EP1453861A2

EP1453861A2 - Polynucleotide and protein involved in synaptogenesis, variants thereof, and their therapeutic and diagnostic uses

Info

Publication number: EP1453861A2
Application number: EP02801090A
Authority: EP
Inventors: Thomas Bourgeron; Stéphane JAMAIN; Hélène QUACH; Catalina Betancur; Marion Leboyer; Christopher Gillberg
Original assignee: Assistance Publique Hopitaux de Paris APHP; Institut Pasteur de Lille; Institut National de la Sante et de la Recherche Medicale INSERM
Current assignee: Assistance Publique Hopitaux de Paris APHP; Institut Pasteur de Lille; Institut National de la Sante et de la Recherche Medicale INSERM
Priority date: 2001-11-30
Filing date: 2002-12-02
Publication date: 2004-09-08
Also published as: US20090202992A1; AU2002364808A1; CA2364106A1; WO2003045998A2; US20050118588A1; US20090117554A1; AU2002364808A8; WO2003045998A3; US7906640B2; US7384740B2

Abstract

The invention concerns identification of human genes coding for a protein involved in synaptogenesis and whereof the mutation is associated in humans with the development of neurological diseases and/or predisposition to developing mental disorders or psychiatric diseases such as autism and asparagus syndrome. More particularly, the invention concerns a protein belonging to the family of human neuroligins (HNL's) and more particularly the HNL4X protein and its functional homologue HNL4Y encoded by a Y chromosome gene. The invention also concerns polynucleotides coding for the HNL4X and HNL4Y proteins mutated or not and mutated HNL3 proteins, the cellular expression vectors comprising the nucleic acid sequences expressing HNL3, HNL4X, HNL4Y mutated or not, and the polyclonal or monoclonal antibodies capable of being fixed on one of said peptides and/or polynucleotides mentioned above. The invention further concerns the use of polypeptides, polynucleotides, a vector, a host cell, and/or an antibody as defined above for preparing a composition for use in the treatment of a mental or neurological disease such as autism, asparagus syndrome, schizophrenia or the ADHD syndrome.

Description

POLYNUCLEOTIDE AND PROTEIN INVOLVED IN SYNAPTOGENESIS, VARIANTS THEREOF, AND THEIR THERAPEUTIC APPLICATIONS AND

DIAGNOSTIC

BACKGROUND OF THE INVENTION a) Field of the invention

The present invention relates to the identification of a human gene coding for a protein involved in synaptogenesis and of its murine ortholog, and whose mutation is associated in humans with the development of neurological diseases and / or with a predisposition to the development of mental disorders or psychiatric illnesses such as autism and Asperger's Syndrome.

The invention also relates to diagnostic and therapeutic applications related to the identification of the gene and its mutations.

The invention also relates to diagnostic and therapeutic applications linked to the identification of the involvement of a defect in a protein of the neuroligin family in the development of mental disorders or psychiatric diseases such as autism and the Syndrome of Asperger. b) Brief description of the prior art

Autism is a disease which affects approximately one child in 1000 and mainly boys (from 4 to 23 boys for a girl depending on the clinical criteria chosen). The clinical symptoms of autism are described in the book DSM-IV-TR ™ (Diagnostic and statistical manual of mental disorders, 2000, pages 70-75).

The molecular basis of autism is currently unknown. Studies have already suggested the existence of a genetic component in autism. Based on results of linkage analysis, Philippe et al. (Human Molecular Genetics, 1999, 8: 805-812) describes 11 chromosomal regions likely to be involved in the development of autism, including a region of the chromosome Xp. On the other hand, Thomas et al. (Hum. Genêt., 1999, 104: 43-48) describes deletions of the short arm of the X chromosome in patients with autism and Milunsky et al. (Clin. Genêt., 1999, 55: 455-460) describes Xp22 deletions in patients with schizophrenia and more specifically suggests the implication of an Xp22.3 deletion in the development of this psychiatric illness. However, neither the gene involved in the disease nor the nature of the mutation is mentioned.

Neuroligins (HNLs) are cell adhesion proteins which alone can trigger synaptogenesis, i.e. the formation of synapses. (Scheiffele et a /., Cell, 2000, 101: 657-669). Neuroligins NL1, NL2 and NL3 were originally cloned in rats (Ichtchenko et al., Cell., 1995, 81 (3): 435-43; Ichtchenko et al., J. Biol. Chem., 1996, 271 ( 5): 2676-82). The neuroligins HNL1 and HNL2 are located on autosomes (3q26 and 17p13). These genes are targets for susceptibility to psychiatric diseases and several protein variations of HNL2 have been demonstrated by the inventors in autistic patients (R734H, G754R, A755V). A protein HNL4X (Human Neuroligline-4) has been described by Bollinger et al. (Biochem. J., 2001, 356: 581-588) without genomic description or associated biological function. On the other hand, the LOCUSLINK ™ database (http://www.ncbi.nim.nih.gov) dated September 13, 2001 provides under the accession numbers KIAA1260 and KIAA0951 incomplete sequences of a neuroligin gene the function of which is also unknown. All neuroligins have an extracellular domain homologous to Acetylcholine esterase (ACHE). In this extracellular part, the neuroligins interact with the β-neurexins (Ichtchenko et al., Cell., 1995, 81 (3): 435-43). This interaction can be modulated by the ACHE itself (Grifman et al., Proc. Natl. Acad. Sci. USA, 1998, 95 (23): 13935-40). At the cytoplasmic level, neuroligins interact with several proteins containing PDZ domains (Irie et al., Sciences, 1997, 277 (5331): 1511-5; Hirao et al., J. Biol. Chem. 1998, 273 (33) , 21105-10; Kurschner et al., Mol. Cell Neurosci., 1999, 11 (3): 161 -72; Bolliger et al., Biochem J., 2001, 356: 581-8; Toyooka et al., J Neurochem., 2002, 83 (4): 797-806). Among these proteins, there are the DLG1-5 family proteins (3q29, 11q13, Xq13.1, 17p13.1 and 10q22.3), the S-SCAM protein (7q21.11), the proteins of the CIPP family ( MPDZ, 9p23 and INADL, 1p31), the protein CASK (Xp11). In view of the above, it is clear that knowledge of the molecular bases of autism and especially of the gene involved in the disease is highly desirable in order to allow the development of new therapeutic approaches, new drugs and diagnostic tests.

There is also a need concerning the identification of the biological function of neuroligins as well as the identification of the nucleic and protein sequence of neuroligins, in particular that of HNL3 and HNL4X.

The present invention meets these needs and other needs as will be apparent to a person skilled in the art on reading the present description of the invention. SUMMARY OF THE INVENTION

The present invention relates to the identification of human genes and their murine ortholog coding for a protein involved in synaptogenesis and whose mutation is associated in humans with the development of neurological diseases and / or with a predisposition to the development of mental disorders or psychiatric illnesses such as autism and Asperger's Syndrome.

More particularly, the present invention relates to an isolated or purified polynucleotide coding for a polypeptide involved, in its wild form, in synaptogenesis. The polynucleotide of the present invention is characterized in that at least one mutation in the nucleic acid sequence of said polynucleotide is associated with the development of neurological diseases and / or with a predisposition to the development of mental disorders or psychiatric diseases.

Preferably, the present invention relates to a polynucleotide encoding a protein belonging to the family of human Neuroligins (HNLs) and more particularly the protein HNL4X (previously called HNL4) and its functional counterpart HNL4Y (previously called HNL5) coded by a chromosome gene.

Y.

The present invention also relates to a polynucleotide encoding the mouse protein MNL4 orthologue of the proteins HNL4X and HNL4Y. According to another object, the present invention relates to an isolated or purified polypeptide, characterized in that it is coded by a polynucleotide as defined above. More particularly, the polypeptide according to the present invention is characterized in that it is involved in synaptogenesis, and in that the presence of at least one mutation in the amino acid sequence of said polypeptide is associated with a predisposition to the development of mental disorders or psychiatric illnesses.

According to another object, the present invention provides a method for detecting biochemical disorders altering the formation of synapses, and / or a predisposition to the development of psychiatric pathologies and / or a mental illness, comprising at least one of the following steps:

the detection of a mutation in the sequence of a polynucleotide as defined above, in the sequence of a fragment of said polynucleotide or in the sequence of a messenger RNA of said polynucleotide;

- detecting the presence of a polypeptide as defined above; - detection of a mutation in a polypeptide as defined above;

- measuring the activity of a polypeptide as defined above or the interaction thereof with one of its protein partners. Another object of the invention is to provide a kit for the detection of biochemical disorders altering the formation of synapses, and / or a predisposition to the development of psychiatric pathologies and / or a mental illness, and / or for the diagnosis of a mental illness, the kit comprising at least one of the elements chosen from the group consisting of: a probe, an antibody, a reagent and a solid support allowing: i) the detection of a mutation in the sequence of a polynucleotide as defined above, in the sequence of a fragment of said polynucleotide or in the sequence of a messenger RNA of said polynucleotide; and / or ii) measuring the biological activity of a polypeptide as defined above or the interaction thereof with one of its protein partners.

The invention also relates to the use of a non-mutated polynucleotide encoding a protein involved in its wild form in synaptogenesis for the treatment or prevention of biochemical pathologies or mental diseases.

The invention also relates to the use of an unmutated polypeptide involved in its wild form in synaptogenesis for the treatment or prevention of biochemical pathologies or mental diseases.

The present invention also provides a method for sorting molecules making it possible to modulate the biological activity of the polypeptide encoded by the polynucleotide defined above or the biological activity of the polypeptide defined above, comprising: a) bringing said polypeptide or a recombinant cell containing it with a molecule capable of modulating its biological activity; b) measuring the biological activity of said polypeptide or its interaction with one of its protein partners; and c) evaluating the activity measured in step b) relative to a measurement of the biological activity of said polypeptide in the absence of said molecule.

Another object of the present invention is a method of treating a mental or neurological disease comprising the insertion into at least a portion of the cells of a patient of a patient of a polynucleotide encoding a polypeptide as defined above. The present invention also provides a method of transforming stem cells of a patient with a mutation of a gene coding for a protein involved in synaptogenesis, characterized by a) the use of stem cells of said patient; b) the insertion into the genome of said stem cells of a polynucleotide as defined above; and c) reimplantation in the patient of cells transformed according to step b). The invention further relates to a cloning or expression vector comprising one of the polynucleotides of the invention or a fragment thereof; a host cell containing a polynucleotide and / or a vector according to the invention; or purified monoclonal or polyclonal antibodies specifically recognizing at least one of the polynucleotides of the invention and / or at least one of the polypeptides of the invention.

The invention also relates to a composition containing at least one element chosen from the group consisting of a) a polypeptide, b) a polynucleotide, c) a vector, d) a host cell or e) an antibody, and a pharmaceutically acceptable vehicle.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the region of chromosome Xp22.3 containing the HNL4X gene.

Figure 2 shows a protein alignment of human Neuroligins.

Figure 3 is a diagram showing the protein architecture of a synapse with the location and known partners of Neuroligins.

Figures 4A and 4B represent a diagram which shows the chromosomal location and the evolution of the HNL4X and HNL4Y genes.

Figure 5 is a diagram showing the genomic structure of human Neuroligins genes.

Figures 6A and 6B show the result of the analysis by SSCP (Single Strand

Conformational Polymorphism) of a mutation in the gene coding for the protein HNL4X as well as the sequence of this mutation.

Figure 7 is a diagram showing the location of the HNL4X protein and the effects of the mutation on HNL4X.

Figure 8A shows the genomic sequence (SEQ ID NO: 1) of the human gene

Wild HNL4X (not mutated). Figure 8B shows the nucleic acid sequence (SEQ ID NO: 16) of the exon

1 of Figure 8A.

Figure 9 shows the complementary DNA sequence (SEQ ID NO: 2) of the human HNL4X wild type gene (not mutated). Figure 10 shows the amino acid sequence (SEQ ID NO: 3) of the human protein HNL4X wild (not mutated).

Figure 11A shows the genomic sequence (SEQ ID NO: 4) of the human gene

HNL4Y.

Figure 11B shows the nucleic acid sequence (SEQ ID NO: 17) of exon 1 of Figure 11A.

Figure 12 shows the complementary DNA sequence (cDNA) (SEQ ID NO: 5) of the wild-type human HNL4 Y gene.

Figure 13 shows the amino acid sequence (SEQ ID NO: 6) of the human protein H NL4Y wild. Figure 14 shows the complementary DNA sequence (cDNA) (SEQ ID NO: 7) of an alternative transcript of the wild-type human HNL4 Y gene.

Figure 15 represents the amino acid sequence (SEQ ID NO: 8) corresponding to the alternative sequence of Figure 14.

Figure 16 shows the amino acid sequence (SEQ ID NO: 9) of the mutated human protein HNL4X.

Figure 17 shows the chromosomal location of the HNL3, HNL4X and

HNL4Y and pedigree of a family with a mutation in HNL4X in an autistic boy and a boy with Asperger's syndrome.

Figure 18 is a diagram showing the conservation of HNL3 mutations. Figure 19A shows the nucleic acid sequence of MNL4 cDNA (SEQ ID

NO: 62) (ortholog of HNL4X and HNL4Y).

Figure 19B shows the amino acid sequence of the MNL4 protein (SEQ ID

NO: 63).

Figure 20 is a diagram showing the genomic structure of the HNL1, HNL2 and HNL3 genes, as well as the location of the mutations observed in HNL3.

Figure 21 is a diagram showing the genomic structure of HNL4X and HNL4Y.

Figure 22 shows a portion of the amino acid sequence (SEQ ID NO: 10) of the HNL3 protein mutated at position 451.

Figure 23 shows another portion of the amino acid sequence (SEQ ID NO: 11) of the HNL3 protein mutated at position 796. Figure 24 shows the complementary DNA sequence (cDNA) (SEQ ID NO: 12) of the wild-type HNL3 transcript.

Figure 25 shows the complementary DNA sequence (cDNA) (SEQ ID NO: 13) of the mutated HNL3 transcript. Figure 26 shows the amino acid sequence (SEQ ID NO: 14) of the human protein HNL3 wild.

Figure 27 shows the amino acid sequence (SEQ ID NO: 15) of the mutated human protein HNL3.

DETAILED DESCRIPTION OF THE INVENTION

The originality of the present invention relates to the identification of the genomic sequence of the HNL4X gene located in Xp22.3 and of a functional homolog HNL4Y placed on the Y chromosome located in Yq11.22 as well as their murine ortholog MLN4.

The invention also relates to the identification of the involvement of synaptogenesis proteins, in particular HNL3 and HNL4 in the development of mental disorders or psychiatric diseases such as autism.

1. Polypeptide and polynucleotide

According to a first aspect, the present invention relates to an isolated or purified polypeptide, which, in its wild form (ie non-mutated), is involved in synaptogenesis, of which at least one mutation in the amino acid sequence is associated with the development of neurological diseases and / or a predisposition to the development of mental disorders or psychiatric diseases.

“Mental disorders or psychiatric illnesses” means illnesses such as autism, Asperger's syndrome, schizophrenia and ADHD (Attention Deficit Hyperactivity Disorder) syndrome.

Preferably, the polypeptide consists of a cell adhesion protein, more preferably a protein belonging to the family of human neuroligins and even more preferably, the polypeptide consists of the protein HNL3, HNL4X or the protein HNL4Y. Advantageously, when the polypeptide is HNL3, it comprises an amino acid sequence according to SEQ ID NO: 14 and the sequences of at least 20, at least 50 and at least 100 consecutive or more derived amino acids of SEQ ID NO: 14. When the polypeptide of the invention is HNL4X or the protein HNL4Y, it comprises a sequence chosen from the group consisting of: SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 8, and the sequences at least 20, at least 50 and at least 100 consecutive or more amino acids derived from SEQ ID NO: 3, SEQ ID NO: 6 or SEQ ID NO: 8.

The invention also relates to the "mutated" polypeptides and the polypeptides "derived" from the wild-type protein, preferably a neuroligin such as HNL3, HNL4X or HNL4Y.

By "polypeptide derived" from a wild protein or "variant" of a wild protein is meant all peptides which have a peptide sequence substantially identical, at least in part, to the peptide sequence of the wild protein. They may, for example, be chemically modified polypeptides having a peptide sequence 100% identical to a portion of the wild-type protein. They may also be hybrid polypeptides having a first portion 100% identical to a first portion of the wild protein and a second portion in no way / partially identical to a second portion of the wild protein. They may also be polypeptides having total / partial homology with a portion of the wild-type protein.

By “mutated” polypeptides derived from a wild protein is meant all the peptides which have been obtained following a modification of said wild protein, whether it is a modification by addition, deletion or substitution of one or more of the amino acids of the wild protein. It can also be a modification brought about by the addition of carbon chains attached to at least one of the amino acids of the wild protein or to at least one of the amino acids of peptides for which there is a substitution or a modification of one of the amino acids compared to wild protein. More particularly, the present invention covers peptides which are derived from the human protein HNL3, HNL4X or HNL4Y. According to a preferred embodiment, and in the case where the polypeptide is a

HNL3 mutated according to the present invention, it has SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 15, and a sequence of at least 20, at least 50 and at least 100 consecutive or more amino acids derived from SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 15. In the case where the polypeptide is a mutated HNL4X or a mutated HNL4Y according to the present invention, it has the SEQ ID NO: 9 or a sequence of at least 20, at least 50 and at least 100 consecutive amino acids or more derived from SEQ ID NO: 9.

The invention also relates to the polypeptides (and fragments thereof) which are encoded by the nucleotide sequences mentioned below. In the context of the present invention, the term "polypeptide" is defined as being any peptide or protein comprising at least two amino acids linked by a modified or unmodified peptide link. The term polypeptide refers to molecules of short chains such as peptides, oligopeptides or oligomers or to long chains such as proteins. A polypeptide according to the present invention can comprise modified amino acids. Thus, the polypeptide of the present invention can also be modified by a natural method such as post-transcriptional modifications or by a chemical method. Some examples of these modifications are: acetylation, acylation, ADP-ribosylation, amidation, covalent bond with flavin, covalent bond with heme, covalent bond with a nucleotide or a nucleotide derivative, bond with a lipid or a lipid derivative, covalent bond with a phosphotidylinositol, crosslinking, cyclization, disulfide bond formation, demethylation, cysteine molecule formation, pyroglutamate formation, formylation, gamma-carboxylation, hydroxylation, iodination, methylation, oxidation, phosphorylation, racemization, hydroxylation, etc. Thus, any modification of the polypeptide which does not have the effect of eliminating the biochemical characteristics of the original polypeptide, i.e. the ability to form functional synapses, is covered within the scope of the present invention.

According to a related aspect, the invention relates to an isolated or purified polynucleotide coding for a polypeptide as defined above and more particularly to an isolated or purified polynucleotide coding for a polypeptide involved in synaptogenesis in which at least one mutation of this polynucleotide is associated with development of neurological diseases and / or a predisposition to the development of mental illnesses or psychiatric illnesses. By "isolated or purified" is meant the molecules which have been altered by humans from their native state, that is to say, if such a molecule exists in nature, it has been changed and / or removed from its initial environment. For example, a polynucleotide or polypeptide naturally present in a living organism is not "isolated". However, the same polynucleotide or polypeptide when separated from its normal environment and / or obtained by cloning, amplification and / or by chemical synthesis is considered according to the present invention as being "isolated". Moreover, a polynucleotide or polynucleotide which is introduced into an organism by transformation, genetic manipulation or by any other method of recombination is "isolated" even if it is present in said organism. By "polynucleotide" is meant any DNA or RNA sequence or molecule having two or more nucleotides, including the nucleic sequences encoding an entire gene. The term polynucleotide encompasses all nucleic acid molecules that are found in a natural or artificial state. This includes DNA molecules, RNA molecules, cDNAs, expressed sequences (ESTs), artificial sequences and all fragments thereof. It goes without saying that the definitions "derivative", "variant" and "mutated" also apply to the polynucleotides according to the present invention. Any polynucleotide which has been chemically, enzymatically or metabolically modified but which has retained the biochemical properties of the original polypeptide, that is to say which has retained its power to form functional synapses, is included within the scope of the present invention. .

According to a preferred embodiment, the polynucleotide according to the invention when it codes for an HNL3 protein or a fragment of this protein, the latter advantageously comprises SEQ ID NO: 14. Preferably, the polynucleotide comprises a sequence chosen from the group consisting of: SEQ ID NO: 12, and the sequences of at least 20, at least 50 and at least 100 consecutive or more nucleotides derived from SEQ ID NO: 12.

According to a preferred embodiment, the polynucleotide according to the invention when it codes for an HNL4X or HNL4Y protein or a fragment of this protein, the latter advantageously comprises SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 8. Preferably, the polynucleotide comprises a sequence chosen from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 16, SEQ ID NO: 17, and the sequences of at least 20, at least 50 and at least 100 consecutive nucleotides or more derived from these sequences.

According to another embodiment, the polynucleotide codes for a non-functional mutated protein. Preferably, the polynucleotide codes for a mutated HNL3 or mutated HNL4X protein. In the case where the protein is HNL4X, the polynucleotide is mutated so that the mutation causes early termination of the protein. More preferably, the polynucleotide of the invention comprises SEQ ID NO: 1 and the mutation is an insertion of a thymine at position 1186 from position 465 of Figure 9 (ORF). This mutation causes the production of a defective protein devoid of its transmembrane part since this mutation causes early termination of the protein (D396stop). In the case where the mutated protein is HNL3, the mutation causes a modification of the sequence protein such as an amino acid substitution at position 451 and / or 796 in Figure 18 or 21. More specifically, the mutation produced at position 451 consists in the substitution of an arginine by a cysteine, while the mutation produced at position 796 consists of the substitution of an asparagine by a serine. This amino acid, arginine R451, is located in the acetylcholine esterase domain of neuroligins and is extremely conserved in all neuroligins sequenced to date and in the acetylcholine esterases of fish, birds and reptiles (Figures 6A and 6B).

The polypeptides and polynucleotides according to the present invention can be prepared by any suitable method. They can in particular be obtained by chemical synthesis, but it is also possible to obtain them by biological means, in particular by using different vectors in appropriate cell cultures as will be described below. The peptides according to the present invention can be in deglycosylated, or glycosylated form, if necessary. A person skilled in the field of the invention will be able to obtain different polynucleotides / polypeptides and he will also be able to determine which of the polynucleotides / polypeptides obtained have those which have adequate biological activity.

2. Vector, Antibody and Cell According to another aspect, the invention relates to any vector (cloning and / or expression) and any cellular host (prokaryotic or eukaryotic) transformed by such a vector, and comprising the regulatory elements allowing expression of the nucleotide sequence coding for a peptide according to the invention.

According to another aspect, the subject of the invention is a process for the preparation of a peptide of the invention, by transformation of a cellular host using an expression vector (plasmid, cosmid, virus, etc. .) comprising the DNA sequences coding for the peptides of the invention, followed by culturing the cell host thus transformed, and recovering the peptide from the culture medium. The use of vectors for the expression of proteins and peptides in the cells of a host, in particular the human, is well known and will not be described in more detail.

The polypeptides and polynucleotides of the present invention can also be used to prepare polyclonal or monoclonal antibodies capable of binding (preferably specifically) to at least one polypeptide / polynucleotide object of the invention. The present invention therefore also relates to such purified antibodies which can be obtained by very well known techniques such as example the technique described by Kolher and Milstein (Continuous cultures of fused cells secreting antibody of predefined specificity, Nature, 1975, 262: 495-497). According to a preferred embodiment of the invention, the antibodies are of the “humanized” type. A person skilled in the art through his general knowledge will know how to prepare these types of antibodies.

In the context of the present invention, the term "vector" refers to a polynucleotide construct designed to be transfected into different cell types. As a result, these vectors target the expression vectors designed for the expression of a nucleotide sequence in a host cell; cloning vectors designed for the isolation, propagation and replication of inserted nucleotides; viral vectors designed for the production of recombinant virus or viral-like particle; or shuttle vectors that include attributes from more than one vector.

3. Methods and Method of Use

According to another aspect, the invention relates to the treatment or prevention of biochemical pathologies or mental illnesses such as autism or Asperger's Syndrome. More particularly, the invention relates to the use of a non-mutated polynucleotide encoding a protein involved in synaptogenesis. Preferably, the protein consists of a cell adhesion protein, more preferably a protein belonging to the family of human neuroligins and even more preferably the polypeptide consists of the protein HNL3, HNL4X or the protein HNL4Y. Examples of non-mutated polynucleotides are given above. The invention also relates to a treatment method comprising the insertion into at least a portion of the cells of a sick patient, of a polynucleotide encoding a polypeptide involved in synaptogenesis such as the protein HNL3 or HNL4X. Preferably, the cells into which the polynucleotide is inserted are stem cells. Examples of satisfactory polynucleotides are given above.

According to a related aspect, the invention relates to a method of transforming stem cells of a patient having a mutation of a gene coding for a protein involved in synaptogenesis, the method comprising: a) the use of stem cells of the patient ; b) insertion into the stem cell genome of a polynucleotide encoding a functional polypeptide involved in synaptogenesis such as the protein HNL3 or HNL4X; and c) reimplantation in the patient of cells transformed according to step b). A person skilled in the art will be able to adapt the above-mentioned methods of treatment and determine, depending on several factors, the polynucleotides to be used, the means of inserting them into cells and the mode and quantity of polynucleotides or cells. to be administered. Among the factors that can influence his choices are: the nature of the treatment, the exact sequence of the polynucleotides; the stage of the disease; the patient's condition, age and weight, etc.

According to another aspect, the invention also relates to a method for detecting biochemical disorders altering the formation, stabilization and / or recognition of synapses, a predisposition to the development of psychiatric pathologies and / or a mental illness such as autism. or Asperger's Syndrome. Thus, the method comprises at least one of the following steps: the detection of a mutation in the sequence of a gene coding for a protein involved in synaptogenesis, in the sequence of a fragment of this gene or in the sequence of a messenger RNA of this gene; - detecting the presence of a protein involved in synaptogenesis; detecting a mutation in a protein involved in synaptogenesis; measuring the biological activity of a protein involved in synaptogenesis or its interaction with one of its protein partners. A method for measuring such an interaction is for example described in Ichtchenko et al. (J. Biol. Chem., 1996, 271 (5): 2676-82) or Grifman et al. (Proc. Natl. Acad. Sci. USA, 1998, 95 (23): 13935-40). According to a preferred embodiment, the method comprises: a) amplification of a gene coding for a protein involved in synaptogenesis, amplification of a fragment of said gene or amplification of a messenger RNA of said gene; and b) detecting a mutation in the sequence of said gene, in the sequence of said fragment or in the sequence of said messenger RNA. A related aspect of the method of the invention relates to a kit (kit) for the detection of biochemical disorders altering the formation of synapses, of a predisposition to the development of psychiatric pathologies and / or of a mental illness, and / or for the diagnosis of mental illness. According to a preferred embodiment, the kit comprises at least one of the elements chosen from the group consisting of: a probe, an antibody, a reagent and a solid support, these elements allowing: i) the detection of a mutation in the sequence a gene coding for a protein involved in synaptogenesis, in the sequence of a fragment of this gene or in the sequence of a messenger RNA of this gene; and / or ii) measuring the biological activity of a protein involved in synaptogenesis or its interaction with one of its protein partners.

Preferably, the gene to which reference is made in the method and the kit codes, in its wild form, for a cell adhesion protein, more preferably for a protein belonging to the family of human neuroligins and even more preferably for the protein HNL3. , HNL4X or the HNL4Y protein.

Advantageously, the gene codes, in its wild form, for a protein comprising SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 8 or SEQ ID NO: 14. More preferably, the gene comprises SEQ ID NO: 1, SEQ ID NO: 4 or SEQ ID NO: 12. Knowledge of the gene involved in a predisposition to the development of autism or Asperger's Syndrome opens the door to the discovery of new molecules allowing to prevent, control or treat the disease. Thus, according to another aspect, the invention relates to a method for sorting molecules which can make it possible to modulate the biological activity of a polypeptide encoded by the polynucleotide as defined above, or the biological activity of the polypeptide as defined above. According to a preferred embodiment, the sorting process comprises: a) bringing said polypeptide into contact with a molecule capable of modulating its biological activity; b) measuring the biological activity of said polypeptide; and c) evaluating the activity measured in step b) relative to a measurement of the biological activity of said polypeptide in the absence of said molecule.

4. Compositions

The present invention also relates to the use of these polypeptides and polynucleotides encoding them for the preparation of therapeutic compositions. useful in the treatment of a mental or neurological disease, such as autism, Asperger's syndrome, schizophrenia or ADHD syndrome.

In a preferred embodiment, the composition of the present invention further contains a pharmaceutically acceptable vehicle, and an element selected from the group consisting of: a polynucleotide according to the present invention; - a polypeptide according to the present invention; an antibody according to the present invention; a vector according to the present invention; and - a host cell according to the present invention.

The compositions according to the present invention can be in any solid or liquid form customary for pharmaceutical administration, that is to say for example forms of liquid administration, in gel, or any other support allowing for example the controlled release. Among the compositions which can be used, mention may in particular be made of injectable compositions more particularly intended for injections into the blood circulation in humans.

A person skilled in the art will know how to prepare pharmaceutically acceptable compositions and to determine, according to several factors, the preferred mode of administration and the quantity to be administered. Among the factors that can influence his choices are: the nature of the treatment, the exact nature of the ingredients, active or not, used in the composition; the stage of the disease; the patient's condition, age and weight, etc.

The examples below will make it possible to demonstrate other characteristics and advantages of the present invention.

EXAMPLES

The examples which follow serve to illustrate the extent of the use of the present invention and not to limit its scope. Modifications and variations can be made without departing from the spirit and scope of the invention. Although other methods or products equivalent to those found below can be used to test or carry out the present invention, the preferred equipment and methods are described. Introduction

A locus of predisposition to autism was suggested in Xp22.3 by the observation of several independent and de novo chromosomal deletions in this region. The size of the critical region deleted in these patients was approximately 10 Mb, bounded by DXYS232X (6 cM) and DXS7103 (16 cM). In support of these results, the overall genome analysis carried out by the PARIS study (Philippe et al., 1999) indicates that the maximum LOD for the X chromosome is located in this region (11 cM).

In this interval, we have identified the human neuroligin 4 gene (HNL4X), coding for a new member of the neuroligin family (Scheiffele et al., 2000; Song et al., 1999). These cell adhesion molecules have homology with acetylcholine esterases and are specifically localized in the postsynaptic membrane of excitatory synapses (Song et al., 1999). They are crucial factors for the formation of functional synapses because the expression of neuroligins in HeLa or kidney cells can trigger the development of presynaptic structures in neurons in contact (Scheiffele et al., 2000). We have identified five HNL genes in the human genome, located on chromosomes 3q26 (HNL1), 17p13 (HNL2), Xq13 (HNL3), Xp22.3 (HNL4X) and Yq11.2 (HNL4Y). The phylogeny of neuroligins suggests that HNL3 is the common ancestor of HNL4X and HNL4Y. The expression profile of the HNLs was determined by specific RT-PCR in different tissues of adult brains (males and females). The expression of the HNL1-3 genes and their alternative transcripts is found in all regions of the brain. HNL4X and HNL4Y are expressed at similar levels in the male brain without significant differences between different tissues. As expected, HNL4Y is not expressed in the female brain, while HNL4X is.

EXAMPLE 1 Characterization of the HNL4X and HNL4Y Genes and Their Implication in Psychiatric Syndromes The phylogenetic study shows that the HNL4X genes located on the X chromosome and the HNL4Y genes located on the Y chromosome began to diverge, there are approximately 40 million years, during the evolution of primates. While all of the genes on the Y chromosome that diverged on that date have become pseudo genes (inactive genes), HNL4 Y is highly conserved (Table 1). Table 1: Conservation of the HNL4X and HNL4Y genes during evolution

Divergence Divergence Sequence

Pair of Ks KA Ks / KA DNA protein proteins compared

(%) (nucleotides)

Group 4

GYG2 / GYG2P ^* 0.11 0.06 1.8 7 12 525

ARSD / ARSDP * 0.09 0.07 1.3 7 13 846

ARSE / ARSEP ^* 0.05 0.04 1.2 4 9 615

PRKX Y 0.07 0.03 2.3 5 8 1020

HNL4X / 4Y 0.079 0.012 6.456 3 2 2451

STS / STSP ^* 0.12 0.10 1.2 11 18 852

KAL1 / KALP * 0.07 0.06 1.2 6 12 1302

AMELX / Y 0.07 0.07 1.0 7 12 576

Group 3

TB4X / Y 0.29 0.04 7.3 7 7 135

EIF1AX / Y 0.32 0.01 32 9 2,432

ZFX / Y 0.23 0.04 5.8 7 7 2394

DFFRX / Y 0.33 0.05 6.6 11 9 7,671

DBX / Y 0.36 0.04 9.0 12 9 1932

CASK / CASKP ^* 0.24 0.22 1.1 15 32 156

UTX / Y 0.26 0.08 3.3 12 15 4068

Group 2

UBE1X / Y 0.58 0.07 8.3 16 13 693

SMCX / Y 0.52 0.08 6.5 17 15 4,623

Group 1

RPS4X / Y 0.97 0.05 19 18 18 792

RBMX Y 0.94 0.25 3.8 29 38 1188

SOX3 / SRY 1.25 0.19 6.6 28 29 264

PCDHX / Y 0.006 0.008 0.809 1 2 2850

This table groups together the synonymous (KS) and non-synonymous (KA) 5 substitution rates of all known genes on the X chromosome having a homolog on the Y chromosome. The KS / KA ratio is an indication of gene conservation. KS is the synonymous substitution rate per synonymous site which represents the modifications which do not change the sequence of the protein. KA is the non-synonymous substitution rate per non-synonymous site which represents the modifications which change the sequence of the protein. If the ratio KS / KA = 1 then the gene is not conserved because there are as many synonymous and non-synonymous modifications. This is the case for X / Y couples with a non-functional pseudogen on the Y chromosome (eg KAL1 / KALP ^* ). If KS / KA> 1, then the gene varies during evolution but the protein is well conserved. This is the case for the couple HNL4 / 5 indicating that the genetic variation between these genes is subjected to a selection pressure which retains the protein sequences of HNL4X and HNL4Y. For the detection of mutations in the HNL4X gene, the following steps were used:

Materials and Methods Identification of the sequence of the HNL4X, HNL4Y and MNL4 genes

The isolation of the HNL4X and HNL4Y genes was carried out by computer analysis of the sequences of the Xp22.3 and Yq11.22 region and by amplification of the complete transcripts from brain mRNAs. Computer analysis A systematic study of the genes of the Xp22.3 region, close to the DXS996 microsatellite, was carried out using data from the sequencing of the human genome (http://genome.usc.edu and http // www. Ensembl.org / genomecentral). The DXS996 microsatellite is the genetic marker that shows the most significant link with autism in the analysis by Philippe et al. (1999, supra). We identified that this genetic marker was located in a putative KIAA1260 gene and that there was a putative homolog KIAA0951 located on the Y chromosome. The partial cDNA sequence of the genes coding for KIAA1260 and KIAA0951 was deduced from the genomic sequence. A sequence alignment analysis (BLAST) and a phylogenetic tree grouping the other human neuroligins was performed to define that KIAA1260 and KIAA0951 are new members of the neuroligin family which we will henceforth call HNL4X and HNL4Y. Analysis of HNL4X and HNL4Y transcripts

Total RNAs from human brains from different men (n = 5) and women (n = 5) were isolated from biopsies of frontal cortices. The complete cDNAs of the HNL4X and HNL4Y mRNAs were back-transcribed, amplified and directly sequenced. The oligonucleotides used for amplification and sequencing are indicated in Tables 2 and 3.

Sequencing of the HNL4X and HNL4Y genes in autistic and Asperger's subjects Each exon of the HNL4X and HNL4Y genes was amplified and sequenced from genomic DNA. The name and sequence of each primer are given in Table 3. Table 2: Names and sequences of the primers used to amplify and sequence the cDNAs of HNL4X and HNL4Y

Exons 1-6 HNLXY1 ACCCCGCGTGAAGATGAAATG SEQ ID NO: 18

HNLXYE6dR GAGGGATAGGARGGGAAATAG SEQ ID NO: 19

Exons 2-5 HNLXYE2F GGATGTGGATGCAGATTTGAA SEQ ID NO: 20

HNLXY4 GCTCTGAATGATGGCCTTCTG SEQ ID NO: 21

Exons 4-6 HNLXY10 TCCTGGATCAGATTCAAGCAC SEQ ID NO: 22

HNLXYE6dR GAGGGATAGGARGGGAAATAG SEQ ID NO: 23

Exons 2-6 HNLXYE2F GGATGTGGATGCAGATTTGAA SEQ ID NO: 24

HNLXYE6dR GAGGGATAGGARGGGAAATAG SEQ ID NO: 25

For degenerate primers, use of the universal code: M (AC), R (AG), W (AT), S (CG), Y (CT), K (GT), V (ACG), H (ACT), D (AGT), B (CGT), N (ACGT)

Table 3: Names and sequences of the primers used to sequence the HNL4X and HNL4Y genes

Exons Primers Sequences SEQ ID NO

Exon 1a HNL4X HNLXYElaF GAAACAACGAATTTCCTCCAAA 26

HNLXYElaR AGIGAGG I I ICCAICCI I IGC 27

Exon1bHNL4X HNLXE1F ATTCTTTAAGAAAACTGTCAGC 28

HNLXYE1R CACGGGAAAGGGGTGCATGGA 29

Exon 1 HNL4Y HNLYE1F GGGG I GC I I C I I I I GGGAGG I 30

HNLXYE1R CACGGGAAAGGGGTGCATGGA 31

Exon 2 HNLX / Y HNLXYE2F GGAIUIGGAIGCAGAI I IGAA 32

HNLXE2Rbis GTATTGTTTTCTGTTCCAGTG 33

Exon 3 HNL4X / Y HNLXYE3F IGIGIIICCGIACI IGGCI I I 34

HNLXYE3R GCTTAGTCATTCACATGATGAA 35

Exon 4 HNL4x HNLXYE4F ACCAAAAATCTCTTGTGTTCT 36

HNLXYE4R I HERE IGGI ICAGGGIAI I IGC 37

Exon 4 HNL4Y HNLYE4F AACAAAAATGTCCTGTGTTCT 38

HNLXYE4R I HERE IGGI ICAGGGIAI I IGC 39

Exon 5 HNL4X / Y HNLXYEδdF I G I CCRCAA I I I I GCAC I GC 40

HNLXYEδdR AGGAYAGTGATACCCCAACA 41

Exon 6 HNL4X / Y HNLXYE6Fbis AGAGCAGATTGTAACTTCCTG 42

HNLXYE6dR GAGGGATAGGARGGGAAATAG 43

For degenerate primers, use of the universal code: M (AC), R (AG), W (AT), S (CG), Y (CT), K (GT), V (ACG), H (ACT), D (AGT), B (CGT), N (ACGT).

Table 4: Names and sequences of the primers used for the amplification of the MNL4 cDNA (mouse 57BL6)

Table 5: Names and sequences of the primers used for the amplification of MNL4 in three PCRs of approximately 1 kb

Table 6: Names and sequences of the primers used for the amplification of HNL3

In order to test this gene in autistic subjects, the genomic structure of the various HNLs was defined and the coding parts (Exon 2-Exon 6) were amplified.

Thus, 140 boys and 18 girls with autism were tested for the majority of the coding part HNL4X / 4Y.

In a Swedish family with two affected brothers, one with autism and the other with Asperger's syndrome, an additional thymidine was identified at nucleotide 1186 of the HNL4X gene, creating a stop codon (Figure 17). This mutation (D396stop) is localized in the esterase domain, producing a stop premature protein and suppressing the transmembrane domain. This change is inherited from the mother, but is absent in the maternal grandmother, in the two maternal aunts and in the unaffected child, indicating the de novo status of this mutation in the mother of affected boys. In addition, this mutation was not found in 350 controls (250 women and 100 men).

On the other hand, the boy / girl ratio, which is four for autism and nine for Asperger's syndrome corroborates this observation that HNL4X / 4Y influences the synaptogenesis and mutation of HNL4X / 4Y constitutes a factor. predisposition to mental illness, including autism and Asperger's syndrome.

The identification of this Stop mutation in a specific gene for primates, carried by the X chromosome in two autistic subjects and involved in synaptogenesis is one of the first functional mutations identified in a psychiatric illness. This mutation is also the first mutation described associated with autism without any other clinical sign (fragile X, tuberculous sclerosis, etc.).

Example 2: Characterization of the HNL3 gene and its implication in psychiatric syndromes.

During the search for mutations in HNL3, the ancestral gene for HNL4X / Y located in the Xq13 region, in two independent families, two amino acid changes located in highly conserved regions of the protein were identified. One of the two families is very similar to the first family mutated in HNL4X. The two brothers, the first with autism and the second with Asperger's syndrome, receive the mutation from their mother. Interestingly, the mother also has a brother with Asperger's syndrome and other parents with psychiatric disorders. The mutation (R451C) is located in the esterase domain of the protein and concerns an amino acid conserved during evolution because it is present in all neuroligins (including in D. melanogasteή and in all mammalian acetylcholine esterases, of fish, reptiles and birds sequenced to date (see Figure 6). The mutation is absent in 200 controls (100 women and 100 men.) These results support the role of neuroligins in the etiology of mental disorders or diseases such as autism and Asperger's syndrome. MNL4, the ortholog for HNL4X in mice, has also been identified. This new gene should make it possible to understand the deficit induced by a mutation such as the HNL4X mutation in autism. (see Figure 19). The last round of the genome performed on families of Finnish autists (Auranen, et al., 2002) identified 2 very significant binding peaks in 3q26 (exactly where HNL1 is located) and in Xq13-21 (exactly where HNL3 is located ). The Xp22.3 region, containing HNL4X, is also deleted in two schizophrenic patients. It is therefore possible that neuroligins are also responsible for the susceptibility to this syndrome (schizophrenia affects 1% of the population).

Claims

1. Isolated or purified polynucleotide encoding a polypeptide involved, in its wild form, in synaptogenesis, characterized in that at least one mutation in the nucleic acid sequence of said polynucleotide is associated with the development of neurological diseases and / or predisposition to the development of mental disorders or psychiatric illnesses.

2. Polynucleotide according to claim 1, characterized in that said protein is a cell adhesion protein.

3. Polynucleotide according to claim 2, characterized in that said protein belongs to the family of human neuroligins.

4. Polynucleotide according to any one of claims 1 to 3, characterized in that it is mutated so as to code for a non-functional mutated protein.

5. Polynucleotide according to claim 4, characterized in that said protein is HNL3.

6. Polynucleotide according to claim 5, characterized in that it codes for a protein comprising a sequence chosen from the group consisting of: SEQ ID NO: 10, SEQ ID NO: 11, and the fragments of this protein.

7. Polynucleotide according to claim 5 or 6, characterized in that it comprises SEQ ID NO: 13, and the sequences of at least 20 consecutive nucleotides derived from said sequence.

8. Polynucleotide according to any one of claims 1 to 4, characterized in that said protein is HNL4X or HNL4Y.

9. Polynucleotide according to claim 8, characterized in that it codes for a protein comprising a sequence chosen from the group consisting of: SEQ ID

NO: 3, SEQ ID NO: 6, SEQ ID NO: 8 and fragments of this protein.

10. Polynucleotide according to claim 8 or 9, characterized in that it comprises a sequence chosen from the group consisting of: SEQ ID NO: 1, SEQ ID NO.2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 16, SEQ ID NO: 17 and the sequences of at least 20 consecutive nucleotides derived from said sequences.

11. Polynucleotide according to any one of claims 8 to 10, characterized in that the protein is HNL4X and in that said polynucleotide is mutated such that said mutation causes early termination of the protein.

12. Polynucleotide according to claim 11, characterized in that it comprises SEQ ID NO: 1 and in that said mutation is an insertion of a thymine in position 1186 from position 465 in Figure 9.

13. Polynucleotide according to any one of claims 8 to 12, characterized in that said mutation causes the production of a defective protein devoid of its transmembrane part.

14. Polynucleotide according to any one of claims 1 to 13, characterized in that said mutation is associated with a predisposition for the development of autism, Asperger's syndrome, schizophrenia or ADHD syndrome.

15. Isolated or purified polypeptide, characterized in that it is coded by a polynucleotide according to any one of claims 1 to 14.

16. Isolated or purified polypeptide, characterized in that it is involved in synaptogenesis, and in that the presence of at least one mutation in the amino acid sequence of said polypeptide is associated with a predisposition to the development of mental disorders or psychiatric illnesses.

17. Polypeptide according to claim 15 or 16, characterized in that it consists of a cell adhesion protein.

18. Polypeptide according to any one of claims 15 to 17, characterized in that it consists of a protein belonging to the family of human neuroligins.

19. Polypeptide according to claim 18, characterized in that it is mutated and non-functional.

20. Polypeptide according to claim 19, characterized in that it consists of the protein HNL3.

21. Polypeptide according to claim 20, characterized in that it comprises a sequence chosen from the group consisting of: SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 15 and the sequences of minus 20 consecutive amino acids from SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 15.

22. Polypeptide according to claim 21, characterized in that said mutation causes an amino acid substitution at position 451 or 796 in FIG. 18.

23. Polypeptide according to claim 22, characterized in that said mutation at position 451 is a substitution of an arginine by a cysteine.

24. Polypeptide according to claim 22, characterized in that said mutation at position 796 is a substitution of an asparagine by a serine.

25. Polypeptide according to any one of claims 15 to 18, characterized in that it consists of the HNL4X protein or the HNL4Y protein.

26. A polypeptide according to claim 25, characterized in that it comprises a sequence chosen from the group consisting of: SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 8, and the sequences of at least 20 consecutive amino acids of SEQ ID NO: 3, SEQ ID NO: 6 or SEQ ID NO: 8.

27. Polypeptide according to claim 25 or 26, characterized in that said mutation causes an early termination of said protein.

28. A polypeptide according to any one of claims 25 to 27, characterized in that said mutation generates a protein devoid of its transmembrane part.

29. A polypeptide according to any one of claims 25 to 28, characterized in that said mutation causes a D396stop termination of the protein.

30. A polypeptide according to any one of claims 12 to 29, characterized in that said mutation is associated with a predisposition for the development of autism, Asperger's syndrome, schizophrenia or ADHD syndrome.

31. Method for detecting biochemical disorders altering the formation of synapses, and / or a predisposition to the development of psychiatric pathologies and / or a mental illness, comprising at least one of the following steps:

- the detection of a mutation in the sequence of a polynucleotide as defined in claim 1, in the sequence of a fragment of said polynucleotide or in the sequence of a messenger RNA of said polynucleotide;

- detecting the presence of a polypeptide as defined in claim 16;

- detection of a mutation in a polypeptide as defined in claim 16;

- measuring the activity of a polypeptide as defined in claim 16, or the interaction of said polypeptide with one of its protein partners.

32. The method according to claim 31, comprising:

- amplification of a gene encoding in its wild form (not mutated) for a protein involved in synaptogenesis, amplification of a fragment of said gene or amplification of a messenger RNA of said gene;

- the detection of a mutation in the sequence of said gene, in the sequence of said fragment or in the sequence of said messenger RNA.

33. Method according to claim 31 or 32, characterized in that the gene codes in its wild form for a cell adhesion protein.

34. Method according to any one of claims 31 to 33, characterized in that said protein belongs to the family of human Neuroligins.

35. Method according to any one of claims 31 to 34, characterized in that said protein is HNL3.

36. Method according to any one of claims 31 to 35, characterized in that said gene codes in its wild form for a protein comprising SEQ ID NO: 14.

37. Method according to any one of claims 30 to 35, characterized in that said gene comprises SEQ ID NO: 12.

38. Method according to any one of claims 30 to 37, characterized in that said mutation causes an amino acid substitution at position 451 or 796 in Figure 18.

39. The method of claim 38, characterized in that said mutation at position 451 is a substitution of an arginine by a cysteine.

40. Method according to claim 38, characterized in that said mutation at position 796 is a substitution of an asparagine by a serine.

41. Method according to any one of claims 31 to 34, characterized in that said protein is HNL4X or HNL4Y.

42. The method according to claim 41, characterized in that said gene codes in its wild form for a protein comprising SEQ ID NO: 3, SEQ ID NO: 6 or SEQ IDNO: 8.

43. Method according to claim 41 or 42, characterized in that said gene comprises SEQ ID NO: 1 or SEQ ID NO: 4.

44. Method according to any one of claims 41 to 43, characterized in that said protein is HNL4X and in that said mutation causes early termination of the protein.

45. Method according to claim 44, characterized in that said mutation causes the production of said protein devoid of its transmembrane part.

46. Method according to any one of claims 41 to 45, characterized in that said gene consists of SEQ ID NO: 1 and in that said mutation is an insertion of a thymine in position 1186 from position 465 of Figure 9.

47. Method according to any one of claims 31 to 46, characterized in that the disorder or mental illness consists of autism, Asperger's syndrome, schizophrenia or ADHD syndrome.

48. Kit for the detection of biochemical disorders altering the formation of synapses, and / or a predisposition to the development of psychiatric pathologies and / or a mental illness, and / or for the diagnosis of a mental illness, the kit comprising at least one of the elements chosen from the group consisting of: a probe, an antibody, a reagent and a solid support allowing: i) the detection of a mutation in the sequence of a polynucleotide as defined in claim 1, in the sequence of a fragment of said polynucleotide or in the sequence of a messenger RNA of said polynucleotide; and / or ii) measuring the biological activity of a polypeptide as defined in claim

16, or the interaction of said polypeptide with one of its protein partners.

49. Kit according to claim 48, characterized in that said gene codes for a protein comprising SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 8, or SEQ ID NO: 14.

50. Kit according to claim 48 or 49, characterized in that said gene comprises SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 12, SEQ ID NO: 16 or SEQ ID NO: 17 .

51. Kit according to any one of claims 48 to 50, characterized in that said protein comprises a sequence chosen from the group consisting of: SEQ

ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 8, or SEQ ID NO: 14.

52. Use of an unmutated polynucleotide encoding a protein involved in its wild form in synaptogenesis for the treatment or prevention of biochemical pathologies or mental illnesses.

53. Use of a non-mutated protein which is involved in its wild form in synaptogenesis for the treatment or prevention of biochemical pathologies or mental illnesses.

54. Use according to claim 52 or 53, characterized in that said protein is a cell adhesion protein.

55. Use according to any one of claims 52 to 54, characterized in that said protein belongs to the family of human neuroligins.

56. Use according to any one of claims 52 to 55, characterized in that said protein is HNL3 or HNL4X.

57. Use according to any one of claims 52 to 56, characterized in that said mental illness is autism, Asperger's syndrome, schizophrenia or ADHD syndrome.

58. A method of sorting molecules making it possible to modulate the biological activity of the polypeptide encoded by the polynucleotide according to one of claims 1 to 14 or the biological activity of the polypeptide according to one of claims 15 to 29, comprising: a) bringing said polypeptide or a recombinant cell containing it into contact with a molecule capable of modulating its biological activity; b) measuring the biological activity of said polypeptide or measuring the interaction of said polypeptide with one of its protein partners; and c) evaluating the activity measured in step b) relative to a measurement of the biological activity of said polypeptide in the absence of said molecule.

59. A method of treating a mental or neurological disease comprising the insertion into at least a portion of the cells of a patient of a patient of a polynucleotide encoding a polypeptide as defined in claim 16.

60. Method according to claim 59, characterized in that said cells are stem cells.

61. Method according to claim 59 or 60, characterized in that said mental illness is autism, Asperger's syndrome, schizophrenia or syndrome

ADHD.

62. Method according to any one of claims 59 to 61, characterized in that one inserts a gene coding for a functional HNL3 protein and / or for a functional HNL4X protein.

63. Method according to claim 62, characterized in that the HNL3 protein has SEQ ID NO: 14.

64. Method according to claim 62, characterized in that the HNL4X protein has the SEQ ID NO: 3.

65. A method of transforming stem cells of a patient presenting a mutation of a gene coding for a protein involved in synaptogenesis, characterized by: a) the use of stem cells of said patient; b) the insertion into the genome of said stem cells of a polynucleotide as defined in claim 1; and c) reimplantation in the patient of cells transformed according to step b).

66. Purified monoclonal or polyclonal antibodies specifically recognizing at least one of the polynucleotides defined in claims 1 to 14 and / or at least one of the polypeptides defined in claims 15 to 30.

67. Antibodies according to claim 66, characterized in that they are humanized.

68. A cloning or expression vector comprising one of the polynucleotides defined in claims 1 to 14 or a fragment thereof.

69. A vector according to claim 68, characterized in that said vector is chosen from plasmids, cosmids or phages.

70. Host cell comprising a polynucleotide according to any one of claims 1 to 14 and / or a vector according to claim 68 or 69.

71. Composition characterized in that it further contains a pharmaceutically acceptable vehicle, and at least one element chosen from the group consisting of: a polynucleotide according to any one of claims 1 to 14; a polypeptide according to any of claims 15 to 30; - an antibody according to claim 66 or 67; a vector according to claim 68 or 69; and a host cell according to claim 70.