proteins.
  • Appropriate cell lines or host systems can be chosen to ensure the desired modification and processing of the foreign protein expressed. For example, expression in a bacterial system can be used to produce an nonglycosylated core protein product.
  • a host cell of the present invention also can be used to produce transgemc animals.
  • a host cell of the invention is a fertilized oocyte or an embryonic stem cell into which GAVE19-cod ⁇ ng sequences have been introduced.
  • Such host cells then can be used to create non-human transgemc animals into which exogenous GAVE 19 sequences have been introduced into the genome, or homologous recombinant animals in which endogenous GAVE 19 sequences have been altered.
  • Such animals are useful for studying the function and/or activity of GAVE19 and for identifying and/or evaluating modulators of GAVE 19 activity.
  • transgemc animal is a non-human animal, preferably a mammal, in which one or more of the cells of the animal includes a transgene.
  • transgemc animals include non-human primates, sheep, dogs, cows, goats, chickens, rats, amphibians etc.
  • transgene refers to exogenous DNA that is integrated into the genome of a cell from which a transgemc animal develops and that remains in the genome of the mature animal.
  • the transgene directs the expression of an encoded gene product in one or more cell types or tissues of the transgemc animal
  • a "homologous recombinant animal” is a non-human animal, preferably a mammal, in which an endogenous GAVE 19 gene has been altered by homologous recombination. That is accomplished between the endogenous gene and an exogenous DNA molecule introduced into a cell of the animal, e g, an embryonic cell of the animal, prior to development of the animal.
  • a transgemc animal of the invention can be created by introducing a GAVE19-encodmg nucleic acid molecule into the male pronuclei of a fertilized oocyte using one of the transfection methods described above. The oocyte is then allowed to develop in a pseudopregnant female foster animal.
  • GAVE19 cDNA sequence e g that of (SEQ ED NO:l), for example, can be introduced as a transgene into the genome of a non-human animal. Intronic sequences and polyadenylation signals also can be included in the transgene to increase the efficiency of expression of the transgene.
  • a tissue-specific regulatory sequence(s) can be operably linked to the GAVE 19 transgene to direct expression of GAVE 19 protein in particular cells. Methods for generating transgemc animals via embryo manipulation and microinjection are conventional in the art and are described, for example, in U.S. Patent Nos. 4,736,866 and 4,870,009 and U.S. Patent No. 4,873,191.
  • transgemc animals with a transgene in the genome and/or expression of GAVE19 mRNA in tissues or cells of the animals.
  • a transgemc founder animal then can be used to breed additional animals carrying the transgene.
  • transgemc animals carrying a transgene encoding GAVE 19 can be bred further to other transgemc animals carrying other transgenes
  • a vector is prepared that contains at least a portion of a GAVE 19 gene into which a deletion, addition or substitution has been introduced thereby to alter, e.g, functionally disrupt, the GAVE19 gene.
  • the vector is designed such that, on homologous recombination, the endogenous GAVE19 gene is disrupted functionally (i.e., no longer encodes a functional protein; also referred to as a knock out" vector).
  • the vector can be designed such that, on homologous recombination, the endogenous GAVE 19 gene is mutated or otherwise altered but still encodes functional protein (e.g, the upstream regulatory region can be altered thereby to alter the expression of the endogenous GAVE 19 protein).
  • the altered portion of the GAVE 19 gene is flanked at the 5' and 3' ends by an additional nucleic acid sequence of the GAVE 19 gene to allow for homologous recombination to occur between the exogenous GAVE 19 gene carried by the vector and an endogenous GAVE 19 gene in an embryonic stem cell.
  • the additional flanking GAVE 19 nucleic acid sequence is of sufficient length for successful homologous recombination with the endogenous gene.
  • flanking DNA both at the 5' and 3' ends
  • flanking DNA are included in the vector (see, e.g, Thomas et al. Cell (1987) 51 :503 for a description of homologous recombination vectors).
  • the vector is introduced into an embryonic stem cell line (e.g, by electroporation) and cells in which the introduced GAVE 19 gene has homologously recombined with the endogenous GAVE 19 gene are selected (see, e.g, Li et al. Cell (1992) 69:915).
  • the selected cells then are injected into a blastocyst of an animal to form aggregation chimeras (see, e.g, Bradley in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, Robertson, ed, ERL, Oxford, (1987) pp. 113-152).
  • a chimenc embryo then can be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term.
  • Progeny harboring the homologously recombined DNA in the germ cells can be used to breed animals wherein all cells of the animal contain the homologously recombined DNA by germhne transmission of the transgene.
  • transgemc non-human animals can be produced that contain selected systems to allow for regulated expression of the transgene.
  • a system is the cre/loxP recombmase system of bactenophage PI.
  • cre/loxP recombmase system see, e.g, Lakso et al, Proc Natl Acad Sci USA (1992) 89.6232-6236.
  • FLP recombmase system is the FLP recombmase system of 5. cerevisiae (O'Gorrnan et al. Science (1991) 251 : 1351-1355).
  • mice containing transgenes encoding both the ere recombmase and a selected protein are required Such animals can be provided through the construction of "double" transgemc animals, e.g, by mating two transgemc animals, one containing a transgene encoding a selected protein and the other containing a transgene encoding a recombmase.
  • Clones of the non-human transgemc animals described herein also can be produced according to the methods described in Wilmut et al. Nature (1997) 385:810-813 and PCT Publication Nos. WO 97/07668 and WO 97/07669.
  • a cell e.g, a somatic cell
  • the quiescent cell then can be fused, e.g, through the use of electrical pulses, to an enucleated oocyte from an animal of the same species from which the quiescent cell is isolated.
  • the reconstructed oocyte then is cultured such that it develops to morula or blastocyte, and then is transferred to a pseudopregnant female foster animal.
  • the offspring borne of the female foster animal will be a clone of the animal from that the cell, e.g, the somatic cell, is isolated.
  • nucleic acid molecules, proteins, protein homologues, antibodies of the present invention, and fragments of such moieties may be used in one or more of the following methods: a) screening assays; b) detection assays (e.g, chromosomal mapping, tissue typing, forensic biology); c) predictive medicine (e.g, diagnostic assays, prognostic assays, monitoring clinical trials and pharmacogenomics), and d) methods of treatment (e.g , therapeutic and prophylactic).
  • a GAVE19 protein interacts with other cellular proteins, and thus can be used for (I) regulation of cellular proliferation; (n) regulation of cellular differentiation, and (in) regulation of cell survival.
  • the isolated nucleic acid molecules of the invention can be used to express GAVE19 protein (e.g, via a recombinant expression vector in a host cell in gene therapy applications), to detect GAVE 19 mRNA (e.g, in a biological sample) or to detect a genetic lesion in a GAVE19 gene and to modulate GAVE 19 activity.
  • a GAVE 19 protein can be used to screen drugs or compounds that modulate GAVE 19 activity or expression. Such drugs or compounds may readily have applications in treating diseases inflammatory diseases such as rheumatoid arthritis, COPD, etc. Screening for the production of GAVE 19 protein forms that have decreased or aberrant activity compared to GAVE 19 wild type protein can also be performed with the present invention.
  • an ant ⁇ -GAVE19 antibody of the invention can be used to detect and to isolate GAVE 19 proteins and to modulate GAVE19 activity.
  • the invention further pertains to novel agents identified by the above-described screening assays and uses thereof for treatments as described herein Screening Assays
  • G protein receptor complex formation Activation of a G protein receptor in the presence of endogenous ligand allows for G protein receptor complex formation, thereupon leading to the binding of GTP to the G protein.
  • the GTPase domain of the G protein slowly hydrolyzes the GTP to GDP resulting, under normal conditions, in receptor deactivation. However, constitutively activated receptors continue to hydrolyze GDP to GTP.
  • a non-hydrolyzable substrate of G protein [ S]GTP ⁇ S
  • [ S]GTP ⁇ S can be used to monitor enhanced binding to membranes which express constitutively activated receptors.
  • Traynor and Nahorski reported that [ S]GTP ⁇ S can be used to monitor G protein coupling to membranes in the absence and presence of ligand (Traynor et al, Mol Pharmacol (1995) 47(4).848-54).
  • a preferred use of such an assay system is for initial screening of candidate compounds, since the system is gene ⁇ cally applicable to all G protein-coupled receptors without regard to the particular G protein that binds to the receptor.
  • G S 2o stimulates the enzyme adenylyl cyclase, while G, and G 0 inhibit that enzyme.
  • adenylyl cyclase catalyzes the conversion of ATP to cAMP; thus, constitutively activated GPCRs that couple the G s protein are associated with increased cellular levels of cAMP.
  • constitutively activated GCPRs that might couple the G, (or G 0 ) protein are associated with decreased cellular levels of cAMP. See “Indirect Mechanism of Synaptic Transmission", Chpt. 8, from Neuron to Bram (3 rd Ed.), Nichols et al. eds, Smauer Associates, Inc, 1992.
  • assays that detect cAMP can be used to determine if a candidate compound is an inverse agonist to the receptor.
  • a variety of approaches known in the art for measuring c AMP can be utilized.
  • anti-cAMP antibodies are used in an ELISA-based format.
  • a whole cell second messenger reporter system assay is contemplated (see PCT Publication No. WO 00/22131).
  • cyclic AMP drives gene expression by promoting the binding of a cAMP- responsive DNA binding protein or transcription factor (CREB) which then binds to the promoter at specific sites called cAMP response elements, and drives the expression of the gene
  • CREB cAMP- responsive DNA binding protein or transcription factor
  • reporter systems can be constructed which have a promoter containing multiple cAMP response elements before the reporter gene, e.g, /3-galactos ⁇ dase or luciferase. Further, as a constitutively activated
  • G s -lmked receptor causes the accumulation of cAMP, that then activates the gene and expression of the reporter protein.
  • the reporter protein such as /3-galactos ⁇ dase or luciferase, then can be detected using standard biochemical assays (PCT Publication No. WO 00/22131).
  • G proteins such as G 0 and G q , are associated with activation of the enzyme phosphohpase C, which in turn hydrolyzes the phospholipid, PEP2, releasing two intracellular messengers: diacylglycerol (DAG) and inositol 1,4,5-t ⁇ phosphate (EP3).
  • DAG diacylglycerol
  • EP3 inositol 1,4,5-t ⁇ phosphate
  • Increased accumulation of EP3 is associated with activation of G q -assoc ⁇ ated receptors and Go-associated receptors (PCT Publication No. WO 00/22131).
  • Assays that detect EP3 accumulation can be used to determine if a candidate compound is an inverse agonist to a G q -assoc ⁇ ated receptor or a G 0 -associated receptor.
  • G q -assoc ⁇ ated receptors also can be examined using an API reporter assays that measures whether G q -dependent phosphohpase C causes activation of genes containing API elements.
  • activated G q -assoc ⁇ ated receptors will demonstrate an increase in the expression of such genes, whereby inverse agonists will demonstrate a decrease in such expression.
  • modulators i.e., candidate or test compounds or agents (e.g, peptides, peptidomimetics, small molecules or other drugs) that bind to GAVE 19 proteins or have a stimulatory or inhibitory effect on, for example, GAVE 19 expression or GAVE 19 activity.
  • modulators i.e., candidate or test compounds or agents (e.g, peptides, peptidomimetics, small molecules or other drugs) that bind to GAVE 19 proteins or have a stimulatory or inhibitory effect on, for example, GAVE 19 expression or GAVE 19 activity.
  • the invention provides assays for screening candidate or test compounds that bind to or modulate the activity of the membrane -bound form of a GAVE 19 protein, polypeptide or biologically active portion thereof
  • the test compounds of the instant invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the "one-bead one-compound” library method; and synthetic library methods using affinity chromatography selection.
  • the biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, Anticancer Drug Des (1997) 12:145).
  • an assay is a cell-based assay in which a cell that expresses a membrane-bound form of GAVE 19 protein, or a biologically active portion thereof, on the cell surface is contacted with a test compound and the ability of the test compound to bind to a GAVE 19 protein is determined.
  • the cell for example, can be a yeast cell or a cell of mammalian origin. Determining the ability of the test compound to bind to the GAVE 19 protein can be accomplished, for example, by coupling the test compound with a radioisotope or enzymatic label so that binding of the test compound to the GAVE 19 protein or biologically active portion thereof can be determined by detecting the labeled compound in a complex.
  • test compounds can be labeled with l25 1, 35 S, 14 C or 3 H, either directly or indirectly and the radioisotope detected by direct counting of radioemmission or by scintillation counting.
  • test compounds can be labeled enzymatically with, for example, horseradish peroxidase, alkaline phosphatase or luciferase and the enzymatic label detected by determination of conversion of an appropriate substrate to product.
  • the assay comprises contacting a cell that expresses a membrane-bound form of GAVE 19 protein or a biologically active portion thereof, on the cell surface with a known compound that binds GAVE 19 to form an assay mixture, contacting the assay mixture with a test compound and determining the ability of the test compound to interact with a GAVE 19 protein, wherein determining the ability of the test compound to interact with a GAVE 19 protein comprises determining the ability of the test compound to bind preferentially to GAVE 19 or a biologically active portion thereof as compared to the known compound.
  • an assay is a cell-based assay comprising contacting a cell expressing a membrane-bound form of GAVE 19 protein or a biologically active portion thereof, on the cell surface with a test compound and determining the ability of the test compound to modulate (e g, stimulate or inhibit) the activity of the GAVE 19 protein or biologically active portion thereof. Determining the ability of the test compound to modulate the activity of GAVE 19 or a biologically active portion thereof can be accomplished, for example, by determining the ability of the GAVE 19 protein to bind to or to interact with a GAVE19 target molecule.
  • a "target molecule” is a molecule with which a GAVE 19 protein binds or interacts in nature, for example, a molecule on the surface of a cell that expresses a GAVE 19 protein, a molecule on the surface of a second cell, a molecule in the extracellular milieu, a molecule associated with the internal surface of a cell membrane or a cytoplasmic molecule
  • a GAVE 19 target molecule can be a non-GAVE 19 molecule or a GAVE 19 protein or polypeptide of the instant invention.
  • a GAVE 19 target molecule is a component of a signal transduction pathway that facilitates transduction of an extracellular signal (e.g, a signal generated by binding of a compound to a membrane-bound GAVE 19 molecule) through the cell membrane and into the cell.
  • the target for example, can be a second intercellular protein that has catalytic activity or a protein that facilitates the association of downstream signaling molecules
  • Determining the ability of the GAVE 19 protein to bind to or to interact with a GAVE 19 target molecule can be accomplished by one of the methods described above for determining direct binding
  • determining the ability of the GAVE 19 protein to bind to or to interact with a GAVE 19 target molecule can be accomplished by determining the activity of the target molecule.
  • the activity of the target molecule can be determined by detecting induction of a cellular second messenger of the target (e.g, intracellular Ca + , diacylglycerol, EP3 etc.), detecting catalytic/enzymatic activity of the target on an appropriate substrate, detecting the induction of a reporter gene (e.g, a GAVE19-respons ⁇ ve regulatory element operably linked to a nucleic acid encoding a detectable marker, e.g. luciferase) or detecting a cellular response, e.g, cellular differentiation or cell proliferation.
  • a reporter gene e.g, a GAVE19-respons ⁇ ve regulatory element operably linked to a nucleic acid encoding a detectable marker, e.g. luciferase
  • a cellular response e.g, cellular differentiation or cell proliferation.
  • the present invention further extends to a cell-free assay comprising contacting a GAVE19 protein, or biologically active portion thereof, with a test compound, and determining the ability of the test compound to bind to the GAVE 19 protein or biologically active portion thereof Binding of the test compound to the GAVE 19 protein can be determined either directly or indirectly as described above
  • the assay includes contacting the GAVE 19 protein or biologically active portion thereof with a known compound that binds GAVE 19 to form an assay mixture, contacting the assay mixture with a test compound, and determining the ability of the test compound to interact with a GAVE19 protein, wherein determining the ability of the test compound to interact with a GAVE19 protein comprises determining the ability of the test compound to preferentially bind to GAVE 19 or biologically active portion thereof as compared to the known compound.
  • Another cell-free assay of the present invention involves contacting GAVE 19 protein or biologically active portion thereof, with a test compound and determining the ability of the test compound to modulate (e.g, stimulate or inhibit) the activity of the GAVE 19 protein or biologically active portion thereof. Determining the ability of the test compound to modulate the activity of GAVE 19 can be accomplished, for example, by determining the ability of the GAVE 19 protein to bind to a GAVE 19 target molecule by one of the methods described above for determining direct binding. In an alternative embodiment, determining the ability of the test compound to modulate the activity of GAVE 19 can be accomplished by determining the ability of the GAVE 19 protein to further modulate a GAVE 19 target molecule. For example, the catalytic/enzymatic activity of the target molecule on an appropriate substrate can be determined as described previously.
  • Still another cell-free assay of the present invention comprises contacting the GAVE 19 protein or biologically active portion thereof, with a known compound that binds GAVE 19 to form an assay mixture, contacting the assay mixture with a test compound and determining the ability of the test compound to interact with a GAVE 19 protein.
  • the step for determining the ability of the test compound to interact with a GAVE19 protein comprises determining the ability of the GAVE19 protein preferentially to bind to or to modulate the activity of a GAVE 19 target molecule
  • Receptors can be activated by non-hgand molecules that necessarily do not inhibit ligand binding but cause structural changes in the receptor to enable G protein binding or, perhaps receptor aggregation, dimerization or clustering that can cause activation.
  • antibodies can be raised to the various portions of GAVE 19 that are exposed at the cell surface. Those antibodies activate a cell via the G protein cascade as determined by standard assays, such as monitoring cAMP levels or intracellular Ca + levels. Because molecular mapping, and particularly epitope mapping, is involved, monoclonal antibodies may be preferred. The monoclonal antibodies can be raised both to mtact receptor expressed at the cell surface and peptides known to form at the cell surface The method of Geysen et al, U.S. Pat. No. 5,998,577, can be practiced to obtain a plurality of relevant peptides
  • Antibodies found to activate GAVE 19 may be modified to minimize activities extraneous to GAVE 19 activation, such as complement fixation.
  • the antibody molecules can be truncated or mutated to minimize or to remove activities outside of GAVE 19 activation. For example, for certain antibodies, only the antigen-binding portion is needed. Thus, the F c portion of the antibody can be removed.
  • Cells expressing GAVE 19 are exposed to antibody to activate GAVE 19. Activated cells then are exposed to various molecules in order to identify which molecules modulate receptor activity, and result in higher activation levels or lower activation levels. Molecules that achieve those goals then can be tested on cells expressing GAVE 19 without antibody to observe the effect on non-activated cells. The target molecules then can be tested and modified as candidate drugs for the treatment of disorders associated with altered GPCR metabolism using known techniques.
  • the cell-free assays of the instant invention are amenable for use of both the soluble form and the membrane-bound form of GAVE 19.
  • non-ionic detergents such
  • binding of a test compound to GAVE 19 or interaction of GAVE 19 with a target molecule in the presence and absence of a candidate compound can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtitre plates, test tubes and micro-centrifuge tubes.
  • a fusion protein can be provided that adds a domain that allows one or both of the proteins to be bound to a matrix.
  • glutath ⁇ one-S-transferase/GAVE19 fusion proteins or glutathione-S-transferase/target fusion proteins can be adsorbed onto glutathione SEPHAROSE beads (Sigma Chemical, St. Louis, MO).
  • glutathione-denvatized microtitre plates are then combined with the test compound. Subsequently, either the non-adsorbed target protein or GAVE 19 protein and the mixture are incubated under conditions conducive to complex formation (e.g, at physiological conditions for salt and pH). Following incubation, the beads or microtitre plate wells are washed to remove any unbound components, and the presence of complex formation is measured either directly or indirectly.
  • the complexes can be dissociated from the matrix and the level of GAVE 19 binding or activity determined using standard techniques.
  • GAVE 19 or a target molecule thereof can be immobilized utilizing conjugation of biotm and streptavidin.
  • Biotinylated GAVE19 or target molecules can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques well known in the art (e.g, biotinylation kit, Pierce Chemicals, Rockford, IL) and immobilized in the wells of streptavidm-coated 96-well plates (Pierce Chemicals).
  • antibodies that are reactive with GAVE 19 or a target molecule, but do not interfere with binding of the GAVE 19 protein to the target molecule can be derivatized to the wells of the plate. Upon incubation, unbound target or GAVE 19 can be trapped in the wells by antibody conjugation.
  • Methods for detecting such complexes include immunodetection of complexes using antibodies reactive with GAVE 19 or target molecule, as well as enzyme-linked assays that rely on detecting an enzymatic activity associated with the GAVE 19 or target molecule.
  • modulators of GAVE 19 expression are identified in a method wherein a cell is contacted with a candidate compound, and the expression of GAVE 19 mRNA or protein in the cell is determined. The level of expression of GAVE 19 mRNA or protein in the presence of the candidate compound is compared to the level of expression of GAVE 19 mRNA or protein in the absence of the candidate compound. The candidate compound then can be identified as a modulator of GAVE 19 expression based on that comparison For example, when expression of GAVE 19 mRNA or protein is greater (statistically significantly greater) in the presence of the candidate compound than in the absence thereof, the candidate compound is identified as a stimulator or agonist of GAVE19 mRNA or protein expression.
  • the candidate compound when expression of GAVE19 mRNA or protein is less (statistically significantly less) in the presence of the candidate compound than in the absence thereof, the candidate compound is identified as an inhibitor or antagonist of GAVE19 mRNA or protein expression. If GAVE19 activity is reduced in the presence of ligand or agonist, or in a constitutive GAVE 19, below baseline, the candidate compound is identified as an inverse agonist.
  • the level of GAVE 19 mRNA or protein expression in the cells can be determined by methods described herein for detecting GAVE 19 mRNA or protein.
  • the GAVE 19 proteins can be used as "bait proteins" in a two-hybrid assay or three-hybrid assay (see, e.g, U.S. Patent No. 5,283,317; Zervos et al. Cell (1993) 72-223-232; Madura et al, J Biol Chem (1993) 268:12046-12054; Bartel et al, Bio/Techniques (1993) 14:920-924; Iwabuchi et al, Oncogene (1993) 8: 1693-1696; and PCT Publication No.
  • GAVE19-b ⁇ ndmg proteins or "GAVE 19-bp”
  • GAVE 19-bp proteins that bind to or interact with GAVE 19
  • GAVE 19-bmd ⁇ ng proteins are also likely to be involved in the propagation of signals by the GAVE 19 proteins such as, for example, upstream or downstream elements of the GAVE 19 pathway.
  • the present invention enables the production of large quantities of pure GAVE 19, physical characterization of the conformation of areas of likely function can be ascertained for rational drug design.
  • the IC3 region of the molecule and EC domains are regions of particular interest Once the shape and ionic configuration of a region is discerned, candidate drugs that should interact with those regions can be configured and then tested in intact cells, animals and patients. Methods that would enable deriving such 3-D structure information include X-ray crystallography, NMR spectroscopy, molecular modeling and so on.
  • the 3-D structure also can lead to identification of analogous conformational sites in other known proteins where known drugs that act at site exist. Those drugs, or derivatives thereof, may find use in treating inflammatory diseases or disorders such as rheumatoid arthritis or COPD, to name only a few
  • the invention further pertains to novel agents identified by the above-described screening assays and uses thereof for treatments as described herein.
  • Detection Assays Portions or fragments of the DNA sequences of the present invention can be used in numerous ways as polynucleotide reagents. For example, the sequences can be used to: (I) map the respective genes on a chromosome and, thus, locate gene regions associated with genetic disease; (n) identify an individual from a minute biological sample (tissue typing); and (in) aid in forensic identification of a biological sample.
  • the applications are described in the subsections below.
  • the sequence can be used to map the location of the GAVE 19 gene on a chromosome. Accordingly, GAVE 19 nucleic acid molecules described herein or fragments thereof can been used to map the location of GAVE 19 in a genome. The mapping of the location of the GAVE 19 sequence in a genome is an important step in correlating the sequences with genes associated with disease.
  • GAVE 19 genes can be mapped in a genome by preparing PCR primers (preferably 15-25 bp in length) from the GAVE 19 sequences The primers are used for PCR screening of somatic cell hybrids containing individual murine chromosomes. Only those hybrids containing the murine gene corresponding to the GAVE 19 sequences yield an amplified fragment.
  • a particular method includes, but certainly is not limited to denaturing murine chromosomes and then contacting them with a detectably labeled GAVE 19 DNA molecule under stringent hybridization conditions. Hybridization and subsequent detection of the detectably labeled GAVE 19 DNA molecule will reveal the location of GAVE 19 in the murine chromosome.
  • Such an in situ hybridization technique is described in Fan et al, Proc Natl Acad Sci USA (1990) 87:6223-27, which involves pre-screening with labeled flow-sorted chromosomes and pre-selection by hybridization to chromosome-specific cDNA libraries.
  • the in situ hybridization (FISH) of a DNA sequence to a metaphase chromosomal spread can also be used to provide a precise chromosomal location in one step.
  • Chromosome spreads can be made using cells in which division has been blocked in metaphase by a chemical, e.g, colcemid, that disrupts the mitotic spindle.
  • the chromosomes can be treated briefly with trypsin and then stained with Giemsa. A pattern of light and dark bands develops on each chromosome so that the chromosomes can be identified individually.
  • the FISH technique can be used with a DNA sequence as short as 500 or 600 bases.
  • clones larger than 1,000 bases have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection.
  • 1,000 bases and more preferably, 2,000 bases will suffice to get good results in a reasonable amount of time.
  • Chromosomal mapping can be inferred in silico, and employing statistical considerations, such as lod scores or mere proximity.
  • Reagents for chromosome mapping can be used individually to locate a single site on a chromosome. Furthermore, panels of reagents can be used for marking multiple sites and/or multiple chromosomes. Reagents corresponding to flanking regions of the GAVE 19 gene actually are preferred for mapping purposes. Coding sequences are more likely to be conserved within gene families, thus increasing the chance of cross hybridization during chromosomal mapping.
  • differences in the DNA sequences between animals affected and unaffected with a disease associated with GAVE 19 can be determined. If a mutation is observed in some or all of the affected animals, but not in any unaffected animals, then the mutation is likely to be the causative agent of the particular disease. Comparison of affected and unaffected animals generally involves first looking for structural alterations in the chromosomes such as deletions or translocations that are visible from chromosome spreads or detectable using PCR based on that DNA sequence. Ultimately, complete sequencing of genes from several animals can be performed to confirm the presence of a mutation and to distinguish mutations from polymorphisms. 1. Diagnostic Assays
  • An exemplary method for detecting the presence or absence of GAVE 19 in a biological sample involves obtaining a biological sample from a test animal and contacting the biological sample with a compound or an agent capable of detecting GAVE19 protein or nucleic acid (e.g, mRNA or genomic DNA) that encodes GAVE 19 protein such that the presence of GAVE 19 is detected m the biological sample
  • a preferred agent for detecting GAVE 19 mRNA or genomic DNA is a labeled nucleic acid probe capable of hybridizing to GAVE 19 mRNA or genomic DNA.
  • the nucleic acid probe can be, for example, a full-length GAVE 19 nucleic acid, such as the nucleic acid of SEQ ED NO: 1 or a portion thereof, such as an ohgonucleotide of at least 15, 30, 50, 100, 250 or 500 or more nucleotides in length and sufficient to specifically hybridize under stringent conditions to GAVE 19 mRNA or genomic DNA.
  • a full-length GAVE 19 nucleic acid such as the nucleic acid of SEQ ED NO: 1 or a portion thereof, such as an ohgonucleotide of at least 15, 30, 50, 100, 250 or 500 or more nucleotides in length and sufficient to specifically hybridize under stringent conditions to GAVE 19 mRNA or genomic DNA.
  • Other suitable probes for use in the diagnostic assays of the invention are described herein.
  • a particular agent for detecting GAVE 19 protein is an antibody capable of binding to GAVE 19 protein, preferably an antibody with a detectable label.
  • Antibodies can be polyclonal, chimenc, or more preferably, monoclonal. An intact antibody or a fragment thereof (e.g, F a b or F( a b') 2 ) ca be used.
  • the term "biological sample” is intended to include tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject. That is, the detection method of the invention can be used to detect GAVE 19 mRNA, protein or genomic DNA in a biological sample in vitro as well as in vivo.
  • in vitro techniques for detection of GAVE 19 mRNA include Northern hybridization and in situ hybridization.
  • In vitro techniques for detection of GAVE19 protein include ELISA, Western blot, lmmunoprecipitation and immunofluorescence.
  • In vitro techniques for detection of GAVE 19 genomic DNA include Southern hybridization.
  • in vivo techniques for detection of GAVE 19 protein include introducing into an animal a labeled anti -GAVE 19 antibody
  • the antibody can be labeled with a radioactive marker, the presence and location of which in an animal can be detected by standard imaging techniques.
  • the biological sample contains protein molecules from the test animal.
  • the biological sample can contain mRNA molecules from the test animal or genomic DNA molecules from the test animal.
  • a particular biological sample having applications herein is a peripheral blood leukocyte sample isolated by conventional means from an animal.
  • the methods further involve obtaining a biological sample from a control animal, contacting the control sample with a compound or agent capable of detecting GAVE 19 protein, mRNA or genomic DNA, such that the presence and amount of GAVE19 protein, mRNA or genomic DNA is detected in the biological sample, and then comparing the presence and amount of GAVE 19 protein, mRNA or genomic DNA in the control sample with the presence and amount of GAVE 19 protein, mRNA or genomic DNA in a test sample to determine whether the compound modulates the expression or activity of GAVE 19.
  • High throughput assays of chemical libraries Any of the assays for compounds capable of modulating the activity of GAVE 19 are amenable to high throughput screening.
  • High throughput screening systems are commercially available (see, e.g., Zymark Corp, Hopkmton, MA; Air Technical Industries, Mentor, OH; Beckman Instruments, Inc. Fullerton, CA; Precision Systems, Inc., Natick, MA, etc ). These systems typically automate entire procedures including all sample and reagent pipetting, liquid dispensing, timed incubations, and final readings of the microplate in detector(s) appropriate for the assay.
  • These configurable systems provide high throughput and rapid start up as well as a high degree of flexibility and customization. The manufacturers of such systems provide detailed protocols the various high throughput.
  • Zymark Corp. provides technical bulletins describing screening systems for detecting the modulation of gene transcription, ligand binding, and the like.
  • kits for detecting the presence of GAVE19 in a biological sample can be used to determine whether a particular compound modulates the expression or activity of GAVE 19.
  • the kit can comprise a labeled compound or agent capable of detecting GAVE 19 protein or mRNA in a biological sample and means for determining the amount of GAVE19 in the sample (e.g, an ant ⁇ -GAVE19 antibody or an ohgonucleotide probe that binds to DNA encoding GAVE19, e.g, SEQ ID NO: l).
  • the kit can comprise, for example: (1) a first antibody (e.g, attached to a solid support) that binds to GAVE 19 protein; and, optionally, (2) a second, different antibody that binds to GAVE 19 protein or to the first antibody and is conjugated to a detectable agent. If the second antibody is not present, then either the first antibody can be detectably labeled, or alternatively, another molecule that binds the first antibody can be detectably labeled. In any event, a labeled binding moiety is included to serve as the detectable reporter molecule, as known in the art.
  • a kit of the present invention can comprise, for example: (1) an ohgonucleotide, e.g, a detectably-labeled ohgonucleotide, that hybridizes to a GAVE19 nucleic acid sequence or (2) a pair of primers useful for amplifying a GAVE19 nucleic acid molecule.
  • the kit also can comprise, e.g, a buffering agent, a preservative or a protein stabilizing agent.
  • the kit also can comprise components necessary for detecting the detectable agent (e.g, an enzyme or a substrate).
  • the kit may also contain a control sample or series of control samples that can be assayed and compared to the test sample.
  • Each component of the kit is usually enclosed with an individual container, and all of the various containers are withm a single package.
  • GAVE 19 expression is modulated in cells associated with activated or inflammatory states.
  • Disorders associated with inflammation include, anaphylactic states, colitis, Crohn's Disease, edematous states, contact hypersensitivity, allergy, other forms of arthritis, meningitis and other conditions wherein the immune system reacts to an insult by vascular dilation, heat, collecting cells, fluids and the like at a site resulting in swelling and the like.
  • agents or modulators that have a stimulatory or inhibitory effect on GAVE 19 activity can be administered to individuals to treat (prophylactically or therapeutically) disorders (e.g, inflammation associated with asthma, chronic obstructive pulmonary disease and rheumatoid arthritis).
  • disorders e.g, inflammation associated with asthma, chronic obstructive pulmonary disease and rheumatoid arthritis.
  • the pharmacogenomics i.e., the study of the relationship between the genotype of an individual and the response of the individual to a foreign compound or drug
  • the individual may be considered.
  • the pharmacogenomics of the individual permits the selection of effective agents (e.g, drugs) for prophylactic or therapeutic treatments based on a consideration of the genotype of the individual. Such pharmacogenomics further can be used to determine appropriate dosages and therapeutic regimens.
  • Pharmacogenomics deals with clinically significant hereditary variations in the response to drugs due to altered drug disposition and abnormal action in affected persons. See, e.g, Lmder, Clm Chem (1997) 43(2):254-266. In general, two types of pharmacogenetic conditions can be differentiated.
  • G6PD glucose-6-phosphate dehydrogenase deficiency
  • the activity of drug metabolizing enzymes is a major determinant of both the intensity and duration of drug action
  • drug metabolizing enzymes e.g, N-acetyltransferase 2 (NAT 2) and cytochrome P450 enzymes, CYP2D6 and CYP2C1 9)
  • NAT 2 N-acetyltransferase 2
  • CYP2D6 and CYP2C1 cytochrome P450 enzymes
  • the polymorphisms are expressed in two phenotypes in the population, the extensive metabohzer (EM) and poor metabohzer (PM). The prevalence of PM is different among different populations.
  • CYP2D6 the gene coding for CYP2D6 is highly polymorphic and several mutations have been identified in PM, all which lead to the absence of functional CYP2D6. Poor metabohzers of CYP2D6 and CYP2C1 9 quite frequently experience exaggerated drug response and side effects when standard doses are received. If a metabolite is the active therapeutic moiety, a PM will show no therapeutic response, as demonstrated for the analgesic effect of codeine mediated by the
  • CYP2D6-formed metabolite morphine.
  • the other extreme is the so-called ultra-rapid metabohzers that do not respond to standard doses.
  • ultra-rapid metabohzers that do not respond to standard doses.
  • ultra-rapid metabolism has been identified to be due to CYP2D6 gene amplification.
  • Activity of a homolog of GAVE 19 protein, or expression of a DNA molecule that is a homolog of GAVE 19 nucleic acid in an individual can be determined to select thereby appropriate agent(s) for therapeutic or prophylactic treatment of the individual.
  • pharmacogenetic studies can be used to apply geno typing of polymorphic alleles encoding drug-metabolizing enzymes to the identification of the drug responsiveness phenotype of an individual. That knowledge, when applied to dosing or drug selection, can avoid adverse reactions or therapeutic failure and thus enhance therapeutic or prophylactic efficiency when treating a subject with a GAVE 19 modulator, such as a modulator identified by one of the exemplary screening assays described herein.
  • the present invention extends to assays for identifying drugs or agents that modulate the expression of GAVE19 in mice.
  • Due to the expression profile of GAVE19 i.e. is highly expressed in normal spleen, has an expression level that is increased two fold relative to normal spleen in collagen induced arthritis (CIA) RA mouse spleen, and has an expression level elevated over five- fold in CIA RA mouse lung compared with normal lung, such drugs or agents may readily have applications in treating diseases or disorders such as inflammatory disorders (e.g. asthma), chronic obstructive pulmonary disease and rheumatoid arthritis, to name only a few.
  • diseases or disorders e.g. asthma
  • chronic obstructive pulmonary disease e.g. asthma
  • rheumatoid arthritis e.g. asthma
  • the invention provides a method for preventing in a subject, a disease or condition such as those described above, by administering to the subject an agent that modulates GAVE19 expression or at least one GAVE19 activity.
  • Subjects that may benefit from such treatment can be identified by, for example, any or a combination of diagnostic or prognostic assays well known to those of ordinary skill in the art.
  • Administration of a prophylactic agent can occur prior to the manifestation of symptoms for such a disease or disorder in order to prevent the disease or disorder, or alternatively to delay its progression.
  • An agent that can used for treating inflammatory diseases i.e., that is found to modulate GAVE19 protein activity in mice, can be an agent as described herein, such as a nucleic acid or a protein, a naturally-occurring cognate ligand of a GAVE 19 protein, a peptide, a GAVE 19 peptidomimetic or other small molecule.
  • the agent stimulates one or more of the biological activities of GAVE 19 protein. Examples of such stimulatory agents include active GAVE 19 protein and a nucleic acid molecule encoding GAVE 19 that has been introduced into the cell.
  • the agent inhibits one or more of the biological activities of GAVE 19 protein.
  • inhibitory agents include antisense GAVE 19 nucleic acid molecules and ant ⁇ -GAVE19 antibodies.
  • the modulatory methods can be performed in vitro (e.g, by cultu ⁇ ng the cell with the agent) or, alternatively, in vivo (e.g, by administering the agent to a subject).
  • the instant invention provides methods of treating an individual afflicted with a disease or disorder as described above that comprises administering to the individual an agent (e.g, an agent identified by a screening assay described herein) or combination of agents that modulates (e.g, upregulates or downregulates) GAVE 19 expression or activity in mice.
  • the method involves administering a GAVE 19 protein or nucleic acid molecule as therapy.
  • the present invention may be better understood by reference to the following non-limiting Example, which is provided as exemplary of the invention.
  • the following Example is presented in order to more fully illustrate the preferred embodiments of the invention. It should in no way be construed, however, as limiting the broad scope of the invention.
  • EXAMPLE The large number of G-protein coupled receptors are the target of -50% of the current therapeutic drugs on the market.
  • the GPCRs are activated by a wide variety of ligands, including peptide, neurotransmitters, hormones, growth factors, amines, lipids, fatty acids, odorant molecules and hgts. The perturbation of GPCR function results in many pathological conditions.
  • GAVE19 the ortholog of human GAVE 18, is highly expressed in normal spleen, has an expression level that is increased two fold relative to normal spleen in collagen induced arthritis (CIA) RA mouse spleen, and has an expression level elevated over five-fold in CIA RA mouse lung compared with normal lung.
  • GAVE 19 provides a new drug target drugs or agents for treating diseases or disorders such as inflammatory disorders (e.g. asthma), chronic obstructive pulmonary disease and rheumatoid arthritis, to name only a few.
  • GAVE 19 also provides the opportunity to find the endogenous ligand through a process sketchde-orphan ⁇ ng".
  • Natural ligand or surrogate ligand identified through de-orphanmg provides a tool for screening some molecules which activate or block the receptor signal transduction, and therefore change the cellular physiology and cell function.
  • Mouse disease models and RNA isolation Mouse total RNAs isolated from different tissues and organs are performed with T ⁇ zol reagent from GIBCO BLR according manufactory instruction. The total RNAs were converted to cDNAs by using Multiscnbe RT-PCR kit from ABE
  • TaqMan analysis TaqMan reactions are performed in duplicate with mouse tissue cDNA and GAPDH gene is used as an internal control. TaqMan results are then calculated as relative expression. The relative expression equals (2 ⁇ (0-ddCt))*1000, where ddCT equals (GAVE19 mean Cts- GAPDH mean Cts) - (GAVE 19 mean NTC Cts- GAPDH mean NTC Cts).
  • TaqMan probe was custom synthesized by Operon Technologies.
  • TaqMan primer sequence 1 5' CTGTTCTTGCTGGTGAAAATGAA 3' (SEQ ID NO:4) and sequence 2: 5' CCATGAACCACCACGAGGTT 3 ' (SEQ ED N0.5).
  • TaqMan probe sequence 5 ' (Fam)- TCACGTTCAGTGACCACCATGGCTG-(Tet) 3 ' (SEQ ED NO:6). TaqMan reaction was performed in a 96-well plate MicroAmp optical tube (PE).
  • PE MicroAmp optical tube
  • TaqMan expression profile showed gradualy increased expression levels of GAVE 19 in the joints of CIA RA model from normal controled sample to RA grade 4. The higher RA grade in the joints correlates higher GAVE 19 expression GAVE 19 also showed dramatically increased expression levels in CIA RA lung and spleen to compare with normal controled lung and spleen.
  • GAVE 19 showed increased expression level in the brain during the EAE peak stage to compare with the expression level m the bram during prechnic stage.
  • GAVE 19 A novel mouse G-protem coupled receptor, GAVE 19, which is the ortholog of human GAVE 18 has been identified and cloned. Full-length coding region of the DNA and its deduced ammo acid sequence have been characterized. Tissue distribution of the receptor has been analyszed by RT-PCR (TaqMan) analyses in normal controled mice and collegen induced arthritis (CIA) mice. Expression profiles of GAVE 19 show the similarities to GAVE 18 (the human ortholog) and clearly indicate its roles in inflammation diseases such as rheumatoid arthritis. Hence, using various assays described herein, GAVE 19 provides a new drug target for inflammation diseases, such as asthma, RA, COPD, etc. Moreover, compounds and agents found with assays of the present invention to modulate the expression and/or activity of GAVE19 in mice may readily applications in treating such diseases

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pulmonology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Rheumatology (AREA)
  • Neurology (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Cardiology (AREA)
  • Neurosurgery (AREA)
  • Pain & Pain Management (AREA)
  • Hematology (AREA)
  • Dermatology (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Diabetes (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Provided herein is a novel and useful G-protein coupled receptor that is involved in signal transduction with respect to inflammation and physiological immunological response. Also provided are methods of using the receptor to screen for molecules that may modulate the activity of the receptor. Such molecules may readily have applications in treating a plethora of inflammation and immunologically related diseases and disorders.

Description

A NT ICT .F.TC A GTT) FNCDDTNO A G-PR OTFXN-COT TPT FD PFCFPTOR ANT) TTSFS THEREOF
FTF.T D OF THF TNVFNTTON
The present invention relates generally to a novel nucleic acid molecule that encodes for GAVE 19, a heretofore unknown G-protein-coupled receptor, along with uses of the nucleic acid molecule and GAVE 19.
BAC OUND OF THF TNVF.NTTON The G protein-coupled receptors (GPCRs) are a large family of integral membrane proteins that are involved in cellular signal transduction. GPCRs respond to a variety of extracellular signals, including neurotransmitters, hormones, odorants and light, and are capable of transducing signals so as to initiate a second messenger response within the cell. Many therapeutic drugs target GPCRs because those receptors mediate a wide variety of physiological responses, including inflammation, vasodilation, heart rate, bronchodilation, endocrine secretion and peristalsis.
GPCRs are characterized by extracellular domains, seven transmembrane domains and intracellular domains. Some of the functions the receptors perform, such as binding ligands and interacting with G proteins, are related to the presence of certain amino acids in critical positions. For example, a variety of studies have shown that differences in amino acid sequence in GPCRs account for differences in affinity to either a natural ligand or a small molecule agonist or antagonist. In other words, minor differences in sequence can account for different binding affinities and activities. (See, for example, Meng et al., J Bio Chem (1996) 271(50):32016-20; Burd et al., J Bio Chem (1998) 273(51):34488-95; and Hurley et al., J Neurochem (1999) 72(1):413-21). In particular, studies have shown that amino acid sequence differences in the third intracellular domain can result in different activities. Myburgh et al. found that alanine 261 of intracellular loop 3 of gonadotropin releasing hormone receptor is crucial for G protein coupling and receptor internalization (Biochem J (1998) 331(Part 3):893-6). Wonerow et al. studied the thyrotropin receptor and demonstrated that deletions in the third intracellular loop resulted in constitutive receptor activity (J Bio Chem (1998)273(14):7900-5).
In general, the action of the binding of an endogenous ligand to a receptor results in a change in the conformation of the intracellular domain(s) of the receptor allowing for coupling between the intracellular domain(s) and an intracellular component, a G-protein. Several G proteins exist, such as Gq, Gs, Gi, Gz and G0 (see, e.g. Dessauer et al., Clin Sci (Colch) (1996) 91(5):527-37). The IC-3 loop as well as the carboxy terminus of the receptor interact with the G proteins (Pauwels et al., Mol Neurobiol (1998) 17(1-3): 109-135 and Wonerow et. al., supra). Some GPCRs are "promiscuous" with respect to G proteins, i e , a GPCR can interact with more than one G protein (see, e g , Kenakm, Life Sciences (1988) 43: 1095).
Ligand activated GPCR coupling with G protein begins a signaling cascade process (referred to as "signal transduction"). Such signal transduction ultimately results in cellular activation or cellular inhibition.
GPCRs exist in the cell membrane in equilibrium between two different conformations: an "inactive" and an "active" state. A receptor in an inactive state is unable to link to the intracellular signaling transduction pathway to produce a biological response (exceptions exist, such as during over- expression of receptor in transduced cells, see e g , www creighton eHn/PharTnaπology/inversfi htrn ). Modulation of the conformation to the active state allows linkage to the transduction pathway (via the G protein) and produces a biological response. Agonists bind and make the active conformation much more likely. However, sometimes, if there is already a considerable response in the absence of any agonist, such receptors are said to be constitutively active (i e , already in an active conformation or ligand independent or autonomous active state). When agonists are added to such systems, an enhanced response routinely is observed. However, when a classical antagonist is added, binding by such molecules produces no effect On the other hand, some antagonists cause an inhibition of the constitutive activity of the receptor, suggesting that the latter class of drugs technically are not antagonists but are agonists with negative intrinsic activity. Those drugs are called inverse agonists, www creighton dn/Pharmacology/inversR.rirm )
Traditional study of receptors has proceeded from the assumption that the endogenous ligand first be identified before discovery could move forward to identify antagonists and other receptor effector molecules. Even where antagonists might have been discovered first, the dogmatic response was to identify the endogenous ligand (WO 00/22131). However, as the active state is the most useful for assay screening purposes, obtaining such constitutive receptors, especially GPCRs, would allow for the facile isolation of agonists, partial, agonists, inverse agonists and antagonists in the absence of information concerning endogenous ligands Moreover, in diseases that result from disorders of receptor activity, drugs that cause inhibition of constitutive activity, or more specifically, reduce the effective activated receptor concentration, could be discovered more readily by assays using receptors in the autonomous active state. For example, as receptors that may be transfected into patients to treat disease, the activity of such receptors may be fine-tuned with inverse agonists discovered by such assays. Diseases such as asthma, chronic obstructive pulmonary disease (COPD) and rheumatoid arthritis (RA) generally are considered to have an inflammatory etiology involving T helper cells, monocyte-macrophages and eosmophils. Current anti-inflammatory therapy with corticosteroids is effective in asthma but is associated with metabolic and endocrine side effects The same is possibly true for inhaled formulations that can be absorbed through lung or nasal mucosa. Satisfactory oral therapies for RA or COPD currently are lacking.
Eosmophils mediate much of the airway dysfunction in allergy and asthma. Interleukιn-5 (IL-5) is an eosinophil growth and activating cytokine. Studies have shown IL-5 to be necessary for tissue eosinophiha and for eosmophil-mediated tissue damage resulting in airway hyperresponsiveness (Chang et al., J Allergy Clin Immunol (1996) 98(5 pt 1):922-931 and Duez et al., Am J Respir Cπt Care Med (2000) 161(l).200-206). IL-5 is made by T-helper-2 cells (Th2) following allergen (e.g house dust mite antigen) exposure in atopic asthma.
RA is believed to result from accumulation of activated macrophages in the affected synovium. Interferon γ (IFNγ) is a T-helper-1 (Thl) cell-derived cytokine with numerous proinflammatory properties It is the most potent macrophage activating cytokine and induces MHC class II gene transcription contributing to a dendritic cell-like phenotype.
Lipopolysaccharide (LPS) is a component of gram-negative bacterial cell walls that elicits inflammatory responses, including tumor necrosis factor (TNFa) release. The efficacy of intravenous anti -TNFα: therapy in RA has been demonstrated in the clinic. COPD is thought also to result from macrophage accumulation in the lung, the macrophages produce neutrophil chemoattractants (e.g., IL-8: de Boer et al., J Pathol (2000) 190(5).619-626). Both macrophages and neutrophils release cathepsins that cause degradation of the alveolar wall. It is believed that lung epithelium can be an important source for inflammatory cell chemoattractants and other inflammatory cell-activating agents (see, for example, Thomas et al., J Virol (2000) 74(18):8425-8433; Lamkhioued et al., Am J Respir Cπt Care Med (2000) 162(2 Pt. l):723-732; and Sekiya et al., J Immunol (2000) 165(4):2205-2213).
Given the role GPCRs have in disease and the ability to treat diseases by modulating the activity of GPCRs, identification and characterization of previously unknown GPCRs can provide for the development of new compositions and methods for treating disease states that involve the activity of a GPCR. Accordingly, what is needed is the discovery, isolation and characterization of novel and useful nucleic acid molecules that encode for heretofore unknown GPCRs. What is also needed are assays that utilize such heretofore unknown GPCRs to identify molecules that can serve potential agonists or antagonists of GPCRS. These molecules may readily have applications as therapeutic agents for modulating the activity of GPCRs in vivo, and thus, treat a plethora of diseases related to GPCR activity.
The citation of any reference herein should not be construed as an admission that such reference is available as "Prior Art" to the instant application.
SUMMARY OF THE TNVF.NTTON
The instant invention identifies and characterizes the expression of a novel constitutively active murme GPCR, GAVE 19, and provides compositions and methods for applying the discovery to the identification and treatment of related diseases
Thus broadly, the present invention extends to an isolated nucleic acid molecule comprising a DNA sequence of Figure 1 (SEQ ED NO: 1), a variant thereof, a fragment thereof, or an analog or a derivative thereof. Such a variant of the present invention may be an allehc variant, a degenerate variant, or an allehc variant that results in a degenerate change in the sequence.
Moreover, the present invention extends to an isolated nucleic acid molecule hybπdizable to the isolated nucleic acid molecule of SEQ ID NO:l, or a variant thereof, under stringent hybridization conditions. Yet further, the present invention extends to an isolated nucleic acid molecule hybπdizable to a nucleic acid molecule that is complementary to the DNA sequence of SEQ ID NO- 1 under stringent hybridization conditions. Stringent hybridization conditions are described infra.
Furthermore, the present invention extends to an isolated nucleic acid molecule comprising a DNA sequence that encodes a polypeptide comprising an amino acid sequence of SEQ ID NO:2.
Optionally, an isolated nucleic acid molecule of the present invention as described above may be detectably labeled. Examples of detectable labels having applications herein include, but certainly are not limited to an enzyme, a radioactive isotope, or a chemical which fluoresces. Particular examples of detectable labels are described infra
Particular polypeptides are also encompassed within the present invention. For example, the present invention extends to a purified polypeptide comprising the ammo acid sequence of SEQ ID NO:2, a conservative variant thereof, or an analog or derivative thereof. Optionally, a polypeptide of the present invention may be detectably labeled
In addition, the present invention extends to antibodies wherein a polypeptide of the present invention is the lmmunogen used in production of the antibodies. These antibodies can be monoclonal or polyclonal. Moreover, the antibodies can be "chimeπc" as, for example, they may comprise protein domains of antibodies raised against a purified polypeptide of the present invention in different species. Naturally, an antibody of the present invention may be detectably labeled. Particular examples of detectable labels having applications herein are described infra
The present invention further extends to an expression vector comprising a nucleic acid molecule comprising a DNA sequence of SEQ ID NO: l, a variant thereof, an analog or derivative thereof, or a fragment thereof, operatively associated with an expression control element. Furthermore, an expression vector of the present invention may comprise an isolated nucleic acid molecule hybπdizable under stringent hybridization conditions to an isolated nucleic acid molecule comprising a DNA sequence of SEQ ID NO.1, operatively associated with an expression control element, or is hybπdizable under stringent hybridization conditions to a hybridization probe that is complementary to an isolated nucleic acid molecule comprising a DNA sequence of SEQ ID NO: l, wherein the hybridization probe is operatively associated with an expression control element. A particular example of an expression control element having applications herein is a promoter. Examples of particular promoters applicable to the present invention, include, but are not limited to early promoters of hCMV, early promoters of SV40, early promoters of adenovirus, early promoters of vaccinia, early promoters of polyoma, late promoters of SV40, late promoters of adenovirus, late promoters of vaccinia, late promoters of polyoma, the lac system, the trp system, the TAC system, the TRC system, the major operator and promoter regions of phage lambda, control regions of fd coat protein, 3- phosphoglycerate kinase promoter, acid phosphatase promoter, or promoters of yeast α mating factor, to name only a few.
With an expression vector of the present invention, one may transfect or transform a host cell and produce a polypeptide comprising an ammo acid sequence of SEQ ID NO 2, or a variant thereof. The host cell may be either a prokaryotic cell or a eukaryotic cell. Particular examples of unicellular hosts having applications herein include E coli, Pseudonomas, Bacillus, Strepomyces, yeast, CHO, RI 1, B- W, L-M, COS1, COS7, BSC1, BSC40, BMT10 and Sf9 cells, etc.
Moreover, the present invention further extends to a method for producing a purified polypeptide comprising the amino acid sequence of SEQ ID NO:2, a variant thereof, or a fragment thereof. Such a method comprises cultuπng a host cell transformed or transfected with an expression vector of the present invention under conditions that provide for expression of the purified polypeptide, and then recovering the purified polypeptide from the unicellular host, the culture surrounding the host cell, or from both.
The present invention also extends to assays for identifying compounds that can modulate the activity of GAVE 19. Such compounds can be an agonist, an antagonist, or an inverse agonist of GAVE 19. Hence accordingly, the present invention extends to a method for identifying an agonist of GAVE 19 comprising contacting a potential agonist with a cell expressing GAVE 19 in the presence of an endogenous ligand, and determining whether the signaling activity of GAVE 19 is increased when the potential agonist is present, relative to the signaling activity of GAVE 19 in the absence of the potential agonist.
Likewise, the present invention extends to a method for identifying an inverse agonist of GAVE 19 Such a method comprises contacting a potential inverse agonist with a cell expressing GAVE19, and determining whether the signaling activity of GAVE 19 in the presence of the potential inverse agonist and an endogenous ligand or agonist is decreased relative to the signaling activity of GAVE 19 under conditions in which the presence of an endogenous ligand or agonist, but in absence of potential inverse agonist, and is decreased in the presence of an endogenous ligand or agonist
Naturally, the present invention extends to methods for identifying an antagonist of GAVE 19. Such a method comprises the steps of contacting a potential antagonist with a cell expressing GAVE 19, and determining whether in the presence of said potential antagonist the signaling activity of GAVE19 is decreased relative to the activity of GAVE 19 in the presence of an endogenous ligand or agonist.
Accordingly, it is an aspect of the present invention to provide an isolated nucleic acid sequence which encodes a GAVE19 protein, a fragment thereof, or a variant thereof
It is also an aspect of the present invention to provide a variant of an nucleic acid molecule comprising a DNA sequence of SEQ ID NO: 1 , as well as a DNA molecule that is hybπdizable to SEQ ID NO: 1 under stringent conditions.
It is a further aspect of the present invention to provide an ammo acid sequence for GAVE19, along with variant thereof, a fragment thereof, or an analog or derivative thereof. It is a further aspect of the present invention to provide an expression vector comprising a DNA sequence that encodes GAVE 19, a variant thereof, a fragment thereof, or an analog or derivative thereof, wherein the DNA sequence is operably associated with an expression control element.
It is still a further aspect of the present invention to provide an antibody having GAVE 19, an variant thereof, an analog or derivative thereof, or a fragment thereof, as an immunogen.
Yet another aspect of the present invention involves methods for identify compounds that can modulate the activity of GAVE19 protein Such modulators may be an antagonist of GAVE19, an agonist of GAVE19, or inverse agonist of GAVE19. Moreover, compounds that modulate the expression or activity of GAVE 19 in mice may well have applications in treating a plethora of diseases or disorders such as various inflammatory diseases, asthma, chronic obstructive pulmonary disease (COPD), and rheumatoid arthritis, to name only a few.
These and other aspects of the present invention will be better appreciated by reference to the following drawings and Detailed Description.
BRTEF DESCRIPTION OF THE PR A WINGS FIGURE 1 : DNA sequence that encodes GAVE19 (SEQ ID NO: 1)
FIGURE 2: Ammo acid sequence of GAVE 19 (SEQ ID NO.2)
FIGURE 3 : GAVE 19 Expression Profile on MPD 1.1.2
FIGURE 4: Comparison of the ammo acid sequence of GAVE19 (SEQ ID NO:2) with the human ortholog GAVE18 (SEQ ID NO:7).
PFTATT ED DESCRIPTION OF THE INVENTION As explained above, the present invention relates to the surprising and unexpected discovery of a heretofore unknown murine nucleic acid molecule that encodes a heretofore unknown G protein-coupled receptor referred to herein as GAVE 19 In particular, it has been discovered that GAVE 19 is expressed in immune tissues or organs, such as the kidney, liver and small intestine. Hence, GAVE 19 can readily serve as a target for the development of pharmaceutical compositions to treat a variety inflammation diseases, such as asthma, rheumatoid arthritis, COPD, etc. Various terms and phrases used throughout the instant Specification and Claims to describe the present invention are set forth below
As used herein, the term "modulator" refers to a moiety (e.g., but not limited to a ligand and a candidate compound) that modulates the activity of GAVE 19. A modulator of the present invention may be an agonist, a partial agonist, an antagonist, or an inverse agonist of GAVE 19
As used herein, the term "agonist" refers to moieties (e.g., but not limited to ligands and candidate compounds) that activate the intracellular response when bound to the receptor, or enhance GTP binding to membranes.
As used herein, the term "partial agonist" refers to moieties (e.g., but not limited to ligands and candidate compounds) that activate the intracellular response when bound to the receptor to a lesser degree/extent than do agonists, or enhance GTP binding to membranes to a lesser degree/extent than do agonists.
As used herein, the term "antagonist" refers moieties (e.g., but not limited to ligands and candidate compounds) that competitively bind to the receptor at the same site as does an agonist However, an antagonist does not activate the intracellular response initiated by the active form of the receptor and thereby can inhibit the intracellular responses by agonists or partial agonists. In a related aspect, antagonists do not diminish the baseline intracellular response in the absence of an agonist or partial agonist.
As used herein, the term "inverse agonist" refers to moieties (e.g , but not limited to ligand and candidate compound) that bind to a constitutively active receptor and inhibit the baseline intracellular response. The baseline response is initiated by the active form of the receptor below the normal base level of activity that is observed in the absence of agonists or partial agonists, or decrease of GTP binding to membranes.
As used herein, the term "candidate compound" refers to a moiety (e g , but not limited to a chemical compound) that is amenable to a screening technique. In one embodiment, the term does not include compounds that were publicly known to be compounds selected from the group consisting of agonist, partial agonist, inverse agonist or antagonist of GAVE 19. Those compounds were identified by traditional drug discovery processes involving identification of an endogenous ligand specific for a receptor, and/or screening of candidate compounds against a receptor wherein such a screening requires a competitive assay to assess efficacy.
As used herein, the terms "constitutively activated receptor" or "autonomously active receptor," are used herein interchangeably, and refer to a receptor subject to activation in the absence of ligand. Such constitutively active receptors can be endogenous (e.g , GAVE 19) or non-endogenous; i.e., GPCRs that can be modified by recombinant means to produce mutant constitutive forms of wild-type GPCRs (e.g, see EP 1071701; WO 00/22129, WO 00/22131; and U.S Pat. Nos. 6,150,393 and 6,140,509 which are hereby incorporated by reference herein in their entireties.
As used herein, the term "constitutive receptor activation" refers to the stabilization of a receptor in the active state by means other than binding of the receptor with the endogenous ligand or chemical equivalent thereof.
As used herein, the term "ligand" refers to a moiety that binds to another molecule, wherein the moiety includes, but certainly is not limited to a hormone or a neurotransmitter, and further, wherein the moiety stereoselectively binds to a receptor.
As used herein, the term "family," when referring to a protein or a nucleic acid molecule of the invention, is intended to mean two or more proteins or nucleic acid molecules having a seemingly common structural domain and having sufficient amino acid or nucleotide sequence identity as defined herein Such family members can be naturally occurring and can be from either the same or different species. For example, a family can contain a first protein of human origin and a homologue of that protein of murine origin, as well as a second, distinct protein of human origin and a murine homologue of that second protein. Members of a family also may have common functional characteristics.
As used herein interchangeably, the terms "GAVE 19 activity", "biological activity of GAVE 19" and "functional activity of GAVE 19", refer to an activity exerted by a GAVE 19 protein, polypeptide or nucleic acid molecule on a GAVE 19 responsive cell as determined in vivo or in vitro, according to standard techniques. A GAVE 19 activity can be a direct activity, such as an association with or an enzymatic activity on a second protein or an indirect activity, such as a cellular signaling activity mediated by interaction of the GAVE 19 protein with a second protein. In a particular embodiment, a GAVE19 activity includes, but is not limited to at least one or more of the following activities: (I) the ability to interact with proteins in the GAVE 19 signaling pathway; (n) the ability to interact with a GAVE19 ligand; and (in) the ability to interact with an intracellular target protein.
Furthermore, in accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g , Sambrook, Fπtsch & Maniatis, Molecular Cloning- A Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (herein "Sambrook et al, 1989"); DNA Cloning- A Practical Approach, Volumes I and II (D.N. Glover ed. 1985); Ohgonucleotide Synthesis (M J. Gait ed. 1984); Nucleic Acid Hybridization [B.D. Hames & S.J. Higgms eds. (1985)]; Transcription And Translation [B.D. Hames & S.J. Higgms, eds. (1984)]; Animal Cell Culture [R.I. Freshney, ed. (1986)]; Immobilized Cells And Enzymes [IRL Press, (1986)]; B. Perbal, A Practical Guide To Molecular Cloning (1984); F.M. Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994).
Therefore, if appearing herein, the following terms shall have the definitions set out below.
A "vector" is a rephcon, such as plasmid, phage or cosmid, to name only a few, to which another DNA segment may be attached so as to bring about the replication of the attached segment A "rephcon" is any genetic element (e.g, plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo, i.e., capable of replication under its own control. Particular examples of vectors are described infra.
A "cassette" refers to a segment of DNA that can be inserted into a vector at specific restriction sites. The segment of DNA encodes a polypeptide of interest, and the cassette and restriction sites are designed to ensure insertion of the cassette in the proper reading frame for transcription and translation.
A cell has been "transfected" by exogenous or heterologous DNA when such DNA has been introduced inside the cell. A cell has been "transformed" by exogenous or heterologous DNA when the transfected DNA effects a phenotypic change. Preferably, the transforming DNA should be integrated (covalently linked) into chromosomal DNA making up the genome of the cell.
"Heterologous" DNA refers to DNA not naturally located in the cell, or in a chromosomal site of the cell. Preferably, the heterologous DNA includes a gene foreign to the cell. "Homologous recombination" refers to the insertion of a foreign DNA sequence of a vector into a chromosome. In particular, the vector targets a specific chromosomal site for homologous recombination. For specific homologous recombination, the vector will contain sufficiently long regions of homology to sequences of the chromosome to allow complementary binding and incorporation of the vector into the chromosome Longer regions of homology, and greater degrees of sequence similarity, may increase the efficiency of homologous recombination
Isolated Nucleic AciH Molecules of the Present Invention In one aspect, the present invention extends to an isolated nucleic acid molecule comprising DNA sequence of Figure 1 (SEQ ID NO 1), a variant thereof, a fragment thereof, or an analog or derivative thereof.
A "nucleic acid molecule" refers to the phosphate ester polymeric form of nbonucleosides (adenosme, guanosine, undine or cytidme, "RNA molecules") or deoxynbonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidme, or deoxycytidine; "DNA molecules"), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic acid molecule, and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms Thus, this term includes double-stranded DNA found, inter aha, in linear or circular DNA molecules (e g , restriction fragments), plasmids, and chromosomes. In discussing the structure of particular double- stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the nontranscπbed strand of DNA (i e , the strand having a sequence homologous to the mRNA) A "recombinant DNA molecule" is a DNA molecule that has undergone a molecular biological manipulation.
An "isolated" nucleic acid molecule is one that is separated from other nucleic acid molecules present in the natural source of the nucleic acid In particular, an "isolated" nucleic acid is free of sequences that naturally flank the nucleic acid encoding GAVE19 (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. In various embodiments, the isolated GAVE19 nucleic acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0 5 kb or 0.1 kb of nucleotide sequences that naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived. Moreover, an "isolated" nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material or culture medium when produced by recombinant techniques or substantially free of chemical precursors or other chemicals when synthesized chemically.
A nucleic acid molecule of the present invention, e.g, a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 1 or a fragment or complement of any of that nucleotide sequence, or an analog or derivative thereof, can be isolated using standard molecular biology techniques and the sequence information provided herein. Using all or a portion of the nucleic acid sequence of SEQ ID NO: 1 as a hybridization probe, GAVE19 nucleic acid molecules can be isolated using standard hybridization and cloning techniques (e.g, as described in Sambrook et al).
A nucleic acid molecule of the invention can be amplified using cDNA, mRNA or genomic DNA as a template and appropriate ohgonucleotide primers according to standard PCR amplification techniques. Such primers may be readily made using information set forth in SEQ DO NO: 1, and routine laboratory techniques. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis Furthermore, oligonucleotides corresponding to GAVE 19 nucleotide sequences can be prepared by standard synthetic techniques, e.g, using an automated DNA synthesizer.
Isolated nucleic And molecule hyhndizahle to GAVF.19 DNA The present invention further extends to isolated nucleic acid molecules hybndizable to GAVE19 DNA, hybndizable to a hybridization probe that is complementary under stringent hybridization conditions to GAVE 19 DNA, or hybndizable under stringent hybridization conditions to both In particular, the present invention extends to an isolated nucleic acid molecule that is hybndizable under stringent hybridization conditions to a nucleic acid molecule comprising a DNA sequence of SEQ ID NO.l, or to a probe that is complementary to an isolated nucleic acid molecule comprising a DNA sequence of SEQ ID NO: 1.
A nucleic acid molecule is "hybndizable" to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to another nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength (see
Sambrook et al , supra). The conditions of temperature and ionic strength determine the "stringency" of the hybridization For preliminary screening for homologous nucleic acids, low stringency hybridization conditions, corresponding to a Tm of 55° C, can be used, e g., 5x SSC, 0.1% SDS, 0.25% milk, and no formamide, or 30% formamide, 5x SSC, 0.5% SDS). Moderate stringency hybridization conditions correspond to a higher Tm, e g , 40% formamide, with 5x or 6x SSC. High stringency hybridization conditions correspond to the highest Tm, e.g., 50% formamide, 5x or 6x SSC. Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible. The appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of Tm for hybrids of nucleic acids having those sequences. The relative stability (corresponding to higher Tm) of nucleic acid hybridizations decreases m the following order: RNA:RNA, DNA:RNA, DNA:DNA. For hybrids of greater than 100 nucleotides in length, equations for calculating Tm have been derived (see Sambrook et al, supra, 9.50-0.51). For hybridization with shorter nucleic acids, e , oligonucleotides, the position of mismatches becomes more important, and the length of the ohgonucleotide determines its specificity (see Sambrook et al, supra, 11.7-11.8). A minimum length for a hybndizable nucleic acid molecule is at least about 20 nucleotides; particularly at least about 30 nucleotides; more particularly at least about 40 nucleotides, even more particularly about 50 nucleotides, and yet more particularly at least about 60 nucleotides. In a particular embodiment of the present invention, a hybndizable nucleic acid molecule of the invention is at least 300, 325, 350, 375, 400, 425, 450, 500, 550, 600, 650, 700, 800, 900, 1000 or 1100 nucleotides in length and hybridizes under stringent conditions to the nucleic acid molecule comprising the nucleotide sequence, preferably the coding sequence, of SEQ ID NO:l a complement thereof, or a fragment thereof.
As used herein, the term "hybridizes under stringent conditions" is intended to describe conditions for hybridization and washing under which nucleotide sequences at least 55%, 60%, 65%, 70% and preferably 75% or more complementary to each other typically remain hybridized. Such stringent conditions are known to those skilled in the art and can be found in "Current Protocols in Molecular Biology", John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. A preferred, non-hmitmg example of stringent hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45° C, followed by one or more washes in 0.2X SSC, 0.1% SDS at 50-65° C. Preferably, an isolated nucleic acid molecule of the invention that hybridizes under stringent conditions to the sequence of SEQ ID NO:l or the complement thereof corresponds to a naturally occurring nucleic acid molecule. As used herein, a "naturally-occurring" nucleic acid molecule refers to an RNA or DNA molecule having a nucleotide sequence that occurs in nature (e.g, encodes a natural protein). The skilled artisan will appreciate that the conditions may be modified in view of sequence-specific variables (e.g, length, G-C richness etc.). The invention contemplates encompassing nucleic acid fragments of GAVE 19 that are diagnostic of GAVE19-lιke molecules that have similar properties. The diagnostic fragments can arise from any portion of the GAVE 19 gene including flanking sequences. The fragments can be used as probe of a library practicing known methods.
Moreover, a nucleic acid molecule of the invention can comprise only a portion of a nucleic acid sequence encoding GAVE19, for example, a fragment that can be used as a probe or primer, or a fragment encoding a biologically active portion of GAVE 19. For example, such a fragment can comprise, but is not limited to, a region encoding amino acid residues about 1 to about 14 of SEQ ID NO'2. The nucleotide sequence determined from the cloning of the human GAVE19 gene allows for the generation of probes and primers for identifying and/or cloning GAVE 19 homologues in other cell types, e g, from other tissues, as well as GAVE19 homologues from other mammals. The probe/primer typically comprises substantially purified ohgonucleotide. The ohgonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 12, preferably about 25, more preferably about 50, 75, 100, 125, 150, 175, 200, 250, 300, 350 or 400 consecutive nucleotides of the sense or anti-sense sequence of SEQ ID NO: l or of a naturally occurring mutant of SEQ ID NO.1. Probes based on a GAVE 19 nucleotide sequence can be used to detect transcripts or genomic sequences encoding the similar or identical proteins.
As used herein, the terms "fragment" or "portion" of an isolated nucleic acid molecule of the present invention comprise at least 12, particularly about 25, more particularly about 50, 75, 100, 125, 150, 175, 200, 250, 300, 350 or 400 consecutive nucleotides Consequently, a "fragment" of an isolated nucleic acid molecule of the present invention is not merely 1 or 2 nucleotides.
Similarly, a "fragment" or "portion" of a polypeptide of the present invention comprises at least 9 contiguous ammo acid residues. A particular example of a fragment of a polypeptide of the present invention comprises an epitope to which a GAVE 19 antibody, or fragment thereof, binds.
A nucleic acid fragment encoding a "biologically active portion of GAVE 19" can be prepared by isolating a portion of SEQ ID NO: 1 that encodes a polypeptide having a GAVE 19 biological activity, expressing the encoded portion of GAVE 19 protein (e.g, by recombinant expression in vitro) and assessing the activity of the encoded portion of GAVE 19. The invention further encompasses nucleic acid molecules that differ from the nucleotide sequence of SEQ ID NO:l due to degeneracy of the genetic code, and thus encode the same GAVE 19 protein as that encoded by the nucleotide sequence shown in SEQ ID NO: 1. Homologous Nucleic And Molecules The present invention further extends to an isolated nucleic acid molecule that is homologous to a GAVE19 DNA molecule, e.g, is homologous to an isolated nucleic acid molecule having a DNA sequence of SEQ ID NO: 1. Two DNA sequences are "substantially homologous" or "substantially similar" when at least about 50% (preferably at least about 75%, and most preferably at least about 90 or 95%) of the nucleotides match over the defined length of the DNA sequences. Sequences that are substantially homologous can be identified by comparing the sequences using standard software available in sequence data banks using default parameters, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g, Maniatis et al, supra; DNA Cloning, Vols. I & π, supra; Nucleic Acid Hybridization, supra. Moreover, nucleic acid molecules encoding GAVE 19 proteins from other species (GAVE 19 homologues) with a nucleotide sequence that differs from that of a human GAVE 19, are intended to be within the scope of the invention.
Variants of an Isolated Nucleic acid Molecule of the present Invention The present invention further extends to variants of an isolated nucleic acid molecule comprising a DNA sequence of SEQ ID NO: 1. Such variants can be degenerate, allehc, or a combination thereof.
Nucleic acid molecules corresponding to natural allehc variants and homologues of the GAVE 19 cDNA of the invention can be isolated based on identity with the murine GAVE19 nucleic acids disclosed herein using the murine cDNA or a portion thereof, as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions.
The term "corresponding to" is used herein to refer similar or homologous sequences, whether the exact position is identical or different from the molecule to which the similarity or homology is measured. Thus, the term "corresponding to" refers to the sequence similarity, and not the numbering of the amino acid residues or nucleotide bases.
Moreover, due to degenerate nature of codons in the genetic code, a GAVE19 protein of the present invention can be encoded by numerous isolated nucleic acid molecules. "Degenerate nature" refers to the use of different three-letter codons to specify a particular amino acid pursuant to the genetic code. It is well known in the art that the following codons can be used interchangeably to code for each specific amino acid: Phenylalanine (Phe or F) UUU or UUC Leucine (Leu or L) UUA or UUG or CUU or CUC or CUA or CUG Isoleucine (He or I) AUU or AUC or AUA Methionine (Met or M) AUG Valine (Val or V) GUU or GUC ofGUA or GUG Serine (Ser or S) UCU or UCC or UCA orUCG or AGU or AGC Prolme (Pro or P) CCU or CCC or CCA or CCG Threonine (Thr or T) ACU or ACC or ACA orACG Alanine (Ala or A) GCU or GCG or GCA orGCG Tyrosine (Tyr or Y) UAU or UAC Histidine (His or H) CAU or CAC Glutamine (Gin or Q) CAA or CAG Asparagine (Asn or N) AAU or AAC Lysine (Lys or K) AAA or AAG Aspartic Acid (Asp or D) GAU or GAC Glutamic Acid (Glu or E) GAA or GAG Cysteine (Cys or C) UGU or UGC Arginine (Arg or R) CGU or CGC or CGA or CGG or AGA or AGG Glycine (Gly or G) GGU or GGC or GGA or GGG Tryptophan (Trp or W) UGG Termination codon UAA (ochre) or UAG (amber) or UGA (opal)
It should be understood that the codons specified above are for RNA sequences. The corresponding codons for DNA have a T substituted for U.
In addition to the murine GAVE19 nucleotide sequence shown in SEQ ID NO:l, it will be appreciated by those skilled in the art that DNA sequence polymorphisms that lead to changes in the amino acid sequences of GAVE 19 may exist withm a population. Such genetic polymorphism in the GAVE 19 gene may exist among individuals within a population due to natural allehc variation. An allele is one of a group of genes that occur alternatively at a given genetic locus. As used herein, the terms "gene" and "recombinant gene" refer to nucleic acid molecules comprising an open reading frame encoding a GAVE 19 protein, preferably a mammalian GAVE 19 protein. As used herein, the phrase "allehc variant" refers to a nucleotide sequence that occurs at a GAVE 19 locus or to a polypeptide encoded by the nucleotide sequence. Alternative alleles can be identified by sequencing the gene of interest in a number of different individuals. That can be carried out readily by using hybridization probes to identify the same genetic locus in a variety of individuals. Any and all such nucleotide variations and resulting amino acid polymorphisms or variations in GAVE 19 that are the result of natural allehc variation and that do not alter the functional activity of GAVE 19 are intended to be withm the scope of the invention
Moreover, variants of an isolated nucleic acid molecule of the present invention can be readily made by one of ordinary skill in the art using routine laboratory techniques, e.g, site -directed mutagenesis.
Antisense Nucleotide Sequences The instant invention also extends to antisense nucleic acid molecules, i.e., molecules that are complementary to a sense nucleic acid encoding a protein, e.g , complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence. Accordingly, an antisense nucleic acid can hydrogen bond to a sense nucleic acid. The antisense nucleic acid can be complementary to an entire GAVE 19 coding strand or to only a portion thereof, e.g, all or part of the protein coding region (or open reading frame). An antisense nucleic acid molecule can be antisense to a noncoding region of the coding strand of a nucleotide sequence encoding GAVE 19. The noncodmg regions ("5' and 3' untranslated regions") are the 5' and 3' sequences that flank the coding region and are not translated into amino acids
Given the coding strand sequences encoding GAVE19 disclosed herein (e.g, SEQ ID NO: l), antisense nucleic acids of the invention can be designed according to the rules of Watson & Crick base pairing. The antisense nucleic acid molecule can be complementary to the entire coding region of GAVE 19 mRNA, but more preferably is an ohgonucleotide that is antisense to only a portion of the coding or noncoding region of GAVE 19 mRNA. For example, the antisense ohgonucleotide can be complementary to the region surrounding the translation start site of GAVE 19 mRNA. An antisense ohgonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length. An antisense nucleic acid of the invention can be constructed using chemical synthesis and enzymatic hgation reactions using procedures known in the art. For example, an antisense nucleic acid (e.g, an antisense ohgonucleotide) can be synthesized chemically using naturally occurring nucleotides or various chemically modified nucleotides designed to increase the biological stability of the molecules, or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g, phosphorothioate derivatives, phosphonate derivatives and acπdme-substituted nucleotides can be used.
Examples of modified nucleotides that can be used to generate the antisense nucleic acid include 5-fluorouracιl, 5-bromouracιl, 5-chlorouracιl, 5-ιodouracιl, hypoxanthine, xanthine, 4-acetylcytosme, 5-(carboxyhydroxylmethyl)uracιl, 5-carboxymethylammomethyl-2-thιouπdme, 5-carboxymethylamιnomethyluracιl, dihydrouracil, β-D-galactosylqueosme, inosine, N6-ιsopentenyladenιne, 1 -methylguanme, 1-methyhnosιne, 2,2-dιmethylguanme, 2-methyladenιne, 2-methylguanιne, 3-methylcytosιne, 5-methylcytosme, N -adenme, 7-methylguanme, 5-methylamιnomethyluracιl, 5-methoxyamιnomethyl-2-thιouracιl, β-D-mannosylqueosine, 5-methoxycarboxymethyluracιl, 5-methoxyuracιl, 2-methylthιo-N6-ιsopentenyladenme, uracιl-5-oxyacetιc acid, wybutoxosine, pseudouracil, queosme, 2-thιocytosιne, 5-methyl-2-thιouracιl, 2-thιouracιl, 4-thιouracιl, 5-methyluracιl, uracιl-5-oxyacetιc acid methylester, uracιl-5-oxyacetιc acid, 5-methyl-2-thιouracιl, 3-(3-ammo-3-N-2-carboxypropyl)uracιl and 2,6-dιammopuπne Alternatively, the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e , RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest).
The antisense nucleic acid molecules of the invention typically are administered to a subject or generated in situ so as to hybridize with or bind to cellular mRNA and/or genomic DNA encoding a GAVE19 protein thereby to inhibit expression of the protein, e.g, by inhibiting transcription and/or translation The hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule that binds to DNA duplexes, through specific interactions in the major groove of the double helix, or to a regulatory region of GAVE 19.
An example of a route of administration of antisense nucleic acid molecules of the invention includes direct injection at a tissue site Alternatively, antisense nucleic acid molecules can be modified to target selected cells and then administered systemically. For example, for systemic administration, antisense molecules can be modified such that the molecules specifically bind to receptors or antigens expressed on a selected cell surface, e.g , by linking the antisense nucleic acid molecules to peptides or antibodies that bind to cell surface receptors or antigens. The antisense nucleic acid molecules also can be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of the antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol HJ promoter are preferred.
An antisense nucleic acid molecule of the invention can be an α-anomeπc nucleic acid molecule. An α-anomeπc nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in that the strands run parallel to each other (Gaultier et al. Nucleic Acids Res (1987)15.6625-6641) The antisense nucleic acid molecule also can comprise a methylπbonucleotide (Inoue et al. Nucleic Acids Res (1987) 15:6131-6148) or a chimeπc RNA-DNA analogue (Inoue et al, FEBS Lett (1987) 215.327-330).
Rihozymes The invention also encompasses πbozymes. Ribozymes are catalytic RNA molecules with ribonuclease activity that are capable of cleaving a smgle-stranded nucleic acid, such as an mRNA, that hybridizes to the πbozyme. Thus, ribozymes (e.g, hammerhead ribozymes (described in Haselhoff et al. Nature (1988) 334:585-591)) can be used to cleave catalytically GAVE19 mRNA transcripts, and thus inhibit translation of GAVE 19 mRNA. A nbozyme having specificity for a GAVE19-encodmg nucleic acid can be designed based on the nucleotide sequence of a GAVE 19 DNA disclosed herein (e.g, SEQ ED NO: 1). For example, a derivative of a Tetrahymena L-19 IVS RNA can be constructed so that the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a GAVE19-encodιng mRNA, see, e.g, U.S. Patent Nos. 4,987,071 and 5,116,742. Alternatively, GAVE19 mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules, see, e.g, Bartel et al. Science (1993) 261:1411-1418.
Triple Helical Nucleic Acid Molecules and Peptide Nucleic Acids of the of the Present Invention The invention also encompasses nucleic acid molecules that form triple helical structures. For example, GAVE 19 gene expression can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the GAVE19 (e.g, the GAVE19 promoter and/or enhancers) to form triple helical structures that prevent transcription of the GAVE 19 gene in target cells, see generally, Helene, Anticancer Drug Des (1991) 6(6):569; Helene Ann NY Acad Sci (1992) 660:27, and Maher, Bioassays (1992) 14(12):807.
In particular embodiments, the nucleic acid molecules of the invention can be modified at the base moiety, sugar moiety or phosphate backbone to improve, e.g, the stability, hybridization or solubility of the molecule. For example, the deoxynbose phosphate backbone of the nucleic acids can be modified to generate peptide nucleic acids (see Hyrup et al, Bioorganic & Medicinal Chemistry (1996) 4:5). As used herein, the terms "peptide nucleic acids" or "PNAs" refer to nucleic acid mimics, e.g, DNA mimics, in that the deoxynbose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength. The synthesis of PNA ohgomers can be performed using standard solid phase peptide synthesis protocols as described in Hyrup et al. (1996) supra; Perry-O'Keefe et al, Proc Natl Acad Sci USA (1996) 93:14670.
PNAs of GAVE19 can also be used in therapeutic and diagnostic applications. For example, PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, e.g, inducing transcription or translation arrest or inhibiting replication. PNAs of GAVE 19 also can be used. For example, a PNA can be used in the analysis of single base pair mutations in a gene by, e.g, PNA-directed PCR clamping; as artificial restriction enzymes when used in combination with other enzymes, e.g, SI nucleases (Hyrup et al. (1996) supra) or as probes or primers for DNA sequence and hybridization (Hyrup et al. (1996) supra; Perry-O'Keefe et al. (1996) supra).
In another embodiment, PNAs of GAVE19 can be modified, e.g, to enhance stability, specificity or cellular uptake, by attaching lipophihc or other helper groups to the PNA, by the formation of PNA-DNA chimeras or by the use of liposomes or other techniques of drug delivery known in the art. The synthesis of PNA-DNA chimeras can be performed as described in Hyrup et al. (1996) supra, Finn et al. Nucleic Acids Res (1996) 24(17):3357-63, Mag et al. Nucleic Acids Res (1989) 17:5973; and Peterser et al, Bioorganic Med Chem Lett (1975) 5:1119.
GAVF.19 Protein Moreover, the present invention extends to an isolated polypeptide comprising the ammo acid sequence of Figure 2 (SEQ ID NO:2), a variant thereof, a fragment thereof or an analog or derivative thereof.
An isolated nucleic acid molecule encoding a GAVE 19 protein having a sequence that differs from that of SEQ ED NO'2, e.g. a variant, can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of SEQ ED NO:l such that one or more ammo acid substitutions, additions or deletions are introduced into the encoded protein.
In a particular embodiment, a mutant GAVE19 protein can be assayed for: (1) the ability to form proteimprotein interactions with proteins in the GAVE 19 signaling pathway; (2) the ability to bind a GAVE 19 ligand; or (3) the ability to bind to an intracellular target protein. In yet another embodiment, a mutant GAVE19 can be assayed for the ability to modulate cellular proliferation or cellular differentiation. Native GAVE19 proteins can be isolated from cells or tissue sources by an appropriate purification scheme using standard protein purification techniques Alternatively, GAVE 19 proteins can readily be produced by recombinant DNA techniques. Yet another alternative encompassed by the present invention is the chemical synthesis of a GAVE 19 protein or polypeptide using standard peptide synthesis techniques
An "isolated" or "purified" protein, or biologically active portion thereof, is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the GAVE19 protein is derived, or is substantially free of chemical precursors or other chemicals when chemically synthesized The phrase, "substantially free of cellular material" includes preparations of GAVE 19 protein in which the protein is separated from cellular components of the cells from which the protein is isolated or recombmantly produced. Thus, GAVE19 protein that is substantially free of cellular material includes preparations of GAVE19 protein having less than about 30%, 20%, 10% or 5% or less (by dry weight) of non-GAVE19 protein (also referred to herein as a "contaminating protein"). When the GAVE 19 protein or biologically active portion thereof is produced recombmantly, it also is preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, 10% or 5% or less of the volume of the protein preparation. When GAVE 19 protein is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals that are involved in the synthesis of the protein. Accordingly, such preparations of GAVE 19 protein have less than about 30%, 20%, 10% or 5% or less (by dry weight) of chemical precursors or non-GAVE19 chemicals.
Biologically active portions or fragments of a GAVE 19 protein include peptides comprising ammo acid sequences sufficiently identical to or derived from the amino acid sequence of the GAVE 19 protein (e.g, the amino acid sequence shown in SEQ D NO:2), that include fewer ammo acids than the full length GAVE 19 protein and exhibit at least one activity of a GAVE 19 protein. Typically, biologically active portions comprise a domain or motif with at least one activity of a GAVE 19 protein. A biologically active portion of a GAVE 19 protein can be a polypeptide that is, for example, 10, 25, 50, 100 or more ammo acids in length. Particular biologically active polypeptides include one or more identified GAVE 19 structural domains.
Moreover, other biologically active portions, in which other regions of the protein are deleted, can be prepared by recombinant techniques and evaluated for one or more of the functional activities of a native GAVE 19 protein Other useful GAVE 19 proteins are substantially identical to SEQ ID NO:2 and retain a functional activity of the protein of SEQ ID NO.2 yet differ in amino acid sequence due to natural allehc variation or mutagenesis. For example, such GAVE19 proteins and polypeptides possess at least one biological activity described herein.
Accordingly, a useful GAVE 19 protein is a protein that includes an amino acid sequence at least about 45%, preferably 55%, 65%, 75%, 85%, 95%, 99% or 100%ιdentιcal to the amino acid sequence of SEQ ID NO:2 and retains a functional activity of a GAVE 19 protein of SEQ ED NO:2 In a particular embodiment, the GAVE 19 protein retains a functional activity of the GAVE 19 protein of SEQ ID NO.2.
To determine the percent identity of two amino acid sequences or of two nucleic acids, the sequences are aligned for optimal comparison purposes (e.g, gaps can be introduced in the sequence of a first ammo acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence). The ammo acid residues or nucleotides at corresponding amino acid positions or nucleotide positions then are compared When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position m the second sequence, then the molecules are considered identical at that position The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., percent identity = number of identical positions/total number of positions (e.g, overlapping positions) X 100). In one embodiment, the two sequences are the same length.
The determination of percent identity between two sequences can be accomplished using a mathematical algorithm. A particular, non-hmitmg example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karhn et al, Proc Natl Acad Sci USA (1990) 87:2264, modified as in Karhn et al, Proc Natl Acad Sci USA (1993) 90:5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al, J Mol Bio (1990) 215:403. BLAST nucleotide searches can be performed with the NBLAST program, for example, score=100, wordlength=12, to obtain nucleotide sequences homologous to a GAVE19 nucleic acid molecule of the present invention. BLAST protein searches can be performed with the XBLAST program, score=50, wordlength=3 to obtain ammo acid sequences homologous to a GAVE19 protein molecule of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. Nucleic Acids Res (1997) 25 3389. Alternatively, PSI-Blast can be used to perform an iterated search that detects distant relationships between molecules. Altschul et al. (1997) supra. When utilizing BLAST, Gapped BLAST and PSI-Blast programs, the default parameters of the respective programs (e.g, XBLAST and NBLAST) can be used, see http://www.ncbi.nlm.mh.gov.
Another particular, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers et al, CABIOS (1988) 4: 11-17. Such an algorithm is incorporated into the ALIGN program (version 2.0) that is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM 120 weight residue table, a gap length penalty of 12 and a gap penalty of 4 may be used.
The percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, only exact matches are counted.
The present invention further extends to GAVE19 chimenc or fusion proteins. As used herein, a
GAVE 19 "chimenc protein" or "fusion protein" comprises a GAVE 19 polypeptide operably linked to a non-GAVE19 polypeptide. A "GAVE19 polypeptide refers to a polypeptide having an ammo acid sequence corresponding to GAVE19. A "non-GAVE 19 polypeptide" refers to a polypeptide having an ammo acid sequence corresponding to a protein that is not substantially identical to the GAVE 19 protein, e.g, a protein that is different from the GAVE19 protein and is derived from the same or a different organism. Within a GAVE19 fusion protein, the GAVE19 polypeptide can correspond to all or a portion of a GAVE 19 protein, preferably at least one biologically active portion of a GAVE 19 protein. Withm the fusion protein, the term "operably linked" is intended to indicate that the GAVE 19 polypeptide and the non-GAVE 19 polypeptide are fused m-frame to each other. The non-GAVE 19 polypeptide can be fused to the N-termmus or C-terminus of a GAVE 19 polypeptide. One useful fusion protein is GST-GAVE 19 in which a GAVE 19 sequence is fused to the C-terminus of glutathione-S-transferase (GST). Such fusion proteins can facilitate the purification of recombinant GAVE 19.
In another embodiment, a fusion protein of the present invention extends to a
GAVE19-ιmmunoglobuhn fusion protein in which all or part of GAVE19 is fused to sequences derived from a member of the immunoglobulin protein family. The GAVE19-immunoglobuhn fusion proteins of the invention can be incorporated into pharmaceutical compositions and administered to a subject to inhibit an interaction between a GAVE 19 ligand and a GAVE 19 protein on the surface of a cell, thereby to suppress GAVE19-medιated signal transduction in vivo. The GAVE19-ιmmunoglobulm fusion proteins can be used to affect the bioavailabihty of a GAVE 19 cognate ligand. Inhibition of the GAVE19 hgand-GAVE19 interaction may be useful therapeutically, both for treating proliferative and differentiative disorders and for modulating (e.g. promoting or inhibiting) cell survival. Moreover, the GAVE 19-ιmmunoglobuhn fusion proteins of the invention can be used as immunogens to produce antι-GAVE19 antibodies in a subject, to purify GAVE 19 ligands and in screening assays to identify molecules that inhibit the interaction of GAVE 19 with a GAVE 19 ligand.
In a particular embodiment, a GAVE 19 chimenc or fusion protein of the present invention is produced by standard recombinant DNA techniques. For example, DNA fragments coding for the different polypeptide sequences are hgated together in-frame in accordance with conventional techniques, for example, by employing blunt-ended or stagger-ended termini for hgation, restriction enzyme digestion to provide for appropriate termini, fillmg-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining and enzymatic hgation. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers.
Alternatively, PCR amplification of gene fragments can be carried out using anchor primers that give rise to complementary overhangs between two consecutive gene fragments that subsequently can be annealed and reamphfied to generate a chimenc gene sequence (see e.g, Ausubel et al, supra). Moreover, many expression vectors are commercially available that already encode a fusion moiety (e.g , a GST polypeptide). A GAVE19-encodmg nucleic acid can be cloned into such an expression vector so that the fusion moiety is linked m-frame to the GAVE 19 protein.
Variants As explained above, the present invention further extends to variants of the GAVE19 protein. For example, mutations may be introduced into the ammo acid sequence of SEQ ED NO:2 using standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Moreover, conservative amino acid substitutions can be made at one or more predicted non-essential amino acid residues. A "conservative ammo acid substitution" is one in which the ammo acid residue is replaced with an amino acid residue having a similar side chain. For example, one or more amino acids can be substituted by another ammo acid of a similar polarity, which acts as a functional equivalent, resulting in a silent alteration. Substitutes for an amino acid within the ammo acid sequence of a polypeptide of the present invention may be selected from other members of the class to which the ammo acid belongs. For example, the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine Ammo acids containing aromatic ring structures are phenylalanine, tryptophan, and tyrosine. The polar neutral ammo acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. The positively charged (basic) ammo acids include arginine, lysine and histidine The negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Such alterations will not be expected to effect apparent molecular weight as determined by polyacrylamide gel electrophoresis, or lsoelectπc point.
Particularly preferred substitutions are-
- Lys for Arg and vice versa such that a positive charge may be maintained;
- Glu for Asp and vice versa such that a negative charge may be maintained;
- Ser for Thr such that a free -OH can be maintained; and - Gin for Asn such that a free NH2 can be maintained.
Moreover, amino acid substitutions may also be introduced to substitute an amino acid with a particularly preferable property. For example, a Cys may be introduced for a potential site for disulfide bridges with another Cys. A His may be introduced as a particularly "catalytic" site (1 e , His can act as an acid or base and is the most common amino acid in biochemical catalysis). Pro may be introduced because of its particularly planar structure, which induces 3-turns in the protein's structure.
Mutations can also be introduced randomly along all or part of a GAVE 19 coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for GAVE19 biological activity to identify mutants that retain activity. Following mutagenesis, the encoded protein can be expressed recombmantly and the activity of the protein can be determined.
Variants of the present invention can function as a GAVE 19 agonist (mimetic) or as GAVE 19 antagonist. Variants of the GAVE19 protein can be generated by mutagenesis, e.g, discrete point mutation or truncation of the GAVE19 protein. An agonist of the GAVE19 protein can retain substantially the same or a subset of the biological activities of the naturally occurring GAVE 19 protein For example, an antagonist of the GAVE 19 protein can competitively bind to a downstream or upstream member of a cellular signaling cascade that includes the GAVE 19 protein, and thus inhibit one or more of the activities of the naturally occurring form of the GAVE 19 protein. Thus, specific biological effects can be elicited by treatment with a variant of limited function. Treatment of a subject with a variant having a subset of the biological activities of the naturally occurring form of the protein can have fewer side effects in a subject relative to treatment with the naturally occurring form of the GAVE 19 proteins. Variants of the GAVE 19 protein that function as either GAVE 19 agonists (mimetics) or as GAVE 19 antagonists can be identified by screening combinatorial libraries of mutants, e.g, truncation mutants, of the GAVE 19 protein for GAVE 19 agonist or antagonist activity. In one embodiment, a variegated library of GAVE 19 variants is generated by combinatorial mutagenesis at the nucleic acid level, and is encoded by a variegated gene library. A variegated library of GAVE 19 variants can be produced by, for example, enzymatically ligatmg a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential GAVE 19 sequences is expressed as individual polypeptides or alternatively, as a set of larger fusion proteins (e.g, for phage display) containing the set of GAVE19 sequences therein. There are a variety of methods that can be used to produce libraries of potential GAVE19 variants from a degenerate ohgonucleotide sequence. Chemical synthesis of a degenerate gene sequence can be performed in an automated DNA synthesizer and the synthetic gene then hgated into an appropriate expression vector. Use of a degenerate set of genes allows for the provision, in one mixture, of all of the sequences encoding the desired set of potential GAVE 19 sequences. Methods for synthesizing degenerate oligonucleotides are known in the art (see, e.g, Narang, Tetrahedron (1983) 39:3; Itakura et al, Ann Rev Biochem (1984) 53:323; Itakura et al. Science (1984) 198- 1056; Ike et al. Nucleic Acid Res (1983) 1 1 :477).
In addition, libraries of fragments of the GAVE 19 protein coding sequence can be used to generate a variegated population of GAVE19 fragments for screening and subsequent selection of variants of a GAVE19 protein. In one embodiment, a library of coding sequence fragments can be generated by treating a double-stranded PCR fragment of a GAVE19 coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double-stranded DNA, renatuπng the DNA to form double-stranded DNA that can include sense/antisense pairs from different nicked products, removing single-stranded portions from reformed duplexes by treatment with SI nuclease and ligatmg the resulting fragment library into an expression vector. By this method, an expression library can be derived that encodes N-termmal and internal fragments of various sizes of the GAVE 19 protein.
Several techniques are known in the art for screening gene products of combinatorial libraries made by point mutations or truncation and for screening cDNA libraries for gene products having a selected property. Such techniques are adaptable for rapid screening of the gene libraries generated by the combinatorial mutagenesis of GAVE19 proteins. The most widely used techniques that are amenable to high through-put analysis for screening large gene libraries typically include cloning the gene library into rephcable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates isolation of the vector encoding the gene whose product was detected. Recursive ensemble mutagenesis (REM), a technique that enhances the frequency of functional mutants in the libraries, can be used in combination with the screening assays to identify GAVE 19 variants (Arkin et al, Proc Natl Acad Sci USA (1992) 89.7811-7815; Delgrave et al. Protein Engineering (1993) 6(3):327-331).
Analogs and Derivatives of GAVF19 Moreover, the present invention also includes derivatives or analogs of GAVE 19 produced from a chemical modification. A GAVE 19 protein of the present invention may be derivatized by the attachment of one or more chemical moieties to the protein moiety.
Chemical Moieties For Derivatization. The chemical moieties suitable for derivatization may be selected from among water soluble polymers so that the GAVE 19 analog or derivative does not precipitate in an aqueous environment, such as a physiological environment. Optionally, the polymer will be pharmaceutically acceptable. One skilled in the art will be able to select the desired polymer based on such considerations as whether the polymer/component conjugate will be used therapeutically, and if so, the desired dosage, circulation time, resistance to proteolysis, and other considerations. For GAVE 19, these may be ascertained using the assays provided herein. Examples of water soluble polymers having applications herein include, but are not limited to, polyethylene glycol, copolymers of ethylene glycol/propylene glycol, carboxymethylcellulose, dextran, polyvinyl alcohol, polyvmyl pyrrohdone, poly-1, 3-dιoxolane, poly-l,3,6-tπoxane, ethylene/maleic anhydride copolymer, polyaminoacids (either homopolymers or random copolymers), dextran, poly(n-vιnyl pyrrohdone)polyethylene glycol, propropylene glycol homopolymers, polypropylene oxide/ethylene oxide co- polymers, polyoxyethylated polyols or polyvinyl alcohol. Polyethylene glycol propionaldenhyde may have advantages in manufacturing due to its stability in water.
The polymer may be of any molecular weight, and may be branched or unbranched. For polyethylene glycol, the preferred molecular weight is between about 2 kDa and about 100 kDa (the term "about" indicating that in preparations of polyethylene glycol, some molecules will weigh more, some less, than the stated molecular weight) for ease in handling and manufacturing. Other sizes may be used, depending on the desired therapeutic profile (e g , the duration of sustained release desired, the effects if any, on biological activity, the ease in handling, the degree or lack of antigenicity and other known effects of the polyethylene glycol to a therapeutic protein or analog).
The number of polymer molecules so attached to GAVE 19 may vary, and one skilled in the art will be able to ascertain the effect on function One may mono-deπvatize, or may provide for a di-, tπ-, tetra- or some combination of derivatization, with the same or different chemical moieties (e g , polymers, such as different weights of polyethylene glycols). The proportion of polymer molecules to GAVE 19 molecules will vary, as will their concentrations in the reaction mixture. In general, the optimum ratio (in terms of efficiency of reaction in that there is no excess unreacted component or components and polymer) will be determined by factors such as the desired degree of derivatization (e g , mono, di-, tπ-, etc.), the molecular weight of the polymer selected, whether the polymer is branched or unbranched, and the reaction conditions.
The polyethylene glycol molecules (or other chemical moieties) should be attached to GAVE 19 with consideration of effects on functional or antigenic domains of GAVE 19. There are a number of attachment methods available to those skilled in the art, e g , EP 0 401 384 herein incorporated by reference (coupling PEG to G-CSF), see also Malik et al, 1992, Exp. Hematol. 20:1028-1035 (reporting pegylation of GM-CSF using tresyl chloride) For example, polyethylene glycol may be covalently bound through amino acid residues via a reactive group, such as a free ammo or carboxyl group. Reactive groups are those to which an activated polyethylene glycol molecule may be bound. The ammo acid residues having a free amino group include lysme residues and the N- terminal ammo acid residues; those having a free carboxyl group include aspartic acid residues, glutamic acid residues and the C-terminal ammo acid residue. Sulfhydryl groups may also be used as a reactive group for attaching the polyethylene glycol molecule(s). Preferred for therapeutic purposes is attachment at an amino group, such as attachment at the N-terminus or lysine group
One may specifically desire N-termmally chemically modified GAVE 19. Using polyethylene glycol as an illustration of the present compositions, one may select from a variety of polyethylene glycol molecules (by molecular weight, branching, etc.), the proportion of polyethylene glycol molecules to GAVE 19 molecules in the reaction mix, the type of pegylation reaction to be performed, and the method of obtaining the selected N-termmally pegylated protein. The method of obtaining the N- terminally pegylated preparation (l e , separating this moiety from other monopegylated moieties if necessary) may be by purification of the N-termmally pegylated material from a population of pegylated protein molecules. Selective N-termmal chemical modification may be accomplished by reductive alkylation which exploits differential reactivity of different types of primary ammo groups (lysine versus the N-termmal) available for derivatization in GAVE 19. Under the appropriate reaction conditions, substantially selective derivatization of GAVE 19 at the N-terminus with a carbonyl group containing polymer is achieved. For example, one may selectively N-terminally pegylate GAVE 19 by performing the reaction at a pH which allows one to take advantage of the pKa differences between the e-ammo groups of the lysine residues and that of the α-ammo group of the N-termmal residue of GAVE19. By such selective derivatization, attachment of a water soluble polymer to GAVE19 is controlled- the conjugation with the polymer takes place predominantly at the N-terminus of GAVE 19 and no significant modification of other reactive groups, such as the lysine side chain amino groups, occurs. Using reductive alkylation, the water soluble polymer may be of the type described above, and should have a single reactive aldehyde for coupling to GAVE 19. Polyethylene glycol propnonaldehyde, containing a single reactive aldehyde, may be used.
Antibodies of GAVE1 , variants thereof, fragments thereof, or analogs or derivatives thereof An isolated GAVE 19 protein or a portion or fragment thereof, can be used as an immunogen to generate antibodies that bind GAVE 19 using standard techniques for polyclonal and monoclonal antibody preparation. The term "antibody" as used herein refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen-bindmg site that specifically binds an antigen, such as GAVE 19, or a fragment thereof. A molecule that specifically binds to GAVE 19 is a molecule that binds GAVE 19, but does not substantially bind other molecules in a sample, e.g, a biological sample that naturally contains GAVE 19. Examples of immunologically active portions of immunoglobulin molecules include F(ab> and F(ab')2 fragments that can be generated by treating the antibody with an enzyme such as pepsin. The invention provides polyclonal, monoclonal and chimenc antibodies that have GAVE 19, a variant thereof, a fragment thereof, or an analog or derivative thereof, as an immunogen
The full-length GAVE 19 protein can be used or, alternatively, the invention provides antigenic peptide fragments of GAVE19 for use as immunogens. The antigenic peptide of GAVE19 comprises at least 8 (preferably 10, 15, 20, 30 or more) ammo acid residues of the amino acid sequence shown in SEQ ED NO'2 and encompasses an epitope of GAVE19 such that an antibody raised against the peptide forms a specific immune complex with GAVE 19.
A GAVE 19 immunogen typically is used to prepare antibodies by immunizing a suitable subject, (e g , rabbit, goat, mouse or other mammal) with the immunogen. An appropriate immunogenic preparation can contain, for example, recombmantly expressed GAVE 19 protein or a chemically synthesized
GAVE 19 polypeptide. The preparation further can include an adjuvant, such as Freund's complete or incomplete adjuvant or similar immunostimulatory agent. Immunization of a suitable subject with an immunogenic GAVE19 preparation induces a polyclonal antι-GAVE19 antibody response. An antibody of the present invention can be a monoclonal antibody, a polyclonal antibody, or a chimenc antibody. The term "monoclonal antibody" or "monoclonal antibody composition", as used herein, refers to a population of antibody molecules that contain only one species of an antigen-bmdmg site capable of lmmunoreacting with a particular epitope of GAVE 19. A monoclonal antibody composition thus typically displays a single binding affinity for a particular GAVE 19 protein epitope.
Polyclonal antι-GAVE19 antibodies can be prepared as described above by immunizing a suitable subject with a GAVE 19 immunogen The antι-GAVE19 antibody titer in the immunized subject can be monitored over time by standard techniques, such as with an enzyme-linked immunosorbent assay (ELISA) using immobilized GAVE 19. If desired, the antibody molecules directed against GAVE 19 can be isolated from the mammal (e.g, from the blood) and further purified by well-known techniques, such as protein A chromatography, to obtain the IgG fraction. At an appropriate time after immunization, e.g, when the antι-GAVE19 antibody titers are highest, antibody-producing cells can be obtained from the subject and used to prepare monoclonal antibodies by standard techniques, such as the hybridoma technique originally described by Kohler et al. Nature (1975) 256:495-497, the human B cell hybridoma technique (Kohler et al, Immunol Today (1983) 4:72), the EBV hybridoma technique (Cole et al. Monoclonal Antibodies and Cancer Therapy, (1985), Alan R. Liss, Inc., pp. 77-96) or tπoma techniques. The technology for producing hybridomas is well known (see generally Current Protocols in Immunology (1994) Cohgan et al, eds, John Wiley & Sons, Inc., New York, NY) Briefly, an immortal cell line (typically a myeloma) is fused to lymphocytes (typically splenocytes) from a mammal immunized with a GAVE 19 immunogen as described above and the culture supernatants of the resulting hybridoma cells are screened to identify a hybridoma producing a monoclonal antibody that binds GAVE19.
Any of the many well known protocols used for fusing lymphocytes and immortalized cell lines can be applied for the purpose of generating an antι-GAVE19 monoclonal antibody (see, e g , Current Protocols in Immunology, supra, Galfre et al. Nature (1977) 266:550-552; Kenneth, in Monoclonal Antibodies A New Dimension In Biological Analyses, Plenum Publishing Corp, New York, N.Y. (1980), and Lerner, Yale J Biol Med (1981) 54:387-402) Moreover, the ordinarily skilled worker will appreciate that there are many variations of such methods that also would be useful. Typically, the immortal cell line (e.g , a myeloma cell line) is derived from the same mammalian species as the lymphocytes. For example, murine hybridomas can be made by fusing lymphocytes from a mouse immunized with an immunogenic preparation of the instant invention with an immortalized mouse cell line, e.g, a myeloma cell line that is sensitive to culture medium containing hypoxanthine, ammopteπn and thymidine ("HAT medium"). Any of a number of myeloma cell lines can be used as a fusion partner according to standard techniques, e.g, the P3-NSl/l-Ag4-l, P3-x63-Ag8.653 or Sp2/0-Agl4 myeloma lines. The myeloma lines are available from ATCC. Typically, HAT-sensitive mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol ("PEG"). Hybridoma cells resulting from the fusion then are selected using HAT medium that kills unfused and unproductively fused myeloma cells (unfused splenocytes die after several days because they are not transformed). Hybridoma cells producing a monoclonal antibody of the invention are detected by screening the hybridoma culture supernatants for antibodies that bind GAVE 19, e.g, using a standard ELISA assay.
Alternative to preparing monoclonal antibody-secreting hybridomas, a monoclonal antι-GAVE19 antibody can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e.g, an antibody phage display library) with GAVE 19 thereby to isolate immunoglobulin library members that bind GAVE 19. Kits for generating and screening phage display libraries are commercially available (e.g, the Pharmacia Recombinant Phage Antibody System, Catalog No. 27-9400-01; and the Stratagene "SURFZAP" Phage Display Kit, Catalog No. 240612).
Additionally, examples of methods and reagents particularly amenable for use in generating and screening antibody display libraries can be found in, for example, U.S. Patent No. 5,223,409; PCT Publication No. WO 92/18619; PCT Publication No. WO 91/17271; PCT Publication
No. WO 92/20791; PCT Publication No. WO 92/15679; PCT Publication No. WO 93/01288; PCT Publication No. WO 92/01047; PCT Publication No. WO 92/09690; PCT Publication No. WO 90/02809; Fuchs et al, Bio/Technology (1991) 9: 1370-1372; Hay et al. Hum Antibody Hybridomas (1992) 3:81-85; Huse et al. Science (1989) 246:1275-1281; and Griffiths et al, EMBO J (1993) 25(12).725-734.
Furthermore, recombinant antι-GAVE19 antibodies, including, e.g , monoclonal and chimenc antibodies, can be made using standard recombinant DNA techniques. Such antibodies can be produced by recombinant DNA techniques known in the art, for example using methods described in PCT Publication No. WO 87/02671; Europe Patent Application No. 184,187; Europe Patent Application No. 171,496; Europe Patent Application No. 173,494; PCT Publication No. WO 86/01533; U.S. Patent No. 4,816,567; Europe Patent Application No. 125,023; Better et al. Science (1988) 240: 1041-1043; Liu et al, Proc Natl Acad Sci USA (1987) 84:3439-3443; Lin et al, J Immunol (1987) 139:3521-3526; Sun et al, Proc Natl Acad Sci USA (1987) 84:214-218; Nishimura et al. Cane Res (1987) 47:999-1005; Wood et al. Nature (1985) 314:446-449; Shaw et al, J Natl Cancer Lnst (1988) 80.1553-1559; Morrison, Science (1985) 229:1202-1207; Oi et al, Bio/Techniques (1986) 4:214; U S. Patent No. 5,225,539; Jones et al. Nature (1986) 321 :552-525, Verhoeyan et al. Science (1988) 239: 1534; and Beidler et al, J Immunol (1988) 141:4053-4060.
An antι-GAVE19 antibody (e.g, monoclonal antibody) can be used to isolate GAVE19 by standard techniques, such as affinity chromatography or lmmunoprecipitation. An antι-GAVE19 antibody can facilitate the purification of natural GAVE19 from cells and of recombmantly produced GAVE19 expressed in host cells. Moreover, an antι-GAVE19 antibody can be used to detect GAVE19 protein (e.g, in a cellular lysate or cell supernatant) to evaluate the abundance and pattern of expression of the GAVE19 protein. Antι-GAVE19 antibodies can be used diagnostically to monitor protein levels in tissue as part of a clinical testing procedure, for example, to determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling the antibody to a detectable substance, which are described infra.
Detectable T .ahels
Optionally, isolated nucleic acid molecules of the present invention, polypeptides of the present invention, and antibodies of the present invention, as well as fragments of such moieties, may be detectably labeled. Suitable labels include enzymes, fluorophores (e g , fluorescene isothiocyanate (FITC), phycoerythnn (PE), Texas red (TR), rhodamine, free or chelated lanthamde series salts, especially Eu +, to name a few fluorophores), chromophores, radioisotopes, chelating agents, dyes, colloidal gold, latex particles, ligands (e g , biotin), bioluminescent materials, and chemiluminescent agents When a control marker is employed, the same or different labels may be used for the receptor and control marker.
In the instance where a radioactive label, such as the isotopes 3H, l4C, 32P, 35S, 36C1, 51Cr, 57Co, 58Co, 59Fe, 90Y, l25I, 13II, and 186Re are used, known currently available counting procedures may be utilized In the instance where the label is an enzyme, detection may be accomplished by any of the presently utilized coloπmetπc, spectrophotometπc, fluorospectrophotometπc, amperometπc or gasometπc techniques known in the art.
Direct labels are one example of labels which can be used according to the present invention. A direct label has been defined as an entity, which in its natural state, is readily visible, either to the naked eye, or with the aid of an optical filter and/or applied stimulation, e.g. U.V. light to promote fluorescence. Among examples of colored labels, which can be used according to the present invention, include metallic sol particles, for example, gold sol particles such as those described by Leuveπng (U.S. Patent 4,313,734); dye sole particles such as described by Gnbnau et al. (U.S. Patent 4,373,932) and May et al. (WO 88/08534); dyed latex such as described by May, supra, Snyder (EP-A 0 280 559 and 0 281 327); or dyes encapsulated in liposomes as described by Campbell et al. (U.S. Patent 4,703,017). Other direct labels include a radionucleotide, a fluorescent moiety or a luminescent moiety. In addition to these direct labelling devices, indirect labels comprising enzymes can also be used according to the present invention. Various types of enzyme linked lmmunoassays are well known in the art, for example, alkaline phosphatase and horseradish peroxidase, lysozyme, glucose-6- phosphate dehydrogenase, lactate dehydrogenase, urease, these and others have been discussed in detail by Eva Engvall in Enzyme Immunoassay ELISA and EMIT in Methods in Enzymology, 70. 419- 439, 1980 and m U.S. Patent 4,857,453.
Other labels for use in the invention include magnetic beads or magnetic resonance imaging labels.
In another embodiment, a phosphorylation site can be created on an isolated polypeptide of the present invention, an antibody of the present invention, or a fragment thereof, for labeling with P, e g , as described in European Patent No. 0372707 or U.S. Patent No. 5,459,240, issued October 17, 1995 to Foxwell et al.
As exemplified herein, proteins, including antibodies, can be labeled by metabolic labeling. Metabolic labeling occurs during in vitro incubation of the cells that express the protein m the presence of culture medium supplemented with a metabolic label, such as [ S]-methιonme or [ P]- orthophosphate. In addition to metabolic (or biosynthetic) labeling with [ S] -methionine, the invention further contemplates labeling with [ C]-ammo acids and [ H]-ammo acids (with the tritium substituted at non-labile positions).
Recombinant Expression Vectors and Host Cells Another aspect of the invention pertains to vectors, preferably expression vectors, containing a nucleic acid encoding GAVE 19 (or a portion thereof). As explained above, one type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into a viral genome. Certain vectors are capable of autonomous replication in a host cell (e.g, bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g, non-episomal mammalian vectors) are integrated into the genome of a host cell on introduction into the host cell and thereby are replicated along with the host genome. Moreover, expression vectors are capable of directing the expression of genes operably linked thereto. In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids (vectors). However, the invention is intended to include other forms of expression vectors, such as viral vectors (e.g, replication defective retroviruses, adenoviruses and adeno-associated viruses), that serve equivalent functions.
A recombinant expression vector of the invention comprises a nucleic acid molecule of the present invention in a form suitable for expression of the nucleic acid in a host cell. That means a recombinant expression vector of the present invention includes one or more regulatory sequences, selected on the basis of the host cells to be used for expression, that is operably linked to the nucleic acid to be expressed Within a recombinant expression vector, "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner that allows for expression of the nucleotide sequence (e.g, in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell). The term "regulatory sequence" is intended to include promoters, enhancers and other expression control elements (e.g, polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology:
Methods in Enzymology Vol. 185, Academic Press, San Diego, CA (1990). Regulatory sequences include those that direct constitutive expression of the nucleotide sequence m many types of host cells (e.g, tissue specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of host cell to be transformed, the level of expression of protein desired etc. The expression vectors of the invention can be introduced into host cells to produce proteins or peptides encoded by nucleic acids as described herein (e.g , GAVE 19 proteins, mutant forms of GAVE 19, fusion proteins etc.).
A recombinant expression vector of the invention can be designed for expression of GAVE 19 in prokaryotic or eukaryotic cells, e.g, bacterial cells such as E coli, insect cells (using baculovirus expression vectors), yeast cells or mammalian cells. Suitable host cells are discussed further in Goeddel, supra. Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using phage regulatory elements and proteins, such as, a T7 promoter and/or a T7 polymerase.
Expression of proteins in prokaryotes is most often carried out in E. coli with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, usually to the ammo terminus of the recombinant protein. Such fusion vectors typically serve three purposes: 1) to increase expression of recombinant protein; 2) to increase the solubility of the recombinant protein; and 3) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein. Such enzymes and the cognate recognition sequences, include Factor Xa, thrombin and enterokinase. Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith et al. Gene (1988) 67:31-40), pMAL (New England Biolabs, Beverly, MA) and pRITS (Pharmacia, Piscataway, NJ), that fuse glutathione 5 -transferase (GST), maltose E binding protein or protein A, respectively, to the target recombinant protein.
Examples of suitable inducible non-fusion E. coh expression vectors include pTrc (Amann et al. Gene (1988) 69:301-315) and pET 1 Id (Studier et al. Gene Expression Technology: Methods in Enzymology, Academic Press, San Diego, California (1990) 185:60-89). Target gene expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-lac fusion promoter.
One strategy to maximize recombinant protein expression in E. coli is to express the protein in a host with impaired capacity to cleave proteolytically the recombinant protein (Gottesman, Gene Expression Technology: Methods in Enzymology, Academic Press, San Diego, California (1990) 185:119-128). Another strategy is to alter the nucleic acid sequence of the nucleic acid molecule to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in E coli (Wada et al. Nucleic Acids Res (1992) 20:2111-2118). Such alteration of nucleic acid sequences of the invention can be carried out by standard DNA synthesis techniques.
In another embodiment, the GAVE 19 expression vector is a yeast expression vector. Examples of vectors for expression in yeast such as S. cerevisiae include pYepSecl (Baldan et al, EMBO J (1987) 6-229-234), pMFa (Kurjan et al. Cell (1982) 30:933-943), pJRY88 (Schultz et al. Gene (1987) 54:113-123), pYES2 (Lnvitrogen Corporation, San Diego, CA) and pPicZ (Invitrogen Corp, San Diego, CA).
Alternatively, GAVE19 can be expressed in insect cells using baculovirus expression vectors. Baculovirus vectors available for expression of proteins in cultured insect cells (e.g, Sf 9 cells) include the pAc series (Smith et al, Mol Cell Biol (1983) 3:2156-2165) and the pVL series (Lucklow et al. Virology (1989) 170:31-39). In yet another embodiment, a nucleic acid of the invention is expressed in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors having applications herein include, but certainly are not limited to pCDM8 (Seed, Nature (1987) 329:840) and pMT2PC (Kaufman et al, EMBO J (1987) 6: 187-195). When used in mammalian cells, control functions of the expression vector often are provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus and simian virus 40. For other suitable expression systems for both prokaryotic and eukaryotic cells, see chapters 16 and 17 of Sambrook et al , supra.
In another embodiment, a recombinant mammalian expression vector of the present invention is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g, tissue-specific regulatory elements are used to express the nucleic acid). Tissue-specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert et al. Genes Dev (1987) 1:268-277), lymphoid-specific promoters (Calame et al, Adv Immunol (1988) 43:235-275), in particular, promoters of T cell receptors (Winoto et al, EMBO J (1989) 8:729-733) and immunoglobulins (Banerji et al. Cell (1983) 33:729-740; Queen et al. Cell (1983) 33:741-748), neuron-specific promoters (e.g, the neurofilament promoter; Byrne et al, Proc Natl Acad Sci USA (1989) 86:5473-5477), pancreas-specific promoters (Edlund et al. Science (1985) 230:912-916) and mammary gland-specific promoters (e.g, milk whey promoter; U.S. Patent No. 4,873,316 and Europe Application No. 264,166).
Developmentally-regulated promoters also are encompassed, for example the murine hox promoters (Kessel et al. Science (1990) 249:374-379) and the α-fetoprotein promoter (Campes et al. Genes Dev (1989) 3:537-546).
The invention further provides a recombinant expression vector comprising a DNA molecule of the invention cloned into an expression vector in an antisense orientation. That is, the DNA molecule is operably linked to a regulatory sequence in a manner that allows for expression (by transcription of the DNA molecule) of an RNA molecule that is antisense to GAVE 19 mRNA. Regulatory sequences operably linked to a nucleic acid cloned in the antisense orientation can be chosen that direct the continuous expression of the antisense RNA molecule in a variety of cell types. For example, viral promoters and/or enhancers or regulatory sequences can be chosen that direct constitutive, tissue-specific or cell type-specific expression of antisense RNA. The antisense expression vector can be in the form of a recombinant plasmid, phagemid or attenuated virus in which antisense nucleic acids are produced under the control of a high efficiency regulatory region, the activity of which can be determined by the cell type into which the vector is introduced. For a discussion of the regulation of gene expression using antisense genes, see Wemtraub et al. (Reviews-Trends in Genetics, Vol. 1(1)1986).
Another aspect of the present invention pertains to host cells into which a recombinant expression vector of the invention has been introduced The terms "host cell" and "recombinant host cell" are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but also to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but still are included within the scope of the term as used herein
A host cell can be any prokaryotic or eukaryotic cell. For example, GAVE 19 protein can be expressed in bacterial cells such as E coh, insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO), 293 cells or COS cells). Other suitable host cells are known to those skilled in the art. Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection" are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g, DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, transduction, DEAE-dextran-mediated transfection, pofection or electroporation.
For stable transfection of mammalian cells, it is known that, depending on the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into the genome. To identify and to select the integrants, a gene that encodes a selectable marker (e.g, for resistance to antibiotics) generally is introduced into the host cells along with the gene of interest Preferred selectable markers include those that confer resistance to drugs, such as G418, hygromycm and methotrexate. Nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as that encoding GAVE 19 or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e g, cells that have incorporated the selectable marker gene will survive, while the other cells die).
A host cell of the present invention, such as a prokaryotic or eukaryotic host cell in culture, can be used to produce (i.e., express) GAVE19 protein Accordingly, the invention further provides methods for producing GAVE19 protein using the host cells of the invention In one embodiment, the method comprises cultuπng a host cell of the present invention (into which a recombinant expression vector encoding GAVE 19 has been introduced) in a suitable medium such that GAVE 19 protein is produced. In another embodiment, the method further comprises isolating GAVE 19 from the medium or the host cell.
In another embodiment, GAVE 19 comprises an inducible expression system for the recombinant expression of other proteins subcloned in modified expression vectors. For example, host cells comprising a mutated G protein (e g, yeast cells, Y2 adrenocortical cells and eye" S49, see U.S. Pat. Nos. 6,168,927 Bl, 5,739,029 and 5,482,835; Mitchell et al, Proc Natl Acad Sci USA (1992) 89(19):8933-37 and Katada et al, J Biol Chem (1984) 259(6):3586-95) are transduced with a first expression vector comprising a nucleic acid sequence encoding GAVE 19, wherein GAVE 19 is functionally expressed in the host cells. Even though the expressed GAVE19 is constitutively active, the mutation does not allow for signal transduction; i.e., no activation of a G-protein directed downstream cascade occurs (e.g, no adenylyl cyclase activation). Subsequently, a second expression vector is used to transduce the GAVE19-compπsιng host cells. The second vector comprises a structural gene that complements the G protein mutation of the host cell (i.e., functional mammalian or yeast Gs, G„ G0, or Gq, e.g, see PCT Publication No. WO 97/48820; U.S. Pat. Nos. 6,168,927 Bl, 5,739,029 and 5,482,835) in addition to the gene of interest to be expressed by the inducible system. The complementary structural gene of the second vector is inducible; i.e., under the control of an exogenously added component (e.g, tetracyclme, EPTG, small molecules etc, see Sambrook et al. supra) that activates a promoter which is operably linked to the complementary structural gene. On addition of the inducer, the protein encoded by the complementary structural gene is functionally expressed such that the constitutively active GAVE 19 now will form a complex that leads to appropriate downstream pathway activation (e.g, second messenger formation). The gene of interest comprising the second vector possesses an operably linked promoter that is activated by the appropriate second messenger (e.g, CREB, API elements). Thus, as second messenger accumulates, the promoter upstream from the gene of interest is activated to express the product of said gene. When the mducer is absent, expression of the gene of interest is switched off.
In a particular embodiment, the host cells for the inducible expression system include, but are not limited to, S49 (eye") cells. While cell lines are contemplated that comprise G-protem mutations, suitable mutants may be artificially produced/constructed (see U.S. Pat. Nos. 6,168,927 Bl, 5,739,029 and 5,482,835 for yeast cells).
In a related aspect, the cells are transfected with a vector operably linked to a cDNA comprising a sequence encoding a protein as set forth in SEQ ID NO:2. The first and second vectors comprising said system are contemplated to include, but are not limited to, pCDM8 (Seed, Nature (1987) 329:840) and pMT2PC (Kaufman et al, EMBO J (1987) 6: 187-195), pYepSecl (Baldan et al, EMBO J (1987) 6:229-234), pMFa (Kurjan et al. Cell (1982) 30:933-943), pJRY88 (Schultz et al. Gene (1987) 54: 1 13-123), pYES2 (Invitrogen Corporation, San Diego, CA) and pPicZ (Invitrogen Corp, San Diego, CA). In a related aspect, the host cells may be transfected by such suitable means, wherein transfection results in the expression of a functional GAVE19 protein (e.g, Sambrook et al, supra, and Kπegler, Gene Transfer and Expression: A Laboratory Manual, Stockton Press, New York, NY, 1990). Such "functional proteins" include, but are not limited to, proteins that once expressed, form complexes with G-protems, where the G-protems regulate second messenger formation. Other methods for transfecting host cells that have applications herein include, but certainly are not limited to transfection, electroporation, micromjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, hpofection (lysosome fusion), use of a gene gun, or a DNA vector transporter (see, e g, Wu et al, 1992, J. Biol. Chem. 267:963-967; Wu and Wu, 1988, J. Biol. Chem. 263:14621- 14624; Hartmut et al, Canadian Patent Application No. 2,012,311, filed March 15, 1990).
A large variety of promoters have applications in the present invention. Indeed, expression of a polypeptide of the present invention may be controlled by any promoter/enhancer element known in the art, but these regulatory elements must be functional in the host selected for expression. Promoters which may be used to control GAVE 19 expression include, but are not limited to, the SV40 early promoter region (Benoist and Chambon, 1981 , Nature 290:304-310), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto, et al, 1980, Cell 22:787- 797), the herpes thymidme kinase promoter (Wagner et al, 1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445), the regulatory sequences of the metallothionem gene (Bπnster et al, 1982, Nature 296:39-42); prokaryotic expression vectors such as the /3-lactamase promoter (Villa-Kamaroff, et al, 1978, Proc. Natl Acad. Sci. U.S.A. 75:3727-3731), or the tac promoter (DeBoer, et al, 1983, Proc. Natl. Acad. Sci. U.S.A. 80:21-25); see also "Useful proteins from recombinant bacteria" in Scientific American, 1980, 242:74-94; promoter elements from yeast or other fungi such as the Gal 4 promoter, the ADC (alcohol dehydrogenase) promoter, PGK (phosphoglycerol kinase) promoter, alkaline phosphatase promoter; and the animal transcriptional control regions, which exhibit tissue specificity and have been utilized in transgemc animals: elastase I gene control region which is active m pancreatic acinar cells (Swift et al, 1984, Cell 38:639-646; Ornitz et al, 1986, Cold Spring Harbor Symp. Quant. Biol. 50:399-409; MacDonald, 1987, Hepatology 7:425-515); insulin gene control region which is active m pancreatic beta cells (Hanahan, 1985, Nature 315: 115-122), immunoglobulin gene control region which is active in lymphoid cells (Grosschedl et al, 1984, Cell 38:647-658; Adames et al, 1985, Nature 318:533-538; Alexander et al, 1987, Mol. Cell. Biol. 7: 1436-1444), mouse mammary tumor virus control region which is active in testicular, breast, lymphoid and mast cells (Leder et al, 1986, Cell 45:485-495), albumin gene control region which is active in liver (Pinkert et al, 1987, Genes and Devel. 1 :268-276), alpha-fetoprotein gene control region which is active in liver (Krumlauf et al, 1985, Mol. Cell. Biol. 5:1639-1648; Hammer et al, 1987, Science 235:53-58), alpha 1 -anti trypsin gene control region which is active in the liver (Kelsey et al, 1987, Genes and Devel. 1: 161-171), beta-globin gene control region which is active in myeloid cells (Mogram et al, 1985, Nature 315:338-340; Kolhas et al, 1986, Cell 46:89-94), myelin basic protein gene control region which is active m ohgodendrocyte cells in the bram (Readhead et al, 1987, Cell 48:703-712), myosin light cham-2 gene control region which is active in skeletal muscle (Sam, 1985, Nature 314:283-286), and gonadotropic releasing hormone gene control region which is active in the hypothalamus (Mason et al, 1986, Science 234:1372-1378).
Expression vectors containing a nucleic acid molecule of the invention can be identified by four general approaches: (a) PCR amplification of the desired plasmid DNA or specific mRNA, (b) nucleic acid hybridization, (c) presence or absence of selection marker gene functions, and (d) expression of inserted sequences. In the first approach, the nucleic acids can be amplified by PCR to provide for detection of the amplified product. In the second approach, the presence of a foreign gene inserted in an expression vector can be detected by nucleic acid hybridization using probes comprising sequences that are homologous to an inserted marker gene. Ln the third approach, the recombinant vector/host system can be identified and selected based upon the presence or absence of certain "selection marker" gene functions (e.g., 3-galactosιdase activity, thymidme kinase activity, resistance to antibiotics, transformation phenotype, occlusion body formation in baculovirus, etc.) caused by the insertion of foreign genes in the vector. In another example, if the nucleic acid encoding GAVE19 protein, a variant thereof, or an analog or derivative thereof, is inserted withm the "selection marker" gene sequence of the vector, recombmants containing the insert can be identified by the absence of the GAVE 19 gene function. In the fourth approach, recombinant expression vectors can be identified by assaying for the activity, biochemical, or immunological characteristics of the gene product expressed by the recombinant, provided that the expressed protein assumes a functionally active conformation.
A wide variety of host/expression vector combinations may be employed in expressing the DNA sequences of this invention. Useful expression vectors, for example, may consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences. Suitable vectors include derivatives of SV40 and known bacterial plasmids, e.g, E coh plasmids col El, pCRl, pBR322, pMal-C2, pET, pGEX (Smith et al , 1988, Gene 67:31-40), pMB9 and their derivatives, plasmids such as RP4; phage DNAS, e.g, the numerous derivatives of phage λ, e.g, NM989, and other phage DNA, e.g. Ml 3 and filamentous single stranded phage DNA; yeast plasmids such as the 2μ plasmid or derivatives thereof; vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells; vectors derived from combinations of plasmids and phage DNAs, such as plasmids that have been modified to employ phage DNA or other expression control sequences; and the like.
For example, in a baculovirus expression systems, both non-fusion transfer vectors, such as but not limited to pVL941 (BamHl cloning site; Summers), pVL1393 (BamHl, Sma\, Xba\, EcoRl, Notl, Xmam, BgHI, and Pstl cloning site; Invitrogen), pVL1392 (BglU, Pstl, Notl, XmaUl, EcoRl, Xbal, Smal, and BamHl cloning site, Summers and Invitrogen), and pBlucδαcIII (BamR\, Bglϊ , Pstl, Ncol, and HindlU cloning site, with blue/white recombinant screening possible; Invitrogen), and fusion transfer vectors, such as but not limited to pAc700 (BamHl and Kpnl cloning site, in which the BamHl recognition site begins with the initiation codon; Summers), pAc701 and pAc702 (same as pAc700, with different reading frames), pAc360 (BamHl cloning site 36 base pairs downstream of a polyhedπn initiation codon; Invιtrogen(195)), and pBlueBacHisA, B, C (three different reading frames, with BamΑl, BglU, Pstl, Ncol, and Hindm cloning site, an N-terminal peptide for ProBond purification, and blue/white recombinant screening of plaques; Invitrogen (220)) can be used.
Mammalian expression vectors contemplated for use in the invention include vectors with inducible promoters, such as the dihydrofolate reductase (DHFR) promoter, e g , any expression vector with a DHFR expression vector, or a .DH R/mefhotrexate co-amplification vector, such as pED (Pstl, Sail, Sbal, Smal, and EcoRl cloning site, with the vector expressing both the cloned gene and DHFR; see Kaufman, Current Protocols in Molecular Biology, 16.12 (1991). Alternatively, a glutamine synthetase/methionine sulfoximme co-amplification vector, such as pEE14 (Hindm, Jώal, Smal, Sbal, EcoRl, and Bell cloning site, in which the vector expresses glutamine synthase and the cloned gene, Celltech). In another embodiment, a vector that directs episomal expression under control of Epstein Barr Virus (EBV) can be used, such as pREP4 (BamHl, Sfιl, Xhol, Notl, Nhel, Hindm, Nhel, PvuU, and Kpnl cloning site, constitutive RSV-LTR promoter, hygromycin selectable marker; Invitrogen), pCEP4 (BamHl, Sfil, Xhol, Notl, Nhel, HindQl, Nhel, Pvull, and Kpnl cloning site, constitutive hCMV immediate early gene, hygromycin selectable marker; Invitrogen), pMEP4 (Kpnl, Pvul, Nhel, HindlU, Notl, Xhol, Sfil, BamΑl cloning site, inducible metallothionein Iia gene promoter, hygromycin selectable marker: Invitrogen), pREP8 (BamHl , Xhol, Notl, Hindm, Nhel, and Kpnl cloning site, RSV-LTR promoter, histidinol selectable marker; Invitrogen), pREP9 (Kpnl, Nhel, Hindm, Notl, Xhol, Sfil, and BamΗI cloning site, RSV-LTR promoter, G418 selectable marker; Invitrogen), and pEBVΗis (RSV-LTR promoter, hygromycin selectable marker, N-terminal peptide puπfiable via ProBond resm and cleaved by enterok ase, Invitrogen). Selectable mammalian expression vectors for use in the invention include pRc/CMV (Hindm, BstXl, Notl, Sbal, and Apal cloning site, G418 selection; Invitrogen), pRc/RSV (Hindm, Spel, BstXl, Notl, Xbal cloning site, G418 selection; Invitrogen), and others. Vaccinia virus mammalian expression vectors (see, Kaufman, 1991, supra) for use according to the invention include but are not limited to pSCl 1 (Smal cloning site, TK- and /3-gal selection), pMJ601 (Sail, Smal, Afil, Narl, BspMU, BamHl, Apal, Nhel, Sacll, Kpnl, and Hindlll cloning site; TK- and /3-gal selection), and pTKgptFIS (EcoRl, Pstl, Sail, Accl, HindR, Sbal, BamHl, and Hpa cloning site, TK or XPRT selection).
Yeast expression systems can also be used according to the invention to express GAVE 19 protein, a variant thereof, or an analog or derivative thereof. For example, the non-fusion pYES2 vector (Xbal, Sphl, Shol, Notl, GstXl, EcoRl, BstXl, BamHl, Sacl, Kpnl, and Hindlll cloning sit; Invitrogen) or the fusion pYESHisA, B, C (Xbal, Sphl, Shol, Notl, BstXl, EcoRl, BamHl, Sacl, Kpnl, and Hindm cloning site, N-termmal peptide purified with ProBond resin and cleaved with enterokinase; Invitrogen), to mention just two, can be employed according to the invention.
Once a particular recombinant DNA molecule is identified and isolated, several methods known in the art may be used to propagate it. Once a suitable host system and growth conditions are established, recombinant expression vectors can be propagated and prepared in quantity. As previously explained, the expression vectors that can be used include, but are not limited to, the following vectors or their derivatives: human or animal viruses such as vaccinia virus or adenovirus; insect viruses such as baculovirus; yeast vectors; bacteπophage vectors (e.g , lambda), and plasmid and cosmid DNA vectors, to name but a few.
In addition, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Different host cells have characteristic and specific mechanisms for the translational and post-translational processing and modification (e.g., glycosylation, cleavage [e.g., of signal sequence]) of proteins. Appropriate cell lines or host systems can be chosen to ensure the desired modification and processing of the foreign protein expressed. For example, expression in a bacterial system can be used to produce an nonglycosylated core protein product.
Transgemc Animals A host cell of the present invention also can be used to produce transgemc animals. For example, in one embodiment, a host cell of the invention is a fertilized oocyte or an embryonic stem cell into which GAVE19-codιng sequences have been introduced. Such host cells then can be used to create non-human transgemc animals into which exogenous GAVE 19 sequences have been introduced into the genome, or homologous recombinant animals in which endogenous GAVE 19 sequences have been altered. Such animals are useful for studying the function and/or activity of GAVE19 and for identifying and/or evaluating modulators of GAVE 19 activity. As used herein, a "transgemc animal" is a non-human animal, preferably a mammal, in which one or more of the cells of the animal includes a transgene. Examples of transgemc animals include non-human primates, sheep, dogs, cows, goats, chickens, rats, amphibians etc.
As used herein, the term "transgene" refers to exogenous DNA that is integrated into the genome of a cell from which a transgemc animal develops and that remains in the genome of the mature animal.
The transgene directs the expression of an encoded gene product in one or more cell types or tissues of the transgemc animal As used herein, a "homologous recombinant animal" is a non-human animal, preferably a mammal, in which an endogenous GAVE 19 gene has been altered by homologous recombination. That is accomplished between the endogenous gene and an exogenous DNA molecule introduced into a cell of the animal, e g, an embryonic cell of the animal, prior to development of the animal.
A transgemc animal of the invention can be created by introducing a GAVE19-encodmg nucleic acid molecule into the male pronuclei of a fertilized oocyte using one of the transfection methods described above. The oocyte is then allowed to develop in a pseudopregnant female foster animal. The
GAVE19 cDNA sequence e g , that of (SEQ ED NO:l), for example, can be introduced as a transgene into the genome of a non-human animal. Intronic sequences and polyadenylation signals also can be included in the transgene to increase the efficiency of expression of the transgene. A tissue-specific regulatory sequence(s) can be operably linked to the GAVE 19 transgene to direct expression of GAVE 19 protein in particular cells. Methods for generating transgemc animals via embryo manipulation and microinjection are conventional in the art and are described, for example, in U.S. Patent Nos. 4,736,866 and 4,870,009 and U.S. Patent No. 4,873,191. Similar methods are used for production of other transgemc animals with a transgene in the genome and/or expression of GAVE19 mRNA in tissues or cells of the animals. A transgemc founder animal then can be used to breed additional animals carrying the transgene. Moreover, transgemc animals carrying a transgene encoding GAVE 19 can be bred further to other transgemc animals carrying other transgenes
To create a homologous recombinant animal, a vector is prepared that contains at least a portion of a GAVE 19 gene into which a deletion, addition or substitution has been introduced thereby to alter, e.g, functionally disrupt, the GAVE19 gene. In a particular embodiment, the vector is designed such that, on homologous recombination, the endogenous GAVE19 gene is disrupted functionally (i.e., no longer encodes a functional protein; also referred to as a knock out" vector).
Alternatively, the vector can be designed such that, on homologous recombination, the endogenous GAVE 19 gene is mutated or otherwise altered but still encodes functional protein (e.g, the upstream regulatory region can be altered thereby to alter the expression of the endogenous GAVE 19 protein).
In the homologous recombination vector, the altered portion of the GAVE 19 gene is flanked at the 5' and 3' ends by an additional nucleic acid sequence of the GAVE 19 gene to allow for homologous recombination to occur between the exogenous GAVE 19 gene carried by the vector and an endogenous GAVE 19 gene in an embryonic stem cell. The additional flanking GAVE 19 nucleic acid sequence is of sufficient length for successful homologous recombination with the endogenous gene. Typically, several kilobases of flanking DNA (both at the 5' and 3' ends) are included in the vector (see, e.g, Thomas et al. Cell (1987) 51 :503 for a description of homologous recombination vectors).
The vector is introduced into an embryonic stem cell line (e.g, by electroporation) and cells in which the introduced GAVE 19 gene has homologously recombined with the endogenous GAVE 19 gene are selected (see, e.g, Li et al. Cell (1992) 69:915). The selected cells then are injected into a blastocyst of an animal to form aggregation chimeras (see, e.g, Bradley in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, Robertson, ed, ERL, Oxford, (1987) pp. 113-152). A chimenc embryo then can be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term. Progeny harboring the homologously recombined DNA in the germ cells can be used to breed animals wherein all cells of the animal contain the homologously recombined DNA by germhne transmission of the transgene.
Methods for constructing homologous recombination vectors and homologous recombinant animals are described further in Bradley, Current Opinion in Bio/Technology (1991) 2:823-829 and in PCT Publication Nos. WO 90/11354, WO 91/01140, WO 92/0968 and WO 93/04169.
In another embodiment, transgemc non-human animals can be produced that contain selected systems to allow for regulated expression of the transgene. One example of such a system is the cre/loxP recombmase system of bactenophage PI. For a description of the cre/loxP recombmase system, see, e.g, Lakso et al, Proc Natl Acad Sci USA (1992) 89.6232-6236. Another example of a recombmase system is the FLP recombmase system of 5. cerevisiae (O'Gorrnan et al. Science (1991) 251 : 1351-1355). If a cre/loxP recombmase system is used to regulate expression of the transgene, animals containing transgenes encoding both the ere recombmase and a selected protein are required Such animals can be provided through the construction of "double" transgemc animals, e.g, by mating two transgemc animals, one containing a transgene encoding a selected protein and the other containing a transgene encoding a recombmase.
Clones of the non-human transgemc animals described herein also can be produced according to the methods described in Wilmut et al. Nature (1997) 385:810-813 and PCT Publication Nos. WO 97/07668 and WO 97/07669. In brief, a cell, e.g, a somatic cell, from the transgemc animal can be isolated and induced to exit the growth cycle and enter Go phase. The quiescent cell then can be fused, e.g, through the use of electrical pulses, to an enucleated oocyte from an animal of the same species from which the quiescent cell is isolated. The reconstructed oocyte then is cultured such that it develops to morula or blastocyte, and then is transferred to a pseudopregnant female foster animal. The offspring borne of the female foster animal will be a clone of the animal from that the cell, e.g, the somatic cell, is isolated.
Uses and Methods nf the Invention The nucleic acid molecules, proteins, protein homologues, antibodies of the present invention, and fragments of such moieties, may be used in one or more of the following methods: a) screening assays; b) detection assays (e.g, chromosomal mapping, tissue typing, forensic biology); c) predictive medicine (e.g, diagnostic assays, prognostic assays, monitoring clinical trials and pharmacogenomics), and d) methods of treatment (e.g , therapeutic and prophylactic). A GAVE19 protein interacts with other cellular proteins, and thus can be used for (I) regulation of cellular proliferation; (n) regulation of cellular differentiation, and (in) regulation of cell survival. The isolated nucleic acid molecules of the invention can be used to express GAVE19 protein (e.g, via a recombinant expression vector in a host cell in gene therapy applications), to detect GAVE 19 mRNA (e.g, in a biological sample) or to detect a genetic lesion in a GAVE19 gene and to modulate GAVE 19 activity. In addition, a GAVE 19 protein can be used to screen drugs or compounds that modulate GAVE 19 activity or expression. Such drugs or compounds may readily have applications in treating diseases inflammatory diseases such as rheumatoid arthritis, COPD, etc. Screening for the production of GAVE 19 protein forms that have decreased or aberrant activity compared to GAVE 19 wild type protein can also be performed with the present invention. In addition, an antι-GAVE19 antibody of the invention can be used to detect and to isolate GAVE 19 proteins and to modulate GAVE19 activity. The invention further pertains to novel agents identified by the above-described screening assays and uses thereof for treatments as described herein Screening Assays
Activation of a G protein receptor in the presence of endogenous ligand allows for G protein receptor complex formation, thereupon leading to the binding of GTP to the G protein. The GTPase domain of the G protein slowly hydrolyzes the GTP to GDP resulting, under normal conditions, in receptor deactivation. However, constitutively activated receptors continue to hydrolyze GDP to GTP.
A non-hydrolyzable substrate of G protein, [ S]GTPτS, can be used to monitor enhanced binding to membranes which express constitutively activated receptors. Traynor and Nahorski reported that [ S]GTPτS can be used to monitor G protein coupling to membranes in the absence and presence of ligand (Traynor et al, Mol Pharmacol (1995) 47(4).848-54). A preferred use of such an assay system is for initial screening of candidate compounds, since the system is geneπcally applicable to all G protein-coupled receptors without regard to the particular G protein that binds to the receptor.
GS2o stimulates the enzyme adenylyl cyclase, while G, and G0 inhibit that enzyme. As is well known the art, adenylyl cyclase catalyzes the conversion of ATP to cAMP; thus, constitutively activated GPCRs that couple the Gs protein are associated with increased cellular levels of cAMP. Alternatively, constitutively activated GCPRs that might couple the G, (or G0) protein are associated with decreased cellular levels of cAMP. See "Indirect Mechanism of Synaptic Transmission", Chpt. 8, from Neuron to Bram (3rd Ed.), Nichols et al. eds, Smauer Associates, Inc, 1992. Thus, assays that detect cAMP can be used to determine if a candidate compound is an inverse agonist to the receptor. A variety of approaches known in the art for measuring c AMP can be utilized. In one embodiment, anti-cAMP antibodies are used in an ELISA-based format. In another embodiment, a whole cell second messenger reporter system assay is contemplated (see PCT Publication No. WO 00/22131).
In a related aspect, cyclic AMP drives gene expression by promoting the binding of a cAMP- responsive DNA binding protein or transcription factor (CREB) which then binds to the promoter at specific sites called cAMP response elements, and drives the expression of the gene Thus, reporter systems can be constructed which have a promoter containing multiple cAMP response elements before the reporter gene, e.g, /3-galactosιdase or luciferase. Further, as a constitutively activated
Gs-lmked receptor causes the accumulation of cAMP, that then activates the gene and expression of the reporter protein. The reporter protein, such as /3-galactosιdase or luciferase, then can be detected using standard biochemical assays (PCT Publication No. WO 00/22131).
Other G proteins, such as G0 and Gq, are associated with activation of the enzyme phosphohpase C, which in turn hydrolyzes the phospholipid, PEP2, releasing two intracellular messengers: diacylglycerol (DAG) and inositol 1,4,5-tπphosphate (EP3). Increased accumulation of EP3 is associated with activation of Gq-assocιated receptors and Go-associated receptors (PCT Publication No. WO 00/22131). Assays that detect EP3 accumulation can be used to determine if a candidate compound is an inverse agonist to a Gq-assocιated receptor or a G0-associated receptor. Gq-assocιated receptors also can be examined using an API reporter assays that measures whether Gq-dependent phosphohpase C causes activation of genes containing API elements. Thus, activated Gq-assocιated receptors will demonstrate an increase in the expression of such genes, whereby inverse agonists will demonstrate a decrease in such expression.
Also provided herein is a method (also referred to herein as a "screening assay") for identifying modulators, i.e., candidate or test compounds or agents (e.g, peptides, peptidomimetics, small molecules or other drugs) that bind to GAVE 19 proteins or have a stimulatory or inhibitory effect on, for example, GAVE 19 expression or GAVE 19 activity.
In one embodiment, the invention provides assays for screening candidate or test compounds that bind to or modulate the activity of the membrane -bound form of a GAVE 19 protein, polypeptide or biologically active portion thereof The test compounds of the instant invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the "one-bead one-compound" library method; and synthetic library methods using affinity chromatography selection. The biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, Anticancer Drug Des (1997) 12:145).
Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al , Proc Natl Acad Sci USA (1993) 90:6909; Erb et al, Proc Natl Acad Sci USA (1994) 91 : 11422; Zuckermann et al, J Med Chem (1994) 37-2678, Cho et al. Science (1993) 261 : 1303; Carrell et al, Angew Chem Int Ed Engl (1994) 33:2059; Carell et al, Angew Chem it Ed Engl (1994) 33:2061 ; and Gallop et al, J Med Chem (1994) 37: 1233.
Libraries of compounds may be presented in solution (e.g, Houghten Bio/Techniques (1992) 13:412-421) or on beads (Lam, Nature (1991) 354:82-84), chips (Fodor, Nature (1993) 364:555-556), bacteria (U.S Patent No. 5,223,409), spores (U S Patent Nos. 5,571,698; 5,403,484; and 5,223,409), plasmids (Cull et al, Proc Natl Acad Sci USA (1992) 89: 1865-1869) or phage (Scott et al. Science (1990) 249.386-390; Devlin, Science (1990) 249.404-406, Cwirla et al, Proc Natl Acad Sci USA (1990) 87:6378-6382; and Fehci, J Mol Biol (1991) 222:301-310).
In a particular embodiment of the present invention, an assay is a cell-based assay in which a cell that expresses a membrane-bound form of GAVE 19 protein, or a biologically active portion thereof, on the cell surface is contacted with a test compound and the ability of the test compound to bind to a GAVE 19 protein is determined. The cell, for example, can be a yeast cell or a cell of mammalian origin. Determining the ability of the test compound to bind to the GAVE 19 protein can be accomplished, for example, by coupling the test compound with a radioisotope or enzymatic label so that binding of the test compound to the GAVE 19 protein or biologically active portion thereof can be determined by detecting the labeled compound in a complex. For example, test compounds can be labeled with l251, 35S, 14C or 3H, either directly or indirectly and the radioisotope detected by direct counting of radioemmission or by scintillation counting. Alternatively, test compounds can be labeled enzymatically with, for example, horseradish peroxidase, alkaline phosphatase or luciferase and the enzymatic label detected by determination of conversion of an appropriate substrate to product. In a particular embodiment, the assay comprises contacting a cell that expresses a membrane-bound form of GAVE 19 protein or a biologically active portion thereof, on the cell surface with a known compound that binds GAVE 19 to form an assay mixture, contacting the assay mixture with a test compound and determining the ability of the test compound to interact with a GAVE 19 protein, wherein determining the ability of the test compound to interact with a GAVE 19 protein comprises determining the ability of the test compound to bind preferentially to GAVE 19 or a biologically active portion thereof as compared to the known compound.
In another embodiment, an assay is a cell-based assay comprising contacting a cell expressing a membrane-bound form of GAVE 19 protein or a biologically active portion thereof, on the cell surface with a test compound and determining the ability of the test compound to modulate (e g, stimulate or inhibit) the activity of the GAVE 19 protein or biologically active portion thereof. Determining the ability of the test compound to modulate the activity of GAVE 19 or a biologically active portion thereof can be accomplished, for example, by determining the ability of the GAVE 19 protein to bind to or to interact with a GAVE19 target molecule. As used herein, a "target molecule" is a molecule with which a GAVE 19 protein binds or interacts in nature, for example, a molecule on the surface of a cell that expresses a GAVE 19 protein, a molecule on the surface of a second cell, a molecule in the extracellular milieu, a molecule associated with the internal surface of a cell membrane or a cytoplasmic molecule A GAVE 19 target molecule can be a non-GAVE 19 molecule or a GAVE 19 protein or polypeptide of the instant invention. In one embodiment, a GAVE 19 target molecule is a component of a signal transduction pathway that facilitates transduction of an extracellular signal (e.g, a signal generated by binding of a compound to a membrane-bound GAVE 19 molecule) through the cell membrane and into the cell The target, for example, can be a second intercellular protein that has catalytic activity or a protein that facilitates the association of downstream signaling molecules
Determining the ability of the GAVE 19 protein to bind to or to interact with a GAVE 19 target molecule can be accomplished by one of the methods described above for determining direct binding In a particular embodiment, determining the ability of the GAVE 19 protein to bind to or to interact with a GAVE 19 target molecule can be accomplished by determining the activity of the target molecule. For example, the activity of the target molecule can be determined by detecting induction of a cellular second messenger of the target (e.g, intracellular Ca +, diacylglycerol, EP3 etc.), detecting catalytic/enzymatic activity of the target on an appropriate substrate, detecting the induction of a reporter gene (e.g, a GAVE19-responsιve regulatory element operably linked to a nucleic acid encoding a detectable marker, e.g. luciferase) or detecting a cellular response, e.g, cellular differentiation or cell proliferation.
The present invention further extends to a cell-free assay comprising contacting a GAVE19 protein, or biologically active portion thereof, with a test compound, and determining the ability of the test compound to bind to the GAVE 19 protein or biologically active portion thereof Binding of the test compound to the GAVE 19 protein can be determined either directly or indirectly as described above In a preferred embodiment, the assay includes contacting the GAVE 19 protein or biologically active portion thereof with a known compound that binds GAVE 19 to form an assay mixture, contacting the assay mixture with a test compound, and determining the ability of the test compound to interact with a GAVE19 protein, wherein determining the ability of the test compound to interact with a GAVE19 protein comprises determining the ability of the test compound to preferentially bind to GAVE 19 or biologically active portion thereof as compared to the known compound.
Another cell-free assay of the present invention involves contacting GAVE 19 protein or biologically active portion thereof, with a test compound and determining the ability of the test compound to modulate (e.g, stimulate or inhibit) the activity of the GAVE 19 protein or biologically active portion thereof. Determining the ability of the test compound to modulate the activity of GAVE 19 can be accomplished, for example, by determining the ability of the GAVE 19 protein to bind to a GAVE 19 target molecule by one of the methods described above for determining direct binding. In an alternative embodiment, determining the ability of the test compound to modulate the activity of GAVE 19 can be accomplished by determining the ability of the GAVE 19 protein to further modulate a GAVE 19 target molecule. For example, the catalytic/enzymatic activity of the target molecule on an appropriate substrate can be determined as described previously.
Still another cell-free assay of the present invention comprises contacting the GAVE 19 protein or biologically active portion thereof, with a known compound that binds GAVE 19 to form an assay mixture, contacting the assay mixture with a test compound and determining the ability of the test compound to interact with a GAVE 19 protein. The step for determining the ability of the test compound to interact with a GAVE19 protein comprises determining the ability of the GAVE19 protein preferentially to bind to or to modulate the activity of a GAVE 19 target molecule
Receptors can be activated by non-hgand molecules that necessarily do not inhibit ligand binding but cause structural changes in the receptor to enable G protein binding or, perhaps receptor aggregation, dimerization or clustering that can cause activation. For example, antibodies can be raised to the various portions of GAVE 19 that are exposed at the cell surface. Those antibodies activate a cell via the G protein cascade as determined by standard assays, such as monitoring cAMP levels or intracellular Ca+ levels. Because molecular mapping, and particularly epitope mapping, is involved, monoclonal antibodies may be preferred. The monoclonal antibodies can be raised both to mtact receptor expressed at the cell surface and peptides known to form at the cell surface The method of Geysen et al, U.S. Pat. No. 5,998,577, can be practiced to obtain a plurality of relevant peptides
Antibodies found to activate GAVE 19 may be modified to minimize activities extraneous to GAVE 19 activation, such as complement fixation. Thus, the antibody molecules can be truncated or mutated to minimize or to remove activities outside of GAVE 19 activation. For example, for certain antibodies, only the antigen-binding portion is needed. Thus, the Fc portion of the antibody can be removed.
Cells expressing GAVE 19 are exposed to antibody to activate GAVE 19. Activated cells then are exposed to various molecules in order to identify which molecules modulate receptor activity, and result in higher activation levels or lower activation levels. Molecules that achieve those goals then can be tested on cells expressing GAVE 19 without antibody to observe the effect on non-activated cells. The target molecules then can be tested and modified as candidate drugs for the treatment of disorders associated with altered GPCR metabolism using known techniques.
The cell-free assays of the instant invention are amenable for use of both the soluble form and the membrane-bound form of GAVE 19. In the case of cell-free assays comprising the membrane-bound form of GAVE 19, it may be desirable to utilize a solubihzmg agent such that the membrane-bound form of GAVE 19 is maintained in solution. Examples of such solubihzmg agents include non-ionic detergents such as n-octylglucoside, n-dodecylglucoside, n-dodecylmaltoside, octanoyl-N-methylglucamide, decanoyl-N-methylglucamide, TRITON X-100, TRITON X-l 14, THESIT, ιsotndecylpoly(ethylene glycol ether)n, 3-[(3-cholamιdopropyl)dιmethylammιno]-l -propane sulfonate (CHAPS), 3-[(3-cholamιdopropyl)dιmethylammmo]-2-hydroxy-l-propane sulfonate (CHAPSO) or N-dodecyl=N,N-dιmethyl-3-ammonιo-l -propane sulfonate.
In more than one embodiment of the above assay methods of the instant invention, it may be desirable to immobilize either GAVE 19 or a target molecule thereof to facilitate separation of complexed from uncomplexed forms of one or both of the proteins, as well as to accommodate automation of the assay. Binding of a test compound to GAVE 19 or interaction of GAVE 19 with a target molecule in the presence and absence of a candidate compound, can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtitre plates, test tubes and micro-centrifuge tubes. In one embodiment, a fusion protein can be provided that adds a domain that allows one or both of the proteins to be bound to a matrix. For example, glutathιone-S-transferase/GAVE19 fusion proteins or glutathione-S-transferase/target fusion proteins can be adsorbed onto glutathione SEPHAROSE beads (Sigma Chemical, St. Louis, MO). Alternatively, glutathione-denvatized microtitre plates are then combined with the test compound. Subsequently, either the non-adsorbed target protein or GAVE 19 protein and the mixture are incubated under conditions conducive to complex formation (e.g, at physiological conditions for salt and pH). Following incubation, the beads or microtitre plate wells are washed to remove any unbound components, and the presence of complex formation is measured either directly or indirectly. Alternatively, the complexes can be dissociated from the matrix and the level of GAVE 19 binding or activity determined using standard techniques.
Other techniques for immobilizing proteins on matrices can also be used in the screening assays of the invention. For example, either GAVE 19 or a target molecule thereof can be immobilized utilizing conjugation of biotm and streptavidin. Biotinylated GAVE19 or target molecules can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques well known in the art (e.g, biotinylation kit, Pierce Chemicals, Rockford, IL) and immobilized in the wells of streptavidm-coated 96-well plates (Pierce Chemicals). Alternatively, antibodies that are reactive with GAVE 19 or a target molecule, but do not interfere with binding of the GAVE 19 protein to the target molecule, can be derivatized to the wells of the plate. Upon incubation, unbound target or GAVE 19 can be trapped in the wells by antibody conjugation. Methods for detecting such complexes, in addition to those described above for the GST-immobihzed complexes, include immunodetection of complexes using antibodies reactive with GAVE 19 or target molecule, as well as enzyme-linked assays that rely on detecting an enzymatic activity associated with the GAVE 19 or target molecule.
In another embodiment, modulators of GAVE 19 expression are identified in a method wherein a cell is contacted with a candidate compound, and the expression of GAVE 19 mRNA or protein in the cell is determined. The level of expression of GAVE 19 mRNA or protein in the presence of the candidate compound is compared to the level of expression of GAVE 19 mRNA or protein in the absence of the candidate compound. The candidate compound then can be identified as a modulator of GAVE 19 expression based on that comparison For example, when expression of GAVE 19 mRNA or protein is greater (statistically significantly greater) in the presence of the candidate compound than in the absence thereof, the candidate compound is identified as a stimulator or agonist of GAVE19 mRNA or protein expression. Alternatively, when expression of GAVE19 mRNA or protein is less (statistically significantly less) in the presence of the candidate compound than in the absence thereof, the candidate compound is identified as an inhibitor or antagonist of GAVE19 mRNA or protein expression. If GAVE19 activity is reduced in the presence of ligand or agonist, or in a constitutive GAVE 19, below baseline, the candidate compound is identified as an inverse agonist The level of GAVE 19 mRNA or protein expression in the cells can be determined by methods described herein for detecting GAVE 19 mRNA or protein.
In yet another aspect of the invention, the GAVE 19 proteins can be used as "bait proteins" in a two-hybrid assay or three-hybrid assay (see, e.g, U.S. Patent No. 5,283,317; Zervos et al. Cell (1993) 72-223-232; Madura et al, J Biol Chem (1993) 268:12046-12054; Bartel et al, Bio/Techniques (1993) 14:920-924; Iwabuchi et al, Oncogene (1993) 8: 1693-1696; and PCT Publication No. WO 94/10300), to identify other proteins that bind to or interact with GAVE 19 ("GAVE19-bιndmg proteins" or "GAVE 19-bp"), and modulate GAVE 19 activity. Such GAVE 19-bmdιng proteins are also likely to be involved in the propagation of signals by the GAVE 19 proteins such as, for example, upstream or downstream elements of the GAVE 19 pathway.
Since the present invention enables the production of large quantities of pure GAVE 19, physical characterization of the conformation of areas of likely function can be ascertained for rational drug design. For example, the IC3 region of the molecule and EC domains are regions of particular interest Once the shape and ionic configuration of a region is discerned, candidate drugs that should interact with those regions can be configured and then tested in intact cells, animals and patients. Methods that would enable deriving such 3-D structure information include X-ray crystallography, NMR spectroscopy, molecular modeling and so on. The 3-D structure also can lead to identification of analogous conformational sites in other known proteins where known drugs that act at site exist. Those drugs, or derivatives thereof, may find use in treating inflammatory diseases or disorders such as rheumatoid arthritis or COPD, to name only a few
The invention further pertains to novel agents identified by the above-described screening assays and uses thereof for treatments as described herein.
Assays of the Present Invention A. Detection Assays Portions or fragments of the DNA sequences of the present invention can be used in numerous ways as polynucleotide reagents. For example, the sequences can be used to: (I) map the respective genes on a chromosome and, thus, locate gene regions associated with genetic disease; (n) identify an individual from a minute biological sample (tissue typing); and (in) aid in forensic identification of a biological sample. The applications are described in the subsections below.
1. Chromosome Mapping
Once the sequence (or a portion of the sequence) of a gene has been isolated, the sequence can be used to map the location of the GAVE 19 gene on a chromosome. Accordingly, GAVE 19 nucleic acid molecules described herein or fragments thereof can been used to map the location of GAVE 19 in a genome. The mapping of the location of the GAVE 19 sequence in a genome is an important step in correlating the sequences with genes associated with disease.
Briefly, GAVE 19 genes can be mapped in a genome by preparing PCR primers (preferably 15-25 bp in length) from the GAVE 19 sequences The primers are used for PCR screening of somatic cell hybrids containing individual murine chromosomes. Only those hybrids containing the murine gene corresponding to the GAVE 19 sequences yield an amplified fragment.
A particular method includes, but certainly is not limited to denaturing murine chromosomes and then contacting them with a detectably labeled GAVE 19 DNA molecule under stringent hybridization conditions. Hybridization and subsequent detection of the detectably labeled GAVE 19 DNA molecule will reveal the location of GAVE 19 in the murine chromosome. Such an in situ hybridization technique is described in Fan et al, Proc Natl Acad Sci USA (1990) 87:6223-27, which involves pre-screening with labeled flow-sorted chromosomes and pre-selection by hybridization to chromosome-specific cDNA libraries. The in situ hybridization (FISH) of a DNA sequence to a metaphase chromosomal spread can also be used to provide a precise chromosomal location in one step. Chromosome spreads can be made using cells in which division has been blocked in metaphase by a chemical, e.g, colcemid, that disrupts the mitotic spindle. The chromosomes can be treated briefly with trypsin and then stained with Giemsa. A pattern of light and dark bands develops on each chromosome so that the chromosomes can be identified individually. The FISH technique can be used with a DNA sequence as short as 500 or 600 bases. However, clones larger than 1,000 bases have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection. Preferably 1,000 bases and more preferably, 2,000 bases will suffice to get good results in a reasonable amount of time. For a review of the technique, see Verma et al. (Human Chromosomes: A Manual of Basic Techniques (Pergamon Press, New York, 1988)). Chromosomal mapping can be inferred in silico, and employing statistical considerations, such as lod scores or mere proximity.
Reagents for chromosome mapping can be used individually to locate a single site on a chromosome. Furthermore, panels of reagents can be used for marking multiple sites and/or multiple chromosomes. Reagents corresponding to flanking regions of the GAVE 19 gene actually are preferred for mapping purposes. Coding sequences are more likely to be conserved within gene families, thus increasing the chance of cross hybridization during chromosomal mapping.
Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. The relationship between genes and disease, mapped to the same chromosomal region, can then be identified through linkage analysis (co-inheritance of physically adjacent genes), described in, e.g, Egeland et al. Nature (1987) 325:783-787.
Moreover, differences in the DNA sequences between animals affected and unaffected with a disease associated with GAVE 19 can be determined. If a mutation is observed in some or all of the affected animals, but not in any unaffected animals, then the mutation is likely to be the causative agent of the particular disease. Comparison of affected and unaffected animals generally involves first looking for structural alterations in the chromosomes such as deletions or translocations that are visible from chromosome spreads or detectable using PCR based on that DNA sequence. Ultimately, complete sequencing of genes from several animals can be performed to confirm the presence of a mutation and to distinguish mutations from polymorphisms. 1. Diagnostic Assays
An exemplary method for detecting the presence or absence of GAVE 19 in a biological sample involves obtaining a biological sample from a test animal and contacting the biological sample with a compound or an agent capable of detecting GAVE19 protein or nucleic acid (e.g, mRNA or genomic DNA) that encodes GAVE 19 protein such that the presence of GAVE 19 is detected m the biological sample A preferred agent for detecting GAVE 19 mRNA or genomic DNA is a labeled nucleic acid probe capable of hybridizing to GAVE 19 mRNA or genomic DNA. The nucleic acid probe can be, for example, a full-length GAVE 19 nucleic acid, such as the nucleic acid of SEQ ED NO: 1 or a portion thereof, such as an ohgonucleotide of at least 15, 30, 50, 100, 250 or 500 or more nucleotides in length and sufficient to specifically hybridize under stringent conditions to GAVE 19 mRNA or genomic DNA. Other suitable probes for use in the diagnostic assays of the invention are described herein.
A particular agent for detecting GAVE 19 protein is an antibody capable of binding to GAVE 19 protein, preferably an antibody with a detectable label. Antibodies can be polyclonal, chimenc, or more preferably, monoclonal. An intact antibody or a fragment thereof (e.g, Fab or F(ab')2) ca be used. The term "biological sample" is intended to include tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject. That is, the detection method of the invention can be used to detect GAVE 19 mRNA, protein or genomic DNA in a biological sample in vitro as well as in vivo. For example, in vitro techniques for detection of GAVE 19 mRNA include Northern hybridization and in situ hybridization. In vitro techniques for detection of GAVE19 protein include ELISA, Western blot, lmmunoprecipitation and immunofluorescence. In vitro techniques for detection of GAVE 19 genomic DNA include Southern hybridization. Furthermore, in vivo techniques for detection of GAVE 19 protein include introducing into an animal a labeled anti -GAVE 19 antibody For example, the antibody can be labeled with a radioactive marker, the presence and location of which in an animal can be detected by standard imaging techniques.
In an embodiment, the biological sample contains protein molecules from the test animal. Alternatively, the biological sample can contain mRNA molecules from the test animal or genomic DNA molecules from the test animal A particular biological sample having applications herein is a peripheral blood leukocyte sample isolated by conventional means from an animal.
In another embodiment, the methods further involve obtaining a biological sample from a control animal, contacting the control sample with a compound or agent capable of detecting GAVE 19 protein, mRNA or genomic DNA, such that the presence and amount of GAVE19 protein, mRNA or genomic DNA is detected in the biological sample, and then comparing the presence and amount of GAVE 19 protein, mRNA or genomic DNA in the control sample with the presence and amount of GAVE 19 protein, mRNA or genomic DNA in a test sample to determine whether the compound modulates the expression or activity of GAVE 19.
High throughput assays of chemical libraries Any of the assays for compounds capable of modulating the activity of GAVE 19 are amenable to high throughput screening. High throughput screening systems are commercially available (see, e.g., Zymark Corp, Hopkmton, MA; Air Technical Industries, Mentor, OH; Beckman Instruments, Inc. Fullerton, CA; Precision Systems, Inc., Natick, MA, etc ). These systems typically automate entire procedures including all sample and reagent pipetting, liquid dispensing, timed incubations, and final readings of the microplate in detector(s) appropriate for the assay. These configurable systems provide high throughput and rapid start up as well as a high degree of flexibility and customization. The manufacturers of such systems provide detailed protocols the various high throughput. Thus, for example, Zymark Corp. provides technical bulletins describing screening systems for detecting the modulation of gene transcription, ligand binding, and the like.
The invention also encompasses kits for detecting the presence of GAVE19 in a biological sample (a test sample). Such kits can be used to determine whether a particular compound modulates the expression or activity of GAVE 19. For example, the kit can comprise a labeled compound or agent capable of detecting GAVE 19 protein or mRNA in a biological sample and means for determining the amount of GAVE19 in the sample (e.g, an antι-GAVE19 antibody or an ohgonucleotide probe that binds to DNA encoding GAVE19, e.g, SEQ ID NO: l).
For antibody-based kits, the kit can comprise, for example: (1) a first antibody (e.g, attached to a solid support) that binds to GAVE 19 protein; and, optionally, (2) a second, different antibody that binds to GAVE 19 protein or to the first antibody and is conjugated to a detectable agent. If the second antibody is not present, then either the first antibody can be detectably labeled, or alternatively, another molecule that binds the first antibody can be detectably labeled. In any event, a labeled binding moiety is included to serve as the detectable reporter molecule, as known in the art.
For ohgonucleotide-based kits, a kit of the present invention can comprise, for example: (1) an ohgonucleotide, e.g, a detectably-labeled ohgonucleotide, that hybridizes to a GAVE19 nucleic acid sequence or (2) a pair of primers useful for amplifying a GAVE19 nucleic acid molecule. The kit also can comprise, e.g, a buffering agent, a preservative or a protein stabilizing agent. The kit also can comprise components necessary for detecting the detectable agent (e.g, an enzyme or a substrate). Furthermore, the kit may also contain a control sample or series of control samples that can be assayed and compared to the test sample. Each component of the kit is usually enclosed with an individual container, and all of the various containers are withm a single package.
2. Pharmacogenomics As explained herein, GAVE 19 expression is modulated in cells associated with activated or inflammatory states. Disorders associated with inflammation include, anaphylactic states, colitis, Crohn's Disease, edematous states, contact hypersensitivity, allergy, other forms of arthritis, meningitis and other conditions wherein the immune system reacts to an insult by vascular dilation, heat, collecting cells, fluids and the like at a site resulting in swelling and the like. Thus, agents or modulators that have a stimulatory or inhibitory effect on GAVE 19 activity (e g, GAVE 19 gene expression) as identified by a screening assay described herein can be administered to individuals to treat (prophylactically or therapeutically) disorders (e.g, inflammation associated with asthma, chronic obstructive pulmonary disease and rheumatoid arthritis). In conjunction with such treatment, the pharmacogenomics (i.e., the study of the relationship between the genotype of an individual and the response of the individual to a foreign compound or drug) of the individual may be considered.
Differences in metabolism of therapeutics can lead to severe toxicity or therapeutic failure by altering the relation between dose and blood concentration of the pharmacologically active drug. Thus, the pharmacogenomics of the individual permits the selection of effective agents (e.g, drugs) for prophylactic or therapeutic treatments based on a consideration of the genotype of the individual. Such pharmacogenomics further can be used to determine appropriate dosages and therapeutic regimens.
Pharmacogenomics deals with clinically significant hereditary variations in the response to drugs due to altered drug disposition and abnormal action in affected persons. See, e.g, Lmder, Clm Chem (1997) 43(2):254-266. In general, two types of pharmacogenetic conditions can be differentiated.
Genetic conditions transmitted as a single factor altering the way drugs act on the body are referred to as "altered drug action." Genetic conditions transmitted as single factors altering the way the body acts on drugs are referred to as "altered drug metabolism." The pharmacogenetic conditions can occur either as rare defects or as polymorphisms. For example, glucose-6-phosphate dehydrogenase deficiency (G6PD) is a common inherited enzymopathy in that the main clinical complication is hemolysis after mgestion of oxidant drugs (anti-malanals, sulfonamides, analgesics or mtrofurans) and consumption of fava beans.
As an illustrative embodiment, the activity of drug metabolizing enzymes is a major determinant of both the intensity and duration of drug action The discovery of genetic polymorphisms of drug metabolizing enzymes (e.g, N-acetyltransferase 2 (NAT 2) and cytochrome P450 enzymes, CYP2D6 and CYP2C1 9) has provided an explanation as to why some patients do not obtain the expected drug effects or show exaggerated drug response and serious toxicity after taking the standard and safe dose of a drug. The polymorphisms are expressed in two phenotypes in the population, the extensive metabohzer (EM) and poor metabohzer (PM). The prevalence of PM is different among different populations. For example, the gene coding for CYP2D6 is highly polymorphic and several mutations have been identified in PM, all which lead to the absence of functional CYP2D6. Poor metabohzers of CYP2D6 and CYP2C1 9 quite frequently experience exaggerated drug response and side effects when standard doses are received. If a metabolite is the active therapeutic moiety, a PM will show no therapeutic response, as demonstrated for the analgesic effect of codeine mediated by the
CYP2D6-formed metabolite, morphine. The other extreme is the so-called ultra-rapid metabohzers that do not respond to standard doses. Recently, the molecular basis of ultra-rapid metabolism has been identified to be due to CYP2D6 gene amplification.
Activity of a homolog of GAVE 19 protein, or expression of a DNA molecule that is a homolog of GAVE 19 nucleic acid in an individual can be determined to select thereby appropriate agent(s) for therapeutic or prophylactic treatment of the individual. In addition, pharmacogenetic studies can be used to apply geno typing of polymorphic alleles encoding drug-metabolizing enzymes to the identification of the drug responsiveness phenotype of an individual. That knowledge, when applied to dosing or drug selection, can avoid adverse reactions or therapeutic failure and thus enhance therapeutic or prophylactic efficiency when treating a subject with a GAVE 19 modulator, such as a modulator identified by one of the exemplary screening assays described herein.
D. Methods of Treatment
As explained above, the present invention extends to assays for identifying drugs or agents that modulate the expression of GAVE19 in mice. Due to the expression profile of GAVE19, i.e. is highly expressed in normal spleen, has an expression level that is increased two fold relative to normal spleen in collagen induced arthritis (CIA) RA mouse spleen, and has an expression level elevated over five- fold in CIA RA mouse lung compared with normal lung, such drugs or agents may readily have applications in treating diseases or disorders such as inflammatory disorders (e.g. asthma), chronic obstructive pulmonary disease and rheumatoid arthritis, to name only a few.
1. Prophylactic Methods
In one aspect, the invention provides a method for preventing in a subject, a disease or condition such as those described above, by administering to the subject an agent that modulates GAVE19 expression or at least one GAVE19 activity. Subjects that may benefit from such treatment can be identified by, for example, any or a combination of diagnostic or prognostic assays well known to those of ordinary skill in the art. Administration of a prophylactic agent can occur prior to the manifestation of symptoms for such a disease or disorder in order to prevent the disease or disorder, or alternatively to delay its progression.
2. Therapeutic Methods An agent that can used for treating inflammatory diseases, i.e., that is found to modulate GAVE19 protein activity in mice, can be an agent as described herein, such as a nucleic acid or a protein, a naturally-occurring cognate ligand of a GAVE 19 protein, a peptide, a GAVE 19 peptidomimetic or other small molecule. In one embodiment, the agent stimulates one or more of the biological activities of GAVE 19 protein. Examples of such stimulatory agents include active GAVE 19 protein and a nucleic acid molecule encoding GAVE 19 that has been introduced into the cell. In another embodiment, the agent inhibits one or more of the biological activities of GAVE 19 protein. Examples of such inhibitory agents include antisense GAVE 19 nucleic acid molecules and antι-GAVE19 antibodies. The modulatory methods can be performed in vitro (e.g, by cultuπng the cell with the agent) or, alternatively, in vivo (e.g, by administering the agent to a subject). As such, the instant invention provides methods of treating an individual afflicted with a disease or disorder as described above that comprises administering to the individual an agent (e.g, an agent identified by a screening assay described herein) or combination of agents that modulates (e.g, upregulates or downregulates) GAVE 19 expression or activity in mice. In another embodiment, the method involves administering a GAVE 19 protein or nucleic acid molecule as therapy.
The present invention may be better understood by reference to the following non-limiting Example, which is provided as exemplary of the invention. The following Example is presented in order to more fully illustrate the preferred embodiments of the invention. It should in no way be construed, however, as limiting the broad scope of the invention. EXAMPLE The large number of G-protein coupled receptors are the target of -50% of the current therapeutic drugs on the market. The GPCRs are activated by a wide variety of ligands, including peptide, neurotransmitters, hormones, growth factors, amines, lipids, fatty acids, odorant molecules and hgts. The perturbation of GPCR function results in many pathological conditions. GAVE19, the ortholog of human GAVE 18, is highly expressed in normal spleen, has an expression level that is increased two fold relative to normal spleen in collagen induced arthritis (CIA) RA mouse spleen, and has an expression level elevated over five-fold in CIA RA mouse lung compared with normal lung. Thus, GAVE 19 provides a new drug target drugs or agents for treating diseases or disorders such as inflammatory disorders (e.g. asthma), chronic obstructive pulmonary disease and rheumatoid arthritis, to name only a few.
Identification and cloning of GAVE 19 also provides the opportunity to find the endogenous ligand through a process „de-orphanιng". Natural ligand or surrogate ligand identified through de-orphanmg provides a tool for screening some molecules which activate or block the receptor signal transduction, and therefore change the cellular physiology and cell function.
Materials and Methods
Identification and cloning ofGA VE19 Using human GAVE18 DNA sequence to quire mouse genomic DNA database did not reveal the mouse homolog DNA sequence. Human GAVE18 DNA containing coding region was then used as the probe to screen Research Genetics mouse genomic BAC libraries. Multiple DNA primers designed according human GAVE 18 sequence were used to sequence the positive mouse BAC. Only the primers, 5' GGC TTC CCC CAA AGA CAA AG 3 ' (SEQ ED NO:3) gave the mouse GAVE19 DNA sequence data.. Multiple mouse DNA sequencing primers were then designed for primer walking to sequence the mouse GAVE 19 coding region.
Mouse disease models and RNA isolation. Mouse total RNAs isolated from different tissues and organs are performed with Tπzol reagent from GIBCO BLR according manufactory instruction. The total RNAs were converted to cDNAs by using Multiscnbe RT-PCR kit from ABE
TaqMan analysis. TaqMan reactions are performed in duplicate with mouse tissue cDNA and GAPDH gene is used as an internal control. TaqMan results are then calculated as relative expression. The relative expression equals (2Λ(0-ddCt))*1000, where ddCT equals (GAVE19 mean Cts- GAPDH mean Cts) - (GAVE 19 mean NTC Cts- GAPDH mean NTC Cts). TaqMan probe was custom synthesized by Operon Technologies. TaqMan primer sequence 1 : 5' CTGTTCTTGCTGGTGAAAATGAA 3' (SEQ ID NO:4) and sequence 2: 5' CCATGAACCACCACGAGGTT 3 ' (SEQ ED N0.5). TaqMan probe sequence: 5 ' (Fam)- TCACGTTCAGTGACCACCATGGCTG-(Tet) 3 ' (SEQ ED NO:6). TaqMan reaction was performed in a 96-well plate MicroAmp optical tube (PE).
Description of the results
TaqMan expression profile showed gradualy increased expression levels of GAVE 19 in the joints of CIA RA model from normal controled sample to RA grade 4. The higher RA grade in the joints correlates higher GAVE 19 expression GAVE 19 also showed dramatically increased expression levels in CIA RA lung and spleen to compare with normal controled lung and spleen. In mouse EAE (Experimental allergic encephalomyelitis) model of multiple sclerosis, GAVE 19 showed increased expression level in the brain during the EAE peak stage to compare with the expression level m the bram during prechnic stage.
Table of TaqMan Expression Profile of GAVE19 in Mouse Tissues
Expression profile data is also graphically shown in Figure 3 All of these data point that GAVE 19 plays important roles in inflammation related diseases.
Discussion
A novel mouse G-protem coupled receptor, GAVE 19, which is the ortholog of human GAVE 18 has been identified and cloned. Full-length coding region of the DNA and its deduced ammo acid sequence have been characterized. Tissue distribution of the receptor has been analyszed by RT-PCR (TaqMan) analyses in normal controled mice and collegen induced arthritis (CIA) mice. Expression profiles of GAVE 19 show the similarities to GAVE 18 (the human ortholog) and clearly indicate its roles in inflammation diseases such as rheumatoid arthritis. Hence, using various assays described herein, GAVE 19 provides a new drug target for inflammation diseases, such as asthma, RA, COPD, etc. Moreover, compounds and agents found with assays of the present invention to modulate the expression and/or activity of GAVE19 in mice may readily applications in treating such diseases
The present invention is not to be limited in scope by the specific embodiments describe herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and the accompanying figures. Such modifications are intended to fall withm the scope of the appended claims.
It is further to be understood that all base sizes or ammo acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description.
Various publications are cited herein, the disclosures of which are incorporated by reference in their entireties.

Claims

WHAT T CT ATMFD TS-
1. An isolated nucleic acid molecule comprising the DNA sequence of Figure 1 (SEQ ED NO: 1).
2. An isolated nucleic acid molecule hybndizable to said isolated nucleic acid molecule of Claim 1, or a hybridization probe that is complementary to said isolated nucleic acid molecule of Claim 1 , under stringent hybridization conditions.
3 The isolated nucleic acid molecule of either of Claims 1 or 2 which encodes a polypeptide having an amino acid sequence of Figure 2 (SEQ ED NO:2).
4. The isolated nucleic acid molecule of Claim 2, which encodes a polypeptide having an amino acid sequence that is at least 30% identical to said ammo acid sequence of SEQ ED NO:2.
5. The isolated nucleic acid molecule of either of Claims 1 or 2, which is detectably labeled.
6. The detectably labeled isolated nucleic acid molecule of Claim 5, wherein said detectable label comprises an enzyme, a radioactive isotope, or a chemical which fluoresces.
7. A purified polypeptide comprising the amino acid sequence of Figure 2 (SEQ ED NO:2).
8. An isolated nucleic acid molecule which encodes said purified polypeptide of Claim 7.
9. The purified polypeptide of Claim 7 which is detectably labeled.
10. The purified polypeptide of Claim 9, wherein said detectable label comprises an enzyme, a radioactive isotope, or a chemical which fluoresces.
11. An antibody having said purified polypeptide of Claim 7 as an immunogen.
12. The antibody of Claim 11, wherein said antibody is selected from the group consisting of a monoclonal antibody, a polyclonal antibody, or a chimenc antibody.
13. The antibody of Claim 11, which is detectably labeled
14. The antibody of Claim 13, wherein said detectable label comprises an enzyme, a radioactive isotope, or a chemical which fluoresces.
15. An expression vector comprising said isolated nucleic acid molecule of Claim 1 operatively associated with an expression control element.
16. An expression vector comprising said isolated nucleic acid molecule of Claim 2, operatively associated with an expression control element.
17. The expression vector of either of Claims 15 or 16, wherein said expression control element is selected from the group consisting of a constitutive regulatory sequence, a cell-specific regulatory sequence, and an inducible regulatory sequence.
18. The expression vector of Claim 17, wherein said expression control element is a promoter.
19. The expression vector of Claim 18, wherein said promoter comprises an immediate early promoter of hCMV, an early promoter of S V40, an early promoter of adenovirus, an early promoter of vaccinia, an early promoter of polyoma, a late promoter of SV40, a late promoter of adenovirus, a late promoter of vaccinia, a late promoter of polyoma, a lac system, a trp system, a
TAC system, a 77? C system, a major operator and promoter region of phage lambda, a control region of fd coat protein, 3-phosphoglycerate kinase promoter, acid phosphatase promoter, or a promoter of yeast α mating factor.
20. A host cell transformed or transfected with the expression vector of either of Claims 15 or 16.
21. The host cell of Claim 20, wherein said host cell comprises a prokaryotic cell or eukaryotic cell.
22. The host cell of Claim 21, wherein said host comprises E. coli, Pseudonomas, Bacillus, Strepomyces, yeast, CHO, RU, B-W, L-M, COS1, COS7, BSC1, BSC40, BMT10 or Sf9 cells.
23. A method for producing the purified polypeptide of Claim 7, comprising the steps of: a) culturing a host cell of Claim 20 under conditions that provide for expression of said isolated polypeptide; and b) recovering said isolated polypeptide from said host, said culture, or a combination thereof.
24. A method for identifying an agonist of GAVE 19 comprising, contacting a potential agonist with a cell expressing GAVE 19 and determining whether in the presence of said potential agonist the signaling activity of GAVE 19 is increased relative to the activity of GAVE 19 in the absence of said potential agonist.
25. A method for identifying an inverse agonist of GAVE19 comprising: contacting a potential inverse agonist with a cell expressing GAVE 19 and determining whether in the presence of said potential inverse agonist, the activity of GAVE 19 is decreased relative to the activity of GAVE 19 in the absence of said potential inverse agonist, and is decreased in the presence of an endogenous ligand or agonist.
26. A method for identifying an antagonist of GAVE19 compnsmg: contacting a potential antagonist with a cell expressing GAVE 19 and determining whether in the presence of said potential antagonist the signaling activity of GAVE 19 is decreased relative to the activity of GAVE 19 in the presence of an endogenous ligand or agonist.
27. A therapeutic composition comprising an agonist, an antagonist, or an inverse agonist of GAVE 19 capable of modulating GAVE 19 signaling activity or transduction.
28. A method for treating a disease comprising admmistenng to a patient in need of treatment a therapeutic composition comprising an agonist, an antagonist or an inverse agonist of GAVE 19 capable of modulating GAVE 19 signaling activity or transduction.
EP03709093A 2002-02-14 2003-02-13 A nucleic acid encoding a g-protein-coupled receptor; and uses thereof Withdrawn EP1476460A4 (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US35668602P 2002-02-14 2002-02-14
US356686P 2002-02-14
GB0219574 2002-08-22
GBGB0219574.1A GB0219574D0 (en) 2002-02-14 2002-08-22 A nucleic acid encoding a g-protein-coupled receptor, and uses thereof
PCT/US2003/004350 WO2003068803A2 (en) 2002-02-14 2003-02-13 A nucleic acid encoding a g-protein-coupled receptor, and uses thereof

Publications (2)

Publication Number Publication Date
EP1476460A2 true EP1476460A2 (en) 2004-11-17
EP1476460A4 EP1476460A4 (en) 2005-12-07

Family

ID=27736226

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03709093A Withdrawn EP1476460A4 (en) 2002-02-14 2003-02-13 A nucleic acid encoding a g-protein-coupled receptor; and uses thereof

Country Status (10)

Country Link
EP (1) EP1476460A4 (en)
JP (1) JP2005517398A (en)
CN (1) CN1642971A (en)
AU (1) AU2003213051A1 (en)
BR (1) BR0307707A (en)
CA (1) CA2476239A1 (en)
MX (1) MXPA04007006A (en)
NO (1) NO20043582L (en)
RU (1) RU2004127439A (en)
WO (1) WO2003068803A2 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MX2010003371A (en) * 2007-09-28 2010-05-05 Intrexon Corp Therapeutic gene-switch constructs and bioreactors for the expression of biotherapeutic molecules, and uses thereof.
KR101137019B1 (en) * 2009-05-25 2012-05-24 한국생명공학연구원 A novel g protein coupled receptor and a use thereof
CN113588940B (en) * 2021-07-30 2023-05-12 菲鹏生物股份有限公司 Method and kit for improving sensitivity of indirect labeling

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001036473A2 (en) * 1999-11-16 2001-05-25 Pharmacia & Upjohn Company Human g protein-coupled receptors
AU2001274522A1 (en) * 2000-06-15 2001-12-24 Takeda Chemical Industries Ltd. Novel g protein-coupled receptor protein and dna thereof

Also Published As

Publication number Publication date
JP2005517398A (en) 2005-06-16
BR0307707A (en) 2005-03-01
CA2476239A1 (en) 2003-08-21
WO2003068803A3 (en) 2004-07-29
MXPA04007006A (en) 2004-10-11
RU2004127439A (en) 2005-04-10
AU2003213051A1 (en) 2003-09-04
CN1642971A (en) 2005-07-20
NO20043582L (en) 2004-08-27
EP1476460A4 (en) 2005-12-07
WO2003068803A2 (en) 2003-08-21

Similar Documents

Publication Publication Date Title
US7723074B2 (en) Nucleic acid molecules encoding prostaglandin receptor proteins
EP1476460A2 (en) A nucleic acid encoding a g-protein-coupled receptor; and uses thereof
US20030166008A1 (en) Nucleic acid encoding a G-protein-coupled receptor, and uses thereof
US20030186873A1 (en) Nucleic acid encoding a G-protein-coupled receptor, and uses thereof
US20030138418A1 (en) Nucleic acid encoding a G-protein-coupled receptor, and uses thereof
EP1470420A2 (en) A nucleic acid encoding a g-protein-coupled receptor, and uses thereof
AU2003214861A1 (en) A nucleic acid encoding a G-protein-coupled receptor, and uses thereof
WO2003042399A9 (en) A nucleic acid encoding a g-protein-coupled receptor, and uses thereof
AU2002363792A1 (en) A nucleic acid encoding a G-protein-coupled receptor, and uses thereof
MXPA06007364A (en) Nucleic acid encoding a novel prostaglandin receptor protein and methods of use thereof
WO2003029413A2 (en) A novel g protein-coupled receptor, gave 10
AU2003226272A8 (en) A novel g protein-coupled purinergic receptor, gave 17
ZA200400383B (en) A novel G protein-coupled receptor, GAVE8.
AU2002341895A1 (en) A novel G protein-coupled receptor, GAVE 10
WO2003054156A2 (en) Novel g proein-coupled receptor, gave7

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO

17P Request for examination filed

Effective date: 20050131

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

A4 Supplementary search report drawn up and despatched

Effective date: 20051024

RIC1 Information provided on ipc code assigned before grant

Ipc: 7A 01N 37/18 B

Ipc: 7C 07H 21/04 B

Ipc: 7C 07H 21/02 B

Ipc: 7G 01N 33/53 B

Ipc: 7C 12P 21/06 B

Ipc: 7C 07K 16/00 B

Ipc: 7C 12N 15/12 B

Ipc: 7C 07K 14/705 A

18W Application withdrawn

Effective date: 20051115