EP1409719A1 - Method for detecting known mutations in tube - Google Patents

Method for detecting known mutations in tube

Info

Publication number
EP1409719A1
EP1409719A1 EP01963075A EP01963075A EP1409719A1 EP 1409719 A1 EP1409719 A1 EP 1409719A1 EP 01963075 A EP01963075 A EP 01963075A EP 01963075 A EP01963075 A EP 01963075A EP 1409719 A1 EP1409719 A1 EP 1409719A1
Authority
EP
European Patent Office
Prior art keywords
mutation
tubes
probe
exonuclease
support
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01963075A
Other languages
German (de)
French (fr)
Inventor
Fabrice Cailloux
Stéphane GOBRON
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
NUCLEICA
Original Assignee
NUCLEICA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by NUCLEICA filed Critical NUCLEICA
Publication of EP1409719A1 publication Critical patent/EP1409719A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism

Definitions

  • the present invention relates to a method for detecting a mutation in a target nucleic acid comprising amplification of the target DNA, specific hybridization of a probe with the target DNA, extension of the probe with selective addition of an ⁇ S-phosphothioatedésoxynucleotide complementary to the mutation in a tube A and addition of an ⁇ S-phosphothioatedésoxynucleotide complementary to the natural base corresponding to said mutation in a tube B; the probe thus extended being resistant to digestion by an exonuclease, in particular by exonuclease III.
  • the detection of the mutation and of the natural base is carried out by direct or indirect measurement in tubes A and B.
  • Mutations in germ cells or in somatic lines can have dreadful consequences on the organism, for example by causing hereditary genetic diseases or the appearance of cancer.
  • the effect of a mutation is closely linked to its location in DNA. In the case of a mutation in a coding region, the loss of the function of the coded protein can be observed. If the mutation is in a regulatory region, DNA expression can be abolished or increased.
  • a mutation in a gene involved in cancer in the germ line does not necessarily mean that the individual concerned will actually contract a tumor, but only that the risk of it is increased.
  • the objective underlying the present invention has been to develop a technique allowing the rapid and easy determination of nucleotides to be identified and consequently the diagnosis of mutations and polymorphisms of genes, or the identification of pathogenic microorganisms or genetically modified. More specifically, the problem lies in a compilation of different techniques combining, within the same tube, the amplification of the DNA of a sample and the detection of a given nucleotide. This method is easy to use, generates signals that do not require tedious processing and complicated interpretation.
  • a system in which all the steps leading to the results are carried out in the same tube which is based on the amplification of the target DNA, the specific hybridization of a probe (in this case serving as an oligonucleotide primer) with the target DNA, extending the probe with selective addition of an ⁇ S- phosphothioated deoxynucleotide to the 3 'end of the primer complementary to the target DNA; the primer thus elongated being resistant to digestion by an exonuclease, in particular by exonuclease III.
  • a probe in this case serving as an oligonucleotide primer
  • the probe remains present in the tube only when the following conditions are met: a) hybridization between the probe and the target DNA of the sample, and b) presence of a complementary base in the target DNA allowing the incorporation of the ⁇ S-phosphothioatedésoxynucleotide into the probe; which prevents its degradation by nuclease.
  • the key steps of this process are illustrated in the example presented in Figure 1 below.
  • the technique described in US 4,656,127 consists in the incorporation of a thio-dNTP which protects from the degradation of the exonuclease.
  • the method according to the invention offers the advantage of speed, simplicity of implementation and ease of interpretation of the results.
  • tubes A and B allow excellent reliability (presence of a positive control, whatever the genotype to be tested) and a direct interpretation of the results.
  • a higher number of tubes can also be used.
  • four tubes are used, in order to be able to test the presence of each base on the target DNA. This allows to refine the analysis when the tested base is very polymorphic.
  • a second advantage of the method according to the invention is conferred by the attachment of one of the primers to the tube used for the amplification and thus anchoring the amplification products on the walls of the tubes.
  • the advantage of this anchoring is to be able to then carry out all the reactions leading to the colored development, including washes in the same tube which in particular avoids the risks of contamination and represents a significant time saving, especially knowing that the use the same solid support for all stages of the process facilitates automation.
  • a third advantage of the present invention is to differentiate between homozygous and heterozygous carriers of the targeted mutation thanks to the use of two separate tubes. Indeed, the revelation results in a coloration in only one of the two tubes if the mutation is present in the homozygous state, while the coloration is present in the two tubes if the mutation is present in the heterozygous state. Furthermore, the result can be obtained in 30 to 40 minutes after PCR amplification and does not require any particular heavy environment.
  • certain steps can be combined (exonuclease and revelation in particular) in order to reduce the implementation time without modifying the specificity. Thanks to such a method, the detection experiment can be repeated, unlike the technique described in US 4,656,127. Indeed, the use of the solid support makes it possible to conserve the strand of nucleic acid to be analyzed and the exonuclease degrading the unprotected probe, the hybridization and detection step can be repeated in the same tube if necessary.
  • the present invention relates to a method allowing the identification of a known mutation or polymorphism in a nucleic sequence comprising the amplification of the region of interest by PCR, this amplification step being advantageously carried out using a primer attached to the wall of two tubes A and B (asymmetric PCR); hybridization of a specific probe designed so that its end is positioned just upstream from the base to be revealed; elongation of this probe by means of a polymerase with a modified nucleotide, advantageously a phosphothionucleotide, in particular an ⁇ S- phosphothioatedésoxynucleotide, complementary to the mutation to be revealed (tube A) and complementary to the normal base corresponding to the mutation to be revealed ( tube B); the action of an exonuclease so that only the elongated probes are not degraded.
  • the detection of the presence or absence of a mutation is carried out by direct or indirect revelation of the probe.
  • all the stages of the method are carried out in the same tube (from PCR amplification to revelation) so that the presence of a mutation is revealed directly by the appearance of a coloration in the tube used for PCR (see Figure 1 ).
  • the presence of the mutation can also be detected by other detection methods, in particular fluorescence, or by using radioactive probes (see below).
  • the invention relates to a method for detecting a mutation located in position n in a target nucleic acid, characterized in that it comprises the following steps: a) amplification on at least two solid supports distinct A and B of the region of interest comprising said mutation using at least one primer linked in 5 'to the supports, b) dehybridization of the DNA strands and elimination of the strands in suspension by washing, c) hybridization a probe with the DNA strands linked to solid supports A and B, the 3 ′ end of said probe hybridizing at most to nucleotide n-1 of said strands, d) elongation reaction of the probe hybridized in step c) by incorporation in the 5'-3 'direction of nucleotides complementary to said DNA strands by means of a reaction mixture comprising a DNA polymerase and a nucleotide derivative resistant to degradation by an exonuclease (dNTP *), the reaction mixture uti used for
  • the binding of the 5 ′ primer to the supports (step a) is advantageously a sufficiently strong bond so that the DNA remains attached to the support during the various steps of the process. It can be a covalent bond, but also a non-covalent bond, such as an avidin-streptavidin / biotin bond, or an antibody / antigen type bond.
  • step c) the probe hybridizing at most to the nucleotide n-1 of said strands means that the probe can also hybridize to n-2, n-3, n-4 ... It will then be necessary therefore provide, during the elongation step (d), the nucleotides complementary to the missing bases in order to allow the elongation of the probe to the mutated base for which the dNTP * is supplied.
  • a “probe” is defined as being a nucleotide fragment comprising for example from 10 to 100 nucleotides, in particular from 15 to 35 nucleotides, having a specificity of hybridization under determined conditions to form a hybridization complex with a target nucleic acid.
  • the probes according to the invention can carry a labeling agent allowing or improving their detection.
  • the probe also serves as a primer in the context of the invention since the objective is to incorporate a nucleotide modified in position n corresponding to the position of the mutation that is sought.
  • the 3 ′ end of the probe therefore ends at the maximum and preferably at n-1.
  • the probe can be marked by means of a marker chosen, for example, from radioactive isotopes, enzymes, in particular enzymes capable of acting on a chromogenic, fluorigenic or luminescent substrate (in particular a peroxidase or an alkaline phosphatase) or alternatively enzymes producing or using protons (oxidase or hydrolase); chromophoric chemical compounds, chromogenic, fluorigenic or luminescent compounds, nucleotitic base analogs, and ligands such as biotin.
  • a marker chosen, for example, from radioactive isotopes, enzymes, in particular enzymes capable of acting on a chromogenic, fluorigenic or luminescent substrate (in particular a peroxidase or an alkaline phosphatase) or alternatively enzymes producing or using protons (oxidase or hydrolase); chromophoric chemical compounds, chromogenic, fluorigenic or luminescent compounds, nucleotitic base analogs, and lig
  • the labeling of the probes according to the invention is carried out by elements selected from ligands such as biotin, avidin, streptavidin, dioxygenin, haptens, dyes, luminescent agents such as radioluminescent, chemiluminescent, bioluminescent, fluorescent, phosphorescent agents.
  • ligands such as biotin, avidin, streptavidin, dioxygenin, haptens, dyes, luminescent agents such as radioluminescent, chemiluminescent, bioluminescent, fluorescent, phosphorescent agents.
  • luminescent agents such as radioluminescent, chemiluminescent, bioluminescent, fluorescent, phosphorescent agents.
  • Another possibility is to label the probe with a peptide comprising an epitope recognized by a given antibody. The presence of this antibody can be revealed by means of a second labeled antibody.
  • the probe is advantageously labeled with one of the abovementioned molecules, said molecules allowing the direct or indirect appearance of a coloration when the non-degraded probe is present on the support, said coloration being preferably detectable by optical reading or simple observation.
  • Optical reading means any measurement of absorption, transmission or emission of light which may possibly be at a specific wavelength either directly from DNA (260 nm for example), or from any marker molecule linked to the probe.
  • This definition also includes any measurement of the fluorescence emitted by markers (fluorescein and / or phycoerythrin).
  • the presence or absence of the mutation is detected either by optical reading, or by simple observation of a coloration on the solid support.
  • the solid support used to anchor the primer can be a plastic material (polystyrene, polycarbonate for example), or nylon or glass, so that this support is a tube, a membrane or a ball on which the region of interest is amplified for its analysis, that is to say the detection of a base change.
  • the support is a tube (individual or in a bar or in a plate) used for amplification, and therefore compatible with the various thermal cyclers (Perkin Elmer 9700 for example).
  • the tubes can also be any ELISA type tube or plate on which covalent attachment of nucleic acids can be carried out.
  • Different methods of immobilizing an oligonucleotide on a support are possible and are described in particular in US 6,030,782. These methods can be a direct immobilization by chemical bond for example or an indirect immobilization (via a linker or a conjugate such as streptavidin for example).
  • supports A and B are tubes on which covalent attachment of nucleic acids can be carried out.
  • these tubes are Nucleolink TM strips (NUNC, catalog reference No. 248259) which have a special coating allowing the direct covalent attachment of oligonucleotides by their 5 ′ phosphate end (Rasmussen, SR et al., Anal. Biochem , 198: 138-142 (1991)).
  • the format of this process is thus the standard 96-well format (12 strips of 8 wells), but the strips being breakable, the desired number of tubes can be used.
  • Other formats can be used, in particular if other fixing methods are used. For example, it is possible to attach the nucleic acids by disulfide bridge by following the method recommended in US 6,300,782.
  • step d) an ⁇ S-phosphothioatedésoxynucleotide, preferably ⁇ S-dATP, ⁇ S-dTTP, ⁇ S-dCTP, ⁇ S-dGTP, ⁇ S-dUTP or ⁇ S-dITP and in step e) an exonuclease, including exonuclease III.
  • exonuclease means any natural or modified enzyme having an exonuclease activity.
  • DNA polymerase having a pyrophophorolysis activity in the presence of a high concentration of pyrophosphate, this enzyme adds a pyrophosphate on the last phosphodiester bond and therefore releases the nucleotide at 3 '.
  • This product is available from Promega under the brand READIT TM, and variants using a luciferase revealing system is available under the brand READase TM.
  • a well receives a DNA, then a probe and the incorporation of only one nucleotide (dNTP *) is allowed. Therefore, at least two tubes are required for each DNA to be tested, one receiving the normal base and the other receiving the mutated base.
  • the method described above is characterized in that two tubes are used, one being intended for the detection of the mutated base (tube A) and the other being intended for the detection of the normal base corresponding to said mutated base (tube B).
  • several series of tubes A and B can be used, in particular in a 96-well plate and a tube C as a negative control for each series of tubes A and B.
  • said dNTP * is an ⁇ S - phosphothioatedésoxynucleotide such as ⁇ S-dATP, ⁇ S-dTTP, ⁇ S-dCTP, ⁇ S-dGTP, ⁇ S-dUTP or ⁇ S-dITP which is incorporated at the 3 ′ end of the probe.
  • DNA polymerase is understood to mean any natural or modified enzyme having polymerase activity. Mention may be made, for example, of pol exo- DNAs, in particular T7 or the klenow fragment.
  • steps e) and f) are carried out simultaneously in the same reaction mixture comprising said exonuclease and the means necessary to reveal the coloration.
  • These means depend on the marker or the ligand which is on the probe.
  • Another aspect of the invention relates to a device or kit making it possible to implement the method defined above.
  • Such a kit is characterized in that it includes: tubes A and B in which at least one primer making it possible to amplify the region comprising the specific mutation is linked in 5 ′ by a covalent bond, reaction mixtures A and B each comprising a different ⁇ S- phosphothioatedesoxynucleotide selected from ⁇ S-dATP, ⁇ S dTTP, ⁇ S-dCTP, S-dGTP, ⁇ S-dUTP and S-dITP, the reaction mixture used for support A comprising an ⁇ S-phosphothioatedésoxynucleotide complementary to said mutation and the reaction mixture used for support B comprising an S-phosphothioatedésoxynucleotide complementary to the normal base corresponding to said mutation.
  • This kit can also comprise at least one element selected from an exonuclease, in particular exonuclease III, a reagent making it possible to reveal the coloration, a DNA polymerase and various buffers or solutions necessary for the implementation of the method.
  • the kit according to the invention comprises a series of tubes A and B, each series making it possible to detect a given mutation and tubes C as negative controls.
  • Said tubes can be NUNC tubes.
  • the invention relates to the use of the method and the kit described above for the detection of gene mutations implicated in diseases, in particular in hereditary genetic diseases, in particular hemochromatosis, anemia sickle cell ⁇ and ⁇ thalassemia, cystic fibrosis, hemophilia, neurodegenerative diseases and mutations in the genes involved in cancer.
  • hereditary genetic diseases in particular hemochromatosis, anemia sickle cell ⁇ and ⁇ thalassemia, cystic fibrosis, hemophilia, neurodegenerative diseases and mutations in the genes involved in cancer.
  • An exhaustive list of mutations in these genes is given on the following website: ftp://ncbi.nlm.nih.gov/reposito ⁇ -v/OMIM/morbid ⁇ nap
  • the method and the kit according to the invention are also useful for studying the polymorphism of genes or any genetic region and for the detection and / or identification of genetically modified organisms (GMOs).
  • Figure 1A PCR amplification in solid phase
  • An enzymatic reaction catalyzes the elongation of a probe resulting in the insertion of a modified nucleotide, for example an ⁇ S-phosphothioatedésoxynucleotide at the 3 'end of the probe.
  • Two reactions in the two tubes A and B are necessary for each sample with the incorporation of a single base to detect the normal genotypes (tube B) and / or mutants (tube A).
  • the elongated probe is protected from the degrading action of the exonuclease and a blue color develops during incubation with the substrate.
  • the non-elongated probe is eliminated, no coloration is obtained.
  • detection can be performed with a FITC-labeled probe and an anti-labeled antibody.
  • Figure 1E very easy visual interpretation of the results The results for 4 series of tubes A and B (for 4 individuals or 4 different mutations in the same individual) are presented. Positive results are blue (dark gray in the text) and negatives are colorless. For each individual, whether mutated or normal, a coloration is obtained. In the case of heterozygote, a coloration is obtained in the two wells.
  • Figures 2A and 2B detection of C282Y and H63D mutations responsible for hemochromatosis.
  • (1) corresponds to the exon of the CFTR gene in which the mutation is found
  • Figures 4A, 4B, 4C, 4D, 4E, 4F and 4G detection of 7 mutations responsible for cystic fibrosis.
  • FIGS. 5A and 5B detection of the C282Y and H63D mutations responsible for hemochromatosis (preferred method according to the invention in which the degradation and revelation steps are coupled).
  • Example 1 protocol for implementing the process according to the invention
  • the method according to the present invention makes it possible to determine the genotype of a sample, the latter being previously amplified using a primer fixed to the wall of the tube.
  • the tubes used are the Nucleolink strips (NUNC), the fixing of the primer is carried out according to the indications of the supplier.
  • PCR buffers dNTP, primer A 1 ⁇ M final, primer B 0.12 ⁇ M final, Taq polymerase and DNA to be tested.
  • the amplification products obtained in the liquid phase can be discarded or kept for analysis on a 1.5% agarose gel stained with ethidium bromide.
  • TMB substrate Tetramethylbenzidine - Sigma
  • Reading can then be done with the naked eye; a blue color appearing in the positive wells. It is also possible to read the optical density at 655 nm using a microplate reader or at 450 nm if the reaction has been stopped.
  • the genotype of a given sample can be determined: by reading with the naked eye: a blue color appears in the positive wells and the negative wells remain colorless.
  • the four possible coloring benefits are described below:
  • Example 2 diagnosis of hemochromatosis, detection of mutations C282Y and H63D responsible for hemochromatosis.
  • H63D in the case of the normal solution
  • ⁇ thiodATP mutant base for C282Y
  • ⁇ thiodCTP mutant base for H63D
  • Mutant case incorporation of an ⁇ S-dATP, region of SNP C282Y and its complementary region, included in the region amplified by the primers SEQ ID No. 1 and SEQ ID No. 2, the probe SEQ ID No. 3 being underlined, the polymorphic base being in bold.
  • Mutant case incorporation of an ⁇ S-dCTP, region of SNP H63D and its complementary region, included in the region amplified by the primers SEQ ID No. 8 and SEQ ID No. 9, the probe SEQ ID No. 10 being underlined, the polymorphic base being in bold.
  • Example 3 Diagnosis of cystic fibrosis, detection of seven mutations responsible for cystic fibrosis.
  • Example 4 Improvement of the protocol, coupling of the exonuclease digestion and revelation steps.
  • Steps 1 to 4 are identical to those of Example 1, only the following steps are modified so that digestion with Exonuclease III and revelation by the antibody are carried out in a single step.
  • - Deposit per well 25 ⁇ l of solution containing 0.01 U of Exonuclease III (New England Biolabs) in its buffer, 2.5 ⁇ l of anti-FITC-POD antibody (Boehringer Mannheim) l / 200th in PBS-BSA 3 % and 0.25 ⁇ l Tween 20; Incubate 10 minutes at 37 ° C;
  • Steps 1 to 2 are identical to those of Example I, only the following steps are modified so that the final development is carried out using streptavidin, the probe having been previously coupled to a biotin. 3. Hybridization and elongation

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention concerns a method for detecting a mutation in a target nucleic acid comprising amplification of the target DNA, specific hybridization of a probe with the DNA target, extension of the probe by selective addition of alpha S-phosphothioatedesoxynucleotide complementary of the mutation in a tube A and adding an alpha S-phosphothioatedesoxynucleotide complementary of the natural base corresponding to said mutation in a tube B; the resulting extended probe being resistant to digestion by an exonuclease, particularly by exonuclease III.

Description

Procédé de détection de mutations connues en tube Method for detecting known tube mutations
La présente invention se rapporte à un procédé de détection d'une mutation dans un acide nucléique cible comprenant l'amplification de l'ADN cible, l'hybridation spécifique d'une sonde avec l'ADN cible, l'extension de la sonde avec addition sélective d'un αS-phosphothioatedésoxynucléotide complémentaire de la mutation dans un tube A et addition d'un αS-phosphothioatedésoxynucléotide complémentaire de la base naturelle correspondant à ladite mutation dans un tube B ; la sonde ainsi allongée étant résistante à la digestion par une exonuclease, en particulier par l' exonuclease III. La détection de la mutation et de la base naturelle est effectuée par mesure directe ou indirecte dans les tubes A et B.The present invention relates to a method for detecting a mutation in a target nucleic acid comprising amplification of the target DNA, specific hybridization of a probe with the target DNA, extension of the probe with selective addition of an αS-phosphothioatedésoxynucleotide complementary to the mutation in a tube A and addition of an αS-phosphothioatedésoxynucleotide complementary to the natural base corresponding to said mutation in a tube B; the probe thus extended being resistant to digestion by an exonuclease, in particular by exonuclease III. The detection of the mutation and of the natural base is carried out by direct or indirect measurement in tubes A and B.
Les mutations dans les cellules germinales ou dans les lignées somatiques peuvent avoir des conséquences redoutables sur l'organisme en provoquant par exemple des maladies génétiques héréditaires ou l'apparition de cancer. L'effet d'une mutation dépend étroitement de sa localisation dans l'ADN. Dans le cas d'une mutation dans une région codante, on peut observer la perte de la fonction de la protéine codée. Si la mutation se trouve dans une région régulatrice, l'expression de l'ADN peut être abolit ou augmenter. Une mutation dans un gène impliqué dans le cancer au niveau de la lignée germinale ne signifie pas obligatoirement que l'individu concerné contractera effectivement une tumeur, mais seulement que le risque de celle-ci est accru. En outre, lorsque l'on cherche à diagnostiquer le potentiel invasif d'une tumeur déjà établie, on ne sait pas d'avance quelles mutations il faut attendre car celles-ci peuvent se trouver sur plusieurs gènes ou à plusieurs endroits d'un même gène. Dès lors, il apparaît nécessaire de disposer d'un test simple, rapide, et fiable, pouvant détecter aisément de nombreuses mutations. Le besoin en une technique de détection de mutations, de typage ou encore d'étude du polymorphisme se fait de plus en plus ressentir dans l'industrie soit pour permettre la découverte de nouvelles cibles biologiques d'intérêts, soit pour connaître précisément le profil génétique d'une tumeur ou d'un patient et envisager des thérapies adaptées. Ce besoin a conduit au développement de diverses techniques telles que la LCR, la SSCP et la RFLP mais elles restent difficiles à mettre en oeuvre à grande échelle.Mutations in germ cells or in somatic lines can have dreadful consequences on the organism, for example by causing hereditary genetic diseases or the appearance of cancer. The effect of a mutation is closely linked to its location in DNA. In the case of a mutation in a coding region, the loss of the function of the coded protein can be observed. If the mutation is in a regulatory region, DNA expression can be abolished or increased. A mutation in a gene involved in cancer in the germ line does not necessarily mean that the individual concerned will actually contract a tumor, but only that the risk of it is increased. In addition, when trying to diagnose the invasive potential of an already established tumor, we do not know in advance which mutations to expect because they can be on several genes or in several places of the same uncomfortable. Therefore, it appears necessary to have a simple, rapid, and reliable test, which can easily detect many mutations. The need for a technique for detecting mutations, typing or even studying polymorphism is increasingly felt in the industry, either for allow the discovery of new biological targets of interest, either to know precisely the genetic profile of a tumor or of a patient and to consider suitable therapies. This need has led to the development of various techniques such as LCR, SSCP and RFLP but they remain difficult to implement on a large scale.
L'objectif à la base de la présente invention a été de mettre au point une technique permettant la détermination rapide et aisée de nucléotides à identifier et par conséquent le diagnostic de mutations et de polymorphismes de gènes, ou l'identification de micro-organismes pathogènes ou génétiquement modifiés. Plus spécifiquement, le problème réside en une compilation de différentes techniques alliant, au sein d'un même tube, l'amplification de l'ADN d'un échantillon et la détection d'un nucléotide donné. Cette méthode s'avère facile d'utilisation, génère des signaux qui ne nécessite pas un traitement fastidieux et une interprétation compliquée.The objective underlying the present invention has been to develop a technique allowing the rapid and easy determination of nucleotides to be identified and consequently the diagnosis of mutations and polymorphisms of genes, or the identification of pathogenic microorganisms or genetically modified. More specifically, the problem lies in a compilation of different techniques combining, within the same tube, the amplification of the DNA of a sample and the detection of a given nucleotide. This method is easy to use, generates signals that do not require tedious processing and complicated interpretation.
Dans le cadre de la présente invention, on a mis au point un système dans lequel on effectue l'ensemble des étapes conduisant aux résultats dans un même tube qui repose sur l'amplification de l'ADN cible, l'hybridation spécifique d'une sonde (servant dans le cas présent d'amorce oligonucléotidique) avec l'ADN cible, l'extension de la sonde avec addition sélective d'un αS- phosphothioatedésoxynucléotide à l'extrémité 3' de l'amorce complémentaire de l'ADN cible ; l'amorce ainsi allongée étant résistante à la digestion par une exonuclease, en particulier par l'exonucléase III. Ainsi, la sonde reste présente dans le tube seulement lorsque les conditions suivantes sont réunies : a) hybridation entre la sonde et l'ADN cible de l'échantillon, et b) présence d'une base complémentaire dans l'ADN cible permettant l'incorporation du αS-phosphothioatedésoxynucléotide dans la sonde ; ce qui empêche sa dégradation par la nucléase. Les étapes clés de ce procédé sont illustrées dans l'exemple présenté à la figure 1 ci- après. La technique décrite dans US 4,656,127 consiste en l'incorporation d'un thio-dNTP qui protège de la dégradation de l'exonuclease. Toutefois, le procédé selon l'invention offre l'avantage de la rapidité, de la simplicité de mise en œuvre et de la facilité d'interprétation des résultats. En effet, l'utilisation de deux tubes distincts A et B, l'un étant destiné à la détection de la base mutée (tube A) et l'autre étant destiné à la détection de la base normale correspondante à ladite base mutée (tube B), permet une excellente fiabilité (présence d'un contrôle positif, quelque soit le génotype à tester) et une interprétation directe des résultats. On peut également utiliser un nombre plus élevé de tubes. Ainsi, dans un cas particulier et avantageux, on utilise quatre tubes, afin de pouvoir tester la présence de chaque base sur l'ADN cible. Ceci permet de d'affiner l'analyse lorsque la base testée est très polymorphe.In the context of the present invention, a system has been developed in which all the steps leading to the results are carried out in the same tube which is based on the amplification of the target DNA, the specific hybridization of a probe (in this case serving as an oligonucleotide primer) with the target DNA, extending the probe with selective addition of an αS- phosphothioated deoxynucleotide to the 3 'end of the primer complementary to the target DNA; the primer thus elongated being resistant to digestion by an exonuclease, in particular by exonuclease III. Thus, the probe remains present in the tube only when the following conditions are met: a) hybridization between the probe and the target DNA of the sample, and b) presence of a complementary base in the target DNA allowing the incorporation of the αS-phosphothioatedésoxynucleotide into the probe; which prevents its degradation by nuclease. The key steps of this process are illustrated in the example presented in Figure 1 below. The technique described in US 4,656,127 consists in the incorporation of a thio-dNTP which protects from the degradation of the exonuclease. However, the method according to the invention offers the advantage of speed, simplicity of implementation and ease of interpretation of the results. Indeed, the use of two separate tubes A and B, one being intended for the detection of the mutated base (tube A) and the other being intended for the detection of the normal base corresponding to said mutated base (tube B), allows excellent reliability (presence of a positive control, whatever the genotype to be tested) and a direct interpretation of the results. A higher number of tubes can also be used. Thus, in a particular and advantageous case, four tubes are used, in order to be able to test the presence of each base on the target DNA. This allows to refine the analysis when the tested base is very polymorphic.
Un deuxième intérêt du procédé selon l'invention est conféré par l'accrochage d'une des amorces au tube utilisé pour l'amplification et d'ancrer ainsi les produits d'amplification sur les parois des tubes. L'avantage de cet ancrage est de pouvoir effectuer ensuite toutes les réactions conduisant à la révélation colorée, y compris des lavages dans le même tube ce qui évite notamment les risques de contamination et représente un gain de temps important, surtout sachant que l'utilisation d'un même support solide pour toutes les étapes du procédé facilite l'automatisation.A second advantage of the method according to the invention is conferred by the attachment of one of the primers to the tube used for the amplification and thus anchoring the amplification products on the walls of the tubes. The advantage of this anchoring is to be able to then carry out all the reactions leading to the colored development, including washes in the same tube which in particular avoids the risks of contamination and represents a significant time saving, especially knowing that the use the same solid support for all stages of the process facilitates automation.
Un troisième intérêt de la présente invention est de différencier des porteurs homozygotes et hétérozygotes de la mutation ciblée grâce à l'utilisation de deux tubes distincts. En effet, la révélation aboutie à une coloration dans un seul des deux tubes si la mutation est présente à l'état homozygote, alors que la coloration est présente dans les deux tubes si la mutation est présente à l'état hétérozygote. Par ailleurs, le résultat peut être obtenu en 30 à 40 minutes après amplification PCR et ne nécessite pas d'environnement lourd particulier. De plus, certaines étapes peuvent être combinées (exonuclease et révélation en particulier) afin de diminuer le temps de mise en œuvre sans pour autant modifier la spécificité. Grâce à un tel procédé, on peut renouveler l'expérience de détection contrairement à la technique décrite dans US 4,656,127. En effet, l'utilisation du support solide permet de conserver le brin d'acide nucléique à analyser et l'exonuclease dégradant la sonde non protégée, l'étape d'hybridation et de détection peut être renouveler dans le même tube si besoin est.A third advantage of the present invention is to differentiate between homozygous and heterozygous carriers of the targeted mutation thanks to the use of two separate tubes. Indeed, the revelation results in a coloration in only one of the two tubes if the mutation is present in the homozygous state, while the coloration is present in the two tubes if the mutation is present in the heterozygous state. Furthermore, the result can be obtained in 30 to 40 minutes after PCR amplification and does not require any particular heavy environment. In addition, certain steps can be combined (exonuclease and revelation in particular) in order to reduce the implementation time without modifying the specificity. Thanks to such a method, the detection experiment can be repeated, unlike the technique described in US 4,656,127. Indeed, the use of the solid support makes it possible to conserve the strand of nucleic acid to be analyzed and the exonuclease degrading the unprotected probe, the hybridization and detection step can be repeated in the same tube if necessary.
L'industrialisation d'un tel procédé paraît ainsi beaucoup plus facile car la réalisation de toutes les étapes dans le même tube y compris la PCR, les différentes incubations et les différents lavages permettent d'envisager une automatisation rapide du procédé sur n'importe quelle plate-forme automate commercialisée de biologie moléculaire.The industrialization of such a process thus seems much easier because the realization of all the stages in the same tube including the PCR, the different incubations and the different washes make it possible to envisage a rapid automation of the process on any commercialized automated molecular biology platform.
DescriptionDescription
La présente invention se rapporte à un procédé permettant l'identification d'une mutation ou d'un polymorphisme connu dans une séquence nucléique comprenant l'amplification de la région d'intérêt par PCR, cette étape d'amplification étant réalisée avantageusement en utilisant une amorce fixée à la paroi de deux tubes A et B (PCR asymétrique); l'hybridation d'une sonde spécifique dessinée de manière à ce que son extrémité soit positionnée juste en amont de la base à révéler ; l'allongement de cette sonde au moyen d'une polymérase avec un nucléotide modifié, avantageusement un phosphothionucléotide, notamment un αS- phosphothioatedésoxynucléotide, complémentaire de la mutation à révéler (tube A) et complémentaire de la base normale correspondante à la mutation à révéler (tube B); l'action d'une exonuclease de sorte que seules les sondes élongées ne sont pas dégradées. La détection de la présence ou de l'absence d'une mutation est effectuée par révélation directe ou indirecte de la sonde. Avantageusement, toutes les étapes de la méthode sont réalisées dans le même tube (de l'amplification PCR à la révélation) de sorte que la présence d'une mutation est révélée directement par l'apparition d'une coloration dans le tube ayant servi à la PCR (voir Figure 1). On peut également détecter la présence de la mutation par d'autres méthodes de détection, en particulier la fluorescence, ou en utilisant des sondes radioactives (voir infra).The present invention relates to a method allowing the identification of a known mutation or polymorphism in a nucleic sequence comprising the amplification of the region of interest by PCR, this amplification step being advantageously carried out using a primer attached to the wall of two tubes A and B (asymmetric PCR); hybridization of a specific probe designed so that its end is positioned just upstream from the base to be revealed; elongation of this probe by means of a polymerase with a modified nucleotide, advantageously a phosphothionucleotide, in particular an αS- phosphothioatedésoxynucleotide, complementary to the mutation to be revealed (tube A) and complementary to the normal base corresponding to the mutation to be revealed ( tube B); the action of an exonuclease so that only the elongated probes are not degraded. The detection of the presence or absence of a mutation is carried out by direct or indirect revelation of the probe. Advantageously, all the stages of the method are carried out in the same tube (from PCR amplification to revelation) so that the presence of a mutation is revealed directly by the appearance of a coloration in the tube used for PCR (see Figure 1 ). The presence of the mutation can also be detected by other detection methods, in particular fluorescence, or by using radioactive probes (see below).
Ainsi, dans un premier aspect, l'invention concerne un procédé de détection d'une mutation se trouvant en position n dans un acide nucléique cible, caractérisé en ce qu'il comprend les étapes suivantes : a) amplification sur au moins deux supports solides distincts A et B de la région d'intérêt comprenant ladite mutation à l'aide d'au moins une amorce liée en 5' aux supports, b) déshybridation des brins d'ADN et élimination des brins en suspension par lavage, c) hybridation d'une sonde avec les brins d'ADN liés aux supports solides A et B, l'extrémité 3' de ladite sonde s'hybridant au maximum jusqu'au nucléotide n-1 desdits brins, d) réaction d'élongation de la sonde hybridée à l'étape c) par incorporation dans la direction 5'-3' de nucléotides complémentaires desdits brins d'ADN au moyen d'un mélange réactionnel comprenant une ADN polymérase et un dérivé de nucléotide résistant à la dégradation par une exonuclease (dNTP*), le mélange réactionnel utilisé pour le support A comprenant un dNTP* complémentaire de ladite mutation et le mélange réactionnel utilisé pour le support B comprenant un dNTP* complémentaire de la base normale correspondante à ladite mutation, e) dégradation par ladite exonuclease de sorte que seules les sondes élongées à l'étape d) ne sont pas dégradées, lavage, f) révélation directe ou indirecte de la sonde non dégradée, ladite révélation étant positive soit dans le cas où le brin d'ADN sur le support A contient la mutation, soit dans le cas où le brin d'ADN sur le support B contient la base normale correspondante à ladite mutation. La liaison de l'amorce en 5' aux supports (étape a) est avantageusement une liaison suffisamment forte afin que l'ADN reste fixé au support lors des différentes étapes du procédé. Ce peut être une liaison covalente, mais aussi une liaison non covalente, telle une liaison avidine-streptavidine / biotine, ou une liaison du type anticorps / antigène.Thus, in a first aspect, the invention relates to a method for detecting a mutation located in position n in a target nucleic acid, characterized in that it comprises the following steps: a) amplification on at least two solid supports distinct A and B of the region of interest comprising said mutation using at least one primer linked in 5 'to the supports, b) dehybridization of the DNA strands and elimination of the strands in suspension by washing, c) hybridization a probe with the DNA strands linked to solid supports A and B, the 3 ′ end of said probe hybridizing at most to nucleotide n-1 of said strands, d) elongation reaction of the probe hybridized in step c) by incorporation in the 5'-3 'direction of nucleotides complementary to said DNA strands by means of a reaction mixture comprising a DNA polymerase and a nucleotide derivative resistant to degradation by an exonuclease (dNTP *), the reaction mixture uti used for support A comprising a dNTP * complementary to said mutation and the reaction mixture used for support B comprising a dNTP * complementary to the normal base corresponding to said mutation, e) degradation by said exonuclease so that only the probes extended to step d) are not degraded, washing, f) direct or indirect revelation of the non-degraded probe, said revelation being positive either in the case where the DNA strand on the support A contains the mutation, or in the case where the DNA strand on support B contains the normal base corresponding to said mutation. The binding of the 5 ′ primer to the supports (step a) is advantageously a sufficiently strong bond so that the DNA remains attached to the support during the various steps of the process. It can be a covalent bond, but also a non-covalent bond, such as an avidin-streptavidin / biotin bond, or an antibody / antigen type bond.
Dans l'étape c), la sonde s'hybridant au maximum jusqu'au nucléotide n-1 desdits brins signifie que la sonde peut également s'hybrider en n-2, n-3, n-4... Il faudra alors donc fournir, lors de l'étape d'élongation (d), les nucléotides complémentaires aux bases manquantes afin de permettre l'élongation de la sonde jusqu'à la base mutée pour laquelle on fournit le dNTP*.In step c), the probe hybridizing at most to the nucleotide n-1 of said strands means that the probe can also hybridize to n-2, n-3, n-4 ... It will then be necessary therefore provide, during the elongation step (d), the nucleotides complementary to the missing bases in order to allow the elongation of the probe to the mutated base for which the dNTP * is supplied.
Une « sonde » se définie comme étant un fragment nucléotidique comprenant par exemple de 10 à 100 nucléotides, notamment de 15 à 35 nucléotides, possédant une spécificité d'hybridation dans des conditions déterminées pour former un complexe d'hybridation avec un acide nucléique cible. Les sondes selon l'invention peuvent porter un agent marqueur permettant ou améliorant leur détection.A "probe" is defined as being a nucleotide fragment comprising for example from 10 to 100 nucleotides, in particular from 15 to 35 nucleotides, having a specificity of hybridization under determined conditions to form a hybridization complex with a target nucleic acid. The probes according to the invention can carry a labeling agent allowing or improving their detection.
Bien entendu, la sonde sert également d'amorce dans le cadre de l'invention puisque l'objectif est d'incorporer un nucléotide modifié en position n correspondant à la position de la mutation que l'on recherche. L'extrémité 3' de la sonde se termine donc au maximum et de préférence à n-1.Of course, the probe also serves as a primer in the context of the invention since the objective is to incorporate a nucleotide modified in position n corresponding to the position of the mutation that is sought. The 3 ′ end of the probe therefore ends at the maximum and preferably at n-1.
La sonde peut être marquée au moyen d'un marqueur choisi par exemple parmi les isotopes radioactifs, des enzymes, en particulier des enzymes susceptibles d'agir sur un substrat chromogène, fluorigène ou luminescent (notamment une peroxydase ou une phosphatase alcaline) ou encore des enzymes produisant ou utilisant des protons (oxydase ou hydrolase) ; des composés chimiques chromophores, des composés chromogènes, fluorigènes ou luminescents, des analogues de base nucléotitiques, et des ligands tels que la biotine. Le marquage des sondes selon l'invention est réalisé par des éléments sélectionnées parmi les ligands tels la biotine, l'avidine, la streptavidine, la dioxygénine, les haptènes, les colorants, les agents luminescents tels que les agents radioluminescents, chémiluminescents, bioluminescents, fluorescents, phosphorescents. Une autre possibilité est de marquer la sonde avec un peptide comprenant un épitope reconnu par un anticorps donné. La présence de cet anticorps peut être révélé au moyen d'un second anticorps marqué.The probe can be marked by means of a marker chosen, for example, from radioactive isotopes, enzymes, in particular enzymes capable of acting on a chromogenic, fluorigenic or luminescent substrate (in particular a peroxidase or an alkaline phosphatase) or alternatively enzymes producing or using protons (oxidase or hydrolase); chromophoric chemical compounds, chromogenic, fluorigenic or luminescent compounds, nucleotitic base analogs, and ligands such as biotin. The labeling of the probes according to the invention is carried out by elements selected from ligands such as biotin, avidin, streptavidin, dioxygenin, haptens, dyes, luminescent agents such as radioluminescent, chemiluminescent, bioluminescent, fluorescent, phosphorescent agents. Another possibility is to label the probe with a peptide comprising an epitope recognized by a given antibody. The presence of this antibody can be revealed by means of a second labeled antibody.
Dans ce procédé, la sonde est avantageusement marquée avec une des molécules précitées, lesdites molécules permettant l'apparition directe ou indirecte d'une coloration lorsque la sonde non dégradée est présente sur le support, ladite coloration pouvant être détectée de préférence par lecture optique ou simple observation. On entend par « lecture optique », toute mesure d'absorption, de transmission ou d'émission de lumière qui peut éventuellement se trouver à une longueur d'onde spécifique soit directement de l'ADN (260 nm par exemple), soit de toute molécule marqueur liée à la sonde. Cette définition comprend également toute mesure de la fluorescence émise par des marqueurs (fluorescéine et/ou phycoérythrine). Avantageusement, on détecte donc à l'étape f) la présence ou l'absence de la mutation soit par lecture optique, soit par simple observation d'une coloration sur le support solide.In this method, the probe is advantageously labeled with one of the abovementioned molecules, said molecules allowing the direct or indirect appearance of a coloration when the non-degraded probe is present on the support, said coloration being preferably detectable by optical reading or simple observation. “Optical reading” means any measurement of absorption, transmission or emission of light which may possibly be at a specific wavelength either directly from DNA (260 nm for example), or from any marker molecule linked to the probe. This definition also includes any measurement of the fluorescence emitted by markers (fluorescein and / or phycoerythrin). Advantageously, therefore, in step f), the presence or absence of the mutation is detected either by optical reading, or by simple observation of a coloration on the solid support.
Le support solide servant à l'ancrage de l'amorce peut être un matériau plastique (polystyrène, polycarbonate par exemple), ou bien du nylon ou du verre, de sorte que ce support est un tube, une membrane ou une bille sur lequel la région d'intérêt est amplifiée pour son analyse, c'est-à-dire la détection d'un changement de base. Avantageusement, le support est un tube (individuel ou en barette ou en plaque) servant à l'amplification, et donc compatible avec les différents thermocycleurs (Perkin Elmer 9700 par exemple). Les tubes peuvent également être n'importe quels tubes ou plaque type ELISA sur lesquels une fixation covalente d'acides nucléiques peut être effectuée. Différentes méthodes d'immobilisation d'un oligonucléotide sur un support sont possibles et sont notamment décrites dans US 6,030,782. Ces méthodes peuvent être une immobilisation directe par liaison chimique par exemple ou une immobilisation indirecte (par l'intermédiaire d'un linker ou d'un conjugué comme la streptavidine par exemple).The solid support used to anchor the primer can be a plastic material (polystyrene, polycarbonate for example), or nylon or glass, so that this support is a tube, a membrane or a ball on which the region of interest is amplified for its analysis, that is to say the detection of a base change. Advantageously, the support is a tube (individual or in a bar or in a plate) used for amplification, and therefore compatible with the various thermal cyclers (Perkin Elmer 9700 for example). The tubes can also be any ELISA type tube or plate on which covalent attachment of nucleic acids can be carried out. Different methods of immobilizing an oligonucleotide on a support are possible and are described in particular in US 6,030,782. These methods can be a direct immobilization by chemical bond for example or an indirect immobilization (via a linker or a conjugate such as streptavidin for example).
Dans un mode préféré de réalisation, les supports A et B sont des tubes sur lesquels une fixation covalente d'acides nucléiques peut être effectuée. De préférence, ces tubes sont des barrettes Nucleolink™ (NUNC, référence du catalogue n°248259) qui possèdent un revêtement particulier permettant la fixation covalente directe d'oligonucleotides par leur extrémité 5' phosphate (Rasmussen, S. R. et al., Anal. Biochem, 198:138-142 (1991)). Le format de ce procédé est ainsi le format standard 96 puits (12 barrettes de 8 puits), mais les barrettes étant sécables, le nombre voulu de tubes peut être utilisé. D'autres formats peuvent être utilisés en particulier si d'autres méthodes de fixation sont utilisées. Par exemple, il est possible d'attacher les acides nucléiques par pont disulfure en suivant la méthode préconisée dans US 6,300,782.In a preferred embodiment, supports A and B are tubes on which covalent attachment of nucleic acids can be carried out. Preferably, these tubes are Nucleolink ™ strips (NUNC, catalog reference No. 248259) which have a special coating allowing the direct covalent attachment of oligonucleotides by their 5 ′ phosphate end (Rasmussen, SR et al., Anal. Biochem , 198: 138-142 (1991)). The format of this process is thus the standard 96-well format (12 strips of 8 wells), but the strips being breakable, the desired number of tubes can be used. Other formats can be used, in particular if other fixing methods are used. For example, it is possible to attach the nucleic acids by disulfide bridge by following the method recommended in US 6,300,782.
On utilise de préférence à l'étape d) un αS-phosphothioatedésoxynucléotide, de préférence αS-dATP, αS-dTTP, αS-dCTP, αS-dGTP, αS-dUTP ou αS-dITP et à l'étape e) une exonuclease, notamment l'exonuclease III. On entend par « exonuclease » tout enzyme naturel ou modifié ayant une activité exonucléasique. On peut également envisager l'utilisation des ADN polymérase possédant une activité de pyrophophorolyse (en présence d'une forte concentration en pyrophosphate, cet enzyme ajoute un pyrophosphate sur la dernière liaison phosphodiester et relâche donc le nucléotide en 3'. Ce produit est disponible chez Promega sous la marque READIT™, et des variants utilisant un système de révélation à la luciférase est disponible sous la marque READase™. D'une manière générale, un puits reçoit un ADN, puis une sonde et on ne permet l'incorporation que d'un seul nucléotide (dNTP*). Donc, au moins deux tubes sont nécessaires pour chaque ADN à tester, l'un recevant la base normale et l'autre recevant la base mutée.Preferably used in step d) an αS-phosphothioatedésoxynucleotide, preferably αS-dATP, αS-dTTP, αS-dCTP, αS-dGTP, αS-dUTP or αS-dITP and in step e) an exonuclease, including exonuclease III. The term "exonuclease" means any natural or modified enzyme having an exonuclease activity. One can also consider the use of DNA polymerase having a pyrophophorolysis activity (in the presence of a high concentration of pyrophosphate, this enzyme adds a pyrophosphate on the last phosphodiester bond and therefore releases the nucleotide at 3 '. This product is available from Promega under the brand READIT ™, and variants using a luciferase revealing system is available under the brand READase ™. Generally, a well receives a DNA, then a probe and the incorporation of only one nucleotide (dNTP *) is allowed. Therefore, at least two tubes are required for each DNA to be tested, one receiving the normal base and the other receiving the mutated base.
Ainsi, le procédé décrit ci-dessus se caractérise en ce qu'on utilise deux tubes, l'un étant destiné à la détection de la base mutée (tube A) et l'autre étant destiné à la détection de la base normale correspondante à ladite base mutée (tube B). Bien entendu, on peut utiliser plusieurs séries de tubes A et B, notamment dans une plaque à 96 puits et un tube C comme témoin négatif pour chaque série de tubes A et B. Dans le mode préféré de réalisation, ledit dNTP* est un αS- phosphothioatedésoxynucléotide tel que αS-dATP, αS-dTTP, αS-dCTP, αS-dGTP, αS-dUTP ou αS-dITP qui est incorporé à l'extrémité 3 'de la sonde. Cela peut s'effectuer par exemple par LCR, ou de préférence par PCR asymétrique. Les αS- phosphothioatedésoxynucléotides peuvent être aisément incorporés dans des polynucléotides par toutes les polymérases et transcriptases inverses testées, ce qui permet d'utiliser des ADN polymérases d'un prix de revient plus avantageux que dans d'autres détections de mutations. On entend par « ADN polymérase », tout enzyme naturel ou modifié ayant une activité polymérasique. On peut citer par exemple les ADN pol exo-, notamment la T7 ou le fragment de klenow.Thus, the method described above is characterized in that two tubes are used, one being intended for the detection of the mutated base (tube A) and the other being intended for the detection of the normal base corresponding to said mutated base (tube B). Of course, several series of tubes A and B can be used, in particular in a 96-well plate and a tube C as a negative control for each series of tubes A and B. In the preferred embodiment, said dNTP * is an αS - phosphothioatedésoxynucleotide such as αS-dATP, αS-dTTP, αS-dCTP, αS-dGTP, αS-dUTP or αS-dITP which is incorporated at the 3 ′ end of the probe. This can be done for example by LCR, or preferably by asymmetric PCR. The αS-phosphothioatedésoxynucleotides can be easily incorporated into polynucleotides by all the polymerases and reverse transcriptases tested, which makes it possible to use DNA polymerases at a more advantageous cost price than in other detection of mutations. “DNA polymerase” is understood to mean any natural or modified enzyme having polymerase activity. Mention may be made, for example, of pol exo- DNAs, in particular T7 or the klenow fragment.
Avantageusement, les étapes e) et f) sont réalisées simultanément dans un même mélange réactionnel comprenant ladite exonuclease et les moyens nécessaires pour révéler la coloration. Ces moyens dépendent du marqueur ou du ligand qui se trouve sur la sonde.Advantageously, steps e) and f) are carried out simultaneously in the same reaction mixture comprising said exonuclease and the means necessary to reveal the coloration. These means depend on the marker or the ligand which is on the probe.
Un autre aspect de l'invention concerne un dispositif ou kit permettant de mettre en œuvre le procédé défini ci-dessus.Another aspect of the invention relates to a device or kit making it possible to implement the method defined above.
Un tel kit se caractérise en ce qu'il comprend : des tubes A et B dans lesquels au moins une amorce permettant d'amplifier la région comprenant la mutation spécifique est liée en 5' par une liaison covalente, des mélanges réactionnels A et B comportant chacun un αS- phosphothioatedésoxynucléotide différent sélectionné parmi αS-dATP, αS dTTP, αS-dCTP, S-dGTP, αS-dUTP et S-dITP, le mélange réactionnel utilisé pour le support A comprenant un αS-phosphothioatedésoxynucléotide complémentaire de ladite mutation et le mélange réactionnel utilisé pour le support B comprenant un S-phosphothioatedésoxynucléotide complémentaire de la base normale correspondante à ladite mutation. Ce kit peut comprendre en outre au moins un élément sélectionné parmi une exonuclease, en particulier l'exonuclease III, un réactif permettant de révéler la coloration, une ADN polymérase et différents tampons ou solutions nécessaires à la mise en œuvre du procédé.Such a kit is characterized in that it includes: tubes A and B in which at least one primer making it possible to amplify the region comprising the specific mutation is linked in 5 ′ by a covalent bond, reaction mixtures A and B each comprising a different αS- phosphothioatedesoxynucleotide selected from αS-dATP, αS dTTP, αS-dCTP, S-dGTP, αS-dUTP and S-dITP, the reaction mixture used for support A comprising an αS-phosphothioatedésoxynucleotide complementary to said mutation and the reaction mixture used for support B comprising an S-phosphothioatedésoxynucleotide complementary to the normal base corresponding to said mutation. This kit can also comprise at least one element selected from an exonuclease, in particular exonuclease III, a reagent making it possible to reveal the coloration, a DNA polymerase and various buffers or solutions necessary for the implementation of the method.
Avantageusement, le kit selon l'invention comprend une série de tubes A et B, chaque série permettant de détecter une mutation donnée et des tubes C comme témoins négatifs. Lesdits tubes peuvent être des tubes NUNC.Advantageously, the kit according to the invention comprises a series of tubes A and B, each series making it possible to detect a given mutation and tubes C as negative controls. Said tubes can be NUNC tubes.
Dans un autre aspect, l'invention porte sur l'utilisation du procédé et du kit décrits ci- dessus pour la détection de mutations de gènes impliquées dans des maladies, notamment dans des maladies génétiques héréditaires, en particulier l'hémochromatose, l'anémie à hématies falciformes, les β et α thalassemies, la fibrose kystique, l'hémophilie, les maladies neurodégénératives et des mutations dans les gènes impliqués dans le cancer. Une liste exhaustive des mutations dans ces gènes est donné sur le site internet suivant : ftp://ncbi.nlm.nih.gov/repositoι-v/OMIM/morbidιnap Le procédé et le kit selon l'invention sont également utiles pour l'étude du polymorphisme des gènes ou de toute région génétique et pour la détection et/ou à l'identification d'organismes génétiquement modifiés (OGM).In another aspect, the invention relates to the use of the method and the kit described above for the detection of gene mutations implicated in diseases, in particular in hereditary genetic diseases, in particular hemochromatosis, anemia sickle cell β and α thalassemia, cystic fibrosis, hemophilia, neurodegenerative diseases and mutations in the genes involved in cancer. An exhaustive list of mutations in these genes is given on the following website: ftp://ncbi.nlm.nih.gov/repositoι-v/OMIM/morbidιnap The method and the kit according to the invention are also useful for studying the polymorphism of genes or any genetic region and for the detection and / or identification of genetically modified organisms (GMOs).
Légendeslegends
Figure 1A : amplification PCR en phase solideFigure 1A: PCR amplification in solid phase
Amplification de la région génétique d'intérêt Figure 1B : dénaturation Le double brin d'ADN est dénaturé, puis les lavages permettent de ne conserver que le brin ancréAmplification of the genetic region of interest Figure 1B: denaturation The double strand of DNA is denatured, then the washes allow only the anchored strand to be preserved
Figure 1C : incorporation d'un nucléotide modifiéFigure 1C: incorporation of a modified nucleotide
Une réaction enzymatique catalyse l'élongation d'une sonde résultant en l'insertion d'un nucléotide modifié, par exemple un αS-phosphothioatedésoxynucléotide à l'extrémité 3' de la sonde. Deux réactions dans les deux tubes A et B sont nécessaires pour chaque échantillon avec l'incorporation d'une seule base pour détecter les génotypes normaux (tube B) et/ou mutants (tube A).An enzymatic reaction catalyzes the elongation of a probe resulting in the insertion of a modified nucleotide, for example an αS-phosphothioatedésoxynucleotide at the 3 'end of the probe. Two reactions in the two tubes A and B are necessary for each sample with the incorporation of a single base to detect the normal genotypes (tube B) and / or mutants (tube A).
Figure 1D : détectionFigure 1D: detection
La sonde élonguée est protégée de l'action de dégradation de l'exonuclease et une coloration bleue se développe pendant l'incubation avec le substrat. La sonde non élonguée est éliminée, aucune coloration n'est obtenue. Par exemple, on peut effectuer la détection avec une sonde marquée au FITC et un anticorps marqué anti-The elongated probe is protected from the degrading action of the exonuclease and a blue color develops during incubation with the substrate. The non-elongated probe is eliminated, no coloration is obtained. For example, detection can be performed with a FITC-labeled probe and an anti-labeled antibody.
FITC.FITC.
Figure 1E : interprétation visuelle très facile des résultats Les résultats pour 4 séries de tubes A et B (pour 4 individus ou 4 mutations différents chez un même individu) sont présentés. Les résultats positifs sont bleus (gris foncé dans le texte) et les négatifs sont incolores. Pour chaque individu, qu'il soit muté ou normal, on obtient une coloration. Dans le cas d'hétérozygote, une coloration est obtenue dans les deux puits. Figures 2A et 2B : détection des mutations C282Y et H63D responsables de Fhémochromatose.Figure 1E: very easy visual interpretation of the results The results for 4 series of tubes A and B (for 4 individuals or 4 different mutations in the same individual) are presented. Positive results are blue (dark gray in the text) and negatives are colorless. For each individual, whether mutated or normal, a coloration is obtained. In the case of heterozygote, a coloration is obtained in the two wells. Figures 2A and 2B: detection of C282Y and H63D mutations responsible for hemochromatosis.
Figure 3 : amorces utilisées pour la détection des mutations responsables de la mucoviscidose. F = « Forward » R = « Reverse »Figure 3: primers used for the detection of mutations responsible for cystic fibrosis. F = "Forward" R = "Reverse"
(1) correspond à l'exon du gène CFTR dans lequel la mutation est trouvée(1) corresponds to the exon of the CFTR gene in which the mutation is found
(2) correspond à l'oligonucléotide fixé = amorce B (3) correspond au nucléotide modifié qui sera incorporé lors de l'extension : A=αS- dATP, T=αS-dTTP, C= S-dCTP, G=αS-dGTP(2) corresponds to the fixed oligonucleotide = primer B (3) corresponds to the modified nucleotide which will be incorporated during the extension: A = αS- dATP, T = αS-dTTP, C = S-dCTP, G = αS- dGTP
Figures 4A, 4B, 4C, 4D, 4E, 4F et 4G : détection de 7 mutations responsables de la mucoviscidose.Figures 4A, 4B, 4C, 4D, 4E, 4F and 4G: detection of 7 mutations responsible for cystic fibrosis.
Figures 5A et 5B : détection des mutations C282Y et H63D responsables de Fhémochromatose (procédé préféré selon l'invention dans lequel les étapes de dégradation et de révélation sont couplées).FIGS. 5A and 5B: detection of the C282Y and H63D mutations responsible for hemochromatosis (preferred method according to the invention in which the degradation and revelation steps are coupled).
Exemple 1 : protocole permettant de mettre en oeuyre le procédé selon l'inventionExample 1: protocol for implementing the process according to the invention
Le procédé selon la présente invention permet de déterminer le génotype d'un échantillon, celui-ci étant préalablement amplifié en utilisant une amorce fixée à la paroi du tube. Les tubes utilisés sont les barrettes Nucleolink (NUNC), la fixation de l'amorce est effectuée selon les indications du fournisseur.The method according to the present invention makes it possible to determine the genotype of a sample, the latter being previously amplified using a primer fixed to the wall of the tube. The tubes used are the Nucleolink strips (NUNC), the fixing of the primer is carried out according to the indications of the supplier.
1. Amplification par PCR de la région d' intérêt1. PCR amplification of the region of interest
Dans un tube contenant l'amorce B préalablement fixée, introduire les différents composants conformément aux différents fournisseurs et permettant l'amplifictaion de la région à analyser par PCR asymétrique : Tampons PCR, dNTP, amorce A 1 μM final, amorce B 0,12 μM final, Taq polymérase et ADN à tester. Remarque : Les produits d'amplification obtenus en phase liquide peuvent être jetés ou gardés pour être analysés sur un gel d'agarose à 1,5% coloré au bromure d'éthidium.In a tube containing the primer B previously fixed, introduce the different components in accordance with the different suppliers and allowing the amplifictaion of the region to be analyzed by asymmetric PCR: PCR buffers, dNTP, primer A 1 μM final, primer B 0.12 μM final, Taq polymerase and DNA to be tested. Note: The amplification products obtained in the liquid phase can be discarded or kept for analysis on a 1.5% agarose gel stained with ethidium bromide.
2. Déshybridation laver le puits à l'eau distillée ; déposer 25 μl de soudre (NaOH) 0,4M) dans chaque puits et laisser la plaque 5 minutes à température ambiante ; enlever la soude et laver à l'eau distillée.2. Dehybridization wash the well with distilled water; place 25 μl of 0.4M NaOH in each well and leave the plate for 5 minutes at room temperature; remove the soda and wash with distilled water.
3. Hybridation et élongation3. Hybridization and elongation
Distribuer 25 μl de solution d'hybridation N (normale) ou M (mutante) dans leur tube respectif ; ces deux solutions étant composées de Sonde 0,05 μM, Bst DNA polymérase (Biolabs) 0,4 U, tampon Bst 1 X, Solution (SSC 2,5X - BlockingDispense 25 μl of N (normal) or M (mutant) hybridization solution into their respective tubes; these two solutions being composed of 0.05 μM probe, Bst DNA polymerase (Biolabs) 0.4 U, Bst 1 X buffer, Solution (SSC 2.5X - Blocking
Reagent 0,25% (Amersham) et ne différant que par la présence du dNTP modifié0.25% reagent (Amersham) and differing only in the presence of modified dNTP
(dNTP*) 10 μM ;(dNTP *) 10 μM;
Incuber 15 minutes à 50°C.Incubate 15 minutes at 50 ° C.
4. Lavages4. Washes
Vider les puits et laver avec une solution NaCl 2,5%.Empty the wells and wash with 2.5% NaCl solution.
5. Digestion enzvmatique - Déposer par puits 25 μl de solution contenant 0,01 U d'Exonucléase III dans son tampon (concentrations finales : Tris 50 mM, DTT 1 mM, MgC12 10 mM) ; Incuber 10 minutes à 37° C.5. Enzymatic digestion - Place 25 μl of solution containing 0.01 U of Exonuclease III in its buffer per well (final concentrations: 50 mM Tris, 1 mM DTT, 10 mM MgC12); Incubate 10 minutes at 37 ° C.
6. Lavages Vider les puits et laver avec une solution lavage PBS IX, T een 0,1%. 7. Révélation6. Washes Empty the wells and wash with a PBS IX, T een 0.1% washing solution. 7. Revelation
- Ajouter 25 μl d'anticorps anti-FITC-POD (Boehringer) l/2000ème dans PBS-- Add 25 μl of anti-FITC-POD antibody (Boehringer) l / 2000th in PBS-
BSA 3% dans chaque puits et laisser à température ambiante 10 minutes ; - Vider le puits et laver avec une solution PBS IX, Tween 0,1% ;BSA 3% in each well and leave at room temperature 10 minutes; - Empty the well and wash with a PBS IX, 0.1% Tween solution;
Déposer 25 μl de substrat TMB (Tetramethylbenzidine - Sigma) par puits ;Deposit 25 μl of TMB substrate (Tetramethylbenzidine - Sigma) per well;
Incuber 15 minutes à température ambiante ;Incubate 15 minutes at room temperature;
Il est possible de stopper la réaction avec 25 μl d'H2SO4.It is possible to stop the reaction with 25 μl of H2SO4.
8. Résultats8. Results
La lecture peut alors d'effectuer à l'œil nu ; un coloration bleue apparaissant dans les puits positifs. Il est également possible de lire la densité optique à 655 nm à l'aide d'un lecteur de microplaque ou à 450 nm si la réaction a été stoppée.Reading can then be done with the naked eye; a blue color appearing in the positive wells. It is also possible to read the optical density at 655 nm using a microplate reader or at 450 nm if the reaction has been stopped.
9. Interprétation des résultats9. Interpretation of results
La détermination du génotype d'un échantillon donné peut s'effectuer : par lecture à l'œil nu : une coloration bleue apparaît dans les puits positifs et les puits négatifs restent incolores. Les quatre profits de coloration possibles sont décrits ci-dessous :The genotype of a given sample can be determined: by reading with the naked eye: a blue color appears in the positive wells and the negative wells remain colorless. The four possible coloring benefits are described below:
Cas l NormalNormal case
Cas 2 MutantCase 2 Mutant
Cas 3 HétérozygoteCase 3 Heterozygous
Cas 4 Contrôle négatif Case 4 Negative control
- par lecture de la densité optique à 655 nm (ou 450 nm si la réaction est stoppée).- by reading the optical density at 655 nm (or 450 nm if the reaction is stopped).
On détermine le rapport R = [DO(N) / DO (M] Si R > 2 alors le génotype est Normal Si 0,5 < R < 2 alors le génotype est Hétérozygote Si R < 0,5 alors le génotype est MutantWe determine the ratio R = [DO (N) / DO (M] If R> 2 then the genotype is Normal If 0.5 <R <2 then the genotype is Heterozygous If R <0.5 then the genotype is Mutant
Exemple 2 : diagnostic de l'hémochromatose, détection des mutations C282Y et H63D responsables de l'hémochromatose.Example 2: diagnosis of hemochromatosis, detection of mutations C282Y and H63D responsible for hemochromatosis.
1. Amplification par PCR de la région d' intérêt Dans un tube contenant l'amorce B fixée, introduire :1. PCR amplification of the region of interest In a tube containing the fixed primer B, introduce:
Concentration finaleFinal concentration
Tampon PCR 10X I XPCR buffer 10X I X
BSA 10 mg/ml 1 mg/mlBSA 10 mg / ml 1 mg / ml
MgC12 50 mM 3 mM dNTP 10 mM 0,20 mMMgC12 50 mM 3 mM dNTP 10 mM 0.20 mM
Amorce A 25 pmole/μl 0,5 μMPrimer A 25 pmole / μl 0.5 μM
Amorce B 3 pmole/μl 0,06 μMPrimer B 3 pmole / μl 0.06 μM
Taq polymérase 5U/μl 0,02 U/μlTaq polymerase 5U / μl 0.02 U / μl
Eau stérile qsp 25 μl 11,9 μlSterile water qs 25 μl 11.9 μl
ADN à tester 1 ng/μlDNA to be tested 1 ng / μl
2. Déshybridation2. Dehybridization
3. Hybridation et élongation3. Hybridization and elongation
Distribuer 25 μl de solution d'hybridation N (normale) ou M (mutante) dans leur tube respectif, les solutions différant par αthiodGTP (base normale pour C282Y etDistribute 25 μl of N (normal) or M (mutant) hybridization solution in their respective tube, the solutions differing by αthiodGTP (normal base for C282Y and
H63D) dans le cas de la solution normale ; αthiodATP (base mutante pour C282Y) dans le case de la solution mutante C282Y ou αthiodCTP (base mutante pour H63D) dans le cas de la solution mutante H63D.H63D) in the case of the normal solution; αthiodATP (mutant base for C282Y) in the case of the C282Y mutant solution or αthiodCTP (mutant base for H63D) in the case of the H63D mutant solution.
Détection de la mutation C282Y :Detection of the C282Y mutation:
Amorces utilisées :Primers used:
- Amorce A 5'CATGAAGTGGCTGAAGGATAA3' (SEQ ID N°l) - Amorce B 5'GCACTCCTCTCAACCCCCA3' (SEQ ID N°2) - Sonde marquée FITC 5'FITC-GGAAGAGCAGAGATATACGT3' (SEQ ID- Primer A 5'CATGAAGTGGCTGAAGGATAA3 '(SEQ ID N ° l) - Primer B 5'GCACTCCTCTCAACCCCCA3' (SEQ ID N ° 2) - Probe marked FITC 5'FITC-GGAAGAGCAGAGATATACGT3 '(SEQ ID
N°3)# 3)
Cas normal : incorporation d'un αS-dGTP, région du SNP C282Y et sa région complémentaire, incluse dans la région amplifiée par les amorces SEQ ID N° 1 et SEQ ID N° 2, la sonde SEQ ID N° 3 étant soulignée, la base polymorphe étant en gras.Normal case: incorporation of an αS-dGTP, region of SNP C282Y and its complementary region, included in the region amplified by the primers SEQ ID N ° 1 and SEQ ID N ° 2, the probe SEQ ID N ° 3 being underlined, the polymorphic base being in bold.
GGGAAGAGCAGAGATATACGTGATGAGAGT (SEQ ID N°4) CCCTTCTCGTCTCTATATGCACTACTCTCA (SEQ ID N°5)GGGAAGAGCAGAGATATACGTGATGAGAGT (SEQ ID N ° 4) CCCTTCTCGTCTCTATATGCACTACTCTCA (SEQ ID N ° 5)
Cas mutant : incorporation d'un αS-dATP, région du SNP C282Y et sa région complémentaire, incluse dans la région amplifiée par les amorces SEQ ID N° 1 et SEQ ID N° 2, la sonde SEQ ID N° 3 étant soulignée, la base polymorphe étant en gras.Mutant case: incorporation of an αS-dATP, region of SNP C282Y and its complementary region, included in the region amplified by the primers SEQ ID No. 1 and SEQ ID No. 2, the probe SEQ ID No. 3 being underlined, the polymorphic base being in bold.
GGGAAGAGCAGAGATATACGTA CCCTTCTCGTCTCTATATGCATTACTCTCA (SEQ ID N°7)GGGAAGAGCAGAGATATACGTA CCCTTCTCGTCTCTATATGCATTACTCTCA (SEQ ID N ° 7)
Détection de la mutation H63D : Amorces utilisées :Detection of the H63D mutation: Primers used:
- Amorce A 5 ' ACATCTGGCTTGAAATTCTACT3 ' (SEQ ID N°8)- Primer A 5 'ACATCTGGCTTGAAATTCTACT3' (SEQ ID N ° 8)
- Amorce B 5 'TCTCCAGGTTCACACTCTCT3 ' (SEQ ID N°9)- Primer B 5 'TCTCCAGGTTCACACTCTCT3' (SEQ ID N ° 9)
- Sonde marquée FITC 5 'FITC-CC AC ACGGCGACTCTC AT3 ' (SEQ ID N° 10)- Probe marked FITC 5 'FITC-CC AC ACGGCGACTCTC AT3' (SEQ ID N ° 10)
Cas normal : incorporation d'un αS-dGTP, région du SNP H63D et sa région complémentaire, incluse dans la région amplifiée par les amorces SEQ ID N° 8 et SEQ ID N° 9, la sonde SEQ ID N° 10 étant soulignée, la base polymorphe étant en gras. TATGATCATGAGAGTCGCCGTGTGGAGCCC (SEQ ID N° ll) ATACTAGTACTCTCAGCGGCACACCTCGGG ( SEQ ID N ° 12 )Normal case: incorporation of an αS-dGTP, region of SNP H63D and its complementary region, included in the region amplified by the primers SEQ ID No. 8 and SEQ ID No. 9, the probe SEQ ID No. 10 being underlined, the polymorphic base being in bold. TATGATCATGAGAGTCGCCGTGTGGAGCCC (SEQ ID No ll) ATACTAGTACTCTCAGCGGCACACCTCGGG (SEQ ID N ° 12)
Cas mutant : incorporation d'un αS-dCTP, région du SNP H63D et sa région complémentaire, incluse dans la région amplifiée par les amorces SEQ ID N° 8 et SEQ ID N° 9, la sonde SEQ ID N° 10 étant soulignée, la base polymorphe étant en gras.Mutant case: incorporation of an αS-dCTP, region of SNP H63D and its complementary region, included in the region amplified by the primers SEQ ID No. 8 and SEQ ID No. 9, the probe SEQ ID No. 10 being underlined, the polymorphic base being in bold.
TATGATGATGAGAGTCGCCGTGTGGAGCCC (SEQ ID N°13) ATACTACTACTCTCAGCGGCACACCTCGGG (SEQ ID N°14)TATGATGATGAGAGTCGCCGTGTGGAGCCC (SEQ ID N ° 13) ATACTACTACTCTCAGCGGCACACCTCGGG (SEQ ID N ° 14)
Les résultats sont présentés à la Figure 2.The results are shown in Figure 2.
Exemple 3 : Diagnostic de la mucoviscidose, détection de sept mutations responsables de la mucoviscidose.Example 3: Diagnosis of cystic fibrosis, detection of seven mutations responsible for cystic fibrosis.
Fréquences (%)* fréquences calculées d'après Cyctic Fibrosis Mutation Data Base février 2000 (http://www.genet.cikkids.on.ca/cftr/newfreq/All.html).Frequencies (%) * frequencies calculated from Cyctic Fibrosis Mutation Data Base February 2000 (http://www.genet.cikkids.on.ca/cftr/newfreq/All.html).
Amorces et sondes utilisées (voir Figure 3) Remarque : Le protocole utilisé et identique à la description générale, l'utilisation de barrettes Nucleolink (NUNC) permet de tester sur un format 96 puits 7 mutations chez 6 personnes. Les résultats sont indiqués à la Figure 4.Primers and probes used (see Figure 3) Note: The protocol used and identical to the general description, the use of Nucleolink strips (NUNC) allows testing on a 96-well format 7 mutations in 6 people. The results are shown in Figure 4.
Exemple 4 : Perfectionnement du protocole, couplage des étapes de digestion par l'exonuclease et de révélation.Example 4: Improvement of the protocol, coupling of the exonuclease digestion and revelation steps.
Les étapes 1 à 4 sont identiques à celles de l'exemple 1, seules les étapes suivantes sont modifiées de sorte que la digestion par l'Exonucléase III et la révélation par l'anticorps sont réalisées en une seule étape. - Déposer par puits 25 μl de solution contenant 0,01 U d'Exonucléase III (New England Biolabs) dans son tampon, 2,5 μl d'anticorps anti-FITC-POD (Boehringer Mannheim) l/200ème dans PBS-BSA 3% et 0,25 μl Tween 20 ; Incuber 10 minutes à 37°C ;Steps 1 to 4 are identical to those of Example 1, only the following steps are modified so that digestion with Exonuclease III and revelation by the antibody are carried out in a single step. - Deposit per well 25 μl of solution containing 0.01 U of Exonuclease III (New England Biolabs) in its buffer, 2.5 μl of anti-FITC-POD antibody (Boehringer Mannheim) l / 200th in PBS-BSA 3 % and 0.25 μl Tween 20; Incubate 10 minutes at 37 ° C;
Effectuer 3 lavages avec la solution de lavage PBS IX, Tween 0,1% ; - Déposer 25 μl de TMB et incuber 15 minutes à 37°C ;Perform 3 washes with washing solution PBS IX, Tween 0.1%; - Add 25 μl of TMB and incubate for 15 minutes at 37 ° C;
Les résultats présentés à la Figure 5 sont interprétés comme indiqué dans l'exemple I.The results presented in Figure 5 are interpreted as shown in Example I.
Exemple 5 : Perfectionnement du protocole, en utilisant un système streptavidine / biotine (sonde biotynilée et streptavidine conjuguée)Example 5: Improvement of the Protocol, Using a Streptavidin / Biotin System (Biotynilated Probe and Conjugated Streptavidin)
Les étapes 1 à 2 sont identiques à celles de l'exemple I, seules les étapes suivantes sont modifiées de sorte que la révélation finale s'effectue grâce à la streptavidine, la sonde ayant été au préalable couplée à une biotine. 3. Hybridation et élongationSteps 1 to 2 are identical to those of Example I, only the following steps are modified so that the final development is carried out using streptavidin, the probe having been previously coupled to a biotin. 3. Hybridization and elongation
Distribuer 25 μl de solution d'hybridation N (normale) ou M (mutante) dans leur tube respectif ; ces deux solutions étant composées de : Sonde biotinylée 0,05 μM, Bst polymérase (New England Biolabs) 0,4 U, Tampon Bst 10 X : 2,5 μl, Solution (SSC 2,5 Blocking Reagent 0,25 % (Amersham)) et ne différant que par la présence du dNTP modifié 10 μM. Incuber 15 minutes à 50°C.Dispense 25 μl of N (normal) or M (mutant) hybridization solution into their respective tubes; these two solutions being composed of: 0.05 μM biotinylated probe, Bst polymerase (New England Biolabs) 0.4 U, Bst 10 X buffer: 2.5 μl, Solution (SSC 2.5 Blocking Reagent 0.25% (Amersham )) and differing only in the presence of the modified 10 μM dNTP. Incubate 15 minutes at 50 ° C.
4. Lavages4. Washes
Vider les puits et laver avec une solution contenant 2,5% NaCl.Empty the wells and wash with a solution containing 2.5% NaCl.
5. Digestion enzymatique - Déposer par puits 25 μl de solution contenant 0,01 d'U d'Exonucléase III (New England Biolabs) dans son tampon ; Incuber 10 minutes à 37°C.5. Enzymatic digestion - Place 25 μl of solution containing 0.01 U of Exonuclease III (New England Biolabs) in its buffer per well; Incubate for 10 minutes at 37 ° C.
6. Lavages6. Washes
Vider les puits et effectuer 3 lavages avec une solution de lavage PBS IX, Tween 0,1%.Empty the wells and perform 3 washes with PBS IX washing solution, 0.1% Tween.
7. Révélation7. Revelation
Ajouter 25 μl de Streptavidine 1 mg/ml diluée au l/2000ème dans du PBS) ; Laisser incuber 10 minutes à température ambiante.Add 25 μl of Streptavidin 1 mg / ml diluted to l / 2000th in PBS); Incubate for 10 minutes at room temperature.
8. Effectuer 3 lavages avec la solution de lavage PBS IX, Tween 0,1%. 9. Déposer 25 μl de TMB et incuber 15 minutes à 37°C.8. Perform 3 washes with PBS IX washing solution, 0.1% Tween. 9. Add 25 μl of TMB and incubate for 15 minutes at 37 ° C.
10. Résultats et interprétation des résultats comme indiqué dans l'Exemple 1. 10. Results and interpretation of the results as indicated in Example 1.

Claims

REVENDICATIONS
1. Procédé de détection d'une mutation se trouvant en position n dans un acide nucléique cible, caractérisé en ce qu'il comprend les étapes suivantes : a) amplification sur au moins deux supports solides distincts A et B de la région d'intérêt comprenant ladite mutation à l'aide d'au moins une amorce liée en 5' aux supports, b) déshybridation des brins d'ADN et élimination des brins en suspension par lavage, c) hybridation d'une sonde avec les brins d'ADN liés aux supports solides A et B, l'extrémité 3' de ladite sonde s'hybridant au maximum jusqu'au nucléotide n-1 desdits brins, d) réaction d'élongation de la sonde hybridée à l'étape c) par incorporation dans la direction 5'-3' de nucléotides complémentaires desdits brins d'ADN au moyen d'un mélange réactionnel comprenant une ADN polymérase et un dérivé de nucléotide résistant à la dégradation par une exonuclease (dNTP*), le mélange réactionnel utilisé pour le support A comprenant un dNTP* complémentaire de ladite mutation et le mélange réactionnel utilisé pour le support B comprenant un dNTP* complémentaire de la base normale correspondante à ladite mutation, e) dégradation par ladite exonuclease de sorte que seules les sondes élongées à l'étape d) ne sont pas dégradées, lavage, f) révélation directe ou indirecte de la sonde non dégradée, ladite révélation étant positive soit dans le cas où le brin d'ADN sur le support A contient la mutation, soit dans le cas où le brin d'ADN sur le support B contient la base normale correspondante à ladite mutation.1. Method for detecting a mutation located in position n in a target nucleic acid, characterized in that it comprises the following steps: a) amplification on at least two distinct solid supports A and B of the region of interest comprising said mutation using at least one primer linked in 5 ′ to the supports, b) dehybridization of the DNA strands and elimination of the suspended strands by washing, c) hybridization of a probe with the DNA strands linked to solid supports A and B, the 3 'end of said probe hybridizing at most to nucleotide n-1 of said strands, d) elongation reaction of the probe hybridized in step c) by incorporation into the 5'-3 'direction of nucleotides complementary to said DNA strands by means of a reaction mixture comprising a DNA polymerase and a nucleotide derivative resistant to degradation by an exonuclease (dNTP *), the reaction mixture used for the support A including a complementary dNTP * of said mutation and the reaction mixture used for support B comprising a dNTP * complementary to the normal base corresponding to said mutation, e) degradation by said exonuclease so that only the probes elongated in step d) are not degraded , washing, f) direct or indirect revelation of the non-degraded probe, said revelation being positive either in the case where the DNA strand on the support A contains the mutation, or in the case where the DNA strand on the support B contains the normal base corresponding to said mutation.
2. Procédé selon la revendication 1 caractérisé en ce que la sonde est marquée avec des molécules sélectionnées parmi des enzymes, en particulier des enzymes susceptibles d'agir sur un substrat chromogène, fluorigène ou luminescent (notamment une peroxydase ou une phosphatase alcaline), des composés chimiques chromophores, des composés chromogènes, fluorigènes ou luminescents, des analogues de base nucléotitiques, et des ligands tels que la biotine, lesdites molécules permettant l'apparition directe ou indirecte d'une coloration lorsque la sonde non dégradée est présente sur le support, ladite coloration pouvant être détectée de préférence par mesure optique ou simple observation.2. Method according to claim 1 characterized in that the probe is labeled with molecules selected from enzymes, in particular enzymes capable of acting on a chromogenic, fluorigenic or luminescent substrate (in particular a peroxidase or an alkaline phosphatase), chromophoric chemical compounds, chromogenic, fluorigenic or luminescent compounds, nucleotitic base analogs, and ligands such as biotin, said molecules allowing the direct or indirect appearance of a coloration when the non-degraded probe is present on the support, said coloration being preferably detectable by optical measurement or simple observation.
3. Procédé selon l'une des revendications 1 et 2 caractérisé en ce que l'on détecte à l'étape f) la présence ou l'absence de la mutation soit par lecture optique, soit par simple observation d'une coloration sur le support solide.3. Method according to one of claims 1 and 2 characterized in that one detects in step f) the presence or absence of the mutation either by optical reading, or by simple observation of a coloration on the solid support.
4. Procédé selon l'une des revendications 1 à 3 caractérisé que ce que les supports A et B sont des tubes sur lesquels une fixation covalente d'acides nucléiques peut être effectuée, de préférence des tubes en un matériau plastique tel que le polystyrène, ou le polycarbonate, notamment des tubes de type Nucleolink™.4. Method according to one of claims 1 to 3 characterized in that the supports A and B are tubes on which a covalent fixing of nucleic acids can be carried out, preferably tubes made of a plastic material such as polystyrene, or polycarbonate, in particular tubes of the Nucleolink ™ type.
5. Procédé selon l'une des revendications précédentes caractérisé en ce qu'on utilise à l'étape d) un αS-phosphothioatedésoxynucléotide, de préférence αS-dATP, αS- dTTP, αS-dCTP, αS-dGTP, αS-dUTP ou αS-dITP.5. Method according to one of the preceding claims, characterized in that in step d) an αS-phosphothioatedésoxynucleotide, preferably αS-dATP, αS- dTTP, αS-dCTP, αS-dGTP, αS-dUTP or aS-dITP.
6. Procédé selon l'une des revendications précédentes caractérisé en ce qu'on utilise à l'étape e) l'exonuclease III.6. Method according to one of the preceding claims, characterized in that in step e) exonuclease III is used.
7. Procédé selon l'une des revendications précédentes caractérisé en ce qu'on utilise deux tubes, l'un étant destiné à la détection de la base mutée (tube A) et l'autre étant destiné à la détection de la base normale correspondante à ladite base mutée (tube B). 7. Method according to one of the preceding claims, characterized in that two tubes are used, one being intended for the detection of the mutated base (tube A) and the other being intended for the detection of the corresponding normal base to said mutated base (tube B).
8. Procédé selon l'une des revendications précédentes caractérisé en ce qu'on utilise plusieurs séries de tubes A et B, notamment dans une plaque à 96 puits. 8. Method according to one of the preceding claims, characterized in that several series of tubes A and B are used, in particular in a 96-well plate.
9. Procédé selon l'une des revendications précédentes caractérisé en ce qu'on utilise en outre un tube C comme témoin négatif.9. Method according to one of the preceding claims, characterized in that a tube C is also used as negative control.
10. Procédé selon l'une des revendications précédentes caractérisé en ce que les étapes e) et f) sont réalisées simultanément dans un même mélange réactionnel comprenant ladite exonuclease et les moyens nécessaire pour révéler la coloration.10. Method according to one of the preceding claims, characterized in that steps e) and f) are carried out simultaneously in the same reaction mixture comprising said exonuclease and the means necessary to reveal the coloration.
11. Dispositif ou Kit permettant de mettre en œuvre le procédé selon l'une des revendications précédentes, caractérisé en ce qu'il comprend : - des tubes A et B dans lesquels au moins une amorce permettant d'amplifier la région comprenant la mutation spécifique est liée en 5' par une liaison covalente, des mélanges réactionnels A et B comportant chacun un αS- phosphothioatedésoxynucléotide différent sélectionné parmi αS-dATP, αS dTTP, αS-dCTP, αS-dGTP, αS-dUTP et αS-dITP, le mélange réactionnel utilisé pour le support A comprenant un αS-phosphothioatedésoxynucléotide complémentaire de ladite mutation et le mélange réactionnel utilisé pour le support B comprenant un αS-phosphothioatedésoxynucléotide complémentaire de la base normale correspondante à ladite mutation.11. Device or kit for implementing the method according to one of the preceding claims, characterized in that it comprises: - tubes A and B in which at least one primer for amplifying the region comprising the specific mutation is linked in 5 ′ by a covalent bond, reaction mixtures A and B each comprising a different αS- phosphothioatedésoxynucleotide selected from αS-dATP, αS dTTP, αS-dCTP, αS-dGTP, αS-dUTP and αS-dITP, the mixture reaction mixture used for support A comprising an αS-phosphothioatedésoxynucleotide complementary to said mutation and the reaction mixture used for support B comprising an αS-phosphothioatedésoxynucleotide complementary to the normal base corresponding to said mutation.
12. Kit selon la revendication 11 caractérisé en ce qu'il comprend en outre au moins un élément sélectionné parmi une exonuclease, en particulier l'exonuclease III, un réactif permettant de révéler la coloration, une ADN polymérase et différents tampons ou solutions nécessaires à la mise en œuvre du procédé.12. Kit according to claim 11 characterized in that it further comprises at least one element selected from an exonuclease, in particular exonuclease III, a reagent for revealing the coloration, a DNA polymerase and various buffers or solutions necessary for the implementation of the process.
13. Kit selon l'une des revendications 11 et 12 caractérisé en ce qu'il comprend une série de tubes A et B, chaque série permettant de détecter une mutation donnée. 13. Kit according to one of claims 11 and 12 characterized in that it comprises a series of tubes A and B, each series making it possible to detect a given mutation.
14. Kit selon l'une des revendications 11 à 13 caractérisé en ce qu'il comprend en outre des tubes C comme témoins négatifs.14. Kit according to one of claims 11 to 13 characterized in that it further comprises tubes C as negative controls.
15. Kit selon l'une des revendications 11 à 14 caractérisé en ce que lesdits tubes sont des tubes en un matériau plastique tel que le polystyrène, ou le polycarbonate, notamment des tubes de type Nucleolink™.15. Kit according to one of claims 11 to 14 characterized in that said tubes are tubes made of a plastic material such as polystyrene, or polycarbonate, in particular tubes of the Nucleolink ™ type.
16. Utilisation du procédé selon l'une des revendications 1 à 10 et du kit selon l'une des revendications 11 à 15 pour la détection de mutations de gènes impliquées dans des maladies, notamment dans des maladies génétiques héréditaires, en particulier l'hémochromatose, l'anémie à hématies falciformes, les β et α thalassemies, la fibrose kystique, l'hémophilie, les maladies neurodégénératives et des mutations dans les gènes impliqués dans le cancer.16. Use of the method according to one of claims 1 to 10 and of the kit according to one of claims 11 to 15 for the detection of gene mutations involved in diseases, in particular in hereditary genetic diseases, in particular hemochromatosis , sickle cell anemia, β and α thalassemia, cystic fibrosis, hemophilia, neurodegenerative diseases and mutations in the genes involved in cancer.
17. Utilisation du procédé selon l'une des revendications 1 à 10 et du kit selon l'une des revendications 11 à 16 pour l'étude du polymorphisme des gènes ou de toute région génétique.17. Use of the method according to one of claims 1 to 10 and of the kit according to one of claims 11 to 16 for the study of the polymorphism of genes or of any genetic region.
18. Utilisation du procédé selon l'une des revendications 1 à 10 et du kit selon l'une des revendications 11 à 16 pour la détection et/ou à l'identification d'organismes génétiquement modifiés (OGM). 18. Use of the method according to one of claims 1 to 10 and of the kit according to one of claims 11 to 16 for the detection and / or identification of genetically modified organisms (GMOs).
EP01963075A 2000-08-08 2001-08-08 Method for detecting known mutations in tube Withdrawn EP1409719A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
FR0010425A FR2812885A1 (en) 2000-08-08 2000-08-08 METHOD OF DETECTING MUTATIONS KNOWN IN TUBE
FR0010425 2000-08-08
PCT/FR2001/002574 WO2002012557A1 (en) 2000-08-08 2001-08-08 Method for detecting known mutations in tube

Publications (1)

Publication Number Publication Date
EP1409719A1 true EP1409719A1 (en) 2004-04-21

Family

ID=8853392

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01963075A Withdrawn EP1409719A1 (en) 2000-08-08 2001-08-08 Method for detecting known mutations in tube

Country Status (5)

Country Link
US (1) US20040076969A1 (en)
EP (1) EP1409719A1 (en)
AU (1) AU2001284121A1 (en)
FR (1) FR2812885A1 (en)
WO (1) WO2002012557A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111647953A (en) * 2020-07-09 2020-09-11 广州赛乐斯密医学科技有限公司 High-throughput library construction kit and library construction method for detecting thalassemia gene mutation

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB8311018D0 (en) * 1983-04-22 1983-05-25 Amersham Int Plc Detecting mutations in dna
US5762876A (en) * 1991-03-05 1998-06-09 Molecular Tool, Inc. Automatic genotype determination
US5700642A (en) * 1995-05-22 1997-12-23 Sri International Oligonucleotide sizing using immobilized cleavable primers

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0212557A1 *

Also Published As

Publication number Publication date
US20040076969A1 (en) 2004-04-22
FR2812885A1 (en) 2002-02-15
AU2001284121A1 (en) 2002-02-18
WO2002012557A1 (en) 2002-02-14

Similar Documents

Publication Publication Date Title
AU2008217678B2 (en) Method and test kit for determining the amounts of target sequences and nucleotide variations therein
Chen et al. Template-directed dye-terminator incorporation (TDI) assay: a homogeneous DNA diagnostic method based on fluorescence resonance energy transfer
US5948899A (en) Compositions for homogenous protection assay
CA2401867A1 (en) Novel dna chips
US5837465A (en) Luciferase labelling method
FR2710075A1 (en) Reagent and method for the detection of a nucleotide sequence with signal amplification
US20050287549A1 (en) Method of genetic testing
EP0827552B1 (en) Nucleotide sequence detection with signal amplification
Lim et al. Detection of Atrazine Based on the SPR Determination of P450 mRNA Levels in Saccharomyces c erevisiae
EP0362042B1 (en) Method for the analysis of a specific sequence of dna or rna, reagents and kits therefor
EP1409719A1 (en) Method for detecting known mutations in tube
CN101292045A (en) Method of analyzing nucleic acid
EP1334211B1 (en) Method for analysing a patient&#39;s predisposition to insulin-dependent diabetes, device and set of primers
CA2211666A1 (en) Method for detecting nucleic acid sequence variations
EP0910667A1 (en) Nucleotide probes and method for determining hla dqb1 typing
CA2175515A1 (en) Corynebacterium 16s ribosomal rna nucleotidic fragment, derived probes and primers, reactant and detection process
JP2003522527A (en) Single nucleotide polymorphism detection
EP0739421B1 (en) Hydridisation assay
WO2017042509A1 (en) Method and device for snp genotyping
EP0353124A1 (en) Process for labelling a nucleic-acid probe and set of reagents for carrying out the process
EP1330542A2 (en) Fast method for detecting organisms in a sample
FR2920159A1 (en) Identifying, analyzing and/or quantifying alleles of polymorphisms in nucleic acid sample, comprises amplifying double strand of nucleic acid sequence, eliminating heteroduplexes, hybridizing products, and determining and comparing signal
JP2006141301A (en) Method for detecting genetic polymorphism

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20030324

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20050302