EP1363936A1 - Juvenile hormone esterase - Google Patents
Juvenile hormone esteraseInfo
- Publication number
- EP1363936A1 EP1363936A1 EP02709903A EP02709903A EP1363936A1 EP 1363936 A1 EP1363936 A1 EP 1363936A1 EP 02709903 A EP02709903 A EP 02709903A EP 02709903 A EP02709903 A EP 02709903A EP 1363936 A1 EP1363936 A1 EP 1363936A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- polypeptide
- polynucleotide
- arthropod
- juvenile hormone
- present
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/18—Carboxylic ester hydrolases (3.1.1)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/60—Isolated nucleic acids
Definitions
- the present invention generally relates to the use of juvenile hormone esterases in the development of strategies for controlling arthropod populations.
- the present invention relates to methods for identifying arthropod control agents which modulate the production and/or activity of juvenile hormone esterase.
- Juvenile hormones Hs are one of several important classes of arthropod hormones whose interplay regulates development and reproduction (for a review see Riddiford, 1993).
- the most well characterised role of JH is in the regulation of the larval-pupal transition through interaction with ecdysone. It also plays roles in various other processes including the regulation of egg production, the development of both male and female gonadotrophic hormones, caste determination and diapause.
- the JH system is best understood in insects but key aspects of the system may be common to all arthropods (Cusson et al., 1991).
- the most common form of JH is JHIII (methyl (2E,6E)-10,ll-epoxy-
- the Lepidoptera have JH0, JHI, JHII and 4-methyl JHI forms of JH, while the JHIII bisepoxide (JHB 3 , in which the 6,7 double bond of JHUI is replaced by a 6S,7S epoxide group) has been found only in the higher Diptera (Schooley et al, 1984; Richard et al, 1989). In Drosophila melanogaster JHIII is a minor and JHB 3 a major form of juvenile hormone.
- JH JH esterase
- JHEH JH epoxide hydrolase
- JH hydrolysing enzymes In Diptera, larval JH hydrolysing enzymes are found in the haemolymph and other tissues, and the relative contributions of JHE and JHEH to total activity vary among species. There is a minimum of JH degrading activity late in the final instar, but a high level of soluble, circulating JHE activity occurs soon after the formation of the puparium and before pupation, probably clearing JH from the whole organism. This JHE is retained, though declining in activity, through the pupal stage. In adults lower levels of both JHE and JHEH are found, though with different subcellular distributions, possibly modulating the JH signal in specific tissues or turning off the JH signal after it has reached its site of action.
- Juvenoid insecticides have been developed, such as methoprene, hydroprene and pyriproxifen, which disrupt JH metabolism.
- methoprene such as methoprene, hydroprene and pyriproxifen
- pyriproxifen such as pyriproxifen
- the present invention provides a method of identifying an arthropod control agent, the method comprising a) exposing a polypeptide with juvenile hormone esterase activity which is at least 90% identical to SEQ ID NO:l to a candidate agent, and b) assessing the ability of the candidate agent to modulate the juvenile hormone esterase activity of the polypeptide.
- the agent inhibits juvenile hormone esterase activity of the polypeptide. In another embodiment, the agent enhances juvenile hormone esterase activity of the polypeptide.
- the polypeptide can be used to hydrolyse an artificial esterase substrate, ⁇ -naphthyl acetate, yielding ⁇ - naphthol which can be detected by a change of absorbance at 235 nm or at visible wavelengths after reaction with certain diazo dyes such as Fast Blue BN (Campbell et al, 1998).
- Certain diazo dyes such as Fast Blue BN (Campbell et al, 1998).
- Candidate agents can be included in such an assay to determine if they are suitable arthropod control agents.
- the arthropod control agent directly binds the polypeptide.
- the polypeptide is at least 300 amino acids in length.
- the juvenile hormone esterase activity is the ability to hydrolyse a juvenile hormone selected from the group consisting of: JHO, JHE, JHTI, JHIII and JHB 3 . More preferably, the juvenile hormone esterase activity is the ability to hydrolyse a juvenile hormone selected from the group consisting of: JHIII and JHB 3 .
- the present invention provides a method of identifying an arthropod control agent, the method comprising a) exposing a polypeptide which is at least 90% identical to SEQ ID NO:l to a binding partner which binds the polypeptide, and a candidate agent, and b) assessing the ability of the candidate agent to compete with the binding partner for binding to the polypeptide.
- the binding partner is detectably labeled.
- the binding partner is juvenile hormone.
- the polypeptide has juvenile hormone esterase activity.
- the present invention provides a method of identifying an arthropod control agent, the method comprising
- step (b) selecting a candidate compound by performing rational drug design with the atomic coordinates obtained in step (a), wherein said selecting is performed in conjunction with computer modeling;
- the present invention provides a crystal of a polypeptide with juvenile hormone esterase activity which is at least 90% identical to SEQ ID NO:l.
- the present invention provides a method of arthropod control agent design comprising using the structural coordinates of a crystal of the present invention to computationally evaluate a compound for its ability to modulate juvenile hormone esterase activity of the polypeptide.
- the present invention provides a method of identifying an arthropod control agent, the method comprising a) exposing a polynucleotide encoding a polypeptide with juvenile hormone esterase activity which is at least 90% identical to SEQ ID NO:l, to a candidate agent under conditions which allow expression of the polynucleotide, and b) assessing the ability of the candidate agent to modulate levels of polypeptide produced by the polynucleotide.
- the agent inhibits production of the polypeptide.
- the present invention provides a method of identifying an arthropod control agent, the method comprising a) exposing a polynucleotide which is at least 90% identical to SEQ ID NO:4 to a candidate agent, and b) assessing the ability of the candidate agent to hybridize and/or cleave the polynucleotide.
- the methods of identifying arthropod control agents of the present invention preferably further comprise the step of selecting a candidate compound to be developed as a lead compound.
- the methods of identifying arthropod control agents of the present invention preferably further comprise formulating the arthropod control agent in an arthropod control composition comprising an agriculturally acceptable carrier.
- the present invention provides a substantially purified polypeptide having juvenile hormone esterase activity, the polypeptide being selected from the group consisting of:
- polypeptide comprising the sequence of SEQ ID NO:l; or (ii) a polypeptide which has a sequence which is at least 90% identical to (i); wherein the polypeptide is not more than 600 residues in length.
- the polypeptide has a sequence which is at least 95% identical to (i). More preferably, the polypeptide has a sequence which is at least 99% identical to (i). Further, it is preferred that the polypeptide is at least 300 amino acids in length.
- the present invention provides a substantially purified polypeptide having juvenile hormone esterase activity, the polypeptide being selected from the group consisting of:
- polypeptide which is at least 31% identical to (i); or wherein the polypeptide is not more than 600 residues in length.
- the polypeptide is at least 40% identical to (i), more preferably at least 50% identical, more preferably at least 60% identical, more preferably at least 70% identical, more preferably at least 80% identical, and even more preferably at least 90% identical to (i).
- the polypeptide is at least 300 amino acids in length.
- the invention provides a polynucleotide encoding a polypeptide according to the present invention.
- the polynucleotide has a sequence selected from:
- the polynucleotide has a sequence which is less than 1660 nucleotides.
- the polynucleotide can be less than 1000 or even 500 nucleotides in length.
- the polynucleotides of the present invention are at least 18 nucleotides in length.
- the present invention provides an antisense polynucleotide which hybridizes under high stringency conditions to a polynucleotide of the present invention.
- antisense polynucleotide comprises a catalytic domain.
- the antisense polynucleotide can be a catalytic enzyme.
- the catalytic enzyme is selected from the group consisting of ribozymes and deoxyribozymes.
- the present invention provides a double stranded RNA (dsRNA) molecule comprising a polynucleotide according to the present invention.
- dsRNA double stranded RNA
- the dsRNA is encoded by a single open reading frame and the resulting dsRNA molecule has a stem loop structure at one end of the molecule.
- the present invention provides a fusion protein comprising a polypeptide according to the present invention fused to at least one other polypeptide sequence.
- the at least one other polypeptide is selected from the group consisting of: a polypeptide that enhances the stability of the polypeptide of the present invention, a polypeptide that acts as an immunopotentiator to enhance an immune response to a polypeptide of the present invention, and a polypeptide that assists in the purification of the fusion protein.
- the present invention provides an isolated polynucleotide that encodes a fusion protein of the present invention.
- the present invention provides a vector comprising a polynucleotide according to the present invention.
- the polynucleotide is operably linked to a promoter.
- the present invention provides a vector comprising an antisense polynucleotide of the present invention.
- the antisense polynucleotide is operably linked to a promoter.
- the present invention provides a vector comprising an open reading frame(s) which upon expression forms a dsRNA molecule according of the present invention.
- the dsRNA molecule is operably linked to a promoter.
- the vector of the present invention is a plasmid or a virus. More preferably, the viral vector is a baculovirus.
- the vector is a capsoid.
- the present invention provides a host cell transformed or transfected with the vector according to the present invention.
- the host cell is a bacterial cell.
- the host cell is an arthropod cell, more preferably an insect cell.
- the present invention provides a transgenic plant, the plant having been transformed with a polynucleotide according to the present invention, wherein the plant expresses the polynucleotide.
- the present invention provides a transgenic plant, the plant having been transformed with an antisense polynucleotide according to the present invention, wherein the plant expresses the antisense polynucleotide.
- the present invention provides a transgenic plant, the plant having been transformed with open reading frame(s) which, upon expression, form a dsRNA molecule according to the present invention, wherein the plant produces the dsRNA molecule.
- the present invention provides a non-human animal transformed with the molecules of the invention.
- the present invention provides a transgenic non-human animal, the animal having been transformed with a polynucleotide according to the present invention, wherein the animal expresses the polynucleotide.
- the present invention provides a transgenic non- human animal, the animal having been transformed with an antisense polynucleotide according to the present invention, wherein the animal expresses the antisense polynucleotide.
- the present invention provides a transgenic non- human animal, the animal having been transformed with open reading frame(s) which, upon expression, form a dsRNA molecule according to the present invention, wherein the animal produces the dsRNA molecule.
- the present invention provides an arthropod control composition, the composition comprising an agent identified according to the present invention, and an agriculturally acceptable carrier.
- the present invention provides an arthropod control composition, the composition comprising a polypeptide according to the present invention, and an agriculturally acceptable carrier.
- the present invention provides an arthropod control composition, the composition comprising a vector according to the present invention, and an agriculturally acceptable carrier.
- the present invention provides a method of controlling an arthropod population, the method comprising exposing members of the arthropod population to an arthropod control composition according to the present invention.
- the arthropod is an insect.
- the present invention provides a process for preparing a polypeptide according to the present invention, the process comprising cultivating a host cell transformed or transfected with a vector encoding a polynucleotide of the present invention under conditions providing for expression of the polynucleotide encoding the polypeptide, and recovering the expressed polypeptide.
- This process can be used for the production of commercially useful quantities of the encoded polypeptide.
- the present invention provides a kit for identifying an arthropod control agent, the kit comprising a polypeptide according to the present invention, and means for determining juvenile hormone esterase activity.
- the present invention provides a kit for identifying an arthropod control agent, the kit comprising a polynucleotide according to the present invention, and means for determining juvenile hormone esterase activity of a polypeptide encoded by the polynucleotide.
- polypeptides, polynucleotides, antisense polynucleotides, dsRNA molecules, vectors, host cells and arthropod control agents can be used in a multitude of ways to control arthropod populations.
- FIG. 1 Inhibition of JHIII hydrolysis by juvenile hormone analogues. JH analogues (lO ⁇ M) were incubated with 3 H-JHHI (56 nM) and JHE. Control incubations had no JH analogue addition (0% inhibition). Greater inhibition indicates that the compound binds more tightly to JHE.
- SEQ ID NO:l D. melanogaster juvenile hormone esterase lacking the N- terminal signal sequence.
- SEQ ID NO:2 D. melanogaster juvenile hormone esterase.
- SEQ ID NO:3 - cDNA encoding D. melanogaster juvenile hormone esterase.
- SEQ ID NO:4 Open reading frame encoding D. melanogaster juvenile hormone esterase provided as SEQ ID NO:l.
- SEQ ID NO:8 Adaptor primer for 3'RACE.
- SEQ ID NO:9 and 10 PCR primers to D. melanogaster cDNA sequence.
- SEQ ID NO: 11 and 12 - PCR primers used to amplify cDNA encoding D. melanogaster juvenile hormone esterase.
- Arthropod control agents identified using the methods of the present invention can be used to disrupt juvenile hormone esterase activity resulting in the death of the arthropod or at least reduce its rate of reproduction or feeding. For instance, during development, the inhibition of JHE will result in increased JH titres and the blocking of a vital moult, whereas inappropriate expression of JHE will result in a drop in JH titre and a precocious moult. Accordingly, agents which either enhance or inhibit JH esterase activity or levels can be useful in controlling arthropod populations.
- a "lead compound” is an arthropod control agent which is subject to trials with the goal of ultimately being formulated in, for example, a composition and sold as an agent for controlling arthropod pest populations.
- the lead compound when exposed to an arthropod, more preferably an insect, disrupts JH esterase activity within the arthropod leading to a reduction in reproduction rates, death, feeding rates etc.
- Known screening techniques can be used to identify arthropod control agents which modulate the activity, or production of, a JH esterase of the present invention.
- the JH esterase can be used to hydrolyse an artificial substrate resulting in a detectable signal.
- one example is the hydrolysis of ⁇ -naphthyl acetate, yielding ⁇ -naphthol which can be detected by a change of absorbance at 235 nm or at visible wavelengths after reaction with certain diazo dyes such as Fast Blue BN (Campbell et al., 1998).
- Candidate agents can be included in such an assay to determine if they are suitable arthropod control agents.
- Another method for screening for agonists/antagonists involves mixing the polypeptide with a binding partner (which is capable of binding to the polypeptide) and measuring their binding to each other in the presence or absence of a potential agonist/antagonist.
- the polypeptide or the binding partner can be detectably labeled using known labels such as those selected from the group consisting of: radioisotopes, fluorophores and chromophores.
- the binding partner is labeled juvenile hormone.
- This binding assay may be in the form of an ELISA plate assay. There are other binding formats known to those of skill in the art, including coprecipitation, centrifugation and surface plasmon resonance.
- One potential antagonist is a small molecule which binds to the juvenile hormone binding site of the polypeptide, making it inaccessible to juvenile hormone.
- small molecules include, but are not limited to, small peptides, peptide-like molecules, plant secondary metabolites or synthetic organic chemicals.
- suitable antisense polynucleotide and dsRNA molecules can be designed based on the sequences of the JH esterase encoding polynucleotides of the present invention.
- Such antisense polynucleotide and dsRNA molecules can be used as arthropod control agents which inhibit the production of JH esterase from the cell of an arthropod which has been transformed with the antisense polynucleotide or dsRNA molecule.
- Such antisense polynucleotides and dsRNA molecules can also be screened for use as an arthropod control agent using the methods of the present invention.
- a JH esterase encoding polynucleotide of the present invention can be expressed in a cell system, or a cell-free expression system, resulting in the production of JH esterase.
- Candidate antisense polynucleotides and dsRNA molecules designed based on the sequences of the JH esterase encoding polynucleotides of the present invention can be incorporated into the system and the resulting affects on JH esterase mRNA levels or JH esterase polypeptide levels or activity, can readily be measured using techniques known in the art.
- Suitable inhibitors of juvenile hormone esterase activity are compounds that interact directly with a protein's active site, thereby inhibiting that esterase's activity, usually by binding to or otherwise interacting with or otherwise modifying the esterase's active site. Juvenile hormone esterase inhibitors can also interact with other regions of the protein to inhibit esterase activity, for example, by allosteric interaction. Effective amounts and dosing regimens for the application of arthropod control agents identified by the methods of the present invention can readily be determined using techniques known to those skilled in the art.
- Some arthropod control agents identified by the methods of the present invention may also interact with other molecules in the JH system.
- some arthropod control agents may, at least partially, act on JH binding proteins, JH receptors and/or JH-degrading enzymes such as JHEH.
- Phage Libraries for Arthropod Control Agent Screening Phage libraries can be constructed which when infected into host E. coli produce random peptide sequences of approximately 10 to 15 amino acids. Specifically, the phage library can be mixed in low dilutions with permissive E. coli in low melting point LB agar which is then poured on top of LB agar plates. After incubating the plates at 37°C for a period of time, small clear plaques in a lawn of E. coli will form which represents active phage growth and lysis of the E. coli. A representative of these phages can be absorbed to nylon filters by placing dry filters onto the agar plates. The filters can be marked for orientation, removed, and placed in washing solutions to block any remaining absorbent sites.
- the filters can then be placed in a solution containing, for example, a radioactively labeled polypeptide of the present invention (e.g., a polypeptide having an amino acid sequence comprising SEQ ID NO:l). After a specified incubation period, the filters can be thoroughly washed and developed for autoradiography. This allows plagues containing the phage that bind to the radioactive polypeptide to be detected. These phages can be further cloned and then retested for their ability to bind to the JH esterase as before. Once the phages have been purified, the binding sequence contained within the phage can be determined by standard DNA sequencing techniques. Once the DNA sequence is known, synthetic peptides can be generated which represents these sequences.
- a radioactively labeled polypeptide of the present invention e.g., a polypeptide having an amino acid sequence comprising SEQ ID NO:l.
- the effective peptide(s) can be synthesized in large quantities for use in in vivo models and eventually as an arthropod control agent to disrupt JH esterase activity. It should be emphasized that synthetic peptide production is relatively non-labor intensive, easily manufactured, quality controlled and thus, large quantities of the desired product can be produced rather cheaply.
- Crystals of a polypeptide of the present invention could be grown by a number of techniques including batch crystallation, vapour diffusion (either by sitting drop or hanging drop) and by microdialysis. Seeding of the crystals in some instances could be required to obtain X-ray quality crystals.
- Standard micro and/or macro seeding of crystals may therefore be used. Once a crystal is grown, X-ray diffraction data can be collected using standard techniques.
- a potential antagonist or agonist can be examined through the use of computer modeling using a docking program such as GRAM, DOCK, or AUTODOCK (Dunbrack et al., 1997). This procedure can include computer fitting of potential ligands to the JH esterase to ascertain how well the shape and the chemical structure of the potential ligand will complement or interfere with JH esterase activity. Computer programs can also be employed to estimate the attraction, repulsion, and steric hindrance of the ligand to the polypeptide of the present invention.
- a potential compound could be obtained, for example, by screening a random peptide library produced by a recombinant bacteriophage as described above, or a chemical library. A compound selected in this manner could be then be systematically modified by computer modeling programs until one or more promising potential compounds are identified.
- Such computer modeling allows the selection of a finite number of rational chemical modifications, as opposed to the countless number of essentially random chemical modifications that could be made, and of which any one might lead to a useful arthropod control agent.
- Each chemical modification requires additional chemical steps, which while being reasonable for the synthesis of a finite number of compounds, quickly becomes overwhelming if all possible modifications needed to be synthesized.
- a large number of these compounds can be rapidly screened on the computer monitor screen, and a few likely candidates can be determined without the laborious synthesis of untold numbers of compounds.
- the prospective arthropod control agent can be placed into any standard binding assay to test its effect on JH esterase activity.
- arthropod control agent screening assays described herein further refinements to the structure of the arthropod control agent will generally be necessary and can be made by the successive iterations of any and/or all of the steps provided by the particular arthropod control agent screening assay.
- Polypeptides By “substantially purified” we mean a polypeptide that has been separated from the lipids, nucleic acids, other polypeptides, and other contaminating molecules with which it is associated in its native state.
- the query sequence is at least 15 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 15 amino acids. More preferably, the query sequence is at least 50 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 50 amino acids. Even more preferably, the query sequence is at least 100 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 100 amino acids.
- the query sequence is at least 250 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 250 amino acids. Even more preferably, the query sequence is at least 500 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 500 amino acids.
- a "biologically active fragment" of a polypeptide of the present invention is a portion of the polypeptide which has JH esterase activity.
- Polypeptides of the present invention can either be naturally occurring
- Amino acid sequence mutants can be prepared by introducing appropriate nucleotide changes into DNA, or by in vitro synthesis of the desired polypeptide. Such mutants include, for example, deletions, insertions or substitutions of residues within the amino acid sequence. A combination of deletion, insertion and substitution can be made to arrive at the final construct, provided that the final protein product possesses the desired characteristics.
- amino acid sequence mutants the location of the mutation site and the nature of the mutation will depend on characteristic (s) to be modified.
- the sites for mutation can be modified individually or in series, e.g., by (1) substituting first with conservative amino acid choices and then with more radical selections depending upon the results achieved, (2) deleting the target residue, or (3) inserting other residues adjacent to the located site.
- Amino acid sequence deletions generally range from about 1 to 30 residues, more preferably about 1 to 10 residues and typically about 1 to 5 contiguous residues.
- Substitution mutants have at least one amino acid residue in the polypeptide molecule removed and a different residue inserted in its place.
- the sites of greatest interest for substitutional mutagenesis include sites identified as the active and/or binding site(s). Other sites of interest are those in which particular residues obtained from various species are identical. These positions may be important for biological activity. These sites, especially those falling within a sequence of at least three other identically conserved sites, are preferably substituted in a relatively conservative manner. Such conservative substitutions are shown in Table 1 under the heading of "exemplary substitutions".
- Hammock and co-inventors have shown that a double lysine mutant (K29R, K522R) and a catalytic serine mutant (S201G) of JHE enhance the ability of recombinant baculoviruses expressing JHE to kill in both Heliothis virescens and Trichoplusia ni (US 5,643,776). Removal of the two lysines is most likely important for preventing the specific degradation of the JHE protein by ubiquitin and lysosomal pathways; removal of the catalytic serine to produce an inactive enzyme possibly enhances lethality by binding and sequestering JH.
- Hammock and co-inventors have improved the insecticidal activity of recombinant baculoviruses expressing JHE even further by removing the signal sequence that targets the JHE enzyme to the plasma membrane (US 5,674,485). Non-glycosylated JHE then accumulates in the cytoplasm of baculovirus infected cells. Similar mutations could be performed on the polypeptide provided as SEQ ID NO:l.
- unnatural amino acids or chemical amino acid analogues can be introduced as a substitution or addition into the polypeptides of the present invention.
- amino acids include, but are not limited to, the D-isomers of the common amino acids, 2,4-diaminobutyric acid, ⁇ -amino isobutyric acid, 4-aminobutyric acid, 2-aminobutyric acid, 6- amino hexanoic acid, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, ⁇ -alanine, fluoro-amino acids, designer amino acids such as ⁇ -methyl amino acids, C ⁇ -methyl amino acids, N ⁇ -methyl amino acids
- polypeptides of the present invention which are differentially modified during or after synthesis, e.g., by biotinylation, benzylation, glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. These modifications may serve to increase the stability and/or bioactivity of the polypeptide of the invention.
- Polypeptides of the present invention can be produced in a variety of ways, including production and recovery of natural proteins, production and recovery of recombinant proteins, and chemical synthesis of the proteins.
- an isolated polypeptide of the present invention is produced by culturing a cell capable of expressing the polypeptide under conditions effective to produce the polypeptide, and recovering the polypeptide.
- a preferred cell to culture is a recombinant cell of the present invention.
- Effective culture conditions include, but are not limited to, effective media, bioreactor, temperature, pH and oxygen conditions that permit protein production.
- An effective medium refers to any medium in which a cell is cultured to produce a polypeptide of the present invention.
- Such medium typically comprises an aqueous medium having assimilable carbon, nitrogen and phosphate sources, and appropriate salts, minerals, metals and other nutrients, such as vitamins.
- Cells of the present invention can be cultured in conventional fermentation bioreactors, shake flasks, test tubes, microtiter dishes, and petri plates. Culturing can be carried out at a temperature, pH and oxygen content appropriate for a recombinant cell. Such culturing conditions are within the expertise of one of ordinary skill in the art.
- isolated polynucleotide we mean a polynucleotide separated from the polynucleotide sequences with which it is associated or linked in its native state. Furthermore, the term “polynucleotide” is used interchangeably herein with the term “nucleic acid molecule”.
- the query sequence is at least 45 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 45 nucleotides.
- the query sequence is at least 150 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 150 nucleotides. More preferably, the query sequence is at least 300 nucleotides in length and the GAP analysis aligns the two sequences over a region of at least 300 nucleotides.
- a polynucleotide sequence of the present invention may hybridise under high stringency conditions to the sequence set out in SEQ ID NO: 3 or SEQ ID NO: 4.
- an antisense polynucleotide of the present invention can hybridise under high stringency conditions to the sequence set out in SEQ ID NO: 3 or SEQ ID NO: 4.
- high stringency conditions are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate/0.1% NaDodS0 4 at 50°C; (2) employ during hybridisation a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 g/ml), 0.1% SDS and 10% dextran sulfate at 42°C in 0.2 x SSC and 0.1% SDS.
- formamide for
- Oligonucleotides of the present invention can be RNA, DNA, or derivatives of either.
- the minimum size of such oligonucleotides is the size required for the formation of a stable hybrid between an oligonucleotide and a complementary sequence on a nucleic acid molecule of the present invention.
- the present invention includes oligonucleotides that can be used as, for example, probes to identify nucleic acid molecules, primers to produce nucleic acid molecules or arthropod control agents to inhibit juvenile hormone esterase protein production or activity (e.g., as antisense-, triplex formation-, ribozyme- and/or RNA drug-based reagents).
- Oligonucleotide of the present invention used as a probe are typically conjugated with a label such as a radioisotope, an enzyme, biotin, a fluorescent molecule or a chemiluminescent molecule.
- catalytic nucleic acid refers to a DNA molecule or DNA- containing molecule (also known in the art as a "deoxyribozyme”) or an RNA or RNA-containing molecule (also known as a "ribozyme”) which specifically recognizes a distinct substrate and catalyzes the chemical modification of this substrate.
- the nucleic acid bases in the catalytic nucleic acid can be bases A, C, G, T and U, as well as derivatives thereof. Derivatives of these bases are well known in the art.
- the catalytic nucleic acid contains an antisense sequence for specific recognition of a target nucleic acid, and a nucleic acid cleaving enzymatic activity (also referred to herein as the "catalytic domain").
- ribozymes that are particularly useful in this invention are the hammerhead ribozyme (Haseloff and Gerlach 1988, Perriman et al., 1992) and the hairpin ribozyme (Shippy et al., 1999).
- the ribozymes of this invention and DNA encoding the ribozymes can be chemically synthesized using methods well known in the art.
- the ribozymes can also be prepared from a DNA molecule (that upon transcription, yields an RNA molecule) operably linked to an RNA polymerase promoter, e.g., the promoter for T7 RNA polymerase or SP6 RNA polymerase.
- an RNA polymerase promoter e.g., the promoter for T7 RNA polymerase or SP6 RNA polymerase.
- a nucleic acid molecule i.e., DNA or cDNA, coding for the ribozymes of this invention.
- the ribozyme can be produced in vitro upon incubation with RNA polymerase and nucleotides.
- the DNA can be inserted into an expression cassette or transcription cassette.
- the RNA molecule can be modified by ligation to a DNA molecule having the ability to stabilize the ribozyme and make it resistant to RNase.
- the ribozyme can be modified to the phosphothio analog for use in liposome delivery systems. This modification also renders the ribozyme resistant to endonuclease activity.
- dsRNA dsRNA is particularly useful for specifically inhibiting the production of a particular protein.
- Dougherty and Parks (1995) have provided a model for the mechanism by which dsRNA can be used to reduce protein production.
- This model has recently been modified and expanded by Waterhouse et al. (1998).
- This technology relies on the presence of dsRNA molecules that contain a sequence that is essentially identical to the mRNA of the gene of interest, in this case an mRNA encoding a polypeptide according to the first, second or third aspects of the invention.
- the dsRNA can be produced in a single open reading frame in a recombinant vector or host cell, where the sense and anti-sense sequences are flanked by an unrelated sequence which enables the sense and anti-sense sequences to hybridize to form the dsRNA molecule with the unrelated sequence forming a loop structure.
- the design and production of suitable dsRNA molecules for the present invention is well within the capacity of a person skilled in the art, particularly considering Dougherty and Parks (1995), Waterhouse et al. (1998), WO 99/32619, WO 99/53050, WO 99/49029, and WO 01/34815.
- One embodiment of the present invention includes a recombinant vector, which includes at least one isolated nucleic acid molecule of the present invention, inserted into any vector capable of delivering the nucleic acid molecule into a host cell.
- a vector contains heterologous nucleic acid sequences, that is nucleic acid sequences that are not naturally found adjacent to nucleic acid molecules of the present invention and that preferably are derived from a species other than the species from which the nucleic acid molecule(s) are derived.
- the vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a virus or a plasmid.
- One type of recombinant vector comprises a nucleic acid molecule of the present invention operatively linked to an expression vector.
- an expression vector is a DNA or RNA vector that is capable of transforming a host cell and of effecting expression of a specified nucleic acid molecule.
- the expression vector is also capable of replicating within the host cell.
- Expression vectors can be either prokaryotic or eukaryotic, and are typically viruses or plasmids.
- Expression vectors of the present invention include any vectors that function (i.e., direct gene expression) in recombinant cells of the present invention, including in bacterial, fungal, endoparasite, arthropod, other animal, and plant cells.
- Preferred expression vectors of the present invention can direct gene expression in bacterial, yeast, arthropod and mammalian cells and more preferably in the cell types disclosed herein.
- expression vectors of the present invention contain regulatory sequences such as transcription control sequences, translation control sequences, origins of replication, and other regulatory sequences that are compatible with the recombinant cell and that control the expression of nucleic acid molecules of the present invention.
- recombinant molecules of the present invention include transcription control sequences.
- Transcription control sequences are sequences which control the initiation, elongation, and termination of transcription. Particularly important transcription control sequences are those which control transcription initiation, such as promoter, enhancer, operator and repressor sequences. Suitable transcription control sequences include any transcription control sequence that can function in at least one of the recombinant cells of the present invention. A variety of such transcription control sequences are known to those skilled in the art.
- Preferred transcription control sequences include those which function in bacterial, yeast, arthropod and mammalian cells, such as, but not limited to, tac, lac, trp, trc, oxy-pro, omp/lpp, rrnB, bacteriophage lambda, bacteriophage T7, T7lac, bacteriophage T3, bacteriophage SP6, bacteriophage SP01, metallothionein, alpha-mating factor, Pichia alcohol oxidase, alphavirus subgenomic promoters (such as Sindbis virus subgenomic promoters), antibiotic resistance gene, baculovirus, Heliothis zea insect virus, vaccinia virus, herpesvirus, raccoon poxvirus, other poxvirus, adenovirus, cytomegalovirus (such as intermediate early promoters), simian virus 40, retrovirus, actin, retroviral long terminal repeat, Rous sarcoma virus, heat shock,
- transcription control sequences include tissue-specific promoters and enhancers as well as lymphokine-inducible promoters (e.g., promoters inducible by interferons or interleukins).
- Transcription control sequences of the present invention can also include naturally occurring transcription control sequences naturally associated with arthropods.
- Recombinant molecules of the present invention may also (a) contain secretory signals (i.e., signal segment nucleic acid sequences) to enable an expressed polypeptide of the present invention to be secreted from the cell that produces the polypeptide and/or (b) contain fusion sequences which lead to the expression of nucleic acid molecules of the present invention as fusion proteins.
- Suitable signal segments include any signal segment capable of directing the secretion of a protein of the present invention.
- Preferred signal segments include, but are not limited to, tissue plasminogen activator (t-PA), interferon, interleukin, growth hormone, histocompatibility and viral envelope glycoprotein signal segments, as well as natural signal sequences.
- t-PA tissue plasminogen activator
- Suitable fusion segments encoded by fusion segment nucleic acids are disclosed herein.
- a nucleic acid molecule of the present invention can be joined to a fusion segment that directs the encoded protein to the proteosome, such as a ubiquitin fusion segment.
- Recombinant molecules may also include intervening and/or untranslated sequences surrounding and/or within the nucleic acid sequences of nucleic acid molecules of the present invention.
- arthropod-specific viruses systems can be used to deliver molecules of the present invention. These can be as diverse as large DNA viruses such as the baculoviruses and small RNA viruses. Wild-type viruses are generally ingested by arthropods. Proteins on the surface of the virus bind to cells of the arthropod's gut causing the contents of the virus to enter the cells. The nucleic acid in the virus then performs two tasks. Firstly, it encodes viral proteins that are required for the assembly of more viruses identical the original virus, and secondly, more copies of the nucleic acid are produced for incorporation into the new virus.
- a virus When a virus is modified as a vector for producing a protein of interest some additional nucleic acid is inserted into the virus' nucleic acid and may or may not replace some of the virus' original nucleic acid.
- the site of insertion of the toxin encoding nucleic acid is chosen to ensure that it will be transcribed (if necessary) and translated into the required protein in the virus infected cells. Abundant expression of the protein might require other modifications such as suitable promoter sites in the nucleic acid. It is generally intended that the modified virus would infect a large number of cells in the target arthropod with abundant expression of the protein in all those cells. It is also generally intended that the expression of the proteins hastens or otherwise enhances the detrimental effects on the arthropod of viral infection.
- viruses can be formulated to allow them to be sprayed or otherwise distributed on a crop plant (or other material one wishes to protect from arthropod attack) and ingested by arthropods when they start to feed on the crop.
- RNA viruses consist of one or a few RNA molecules which associate with a capsid protein encoded by that RNA. Molecules of the capsid protein assemble into regular geometric structures that enclose and protect the RNA. The same protein also provides the function of binding to cells in the gut of arthropods and causing the viral RNA to enter the gut cell. Within the cell more copies of the RNA are made and these are expressed to make more of the viral protein.
- the RNA and protein assemble into new virus particles that can infect other cells and arthropods.
- the capsoid system uses some of the functions of the wild-type virus to deliver a protein to arthropod gut cells but does not have all the functions required to sustain a viral infection. It also has features that allow it to be produced by a transgenic plant rather than needing to be produced elsewhere and sprayed on to a crop.
- the plant is transformed with a gene that causes the plant to produce the capsid protein.
- the transgenic plant also produces an RNA molecule that contains the necessary sequences to associate with the capsid protein to produce a virus-like particle.
- the capsid protein binds to the arthropod's gut cells and the RNA enters the cell. That RNA can be engineered to resemble a messenger RNA causing the cell to translate the message into a protein.
- a variation of the capsoid system has the transgenic plant expressing the protein of interest and the capsid protein as a fusion product from a single gene. It is the protein rather than the corresponding RNA that is delivered. Simply feeding an unprotected protein such as JHE to an arthropod is unlikely to be effective because the protein would most likely be digested by normal gut processes.
- the capsid protein domains assemble into virus-like structures with the toxin protein domain protected from digestion within the lumen of the virus-like structure.
- the toxin protein is only exposed after the capsid domains have bound to gut cells.
- the fusion of the virus-like structure with the target cell's membrane causes the toxin domains to be presented to the inside of the cell where they remain protected from digestion in the gut. Ingestion of capsoids would cause many cells lining the gut to contain active JHE which are expected to act as a sinks for JH as described above.
- Another embodiment of the present invention includes a recombinant cell comprising a host cell transformed with one or more recombinant molecules of the present invention. Transformation of a nucleic acid molecule into a cell can be accomplished by any method by which a nucleic acid molecule can be inserted into the cell. Transformation techniques include, but are not limited to, transfection, electroporation, microinjection, lipofection, adsorption, and protoplast fusion. A recombinant cell may remain unicellular or may grow into a tissue, organ or a multicellular organism.
- Transformed nucleic acid molecules of the present invention can remain extrachromosomal or can integrate into one or more sites within a chromosome of the transformed (i.e., recombinant) cell in such a manner that their ability to be expressed is retained.
- Suitable host cells to transform include any cell that can be transformed with a polynucleotide of the present invention.
- Host cells can be either untransformed cells or cells that are already transformed with at least one nucleic acid molecule (e.g., nucleic acid molecules encoding one or more proteins of the present invention).
- Host cells of the present invention either can be endogenously (i.e., naturally) capable of producing proteins of the present invention or can be capable of producing such proteins after being transformed with at least one nucleic acid molecule of the present invention.
- Host cells of the present invention can be any cell capable of producing at least one protein of the present invention, and include bacterial, fungal (including yeast), parasite, other arthropod, other animal and plant cells.
- Preferred host cells include bacterial, mycobacterial, yeast, arthropod and mammalian cells.
- More preferred host cells include Salmonella, Escherichia, Bacillus, Listeria, Saccharomyces, Spodoptera, Mycohacte ⁇ a, Trichoplusia, BHK (baby hamster kidney) cells, MDCK cells (normal dog kidney cell line for canine herpesvirus cultivation), CRFK cells (normal cat kidney cell line for feline herpesvirus cultivation), CV-1 cells (African monkey kidney cell line used, for example, to culture raccoon poxvirus), COS (e.g., COS-7) cells, and Vero cells.
- Particularly preferred host cells are E. coli, including E.
- coli K-12 derivatives Salmonella typhi; Salmonella typhimu ⁇ um, including attenuated strains; Spodoptera frugiperda; Trichoplusia ni; BHK cells; MDCK cells; CRFK cells; CV-1 cells; COS cells; Vero cells; and non-tumorigenic mouse myoblast G8 cells (e.g., ATCC CRL 1246).
- Additional appropriate mammalian cell hosts include other kidney cell lines, other fibroblast cell lines (e.g., human, murine or chicken embryo fibroblast cell lines), myeloma cell lines, Chinese hamster ovary cells, mouse NIH/3T3 cells, LMTK cells and/or HeLa cells.
- Recombinant DNA technologies can be used to improve expression of transformed polypeptide molecules by manipulating, for example, the number of copies of the polypeptide molecules within a host cell, the efficiency with which those polypeptide molecules are transcribed, the efficiency with which the resultant transcripts are translated, and the efficiency of post-translational modifications.
- Recombinant techniques useful for increasing the expression of polypeptide molecules of the present invention include, but are not limited to, operatively linking polypeptide molecules to high-copy number plasmids, integration of the polypeptide molecules into one or more host cell chromosomes, addition of vector stability sequences to plasmids, substitutions or modifications of transcription control signals (e.g., promoters, operators, enhancers), substitutions or modifications of translational control signals (e.g., ribosome binding sites, Shine-Dalgarno sequences), modification of polypeptide molecules of the present invention to correspond to the codon usage of the host cell, and the deletion of sequences that destabilize transcripts.
- the activity of an expressed recombinant protein of the present invention may be improved by fragmenting, modifying, or derivatizing polypeptide molecules encoding such a protein.
- plant refers to whole plants, plant organs (e.g. leaves, stems roots, etc), seeds, plant cells and the like. Plants contemplated for use in the practice of the present invention include both monocotyledons and dicotyledons. Exemplary dicotyledons include cotton, corn, tomato, tobacco, potato, bean, soybean, and the like.
- Transgenic plants as defined in the context of the present invention include plants (as well as parts and cells of said plants) and their progeny which have been genetically modified using recombinant DNA techniques to cause or enhance production of at least one protein of the present invention in the desired plant or plant organ.
- polypeptide of the present invention may be expressed constitutively in the transgenic plants during all stages of development.
- the proteins may be expressed in a stage-specific manner. Furthermore, depending on the use, the proteins may be expressed tissue-specifically.
- the choice of the plant species is determined by the intended use of the plant or parts thereof and the amenability of the plant species to transformation. Regulatory sequences which are known or are found to cause expression of a gene encoding a protein of interest in plants may be used in the present invention.
- the choice of the regulatory sequences used depends on the target crop and/or target organ of interest. Such regulatory sequences may be obtained from plants or plant viruses, or may be chemically synthesized. Such regulatory sequences are well known to those skilled in the art.
- Other regulatory sequences such as terminator sequences and polyadenylation signals include any such sequence functioning as such in plants, the choice of which would be obvious to the skilled addressee.
- An example of such sequences is the 3' flanking region of the nopaline synthase (nos) gene of Agrobacterium tumefaciens.
- transformation and/or regeneration techniques are available for the introduction of the expression construct containing a DNA sequence encoding a protein of interest into the target plants.
- Such techniques include but are not limited to transformation of protoplasts using the calcium/polyethylene glycol method, electroporation and microinjection or (coated) particle bombardment.
- transformation systems involving vectors are widely available, such as viral and bacterial vectors (e.g. from the genus Agrobacterium) .
- the protoplasts, cells or plant parts that have been transformed can be regenerated into whole plants, using methods known in the art. The choice of the transformation and/or regeneration techniques is not critical for this invention.
- Heterologous DNA can be introduced, for example, into fertilized mammalian ova.
- totipotent or pluripotent stem cells can be transformed by microinjection, calcium phosphate mediated precipitation, liposome fusion, retroviral infection or other means, the transformed cells are then introduced into the embryo, and the embryo then develops into a transgenic animal.
- developing embryos are infected with a retrovirus containing the desired DNA, and transgenic animals produced from the infected embryo.
- the appropriate DNAs are coinjected into the pronucleus or cytoplasm of embryos, preferably at the single cell stage, and the embryos allowed to develop into mature transgenic animals.
- transgenic animal Another method used to produce a transgenic animal involves microinjecting a nucleic acid into pro-nuclear stage eggs by standard methods. Injected eggs are then cultured before transfer into the oviducts of pseudopregnant recipients. Transgenic animals may also be produced by nuclear transfer technology. Using this method, fibroblasts from donor animals are stably transfected with a plasmid incorporating the coding sequences for a binding domain or binding partner of interest under the control of regulatory. Stable transfectants are then fused to enucleated oocytes, cultured and transferred into female recipients.
- an "arthropod control composition” is a formulation which comprises an arthropod control agent of the present invention, where upon exposure of the composition to an arthropod results in the disruption of JH esterase activity.
- compositions for arthropod control are known in the art. Agricultural compositions for the control of arthropod pests of plants and/or animals must be suitable for agricultural use, particularly for dispersal'in fields. Similarly, compositions for the control of arthropod pests are preferably environmentally acceptable. In addition to appropriate solid or, more preferably, liquid carriers, agricultural compositions may include sticking and adhesive agents, emulsifying and wetting agents, but no components which deter arthropod feeding or any arthropod control agent functions. It may also be desirable to add components which protect the arthropod control agent from UV inactivation or components which serve as adjuvants to increase the potency and/or virulence of an entomopathogen. Agricultural compositions for arthropod pest control may also include agents which stimulate arthropod feeding.
- composition of the present invention can be used to protect a plant or animal from arthropod infestation by administering such composition in order to prevent infestation.
- administration could be oral (in the case of animals), or by application to the environment (e.g., spraying).
- an arthropod such as a l, cuprina
- compositions of the present invention also include excipients.
- Excipients are also referred to herein as "agriculturally acceptable carriers".
- An excipient can be any material that an animal, plant or environment to be treated can tolerate. Examples of such excipients include water, saline, Ringer's solution, dextrose solution, Hank's solution, and other aqueous physiologically balanced salt solutions. Nonaqueous vehicles, such as fixed oils, sesame oil, ethyl oleate, or triglycerides may also be used. Other useful formulations include suspensions containing viscosity enhancing agents, such as sodium carboxymethylcellulose, sorbitol, or dextran. Excipients can also contain minor amounts of additives, such as substances that enhance isotonicity and chemical stability.
- buffers include phosphate buffer, bicarbonate buffer and Tris buffer
- preservatives include thimerosal or o-cresol, formalin and benzyl alcohol.
- Standard formulations can either be liquid injectables or solids which can be taken up in a suitable liquid as a suspension or solution for injection.
- the excipient in a non- liquid formulation, can comprise dextrose, human serum albumin, dog serum albumin, cat serum albumin, preservatives, etc., to which sterile water or saline can be added prior to administration.
- a composition can include a carrier.
- Carriers include compounds that increase the half-life of a composition in the treated animal, plant or environment. Suitable carriers include, but are not limited to, polymeric controlled release vehicles, biodegradable implants, liposomes, bacteria, viruses, other cells, oils, esters, and glycols.
- a controlled release formulation that is capable of slowly releasing a composition of the present invention into an animal, plant or the environment.
- a controlled release formulation comprises a composition of the present invention in a controlled release vehicle.
- Suitable controlled release vehicles include, but are not limited to, biocompatible polymers, other polymeric matrices, capsules, microcapsules, microparticles, bolus preparations, osmotic pumps, diffusion devices, liposomes, lipospheres, and transdermal delivery systems.
- Other controlled release formulations of the present invention include liquids that, upon administration, form a solid or a gel in situ.
- Preferred controlled release formulations are biodegradable (i.e., bioerodible).
- a preferred controlled release formulation of the present invention is capable of releasing a composition of the present invention into, for example, the environment, or the blood of an animal, at a constant rate sufficient to attain effective dose levels of the composition to protect against arthropod infestation.
- the composition is preferably released over a period of time ranging from about 1 to about 12 months.
- a preferred controlled release formulation of the present invention is capable of effecting a treatment preferably for at least about 1 month, more preferably for at least about 3 months, even more preferably for at least about 6 months, even more preferably for at least about 9 months, and even more preferably for at least about 12 months.
- concentration of the arthropod control agent that will be required to produce effective compositions for the control of an arthropod pest will depend on the type of organism and the formulation of the composition.
- the effective concentration of the arthropod control agent within the composition can readily be determined experimentally, as will be understood by the skilled artisan. For example, the effective concentration of a virus can be readily determined using techniques known to the art.
- Acceptable protocols to administer compositions of the present invention to animals in an effective manner include individual dose size, number of doses, frequency of dose administration, and mode of administration. Determination of such protocols can be accomplished by those skilled in the art.
- a suitable single dose is a dose that is capable of protecting an animal from arthropod infestation when administered one or more times over a suitable time period.
- a preferred single dose of a composition comprising a polypeptide, polynucleotide or arthropod control agent of the present invention is from about 1 microgram to about 10 milligrams of the composition per kilogram body weight of the animal.
- Boosters can be administered from about 2 weeks to several years after the original administration.
- a preferred administration schedule is one in which from about 10 ⁇ g to about 1 mg of the composition per kg body weight of the animal is administered from about one to about two times over a time period of from about 2 weeks to about 12 months.
- Modes of administration can include, but are not limited to, subcutaneous, intradermal, intravenous, intranasal, oral, transdermal, intraocular and intramuscular routes. Kits
- the present invention also includes a test kit to identify a compound capable of inhibiting esterase activity of an arthropod.
- a test kit includes a polypeptide according to the present invention, having esterase activity and a means for determining the extent of inhibition of esterase activity in the presence of (i.e., effected by) a putative inhibitory compound.
- Such compounds can also be screened to identify those that are substantially not toxic in host animals, plants or the environment.
- D. melanogaster strain 12111.2 were collected at 12 ⁇ 6 hours after the time of puparium formation and stored at -70°C.
- a 100 g of D. melanogater were homogenised on ice with 500 ml of 10 mM KOH acetic acid buffer, pH4.5 and a few milligrams of phenylthiourea in a Sorvall blender.
- the homogenate was clarified by centrifugation at 13,000 g, 4°C for 20 minutes followed by filtration through glass wool.
- the pH of this solution was raised by the addition of an equal volume of 100 mM sodium phosphate buffer, pH 7.0 containing 10% glycerol.
- a 30-60% ammonium sulphate cut was made by appropriate additions of solid ammonium sulphate and the resulting pellet was resuspended in 100 mM sodium phosphate buffer, pH 7.0 containing 10% glycerol to a final volume of 52 ml.
- Acetone (0°C) was slowly added to the resuspended ammonium sulphate pellet with vigorous swirling in an ice/water slurry to a final concentration of 40% (v/v).
- the solution was then centrifuged at 9000 g for 15 minutes at 0°C.
- the supernatant was dialysed overnight at 4°C against 3 1 of 10 mM imidazole/HCl buffer, pH 7.0 containing 10% glycerol. This material in the dialysis tubing was concentrated to less than 50 ml using aquacide III (Calbiochem 17852) to remove the excess water.
- Isoelectric Focussing of the acetone supernatant was performed using a Biorad "Rotofor" apparatus. Three ml of ampholytes (Pharmalyte pH 5-6, Pharmacia) and 10% glycerol were added to the acetone supernatant, bringing the total volume to 50 ml, the volume of the Rotofor focussing chamber. Antifreeze solution at -8°C was circulated through the apparatus to achieve a temperature in the focussing chamber of approx. 2°C. The sample was focussed for 4 h at 12 w, during which time the voltage rose from 300 to 880 v. Twenty 2.5 ml fractions were collected and their protein content, pH and JHE activities were determined.
- Fractions containing JHE activity (pHs 5.35-6.12) were returned to the Rotofor with sufficient 10% glycerol to fill the focussing chamber. These were refocussed for a further 4 h, during which time the voltage rose from 1600 to 1900 v. Then fractions were collected and assayed as above.
- the JHE containing fractions (pHs 5.29-5.56) were pooled, filtered through a 0.22 ⁇ m membrane, and concentrated to 0.5 ml using a Centriprep 30 ultrafiltration device (Amicon).
- the concentrated material from the previous step was diluted to 5ml with 0.1M imidazole/HCl to pH 7.0, 10% glycerol, 1 mM dithiothrietol. It was loaded onto a Pharmacia "Mono Q HR5/5" chromatography column previously equilibrated with the same buffer. The column was washed with 6ml of buffer and eluted with a 20ml linear gradient of 0 to 500 mM NaCl in imidazole buffer at a flow rate of 0.5 ml/min.. The gradient eluate was collected in 1 ml fractions.
- the JHE containing fractions from the Mono Q column (265-335 mM NaCl) were concentrated to about 100 ⁇ l using a Centricon 30 ultrafiltration device (Amicon) and loaded onto a Pharmacia "Superose 6" 30 ml gel filtration column previously equilibrated with two column volumes of the above imidazole buffer.
- the column was eluted with imidazole buffer at a flow rate of 0.5 ml/min and 1 ml fractions were collected.
- the two fractions containing JHE activity (around 16.5 ml elution volume) were stored at 20°C overnight then assessed for purity by SDS-PAGE and silver staining.
- the PAGE gels were then stored dry at room temperature between sheets of Promega gel drying film.
- a radiometric partition assay for JHE activity was used for monitoring the purification of JHE.
- the partition assay consists of an incubation of the enzyme with chain-labelled 3 H-JH ⁇ I which is hydrolysed to yield 3 H-JHIII-acid.
- the reaction is stopped by the addition of organic solvent which extracts the JHIII while the JHHI-acid product remains in the aqueous phase.
- the reaction is quantified by determining the amount of 3 H in the aqueous phase using liquid scintillation counting.
- reaction rate per mole of JHE (k C( ⁇ ) that we report for JHIII was calculated immediately after the final separation step using the fraction that appeared homogeneous (Fraction 6).
- the calculation used the enzyme's molecular weight (66 kDa) estimated from its mobility on SDS-PAGE, the JHE activity of fraction 6, and the protein content of fraction 6. Aliquots of Fr7 were used to calculate other kinetic parameters. This fraction contained an unidentified protein that did not have JHE activity. Fortunately, the constants k M and iq are independent of the absolute amount of active enzyme so the presence of the unidentified protein could be ignored.
- the type of inhibition and inhibition constants ( s) were determined for three forms of JH.
- the assays were as described above except that the 3 H- JHi ⁇ concentration was varied, potential inhibitors were included in some assays, and the assay tubes were pretreated with 2% polyethyleneglycol ("Carbowax" Compound 4000, Union Carbide) to minimise adsorption of JH (and its analogues) to the glass.
- JHIII 89 ⁇ 12 nM
- JHB 3 1.2 ⁇ 0.4 ⁇ M
- methyl farnesoate 3.33 ⁇ 0.36 ⁇ M
- JHI 3.34 ⁇ 0.47 ⁇ M
- the JHB 3 used to determine the I was a racemate of four possible stereoisomers.
- the binding affinity for the natural stereoisomer (6S,7S,10R) is greater than for the three unnatural isomers. Therefore the lq for 6S,7S,10R JHB 3 is lower than 1.2 ⁇ M.
- JHE shows preferential binding to the natural 6S,7S,10R stereoisomer of JHB 3 .
- High affinity binding of JHB 3 is likely to be unique to JHEs from higher Diptera as this form of JH has only been found in the higher Diptera.
- Example 3 Peptide mass fingerprint ofD. melanogaster JHE.
- JHE bands were cut from silver-stained SDS-PAGE gels that had been stored between sheets of Promega gel drying film.
- the two JHE bands were processed separately as follows to obtain two peptide mass fingerprints.
- the bands were rehydrated with lO ⁇ l of water, and the film was removed.
- In-gel digestion of the protein was performed with reduction and carbamidomethylation of any cysteine residues.
- the pieces of gel were incubated with 2.8 mM dithiothrietol in ammonium bicarbonate solution (160 ⁇ l, 100 mM) for 30 minutes at 60°C. lodoacetamide (10 ⁇ l, 5.9 mM final cone.) was added and the reaction was kept for a further 30 minutes at room temperature in the dark.
- the gel pieces were washed twice with 50% acetonitrile/0.1% trifluoroacetic acid, dried under vacuum, rehydrated with 150 ng of trypsin (Promega sequencing grade) in 10 ⁇ l ammonium bicarbonate (100 mM), incubated overnight at 37°C, then extracted twice with 50% acetonitrile/0.1% trifluoroacetic acid in a sonicating water bath.
- the extracts were pooled and dried in a vacuum centrifuge, redissolved in 2 ⁇ l of matrix solution (10 mg/ml of ⁇ -cyano, 4-hydroxy, cinnamic acid in 50% acetonitrile/0.1% trifluoroacetic acid), and dried on the sample plate of a Voyager Elite MALDI-TOF mass spectrometer (Perseptive Biosystems). Peptides in a trypsin digest of bovine serum albumin (927.4940 and 2045.0285) were used for a close external calibration of the JHE digest.
- the mass list from the JHE digest was used to search the NCBInr database (29/3/2000, Drosophila only) using ProFound software (Version 4.8.5, Rockefeller University) after the masses of a trypsin autolysis peptide (842.5) and several peptides derived from human keratin were excluded. The largest and smallest masses from the best matching sequence were used for internal calibration of the mass spectrum and the search was repeated with a mass tolerance of 30 ppm.
- Tryptic digest peptides were recovered from two JHE bands from SDS- PAGE gels of purified D. melanogaster JHE.
- the peptide mass spectra from the two gels were virtually identical and one is shown in Figure 2.
- the mRNA sequence of the JHE gene was determined using 3'- and 5'- Rapid Amplification of cDNA Ends (RACE). Primers were chosen so that 3'- and 5'-RACE would yield overlapping products and therefore the complete cDNA sequence of the JHE gene.
- Polyadenylated RNA was isolated from homogenates of whole D. melanogaster prepupae, strain 12111.2, aged as above for peak JHE activity (Campbell et al., 1992). Approximately 50 mg of prepupae yielded 3.4 ⁇ g of purified mRNA using the QuickPrep Micro mRNA Purification Kit (Amersham Pharmacia Biotech). This mRNA (1 ⁇ g) was used as the template for the 5'RACE System (Gibco BRL).
- Two antisense primers (5'-GTT-CTG-ATC-CTT-TAG-GCC-3') (SEQ ID NO:5) and (5'-GGC-CAA-AGT- TAC-CAG-ACA-TCA-3 1 ) (SEQ ID NO:6), were designed for nested PCR from the predicted D. melanogaster cDNA sequence CG8425, and synthesised by GeneWorks.
- the 5'RACE product was cloned using the pGem-T Easy Vector System (Promega) and sequenced with pUC/Ml3 forward and reverse universal vector primers (Bresatec).
- first strand cDNA was synthesised from 1 ⁇ g of D. melanogaster prepupal mRNA using AMV Reverse Transcriptase (Promega), and 0.48 ⁇ g of a poly-T adaptor primer (5'-GCG-GCC-GCT-TGA-ATT-CCC- ACT-TTT-TTT-TTT-TTT-TTT-TTT-T-3') (SEQ ID NO: 7) according to Promega Technical Bulletin No.502, with the addition of fresh DTT (20mM final concentration).
- Second strand synthesis and PCR amplification of cDNA used 50 pmoles of adaptor primer (5'-GCG-GCC-GCT-TGA-ATT-CCC-AC-3') (SEQ ID NO:8) and a CG8425 -derived primer (5'-GTT-GTC-TAC-GGC-GAT- GAG-3') (SEQ ID NO:9), 1 mM MgCl 2 , 0.2 mM dNTP mix, IX Taq DNApolymerase reaction buffer and lOu Taq DNA polymerase (Gibco BRL), and 1 ⁇ l of a 1:20 dilution of the first strand cDNA mRNA mixture, in a total volume of 50 ⁇ l.
- adaptor primer 5'-GCG-GCC-GCT-TGA-ATT-CCC-AC-3'
- CG8425 -derived primer 5'-GTT-GTC-TAC-GGC-GAT- GAG-3'
- amplification conditions were used: 3 minutes at 94°C for initial denaturation followed by 40 cycles of 94°C for 45 seconds, 50°C for 1 minute, and 72°C for 2 minutes. Final extension conditions were 72°C for 7 minutes.
- a second, he mi-nested round of PCR was performed using 1 ⁇ l of the first reaction mixture (purified using the QAIquick PCR Purification Kit, Qiagen), 50 pmoles each of adaptor primer and another CG8425-derived primer (5'-CGC-ACT-ACC-TGT-AAT-GGT-CTA- 3') (SEQ ID NO: 10).
- Conditions and other reagents were as above except that the annealing was performed at 57°C.
- the gel purified product (QAIquick PCR Purification Kit, Qiagen) was cloned into the pSTBlue-1 vector (Perfectly Blunt Cloning Kit, Novagen) and sequenced. All incubations and PCR cycling was performed on either a PerkinElmer GeneAmp PCR System 9700 or 2400. Sequencing was performed by the ABI Prism BigDye terminator method (Perkin-Elmer) .
- the open reading frame encoding D. melanogaster JHE, and the translation thereof, is provided in Figure 3.
- the isolated D. melanogaster JHE cDNA shares some common sequence to the Drosophila genome project's predicted product CG8425 (Adams et al, 2000).
- the cDNA confirms the predicted CG8425 product except that the fifth predicted intron was not removed; instead there is an in-frame stop codon immediately after the predicted splice site followed by a polyadenylation signal and a polyA tail.
- conserveed features of carboxylesterases found in JHE of the present invention include a catalytic triad composed of Ser213, His471 and Glu346.
- D. melanogaster JHE shows 29% identity overall with the full-length sequences of JHE from the lepidopterans Heliothis virescens and Choristoneura fumiferana (Feng et al., 1999). This is only slightly greater than the degree of identity found among carboxylesterases in general.
- JHE of the present invention could be used in preference to the H. virescens JHE in at least two situations. Firstly, it might be more effective for degrading JH in non-lepidopteran insects, especially higher Diptera, as a consequence of a different spectrum of binding preferences among the different forms of JH. D.
- JHE melanogaster JHE shows similar kinetics to the Lepidopteran JHE with JHIII but it also shows good binding affinity for JHB 3 , the form of JH that is apparently unique to the higher Diptera. It is reasonable to assume that the D. melanogaster enzyme has evolved to hydrolyse JHB 3 efficiently. Secondly, JHE of the present invention might be more effective in Lepidoptera if its structure is sufficiently different from the lepidopteran enzyme to avoid recognition by a specific mechanism for the removal of JHE.
- RNA was isolated from D. melanogaster as described in Example 4.
- the JHE cDNA was amplified from the RNA using the oligonucleotides
- JheRTPCR.F2 f ⁇ 'CGCGGATCCGCGATGCTACAACTGCTGCTTCT 3') (SEQ ID NO:ll) and JheRTPCR.R2
- SUPERSCRIPT One-Step RT-PCR with PLATINUM T ⁇ q kit (Life Technologies) was used to amplify the JHE cDNA.
- the 50 ⁇ l reaction contained (final concentrations); lx Reaction Mix, 200ng D. melanogaster prepupal RNA, 0.2 ⁇ M JheRTPCR.F2, 0.2 ⁇ M JheRTPCR.R2, l ⁇ l RT/PLATINUM Taq Mix.
- the following amplification cycles were used; 50°C for 30 min, 94°C for 2 min, followed by 35 cycles of 94°C for 15 sec, 48°C for 30 sec, 72°C for 2 min, finished with a final amplification step of 72°C for 10 min.
- the B ⁇ mHI and Xbal digested RT-PCR product was purified by agarose gel electrophoresis and the QIAquick PCR Purification Kit (QIAGEN), then ligated into the pFastBacl plasmid multiple cloning site, previously digested with BamH and Xbal.
- the ligation mix was transformed into TG-1 heat shock cells and bacmid DNA prepared and isolated according to the Instruction Manual, BAC-TO-BAC Baculovirus Expression Systems (Gibco BRL LIFE TECHNOLOGIES) .
- Sf9 cells were transfected with the recombinant DNA prepared above according to the Instruction Manual, BAC-TO-BAC Baculovirus Expression Systems (Gibco BRL LIFE TECHNOLOGIES) with the following modifications.
- Grace's cell culture medium was substituted for Sf-900 II Serum Free Medium.
- Solution A contained 9 ⁇ l mini-prep bacmid DNA and 41 ⁇ l lxHepes Buffered Saline,
- Solution B contained 15 ⁇ l DOTAP transfection reagent and 35 ⁇ l lxHBS.
- the JHE/pFastBacl viral supernatant titre was amplified in Sf9 cell mono-layer cultures grown in Grace's cell culture medium. A 25 cm 2 flask was seeded to high confluence (approximately 2xl0 ⁇ cells) and 2 ml of JHE/pFastBacl viral supernatant (first passage) was added to a total of 3 ml of Grace's cell culture medium and incubated at 27 °C for 72 hours. The culture was harvested and centrifuged at lOOg for 5 min, the JHE/pFastBacl viral supernatant (second passage) was removed.
- This supernatant (1ml) was used to infect a 75 cm 2 flask at high confluence, approximately 5xlO e cells, in 20 ml of Grace's cell culture medium.
- the 75 cm 2 infected culture was incubated at 27°C and harvested after 72 hours, centrifuged at lOOg for 5 min to remove cells from the JHE/pFastBacl viral supernatant (third passage) which was titred and used to infect the final expression culture.
- JHE gene was performed in a 10 ml suspension culture of Sf9 cells with a concentration of 1.5xl0 6 cells/ml in HyQ SFX- Insect serum free medium (HyClone) using JHE/pFastBacl viral supernatant (third passage) at a multiplicity of infection of 5 pfu/ml.
- HyQ SFX- Insect serum free medium HyClone
- JHE/pFastBacl viral supernatant third passage
- the JHE activities of the resuspended cell pellets (lO ⁇ l) and the supernatants (lO ⁇ l) were determined using the assay described in Example 1 and adjust to reflect the activities of the original 10ml cultures.
- JHE activity was found in the culture expressing JHE cDNA (15 nmoles/min/lOml culture) compared with the control culture (0.34 nmoles/min/lOml culture) confirming that the D. melanogaster JHE cDNA encodes a protein with JHE activity. Most of the JHE activity detected in the control culture was present in the cells (0.27 nmoles/min/lOml culture) rather than the supernatant fraction (0.07 nmoles/min/lOml culture).
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Dentistry (AREA)
- General Engineering & Computer Science (AREA)
- Environmental Sciences (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Biomedical Technology (AREA)
- Pest Control & Pesticides (AREA)
- Virology (AREA)
- Agronomy & Crop Science (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Enzymes And Modification Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The present invention relates to the use of juvenile hormone esterases in the development of strategies for controlling arthropod populations. The methods of identifying arthropod control agents of the present invention are based on the cloning and characterization of a cDNA encoding Drosophila melanogaster juvenile hormone esterase.
Description
JUVENILE HORMONE ESTERASE
Field of the Invention;
The present invention generally relates to the use of juvenile hormone esterases in the development of strategies for controlling arthropod populations. In particular, the present invention relates to methods for identifying arthropod control agents which modulate the production and/or activity of juvenile hormone esterase.
Background of the Invention:
Juvenile hormones Hs) are one of several important classes of arthropod hormones whose interplay regulates development and reproduction (for a review see Riddiford, 1993). The most well characterised role of JH is in the regulation of the larval-pupal transition through interaction with ecdysone. It also plays roles in various other processes including the regulation of egg production, the development of both male and female gonadotrophic hormones, caste determination and diapause. The JH system is best understood in insects but key aspects of the system may be common to all arthropods (Cusson et al., 1991). The most common form of JH is JHIII (methyl (2E,6E)-10,ll-epoxy-
3,7,11-trimethyl 2,6-dodecadienoate), which is found in all insect orders so far investigated (Schooley et al., 1984). The lepidopteran and dipteran orders differ from most other insects by having other forms of JH in addition to JHIII. These are similar to JHIII, differing slightly by the substituents on the acid moiety. All are esters of methanol, have a 10(R),11 epoxide group and a 2,3 double bond. The Lepidoptera have JH0, JHI, JHII and 4-methyl JHI forms of JH, while the JHIII bisepoxide (JHB3, in which the 6,7 double bond of JHUI is replaced by a 6S,7S epoxide group) has been found only in the higher Diptera (Schooley et al, 1984; Richard et al, 1989). In Drosophila melanogaster JHIII is a minor and JHB3 a major form of juvenile hormone.
The regulation of JH titre is achieved by a balance between synthesis and degradation, although other mechanisms such as sequestration and secretion may also contribute. The two main degradative pathways for JH are hydrolysis of the ester and epoxide groups by JH esterase (JHE) and JH epoxide hydrolase (JHEH), respectively. JH degradation has been studied most extensively in the hemolymph of final instar larval Lepidoptera, in
which degradation occurs via JHE. Key features of this period are the general occurrence of a pre-wandering peak and a pre-pupation peak of JHE in the hemolymph, which correlate inversely with haemolymph JH titre. In Diptera, larval JH hydrolysing enzymes are found in the haemolymph and other tissues, and the relative contributions of JHE and JHEH to total activity vary among species. There is a minimum of JH degrading activity late in the final instar, but a high level of soluble, circulating JHE activity occurs soon after the formation of the puparium and before pupation, probably clearing JH from the whole organism. This JHE is retained, though declining in activity, through the pupal stage. In adults lower levels of both JHE and JHEH are found, though with different subcellular distributions, possibly modulating the JH signal in specific tissues or turning off the JH signal after it has reached its site of action.
Juvenoid insecticides have been developed, such as methoprene, hydroprene and pyriproxifen, which disrupt JH metabolism. However, there is a need for further agents which can be used to disrupt the JH signaling system.
Summary of the Invention: The present inventors have identified a juvenile hormone esterase from
Drosophila melanogaster. Knowledge of this esterase can be used for designing screening strategies to identify arthropod control agents for disrupting arthropod development and/or reproduction, and hence provide means for controlling arthropod populations. In one aspect, the present invention provides a method of identifying an arthropod control agent, the method comprising a) exposing a polypeptide with juvenile hormone esterase activity which is at least 90% identical to SEQ ID NO:l to a candidate agent, and b) assessing the ability of the candidate agent to modulate the juvenile hormone esterase activity of the polypeptide.
In one embodiment, the agent inhibits juvenile hormone esterase activity of the polypeptide. In another embodiment, the agent enhances juvenile hormone esterase activity of the polypeptide.
In one example of the present invention, the polypeptide can be used to hydrolyse an artificial esterase substrate, α-naphthyl acetate, yielding α- naphthol which can be detected by a change of absorbance at 235 nm or at
visible wavelengths after reaction with certain diazo dyes such as Fast Blue BN (Campbell et al, 1998). Candidate agents can be included in such an assay to determine if they are suitable arthropod control agents.
In a particularly preferred embodiment, the arthropod control agent directly binds the polypeptide.
Preferably, the polypeptide is at least 300 amino acids in length.
Preferably, the juvenile hormone esterase activity is the ability to hydrolyse a juvenile hormone selected from the group consisting of: JHO, JHE, JHTI, JHIII and JHB3. More preferably, the juvenile hormone esterase activity is the ability to hydrolyse a juvenile hormone selected from the group consisting of: JHIII and JHB3.
In another aspect, the present invention provides a method of identifying an arthropod control agent, the method comprising a) exposing a polypeptide which is at least 90% identical to SEQ ID NO:l to a binding partner which binds the polypeptide, and a candidate agent, and b) assessing the ability of the candidate agent to compete with the binding partner for binding to the polypeptide.
Preferably, the binding partner is detectably labeled. Preferably, the binding partner is juvenile hormone.
Preferably, the polypeptide has juvenile hormone esterase activity.
In silico techniques can also be employed to identify arthropod control agents.
Accordingly, in a further aspect the present invention provides a method of identifying an arthropod control agent, the method comprising
(a) determining the atomic coordinates defining the three-dimensional structure of a polypeptide with juvenile hormone esterase activity which is at least 90% identical to SEQ ID NO:l;
(b) selecting a candidate compound by performing rational drug design with the atomic coordinates obtained in step (a), wherein said selecting is performed in conjunction with computer modeling; and
(c) determining the ability of the candidate compound to modulate the juvenile hormone esterase activity of the polypeptide.
In another aspect, the present invention provides a crystal of a polypeptide with juvenile hormone esterase activity which is at least 90% identical to SEQ ID NO:l.
In yet another aspect, the present invention provides a method of arthropod control agent design comprising using the structural coordinates of a crystal of the present invention to computationally evaluate a compound for its ability to modulate juvenile hormone esterase activity of the polypeptide. In another aspect, the present invention provides a method of identifying an arthropod control agent, the method comprising a) exposing a polynucleotide encoding a polypeptide with juvenile hormone esterase activity which is at least 90% identical to SEQ ID NO:l, to a candidate agent under conditions which allow expression of the polynucleotide, and b) assessing the ability of the candidate agent to modulate levels of polypeptide produced by the polynucleotide.
In one embodiment, the agent inhibits production of the polypeptide. In another aspect, the present invention provides a method of identifying an arthropod control agent, the method comprising a) exposing a polynucleotide which is at least 90% identical to SEQ ID NO:4 to a candidate agent, and b) assessing the ability of the candidate agent to hybridize and/or cleave the polynucleotide. The methods of identifying arthropod control agents of the present invention preferably further comprise the step of selecting a candidate compound to be developed as a lead compound. Furthermore, the methods of identifying arthropod control agents of the present invention preferably further comprise formulating the arthropod control agent in an arthropod control composition comprising an agriculturally acceptable carrier.
In another aspect, the present invention provides a substantially purified polypeptide having juvenile hormone esterase activity, the polypeptide being selected from the group consisting of:
(i) a polypeptide comprising the sequence of SEQ ID NO:l; or (ii) a polypeptide which has a sequence which is at least 90% identical to (i); wherein the polypeptide is not more than 600 residues in length. Preferably, the polypeptide has a sequence which is at least 95% identical to (i). More preferably, the polypeptide has a sequence which is at least 99% identical to (i).
Further, it is preferred that the polypeptide is at least 300 amino acids in length.
In another aspect, the present invention provides a substantially purified polypeptide having juvenile hormone esterase activity, the polypeptide being selected from the group consisting of:
(i) a polypeptide comprising the sequence of SEQ ID NO:l; or
(ii) a polypeptide which is at least 31% identical to (i); or wherein the polypeptide is not more than 600 residues in length.
Preferably, the polypeptide is at least 40% identical to (i), more preferably at least 50% identical, more preferably at least 60% identical, more preferably at least 70% identical, more preferably at least 80% identical, and even more preferably at least 90% identical to (i).
Preferably, the polypeptide is at least 300 amino acids in length.
In another aspect, the invention provides a polynucleotide encoding a polypeptide according to the present invention.
In one embodiment, the polynucleotide has a sequence selected from:
(i) a sequence of nucleotides shown in SEQ ID NO:3;
(ii) a sequence of nucleotides shown in SEQ ID NO:4; or
(iii) a sequence which hybridizes to (i) or (ii) under high stringency conditions.
Preferably, the polynucleotide has a sequence which is less than 1660 nucleotides. However, the polynucleotide can be less than 1000 or even 500 nucleotides in length. Preferably, the polynucleotides of the present invention are at least 18 nucleotides in length. In a further aspect, the present invention provides an antisense polynucleotide which hybridizes under high stringency conditions to a polynucleotide of the present invention.
Preferably, antisense polynucleotide comprises a catalytic domain. Accordingly, the antisense polynucleotide can be a catalytic enzyme. Preferably, the catalytic enzyme is selected from the group consisting of ribozymes and deoxyribozymes.
In another aspect, the present invention provides a double stranded RNA (dsRNA) molecule comprising a polynucleotide according to the present invention.
Preferably, the dsRNA is encoded by a single open reading frame and the resulting dsRNA molecule has a stem loop structure at one end of the molecule.
In yet another aspect, the present invention provides a fusion protein comprising a polypeptide according to the present invention fused to at least one other polypeptide sequence.
Preferably, the at least one other polypeptide is selected from the group consisting of: a polypeptide that enhances the stability of the polypeptide of the present invention, a polypeptide that acts as an immunopotentiator to enhance an immune response to a polypeptide of the present invention, and a polypeptide that assists in the purification of the fusion protein.
In another aspect, the present invention provides an isolated polynucleotide that encodes a fusion protein of the present invention.
In a further aspect, the present invention provides a vector comprising a polynucleotide according to the present invention.
Preferably, the polynucleotide is operably linked to a promoter.
In a further aspect, the present invention provides a vector comprising an antisense polynucleotide of the present invention.
Preferably, the antisense polynucleotide is operably linked to a promoter.
In a further aspect, the present invention provides a vector comprising an open reading frame(s) which upon expression forms a dsRNA molecule according of the present invention.
Preferably, the dsRNA molecule is operably linked to a promoter. In a further preferred embodiment, the vector of the present invention is a plasmid or a virus. More preferably, the viral vector is a baculovirus.
In a particularly preferred embodiment, the vector is a capsoid.
In another embodiment, the present invention provides a host cell transformed or transfected with the vector according to the present invention. In one embodiment, the host cell is a bacterial cell. In another embodiment, the host cell is an arthropod cell, more preferably an insect cell.
In another aspect, the present invention provides a transgenic plant, the plant having been transformed with a polynucleotide according to the present invention, wherein the plant expresses the polynucleotide. In another aspect, the present invention provides a transgenic plant, the plant having been transformed with an antisense polynucleotide
according to the present invention, wherein the plant expresses the antisense polynucleotide.
In another aspect, the present invention provides a transgenic plant, the plant having been transformed with open reading frame(s) which, upon expression, form a dsRNA molecule according to the present invention, wherein the plant produces the dsRNA molecule.
Since there are many arthropods which feed off live animals, for instance mosquitoes and the larvae of Lucilia cuprina, the present invention provides a non-human animal transformed with the molecules of the invention.
Accordingly, in another aspect, the present invention provides a transgenic non-human animal, the animal having been transformed with a polynucleotide according to the present invention, wherein the animal expresses the polynucleotide. In another aspect, the present invention provides a transgenic non- human animal, the animal having been transformed with an antisense polynucleotide according to the present invention, wherein the animal expresses the antisense polynucleotide.
In another aspect, the present invention provides a transgenic non- human animal, the animal having been transformed with open reading frame(s) which, upon expression, form a dsRNA molecule according to the present invention, wherein the animal produces the dsRNA molecule.
In another aspect, the present invention provides an arthropod control composition, the composition comprising an agent identified according to the present invention, and an agriculturally acceptable carrier.
In another aspect, the present invention provides an arthropod control composition, the composition comprising a polypeptide according to the present invention, and an agriculturally acceptable carrier.
In another aspect, the present invention provides an arthropod control composition, the composition comprising a vector according to the present invention, and an agriculturally acceptable carrier.
In another aspect, the present invention provides a method of controlling an arthropod population, the method comprising exposing members of the arthropod population to an arthropod control composition according to the present invention.
Preferably, the arthropod is an insect.
In another aspect, the present invention provides a process for preparing a polypeptide according to the present invention, the process comprising cultivating a host cell transformed or transfected with a vector encoding a polynucleotide of the present invention under conditions providing for expression of the polynucleotide encoding the polypeptide, and recovering the expressed polypeptide.
This process can be used for the production of commercially useful quantities of the encoded polypeptide.
In another aspect, the present invention provides a kit for identifying an arthropod control agent, the kit comprising a polypeptide according to the present invention, and means for determining juvenile hormone esterase activity.
In another aspect, the present invention provides a kit for identifying an arthropod control agent, the kit comprising a polynucleotide according to the present invention, and means for determining juvenile hormone esterase activity of a polypeptide encoded by the polynucleotide.
In numerous other aspects of the present invention, the polypeptides, polynucleotides, antisense polynucleotides, dsRNA molecules, vectors, host cells and arthropod control agents can be used in a multitude of ways to control arthropod populations.
The terms "comprise", "comprises" and "comprising" as used throughout the specification are intended to refer to the inclusion of a stated component or feature or group of components or features with or without the inclusion of a further component or feature or group of components or features. The invention is hereinafter described by way of the following non- limiting examples and with reference to the accompanying figures.
Brief Description of the Accompanying Figures:
Figure 1. Inhibition of JHIII hydrolysis by juvenile hormone analogues. JH analogues (lOμM) were incubated with 3H-JHHI (56 nM) and JHE. Control incubations had no JH analogue addition (0% inhibition). Greater inhibition indicates that the compound binds more tightly to JHE. (A) JH analogues differing in the size of the carboxyl chain, (B) JH analogues differing in the alcohol moiety, (C) JH analogues with the 10,11 epoxide is present (like JHT I) differing by the presence (+) or absence (-) of double bonds, (D) JH analogues with the 10,11 epoxide absent (like methyl farnesoate) differing by the
presence (+) or absence (-) of double bonds, (E) JH analogues differing by the presence or absence of 6,7 and 10,11 epoxide moieties (racemic), (F) the four possible stereoisomers of JHB3, (G) three JH analogues carrying hydroxyl groups on the carboxyl chain, with JHIII and methylfarnesoate included for comparison, and (H) two insecticides, hydroprene and methoprene, with JHB3 and JHB3-diene included for comparison.
Figure 2. Tryptic digest fingerprints of purified D. melanogaster JHE recovered from a dried, silver-stained SDS-PAGE gel. Peaks matching the masses predicted from the CG8425 gene product are marked 'J' for JHE. A peak due to trypsin autolysis is marked 'TΛ
Figure 3. JHE cDNA sequence with its translation.
Key to Sequence Listing:
SEQ ID NO:l - D. melanogaster juvenile hormone esterase lacking the N- terminal signal sequence.
SEQ ID NO:2 - D. melanogaster juvenile hormone esterase.
SEQ ID NO:3 - cDNA encoding D. melanogaster juvenile hormone esterase. SEQ ID NO:4 - Open reading frame encoding D. melanogaster juvenile hormone esterase provided as SEQ ID NO:l.
SEQ ID NO:5 and 6 - PCR primers to D. melanogaster cDNA sequence.
SEQ ID NO: 7 - Poly-T adaptor primer.
SEQ ID NO:8 - Adaptor primer for 3'RACE. SEQ ID NO:9 and 10 - PCR primers to D. melanogaster cDNA sequence.
SEQ ID NO: 11 and 12 - PCR primers used to amplify cDNA encoding D. melanogaster juvenile hormone esterase.
Detailed Description of the Invention: General Techniques
Unless otherwise indicated, the recombinant DNA techniques utilized in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T.A.
Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F.M. Ausubel et al. (Editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present) and are incorporated herein by reference.
Arthropod Control Agents, and Methods of Screening Therefor
Arthropod control agents identified using the methods of the present invention can be used to disrupt juvenile hormone esterase activity resulting in the death of the arthropod or at least reduce its rate of reproduction or feeding. For instance, during development, the inhibition of JHE will result in increased JH titres and the blocking of a vital moult, whereas inappropriate expression of JHE will result in a drop in JH titre and a precocious moult. Accordingly, agents which either enhance or inhibit JH esterase activity or levels can be useful in controlling arthropod populations.
As used herein a "lead compound" is an arthropod control agent which is subject to trials with the goal of ultimately being formulated in, for example, a composition and sold as an agent for controlling arthropod pest populations. The lead compound, when exposed to an arthropod, more preferably an insect, disrupts JH esterase activity within the arthropod leading to a reduction in reproduction rates, death, feeding rates etc.
Known screening techniques can be used to identify arthropod control agents which modulate the activity, or production of, a JH esterase of the present invention. For instance, the JH esterase can be used to hydrolyse an artificial substrate resulting in a detectable signal. As outlined above, one example is the hydrolysis of α-naphthyl acetate, yielding α-naphthol which can be detected by a change of absorbance at 235 nm or at visible wavelengths after reaction with certain diazo dyes such as Fast Blue BN (Campbell et al., 1998). Candidate agents can be included in such an assay to determine if they are suitable arthropod control agents. Many reactions screening many potential inhibitors can be performed automatically in microtitre trays using robots to transfer the various solutions and measure the adsorbance of each well. Another method for screening for agonists/antagonists involves mixing the polypeptide with a binding partner (which is capable of binding to the
polypeptide) and measuring their binding to each other in the presence or absence of a potential agonist/antagonist. The polypeptide or the binding partner can be detectably labeled using known labels such as those selected from the group consisting of: radioisotopes, fluorophores and chromophores. Most preferably, the binding partner is labeled juvenile hormone. This binding assay may be in the form of an ELISA plate assay. There are other binding formats known to those of skill in the art, including coprecipitation, centrifugation and surface plasmon resonance.
One potential antagonist is a small molecule which binds to the juvenile hormone binding site of the polypeptide, making it inaccessible to juvenile hormone. Examples of small molecules include, but are not limited to, small peptides, peptide-like molecules, plant secondary metabolites or synthetic organic chemicals.
As described herein, suitable antisense polynucleotide and dsRNA molecules can be designed based on the sequences of the JH esterase encoding polynucleotides of the present invention. Such antisense polynucleotide and dsRNA molecules can be used as arthropod control agents which inhibit the production of JH esterase from the cell of an arthropod which has been transformed with the antisense polynucleotide or dsRNA molecule.
Such antisense polynucleotides and dsRNA molecules can also be screened for use as an arthropod control agent using the methods of the present invention. For instance, a JH esterase encoding polynucleotide of the present invention can be expressed in a cell system, or a cell-free expression system, resulting in the production of JH esterase. Candidate antisense polynucleotides and dsRNA molecules designed based on the sequences of the JH esterase encoding polynucleotides of the present invention can be incorporated into the system and the resulting affects on JH esterase mRNA levels or JH esterase polypeptide levels or activity, can readily be measured using techniques known in the art.
Suitable inhibitors of juvenile hormone esterase activity are compounds that interact directly with a protein's active site, thereby inhibiting that esterase's activity, usually by binding to or otherwise interacting with or otherwise modifying the esterase's active site. Juvenile hormone esterase inhibitors can also interact with other regions of the protein to inhibit esterase activity, for example, by allosteric interaction.
Effective amounts and dosing regimens for the application of arthropod control agents identified by the methods of the present invention can readily be determined using techniques known to those skilled in the art.
Some arthropod control agents identified by the methods of the present invention may also interact with other molecules in the JH system. For instance, some arthropod control agents may, at least partially, act on JH binding proteins, JH receptors and/or JH-degrading enzymes such as JHEH.
Phage Libraries for Arthropod Control Agent Screening Phage libraries can be constructed which when infected into host E. coli produce random peptide sequences of approximately 10 to 15 amino acids. Specifically, the phage library can be mixed in low dilutions with permissive E. coli in low melting point LB agar which is then poured on top of LB agar plates. After incubating the plates at 37°C for a period of time, small clear plaques in a lawn of E. coli will form which represents active phage growth and lysis of the E. coli. A representative of these phages can be absorbed to nylon filters by placing dry filters onto the agar plates. The filters can be marked for orientation, removed, and placed in washing solutions to block any remaining absorbent sites. The filters can then be placed in a solution containing, for example, a radioactively labeled polypeptide of the present invention (e.g., a polypeptide having an amino acid sequence comprising SEQ ID NO:l). After a specified incubation period, the filters can be thoroughly washed and developed for autoradiography. This allows plagues containing the phage that bind to the radioactive polypeptide to be detected. These phages can be further cloned and then retested for their ability to bind to the JH esterase as before. Once the phages have been purified, the binding sequence contained within the phage can be determined by standard DNA sequencing techniques. Once the DNA sequence is known, synthetic peptides can be generated which represents these sequences. The effective peptide(s) can be synthesized in large quantities for use in in vivo models and eventually as an arthropod control agent to disrupt JH esterase activity. It should be emphasized that synthetic peptide production is relatively non-labor intensive, easily manufactured, quality controlled and thus, large quantities of the desired product can be produced rather cheaply.
Protein-Structure Based Design of Arthropod Control Agents
Crystals of a polypeptide of the present invention could be grown by a number of techniques including batch crystallation, vapour diffusion (either by sitting drop or hanging drop) and by microdialysis. Seeding of the crystals in some instances could be required to obtain X-ray quality crystals.
Standard micro and/or macro seeding of crystals may therefore be used. Once a crystal is grown, X-ray diffraction data can be collected using standard techniques.
Once the three-dimensional structure of a polypeptide of the present invention is determined, a potential antagonist or agonist can be examined through the use of computer modeling using a docking program such as GRAM, DOCK, or AUTODOCK (Dunbrack et al., 1997). This procedure can include computer fitting of potential ligands to the JH esterase to ascertain how well the shape and the chemical structure of the potential ligand will complement or interfere with JH esterase activity. Computer programs can also be employed to estimate the attraction, repulsion, and steric hindrance of the ligand to the polypeptide of the present invention. Generally the tighter the fit (e.g., the lower the steric hindrance, and/or the greater the attractive force) the more potent the potential arthropod control agent will be since these properties are consistent with a tighter binding constant. Furthermore, the more specificity in the design of a potential arthropod control agent the more likely that the arthropod control agent will not interfere with other proteins. This will minimize potential side-effects due to unwanted interactions with other proteins. Initially a potential compound could be obtained, for example, by screening a random peptide library produced by a recombinant bacteriophage as described above, or a chemical library. A compound selected in this manner could be then be systematically modified by computer modeling programs until one or more promising potential compounds are identified. Such computer modeling allows the selection of a finite number of rational chemical modifications, as opposed to the countless number of essentially random chemical modifications that could be made, and of which any one might lead to a useful arthropod control agent. Each chemical modification requires additional chemical steps, which while being reasonable for the synthesis of a finite number of compounds, quickly becomes overwhelming if all possible modifications needed to be
synthesized. Thus through the use of the three-dimensional structure and computer modeling, a large number of these compounds can be rapidly screened on the computer monitor screen, and a few likely candidates can be determined without the laborious synthesis of untold numbers of compounds.
The prospective arthropod control agent can be placed into any standard binding assay to test its effect on JH esterase activity.
For all of the arthropod control agent screening assays described herein further refinements to the structure of the arthropod control agent will generally be necessary and can be made by the successive iterations of any and/or all of the steps provided by the particular arthropod control agent screening assay.
Polypeptides By "substantially purified" we mean a polypeptide that has been separated from the lipids, nucleic acids, other polypeptides, and other contaminating molecules with which it is associated in its native state.
The % identity of a polypeptide is determined by GAP (Needleman and Wunsch, 1970) analysis (GCG program) with a gap creation penal ty=5, and a gap extension penalty =0.3. The query sequence is at least 15 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 15 amino acids. More preferably, the query sequence is at least 50 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 50 amino acids. Even more preferably, the query sequence is at least 100 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 100 amino acids. More preferably, the query sequence is at least 250 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 250 amino acids. Even more preferably, the query sequence is at least 500 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 500 amino acids.
As used herein a "biologically active fragment" of a polypeptide of the present invention is a portion of the polypeptide which has JH esterase activity. Polypeptides of the present invention can either be naturally occurring
(e.g. SEQ ID NO:l or 2) or mutants and/or fragments thereof.
Amino acid sequence mutants can be prepared by introducing appropriate nucleotide changes into DNA, or by in vitro synthesis of the desired polypeptide. Such mutants include, for example, deletions, insertions or substitutions of residues within the amino acid sequence. A combination of deletion, insertion and substitution can be made to arrive at the final construct, provided that the final protein product possesses the desired characteristics.
In designing amino acid sequence mutants, the location of the mutation site and the nature of the mutation will depend on characteristic (s) to be modified. The sites for mutation can be modified individually or in series, e.g., by (1) substituting first with conservative amino acid choices and then with more radical selections depending upon the results achieved, (2) deleting the target residue, or (3) inserting other residues adjacent to the located site. Amino acid sequence deletions generally range from about 1 to 30 residues, more preferably about 1 to 10 residues and typically about 1 to 5 contiguous residues.
Substitution mutants have at least one amino acid residue in the polypeptide molecule removed and a different residue inserted in its place. The sites of greatest interest for substitutional mutagenesis include sites identified as the active and/or binding site(s). Other sites of interest are those in which particular residues obtained from various species are identical. These positions may be important for biological activity. These sites, especially those falling within a sequence of at least three other identically conserved sites, are preferably substituted in a relatively conservative manner. Such conservative substitutions are shown in Table 1 under the heading of "exemplary substitutions".
Hammock and co-inventors have shown that a double lysine mutant (K29R, K522R) and a catalytic serine mutant (S201G) of JHE enhance the ability of recombinant baculoviruses expressing JHE to kill in both Heliothis virescens and Trichoplusia ni (US 5,643,776). Removal of the two lysines is most likely important for preventing the specific degradation of the JHE protein by ubiquitin and lysosomal pathways; removal of the catalytic serine to produce an inactive enzyme possibly enhances lethality by binding and sequestering JH. Hammock and co-inventors have improved the insecticidal activity of recombinant baculoviruses expressing JHE even further by
removing the signal sequence that targets the JHE enzyme to the plasma membrane (US 5,674,485). Non-glycosylated JHE then accumulates in the cytoplasm of baculovirus infected cells. Similar mutations could be performed on the polypeptide provided as SEQ ID NO:l.
TABLE 1
Furthermore, if desired, unnatural amino acids or chemical amino acid analogues can be introduced as a substitution or addition into the polypeptides of the present invention. Such amino acids include, but are not limited to, the D-isomers of the common amino acids, 2,4-diaminobutyric acid, α-amino isobutyric acid, 4-aminobutyric acid, 2-aminobutyric acid, 6- amino hexanoic acid, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, β-alanine, fluoro-amino acids, designer amino acids such as β-methyl amino acids, Cα-methyl amino acids, Nα-methyl amino acids, and amino acid analogues in general.
Also included within the scope of the invention are polypeptides of the present invention which are differentially modified during or after synthesis, e.g., by biotinylation, benzylation, glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. These modifications may serve to increase the stability and/or bioactivity of the polypeptide of the invention.
Polypeptides of the present invention can be produced in a variety of ways, including production and recovery of natural proteins, production and recovery of recombinant proteins, and chemical synthesis of the proteins. In one embodiment, an isolated polypeptide of the present invention is produced by culturing a cell capable of expressing the polypeptide under conditions effective to produce the polypeptide, and recovering the polypeptide. A preferred cell to culture is a recombinant cell of the present invention. Effective culture conditions include, but are not limited to, effective media, bioreactor, temperature, pH and oxygen conditions that permit protein production. An effective medium refers to any medium in which a cell is cultured to produce a polypeptide of the present invention. Such medium typically comprises an aqueous medium having assimilable carbon, nitrogen and phosphate sources, and appropriate salts, minerals, metals and other nutrients, such as vitamins. Cells of the present invention can be cultured in conventional fermentation bioreactors, shake flasks, test tubes, microtiter dishes, and petri plates. Culturing can be carried out at a temperature, pH and oxygen content appropriate for a recombinant cell.
Such culturing conditions are within the expertise of one of ordinary skill in the art.
Polynucleotides By "isolated polynucleotide" we mean a polynucleotide separated from the polynucleotide sequences with which it is associated or linked in its native state. Furthermore, the term "polynucleotide" is used interchangeably herein with the term "nucleic acid molecule".
The % identity of a polynucleotide is determined by GAP (Needleman and Wunsch, 1970) analysis (GCG program) with a gap creation penalty=5, and a gap extension penalty=0.3. The query sequence is at least 45 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 45 nucleotides. Preferably, the query sequence is at least 150 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 150 nucleotides. More preferably, the query sequence is at least 300 nucleotides in length and the GAP analysis aligns the two sequences over a region of at least 300 nucleotides.
A polynucleotide sequence of the present invention may hybridise under high stringency conditions to the sequence set out in SEQ ID NO: 3 or SEQ ID NO: 4. In particular, an antisense polynucleotide of the present invention can hybridise under high stringency conditions to the sequence set out in SEQ ID NO: 3 or SEQ ID NO: 4. As used herein, high stringency conditions are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate/0.1% NaDodS04 at 50°C; (2) employ during hybridisation a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 g/ml), 0.1% SDS and 10% dextran sulfate at 42°C in 0.2 x SSC and 0.1% SDS.
Polynucleotides which will hybridize to SEQ ID NO: 3 or SEQ ID NO: 4, or parts thereof, may possess one or more mutations which are deletions, insertions, or substitutions of nucleotide residues. Mutants can be either naturally occurring (that is to say, isolated from a natural source) or synthetic
(for example, by performing site-directed mutagenesis on the nucleic acid). It is thus apparent that polynucleotides of the invention can be either naturally occurring or recombinant.
Oligonucleotides of the present invention can be RNA, DNA, or derivatives of either. The minimum size of such oligonucleotides is the size required for the formation of a stable hybrid between an oligonucleotide and a complementary sequence on a nucleic acid molecule of the present invention. The present invention includes oligonucleotides that can be used as, for example, probes to identify nucleic acid molecules, primers to produce nucleic acid molecules or arthropod control agents to inhibit juvenile hormone esterase protein production or activity (e.g., as antisense-, triplex formation-, ribozyme- and/or RNA drug-based reagents). Oligonucleotide of the present invention used as a probe are typically conjugated with a label such as a radioisotope, an enzyme, biotin, a fluorescent molecule or a chemiluminescent molecule.
Catalytic Nucleic Acids
The term catalytic nucleic acid refers to a DNA molecule or DNA- containing molecule (also known in the art as a "deoxyribozyme") or an RNA or RNA-containing molecule (also known as a "ribozyme") which specifically recognizes a distinct substrate and catalyzes the chemical modification of this substrate. The nucleic acid bases in the catalytic nucleic acid can be bases A, C, G, T and U, as well as derivatives thereof. Derivatives of these bases are well known in the art. Typically, the catalytic nucleic acid contains an antisense sequence for specific recognition of a target nucleic acid, and a nucleic acid cleaving enzymatic activity (also referred to herein as the "catalytic domain"). The types of ribozymes that are particularly useful in this invention are the hammerhead ribozyme (Haseloff and Gerlach 1988, Perriman et al., 1992) and the hairpin ribozyme (Shippy et al., 1999).
The ribozymes of this invention and DNA encoding the ribozymes can be chemically synthesized using methods well known in the art. The ribozymes can also be prepared from a DNA molecule (that upon transcription, yields an RNA molecule) operably linked to an RNA polymerase promoter, e.g., the promoter for T7 RNA polymerase or SP6 RNA polymerase. Accordingly, also provided by this invention is a nucleic acid
molecule, i.e., DNA or cDNA, coding for the ribozymes of this invention. When the vector also contains an RNA polymerase promoter operably linked to the DNA molecule, the ribozyme can be produced in vitro upon incubation with RNA polymerase and nucleotides. In a separate embodiment, the DNA can be inserted into an expression cassette or transcription cassette. After synthesis, the RNA molecule can be modified by ligation to a DNA molecule having the ability to stabilize the ribozyme and make it resistant to RNase. Alternatively, the ribozyme can be modified to the phosphothio analog for use in liposome delivery systems. This modification also renders the ribozyme resistant to endonuclease activity.
dsRNA dsRNA is particularly useful for specifically inhibiting the production of a particular protein. Although not wishing to be limited by theory, Dougherty and Parks (1995) have provided a model for the mechanism by which dsRNA can be used to reduce protein production. This model has recently been modified and expanded by Waterhouse et al. (1998). This technology relies on the presence of dsRNA molecules that contain a sequence that is essentially identical to the mRNA of the gene of interest, in this case an mRNA encoding a polypeptide according to the first, second or third aspects of the invention. Conveniently, the dsRNA can be produced in a single open reading frame in a recombinant vector or host cell, where the sense and anti-sense sequences are flanked by an unrelated sequence which enables the sense and anti-sense sequences to hybridize to form the dsRNA molecule with the unrelated sequence forming a loop structure. The design and production of suitable dsRNA molecules for the present invention is well within the capacity of a person skilled in the art, particularly considering Dougherty and Parks (1995), Waterhouse et al. (1998), WO 99/32619, WO 99/53050, WO 99/49029, and WO 01/34815.
Recombinant Vectors
One embodiment of the present invention includes a recombinant vector, which includes at least one isolated nucleic acid molecule of the present invention, inserted into any vector capable of delivering the nucleic acid molecule into a host cell. Such a vector contains heterologous nucleic acid sequences, that is nucleic acid sequences that are not naturally found
adjacent to nucleic acid molecules of the present invention and that preferably are derived from a species other than the species from which the nucleic acid molecule(s) are derived. The vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a virus or a plasmid. One type of recombinant vector comprises a nucleic acid molecule of the present invention operatively linked to an expression vector. The phrase operatively linked refers to insertion of a nucleic acid molecule into an expression vector in a manner such that the molecule is able to be expressed when transformed into a host cell. As used herein, an expression vector is a DNA or RNA vector that is capable of transforming a host cell and of effecting expression of a specified nucleic acid molecule. Preferably, the expression vector is also capable of replicating within the host cell. Expression vectors can be either prokaryotic or eukaryotic, and are typically viruses or plasmids. Expression vectors of the present invention include any vectors that function (i.e., direct gene expression) in recombinant cells of the present invention, including in bacterial, fungal, endoparasite, arthropod, other animal, and plant cells. Preferred expression vectors of the present invention can direct gene expression in bacterial, yeast, arthropod and mammalian cells and more preferably in the cell types disclosed herein. In particular, expression vectors of the present invention contain regulatory sequences such as transcription control sequences, translation control sequences, origins of replication, and other regulatory sequences that are compatible with the recombinant cell and that control the expression of nucleic acid molecules of the present invention. In particular, recombinant molecules of the present invention include transcription control sequences. Transcription control sequences are sequences which control the initiation, elongation, and termination of transcription. Particularly important transcription control sequences are those which control transcription initiation, such as promoter, enhancer, operator and repressor sequences. Suitable transcription control sequences include any transcription control sequence that can function in at least one of the recombinant cells of the present invention. A variety of such transcription control sequences are known to those skilled in the art. Preferred transcription control sequences include those which function in bacterial, yeast, arthropod and mammalian cells, such as, but not limited to, tac, lac, trp, trc, oxy-pro, omp/lpp, rrnB, bacteriophage lambda, bacteriophage T7, T7lac, bacteriophage T3,
bacteriophage SP6, bacteriophage SP01, metallothionein, alpha-mating factor, Pichia alcohol oxidase, alphavirus subgenomic promoters (such as Sindbis virus subgenomic promoters), antibiotic resistance gene, baculovirus, Heliothis zea insect virus, vaccinia virus, herpesvirus, raccoon poxvirus, other poxvirus, adenovirus, cytomegalovirus (such as intermediate early promoters), simian virus 40, retrovirus, actin, retroviral long terminal repeat, Rous sarcoma virus, heat shock, phosphate and nitrate transcription control sequences as well as other sequences capable of controlling gene expression in prokaryotic or eukaryotic cells. Additional suitable transcription control sequences include tissue-specific promoters and enhancers as well as lymphokine-inducible promoters (e.g., promoters inducible by interferons or interleukins). Transcription control sequences of the present invention can also include naturally occurring transcription control sequences naturally associated with arthropods. Recombinant molecules of the present invention may also (a) contain secretory signals (i.e., signal segment nucleic acid sequences) to enable an expressed polypeptide of the present invention to be secreted from the cell that produces the polypeptide and/or (b) contain fusion sequences which lead to the expression of nucleic acid molecules of the present invention as fusion proteins. Examples of suitable signal segments include any signal segment capable of directing the secretion of a protein of the present invention. Preferred signal segments include, but are not limited to, tissue plasminogen activator (t-PA), interferon, interleukin, growth hormone, histocompatibility and viral envelope glycoprotein signal segments, as well as natural signal sequences. Suitable fusion segments encoded by fusion segment nucleic acids are disclosed herein. In addition, a nucleic acid molecule of the present invention can be joined to a fusion segment that directs the encoded protein to the proteosome, such as a ubiquitin fusion segment. Recombinant molecules may also include intervening and/or untranslated sequences surrounding and/or within the nucleic acid sequences of nucleic acid molecules of the present invention.
Known arthropod-specific viruses systems can be used to deliver molecules of the present invention. These can be as diverse as large DNA viruses such as the baculoviruses and small RNA viruses. Wild-type viruses are generally ingested by arthropods. Proteins on the surface of the virus bind to cells of the arthropod's gut causing the contents of the virus to enter
the cells. The nucleic acid in the virus then performs two tasks. Firstly, it encodes viral proteins that are required for the assembly of more viruses identical the original virus, and secondly, more copies of the nucleic acid are produced for incorporation into the new virus. When a virus is modified as a vector for producing a protein of interest some additional nucleic acid is inserted into the virus' nucleic acid and may or may not replace some of the virus' original nucleic acid. The site of insertion of the toxin encoding nucleic acid is chosen to ensure that it will be transcribed (if necessary) and translated into the required protein in the virus infected cells. Abundant expression of the protein might require other modifications such as suitable promoter sites in the nucleic acid. It is generally intended that the modified virus would infect a large number of cells in the target arthropod with abundant expression of the protein in all those cells. It is also generally intended that the expression of the proteins hastens or otherwise enhances the detrimental effects on the arthropod of viral infection. In the case of JHE expression the virus-infected arthropod would suffer both viral infection and endocrine disruption which should prove lethal. Such viruses can be formulated to allow them to be sprayed or otherwise distributed on a crop plant (or other material one wishes to protect from arthropod attack) and ingested by arthropods when they start to feed on the crop.
Also known are vector systems that are derived from viruses. An example is the capsoid system (Hanzlik et al., 1999; WO 97/46666). The capsoid system is based on small RNA viruses but differs from viruses in that it does not replicate in the arthropod's cells. Small RNA viruses consist of one or a few RNA molecules which associate with a capsid protein encoded by that RNA. Molecules of the capsid protein assemble into regular geometric structures that enclose and protect the RNA. The same protein also provides the function of binding to cells in the gut of arthropods and causing the viral RNA to enter the gut cell. Within the cell more copies of the RNA are made and these are expressed to make more of the viral protein. The RNA and protein assemble into new virus particles that can infect other cells and arthropods. The capsoid system uses some of the functions of the wild-type virus to deliver a protein to arthropod gut cells but does not have all the functions required to sustain a viral infection. It also has features that allow it to be produced by a transgenic plant rather than needing to be produced elsewhere and sprayed on to a crop. The plant is transformed with a gene
that causes the plant to produce the capsid protein. The transgenic plant also produces an RNA molecule that contains the necessary sequences to associate with the capsid protein to produce a virus-like particle. When an arthropod feeds on the plant it ingests the virus-like particles. The capsid protein binds to the arthropod's gut cells and the RNA enters the cell. That RNA can be engineered to resemble a messenger RNA causing the cell to translate the message into a protein.
A variation of the capsoid system has the transgenic plant expressing the protein of interest and the capsid protein as a fusion product from a single gene. It is the protein rather than the corresponding RNA that is delivered. Simply feeding an unprotected protein such as JHE to an arthropod is unlikely to be effective because the protein would most likely be digested by normal gut processes. The capsid protein domains assemble into virus-like structures with the toxin protein domain protected from digestion within the lumen of the virus-like structure. The toxin protein is only exposed after the capsid domains have bound to gut cells. The fusion of the virus-like structure with the target cell's membrane causes the toxin domains to be presented to the inside of the cell where they remain protected from digestion in the gut. Ingestion of capsoids would cause many cells lining the gut to contain active JHE which are expected to act as a sinks for JH as described above.
Host cells
Another embodiment of the present invention includes a recombinant cell comprising a host cell transformed with one or more recombinant molecules of the present invention. Transformation of a nucleic acid molecule into a cell can be accomplished by any method by which a nucleic acid molecule can be inserted into the cell. Transformation techniques include, but are not limited to, transfection, electroporation, microinjection, lipofection, adsorption, and protoplast fusion. A recombinant cell may remain unicellular or may grow into a tissue, organ or a multicellular organism. Transformed nucleic acid molecules of the present invention can remain extrachromosomal or can integrate into one or more sites within a chromosome of the transformed (i.e., recombinant) cell in such a manner that their ability to be expressed is retained.
Suitable host cells to transform include any cell that can be transformed with a polynucleotide of the present invention. Host cells can be either untransformed cells or cells that are already transformed with at least one nucleic acid molecule (e.g., nucleic acid molecules encoding one or more proteins of the present invention). Host cells of the present invention either can be endogenously (i.e., naturally) capable of producing proteins of the present invention or can be capable of producing such proteins after being transformed with at least one nucleic acid molecule of the present invention. Host cells of the present invention can be any cell capable of producing at least one protein of the present invention, and include bacterial, fungal (including yeast), parasite, other arthropod, other animal and plant cells. Preferred host cells include bacterial, mycobacterial, yeast, arthropod and mammalian cells. More preferred host cells include Salmonella, Escherichia, Bacillus, Listeria, Saccharomyces, Spodoptera, Mycohacteήa, Trichoplusia, BHK (baby hamster kidney) cells, MDCK cells (normal dog kidney cell line for canine herpesvirus cultivation), CRFK cells (normal cat kidney cell line for feline herpesvirus cultivation), CV-1 cells (African monkey kidney cell line used, for example, to culture raccoon poxvirus), COS (e.g., COS-7) cells, and Vero cells. Particularly preferred host cells are E. coli, including E. coli K-12 derivatives; Salmonella typhi; Salmonella typhimuήum, including attenuated strains; Spodoptera frugiperda; Trichoplusia ni; BHK cells; MDCK cells; CRFK cells; CV-1 cells; COS cells; Vero cells; and non-tumorigenic mouse myoblast G8 cells (e.g., ATCC CRL 1246). Additional appropriate mammalian cell hosts include other kidney cell lines, other fibroblast cell lines (e.g., human, murine or chicken embryo fibroblast cell lines), myeloma cell lines, Chinese hamster ovary cells, mouse NIH/3T3 cells, LMTK cells and/or HeLa cells.
Recombinant DNA technologies can be used to improve expression of transformed polypeptide molecules by manipulating, for example, the number of copies of the polypeptide molecules within a host cell, the efficiency with which those polypeptide molecules are transcribed, the efficiency with which the resultant transcripts are translated, and the efficiency of post-translational modifications. Recombinant techniques useful for increasing the expression of polypeptide molecules of the present invention include, but are not limited to, operatively linking polypeptide molecules to high-copy number plasmids, integration of the polypeptide molecules into one or more host cell chromosomes, addition of vector
stability sequences to plasmids, substitutions or modifications of transcription control signals (e.g., promoters, operators, enhancers), substitutions or modifications of translational control signals (e.g., ribosome binding sites, Shine-Dalgarno sequences), modification of polypeptide molecules of the present invention to correspond to the codon usage of the host cell, and the deletion of sequences that destabilize transcripts. The activity of an expressed recombinant protein of the present invention may be improved by fragmenting, modifying, or derivatizing polypeptide molecules encoding such a protein.
Transgenic Plants
The term "plant" refers to whole plants, plant organs (e.g. leaves, stems roots, etc), seeds, plant cells and the like. Plants contemplated for use in the practice of the present invention include both monocotyledons and dicotyledons. Exemplary dicotyledons include cotton, corn, tomato, tobacco, potato, bean, soybean, and the like.
Transgenic plants, as defined in the context of the present invention include plants (as well as parts and cells of said plants) and their progeny which have been genetically modified using recombinant DNA techniques to cause or enhance production of at least one protein of the present invention in the desired plant or plant organ.
The polypeptide of the present invention may be expressed constitutively in the transgenic plants during all stages of development.
Depending on the use of the plant or plant organs, the proteins may be expressed in a stage-specific manner. Furthermore, depending on the use, the proteins may be expressed tissue-specifically.
The choice of the plant species is determined by the intended use of the plant or parts thereof and the amenability of the plant species to transformation. Regulatory sequences which are known or are found to cause expression of a gene encoding a protein of interest in plants may be used in the present invention. The choice of the regulatory sequences used depends on the target crop and/or target organ of interest. Such regulatory sequences may be obtained from plants or plant viruses, or may be chemically synthesized. Such regulatory sequences are well known to those skilled in the art.
Other regulatory sequences such as terminator sequences and polyadenylation signals include any such sequence functioning as such in plants, the choice of which would be obvious to the skilled addressee. An example of such sequences is the 3' flanking region of the nopaline synthase (nos) gene of Agrobacterium tumefaciens.
Several techniques are available for the introduction of the expression construct containing a DNA sequence encoding a protein of interest into the target plants. Such techniques include but are not limited to transformation of protoplasts using the calcium/polyethylene glycol method, electroporation and microinjection or (coated) particle bombardment. In addition to these so- called direct DNA transformation methods, transformation systems involving vectors are widely available, such as viral and bacterial vectors (e.g. from the genus Agrobacterium) . After selection and/or screening, the protoplasts, cells or plant parts that have been transformed can be regenerated into whole plants, using methods known in the art. The choice of the transformation and/or regeneration techniques is not critical for this invention.
Transgenic non-human animals
Techniques for producing transgenic animals are well known in the art. A useful general textbook on this subject is Houdebine, Transgenic animals - Generation and Use (Harwood Academic, 1997).
Heterologous DNA can be introduced, for example, into fertilized mammalian ova. For instance, totipotent or pluripotent stem cells can be transformed by microinjection, calcium phosphate mediated precipitation, liposome fusion, retroviral infection or other means, the transformed cells are then introduced into the embryo, and the embryo then develops into a transgenic animal. In a highly preferred method, developing embryos are infected with a retrovirus containing the desired DNA, and transgenic animals produced from the infected embryo. In a most preferred method, however, the appropriate DNAs are coinjected into the pronucleus or cytoplasm of embryos, preferably at the single cell stage, and the embryos allowed to develop into mature transgenic animals.
Another method used to produce a transgenic animal involves microinjecting a nucleic acid into pro-nuclear stage eggs by standard methods. Injected eggs are then cultured before transfer into the oviducts of pseudopregnant recipients.
Transgenic animals may also be produced by nuclear transfer technology. Using this method, fibroblasts from donor animals are stably transfected with a plasmid incorporating the coding sequences for a binding domain or binding partner of interest under the control of regulatory. Stable transfectants are then fused to enucleated oocytes, cultured and transferred into female recipients.
Compositions and Agriculturally Acceptable Carriers
As used herein, an "arthropod control composition", is a formulation which comprises an arthropod control agent of the present invention, where upon exposure of the composition to an arthropod results in the disruption of JH esterase activity.
Agriculturally suitable and/or environmentally acceptable compositions for arthropod control are known in the art. Agricultural compositions for the control of arthropod pests of plants and/or animals must be suitable for agricultural use, particularly for dispersal'in fields. Similarly, compositions for the control of arthropod pests are preferably environmentally acceptable. In addition to appropriate solid or, more preferably, liquid carriers, agricultural compositions may include sticking and adhesive agents, emulsifying and wetting agents, but no components which deter arthropod feeding or any arthropod control agent functions. It may also be desirable to add components which protect the arthropod control agent from UV inactivation or components which serve as adjuvants to increase the potency and/or virulence of an entomopathogen. Agricultural compositions for arthropod pest control may also include agents which stimulate arthropod feeding.
In one embodiment, a composition of the present invention can be used to protect a plant or animal from arthropod infestation by administering such composition in order to prevent infestation. Such administration could be oral (in the case of animals), or by application to the environment (e.g., spraying). In another embodiment, an arthropod, such as a l, cuprina, can ingest compositions, or products thereof, present in the blood of a host animal that has been administered with a composition of the present invention. Compositions of the present invention also include excipients.
Excipients are also referred to herein as "agriculturally acceptable carriers".
An excipient can be any material that an animal, plant or environment to be treated can tolerate. Examples of such excipients include water, saline, Ringer's solution, dextrose solution, Hank's solution, and other aqueous physiologically balanced salt solutions. Nonaqueous vehicles, such as fixed oils, sesame oil, ethyl oleate, or triglycerides may also be used. Other useful formulations include suspensions containing viscosity enhancing agents, such as sodium carboxymethylcellulose, sorbitol, or dextran. Excipients can also contain minor amounts of additives, such as substances that enhance isotonicity and chemical stability. Examples of buffers include phosphate buffer, bicarbonate buffer and Tris buffer, while examples of preservatives include thimerosal or o-cresol, formalin and benzyl alcohol. Standard formulations can either be liquid injectables or solids which can be taken up in a suitable liquid as a suspension or solution for injection. Thus, in a non- liquid formulation, the excipient can comprise dextrose, human serum albumin, dog serum albumin, cat serum albumin, preservatives, etc., to which sterile water or saline can be added prior to administration.
In one embodiment of the present invention, a composition can include a carrier. Carriers include compounds that increase the half-life of a composition in the treated animal, plant or environment. Suitable carriers include, but are not limited to, polymeric controlled release vehicles, biodegradable implants, liposomes, bacteria, viruses, other cells, oils, esters, and glycols.
One embodiment of the present invention is a controlled release formulation that is capable of slowly releasing a composition of the present invention into an animal, plant or the environment. As used herein, a controlled release formulation comprises a composition of the present invention in a controlled release vehicle. Suitable controlled release vehicles include, but are not limited to, biocompatible polymers, other polymeric matrices, capsules, microcapsules, microparticles, bolus preparations, osmotic pumps, diffusion devices, liposomes, lipospheres, and transdermal delivery systems. Other controlled release formulations of the present invention include liquids that, upon administration, form a solid or a gel in situ. Preferred controlled release formulations are biodegradable (i.e., bioerodible). A preferred controlled release formulation of the present invention is capable of releasing a composition of the present invention into, for example,
the environment, or the blood of an animal, at a constant rate sufficient to attain effective dose levels of the composition to protect against arthropod infestation. The composition is preferably released over a period of time ranging from about 1 to about 12 months. A preferred controlled release formulation of the present invention is capable of effecting a treatment preferably for at least about 1 month, more preferably for at least about 3 months, even more preferably for at least about 6 months, even more preferably for at least about 9 months, and even more preferably for at least about 12 months. The concentration of the arthropod control agent that will be required to produce effective compositions for the control of an arthropod pest will depend on the type of organism and the formulation of the composition. The effective concentration of the arthropod control agent within the composition can readily be determined experimentally, as will be understood by the skilled artisan. For example, the effective concentration of a virus can be readily determined using techniques known to the art.
Acceptable protocols to administer compositions of the present invention to animals in an effective manner include individual dose size, number of doses, frequency of dose administration, and mode of administration. Determination of such protocols can be accomplished by those skilled in the art. A suitable single dose is a dose that is capable of protecting an animal from arthropod infestation when administered one or more times over a suitable time period. For example, a preferred single dose of a composition comprising a polypeptide, polynucleotide or arthropod control agent of the present invention is from about 1 microgram to about 10 milligrams of the composition per kilogram body weight of the animal. Boosters can be administered from about 2 weeks to several years after the original administration. A preferred administration schedule is one in which from about 10 μg to about 1 mg of the composition per kg body weight of the animal is administered from about one to about two times over a time period of from about 2 weeks to about 12 months. Modes of administration can include, but are not limited to, subcutaneous, intradermal, intravenous, intranasal, oral, transdermal, intraocular and intramuscular routes.
Kits
The present invention also includes a test kit to identify a compound capable of inhibiting esterase activity of an arthropod. Such a test kit includes a polypeptide according to the present invention, having esterase activity and a means for determining the extent of inhibition of esterase activity in the presence of (i.e., effected by) a putative inhibitory compound. Such compounds can also be screened to identify those that are substantially not toxic in host animals, plants or the environment.
Examples:
Example 1 - Purification ofD. melanogaster JHE. Method
D. melanogaster strain 12111.2 were collected at 12 ±6 hours after the time of puparium formation and stored at -70°C.
A 100 g of D. melanogater were homogenised on ice with 500 ml of 10 mM KOH acetic acid buffer, pH4.5 and a few milligrams of phenylthiourea in a Sorvall blender. The homogenate was clarified by centrifugation at 13,000 g, 4°C for 20 minutes followed by filtration through glass wool. The pH of this solution was raised by the addition of an equal volume of 100 mM sodium phosphate buffer, pH 7.0 containing 10% glycerol.
A 30-60% ammonium sulphate cut was made by appropriate additions of solid ammonium sulphate and the resulting pellet was resuspended in 100 mM sodium phosphate buffer, pH 7.0 containing 10% glycerol to a final volume of 52 ml.
Acetone (0°C) was slowly added to the resuspended ammonium sulphate pellet with vigorous swirling in an ice/water slurry to a final concentration of 40% (v/v). The solution was then centrifuged at 9000 g for 15 minutes at 0°C. The supernatant was dialysed overnight at 4°C against 3 1 of 10 mM imidazole/HCl buffer, pH 7.0 containing 10% glycerol. This material in the dialysis tubing was concentrated to less than 50 ml using aquacide III (Calbiochem 17852) to remove the excess water.
Isoelectric Focussing (IEF) of the acetone supernatant was performed using a Biorad "Rotofor" apparatus. Three ml of ampholytes (Pharmalyte pH 5-6, Pharmacia) and 10% glycerol were added to the acetone supernatant, bringing the total volume to 50 ml, the volume of the Rotofor focussing
chamber. Antifreeze solution at -8°C was circulated through the apparatus to achieve a temperature in the focussing chamber of approx. 2°C. The sample was focussed for 4 h at 12 w, during which time the voltage rose from 300 to 880 v. Twenty 2.5 ml fractions were collected and their protein content, pH and JHE activities were determined. Fractions containing JHE activity (pHs 5.35-6.12) were returned to the Rotofor with sufficient 10% glycerol to fill the focussing chamber. These were refocussed for a further 4 h, during which time the voltage rose from 1600 to 1900 v. Then fractions were collected and assayed as above. The JHE containing fractions (pHs 5.29-5.56) were pooled, filtered through a 0.22 μm membrane, and concentrated to 0.5 ml using a Centriprep 30 ultrafiltration device (Amicon).
The concentrated material from the previous step was diluted to 5ml with 0.1M imidazole/HCl to pH 7.0, 10% glycerol, 1 mM dithiothrietol. It was loaded onto a Pharmacia "Mono Q HR5/5" chromatography column previously equilibrated with the same buffer. The column was washed with 6ml of buffer and eluted with a 20ml linear gradient of 0 to 500 mM NaCl in imidazole buffer at a flow rate of 0.5 ml/min.. The gradient eluate was collected in 1 ml fractions.
The JHE containing fractions from the Mono Q column (265-335 mM NaCl) were concentrated to about 100 μl using a Centricon 30 ultrafiltration device (Amicon) and loaded onto a Pharmacia "Superose 6" 30 ml gel filtration column previously equilibrated with two column volumes of the above imidazole buffer. The column was eluted with imidazole buffer at a flow rate of 0.5 ml/min and 1 ml fractions were collected. The two fractions containing JHE activity (around 16.5 ml elution volume) were stored at 20°C overnight then assessed for purity by SDS-PAGE and silver staining. The PAGE gels were then stored dry at room temperature between sheets of Promega gel drying film.
A radiometric partition assay for JHE activity (Hammock and Roe, 1985) was used for monitoring the purification of JHE. The partition assay consists of an incubation of the enzyme with chain-labelled 3H-JHϋI which is hydrolysed to yield 3H-JHIII-acid. The reaction is stopped by the addition of organic solvent which extracts the JHIII while the JHHI-acid product remains in the aqueous phase. The reaction is quantified by determining the amount of 3H in the aqueous phase using liquid scintillation counting. The only departures from the method of Hammock and Roe (1985) were that the
reaction volume was halved to 100 μl, 0.5 mg/ml BSA (Sigma) was included and the buffer was 100 mM sodium phosphate, pH 8.0. The protein content of solutions was determined by the method of Bradford (1976) using the Biorad Protein Assay kit, with BSA as the standard.
Results
Two fractions from the final, gel filtration chromatographic separation were separated by SDS-PAGE and silver stained (BioRad silver stain kit) to reveal the proteins. One fraction (Fr. 6) contained virtually pure JHE and was used to estimate the kcat of the enzyme (see below) while the other fraction (Fr. 7) was used for other kinetic experiments (see Example 2). SDS-PAGE gels containing aliquots of the fractions were dried between sheets of Promega gel drying film and stored at room temperature until the bands containing JHE were excised for peptide mass fingerprinting (see Example 3).
Example 2 - Kinetic analysis of JHE, Method
The reaction rate per mole of JHE (kC(ά) that we report for JHIII was calculated immediately after the final separation step using the fraction that appeared homogeneous (Fraction 6). The calculation used the enzyme's molecular weight (66 kDa) estimated from its mobility on SDS-PAGE, the JHE activity of fraction 6, and the protein content of fraction 6. Aliquots of Fr7 were used to calculate other kinetic parameters. This fraction contained an unidentified protein that did not have JHE activity. Fortunately, the constants kM and iq are independent of the absolute amount of active enzyme so the presence of the unidentified protein could be ignored.
The type of inhibition and inhibition constants ( s) were determined for three forms of JH. The assays were as described above except that the 3H- JHiπ concentration was varied, potential inhibitors were included in some assays, and the assay tubes were pretreated with 2% polyethyleneglycol ("Carbowax" Compound 4000, Union Carbide) to minimise adsorption of JH (and its analogues) to the glass. Assays were performed for all combinations of JHI (5, 10, and 15 μM), JHB3 (3, 5, and 8 μM) or methyl farnesoate (MF) (6, 12 and 18 μM) as inhibitors of 3H-THHI hydrolysis (0.0555, 0.0715, 0.1, 0.1665 0.5μM; 3871 cpm/pmol). JHIII was added to the assay solution in 1 μl ethanol whereas the inhibiting JHs were added in 1 μl dimethylsulphoxide in
the case of MF and JHI or ethanol in the case of JHB3. Reactions were also performed at each JHIII concentration with solvent additions only. Reactions were started with the addition of 3 μl of JHE (Fr7 diluted 1/20 in 5 mg/ml BSA). Incubation times for these experiments were 20 min, during which time a maximum of 20% of the substrate was consumed and the reaction rates were linear. Each inhibition experiment also provided an estimate of the kM for hydrolysis of JHIII by JHE. For each inhibitor the experiment was repeated three times, providing three data sets. After graphical determination of the type of inhibition, an overall fit of each set of data was made to the appropriate rate equation (in this case competitive inhibition) using the appropriate computer program of Cleland (1979). Weighted means and standard errors of the inhibition constants from each data set were then calculated.
Results
JHIII is hydrolysed slowly by JHE from D. melanogaster (kcai = 0.60 sec"1) but the Michaelis constant for the reaction is very low (KM = 89 ± 12 nM) so the resulting specificity constant [kc Ku = 6.8 x 106 M^sec"1) is very high, approaching the theoretic diffusion limited maximum of around 108-109 M^sec"1.
Three natural forms of JH (JHI, methyl farnesoate and JHB3) each showed competitive inhibition of JHIII hydrolysis indicating that they bind to the same site as the substrate, JHIII, and that the inhibition constants ( qs) can be interpreted as a measure of the binding affinity of JHE for these compounds. JHIII (89 ± 12 nM) and JHB3 (1.2 ± 0.4 μM) are bound more tightly than methyl farnesoate (3.33 ± 0.36 μM) or JHI (3.34 ± 0.47 μM), consistent with the former two compounds being the major forms of JH found in the higher Diptera. We note however, that the JHB3 used to determine the I was a racemate of four possible stereoisomers. Below we show that the binding affinity for the natural stereoisomer (6S,7S,10R) is greater than for the three unnatural isomers. Therefore the lq for 6S,7S,10R JHB3 is lower than 1.2 μM.
Inhibition of JHIII hydrolysis was also analysed by a range of natural forms of JH and JH analogues at single, fixed concentrations. This experiment revealed relative binding affinities rather than absolute values. Almost all deviations from the structure of JHDI or JHB3 showed significantly
reduced binding affinity to JHE (Figure 1). The overall size of the molecule is important and even small increases in the size, such as the changes from methyl to ethyl side chains found in JFH and JHII, or increases in the size of the methyl ester moiety, decrease binding. The conjugated 2E,3 double bond and the 10R,11 epoxide both promote binding to JHE, consistent with the general occurance of these features in insect JHs. In addition, JHE shows preferential binding to the natural 6S,7S,10R stereoisomer of JHB3. High affinity binding of JHB3 is likely to be unique to JHEs from higher Diptera as this form of JH has only been found in the higher Diptera.
Example 3 - Peptide mass fingerprint ofD. melanogaster JHE. Method
JHE bands were cut from silver-stained SDS-PAGE gels that had been stored between sheets of Promega gel drying film. The two JHE bands were processed separately as follows to obtain two peptide mass fingerprints. The bands were rehydrated with lOμl of water, and the film was removed. In-gel digestion of the protein was performed with reduction and carbamidomethylation of any cysteine residues. The pieces of gel were incubated with 2.8 mM dithiothrietol in ammonium bicarbonate solution (160 μl, 100 mM) for 30 minutes at 60°C. lodoacetamide (10 μl, 5.9 mM final cone.) was added and the reaction was kept for a further 30 minutes at room temperature in the dark. The gel pieces were washed twice with 50% acetonitrile/0.1% trifluoroacetic acid, dried under vacuum, rehydrated with 150 ng of trypsin (Promega sequencing grade) in 10 μl ammonium bicarbonate (100 mM), incubated overnight at 37°C, then extracted twice with 50% acetonitrile/0.1% trifluoroacetic acid in a sonicating water bath. For each gel piece, the extracts were pooled and dried in a vacuum centrifuge, redissolved in 2μl of matrix solution (10 mg/ml of α-cyano, 4-hydroxy, cinnamic acid in 50% acetonitrile/0.1% trifluoroacetic acid), and dried on the sample plate of a Voyager Elite MALDI-TOF mass spectrometer (Perseptive Biosystems). Peptides in a trypsin digest of bovine serum albumin (927.4940 and 2045.0285) were used for a close external calibration of the JHE digest. The mass list from the JHE digest was used to search the NCBInr database (29/3/2000, Drosophila only) using ProFound software (Version 4.8.5, Rockefeller University) after the masses of a trypsin autolysis peptide (842.5) and several peptides derived from human keratin were excluded. The largest
and smallest masses from the best matching sequence were used for internal calibration of the mass spectrum and the search was repeated with a mass tolerance of 30 ppm.
Result
Tryptic digest peptides were recovered from two JHE bands from SDS- PAGE gels of purified D. melanogaster JHE. The peptide mass spectra from the two gels were virtually identical and one is shown in Figure 2. Only one predicted gene product from Z melanogaster (CG8425) was a close match to the submitted mass list (Z = 2.36, p < 0.05). That gene had been identified as having carboxylesterase-like sequences but its function as juvenile hormone esterase had not been identified.
Example 4 -Isolation and sequencing ofD. melanogaster JHE cDNA. Method
The mRNA sequence of the JHE gene was determined using 3'- and 5'- Rapid Amplification of cDNA Ends (RACE). Primers were chosen so that 3'- and 5'-RACE would yield overlapping products and therefore the complete cDNA sequence of the JHE gene. Polyadenylated RNA was isolated from homogenates of whole D. melanogaster prepupae, strain 12111.2, aged as above for peak JHE activity (Campbell et al., 1992). Approximately 50 mg of prepupae yielded 3.4 μg of purified mRNA using the QuickPrep Micro mRNA Purification Kit (Amersham Pharmacia Biotech). This mRNA (1 μg) was used as the template for the 5'RACE System (Gibco BRL). Two antisense primers, (5'-GTT-CTG-ATC-CTT-TAG-GCC-3') (SEQ ID NO:5) and (5'-GGC-CAA-AGT- TAC-CAG-ACA-TCA-31) (SEQ ID NO:6), were designed for nested PCR from the predicted D. melanogaster cDNA sequence CG8425, and synthesised by GeneWorks. The 5'RACE product was cloned using the pGem-T Easy Vector System (Promega) and sequenced with pUC/Ml3 forward and reverse universal vector primers (Bresatec).
For 3'RACE, first strand cDNA was synthesised from 1 μg of D. melanogaster prepupal mRNA using AMV Reverse Transcriptase (Promega), and 0.48 μg of a poly-T adaptor primer (5'-GCG-GCC-GCT-TGA-ATT-CCC- ACT-TTT-TTT-TTT-TTT-TTT-T-3') (SEQ ID NO: 7) according to Promega Technical Bulletin No.502, with the addition of fresh DTT (20mM final concentration). Second strand synthesis and PCR amplification of cDNA
used 50 pmoles of adaptor primer (5'-GCG-GCC-GCT-TGA-ATT-CCC-AC-3') (SEQ ID NO:8) and a CG8425 -derived primer (5'-GTT-GTC-TAC-GGC-GAT- GAG-3') (SEQ ID NO:9), 1 mM MgCl2, 0.2 mM dNTP mix, IX Taq DNApolymerase reaction buffer and lOu Taq DNA polymerase (Gibco BRL), and 1 μl of a 1:20 dilution of the first strand cDNA mRNA mixture, in a total volume of 50 μl. The following amplification conditions were used: 3 minutes at 94°C for initial denaturation followed by 40 cycles of 94°C for 45 seconds, 50°C for 1 minute, and 72°C for 2 minutes. Final extension conditions were 72°C for 7 minutes. A second, he mi-nested round of PCR was performed using 1 μl of the first reaction mixture (purified using the QAIquick PCR Purification Kit, Qiagen), 50 pmoles each of adaptor primer and another CG8425-derived primer (5'-CGC-ACT-ACC-TGT-AAT-GGT-CTA- 3') (SEQ ID NO: 10). Conditions and other reagents were as above except that the annealing was performed at 57°C. The gel purified product (QAIquick PCR Purification Kit, Qiagen) was cloned into the pSTBlue-1 vector (Perfectly Blunt Cloning Kit, Novagen) and sequenced. All incubations and PCR cycling was performed on either a PerkinElmer GeneAmp PCR System 9700 or 2400. Sequencing was performed by the ABI Prism BigDye terminator method (Perkin-Elmer) .
Result
The open reading frame encoding D. melanogaster JHE, and the translation thereof, is provided in Figure 3. The isolated D. melanogaster JHE cDNA shares some common sequence to the Drosophila genome project's predicted product CG8425 (Adams et al, 2000). The cDNA confirms the predicted CG8425 product except that the fifth predicted intron was not removed; instead there is an in-frame stop codon immediately after the predicted splice site followed by a polyadenylation signal and a polyA tail. Conserved features of carboxylesterases found in JHE of the present invention include a catalytic triad composed of Ser213, His471 and Glu346. Also conserved is an additional Ser (239 in JHE) that is found in the active site of all catalytically active serine esterases and is proposed to have an essential function. Putative oxyanion hole residues are conserved (Glyl32, Glyl33 and Ala214), as are a pair of Cys residues (90 and 108) forming a disulphide linkage, and residues forming salt bridges (Arg67 and Glul06,
Argl63 and Aspl85). There is a predicted signal peptide (cleaving after Ala20) consistent with JHE being secreted into the haemolymph of prepupae.
D. melanogaster JHE shows 29% identity overall with the full-length sequences of JHE from the lepidopterans Heliothis virescens and Choristoneura fumiferana (Feng et al., 1999). This is only slightly greater than the degree of identity found among carboxylesterases in general.
Full or partial cDNA or amino acid sequences of JHEs are available from several lepidopterans and two coleopterans (Hanzlik et al. 1989; Thomas et al., 2000) but none from D. melanogaster or any other dipteran. JHE of the present invention could be used in preference to the H. virescens JHE in at least two situations. Firstly, it might be more effective for degrading JH in non-lepidopteran insects, especially higher Diptera, as a consequence of a different spectrum of binding preferences among the different forms of JH. D. melanogaster JHE shows similar kinetics to the Lepidopteran JHE with JHIII but it also shows good binding affinity for JHB3, the form of JH that is apparently unique to the higher Diptera. It is reasonable to assume that the D. melanogaster enzyme has evolved to hydrolyse JHB3 efficiently. Secondly, JHE of the present invention might be more effective in Lepidoptera if its structure is sufficiently different from the lepidopteran enzyme to avoid recognition by a specific mechanism for the removal of JHE.
Example 5 - In vitro expression of JHE. Method
RNA was isolated from D. melanogaster as described in Example 4. The JHE cDNA was amplified from the RNA using the oligonucleotides
JheRTPCR.F2 fδ'CGCGGATCCGCGATGCTACAACTGCTGCTTCT 3') (SEQ ID NO:ll) and JheRTPCR.R2
(5'GCTCTAGAGCTTATTACTTTTCGTTGAGTATAT 3') (SEQ ID NO:12) that contain BαmHI and Xbάl restriction enzyme sites respectively (underlined), with an additional stop codon (underlined) in the case of the latter. The
SUPERSCRIPT One-Step RT-PCR with PLATINUM Tαq kit (Life Technologies) was used to amplify the JHE cDNA. The 50μl reaction contained (final concentrations); lx Reaction Mix, 200ng D. melanogaster prepupal RNA, 0.2μM JheRTPCR.F2, 0.2μM JheRTPCR.R2, lμl RT/PLATINUM Taq Mix. The following amplification cycles were used; 50°C for 30 min, 94°C for 2 min,
followed by 35 cycles of 94°C for 15 sec, 48°C for 30 sec, 72°C for 2 min, finished with a final amplification step of 72°C for 10 min.
The BαmHI and Xbal digested RT-PCR product was purified by agarose gel electrophoresis and the QIAquick PCR Purification Kit (QIAGEN), then ligated into the pFastBacl plasmid multiple cloning site, previously digested with BamH and Xbal. The ligation mix was transformed into TG-1 heat shock cells and bacmid DNA prepared and isolated according to the Instruction Manual, BAC-TO-BAC Baculovirus Expression Systems (Gibco BRL LIFE TECHNOLOGIES) . Sf9 cells were transfected with the recombinant DNA prepared above according to the Instruction Manual, BAC-TO-BAC Baculovirus Expression Systems (Gibco BRL LIFE TECHNOLOGIES) with the following modifications. Grace's cell culture medium was substituted for Sf-900 II Serum Free Medium. Solution A contained 9μl mini-prep bacmid DNA and 41μl lxHepes Buffered Saline, Solution B contained 15μl DOTAP transfection reagent and 35μl lxHBS. After the initial cell wash, cells were overlayed with 1.5ml Grace's cell culture medium without Foetal Calf Serum or antibiotics and the complete transfection mixture was added to create JHE/pFastBacl viral supernatant (first passage) which was harvested 72 hours after the start of transfection.
The JHE/pFastBacl viral supernatant titre was amplified in Sf9 cell mono-layer cultures grown in Grace's cell culture medium. A 25 cm2 flask was seeded to high confluence (approximately 2xl0β cells) and 2 ml of JHE/pFastBacl viral supernatant (first passage) was added to a total of 3 ml of Grace's cell culture medium and incubated at 27 °C for 72 hours. The culture was harvested and centrifuged at lOOg for 5 min, the JHE/pFastBacl viral supernatant (second passage) was removed. This supernatant (1ml) was used to infect a 75 cm2 flask at high confluence, approximately 5xlOe cells, in 20 ml of Grace's cell culture medium. The 75 cm2 infected culture was incubated at 27°C and harvested after 72 hours, centrifuged at lOOg for 5 min to remove cells from the JHE/pFastBacl viral supernatant (third passage) which was titred and used to infect the final expression culture.
Expression of the JHE gene was performed in a 10 ml suspension culture of Sf9 cells with a concentration of 1.5xl06 cells/ml in HyQ SFX- Insect serum free medium (HyClone) using JHE/pFastBacl viral supernatant (third passage) at a multiplicity of infection of 5 pfu/ml. As a control another
flask of Sf9 cells was prepared in an identical manner except that the virus had not been modified with JHE cDNA. The suspension cultures were incubated at 27°C, with shaking for 72 hours then centrifuged at lOOg for 5 min. Supernatants were stored at -80°C. Pelleted cells from both flasks were resuspended in 800 μl O.lM phosphate buffer, pH 8.0 for final cell densities of lxlO8 cells/ml and stored at -80°C.
The JHE activities of the resuspended cell pellets (lOμl) and the supernatants (lOμl) were determined using the assay described in Example 1 and adjust to reflect the activities of the original 10ml cultures.
Result
Forty four-fold more JHE activity was found in the culture expressing JHE cDNA (15 nmoles/min/lOml culture) compared with the control culture (0.34 nmoles/min/lOml culture) confirming that the D. melanogaster JHE cDNA encodes a protein with JHE activity. Most of the JHE activity detected in the control culture was present in the cells (0.27 nmoles/min/lOml culture) rather than the supernatant fraction (0.07 nmoles/min/lOml culture). In contrast most of the JHE activity in the culture expressing JHE cDNA was found in the supernatant (14.7 nmoles/min/lOml culture) rather than the cells (0.19 nmoles/min/lOml culture). This shows that D. melanogaster JHE is secreted from Sf9 cells, consistent with the predicted signal peptide for secretion described in Example 4.
Any discussion of prior art documents, acts, materials, devices, articles or the like which has been included in the present specification has been so solely for the purpose of providing a context for the present invention. It is not suggested or represented that any or all of these matters formed part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application.
All publications discussed above are incorporated herein in their entirety.
It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the
invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.
References:
Adams, M.D., Celniker, S.E., Holt R.A. et al, (2000) Science 287, 2185-2195.
Bradford, M. M. (1976) Anal. Biochem. 72, 248-254.
Campbell, P.M., Healy M.J., Oakeshott J.G. (1992) Insect Biochem. Molec. Biol. 22, 665-677.
Campbell, P. M., Oakeshott, J. G., and Healy, M. J. (1998) Insect Biochem. Molec. Biol. 28, 501-515.
Cleland, W. W. (1979) Methods Enzymol. 63, 103-138.
Cusson. M., Yagi, K.J., Ding, Q., Duve, H., Thorpe, A., McNeil, J.N. and Tobe, S.S. (1991) Insect Biochem. 21, 1-6.
Dougherty W.G. and Parks, T.D. (1995) Curr. Opin. Cell Biol. 7, 399-405.
Dunbrack, R.L, Jr, Gerloff, D.L., Bower, M., Chen, X., Lichtarge, 0. and Cohen, F.E. (1997). Folding and Design, 2:R27-42.
Feng, Q.L., Ladd, T.R., Tomkins, B.L., Sundaram, M., Sohi, S.S., Retnakaran, A., Davey, K.G. and Palli, S.R. (1999) Mol. Cell. Endocrinol. 148, 95-108.
Hammock, B. D. and Roe, R. M. (1985) Methods Enzymol. Ill, 487-494.
Hanzlik, T.N., Abdel-Aal, Y.A., Harshman, L.G. and Hammock, B.D. (1989) /. Biol. Chem. 264, 12419-12425.
Hanzlik, T.N., Christian, P. and Gordon, K. (1999) Pesticide Outlook 10, 22-26.
Haseloff, J. and Gerlach, W.L. (1988) Nature 334, 585-591.
Needleman, S.B. and Wunsch, CD. (1970) /. Mol. Biol. 48, 443-453.
Perriman, R., Delves, A. and Gerlach, W.L. (1992) Gene 113, 157-163.
Richard, D. S., Applebaum, S. W„ Sliter, T. J., Baker, F. C, Schooley, D. A., Reuter, C. C, Henrich, V. C. and Gilbert, L. I. (1989) Proc. Natl. Acad. Sci. 86, 1421-1425.
Riddiford, L.M. (1993) Receptor 3:203-209.
Schooley, D. A., Baker, F. C, Tsai, L. W., Miller, C. A. and Jamieson, G. C. (1984) In Biosynthesis, Metabolism and Mode of Action of Invertebrate Hormones (Edited by Hoffman, J. and Porchet, M.), pp. 373-383. Springer- Verlag, Berlin Heidelberg.
Shippy, R., Lockner, R., Farnsworth, M. and Hampel, A. (1999) Mol. Biotech. 12, 117-129.
Thomas, B.A., Hinton, A.C., Moskowitz, H., Severson, T.F. and Hammock, B.D. (2000) Insect Biochem. 30, 529-540.
Waterhouse, P.M., Graham, M.W. and Wang, M.B. (1998) Proc Natl Acad Sci USA 95, 13959-13964.
Claims
1. A method of identifying an arthropod control agent, the method comprising a) exposing a polypeptide with juvenile hormone esterase activity which is at least 90% identical to SEQ ID NO:l to a candidate agent, and b) assessing the ability of the candidate agent to modulate the juvenile hormone esterase activity of the polypeptide.
2. The method according to claim 1, wherein the agent inhibits juvenile hormone esterase activity of the polypeptide.
3. The method according to claim 1, wherein the agent enhances juvenile hormone esterase activity of the polypeptide.
4. The method according to any one of claims 1 to 3, wherein the polypeptide is at least 300 amino acids in length.
5. A method of identifying an arthropod control agent, the method comprising a) exposing a polypeptide which is at least 90% identical to SEQ ID NO:l to a binding partner which binds the polypeptide, and a candidate agent, and b) assessing the ability of the candidate agent to compete with the binding partner for binding to the polypeptide.
6. The method of claim 5, wherein the binding partner is detectably labeled.
7. The method of claim 5 or claim 6, wherein the binding partner is juvenile hormone.
8. A method of identifying an arthropod control agent, the method comprising (a) determining the atomic coordinates defining the three-dimensional structure of a polypeptide with juvenile hormone esterase activity which is at least 90%) identical to SEQ ID NO:l;
(b) selecting a candidate compound by performing rational drug design with the atomic coordinates obtained in step (a), wherein said selecting is performed in conjunction with computer modeling; and
(c) determining the ability of the candidate compound to modulate the juvenile hormone esterase activity of the polypeptide.
9. A crystal of a polypeptide with juvenile hormone esterase activity which is at least 90% identical to SEQ ID NO:l.
10. A method of arthropod control agent design comprising using the structural coordinates of a crystal according to claim 9 to computationally evaluate a compound for its ability to modulate juvenile hormone esterase activity of the polypeptide.
11. A method of identifying an arthropod control agent, the method comprising a) exposing a polynucleotide encoding a polypeptide with juvenile hormone esterase activity which is at least 90% identical to SEQ ID NO:l, to a candidate agent under conditions which allow expression of the polynucleotide, and b) assessing the ability of the candidate agent to modulate levels of polypeptide produced by the polynucleotide.
12. The method according to claim 11, wherein the agent inhibits production of the polypeptide.
13. A method of identifying an arthropod control agent, the method comprising a) exposing a polynucleotide which is at least 90% identical to SEQ ID
NO:4 to a candidate agent, and b) assessing the ability of the candidate agent to hybridize and/or cleave the polynucleotide.
14. A substantially purified polypeptide having juvenile hormone esterase activity, the polypeptide being selected from the group consisting of: (i) a polypeptide comprising the sequence of SEQ ID NO:l; or (ii) a polypeptide which has a sequence which is at least 90% identical to (i); wherein the polypeptide is not more than 600 residues in length.
15. The substantially purified polypeptide of claim 14, wherein the polypeptide has a sequence which is at least 95% identical to (i).
16. The substantially purified polypeptide of claim 14, wherein the polypeptide has a sequence which is at least 99% identical to (i).
17. The substantially purified polypeptide according to any one of claims 14 to 16, wherein the polypeptide is at least 300 amino acids in length.
18. An isolated polynucleotide, the polynucleotide encoding a polypeptide according to any one of claims 14 to 17.
19. The isolated polynucleotide of claim 18, the polynucleotide having a sequence selected from: (i) a sequence of nucleotides shown in SEQ ID NO: 3;
(ii) a sequence of nucleotides shown in SEQ ID NO:4; or
(iii) a sequence which hybridizes to (i) or (ii) under high stringency conditions.
20. The isolated polynucleotide of claim 19, wherein the polynucleotide has a sequence which is less than 1660 nucleotides.
21. An antisense polynucleotide which hybridizes under high stringency conditions to a polynucleotide according to any one of claims 18 to 20.
22. The antisense polynucleotide of claim 21, which comprises a catalytic domain.
23. A double stranded RNA (dsRNA) molecule comprising a polynucleotide according to any one of claims 18 to 20.
24. The dsRNA molecule of claim 23, wherein the dsRNA is encoded by a single open reading frame and the resulting dsRNA molecule has a stem loop structure at one end of the molecule.
25. A fusion protein comprising a polypeptide according to any one of claims 14 to 17 fused to at least one other polypeptide sequence.
26. The fusion protein of claim 25, wherein the at least one other polypeptide is selected from the group consisting of: a polypeptide that enhances the stability of the polypeptide of any one of claims 14 to 17, a polypeptide that acts as an immunopotentiator to enhance an immune response to a polypeptide of any one of claims 14 to 17, and a polypeptide that assists in the purification of the fusion protein.
27. An isolated polynucleotide that encodes a fusion protein according to claim 25 or claim 26.
28. A vector comprising a polynucleotide according to any one of claims claim 18 to 20 or 27.
29. The vector according to claim 28, wherein the polynucleotide is operably linked to a promoter.
30. A vector comprising an antisense polynucleotide according to claim 21 or 22.
31. The vector according to claim 30, wherein the antisense polynucleotide is operably linked to a promoter.
32. A vector comprising an open reading frame(s) which upon expression form a dsRNA molecule according to claim 23 or 24.
33. The vector according to claim 32, wherein the dsRNA molecule is operably linked to a promoter.
34. The vector according to any one of claims 28 to 33, wherein the vector is a plasmid or a virus.
35. The vector of claim 34, wherein the viral vector is a baculovirus.
36. The vector according to any one of claims 28 to 33, wherein the vector is a capsoid.
37. A host cell transformed or transfected with the vector according to any one of claims 28 to 36.
38. The host cell of claim 37 which a bacterial cell.
39. The host cell of claim 37 which is an arthropod cell.
40. The host cell of claim 37 which is an insect cell.
41. A transgenic plant, the plant having been transformed with a polynucleotide according to any one of claims 18 to 20 or 27, wherein the plant expresses the polynucleotide.
42. A transgenic plant, the plant having been transformed with an antisense polynucleotide according to claim 21 or claim 22, wherein the plant expresses the antisense polynucleotide.
43. A transgenic plant, the plant having been transformed with open reading frame(s) which, upon expression, form a dsRNA molecule according to claim 23 or claim 24, wherein the plant produces the dsRNA molecule.
44. A transgenic non-human animal, the animal having been transformed with a polynucleotide according to any one of claims 18 to 20 or 27, wherein the animal expresses the polynucleotide.
45. A transgenic non-human animal, the animal having been transformed with an antisense polynucleotide according to claim 21 or claim 22, wherein the animal expresses the antisense polynucleotide.
46. A transgenic non-human animal, the animal having been transformed with open reading frame(s) which, upon expression, form a dsRNA molecule according to claim 23 or claim 24, wherein the animal produces the dsRNA molecule.
47. An arthropod control composition, the composition comprising an agent identified according to any one of claims 1 to 8 or 10 to 13, and an agriculturally acceptable carrier.
48. An arthropod control composition, the composition comprising a polypeptide according to any one of claims 14 to 17, and an agriculturally acceptable carrier.
49. An arthropod control composition, the composition comprising a vector according to any one of claims 28 to 36, and an agriculturally acceptable carrier.
50. A method of controlling an arthropod population, the method comprising exposing members of the arthropod population to an arthropod control composition according to any one of claims 47 to 49.
51. The method according to claim 50, wherein the arthropod is an insect.
52. A process for preparing a polypeptide according to any one of claims 14 to 17, the process comprising cultivating a host cell transformed or transfected with a vector according to claim 29 under conditions providing for expression of the polynucleotide encoding the polypeptide, and recovering the expressed polypeptide.
53. A kit for identifying an arthropod control agent, the kit comprising a polypeptide according to any one of claims 14 to 17, and means for determining juvenile hormone esterase activity.
54. A kit for identifying an arthropod control agent, the kit comprising a polynucleotide according to any one of claims 18 to 20, and means for determining juvenile hormone esterase activity of a polypeptide encoded by the polynucleotide.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AUPR2821A AUPR282101A0 (en) | 2001-02-01 | 2001-02-01 | Juvenile hormone esterase |
| AUPR282101 | 2001-02-01 | ||
| PCT/AU2002/000101 WO2002060940A1 (en) | 2001-02-01 | 2002-02-01 | Juvenile hormone esterase |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP1363936A1 true EP1363936A1 (en) | 2003-11-26 |
Family
ID=3826847
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP02709903A Withdrawn EP1363936A1 (en) | 2001-02-01 | 2002-02-01 | Juvenile hormone esterase |
Country Status (6)
| Country | Link |
|---|---|
| EP (1) | EP1363936A1 (en) |
| JP (1) | JP2004533809A (en) |
| AU (1) | AUPR282101A0 (en) |
| CA (1) | CA2437121A1 (en) |
| IL (1) | IL157014A0 (en) |
| WO (1) | WO2002060940A1 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109161602B (en) * | 2018-10-22 | 2021-06-22 | 福建省农业科学院植物保护研究所 | Primer and method for detecting transcription level of JHE gene of agasicles hygrophila |
| CN112913784B (en) * | 2019-12-06 | 2022-07-22 | 中国林业科学研究院资源昆虫研究所 | Diapause induction method of Kallima inachus |
-
2001
- 2001-02-01 AU AUPR2821A patent/AUPR282101A0/en not_active Abandoned
-
2002
- 2002-02-01 CA CA002437121A patent/CA2437121A1/en not_active Abandoned
- 2002-02-01 WO PCT/AU2002/000101 patent/WO2002060940A1/en not_active Ceased
- 2002-02-01 JP JP2002561508A patent/JP2004533809A/en not_active Withdrawn
- 2002-02-01 EP EP02709903A patent/EP1363936A1/en not_active Withdrawn
- 2002-02-01 IL IL15701402A patent/IL157014A0/en unknown
Non-Patent Citations (1)
| Title |
|---|
| See references of WO02060940A1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2002060940A1 (en) | 2002-08-08 |
| IL157014A0 (en) | 2004-02-08 |
| CA2437121A1 (en) | 2002-08-08 |
| AUPR282101A0 (en) | 2001-02-22 |
| JP2004533809A (en) | 2004-11-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP3482214B2 (en) | Insecticidal protein toxin from Hotorhabdasu | |
| Parkinson et al. | A new form of arthropod phenoloxidase is abundant in venom of the parasitoid wasp Pimpla hypochondriaca | |
| JP2000515024A (en) | Insecticidal protein toxin from Hotorabudas | |
| ES2389646T3 (en) | Degradation of pesticides and toxins of hydrophobic esters | |
| CA2445011A1 (en) | Transformed silkworm producing human collagen | |
| AU4103896A (en) | Use of flea proteases and protease inhibitors to protect animals from flea infestation | |
| WO1998021324A1 (en) | Novel carboxylesterase nucleic acid molecules, proteins and uses thereof | |
| EP1662867B1 (en) | Insecticidal compounds and methods for selection thereof | |
| US6290958B1 (en) | Anti-flea epoxide hydrolase antibodies and uses thereof | |
| WO2002060940A1 (en) | Juvenile hormone esterase | |
| AU2002227788A1 (en) | Juvenile hormone esterase | |
| US20150141617A1 (en) | Production and purification of active eukaryotic formylglycinegenerating enzyme (fge) variants | |
| WO1999037758A2 (en) | Expression of proteolytically-sensitive peptides | |
| WO2000032618A9 (en) | Nucleic acids and polypeptides of d. melanogaster insulin-like genes and uses thereof | |
| CA2370313A1 (en) | Materials and methods useful for the control of insect larvae | |
| WO2003018802A1 (en) | Lipophorins | |
| US6406900B1 (en) | Flea protease proteins, nucleic acid molecules and uses thereof | |
| JP2001510324A (en) | Flea protease proteins, nucleic acid molecules, and uses thereof | |
| CA2438710A1 (en) | <i>nomuraeae rileyi</i>-origin ecdysteroid 22-oxidase and molt hormone inactivation system with the use of the same | |
| AU731609B2 (en) | Insecticidal enzymes | |
| US6204010B1 (en) | Flea protease proteins, nucleic acid molecules, and uses thereof | |
| JP3530495B2 (en) | Ecdysteroid 22 oxidase from Pseudomonas oryzae and molting hormone inactivation system using it | |
| Borovsky et al. | Culex quinquefasciatus Late Trypsin Biosynthesis Is Translationally Regulated by Trypsin Modulating Oostatic Factor | |
| CN114041464A (en) | Method for enhancing bacterial resistance of plants | |
| US6214579B1 (en) | Flea leucine aminopeptidase nucleic acid molecules and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20030822 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK RO SI |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN |
|
| 18W | Application withdrawn |
Effective date: 20040813 |