EP1354063A2

EP1354063A2 - Detecting specific nucleotide sequences

Info

Publication number: EP1354063A2
Application number: EP01981799A
Authority: EP
Inventors: Yuri Khripin
Original assignee: Intergen Co
Current assignee: Intergen Co
Priority date: 2000-10-24
Filing date: 2001-10-24
Publication date: 2003-10-22
Also published as: WO2002034947A2; JP2004530410A; AU2002213416A1; WO2002034947A3; CA2426812A1

Abstract

Oligonucleotide primers, each labeled with a molecular energy transfer pair, including an energy donor and an energy acceptor, are used to detect the presence of one or more identifying nucleotide sequences. Two sequence-specific oligonucleotide primers, one specific for a first identifying sequence and the other for the second identifying sequence, together with a reverse primer, are employed in a polymerase chain reaction mixture which contains a nucleic acid template. Using only its complementary identifying sequence as a template, each sequence-specific primer directs amplification. Resultant PCR products, representing the first and the second identifying sequence, are detected via PCR amplification which uses two MET-labeled primers, each specific for the PCR product representing either the first or the second identifying sequence, together with another primer that is complementary to the PCR products representing both identifying sequences.

Description

DETECTING SPECIFIC NUCLEOTIDE SEQUENCES

This application claims the priority benefit of U.S. provisional patent application serial No. 60/242,672, filed October 24, 2000.

FIELD OF THE INVENTION

The present invention broadly concerns methods for detecting specific nucleotide sequences. More particularly, the present invention relates to methodology in which the detection of a signal from an oligonucleotide that is labeled with a molecular energy transfer (MET) pair, including an energy donor and an energy acceptor, indicates the presence of a specific nucleotide sequence in a sample. The methodology has enough sensitivity to distinguish a single nucleotide in the context of other nucleotides. Thus, the invention also concerns detection of nucleic acid polymorphisms, such as single nucleotide polymorphisms (SNPs).

BACKGROUND OF THE INVENTION

Certain identifying nucleotide sequences in genes suggest the presence of disease, a susceptibility to disease, or a phenotype. These identifying sequences may represent spontaneous changes in a particular gene (e.g., mutations) of an individual or may represent a difference between forms of a gene (e.g., alleles) that persist in a population. The changes or differences may occur at several nucleotides in a gene or may occur at a single nucleotide. Single-nucleotide changes or differences represent greater challenges for detection systems.

An identifying sequence that distinguishes between alleles of a gene is said to characterize a "single-nucleotide polymorphism" or SNP, when the difference in question resides at one nucleotide position. Single nucleotide changes have been shown to give rise to a variety of genetic diseases. For example, sickle cell anemia is caused by the transversion of an adenine residue to a thymine residue in the sixth codon of the human β-globin gene. This transversion results in the substitution of a valine residue for a glutamate residue in the β- globin subunit of hemoglobin, causing a reduced solubility of the deoxyhemoglobin molecule and, in turn, a "sickling" of affected red blood cells. The sickled red blood cells become trapped in the microcirculation and cause damage to multiple organs.

Kan et al., Lancet 2: 910-12 (1978), were the first to describe the diagnosis of sickle cell anemia by examining DNA from affected individuals, based on the linkage of the sickle cell allele to a Hpal restriction fragment length polymorphism. Later, Geever et al., Proc. Nat 'lAcad. Sci. USA 78: 5081-85 (1982), and Chang et al, New England J. Med. 307: 30-32 (1982), demonstrated that the mutation in question affected the cleavage site of both Ddel and Mstll and, therefore, could be detected directly by restriction enzyme cleavage. Conner et al., Proc. Nat 'lAcad. Sci. USA 80: 278-82 (1983), described a more general approach to the direct detection of single-nucleotide variation, by the use of sequence-specific oligonucleotide hybridization. In this method, a short synthetic oligonucleotide probe hybridizes, under appropriate conditions, to only one allele.

All of these approaches are slow, technically challenging and require reasonably large amounts of DNA.

The polymerase chain reaction (PCR), developed by Saiki et al, Science 230: 1350- 54 (1985), allowed for rapid amplification of a small amount of a target DNA. PCR utilizes two oligonucleotide primers that anneal to opposing strands of DNA at positions spanning a sequence of interest. A DNA polymerase, such as the Klenow fragment of E. coli DNA polymerase I (Saiki et al. (1985), supra) or Thermus aquaticus DNA polymerase (Saiki et al, Science 239: 487-91 (1988)), is used for sequential rounds of template-dependent synthesis of the DNA sequence. Prior to the initiation of each new round, the DNA is denatured and fresh enzyme is added, in the case of the E. coli enzyme. In this manner, exponential amplification of the target sequences is achieved.

The resultant amplified DNA then can be analyzed readily for the presence of DNA sequence variation, such as the sickle cell mutation, by sequence-specific oligonucleotide hybridization (Saiki et al, Nature 324: 163-66 (1986)), restriction enzyme cleavage (Saiki et al. (1985), supra; Chehab et al, Nature 329: 293-94(1987)), ligation of oligonucleotide pairs (Landegrenet al, Science 241 : 1077-80 (1988)), or ligation amplification. While PCR increased the speed of analysis and reduced the amount of DNA required, it did not change the method of analysis of DNA sequence variation.

More recently, U.S. patent No. 5,639,611 to Wallace et al. disclosed an allele-specific polymerase chain reaction, said to be suitable for detecting the allele responsible for sickle cell anemia. Wallace et al. found that amplification proceeds with reduced efficiency when the 3' nucleotide of one of the PCR primers forms a mismatched base-pair with the template. Thus, under Wallace's method, the specific primers direct amplification of a specific allele only. The formation of an amplified fragment, after multiple rounds of amplification, indicates the presence of the allele in the test sample. While Wallace's method represents an improvement over restriction digests and radiolabeled hybridizations, the approach remains laborious and time-consuming. Besides requiring gel electrophoresis, the method necessitates performing multiple amplication and detection reactions to identify the genotype of a sample. Thus, a need exists for a quicker, less labor-intensive procedure for detecting identifying sequences, including single- nucleotide polymorphisms.

SUMMARY OF THE INVENTION

It is therefore one object of the present invention to provide an enhanced method of detecting the presence of identifying sequences in a genomic sample.

It is another object of the invention to provide kits for detecting the presence of identifying sequences in a genomic sample.

In accomplishing these and other objects of the invention, there is provided, in accordance with one aspect of the present invention, a method for determining the presence in a DNA sample of a first identifying sequence or a second identifying sequence, or both, which method comprises:

(A) providing a first oligonucleotide comprising:

(i) a first nucleotide sequence capable of specifically hybridizing to the first identifying sequence, but unable to hybridize specifically with the second identifying sequence; and

(ii) a second nucleotide sequence at the 5' end of the first nucleotide sequence,

(B) providing a second oligonucleotide comprising:

(i) a third nucleotide sequence capable of specifically hybridizing to the second identifying sequence, but unable to hybridize specifically to the first identifying sequence; and

(ii) a fourth nucleotide sequence at the 5' end of the first nucleotide sequence,

(C) providing a third oligonucleotide,

(D) providing a fourth oligonucleotide comprising:

(i) a fifth nucleotide sequence,

(ii) a sixth nucleotide sequence at the 5' end of the fifth nucleotide sequence, (iii) a seventh nucleotide sequence at the 5' end of the sixth nucleotide sequence, and

(iv) an eighth nucleotide sequence at the 5' end of the seventh nucleotide sequence, wherein the fifth nucleotide sequence is identical to the second nucleotide sequence, the fourth oligonucleotide is capable of forming a first hairpin containing nucleotides of the sixth and eighth nucleotide sequences, and the fourth oligonucleotide emits a first detectable signal if the first hairpin is not formed,

(E) providing a fifth oligonucleotide comprising:

(i) a ninth nucleotide sequence,

(ii) a tenth nucleotide sequence at the 5' end of the ninth nucleotide sequence,

(iii) an eleventh nucleotide sequence at the 5' end of the tenth nucleotide sequence, and

(iv) a twelfth nucleotide sequence at the 5' end of the eleventh nucleotide sequence, wherein the ninth nucleotide sequence is identical to fourth nucleotide sequence, the fifth oligonucleotide is capable of forming a second hairpin containing nucleotides of the tenth and twelfth nucleotide sequences, and the fourth oligonucleotide emits a second detectable signal if the second hairpin is not formed,

(F) if the first identifying sequence is present in the DNA sample, then:

(i) annealing the first oligonucleotide to the first identifying sequence,

(ii) extending the 3' end of the first oligonucleotide using the first identifying sequence as a template to form an extended first strand, wherein the first identifying sequence is annealed to the extended first strand,

(iii) separating the first identifying sequence from the extended first strand,

(iv) annealing the third oligonucleotide to the extended first strand,

(v) extending the 3' end of the third oligonucleotide using the extended first strand as a template to form an extended second strand, wherein the extended first strand is annealed to the extended second strand,

(vi) separating the extended first strand from the extended second strand, (vii) annealing the fourth oligonucleotide to the extended second strand, (viii) extending the 3' end of the fourth oligonucleotide using the extended second strand as a template to form a doubly extended first strand, wherein the doubly extended first strand is annealed to the extended second strand,

(ix) separating the doubly extended first strand from the extended second strand,

(x) annealing the third oligonucleotide to the doubly extended first strand,

(xi) extending the 3' end of the third oligonucleotide using the doubly extended first strand as a template to form a doubly extended second strand,

(xii) optionally amplifying the doubly extended first and second strands,

(xiii) detecting the first detectable signal, and

(xiv) determining that the first identifying sequence is present in the DNA sample, and (G) if the second identifying sequence is present in the DNA sample, then:

(i) annealing the second oligonucleotide to the second identifying sequence,

(ii) extending the 3' end of the second oligonucleotide using the second identifying sequence as a template to form an extended third strand, wherein the second identifying sequence is annealed to the extended third strand,

(iii) separating the second identifying sequence from the extended third strand,

(iv) annealing the third oligonucleotide to the extended third strand,

(v) extending the 3' end of the third oligonucleotide using the extended third strand as a template to form an extended fourth strand, wherein the extended third strand is annealed to the extended fourth strand,

(vi) separating the extended third strand from the extended fourth strand,

(vii) annealing the fifth oligonucleotide to the extended fourth strand,

(viii) extending the 3' end of the fifth oligonucleotide using the extended fourth strand as a template to form a doubly extended third strand, wherein the doubly extended third strand is annealed to the extended fourth strand,

(ix) separating the doubly extended third strand from the extended fourth strand,

(x) annealing the third oligonucleotide to the doubly extended third strand, (xi) extending the 3' end of the third oligonucleotide using the doubly extended third strand as a template to form a doubly extended fourth strand,

(xii) optionally amplifying the doubly extended third and fourth strands, and

(xiii) detecting the second detectable signal, and

(xiv) determining that the second identifying sequence is present in the DNA sample. In a preferred embodiments, the amplification reaction is PCR, and each of the first and second donor moieties is a fluorophore, while each of the first and second acceptor moieties is a quencher of light emitted by the fluorophore.

In another embodiment, there is provided a method for determining the presence in a DNA sample of a first identifying sequence or a second identifying sequence, or both, which method comprises:

(A) contacting the sample with first and second oligonucleotides, wherein the first oligonucleotide contains:

(i) a first nucleotide sequence,

(iii) a third nucleotide sequence at the 5' end of the second nucleotide sequence, and

(iv) a fourth nucleotide sequence at the 5' end of the third nucleotide sequence, wherein the first oligonucleotide is capable of forming a first hairpin containing nucleotides of the second and fourth nucleotide sequences, and the first oligonucleotide emits a first detectable signal if the first hairpin is not formed, wherein the second oligonucleotide contains:

(i) a fifth nucleotide sequence,

(ii) a sixth nucleotide sequence at the 5' end of the fifth nucleotide sequence,

(iii) a seventh nucleotide sequence at the 5' end of the sixth nucleotide sequence, and

(iv) an eighth nucleotide sequence at the 5' end of the seventh nucleotide sequence, wherein the second oligonucleotide is capable of forming a second hairpin containing nucleotides of the sixth and eighth nucleotide sequences, and the second oligonucleotide emits a second detectable signal if the second hairpin is not formed,

(B) incorporating:

(i) the first oligonucleotide into a double-stranded nucleic acid using a polymerase if the first identifying sequence is present in the sample, thereby preventing the first hairpin from forming,

(ii) the second oligonucleotide into a double-stranded nucleic acid using a polymerase if the second identifying sequence is present in the sample, thereby preventing the second hairpin from forming, or

(iii) each of the first and second oligonucleotides into a double-stranded nucleic acid using a polymerase if both of the first and second identifying sequences are present in the sample, thereby preventing each of the first and second hairpins from forming,

(C) optionally conducting an amplification reaction, thereby incorporating:

(i) the first oligonucleotide into a first amplification product if the first identifying sequence is present in the sample,

(ii) the second oligonucleotide into a second amplification product if the second identifying sequence is present in the sample, or

(iii) the first oligonucleotide into a first amplification product if the first identifying sequence is present in the sample, and the second oligonucleotide into a second amplification product if the second identifying sequence is present in the sample,

(D) determining:

(i) that the first identifying sequence is present in the sample if the first signal is detected,

(ii) that the second identifying sequence is present in the sample if the second signal is detected, or

(iii) that the first and second identifying sequences are present in the sample if the first and second signals are detected. The present invention also provides a method of directly identifying one or more nucleic acid polymorphisms in a single nucleic acid sample. This improved technique meets two major requirements. First, it permits detection of the nucleic acid polymorphisms without prior separation of unincorporated oligonucleotides. Second, it allows detection of the one or more nucleic acid polymorphisms in a sample directly, by incorporating the labeled oligonucleotide into the amplified nucleic acid sample. The present invention also relates to kits for the identification of one or more nucleic acid polymorphism in a single sample. Such kits may be diagnostic kits where the presence of the nucleic acid polymorphism is correlated with the presence or absence of a disease or disorder.

Other objects, features and advantages of the present invention will become apparent from the following detailed description. The detailed description and specific examples, while indicating preferred embodiments, are given for illustration only since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. Further, the examples demonstrate the principle of the invention and cannot be expected to specifically illustrate the application of this invention to all the examples where it will be obviously useful to those skilled in the prior art.

DESCRIPTION OF THE FIGURES

FIGURE 1 represents a general schematic of the oligonucleotide primers of the present invention.

The first oligonucleotide (Ol) comprises a first nucleotide sequence (1) and a second nucleotide sequence (2) at the 5' end of the first nucleotide sequence (hatched).

The second oligonucleotide (02) comprises a third nucleotide sequence (3) and a fourth nucleotide sequence (4) at the 5' end of the third nucleotide sequence (solid).

The third oligonucleotide (03) comprises the reverse primer.

The fourth oligonucleotide (04) comprises a fifth nucleotide sequence (5) (hatched), a sixth nucleotide (6) sequence at the 5' end of the fifth nucleotide sequence, a seventh nucleotide (7) sequence at the 5' end of the sixth nucleotide sequence, and an eighth nucleotide sequence (8) at the 5' end of the seventh nucleotide sequence. The fifth nucleotide sequence is identical to the second nucleotide sequence. 04 is capable of forming a first hairpin which contains nucleotide sequences six and eight. 04 emits a signal if the hairpin is not formed. The fifth oligonucleotide (05) comprises a ninth nucleotide sequence (9) (solid), a tenth nucleotide sequence (10) at the 5' end of the ninth nucleotide sequence, a eleventh nucleotide sequence (1 1) at the 5' end of the tenth nucleotide sequence, and a twelfth nucleotide sequence (12) at the 5' end of the eleventh nucleotide sequence. The ninth nucleotide sequence is identical to the fourth nucleotide sequence. 05 is capable of forming a hairpin containing nucleotides of the 10 and 12 nucleotide sequences. 05 emits a signal if the hairpin is not formed.

FIGURE 2 provides a schematic representation of one of the preferred embodiments of the inventive methodology. It employs sequence-specific primers separate from the hairpin- forming oligonucleotides. If a DNA sample contains a target sequence, the sequence-specific forward primer (Ol) will anneal and extend during the first cycle of a polymerase chain reaction, forming an extended first strand. In subsequent cycles, a hairpin- forming oligonucleotide (04) anneals to a 5' tail of the incorporated sequence- specific primer (as in cycle 3) and acts as a primer in formation of a doubly extended first strand. During still later cycles, as polymerase copies the doubly extended first strand, it forces the incorporated oligonucleotide out of its hairpin formation and into an extended, light-emitting conformation (as in cycle 4). Again, repetitive cycles will increase the magnitude of signal emitted.

FIGURE 3 is a schematic illustration of the structure of an oligonucleotide (A) in a hairpin conformation and (B) an extended conformation. Element (a) represents a nucleotide sequence that specifically hybridizes to a target sequence; (b) and (d) represent nucleotide sequences that hybridize to one another to form a hairpin; and (c) represents the sequence that links (b) with (d) and forms the loop of the hairpin. Open and closed circles on (b) and (d) represent a pair of molecular energy transfer molecules.

FIGURE 4 depicts another embodiment of the inventive methodology that utilizes a polymerase chain reaction. Hairpin-forming oligonucleotides (a) contain a primer sequence specific for each identifying sequence. If a DNA sample contains a target sequence, the specific primer will anneal and extend during the first cycle of a polymerase chain reaction (forming an extended first strand). In a second cycle, as polymerase copies the extended first strand, it forces the incorporated oligonucleotide out of its hairpin formation and into an extended, light-emitting conformation. Repetitive (n) cycles will increase the magnitude of the signal emitted. FIGURE 5A shows the genotyping results of the CYP17 gene for the A-type allele and G-type allele. Both primers differed at their 3' terminal nucleotide. Column 2 represents the fluorescence measurements for FAM, and column 3 represents the fluorescence measurements for SR. Column 1 show the genotype of the CYP17 DNA tested.

FIGURE 5B illustrates the benefit of using multiplex PCR reaction over a singleplex PCR reaction. This figure shows the gentoyping results of the CYP17 gene for the A- type and G-type allele. The A-specific primer is labeled with FAM and the G-specific primer is labeled with SR. Column 1: a CYP17 DNA sample containing the A-type allele was screened via a singleplex PCR reaction using the A-specific primer. Column 2: a CYP17 DNA sample containing the G-type allele was screened via a singleplex PCR reaction using the A-specific primer. Column 3: a CYP17 DNA sample containing the A- type allele was screened via a singleplex PCR reaction using the G-specific primer. Column 4: a CYP17 DNA sample containing the G-type allele was screened via a singleplex PCR reaction using the G-specific primer. Column 5: a CYP17 DNA sample containing both A-type and G-type alleles were screened via a multiplex PCR reaction using both A-specific and G-specific primers. Column 6: a CYP17 DNA sample containing both the A-type and G-type allele was screened via a multiplex PCR reaction using both the A- specific and G-specific primers. Comparing columns 1 and 2: FAM signal is detected in both A-type and G-type DNA samples using the A-specific primer. This result demonstrates the low allelic discrimination achieved using the A-specific primer in a singleplex PCR reaction. Comparing columns 3 and 4: SR signal is detected in both A-type and G-type DNA samples using the G-specific primer. This result demonstrates the low allelic discrimination using only the G-specific primer in a singleplex PCR reaction. Comparing columns 5 and 6 demonstrates the high allelic discrimination when using both the A-specific and G-specific primers in a multiplex PCR reaction because the allelic there was no signal of the opposite allele generated.

FIGURE 6A shows the genotyping results of the HER2 gene for the A-type allele and G-type allele. Both primers differed at their 3' terminal nucleotide. The no DNA controls are designated by NDC. Column 1 represents the fluorescence measurements for FAM and column 2 represents the fluorescence measurements for SR. Column 3 show the genotype of the HER2 DNA tested. FIGURE 6B shows a graphic representation of the fluorescence results of figure 5A. The results demonstrate the allelic discrimination of the multiplex PCR reaction using both the A-specific and G-specific primers.

FIGURE 7A shows the genotyping results of the CYP2C8 gene for the C-type allele and T-type allele. The 3' terminal nucleotide of the C-specific primer contained the mismatch for detecting the polymorphism. The second nucleotide removed from the terminus of the T-specific primer contained the mismatch nucleotide for detecting the polymorphism. The no DNA controls are designated by NDC. Column 1 represents the fluorescence measurements for FAM and column 2 represents the fluorescence measurements for SR. Column 3 show the genotype of the CYP2C8 DNA tested.

FIGURE 7B shows a graphic representation of the fluorescence results of figure 6A. The results demonstrate the good allelic discrimination of the multiplex PCR reaction using both the C-specific and T-specific primers.

FIGURE 8A shows the genotyping results of the HTR2C gene for the C-type allele and G-type allele. The third nucleotide removed from the terminus of the C-specific and G-specific primer contained the mismatch nucleotide for detecting the polymorphism. The no DNA controls are designated by NDC. Column 1 represents the fluorescence measurements for FAM and column 2 represents the fluorescence measurements for SR. Column 3 show the genotype of the HTR2C DNA tested.

FIGURE 8B shows a graphic representation of the fluorescence results of figure 7A. The results demonstrate the allelic discrimination of the multiplex PCR reaction using both the C-specific and G-specific primers.

FIGURE 9A shows the genotyping results of the CCR5 gene for the wild-type gene and the deletion mutant. The no DNA controls are designated by NDC. Column 1 represents the fluorescence measurements for FAM and column 2 represents the fluorescence measurements for SR. Column 3 show the genotype of the CCR5 DNA tested.

FIGURE 9B shows a graphic representation of the fluorescence results of figure 8A. The results demonstrate the good allelic discrimination of the multiplex PCR reaction using both the wild-type and deletion mutant primers. DETAILED DESCRIPTION

A PCR-based methodology has been discovered for detecting specific nucleotide sequences (identifying sequences), absent the drawbacks of conventional technology. The instant invention enables the rapid detection of genetic polymorphisms, such as a SNPs, insertions and deletions, within a target sequence. Elucidation of a polymorphism is accomplished by discerning the presence of one or more identifying sequences via their hybridization to sequence-specific oligonucleotide primers. The invention's creative use of fluorescence resonance energy transfer (FRET)-labeled oligonucleotides enables the rapid characterization of these hybridizations.

As described herein, an "identifying sequence" refers to a particular nucleotide acid that may represent a variation of a gene that persists in a population, such as an allele, or a spontaneous change in a particular nucleic acid sequence of an individual, such as a mutation. The difference or change from the wild type form can encompass a single nucleotide or several nucleotides and typically indicates a particular phenotype, disease or disease-susceptibility .

A genomic sample from an individual may encompasses two alleles of a particular gene, depending on whether the individual is homozygous or heterozygous for a given gene. Accordingly, a genomic sample can contain a first identifying sequence, a second identifying sequence, both a first and second identifying sequences or no identifying sequences. In one embodiment, the invention identifies genetic polymorphisms in a DNA sample by simultaneously detecting the presence of a first identifying sequence, a second identifying sequence, or both. To this end, the sample is contacted, in step (A), with first and second oligonucleotides. The first and second oligonucleotides may differ from each other in their terminal 3' nucleotide only. In another preferred embodiment, the oligonucleotides may differ at a nucleotide or at nucleotides other than the 3 ' terminal nucleotide. For example, the second, third, fourth, or fifth nucleotides removed from the 3' terminus of each primer may differ individually or in combination.

In another embodiment, the present invention can be used to determine the presence of a variety of identifying sequences simultaneously. For example, where a particular gene has five possible alleles, five oligonucleotides, specific for the corresponding identifying sequences, can be used simultaneously. In this manner, the genotype of the sample can be determined immediately. In a preferred embodiment of the present invention, two sequence-specific oligonucleotide primers, one specific for a first identifying sequence and one for a second identifying sequence, together with another primer (such as a reverse primer), are used in a PCR mixture containing a genomic DNA template. Primarily, nucleotides toward the 3' end of a primer determine specificity. Thus, the sequence-specific primers may differ from each other in their terminal 3' nucleotide only. Additionally, the primers may differ at a nucleotide or at nucleotides other than the 3' terminal nucleotide. For example, the second, third, fourth, or fifth nucleotides removed from the 3 ' terminus of each primer may differ individually or in combination. When nucleotides other than the 3 ' terminal nucleotide differ, the primer sequences will bridge the polymorphism. Regardless of mismatch location, under appropriate annealing temperature and PCR conditions, each sequence-specific primer only directs amplification using its complementary sequence as a template. Resultant PCR products, representing the target sequences, then are detected by conducting PCR amplification using two FRET-labeled primers, each specific for the PCR product, together with another primer complementary to the PCR products.

According to this aspect of the invention the method comprises the following steps:

In step (A), a first oligonucleotide is provided comprising (i) a first nucleotide sequence capable of specifically hybridizing to the first identifying sequence, but unable to specifically hybridize with the second identifying sequence due to one or more nucleotide mismatches, and (ii) a second nucleotide sequence at the 5' end of the first nucleotide sequence.

In step (B), a second oligonucleotide is provided comprising (i) a third nucleotide sequence capable of specifically hybridizing to the second identifying sequence, but unable to specifically hybridize with the first identifying sequence due to one or more nucleotide mismatches, and (ii) a fourth nucleotide sequence at the 5' end of the first nucleotide sequence.

In step (C), a third oligonucleotide is provided.

In step (D), a fourth oligonucleotide is provided, comprising (i) a fifth nucleotide sequence, (ii) a sixth nucleotide sequence at the 5' end of the fifth nucleotide sequence, (iii) a seventh nucleotide sequence at the 5' end of the sixth nucleotide sequence, and (iv) an eighth nucleotide sequence at the 5' end of the seventh nucleotide sequence. The fifth nucleotide sequence is identical to the second nucleotide sequence, the fourth oligonucleotide is capable of forming a first hairpin which contains nucleotides of the sixth and eighth nucleotide sequences, and the fourth oligonucleotide emits a first detectable signal if the first hairpin is not formed.

In step (E), a fifth oligonucleotide is provided that comprises (i) a ninth nucleotide sequence, (ii) a tenth nucleotide sequence at the 5' end of the ninth nucleotide sequence, (iii) an eleventh nucleotide sequence at the 5' end of the tenth nucleotide sequence, and (iv) a twelfth nucleotide sequence at the 5' end of the eleventh nucleotide sequence. The ninth nucleotide sequence is identical to the fourth nucleotide sequence, the fifth oligonucleotide is capable of forming a second hairpin containing nucleotides of the tenth and twelfth nucleotide sequences, and the fourth oligonucleotide emits a second detectable signal if the second hairpin is not formed.

In step (F), if the first identifying sequence is present in the DNA sample, then (i) the first oligonucleotide anneals with the first identifying sequence, (ii) the 3' end of the first oligonucleotide is extended using the first identifying sequence as a template to form an extended first strand, wherein the first identifying sequence is annealed to the extended first strand, (iii) first identifying sequence is separated from the extended first strand, (iv) the third oligonucleotide is annealed to the extended first strand, (v) the 3' end of the third oligonucleotide is extended using the extended first strand as a template to form an extended second strand, wherein the extended first strand is annealed to the extended second strand, (vi) the extended first strand is separated from the extended second strand, (vii) the fourth oligonucleotide is annealed to the extended second strand, (viii) the 3' end of the fourth oligonucleotide is extended using the extended second strand as a template to form a doubly extended first strand, wherein the doubly extended first strand is annealed to the extended second strand, (ix) the doubly extended first strand is separated from the extended second strand, (x) the third oligonucleotide is annealed to the doubly extended first strand, (xi) the 3' end of the third oligonucleotide is extended using the doubly extended first strand as a template to form a doubly extended second strand, (xii) the doubly extended first and second strands are optionally amplified, (xiii) the first detectable signal is detected, and (xiv) it is determined that the first identifying sequence is present in the DNA sample. Figure 2 schematically represents the essence of step (F).

In step (G), if the second identifying sequence is present in the DNA sample, then (i) the second oligonucleotide anneals with the second identifying sequence, (ii) the 3' end of the second oligonucleotide is extended using the second identifying sequence as a template to form an extended third strand, wherein the second identifying sequence is annealed to the extended third strand, (iii) the second identifying sequence is separated from the extended third strand, (iv) the third oligonucleotide is annealed to the extended third strand, (v) the 3' end of the third oligonucleotide is extended using the extended third strand as a template to form an extended fourth strand, wherein the extended third strand is annealed to the extended fourth strand, (vi) the extended third strand is separated from the extended fourth strand, (vii) the fifth oligonucleotide is annealed to the extended fourth strand, (viii) the 3' end of the fifth oligonucleotide is extended using the extended fourth strand as a template to form a doubly extended third strand, wherein the doubly extended third strand is annealed to the extended fourth strand, (ix) the doubly extended third strand is separated from the extended fourth strand, (x) the third oligonucleotide is annealed to the doubly extended third strand, and (xi) the 3' end of the third oligonucleotide is extended, using the doubly extended third strand as a template to form a doubly extended fourth strand. Then, (xii) the doubly extended third and fourth strands are optionally amplified, (xiii) the second detectable signal is detected, and (xiv) it is determined that the second identifying sequence is present in the DNA sample.

Advantageously, the fourth oligonucleotide emits the first detectable signal only if the first hairpin is not formed, and the fifth oligonucleotide emits the second detectable signal only if the second hairpin is not formed. The first detectable signal emitted by the fourth oligonucleotide if the first hairpin is not formed preferably is more intense than a signal emitted by the fourth oligonucleotide if the first hairpin is formed, and the second detectable signal emitted by the fifth oligonucleotide if the second hairpin is not formed is more intense than a signal emitted by the fifth oligonucleotide if the second hairpin is formed. The fourth oligonucleotide ideally emits the first detectable signal only if the first hairpin is not formed, and the fifth oligonucleotide emits the second detectable signal only if the second hairpin is not formed.

In preferred embodiments, the fourth oligonucleotide contains a first molecular energy transfer pair including a first energy donor moiety that is capable of emitting a first energy, and a first energy acceptor moiety that is capable of absorbing an amount of the emitted first energy. The first donor moiety is attached to a nucleotide of the sixth nucleotide sequence and the first acceptor moiety is attached to a nucleotide of the eighth nucleotide sequence, or the first acceptor moiety is attached to a nucleotide of the sixth nucleotide sequence and the first donor moiety is attached to a nucleotide of the eighth nucleotide sequence, and the first acceptor moiety absorbs the amount of the emitted first energy only if the first hairpin is formed. Additionally, the fifth oligonucleotide further contains a second molecular energy transfer pair including a second energy donor moiety that is capable of emitting a second energy, and a second energy acceptor moiety that is capable of absorbing an amount of the emitted second energy. The second donor moiety is attached to a nucleotide of the tenth nucleotide sequence and the second acceptor moiety is attached to a nucleotide of the twelfth nucleotide sequence, or the second acceptor moiety is attached to a nucleotide of the tenth nucleotide sequence and the second donor moiety is attached to a nucleotide of the twelfth nucleotide sequence, and the second acceptor moiety absorbs the amount of the emitted second energy only if the second hairpin is formed.

Each of the first and second donor moieties can be a fluorophore, and each of the first and second acceptor moieties is a quencher of light emitted by the fluorophore. The preferred first and second acceptor moieties are DABSYL, while the preferred first donor moiety is fluorescein and the preferred second acceptor moiety is sulfarhodamine, or vice versa.

Ideally, the amplification reaction is a polymerase chain reaction, e.g., a triamplification, a nucleic acid sequence-based amplification, a strand displacement amplification, a cascade rolling circle amplification, or an amplification refractory mutation system. The amplification reaction may be conducted in situ.

Step (F)(xii) ideally comprises (a) separating the doubly extended first strand from the doubly extended second strand, (b) annealing the third oligonucleotide to the doubly extended first strand, and annealing the fourth oligonucleotide to the doubly extended second strand, (c) extending the 3' end of the third oligonucleotide using the doubly extended first strand as a template to form another doubly extended second strand, wherein the doubly extended first strand is annealed to the other doubly extended second strand, and extending the 3' end of the fourth oligonucleotide using the doubly extended second strand as a template to form another doubly extended first strand, wherein the doubly extended second strand is annealed to the other doubly extended first strand, and (d) repeating (a), (b), and (c) for a finite number of times, wherein, in (a), the doubly extended first and second strands respectively are the doubly extended first strand and the other doubly extended second strand of (c), or respectively are the other doubly extended first strand and the doubly extended second strand of (c).

Step (G)(xii) ideally comprises separating the doubly extended third strand from the doubly extended fourth strand, (b) annealing the third oligonucleotide to the doubly extended third strand, and annealing the fifth oligonucleotide to the doubly extended fourth strand, (c) extending the 3' end of the third oligonucleotide using the doubly extended third strand as a template to form another doubly extended fourth strand, wherein the doubly extended third strand is annealed to the other doubly extended fourth strand, and extending the 3' end of the fifth oligonucleotide using the doubly extended fourth strand as a template to form another doubly extended third strand, wherein the doubly extended fourth strand is annealed to the other doubly extended third strand, and (d) repeating (a), (b), and (c) for a finite number of times, wherein, in (a), the doubly extended third and fourth strands respectively are the doubly extended third strand and the other doubly extended fourth strand of (c), or respectively are the other doubly extended third strand and the doubly extended fourth strand of (c).

The molecular energy transfer (MET) phenomenon is a process by which energy is passed between a donor molecule and an acceptor molecule. Fluorescence resonance energy transfer (FRET), which involves at least one fluorophore, is a form of MET. A fluorophore is a compound that absorbs light at one wavelength, and emits light at different wavelength. A spectrofluorimeter is used to simultaneously emit light which excites the fluorophore, and detect light emitted by the fluorophore. In FRET, the fluorophore is a donor molecule which absorbs photons, and subsequently transfers this energy to an acceptor molecule. Donor and acceptor molecules that engage in MET or FRET are termed "MET pairs" and "FRET pairs," respectively. Fδrster, Z. Naturforsch A4: 321-27 (1994); Clegg, Methods In Enzymology 21 1 : 353-88 (1992).

When two fluorophores are in close proximity, and the emission spectrum of the first fluorophore overlaps the excitation spectrum of the second fluorophore, excitation of the first fluorophore causes it to emit light that is absorbed by the second fluorophore, which in turn causes the second fluorophore to emit light. As a result, the fluorescence of the first fluorophore is quenched, while the fluorescence of the second fluorophore is enhanced. If the energy of the first fluorophore is transferred to a compound that is not a fluorophore, however, the fluorescence of the first fluorophore is quenched without subsequent emission of light by the non-fluorophore. The FRET phenomenon has been exploited to detect nucleic acids. One of these methods is disclosed in U.S. patent No. 5,866,366, the entire contents of which are herein incorporated by reference. The '366 patent relates a FRET-labeled hairpin oligonucleotide which is used as a probe in polymerase chain reaction (PCR) methods to detect target nucleic acid sequences. This oligonucleotide contains an energy donor and an energy acceptor constituting a FRET pair. The donor and acceptor are respectively situated on first and second nucleotide sequences of the oligonucleotide. These two nucleotide sequences are complementary to each other, and are therefore able to form a hairpin in the oligonucleotide.

If the first and second nucleotide sequences are annealed to each other, then the donor and acceptor are in close proximity. In this spatial arrangement, the acceptor absorbs the emission from the donor, and thereby quenches the signal from the donor. However, if the nucleotide sequences are not annealed to each other, then the donor and acceptor are separated, the acceptor can no longer absorb the emission from the donor, and the signal from the donor is not quenched.

Thus, if the oligonucleotide is incorporated into an amplification product during PCR, then the hairpin unfolds, resulting in the separation of the donor from the acceptor, and the consequent emission of an observable signal. However, if the oligonucleotide is not incorporated into a PCR amplification product, then the hairpin remains, and the emission from the donor is quenched by the acceptor. Detection of a signal after PCR therefore indicates the presence of the target.

In preferred embodiments, the concentration of the first oligonucleotide in the reaction mixture in which (F)(i) is conducted is less than 50 nM, 25 nM, or 5 nM, is between 5 and 50 nM or between 20 and 30 nM, or is about 25 nM. The concentration of the fourth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is preferably less than 500 nM, 250 nM, or 50 nM, is between 50 and 500 nM or between 200 and 300 nM, or is about 250 nM. Preferably, the concentration of the fourth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is at least five times, ten times, twenty times, thirty times, from five to thirty times, from ten to twenty times, or about ten times the concentration of the first oligonucleotide in the reaction mixture in which (F)(i) is conducted. Preferably, the concentration of the second oligonucleotide in the reaction mixture in which (F)(i) is conducted is less than 50 nM, 25 nM, 5 nM, is between 5 and 50 nM or between 20 and 30 nM, or is about 25 nM. Preferably, the concentration of the fifth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is less than 500 nM, 250 nM, 50 nM, is between 50 and 500 nM or between 200 and 300 nM, or is about 250 nM. Preferably, the concentration of the fifth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is at least five times, ten times, twenty times, thirty times, from five to thirty times, from ten to twenty times, or about ten times the concentration of the second oligonucleotide in the reaction mixture in which (F)(i) is conducted.

In a further embodiment, the present invention provides a method for the direct identification of a nucleic acid polymorphism, where the detection may be performed without opening the reaction tube. This embodiment, the "closed-tube" format, reduces greatly the possibility of carryover contamination with amplification products that has slowed the acceptance of PCR in many applications. The closed-tube method also provides for high throughput of samples and may be totally automated.

The nucleic acids in the sample may be purified or unpurified. In a specific embodiment, the oligonucleotides of the invention are used in situ amplification reactions, performed on samples of fresh or preserved tissues or cells. In in situ reactions, it is advantageous to use methods that allow for the accurate and sensitive detection of the target directly after the amplification step. In contrast, conventional in situ PCR requires, in paraffin embedded tissue, detection by a hybridization step, as the DNA repair mechanism invariably present in tissue samples from, e.g., CNS, lymph nodes, and spleen, precludes detection by direct incorporation of a reporter nucleotide during the PCR step. Typically, when conventional linear primers labeled with biotin or digoxigenin moieties are employed in in situ PCR, little or no detectable label is incorporated during amplification, which comprises annealing and extension steps. Moreover, when amplification reaction conditions are modified to enhance incorporation of nucleotides labeled with such moieties, unacceptably high background and false positive results are obtained. This can be attributed to the activity of endogenous DNA repair enzymes, which incorporate the labeled nucleotides into nicked DNA in the sample. Others have attempted to use other types of singly labeled PCR primers (Nuovo, 1997, PCR In Situ Hybridization: Protocols and Applications, Third Edition, Lippincott-Raven Press, New York), but have not been able to achieve adequate sensitivity, often leading resulting in false negative results. The requirements for a hybridization step, followed by a washing step, add additional time and expense to conventional in situ PCR protocols. It is therefore advantageous to use methods that allow for the accurate and sensitive detection of the target directly after the amplification step. Such methods are afforded by the present invention.

In a specific embodiment, the energy emitted by the donor moiety (e.g. , when a quencher is the acceptor moiety) or by the acceptor moiety (e.g., when a fluorophore or chromophore is the acceptor moiety), that is detected and measured after conducting an amplification reaction of the invention correlates with the amount of the preselected target sequence originally present in the sample, thereby allowing determination of the amount of the preselected target sequence present in the original sample. Thus, the methods of the invention can be used quantitatively to determine the existence of a nucleic acid polymorphism, number of chromosomes, or amount of DNA or RNA, containing the preselected target sequence.

In another embodiment of the present invention, the first oligonucleotide contains (i) a first nucleotide sequence, (ii) a second nucleotide sequence at the 5' end of the first nucleotide sequence, (iii) a third nucleotide sequence at the 5' end of the second nucleotide sequence, and (iv) a fourth nucleotide sequence at the 5' end of the third nucleotide sequence. Under hybridizing conditions, the first oligonucleotide would form a first hairpin, containing nucleotides of the second and fourth nucleotide sequences (Figure 3A). Conversely, the first oligonucleotide emits a first detectable signal if the first hairpin is not formed (Figure 3B).

The second oligonucleotide contains (i) a fifth nucleotide sequence, (ii) a sixth nucleotide sequence at the 5' end of the fifth nucleotide sequence, (iii) a seventh nucleotide sequence at the 5' end of the sixth nucleotide sequence, and (iv) an eighth nucleotide sequence at the 5' end of the seventh nucleotide sequence. Again, the second oligonucleotide is capable of forming a second hairpin containing nucleotides of the sixth and eighth nucleotide sequences, and the second oligonucleotide emits a second detectable signal if the second hairpin is not formed.

In step (B), the first oligonucleotide is incorporated into a double-stranded nucleic acid, by means of a polymerase, if the first identifying sequence is present in the sample, thereby preventing the first hairpin from forming (Figure 4, through 2 cycles). Alternatively, a polymerase effects the incorporation of the second oligonucleotide into a double-stranded nucleic acid, if the second identifying sequence is present in the sample, thereby preventing the second hairpin from forming. If both the first and second identifying sequences are present in the sample, each of the first and second oligonucleotides is incorporated into a double-stranded nucleic acid, precluding formation of the first and second hairpins, respectively.

In step (C), which is optional, an amplification reaction is conducted (Figure 4, through n cycles). The result is (i) incorporation of the first oligonucleotide into a first amplification product, if the first identifying sequence is present in the sample, (ii) incorporation of the second oligonucleotide into a second amplification product, if the second identifying sequence is present in the sample, or (iii) incorporation of the first oligonucleotide into the first amplification product and the second oligonucleotide into the second amplification product, if both identifying sequences are present in the sample. In step (D), a determination is made as to whether the first identifying sequence is present in the sample (i.e. , if the first signal is detected), whether the second identifying sequence is present (if the second signal is detected), or whether both identifying sequences are present in the sample (both signals are detected).

Advantageously, the first oligonucleotide emits the first detectable signal only if the first hairpin is not formed, and the second oligonucleotide emits the second detectable signal only if the second hairpin is not formed. The first detectable signal, emitted by the first oligonucleotide if the first hairpin is not formed, preferably is more intense than a signal emitted by the first oligonucleotide if the first hairpin is formed, and the second detectable signal, emitted by the second oligonucleotide if the second hairpin is not formed, is more intense than a signal emitted by the second oligonucleotide if the second hairpin is formed.

In another embodiment, the first oligonucleotide further contains a first molecular energy transfer pair which includes a first energy donor moiety that is capable of emitting a first energy, and a first energy acceptor moiety that is capable of absorbing an amount of the emitted first energy. The first donor moiety is attached to a nucleotide of the second nucleotide sequence and the first acceptor moiety is attached to a nucleotide of the fourth nucleotide sequence, or the first acceptor moiety is attached to a nucleotide of the second nucleotide sequence and the first donor moiety is attached to a nucleotide of the fourth nucleotide sequence, and the first acceptor moiety absorbs the amount of the emitted first energy only if the first hairpin is formed. Additionally, the second oligonucleotide further contains a second molecular energy transfer pair including a second energy donor moiety that is capable of emitting a second energy, and a second energy acceptor moiety that is capable of absorbing an amount of the emitted second energy. The second donor moiety is attached to a nucleotide of the sixth nucleotide sequence and the second acceptor moiety is attached to a nucleotide of the eighth nucleotide sequence, or the second acceptor moiety is attached to a nucleotide of the sixth nucleotide sequence and the second donor moiety is attached to a nucleotide of the eighth nucleotide sequence, and the second acceptor moiety absorbs the amount of the emitted second energy only if the second hairpin is formed.

It is preferred that each of the first and second donor moieties is a fluorophore, and that each of the first and second acceptor moieties is a quencher of light emitted by the fluorophore. Illustrative of the first and second acceptor moieties is DABSYL, while the first donor moiety can be fluorescein and the second acceptor moiety can be sulfarhodamine; alternatively, the first donor moiety is sulfarhodamine and the second acceptor moiety is fluorescein.

The amplification reaction ideally is a polymerase chain reaction, such as a triamplification, a nucleic acid sequence-based amplification, a strand displacement amplification, a cascade rolling circle amplification, or an amplification refractory mutation system. The amplification reaction may be conducted in situ.

As referred to herein, nucleic acids that are "complementary" can be perfectly or imperfectly complementary, as long as the desired property resulting from the complementarity is not lost, e.g., ability to hybridize.

An additional aspect of the present invention relates to kits for determining the presence of a first identifying sequence or a second identifying sequence or both. In specific embodiments, the kits comprise first to fifth oligonucleotides, in one or more containers. The kit can further comprise additional components for carrying out the amplification reactions of the invention. Where the target nucleic acid sequence being amplified is one implicated in disease or disorder, the kits can be used for diagnosis or prognosis. In a specific embodiment, a kit is provided that comprises, in one or more containers, forward and reverse primers of the invention for carrying out detection and amplification of the nucleic acid polymorphism, and optionally, a DNA polymerase or two DNA polymerases respectively with and without exonuclease activity. A kit for triamplification can further comprise, in one or more containers, a blocking oligonucleotide, and optionally DNA ligase. Oligonucleotides in containers can be in any form, e.g. , lyophilized, or in solution (e.g. , a distilled water or buffered solution), etc. oligonucleotides ready for use in the same amplification reaction can be combined in a single container or can be in separate containers. Multiplex kits are also provided, containing more than one pair of amplification (forward and reverse) primers, wherein the signal being detected from each amplified product is of a different wavelength, e.g., wherein the donor moiety of each primer pair fluoresces at a different wavelength. Such multiplex kits contain at least two such pairs of primers.

In a specific embodiment, a kit comprises, in one or more containers, a pair of primers preferably in the range of 10-100 or 10-80 nucleotides, and more preferably, in the range of 20-40 nucleotides, that are capable of priming amplification. Such primers can initiate amplification in a variety of amplification reactions, including, but not limited to, PCR (see e.g. , Innis et al. , 1990, PCR Protocols, Academic Press, Inc., San Diego, Calif.), competitive PCR, competitive reverse-transcriptase PCR (Clementi et al. , 1994, Genet. Anal. Tech. Appl. ll(l):l-6; Siebert et al. , 1992, Nature 359:557-558), triamplification, NASBA and strand displacement.

A pair of primers, consisting of a forward primer and a reverse primer, for use in PCR or strand displacement amplification, consists of primers that are each complementary with a different strand of two complementary nucleic acid strands, such that when an extension product of one primer in the direction of the other primer is generated by a nucleic acid polymerase, that extension product can serve as a template for the synthesis of the extension product of the other primer. A pair of primers, consisting of a forward primer and a reverse primer, for use in triamplification, consists of primers that are each complementary with a different strand of two complementary nucleic acid strands, such that when an extension-ligation product of one primer in the direction of the other primer is generated by a nucleic acid polymerase and a nucleic acid ligase, that extension-ligation product can serve as a template for the synthesis of the extension-ligation product of the other primer. The amplified product in these instances is that content of a nucleic acid in the sample between and including the primer sequences.

In another embodiment, a kit for determining the presence of a first identifying sequence or a second identifying sequence or both, comprising in one or more containers (a) oligonucleotide primers, one or both of which are hairpin primers labeled with fluorescent and quenching moieties that can perform MET; and optionally: (b) a control DNA target sequence; (c) an optimized buffer for amplification; (d) appropriate enzymes for the method of amplification contemplated, e.g., a DNA polymerase for PCR or triamplification or SDA, or a reverse transcriptase for NASBA; and (e) a set of directions for carrying out the amplification. Such directions can describe, for example, the optimal conditions, e.g. , temperature, number of cycles of amplification, pH, salt, etc, for conducting the reaction. Optionally, the kit provides (f) means for stimulating and detecting fluorescent light emissions, e.g. , a fluorescence plate reader or a combination thermocycler-plate-reader to perform the analysis.

In yet another embodiment, a kit for triamplification is provided. The kit comprises forward and reverse extending primers and a blocking oligonucleotide. Either the forward or reverse primer is labeled with one moiety of a pair of MET moieties, and the blocking oligonucleotide is labeled with the other MET moiety of the pair. One embodiment of such a kit comprises, in one or more containers: (a) a first oligonucleotide; (b) a second oligonucleotide, wherein said first and second oligonucleotides are linear primers for use in a triamplification reaction; (c) a third oligonucleotide that is a blocking oligonucleotide that comprises a sequence complementary and hybridizable to a sequence of said first oligonucleotide, said first and third oligonucleotides being labeled with a first and second moiety, respectively, that are members of a molecular energy transfer pair consisting of a donor moiety and an acceptor moiety, such that when said first and third oligonucleotides are hybridized to each other and the donor moiety is excited and emits energy, the acceptor moiety absorbs energy emitted by the donor moiety; and (d) in a separate container, a nucleic acid ligase.

Another embodiment of a kit comprises in a container a universal hairpin optionally also comprising a second container containing cyanogen bromide or a nucleic acid ligase (e.g. , DNA ligase, for example, T4 DNA ligase).

A kit for carrying out a reaction such as that shown in FIG. 2 comprises in one or more containers: (a) a first and second oligonucleotide; (b) a third oligonucleotide, wherein the first and second oligonucleotides are forward primers and the third oligonucleotide is a reverse primer for DNA synthesis in an amplification reaction to identify a nucleic acid polymorphism, and wherein said first and second oligonucleotides comprise (i) a 5' sequence that is not complementary to a preselected target sequence in said nucleic acid sequence, and (ii) a 3' sequence that is complementary to said preselected target sequence and may comprise one or more mismatch nucleotides; and (c) a fourth oligonucleotide that comprises in 5' to 3' order (i) a first nucleotide sequence of 6-30 nucleotides, wherein a nucleotide within said first nucleotide sequence is labeled with a first moiety selected from the group consisting of a donor moiety and an acceptor moiety of a molecular energy transfer pair, wherein the donor moiety emits energy of one or more particular wavelengths when excited, and the acceptor moiety absorbs energy at one or more particular wavelengths emitted by the donor moiety; (ii) a second, single-stranded nucleotide sequence of 3-20 nucleotides; (iii) a third nucleotide sequence of 6-30 nucleotides, wherein a nucleotide within said third nucleotide sequence is labeled with a second moiety selected from the group consisting of said donor moiety and said acceptor moiety, and said second moiety is the member of said group not labeling said first nucleotide sequence, wherein said third nucleotide sequence is sufficiently complementary in reverse order to said first nucleotide sequence for a duplex to form between said first nucleotide sequence and said third nucleotide sequence such that said first moiety and second moiety are in sufficient proximity such that, when the donor moiety is excited and emits energy, the acceptor moiety absorbs energy emitted by the donor moiety; (iv) at the 3' end of said third oligonucleotide primer, a fourth nucleotide sequence of 10-25 nucleotides that comprises at its 3' end a sequence identical to said 5' sequence of said first oligonucleotide primer. Where such kit is used for triamplification, a blocking oligonucleotide can also provided.

Another kit of the invention comprises in one or more containers: (a) a first oligonucleotide; (b) a second oligonucleotide, said first and second oligonucleotide being hybridizable to each other; said first oligonucleotide being labeled with a donor moiety said second oligonucleotide being labeled with an acceptor moiety, said donor and acceptor moieties being a molecular energy transfer pair, wherein the donor moiety emits energy of one or more particular wavelengths when excited, and the acceptor moiety absorbs energy at one or more particular wavelengths emitted by the donor moiety; and (c) in a separate container, a nucleic acid ligase.

The approach of the present invention presents a powerful tool for genetic disease diagnosis, carrier screening, HLA typing, human gene mapping, forensics, and paternity testing, inter alia. The invention is further described by reference to the following example, which is set forth by way of illustration only. Nothing in the following examples should be taken as a limitation upon the overall spirit and scope of the present invention.

EXAMPLES Example 1: General Amplification Reaction with Universal FRET Primers

1. Primer Design:

A schematic representation of the oligonucleotide primers of the present invention are shown in Figure 1.

For the purpose of the examples following, the oligonucleotide primers of the present invention will be referred as the primers listed below:

01 will herein be referred to as "forward primer". This is a sequence specific primer that contains one or more mismatched nucleotides for the detection of one or more polymorphisms and is capable of binding to the FAM universal primer;

02 will herein be referred to as "forward primer". This is the second sequence specific primer that contains one or more mismatched nucleotides for detection one or more polymorphisms. This primer is capable of binding to the SR universal primer;

03 will herein be referred to as the "reverse primer";

04 will herein be referred to as the "FAM universal primer"; and

05 will herein be referred to as the "SR universal primer".

Examples of the forward and reverse primer sequences can be found in Table 1 and Table 2. Table 1 illustrates representative examples of both forward and reverse primers. The sequence specific forward primer pairs in Table 1 differ at their terminal 3' nucleotide. Table 2 illustrates representative examples of both forward and reverse primers, as well as the gene target sequence containing the polymorphism.

The universal FRET primers used in the following examples, comprise the following sequences:

Green (FAM) primer:

5'-FAM-AGCGATGCGTTCGAGCArCGCTGAAGGTGACCAAGTTCATGCT-3' (SEQ ID NOJ); and red (Sulforhodmaine (SR)): 5'- (SR)-GGACGCTGAGATGCGTCC7XjAAGGTCGGAGTCAACGGATT-3' (SEQ ID NO:2).

The sequences capable of forming the hairpin are underlined in both universal primers and the italicized T shows where the DABSYL quencher is tethered to a base.

" [tail 1 ] = gaaggtgaccaagttcatgct corresponds to the 3' portion of FAM ^b [tail 2J = gaaggtcggagtcaacggatt correspond to the 3' portion of SR

Table 1

Comments: polymorphisms are shown in bold. In the C, the sequence shown in bold is deleted in the mutant allele. R=A or G, Y=T or C, S=G or C.

Table 2

1. Amplification: Amplification reactions were assembled in standard 96-well polypropylene PCR plates reactions, which can be read directly on an a Victor II fluorescence plate reader (Wallac). Alternatively, reactions can take place in tubes, and then be transferred to plates for fluorescence measurements. The PCR amplification reaction mixture is listed below.

2. Reaction Mix: Final volume was 20 μl:

Reagent Final Concentration

Genomic DNA -40 ng

Oligonculeotide 1 Primer 250 nM each

Oligonucleotide 3 Primer 250 nM

Oligonucleotide 4-FAM (Seq ID No:l) 250 nM

Oligonucleotide 5-SR (Seq ID No: 2) 250 nM

MgCl 1.8 mM

KC1 50 mM

Tris HC1 (pH 8.3) 100 M dNTPs 200 μM each rTaq Polymerase (Shuzo Co, Japan) 0.5 units

Water to volume *As an alternative enzyme, Platinum Taq (BRL) was successfully used with the same buffer.

3. PCR Reaction: The UltraPIates were sealed with cyclesealer (Robbins Scientific), placed onto the thermocycler block (Perkin-Elmer 9700) and preheated to 94°C. After heating at 94°C for 5 minutes, 35 cycles of amplification (10 seconds at 94°C, 20 seconds at 55°C, 40 seconds at 72°C) followed.

4. Fluorescence measurement: Following the reaction, the plate was placed in a black support to prevent cross-talk, and fluorescence intensity was measured with green and red filters. Several instruments were found to be adequate for the fluorescence measurement of the samples, two fluorescent plate readers and two digital cameras.

Measurements were performed using a Victor II fluorescence plate reader (Wallac). Additional emission and excitation filters for SR channel were installed by the manufacturer. Example 2: Multiplex allele-specific PCR for detecting a SNP in the CYP 17 gene

1. Amplification Reaction: Samples of human genomic DNA were analyzed for the presence of *2 allele in the CYP 17 gene. In particular, the DNA samples were analyzed for the presence of either the A-type or G-type allele.

PCR Amplification Reaction Primers

The unlabeled forward primer specific for the A-type allele comprised the sequence 5'-gaaggtgaccaagttcatgctGCCACAGCTCTTCTACTCCACT (SEQ ID No: 12), where the sequence identical to the 3 '-portion of the FAM labeled primer is shown in lower case. The unlabeled forward primer specific for the G-type allele comprised the sequence 5'-gaaggtcggagtcaacggattGCCACAGCTCTTCTACTCCACC, where the sequence identical to the 3 '-portion of the SR labeled primer is shown in lower case. The nucleotides directed to identifying the polymorphism are shown in bold. The reverse primer used in the reaction comprised the sequence GGCACCAGGCCACCTTCTCTT (SEQ ID No: 14). The universal FRET primers used were identical to those described in Example 1.

2. Amplification Reaction

Three sets of amplification reactions were prepared to determine whether a multiplex PCR reaction would be capable of achieving a high level of allelic discrimination. Reaction 1 (Singleplex): The amplification reaction mixture using human genomic DNA was the same as that described in Example 1, with the following differences. This reaction only utilized the primer specific for the A-type allele, the FAM labeled hairpin primer, and the reverse primer.

Reaction 2 (Singleplex): The amplification reaction mixture using human genomic DNA was the same as that described in Example 1, with the following differences. This reaction only utilized the primer specific for the G-type allele, the SR-labeled hairpin primer, and the reverse primer.

Reaction 3 (Multiplex): The amplification reaction mixture using human genomic DNA was the same as that described in Example 1. This reaction used both of the forward primers, i.e., the primer specific for the G-type allele and the primer specific for the A-type allele, the SR- labeled hairpin primer, the FAM-labeled hairpin primer, and the reverse primer. This reaction is exemplary of multiplex PCR amplification because both allele specific primers are present in the same reaction. 3. PCR Reaction

The three sets of reactions each included three 'no DNA controls' (NDC). The mixtures were preheated at 94°C for 3 min and subjected to thermocycling (PCR) for 35 cycles of 10 sec at 94°C, 20 sec at 55°C, and 40 sec at 72°C.

4. Fluorescence measurement

Following PCR, the relative fluorescence was measured in a plate reader, using emission filters 585 nm for FAM and 620 nm for SR. The average fluorescent signal in no DNA controls was subtracted from the corresponding signal of each sample reaction, and the corrected fluorescent signal is shown on the plot. (Figure 5B).

5. Results

The results are shown in Figures 5 A and 5B. Figures 5 A and 5B show that the A- specific primer had produced FAM signal on both A-type and G-type DNA (1 and 2), and the G-specific primer produced SR signal with both A-type and G-type DNA (3 and 4). Hence, when these primers were taken separately, the allelic discrimination was low and not sufficient to distinguish between the types of DNA. When both the A-specific and G- specific primers, however, were present simultaneously (reaction 3, multiplex PCR), (5 and 6).

Example 3: Multiplex allele-specific PCR for detecting a SNP in the HER2 gene 1. Amplification Reaction: Samples of genomic DNA were analyzed for the presence of a SNP in the HER2 gene. In particular, the DNA samples were analyzed for the presence of either the A-type or G-type allele.

PCR Amplification Reaction Primers

The primers and target sequence are summarized in Table 2(A). The unlabeled forward primer specific for the A-type allele comprised the sequence 5'-gaaggtgaccaagttcatgctGCC ACCACCGCAGAG T (SEQ ID No: XX), where the sequence identical to the 3 '-portion of the FAM labeled primer is shown in lower case and the nucleotide directed to identifying the polymorphism is shown in bold. The unlabeled forward primer specific for the G-type allele comprised the sequence 5'-gaaggtcggagtcaacggattGCCAACCACCGCAGAGAC (Seq ID No: XX), where the sequence identical to the 3 '-portion of the SR labeled primer is shown in lower case, and the nucleotide directed to identifying the polymorphism is shown in bold. The reverse primer used in the reaction comprised the sequence TCAATCCCTGACCCTGGCTT (SEQ ID No: XX). The universal FRET primers used were identical to those described in Example 1.

2. Multiplex Amplification Reaction

The amplification reaction mixture using genomic DNA was the same as that described in Example 1. This reaction used both of the forward primers, i.e., the primer specific for the G-type allele and the primer specific for the A-type allele, the SR-labeled hairpin primer, the FAM-labeled hairpin primer, and the reverse primer.

3. PCR Reaction

The PCR reactions each included four 'no DNA controls' (NDC). The mixtures were preheated at 94°C for 3 min and subjected to thermocycling (PCR) for 35 cycles of 10 sec at 94°C, 20 sec at 55°C, and 40 sec at 72°C.

4. Fluorescence measurement

Following PCR, the relative fluorescence was measured in a plate reader, using emission filters 585 nm for FAM and 620 nm for SR. The average fluorescent signal in no DNA controls was subtracted from the corresponding signal of each sample reaction, and the corrected fluorescent signal is shown on the plot. (Figures 6A and 6B).

5. Results

The results are shown in Figures 6A and 6B. The figure illustrates good allelic discrimination when both the A-specific and G-specific primers were present simultaneously.

Example 4: Multiplex allele-specific PCR for detecting a SNP in CYP2C8 gene by bridging the polymorphism

1. Amplification Reaction: Samples of genomic DNA were analyzed for the presence of a SNP in the CYP2C8 gene. In particular, the DNA samples were analyzed for the presence of either the C-type or T-type allele. The primers used in this reaction differ from each other. The primer specific for the T-type allele will bridge the polymorphism because a nucleotide other than its 3' terminal nucleotide differs.

PCR Amplification Reaction Primers

The primers and target sequence are summarized in Table 2(B). The unlabeled forward primer specific for the C-type allele comprised the sequence 5'-gaaggtgaccaagttcatgctGTTGCAGGTGATAGCAGATCG (SEQ ID No: XX), where the sequence identical to the 3 '-portion of the FAM labeled primer is shown in lower case, and the nucleotide directed to identifying the polymorphism is shown in bold. The unlabeled forward primer specific for the T-type allele comprised the sequence 5'-gaaggtcggagtcaacggattGTTGCAGGTGATAGCAGATAG (Seq ID No: XX), where the sequence identical to the 3 '-portion of the SR labeled primer is shown in lower case, and the nucleotide directed to identifying the polymorphism is shown in bold. With this primer, the second nucleotide removed from the 3' terminus of the primer differs rather than the 3' terminal nucleotide. The reverse primer used in the reaction comprised the sequence TGCTTCATCCCTGTCTGAAGAAT (SEQ ID No: XX). The universal FRET primers used were identical to those described in Example 1.

2. Multiplex Amplification Reaction

The amplification reaction mixture using genomic DNA was the same as that described in Example 1. This reaction used both of the forward primers, i.e., the primer specific for the c-type allele and the primer specific for the t-type allele, the SR-labeled hairpin primer, the FAM-labeled hairpin primer, and the reverse primer.

3. PCR Reaction

The PCR reactions each included four 'no DNA controls' (NDC). The mixtures were preheated at 94°C for 3 min and subjected to thermocycling (PCR) for 35 cycles of 10 sec at 94°C, 20 sec at 55°C, and 40 sec at 72°C. 4. Fluorescence measurement

Following PCR, the relative fluorescence was measured in a plate reader, using emission filters 585 nm for FAM and 620 nm for SR. The average fluorescent signal in no DNA controls was subtracted from the corresponding signal of each sample reaction, and the corrected fluorescent signal is shown on the plot. (Figures 7A and 7B).

5. Results

The results are shown in Figures 7 A and 7B. The figure illustrates good allelic discrimination when both the C-specific and T-specific primers were present simultaneously.

Example 5: Multiplex allele-specific PCR for detecting a SNP in HTR2C gene by bridging the polymorphism

1. Amplification Reaction: Samples of genomic DNA were analyzed for the presence of a SNP in the HTR2C gene. In particular, the DNA samples were analyzed for the presence of either the C-type or G-type allele. The primers used in this reaction will bridge the polymorphism because the 3 nucleotide removed from the 3' terminal nucleotide differs.

PCR Amplification Reaction Primers

The primers and target sequence are summarized in Table 2(C). The unlabeled forward primer specific for the C-type allele comprised the sequence 5'-gaaggtgaccaagttcatgctGGGCTCACAGAAATATCAGAT (SEQ ID No: XX), where the sequence identical to the 3 '-portion of the FAM labeled primer is shown in lower case and the nucleotide directed to identifying the polymorphism is shown in bold. The unlabeled forward primer specific for the T-type allele comprised the sequence 5'-gaaggtcggagtcaacggattGGGCTCACAGAAATATCACAT (Seq ID No: XX), where the sequence identical to the 3 '-portion of the SR labeled primer is shown in lower case and the nucleotide directed to identifying the polymorphism is shown in bold. With this primer, the second nucleotide removed from the 3' terminus of the primer differs rather than the 3' terminal nucleotide. The reverse primer used in the reaction comprised the sequence TGCACCTAATTGGCCTATTGGTTT (SEQ ID No: XX). The universal FRET primers used were identical to those described in Example 1. 2. Multiplex Amplification Reaction

The amplification reaction mixture using genomic DNA was the same as that described in Example 1. This reaction used both of the forward primers, i.e., the primer specific for the G-type allele and the primer specific for the C-type allele, the SR-labeled hairpin primer, the FAM-labeled hairpin primer, and the reverse primer.

3. PCR Reaction

4. Fluorescence measurement

Following PCR, the relative fluorescence was measured in a plate reader, using emission filters 585 nm for FAM and 620 nm for SR. The average fluorescent signal in no DNA controls was subtracted from the corresponding signal of each sample reaction, and the corrected fluorescent signal is shown on the plot. (Figures 8 A and 8B).

5. Results

The results are shown in Figures 8 A and 8B. The figure illustrates good allelic discrimination when both the C-specific and G-specific primers were present simultaneously.

Example 6: Multiplex allele-specific PCR for detecting a deletion in the CCR5 gene 1. Amplification Reaction: Samples of genomic DNA were analyzed for the presence of a deletion in the CCR5 gene. In particular, the DNA samples were analyzed for the presence of absence of the gene deletion.

PCR Amplification Reaction Primers

The primers and target sequence are summarized in Table 2(D). The unlabeled forward primer specific for the wild- type allele comprised the sequence 5'-gaaggtgaccaagttcatgctCTCATTTTCCATACAGTCA (SEQ ID No: XX), where the sequence identical to the 3 '-portion of the FAM labeled primer is shown in lower case and the nucleotide directed to identifying the wild-type allele is shown in bold. The unlabeled forward primer specific for the mutant allele comprised the sequence 5'-gaaggtcggagtcaacggattgcagctctcattttccatacatta (Seq ID No: XX), where the sequence identical to the 3 '-portion of the SR labeled primer is shown in lower case. The reverse primer used in the reaction comprised the sequence ACCAGCCCCAAGATGACTATCTT (SEQ ID No: XX). The universal FRET primers used were identical to those described in Example 1.

2. Multiplex Amplification Reaction

The amplification reaction mixture using genomic DNA was the same as that described in Example 1. This reaction used both of the forward primers, i.e., the primer specific for the wild type-allele and the primer specific for the mutant-allele, the SR-labeled hairpin primer, the FAM-labeled hairpin primer, and the reverse primer.

3. PCR Reaction

4. Fluorescence measurement

Following PCR, the relative fluorescence was measured in a plate reader, using emission filters 585 nm for FAM and 620 nm for SR. The average fluorescent signal in no DNA controls was subtracted from the corresponding signal of each sample reaction, and the corrected fluorescent signal is shown on the plot. (Figures 9A and 9B).

5. Results

The results are shown in Figures 9A and 9B. The figure illustrates good allelic discrimination when both the wild type-specific and mutant-specific primers were present simultaneously.

Claims

WHAT IS CLAIMED IS:

1. A method for determining the presence in a sample of a first identifying sequence or a second identifying sequence, or both, which method comprises:

(A) providing a first oligonucleotide comprising:

(B) providing a second oligonucleotide comprising:

(C) providing a third oligonucleotide,

(D) providing a fourth oligonucleotide comprising:

(i) a fifth nucleotide sequence,

(E) providing a fifth oligonucleotide comprising:

(i) a ninth nucleotide sequence,

(ii) a tenth nucleotide sequence at the 5' end of the ninth nucleotide sequence, (iii) an eleventh nucleotide sequence at the 5' end of the tenth nucleotide sequence, and

(F) if the first identifying sequence is present in the sample, then:

(i) annealing the first oligonucleotide to the first identifying sequence,

(iii) separating the first identifying sequence from the extended first strand,

(iv) annealing the third oligonucleotide to the extended first strand,

(x) annealing the third oligonucleotide to the doubly extended first strand, (xi) extending the 3' end of the third oligonucleotide using the doubly extended first strand as a template to form a doubly extended second strand,

(xii) optionally amplifying the doubly extended first and second strands,

(xiii) detecting the first detectable signal, and

(xiv) determining that the first identifying sequence is present in the sample, and (G) if the second identifying sequence is present in the sample, then:

(i) annealing the second oligonucleotide to the second identifying sequence, (ii) extending the 3 ' end of the second oligonucleotide using the second identifying sequence as a template to form an extended third strand, wherein the second identifying sequence is annealed to the extended third strand,

(iv) annealing the third oligonucleotide to the extended third strand,

(vi) separating the extended third strand from the extended fourth strand, (vii) annealing the fifth oligonucleotide to the extended fourth strand, (viii) extending the 3' end of the fifth oligonucleotide using the extended fourth strand as a template to form a doubly extended third strand, wherein the doubly extended third strand is annealed to the extended fourth strand,

(xii) optionally amplifying the doubly extended third and fourth strands, and

(xiii) detecting the second detectable signal, and

(xiv) determining that the second identifying sequence is present in the sample.

2. The method of claim 1 , wherein the sample is a genomic DNA sample.

3. The method of claim 1 , wherein the fourth oligonucleotide emits the first detectable signal only if the first hairpin is not formed, and the fifth oligonucleotide emits the second detectable signal only if the second hairpin is not formed.

4. The method of claim 1, wherein the first detectable signal emitted by the fourth oligonucleotide if the first hairpin is not formed is more intense than a signal emitted by the fourth oligonucleotide if the first hairpin is formed, and the second detectable signal emitted by the fifth oligonucleotide if the second hairpin is not formed is more intense than a signal emitted by the fifth oligonucleotide if the second hairpin is formed.

5. The method of claim 1, wherein the fourth oligonucleotide emits the first detectable signal only if the first hairpin is not formed, and the fifth oligonucleotide emits the second detectable signal only if the second hairpin is not formed.

6. The method of claim 1, wherein the fourth oligonucleotide further contains a first molecular energy transfer pair including a first energy donor moiety that is capable of emitting a first energy, and a first energy acceptor moiety that is capable of absorbing an amount of the emitted first energy, the first donor moiety is attached to a nucleotide of the second nucleotide sequence and the first acceptor moiety is attached to a nucleotide of the fourth nucleotide sequence, or the first acceptor moiety is attached to a nucleotide of the second nucleotide sequence and the first donor moiety is attached to a nucleotide of the fourth nucleotide sequence; and the first acceptor moiety absorbs the amount of the emitted first energy only if the first hairpin is formed, the fifth oligonucleotide further contains a second molecular energy transfer pair including a second energy donor moiety that is capable of emitting a second energy, and a second energy acceptor moiety that is capable of absorbing an amount of the emitted second energy, and the second donor moiety is attached to a nucleotide of the sixth nucleotide sequence and the second acceptor moiety is attached to a nucleotide of the eighth nucleotide sequence, or the second acceptor moiety is attached to a nucleotide of the sixth nucleotide sequence and the second donor moiety is attached to a nucleotide of the eighth nucleotide sequence, and the second acceptor moiety absorbs the amount of the emitted second energy only if the second hairpin is formed.

7. The method of claim 1, wherein each of the first and second donor moieties is a fluorophore and each of the first and second acceptor moieties is a quencher of light emitted by the fluorophore.

8. The method of claim 8, wherein the first and second acceptor moieties are DABSYL, wherein the first donor moiety is fluorescein and the second acceptor moiety is sulfarhodamine, or the first donor moiety is sulfarhodamine and the second acceptor moiety is fluorescein.

9. The method of claim 1, wherein the amplification reaction is a polymerase chain reaction.

10. The method of claim 1, wherein the amplification reaction is a triamplification, a nucleic acid sequence-based amplification, a strand displacement amplification, a cascade rolling circle amplification, or an amplification refractory mutation system.

11. The method of claim 1, wherein the amplification reaction is conducted in situ.

12. The method of claim 1, wherein (F)(xii) comprises:

(a) separating the doubly extended first strand from the doubly extended second strand,

(b) annealing the third oligonucleotide to the doubly extended first strand, and annealing the fourth oligonucleotide to the doubly extended second strand,

(c) extending the 3' end of the third oligonucleotide using the doubly extended first strand as a template to form another doubly extended second strand, wherein the doubly extended first strand is annealed to the other doubly extended second strand; and extending the 3' end of the fourth oligonucleotide using the doubly extended second strand as a template to form another doubly extended first strand, wherein the doubly extended second strand is annealed to the other doubly extended first strand, and

(d) repeating (a), (b), and (c) for a finite number of times, wherein, in (a), the doubly extended first and second strands respectively are the doubly extended first strand and the other doubly extended second strand of (c), or respectively are the other doubly extended first strand and the doubly extended second strand of (c).

13. The method of claim 1, wherein (G)(xii) comprises:

(a) separating the doubly extended third strand from the doubly extended fourth strand,

(b) annealing the third oligonucleotide to the doubly extended third strand, and annealing the fifth oligonucleotide to the doubly extended fourth strand,

(c) extending the 3' end of the third oligonucleotide using the doubly extended third strand as a template to form another doubly extended fourth strand, wherein the doubly extended third strand is annealed to the other doubly extended fourth strand; and extending the 3' end of the fifth oligonucleotide using the doubly extended fourth strand as a template to form another doubly extended third strand, wherein the doubly extended fourth strand is annealed to the other doubly extended third strand, and

(d) repeating (a), (b), and (c) for a finite number of times, wherein, in (a), the doubly extended third and fourth strands respectively are the doubly extended third strand and the other doubly extended fourth strand of (c), or respectively are the other doubly extended third strand and the doubly extended fourth strand of (c).

14. The method of claim 1, wherein the concentration of the first oligonucleotide in the reaction mixture in which (F)(i) is conducted is less than 50 nM.

15. The method of claim 1, wherein the concentration of the first oligonucleotide in the reaction mixture in which (F)(i) is conducted is less than 25 nM.

16. The method of claim 1 , wherein the concentration of the first oligonucleotide in the reaction mixture in which (F)(i) is conducted is less than 5 nM.

17. The method of claim 1, wherein the concentration of the first oligonucleotide in the reaction mixture in which (F)(i) is conducted is between 5 and 50 nM.

18. The method of claim 1, wherein the concentration of the first oligonucleotide in the reaction mixture in which (F)(i) is conducted is between 20 and 30 nM.

19. The method of claim 1, wherein the concentration of the first oligonucleotide in the reaction mixture in which (F)(i) is conducted is about 25 nM.

20. The method of claim 1, wherein the concentration of the fourth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is less than 500 nM.

21. The method of claim 1, wherein the concentration of the fourth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is less than 250 nM.

22. The method of claim 1, wherein the concentration of the fourth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is less than 50 nM.

23. The method of claim 1, wherein the concentration of the fourth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is between 50 and 500 nM.

24. The method of claim 1, wherein the concentration of the fourth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is between 200 and 300 nM.

25. The method of claim 1, wherein the concentration of the fourth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is about 250 nM.

26. The method of claim 1, wherein the concentration of the fourth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is at least five times the concentration of the first oligonucleotide in the reaction mixture in which (F)(i) is conducted.

27. The method of claim 1 , wherein the concentration of the fourth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is at least ten times the concentration of the first oligonucleotide in the reaction mixture in which (F)(i) is conducted.

28. The method of claim 1, wherein the concentration of the fourth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is at least twenty times the concentration of the first oligonucleotide in the reaction mixture in which (F)(i) is conducted.

29. The method of claim 1, wherein the concentration of the fourth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is at least thirty times the concentration of the first oligonucleotide in the reaction mixture in which (F)(i) is conducted.

30. The method of claim 1, wherein the concentration of the fourth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is from five to thirty times the concentration of the first oligonucleotide in the reaction mixture in which (F)(i) is conducted.

31. The method of claim 1 , wherein the concentration of the fourth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is from ten to twenty times the concentration of the first oligonucleotide in the reaction mixture in which (F)(i) is conducted.

32. The method of claim 1, wherein the concentration of the fourth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is about ten times the concentration of the first oligonucleotide in the reaction mixture in which (F)(i) is conducted.

33. The method of claim 1 , wherein the concentration of the second oligonucleotide in the reaction mixture in which (F)(i) is conducted is less than 50 nM.

34. The method of claim 1, wherein the concentration of the second oligonucleotide in the reaction mixture in which (F)(i) is conducted is less than 25 nM.

35. The method of claim 1 , wherein the concentration of the second oligonucleotide in the reaction mixture in which (F)(i) is conducted is less than 5 nM.

36. The method of claim 1 , wherein the concentration of the second oligonucleotide in the reaction mixture in which (F)(i) is conducted is between 5 and 50 nM.

37. The method of claim 1, wherein the concentration of the second oligonucleotide in the reaction mixture in which (F)(i) is conducted is between 20 and 30 nM.

38. The method of claim 1, wherein the concentration of the second oligonucleotide in the reaction mixture in which (F)(i) is conducted is about 25 nM.

39. The method of claim 1, wherein the concentration of the fifth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is less than 500 nM.

40. The method of claim 1, wherein the concentration of the fifth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is less than 250 nM.

41. The method of claim 1 , wherein the concentration of the fifth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is less than 50 nM.

42. The method of claim 1, wherein the concentration of the fifth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is between 50 and 500 nM.

43. The method of claim 1 , wherein the concentration of the fifth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is between 200 and 300 nM.

44. The method of claim 1, wherein the concentration of the fifth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is about 250 nM.

45. The method of claim 1, wherein the concentration of the fifth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is at least five times the concentration of the second oligonucleotide in the reaction mixture in which (F)(i) is conducted.

46. The method of claim 1, wherein the concentration of the fifth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is at least ten times the concentration of the second oligonucleotide in the reaction mixture in which (F)(i) is conducted.

47. The method of claim 1 , wherein the concentration of the fifth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is at least twenty times the concentration of the second oligonucleotide in the reaction mixture in which (F)(i) is conducted.

48. The method of claim 1, wherein the concentration of the fifth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is at least thirty times the concentration of the second oligonucleotide in the reaction mixture in which (F)(i) is conducted.

49. The method of claim 1, wherein the concentration of the fifth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is from five to thirty times the concentration of the second oligonucleotide in the reaction mixture in which (F)(i) is conducted.

50. The method of claim 1, wherein the concentration of the fifth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is from ten to twenty times the concentration of the second oligonucleotide in the reaction mixture in which (F)(i) is conducted.

51. The method of claim 1, wherein the concentration of the fifth oligonucleotide in the reaction mixture in which (F)(vii) is conducted is about ten times the concentration of the second oligonucleotide in the reaction mixture in which (F)(i) is conducted.

52. A method for determining the presence in a sample of a first identifying sequence or a second identifying sequence, or both, which method comprises:

(A) contacting the sample with first and second oligonucleotides, wherein the first oligonucleotide contains: (i) a first nucleotide sequence, (ii) a second nucleotide sequence at the 5' end of the first nucleotide sequence,

(i) a fifth nucleotide sequence,

(iv) an eighth nucleotide sequence at the 5' end of the seventh nucleotide sequence, wherein the second oligonucleotide is capable of forming a second hairpin containing nucleotides of the sixth and eighth nucleotide sequences, and the second oligonucleotide emits a second detectable signal if the second hairpin is not formed, (B) incorporating:

(iii) each of the first and second oligonucleotides into a double-stranded nucleic acid using a polymerase if both of the first and second identifying sequences are present in the sample, thereby preventing each of the first and second hairpins from forming, (C) optionally conducting an amplification reaction, thereby incorporating:

(D) determining:

(iii) that the first and second identifying sequences are present in the sample if the first and second signals are detected.

53. The method of claim 1, wherein the sample is a genomic DNA sample.

54. The method of claim 1, wherein the first oligonucleotide emits the first detectable signal only if the first hairpin is not formed, and the second oligonucleotide emits the second detectable signal only if the second hairpin is not formed.

55. The method of claim 1 , wherein the first detectable signal emitted by the first oligonucleotide if the first hairpin is not formed is more intense than a signal emitted by the first oligonucleotide if the first hairpin is formed, and the second detectable signal emitted by the second oligonucleotide if the second hairpin is not formed is more intense than a signal emitted by the second oligonucleotide if the second hairpin is formed.

56. The method of claim 1 , wherein the first oligonucleotide emits the first detectable signal only if the first hairpin is not formed, and the second oligonucleotide emits the second detectable signal only if the second hairpin is not formed.

57. The method of claim 1, wherein the first oligonucleotide further contains a first molecular energy transfer pair including a first energy donor moiety that is capable of emitting a first energy, and a first energy acceptor moiety that is capable of absorbing an amount of the emitted first energy, the first donor moiety is attached to a nucleotide of the second nucleotide sequence and the first acceptor moiety is attached to a nucleotide of the fourth nucleotide sequence, or the first acceptor moiety is attached to a nucleotide of the second nucleotide sequence and the first donor moiety is attached to a nucleotide of the fourth nucleotide sequence; and the first acceptor moiety absorbs the amount of the emitted first energy only if the first hairpin is formed, the second oligonucleotide further contains a second molecular energy transfer pair including a second energy donor moiety that is capable of emitting a second energy, and a second energy acceptor moiety that is capable of absorbing an amount of the emitted second energy, and the second donor moiety is attached to a nucleotide of the sixth nucleotide sequence and the second acceptor moiety is attached to a nucleotide of the eighth nucleotide sequence, or the second acceptor moiety is attached to a nucleotide of the sixth nucleotide sequence and the second donor moiety is attached to a nucleotide of the eighth nucleotide sequence, and the second acceptor moiety absorbs the amount of the emitted second energy only if the second hairpin is formed.

58. The method of claim 6, wherein each of the first and second donor moieties is a fluorophore and each of the first and second acceptor moieties is a quencher of light emitted by the fluorophore.

59. The method of claim 7, wherein the first and second acceptor moieties are DABSYL, wherein the first donor moiety is fluorescein and the second acceptor moiety is sulfarhodamine, or the first donor moiety is sulfarhodamine and the second acceptor moiety is fluorescein.

60. The method of claim 1, wherein the amplification reaction is a polymerase chain reaction.

61. The method of claim 1, wherein the amplification reaction is a triamplification, a nucleic acid sequence-based amplification, a strand displacement amplification, a cascade rolling circle amplification, or an amplification refractory mutation system.

62. The method of claim 1, wherein the amplification reaction is conducted in situ.

63. A kit for determining the presence in a sample of a first identifying sequence or a second identifying sequence, or both, comprising, in one or more containers: (a) a first and second oligonucleotide; (b) a third oligonucleotide, wherein the first and second oligonucleotides are forward primers and the third oligonucleotide is a reverse primer for DNA synthesis in an amplification reaction to identify a nucleic acid polymorphism, and wherein said first and second oligonucleotides comprise (i) a 5' sequence that is not complementary to a preselected target sequence in said nucleic acid sequence, and (ii) a 3' sequence that is complementary to said preselected target sequence and may comprise one or more mismatch nucleotides; and (c) a fourth oligonucleotide that comprises in 5' to 3' order (i) a first nucleotide sequence of 6-30 nucleotides, wherein a nucleotide within said first nucleotide sequence is labeled with a first moiety selected from the group consisting of a donor moiety and an acceptor moiety of a molecular energy transfer pair, wherein the donor moiety emits energy of one or more particular wavelengths when excited, and the acceptor moiety absorbs energy at one or more particular wavelengths emitted by the donor moiety; (ii) a second, single-stranded nucleotide sequence of 3-20 nucleotides; (iii) a third nucleotide sequence of 6-30 nucleotides, wherein a nucleotide within said third nucleotide sequence is labeled with a second moiety selected from the group consisting of said donor moiety and said acceptor moiety, and said second moiety is the member of said group not labeling said first nucleotide sequence, wherein said third nucleotide sequence is sufficiently complementary in reverse order to said first nucleotide sequence for a duplex to form between said first nucleotide sequence and said third nucleotide sequence such that said first moiety and second moiety are in sufficient proximity such that, when the donor moiety is excited and emits energy, the acceptor moiety absorbs energy emitted by the donor moiety; (iv) at the 3' end of said third oligonucleotide primer, a fourth nucleotide sequence of 10-25 nucleotides that comprises at its 3' end a sequence identical to said 5' sequence of said first oligonucleotide primer.

64. The kit of claim 63, further comprising a fifth oligonucleotide that comprises in 5' to 3' order (i) a first nucleotide sequence of 6-30 nucleotides, wherein a nucleotide within said first nucleotide sequence is labeled with a first moiety selected from the group consisting of a donor moiety and an acceptor moiety of a molecular energy transfer pair, wherein the donor moiety emits energy of one or more particular wavelengths when excited, and the acceptor moiety absorbs energy at one or more particular wavelengths emitted by the donor moiety; (ii) a second, single-stranded nucleotide sequence of 3-20 nucleotides; (iii) a third nucleotide sequence of 6-30 nucleotides, wherein a nucleotide within said third nucleotide sequence is labeled with a second moiety selected from the group consisting of said donor moiety and said acceptor moiety, and said second moiety is the member of said group not labeling said first nucleotide sequence, wherein said third nucleotide sequence is sufficiently complementary in reverse order to said first nucleotide sequence for a duplex to form between said first nucleotide sequence and said third nucleotide sequence such that said first moiety and second moiety are in sufficient proximity such that, when the donor moiety is excited and emits energy, the acceptor moiety absorbs energy emitted by the donor moiety; (iv) at the 3' end of said third oligonucleotide primer, a fourth nucleotide sequence of 10-25 nucleotides that comprises at its 3' end a sequence identical to said 5' sequence of said second oligonucleotide primer.

65. A kit for determining the presence of a first identifying sequence or a second identifying sequence or both, comprising in one or more containers: (a) oligonucleotide primers, one or more of which are hairpin primers labeled with fluorescent and quenching moieties that can perform MET; and optionally: (b) a control DNA target sequence; (c) an optimized buffer for amplification; (d) appropriate enzymes for the method of amplification contemplated, e.g., a DNA polymerase for PCR or triamplification or SDA, or a reverse transcriptase for NASBA; and (e) a set of directions for carrying out the amplification.