EP1373575A2 - Procede de detection d'arnm de papillomavirus humain - Google Patents

Procede de detection d'arnm de papillomavirus humain

Info

Publication number
EP1373575A2
EP1373575A2 EP01949793A EP01949793A EP1373575A2 EP 1373575 A2 EP1373575 A2 EP 1373575A2 EP 01949793 A EP01949793 A EP 01949793A EP 01949793 A EP01949793 A EP 01949793A EP 1373575 A2 EP1373575 A2 EP 1373575A2
Authority
EP
European Patent Office
Prior art keywords
seq
type
oligonucleotide
primer
combination
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01949793A
Other languages
German (de)
English (en)
Inventor
Frank Karlsen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Norchip AS
Original Assignee
Norchip AS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Norchip AS filed Critical Norchip AS
Publication of EP1373575A2 publication Critical patent/EP1373575A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C12Q1/708—Specific hybridization probes for papilloma
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms

Definitions

  • the present invention is concerned with methods 5 of detecting the presence of human papillomavirus mRNA in clinical samples using nucleic acid sequence-based amplification and in particular with sets of degenerate oligonucleotide primers for use in such methods .
  • HPV human papillomavirus
  • E7 protein is multifunctional and enhances the degradation of retinoblastoma gene products (Boyer et al., 1996) and the E6 proteins accelerate in vitro degradation of P53
  • E6 and E7 proteins are oncogenic, not only because of the degradation of p53, RB and other tumour suppressor proteins, but also because of their influence on cell cycle control mediators p21, p27, E2F (transcription factor) and PCNA (proliferating cell nuclear antigen) .
  • HPV types 16, 18 and 33 are often found integrated into chromosomes of cancerous cervical cells, and this integration has been postulated to result in increased levels of stabilities of gene E6 and E7 expression.
  • HPV type 16 DNA integration correlates with increased levels of expression of the viral E7 protein and with a selective growth advantage over cells harbouring extrachromosomal HPV16 DNA.
  • HPV-negative cervical cancers is now debatable; zur Hausen and de Villiers have argued that if they do exist, their incidence should be low.
  • HPV detection is often carried out in the presence of vast quantities of host nucleic acids and cells not infected with the virus, the ability of the primers to be virus specific is critical for a sensitive and specific amplification.
  • NASBA Nucleic acid sequence-based amplification
  • RNA Compton, Nature. 350: 91-92 (1991)
  • NASBA is well known by persons of ordinary skill in the art and is described, for example, in US-A-5, 409, 818.
  • NASBA is an effective procedure for generating large quantities of a target RNA sequence in vitro, allowing detection of target RNA sequences that are present in very low concentrations in the original test sample.
  • the NASBA method is based on the same type of primer-sets as for PCR but one primer is modified with a promotor sequence, for example a T7 promoter.
  • NASBA sensitivity and specificity of the NASBA amplification has been shown to be the same as for PCR and better then most RT-PCR protocols. Since the NASBA method is an isothermal assay and it is dependent on RNase H it cannot amplify DNA. This is important in connection with detection of mRNA expression from the HPV genome where the RT-PCR method would amplify both the RNA and DNA. There is extensive literature on the use of NASBA for the detection of HIV-1 in clinical samples (see for example Kievits et al . , Journal of Virological Methods. 35: 273-286 (1991)).
  • the present inventors have now applied the NASBA technique to the detection of human papillomavirus (HPV) in test samples.
  • HPV human papillomavirus
  • the invention provides oligonucleotides, more particularly degenerate oligonucleotides, which may be used for the detection of specific combinations of HPV types.
  • the invention provides an oligonucleotide for use in detecting the presence of human papilloma virus type 16, type 31, type 35 or a combination thereof in a test sample, said oligonucleotide being selected from the group consisting of:
  • oligonucleotides comprising one of the following nucleotide sequences:
  • X x represents a nucleotide sequence comprising a promoter
  • Primer 2 oligonucleotides 5' CCRYTGTGTCCWGWWGAA [SEQ ID NO : 4 ] 5' TGCRTGGAGAWAYAMCTA [SEQ ID NO: 5] 5' TATRTKTTAGATTTGSAACC [SEQ ID NO: 6]
  • Probe oligonucleotides 5' TGTAAWCATGCRTGGAGAWA [SEQ ID NO: 7] 5' GAAACCSARSTGTAAWCATG [SEQ ID NO: 8] 5' CATGCRTGGAGAWAYAMCTA [SEQ ID NO: 9] 5' GACAGCTCAGAKGAGGAGGA [SEQ ID NO: 10] 5' CAACTGAYCTMYACTGTTATGA [SEQ ID NO: 11] 5' CAACTGAYCTMYACTGTTATGAGCAATT [SEQ ID NO: 12]
  • oligonucleotides comprising one of the following structures :
  • X 2 and X 3 represent a fluorescent moiety and a quencher moiety capable of substantially or completely quenching the fluorescence from the fluorescent moiety when the two are held together in close proximity.
  • the invention provides an oligonucleotide for use in detecting the presence of human papilloma virus type 52, type 58, type 67 or a combination thereof in a test sample, said oligonucleotide being selected from the group consisting of:
  • oligonucleotides comprising one of the following nucleotide sequences:
  • X ⁇ represents a nucleotide sequence comprising a promoter
  • X 2 and X 3 represent a fluorescent moiety and a quencher moiety capable of substantially or completely quenching the fluorescence from the fluorescent moiety when the two are held together in close proximity.
  • the invention provides an oligonucleotide for use in detecting the presence of human papilloma virus type 33, type 58 or a combination thereof in a test sample, said oligonucleotide being selected from the group consisting of:
  • oligonucleotides comprising one of the following nucleotide sequences:
  • X l represents a nucleotide sequence comprising a promoter
  • Molecular beacon' probes 5' X 2 -CCAAGCGCCAGATGGACAAGCACAAGCTTGG ⁇ X 3 [SEQ ID NO: 30] 5' X 2 -CCGAGCGCCAGATGGACAAGCACAAGCTCGG-X 3 [SEQ ID NO: 31] wherein X 2 and X 3 represent a fluorescent moiety and a quencher moiety capable of substantially or completely quenching the fluorescence from the fluorescent moiety when the two are held together in close proximity.
  • the invention provides an oligonucleotide for use in detecting the presence of human papilloma virus type 18, type 45 or a combination thereof in a test sample, said oligonucleotide being selected from the group consisting of:
  • oligonucleotides comprising one of the following nucleotide sequences:
  • Primer 1 oligonucleotides 5' Xi-AGCTCAATTCTGSCKTCA [SEQ ID NO: 32] 5' Xj-ACGGACACACAAAGGACA [SEQ ID NO: 33] 5' Xi-GCACACCACGGACACACA [SEQ ID NO: 34] wherein X x represents a nucleotide sequence comprising a promoter,
  • Primer 2 oligonucleotides 5' ACGAGCAATTAAGCGAST [SEQ ID NO: 35] 5' CCGACGAGCCGAACCACA [SEQ ID NO: 36]
  • oligonucleotides having the following structure: 5' X 2 -CCAAGCAGCCCGACGAGCCGAACCACAGCTTGG-X 3 [SEQ ID NO:39] wherein X 2 and X 3 represent a fluorescent moiety and a quencher moiety capable of substantially or completely quenching the fluorescence from the fluorescent moiety when the two are held together in close proximity.
  • the oligonucleotide molecules of the invention are preferably single stranded DNA molecules .
  • Non- natural synthetic polynucleotides which retain the ability to base-pair with a complementary nucleic acid molecule and are able to function in the NASBA reaction are also within the scope of the invention, including synthetic oligonucleotides which incorporate modified bases and synthetic oligonucleotides wherein the links between individual nucleosides include bonds other than phosphodiester bonds.
  • the oligonucleotide molecules of the invention may be produced according to techniques well known in the art, such as by chemical synthesis using standard apparatus and protocols for oligonucleotide synthesis. Representations of the sequences of degenerate oligonucleotide molecules provided herein use the standard IUB code for mixed base sites:
  • the oligonucleotide molecules of the invention are selected to be specific for mRNA transcribed from the HPV E6 or E7 genes, expression of which is associated with cervical cytological abnormalities which often progress to more serious disease.
  • a number of studies relate the expression of the E6 and E7 genes to oncogenesis. Co-operation between E6 and E7 increases significantly the frequency of immortalization.
  • Evidence has been presented that the E6 and E7 open reading frames are involved in the transforming activity of the virus (Tanaka et al . , J. Virol. 63: 1465-1469, 1989).
  • the oligonucleotide molecules provided by the invention fall into four groups.
  • Primer 1 (PI) oligonucleotide molecules are generally approximately 50 bases in length, with an average of about 20 bases at the 3' end that are complementary to a region of the target HPV mRNA. One or more of the bases in the 3' end region are degenerate, and this degeneracy results in specificity for two or more HPV types.
  • the 5' ends of the primer 1 oligonucleotides (represented herein in general terms as X ⁇ ) comprise a promoter sequence that is recognized by a specific RNA polymerase.
  • Bacteriophage promoters for example the T7, T3 and SP6 promoters, are preferred for use in the oligonucleotides of the invention, since they provide advantages of high level transcription which is dependent only on binding of the appropriate RNA polymerase.
  • the 5' terminal sequence of the primer 1 oligonucleotides may comprise the sequence AATTCTAATACGACTCACTATAGGG [SEQ ID NO: 40] or the sequence AATTCTAATACGACTCACTATAGGGAGAAGG [SEQ ID NO: 62]. These sequences contain a T7 promoter, including the transcription initiation site for T7 RNA polymerase.
  • the primer 2 (P2) oligonucleotides generally comprise a sequence of approximately 20 bases substantially identical to a region of the target HPV mRNA. As with the primer 1 oligonucleotides one or more of the bases in this sequence are degenerate, resulting in specificity for two or more HPV types.
  • the primer 2 oligonucleotides may, in a particular but non-limiting embodiment, further comprise a sequence of nucleotides at the 5' end which is unrelated to HPV but which is capable of hybridising to a generic detection probe.
  • the detection probe will preferably be labelled, for example with a fluorescent, luminescent or enzymatic label.
  • the detection probe is labelled with a label that permits detection using ECLTM technology, although it will be appreciated that the invention is in no way limited to this particular method of detection.
  • the 5' end of the primer 2 oligonucleotides may comprise the sequence GATGCAAGGTCGCATATGAG [SEQ ID NO: 41]. This sequence is capable of hybridising to a generic ECLTM probe commercially available from Organon Teknika having the following structure:
  • the primer 2 oligonucleotide may incorporate ⁇ molecular beacons' technology, which is known in the art and described, for example, in WO 95/13399 by Tyagi and Kramer, Nature Biotechnology. 14: 303-308, 1996, to allow for real-time monitoring of the NASBA reaction.
  • the third type of oligonucleotide molecules provided by the invention are HPV-specific probe oligonucleotides.
  • the probe oligonucleotides generally comprise a sequence of approximately 20-25 bases substantially identical to a region of the target HPV mRNA. One or more of the bases in this sequence may be degenerate, resulting in a probe mix which has specificity for two or more HPV types.
  • the probe oligonucleotides may be used as HPV-specific hybridisation probes for detection of the products of a NASBA reaction. In this connection the probe oligonucleotides may be coupled to a solid support, such as paramagnetic beads, to form a capture probe (see below) .
  • the 5' end of the probe oligonucleotide may be labelled with biotin.
  • a biotin label facilitates attachment of the probe to a solid support via a biotin/streptavidin or biotin/avidin linkage.
  • the fourth type of oligonucleotide molecules provided by the invention are HPV-specific probes incorporating molecular beacons' technology which is known in the art and described, for example, by Tyagi and Kramer, Nature Biotechnology. 14: 303-308, 1996 and in WO 95/13399. The use of molecular beacons technology allows for real-time monitoring of the NASBA reaction.
  • the molecular beacons primers generally include, in addition to a HPV-specific sequence including one or more degenerate bases, additional bases which allow formation of a hairpin loop structure, a fluorescent moiety and a quencher moiety, the fluorescent and the quencher moieties being represented herein by the notation X 2 and X 3 .
  • the fluorescer and quencher moieties are selected such that the quencher moiety is capable of substantially or completely quenching the fluorescence from the fluorescent moiety when the two moieties are in close proximity, e.g. when the probe is in the hairpin closed' conformation in the absence of the target sequence.
  • Suitable pairs of quencher/fluorescer moieties which may be used in accordance with the invention are known in the art (see WO 95/13399, Tyagi and Kramer, ibid) .
  • Preferred combinations include the fluorophore 5-(2'- aminoethyl) aminonaphthalene-1-sulphonic acid (EDANS) and the quencher 4- (4 ' -dimethylaminophenylazo) benzoic acid (DABCYL) , although it will be appreciated that the invention is not limited to this particular combination.
  • the fluorescer and quencher moieties may be covalently attached to the probe in either orientation, either with the fluorescer at or near the 5' end and the quencher at or near the 3' end or vice versa.
  • the oligonucleotide molecules of the invention may be used in the detection of HPV mRNA by NASBA.
  • suitable combinations of primer 1 and primer 2 oligonucleotide molecules may be used to drive a NASBA amplification reaction.
  • the primer 1 and primer 2 oligonucleotides In order to drive a NASBA amplification reaction the primer 1 and primer 2 oligonucleotides must be capable of priming synthesis of a double-stranded DNA from a target region of mRNA, specifically HPV E6-E7 mRNA. For this to occur the primer 1 and primer 2 oligonucleotides must comprise HPV-specific sequences which are complementary to regions of the sense and the antisense strand of the target mRNA, respectively.
  • the primer 1 oligonucleotide anneals to a complementary sequence in the target mRNA and its 3' end is extended by the action of an RNA-dependent DNA polymerase (e.g. reverse transcriptase) to form a first-strand cDNA synthesis.
  • an RNA-dependent DNA polymerase e.g. reverse transcriptase
  • the RNA strand of the resulting RNA: DNA hybrid is then digested, e.g. by the action of RnaseH, to leave a single stranded DNA.
  • the primer 2 oligonucleotide anneals to a complementary sequence towards the 3' end of this single stranded DNA and its 3' end is extended (by the action of reverse transcriptase) , forming a double stranded DNA.
  • RNA polymerase is then able to transcribe multiple RNA copies from the now transcriptionally active promoter sequence within the double-stranded DNA.
  • This RNA transcript which is antisense to the original target mRNA, can act as a template for a further round of NASBA reactions, with primer 2 annealing to the RNA and priming synthesis of the first cDNA strand and primer 1 priming synthesis of the second cDNA strand.
  • the general principles of the NASBA reaction are well known in the art (see Compton, J. Nature. 350: 91-92).
  • the HPV-specific probe oligonucleotides described herein may also be attached to a solid support, such as magnetic microbeads, and used as ⁇ capture probes' to immobilise the product of the NASBA amplification reaction (a single stranded RNA) .
  • the HPV-specific ⁇ molecular beacons' probes described herein may be used for real-time monitoring of the NASBA reaction (see Leone et al . , Nucleic Acids Research., 1998, vol : 26, pp 2150-2155) .
  • Oligonucleotides for the detection of HPV 16, 31, 35 Primer 1 oligonucleotides
  • Probe oligonucleotides HPV AP02A 5 ' TGTAAWCATGCRTGGAGAWA [SEQ ID NO: 7]
  • HPV APOIB 5 CAACTGAYCTMYACTGTTATGAGCAATT [SEQ ID NO: 12]
  • Oligonucleotides for the detection of HPV 52, 58, 67 Primer 1 oligonucleotides:
  • TGTKCA HPV BP2A-2 5 ' GATGCAAGGTCGCATATGAGTGTKCAGWGTGT TGGAGA [SEQ ID NO: 51]
  • Oligonucleotides for the detection of HPV 33, 58 Primer 1 oligonucleotides:
  • WCTGCTA [SEQ ID NO: 54] HPV BP1A-2 5 ' GATGCAAGGTCGCATATGAGATCCTGAACCAA
  • Oligonucleotides for the detection of HPV 18,45 Primer 1 oligonucleotides:
  • HPVCPl-1 5 AATTCTAATACGACTCACTATAGGGAGAAGGA GCTCAATTCTGSCKTCA [SEQ ID NO: 56]
  • HPVCP3-2 5 GATGCAAGGTCGCATATGAGCCGACGAGCCGA
  • Probe oligonucleotides HPVCPOl 5 'AGCCCGACGAGCCGAACCACA [SEQ ID NO: 37] HPVCP03 5 ' GTTGTAAGTGTGAMGSCAGAATT [SEQ ID NO:38] Cocktails of primer-sets and probes comprising certain combinations of the oligonucleotide molecules of the invention are also the subject of the present invention, these primer cocktails being useful for the detection of various combinations of two or more HPV types by NASBA.
  • the invention provides a first primer cocktail which is suitable for use in detecting the presence of human papilloma virus type 16, type 31, type 35 or a combination thereof in a test sample, the primer cocktail comprising a combination of oligonucleotide molecules having the following nucleotide sequences:
  • X x represents a nucleotide sequence comprising a promoter
  • GWWGAA [SEQ ID NO: 45] HPV AP1-1 5 'AATTCTAATACGACTCACTATAGGGAGAAGGT
  • the invention also provides a primer cocktail/probe mixture comprising the first primer cocktail according to the invention and a mixture of probe oligonucleotide molecules having the following nucleotide sequences:
  • the invention still further provides a primer cocktail/probe mixture comprising the first primer cocktail according to the invention and a mixture of molecular beacon probe oligonucleotides having the following structures:
  • X 2 and X 3 represent a fluorescent moiety and a quencher moiety capable of substantially or completely quenching the fluorescence from the fluorescent moiety when the two are held together in close proximity.
  • the invention also provides a second primer cocktail which is suitable for use in detecting the presence of human papilloma virus type 52, type 58, type 67 or a combination thereof in a test sample, the primer cocktail comprising the following combination of oligonucleotide molecules:
  • the invention also provides a primer cocktail/probe mixture comprising a second primer cocktail according to the invention and a mixture of probe oligonucleotide molecules having the following sequences:
  • the invention further provides a primer cocktail/probe mixture comprising a second primer cocktail according to the invention and a mixture of molecular beacon probe oligonucleotides having the following structures:
  • X 2 and X 3 represent a fluorescent moiety and a quencher moiety capable of substantially or completely quenching the fluorescence from the fluorescent moiety when the two are held together in close proximity.
  • the invention also provides a third primer cocktail for use in detecting the presence of human papilloma virus type 33, type 58 or a combination thereof in a test sample, the primer cocktail comprising the following combination of oligonucleotides :
  • X x represents a nucleotide sequence comprising a promoter
  • the invention also provides a primer cocktail/probe mixture comprising a third primer cocktail according to the invention and a mixture of probe oligonucleotide molecules having the following sequences:
  • the invention also provides a primer cocktail/probe mixture comprising a third primer cocktail according to the invention and a mixture of molecular beacon probe oligonucleotide molecules having the following structures:
  • X 2 and X 3 represent a fluorescent moiety and a quencher moiety capable of substantially or completely quenching the fluorescence from the fluorescent moiety when the two are held together in close proximity.
  • the invention still further provides a fourth primer cocktail for use in detecting the presence of human papilloma virus type 18, type 45 or a combination thereof in a test sample, the primer cocktail comprising the following combination of oligonucleotides :
  • X x represents a nucleotide sequence comprising a promoter
  • HPVCPl-1 5 'AATTCTAATACGACTCACTATAGGGAGAAGGA GCTCAATTCTGSCKTCA [SEQ ID NO: 56]
  • GCGAST [SEQ ID NO: 59] HPVCP2-1 5 'AATTCTAATACGACTCACTATAGGGAGAAGGA
  • GCGAST [SEQ ID NO: 60] HPVCP3-1 5 'AATTCTAATACGACTCACTATAGGGAGAAGGG
  • the invention provides a primer cocktail/probe mixture comprising a fourth primer cocktail according to the invention and a mixture of probe oligonucleotide molecules having the following sequences:
  • the invention also provides a primer cocktail/probe mixture comprising a fourth primer cocktail according to the invention and a molecular beacon probe oligonucleotide molecule having the following structure:
  • X 2 and X 3 represent a fluorescent moiety and a quencher moiety capable of substantially or completely quenching the fluorescence from the fluorescent moiety when the two are held together in close proximity.
  • the primer cocktails provided by the invention are mixtures of degenerate primer 1 and primer 2 oligonucleotides which collectively have specificity for two or more defined HPV types.
  • the primer cocktails may be used to amplify HPV mRNA in a test sample by nulceic acid sequence-based amplification under standard NASBA conditions which are well known in the art.
  • the primer cocktail/probe mixtures additionally contain degenerate probe oligonucleotides having specificity for the same HPV types.
  • the mixtures of primer cocktails and molecular beacon probes may be used to detect HPV mRNA by real-time NASBA.
  • primer cocktails and primer cocktail/probe mixtures may be supplied in the form of a solution in an appropriate buffer or they may be supplied in lyophilised or dried form and then reconstituted prior to use by the addition of a suitable buffer.
  • kits of reagents for HPV detection may be included in kits of reagents for HPV detection, as described below.
  • the primer cocktails of the invention allow simultaneous detection of combinations of two or more HPV types in a single NASBA reaction.
  • the inventors' proposal of different cocktails of degenerate primer-sets that may be used to amplify transcripts from the E6 and E7 oncogenes, and in particular the ability to simultaneously detect several HPV types, represents a novel approach to the problem of detecting HPV transcripts that provides certain advantages over the prior art methods of HPV detection, both in terms sensitivity and specificity and automation of large scale screening/detection programs .
  • a novel aspect of the inventors' approach is the simultaneous detection of combinations of HPV types.
  • the combination is possible due to the similarity of the different HPV types.
  • a system that includes 13 different marker units is very difficult to automate on a large scale.
  • With the use of the degenerate primer cocktails provided by the invention it is possible to screen for HPV types 16, 31, 35, 52, 58, 67, 33, 18 and 45 simultaneously using only 4 different marker units. This system is much more useful for robotic based diagnostics on a large number of patient samples .
  • the invention further provides individual primer sets, i.e. pairs of primer 1 and primer 2 oligonucleotides, and also primer set/probe mixtures all of which may be used for the detection of HPV by NASBA. Therefore, in a further aspect the invention provides three different oligonucleotide primer sets for use in the detection of HPV type 16, type 31, type 35 or a combination thereof in a test sample, as follows :
  • Primer set 1 comprising a first oligonucleotide primer comprising the sequence 5' X ⁇ AGRTCAGTTGYCTCDGGT [SEQ ID NO:l], wherein X ⁇ represents a nucleotide sequence comprising a promoter, and a second oliogonucleotide primer comprising the sequence 5' CCRYTGTGTCCWGWWGAA [SEQ ID N0:4] .
  • Primer set 2 comprising a first oligonucleotide primer comprising the sequence 5' X ⁇ TCYGGTTYTGCTTGTCCA [SEQ ID NO: 2], wherein X x represents a nucleotide sequence comprising a promoter, and a second oliogonucleotide primer comprising the sequence 5' TGCRTGGAGAWAYAMCTA [SEQ ID NO:5] .
  • Primer set 3 comprising a first oligonucleotide primer comprising the sequence 5' Xj-TGTGTGCTYTGTACRCACAR [SEQ ID NO: 3], wherein X x represents a nucleotide sequence comprising a promoter, and a second oliogonucleotide primer comprising the sequence 5' TATRTKTTAGATTTGSAACC [SEQ ID NO: 6].
  • X x preferably represents a nucleotide sequence comprising a T7 promoter, and even more preferably represents the nucleotide sequence AATTCTAATACGACTCACTATAGGGAGAAGG [SEQ ID NO: 62].
  • the invention still further provides two different probe/primer mixtures for use in the detection of HPV type 16, type 31, type 35 or a combination thereof in a test sample, as follows:
  • Probe primer mixture 1 comprising oligonucleotide primer set 1 as defined above and at least one oligonucleotide probe comprising a nucleotide sequence selected from the group consisting of:
  • Probe/primer mixture 2 comprising oligonucleotide primer set 2 or 3, as defined above and at least one oligonucleotide probe selected from the group consisting of: oligonucleotide probes comprising one of the following nucleotide sequences:
  • oligonucleotide probes having one of the following structures :
  • X 2 and X 3 represent a fluorescent moiety and a quencher moiety capable of substantially or completely quenching the fluorescence from the fluorescent moiety when the two are held together in close proximity.
  • the invention provides two different oligonucleotide primer sets for use in the detection of HPV type 52, type 58 or type 67 or a combination thereof in a test sample, as follows:
  • Primer set 4 comprising a first oligonucleotide primer comprising the sequence 5' X- L -TCCTCRTCTGAGCTGTCA [SEQ ID NO: 16], wherein X x represents a nucleotide sequence comprising a promoter, and a second oliogonucleotide primer comprising the sequence 5 ' TGGACAGGRCGSTGTKCA [SEQ ID NO: 18] .
  • Primer set 5 comprising a first oligonucleotide primer comprising the sequence 5' X ⁇ TGCTTGTCCATCTGGCCGGT [SEQ ID NO:17], wherein X x represents a nucleotide sequence comprising a promoter, and a second oliogonucleotide primer comprising the sequence 5' TGTKCAGWGTGTTGGAGA [SEQ ID NO: 19].
  • X x preferably represents a nucleotide sequence comprising a T7 promoter, and even more preferably represents the nucleotide sequence AATTCTAATACGACTCACTATAGGGAGAAGG [SEQ ID NO: 62].
  • the invention further provides a probe/primer mixture for use in the detection of HPV type 52, type 58, type 67 or a combination thereof in a test sample, as follows:
  • Probe/primer mixture 3 comprising oligonucleotide primer set 4 or 5, as defined above, and at least one oligonucleotide probe selected from the group consisting of:
  • oligonucleotide probes comprising one of the following nucleotide sequences:
  • oligonucleotide probes having one of the following structures :
  • X 2 and X 3 represent a fluorescent moiety and a quencher moiety capable of substantially or completely quenching the fluorescence from the fluorescent moiety when the two are held together in close proximity.
  • the invention provides two oligonucleotide primer sets for use in the detection of HPV type 33, type 58 or a combination thereof in a test sample, as follows:
  • Primer set 6 comprising a first oligonucleotide primer comprising the sequence 5' Xj-CAAGTGTRACAACARGTTA [SEQ ID NO:24], wherein X x represents a nucleotide sequence comprising a promoter, and a second oliogonucleotide primer comprising the sequence 5' CAACTGACCTATWCTGCTA [SEQ ID NO:26] .
  • Primer set 7 comprising a first oligonucleotide primer comprising the sequence 5' Xi-GCACAGSTAGGGCACACAA [SEQ ID NO:25], wherein X ⁇ represents a nucleotide sequence comprising a promoter, and a second oliogonucleotide primer comprising the sequence 5 'ATCCTGAACCAACTGACCTA [SEQ ID NO:27] .
  • X x preferably represents a nucleotide sequence comprising a T7 promoter, and even more preferably represents the nucleotide sequence AATTCTAATACGACTCACTATAGGGAGAAGG [SEQ ID NO: 62].
  • the invention further provides a probe/primer mixture for use in the detection of HPV type 33, type 58 or a combination thereof in a test sample, as follows :
  • Probe/primer mixture 4 comprising oligonucleotide primer set 6 or 7, as defined above, and at least one oligonucleotide probe selected from the group consisting of:
  • oligonucleotide probes comprising one of the following nucleotide sequences:
  • oligonucleotide probes having one of the following structures :
  • X 2 and X 3 represent a fluorescent moiety and a quencher moiety capable of substantially or completely quenching the fluorescence from the fluorescent moiety when the two are held together in close proximity.
  • the invention provides three different oligonucleotide primer sets for use in the detection of HPV type 45, type 18 or a combination thereof in a test sample, as follows:
  • Primer set 8 comprising a first oligonucleotide primer comprising the sequence 5' Xi-AGCTCAATTCTGSCKTCA [SEQ ID NO: 32], wherein X ⁇ represents a nucleotide sequence comprising a promoter, and a second oliogonucleotide primer comprising the sequence 5 ' ACGAGCAATTAAGCGAST [SEQ ID NO:35] .
  • Primer set 9 comprising a first oligonucleotide primer comprising the sequence 5' X ⁇ ACGGACACACAAAGGACA [SEQ ID NO:33], wherein X x represents a nucleotide sequence comprising a promoter, and a second oliogonucleotide primer comprising the sequence 5 ' ACGAGCAATTAAGCGAST [SEQ ID NO: 35] .
  • Primer set 10 comprising a first oligonucleotide primer comprising the sequence
  • X ⁇ represents a nucleotide sequence comprising a promoter, and a second oliogonucleotide primer comprising the sequence 5' CCGACGAGCCGAACCACA [SEQ ID NO:36] .
  • X x preferably represents a nucleotide sequence comprising a T7 promoter, and even more preferably represents the nucleotide sequence AATTCTAATACGACTCACTATAGGGAGAAGG [SEQ ID NO: 62].
  • the invention still further provides two different probe/primer mixtures for use in the detection of HPV type 45, type 18 or a combination thereof in a test sample, as follows:
  • Probe/primer mixture 5 comprising oligonucleotide primer set 8, as defined above, and at least one of: an oligonucleotide probe comprising the nucleotide sequence 5' AGCCCGACGAGCCGAACCACA [SEQ ID NO: 37] or an oligonucleotide probe having the structure 5' X 2 -CCAAGCAGCCCGACGAGCCGAACCACAGCTTGG-X 3 [SEQ ID NO: 37] or an oligonucleotide probe having the structure 5' X 2 -CCAAGCAGCCCGACGAGCCGAACCACAGCTTGG-X 3 [SEQ ID NO: 37] or an oligonucleotide probe having the structure 5' X 2 -CCAAGCAGCCCGACGAGCCGAACCACAGCTTGG-X 3 [SEQ ID NO: 37] or an oligonucleotide probe having the structure 5' X 2 -CCAAGCAGCCCGACGAGCCGAACCACAGCTTGG-X 3 [S
  • X 2 and X 3 represent a fluorescent moiety and a quencher moiety capable of substantially or completely quenching the fluorescence from the fluorescent moiety when the two are held together in close proximity.
  • Probe/primer mixture 6 comprising oligonucleotide primer set 9 or 10, as defined above, and at least one of: an oligonucleotide probe comprising the nucleotide sequence 5' GTTGTAAGTGTGAMGSCAGAATT [SEQ ID NO: 38] an oligonucleotide probe having the structure 5' X 2 -CCAAGCAGCCCGACGAGCCGAACCACAGCTTGG-X 3 [SEQ ID NO: 39] wherein X 2 and X 3 represent a fluorescent moiety and a quencher moiety capable of substantially or completely quenching the fluorescence from the fluorescent moiety when the two are held together in close proximity.
  • the primer sets and probe/primer mixtures may also be supplied in the form of a solution in an appropriate buffer or in a lyophilised or dried form which may be reconstituted prior to use by the addition of a suitable buffer.
  • they may be included in kits of reagents for HPV detection, as described below.
  • kits for use in the detection of HPV by NASBA comprising one or more oligonucleotide primer cocktails or primer sets acccording to the invention.
  • the reagent kits may further comprise a mixture of enzymes required for the NASBA reaction, specifically an enzyme mixture containing an RNA directed DNA polymerase (e.g. a reverse transcriptase) , a ribpnuclease that hydrolyses the RNA strand of an RNA- DNA hybrid without hydrolysing single or double stranded RNA or DNA (e.g. RNaseH) and an RNA polymerase.
  • the RNA polymerase should be one which recognises the promoter sequence present in the 5' terminal region of the primer 1 oligonucleotides in the oligonucleotide primer cocktails or primer sets supplied in the reagent kit.
  • the kit may also comprise a supply of NASBA buffer containing the ribonucleosides and deoxyribonucleosides required for RNA and DNA synthesis. Details of the composition of a standard NASBA reaction buffer are given in the accompanying examples.
  • the kit may further contain one or more capture probes, comprising a probe oligonucleotide attached to a solid support as described above, for immobilising the products of a specific NASBA reaction.
  • the kit may still further contain labelled generic detection probes.
  • the detection probes may comprise a sequence of nucleotides complementary to a non-HPV sequence present at the 5' terminal end of the primer 2 oligonucleotides present in the reagent kit.
  • the kit may further contain one or more molecular beacon probes according to the invention.
  • the molecular beacon probes may be supplied as a seperate reagent within the kit or may be supplied in a primer cocktail/probe or primer set/probe mixture.
  • the invention provides methods for the detection of HPV in test samples using the NASBA technique. These methods generally comprise the following steps:
  • RNA directed DNA polymerase a ribonuclease that hydrolyses the RNA strand of an RNA- DNA hybrid without hydrolysing single or double stranded RNA or DNA
  • an RNA polymerase that recognises said promoter
  • ribonucleoside and deoxyribonucleoside triphosphates a reaction medium comprising a primer cocktail or a primer set according to the invention, an RNA directed DNA polymerase, a ribonuclease that hydrolyses the RNA strand of an RNA- DNA hybrid without hydrolysing single or double stranded RNA or DNA, an RNA polymerase that recognises said promoter, and ribonucleoside and deoxyribonucleoside triphosphates ;
  • the ⁇ test sample suspected of containing HPV will most commonly be a clinical sample, for example a cervical scraping in the cervical screening field.
  • the NASBA reaction will preferably be carried out on a preparation of nucleic acid isolated from the test sample.
  • This preparation of nucleic acid must include mRNA, however it need not be a preparation of purified poly A+ mRNA and preparations of total RNA or even preparations of total nucleic acid containing both RNA and genomic DNA are also suitable as starting material for a NASBA reaction.
  • any technique known in the art for the isolation of a preparation of nucleic acid including mRNA may be used to isolate nucleic acid from the test sample.
  • a preferred technique is the "Boom" isolation method described in US-A-5, 234, 809 and EP-B-0389, 063.
  • This method which can be used to isolate a nucleic acid preparation containing both RNA and DNA, is based on the nucleic acid binding properties of silicon dioxide particles in the presence of the chaotropic agent guanidine thiocyanate (GuSCN) .
  • Detection of the specific product (s) of the NASBA reaction i.e. sense and/or antisense copies of the target RNA may be carried out in a number of different ways. In one approach the NASBA product (s) may be detected with the use of an HPV-specific hybridisation probe capable of specifically annealing to the NASBA product.
  • the hybridisation probe may be attached to a revealing label, for example a fluorescent, luminescent, radioactive or chemiluminescent compound or an enzyme label or any other type of label known to those of ordinary skill in the art.
  • a revealing label for example a fluorescent, luminescent, radioactive or chemiluminescent compound or an enzyme label or any other type of label known to those of ordinary skill in the art.
  • the precise nature of the label is not critical, but it should be capable of producing a signal detectable by external means, either by itself or in co juction with one or more additional substances (e.g. the substrate for an enzyme).
  • ⁇ eal-time NASBA' which allows continuous monitoring of the formation of the product of the NASBA reaction over the course of the reaction.
  • This may be achieved using a ⁇ molecular beacons' probe comprising an HPV-specific sequence capable of annealing to the NASBA product, a hairpin forming oligonucleotide sequence and a pair of fluorescer/quencher moieties, as described in WO 95/13399. If the molecular beacons probe is added to the reaction mixture prior to amplification it may be possible to monitor the formation of the NASBA product in real-time (see Leone et al . , Nucleic Acids Research., 1998, vol : 26, pp 2150-2155).
  • the molecular beacons technology may be incorporated into the primer 2 oligonucleotide allowing real-time monitoring of the NASBA reaction without the need for a separate hybridisation probe.
  • the products of the NASBA reaction may be monitored using a generic labelled detection probe which hybridises to a nucleotide sequence in the 5' terminus of primer 2.
  • a generic labelled detection probe which hybridises to a nucleotide sequence in the 5' terminus of primer 2.
  • This is equivalent to the NucliSensTM' detection system supplied by Organon Teknika.
  • specificity for NASBA products derived from the target HPV mRNA may be conferred by using HPV-specific capture probes comprising probe oligonucleotides as described herein attached to a solid support such as a magnetic microbead.
  • the generic labelled detection probe is the ECLTM detection probe supplied by Organon Teknika.
  • NASBA amplicons are hybridized to the HPV-specific capture probes and the generic ECL probe (via a complementary sequence on primer 2) . Following hybridization the bead/amplicon/ECL probe complexes may be captured at the magnet electrode of an automatic ECL reader (e.g. the NucliSensTM reader supplied by Organon Teknika. Subsequently, a voltage pulse triggers the ECLTM reaction.
  • an automatic ECL reader e.g. the NucliSensTM reader supplied by Organon Teknika.
  • the invention provides a number of HPV-specific oligonucleotide probes, including molecular beacons probes, an it will be readily apparent to one of ordinary skill in the art from the foregoing description which probes or mixtures of probes are suitable for use with a given primer cocktail or primer set .
  • the degenerated primer sets were constructed as follows:
  • Probe length between 20 and 25.
  • the first 10 nts following the promotor sequence of primer 1 must be purine rich. 10. No stretches of pyrimidines in the first 10-12 nucleotides . 11. No false priming either in the sense or in the antisense of the targeted sequence.
  • the stability of the primer-set compared to the product has to be optimal.
  • the delta G value of the two different primer-set has to be equal.
  • the Tm difference has to be under 4 to 5°C.
  • the annealing temperature must be below 55°C.
  • the number of mixed bases sites have to be under 4.
  • the final real-time NASBA reaction buffer consists of the following components:
  • NASBA buffer 3 ng/nl molecular beacon probe, 1 M of each dNTP, 2 mM of ATP, UTP and CTP, 1.5 mM GTP, and
  • the primer mix solution consist of 45% DMSO and 0.2 ⁇ M each of the antisense and sense primers.
  • the enzyme mix consists of 375 mM sorbitol, 2.5 ⁇ g
  • AMV-reverse transcriptase AMV-reverse transcriptase.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne des procédés de détection de la présence de transcrits d'ARNm provenant des gènes E6 ou E7 de papillomavirus humain (HPV) dans des échantillons cliniques par utilisation d'une amplification d'acide nucléique basée sur la séquence. Elle concerne aussi des ensembles d'amorces d'oligonucléotides dégénérés pouvant être utilisés pour une détection simultanée de types multiples d'HPV.
EP01949793A 2000-07-21 2001-07-20 Procede de detection d'arnm de papillomavirus humain Withdrawn EP1373575A2 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
GB0018050 2000-07-21
GBGB0018050.5A GB0018050D0 (en) 2000-07-21 2000-07-21 Detection of human papillomavirus mRNA
PCT/GB2001/003293 WO2002008460A2 (fr) 2000-07-21 2001-07-20 Procede de detection d'arnm de papillomavirus humain

Publications (1)

Publication Number Publication Date
EP1373575A2 true EP1373575A2 (fr) 2004-01-02

Family

ID=9896172

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01949793A Withdrawn EP1373575A2 (fr) 2000-07-21 2001-07-20 Procede de detection d'arnm de papillomavirus humain

Country Status (4)

Country Link
EP (1) EP1373575A2 (fr)
AU (1) AU2001270908A1 (fr)
GB (1) GB0018050D0 (fr)
WO (1) WO2002008460A2 (fr)

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0120938D0 (en) * 2001-08-29 2001-10-17 Norchip As Detection of human papillomavirus E7 mRNA
ES2654909T3 (es) 2002-01-07 2018-02-15 Pretect As Método para detectar ARNm del virus del papiloma humano
GB0200258D0 (en) * 2002-01-07 2002-02-20 Norchip As Detection of human papillomavirus
US8304184B2 (en) 2002-07-30 2012-11-06 Baback Gharizadeh Genotyping using multiple variant-specific primer pools
EP1935992A3 (fr) * 2003-12-23 2008-12-03 Autogenomics, Inc. Analyse d'acides nucléiques multiplexés dotée d'une grande spécificité
EP1819835B1 (fr) * 2004-12-08 2010-08-04 Gen-Probe Incorporated Detection d'acides nucleiques de types multiples de papillomavirus humains
AU2013205122B2 (en) * 2012-10-11 2016-11-10 Gen-Probe Incorporated Compositions and Methods for Detecting Human Papillomavirus Nucleic Acid
CN117126966A (zh) * 2023-09-01 2023-11-28 弗雷米德生物医药技术（天津）有限公司 基于HPV mRNA表达量的试剂盒及应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999014377A2 (fr) * 1997-09-16 1999-03-25 Innogenetics N.V. Detection et identification du virus du papillome humain au moyen d'une pcr et d'une hybridation inverse specifique de type

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2629458B2 (fr) * 1987-07-31 1991-08-09 Ire Celltarg Sa Nouvelles sondes d'acides nucleiques specifiques de differents types de virus de papillome humain
DE3907721A1 (de) * 1989-03-10 1990-09-20 Behringwerke Ag Immunogene regionen auf dem e7-protein des humanen papillomvierus typ 16
US5580970A (en) * 1989-12-01 1996-12-03 Amoco Corporation Detection of HPV transcripts
US5695926A (en) * 1990-06-11 1997-12-09 Bio Merieux Sandwich hybridization assays using very short capture probes noncovalently bound to a hydrophobic support
CA2052413C (fr) * 1990-09-28 2004-07-13 Jeffrey L. Joseph Sequence de nucleotides utiles comme sondes specifiques, amorces de la rcp et sondes de la rcl pour l'amplification et la detection du virus du papillome humain, et trousses et methodes connexes
US5506105A (en) * 1991-12-10 1996-04-09 Dade International Inc. In situ assay of amplified intracellular mRNA targets
US5618536A (en) * 1992-09-03 1997-04-08 The United States Of America As Represented By The Department Of Health And Human Services Chimeric papillomavirus-like particles
ATE222295T1 (de) * 1994-02-21 2002-08-15 Stichting Res Fonds Pathologie Nachweis humaner papillomviren mit nukleinsäüre amplifikation die generelle primer verwendet

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999014377A2 (fr) * 1997-09-16 1999-03-25 Innogenetics N.V. Detection et identification du virus du papillome humain au moyen d'une pcr et d'une hybridation inverse specifique de type

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
S. PIZZIGHELLA ET AL: "Simultaneous polymerase chain reaction detection and restriction typing for the diagnosis of human genital papillomavirus infection", JOURNAL OF VIROLOGICAL METHODS, vol. 55, no. 2, 1 October 1995 (1995-10-01), pages 245 - 256, XP055013558, ISSN: 0166-0934, DOI: 10.1016/0166-0934(95)00063-Z *
See also references of WO0208460A3 *

Also Published As

Publication number Publication date
GB0018050D0 (en) 2000-09-13
AU2001270908A1 (en) 2002-02-05
WO2002008460A3 (fr) 2003-10-09
WO2002008460A2 (fr) 2002-01-31

Similar Documents

Publication Publication Date Title
Shen et al. Recent advances and perspectives of nucleic acid detection for coronavirus
Schweitzer et al. Combining nucleic acid amplification and detection
US5283171A (en) Compositions for and detection of human papillomavirus by specific oligonucleotide polymerase primers using the polymerase chain reaction
JP5595276B2 (ja) 子宮頸部ｈｐｖの新たな検出方法
US10988816B2 (en) Compositions and methods for detecting human papillomavirus nucleic acid
CA2268753C (fr) Amorces et sondes d'acide nucleique pour la detection de papillomavirus humains oncogenes
AU741141B2 (en) Specific and sensitive method for detecting nucleic acids
US20070281295A1 (en) Detection of human papillomavirus E6 mRNA
EP1082466B1 (fr) Procede, reactif et kit servant a determiner le genotype de papillomavirus humains
MXPA04008955A (es) Metodo de amplificacion-hibridacion para detectar y tipificar virus del papiloma humano.
CN102399871B (zh) 耐热等温核酸检测试剂及其试剂盒和检测方法
WO2002008460A2 (fr) Procede de detection d'arnm de papillomavirus humain
CA3074551C (fr) Compositions, methodes et kits permettant de detecter l'acide nucleique du virus de l'herpes simplex
US20050260561A1 (en) Method for detecting and typing of cutaneous hpv and primers and probes for use therein
WO2003083142A2 (fr) Detection universelle de l'arnm du papillomavirus humain
JP2006512909A (ja) α−フェトプロテインｍＲＮＡの検出および定量のための等温増幅に基づくアッセイ
WO2003020976A2 (fr) Oligonucleotides destines a etre utilises dans la detection du papillomavirus humain e7 mrna
WO2003020975A2 (fr) Oligonucleotides utilises pour detecter l'arnm du gène l1 des papillomavirus humains
WO2010125420A1 (fr) Procédé de détection et d'identification de variants du vph16 au moyen d'amorces et de sondes
US20030059806A1 (en) Probes for the detection of human papillomavirus

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20030124

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

17Q First examination report despatched

Effective date: 20091125

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20120426