EP1352060A2 - Methods for expressing endogenous genes by restriction enzyme mediated integration - Google Patents

Methods for expressing endogenous genes by restriction enzyme mediated integration

Info

Publication number
EP1352060A2
EP1352060A2 EP01992773A EP01992773A EP1352060A2 EP 1352060 A2 EP1352060 A2 EP 1352060A2 EP 01992773 A EP01992773 A EP 01992773A EP 01992773 A EP01992773 A EP 01992773A EP 1352060 A2 EP1352060 A2 EP 1352060A2
Authority
EP
European Patent Office
Prior art keywords
dependent
cells
cell
factor
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01992773A
Other languages
German (de)
French (fr)
Inventor
Janine Lin
Debbie Yaver
Donald Foster
Richard Holly
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zymogenetics Inc
Novozymes Inc
Original Assignee
Zymogenetics Inc
Novozymes Biotech Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zymogenetics Inc, Novozymes Biotech Inc filed Critical Zymogenetics Inc
Publication of EP1352060A2 publication Critical patent/EP1352060A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression

Definitions

  • the present invention relates to methods for identifying and isolating endogenous genes in mammalian cells by restriction enzyme mediated integration of a regulatory sequence and to isolated genes obtained by such methods.
  • the present invention also relates to methods for expressing endogenous genes of mammalian cells.
  • WO 99/15650 discloses methods for activating gene expression or causing over- expression of a gene in human HH1 cells by non-homologous or illegitimate recombination with a vector having a splice donor sequence which directs a regulatory sequence of a non-homologously integrated vector to become operably linked to the endogenous gene.
  • the present invention relates to a method for producing a mutant mammalian cell by introducing into mammalian cells a nucleic acid construct and a restriction enzyme under conditions where the nucleic acid construct integrates into the genome of the mammalian cells at sites generated by the restriction enzyme.
  • the method involves growing the mammalian cells and selecting for a mutant mammalian cell having a trait of interest.
  • the nucleic acid construct preferably includes a regulatory region
  • the present invention also relates to methods for expressing an endogenous gene in mammalian cells by integration of a regulatory sequence such that expression of the gene is altered, preferably by being activated or increased.
  • the present invention also relates to isolated genes obtained from mammalian cells produced by such methods and to nucleic acid constructs, expression vectors, and host cells containing the isolated genes, and methods of producing polypeptides with such host cells.
  • such genes are isolated by identifying the locus at the site of integration of the nucleic acid construct and isolating the gene controlling the trait of interest.
  • the present invention also relates to methods of obtaining mutant mammalian cells having an altered expression of an endogenous gene, and to mutant mammalian cells obtained by such methods.
  • the present invention further relates to methods of obtaining mutant mammalian cells having activated or increased expression of an endogenous gene, and to mutant mammalian cells obtained by such methods.
  • the present invention further relates to methods for producing transfectants of mammalian cells.
  • the integration is by restriction enzyme mediated integration.
  • Figure 1 shows proliferation phenotypes of wild type Ba F3 and four positive clones in response to G-CSF.
  • the proliferation of each clone in the presence of IL-3 is normalized as 100%.
  • the percentage of proliferation in the presence of G-CSF compared with that in response to IL-3 for each clone is indicated.
  • FIG. 2 shows schematic diagrams of two G-CSFR-specific PCR products (31A6-9 Race 1 and 2) generated from 5' RACE analysis that determine linkage between the CMV promoter and the G-CSFR gene in the 31A6-9 cell clone.
  • Figure 3 shows the DNA sequence (SEQ ID NO. 12) of the 31A6-9 RACE product 1.
  • the CMV promoter sequence is in bold; G-CSFR intron 1 sequence is in lower case; and regions of G-CSFR exon 2, 3, and 4, are indicated and underlined.
  • the two nucleotides (ac) at the junction of CMV promoter and intron 1 could be either CMV promoter or intron 1 sequence, thus labeled bold and lower case.
  • the amino acid sequence (SEQ ID NO. 13) of the G-CSFR protein initiated from exon 3 is also indicated.
  • FIG. 4 shows the DNA sequence (SEQ ID NO. 14) of the 31A6-9 RACE product 2.
  • the CMV promoter sequence is in bold; G-CSFR intron 1 sequence is in lower case; and regions of G-CSFR exon 2, 3, and 4, are indicated and underlined.
  • the two nucleotides (ac) at the junction of CMV promoter and intron 1 could be either CMV promoter or intron 1 sequence, thus labeled bold and lower case.
  • the amino acid sequence (SEQ ID NO. 15) of the G-CSFR protein initiated from exon 3 is also indicated.
  • Figures 5 A and B show the DNA sequence (SEQ ID NO. 16) of the genomic PCR product amplified with CMV promoter- and G-CSFR-specific primers from the 31A6-9 cell clone. Regions of CMV promoter are labeled. A stretch of DNA rearrangement resulting in a flipped CMV promoter region (772-696) is indicated. The assigned nucleotide number of the CMV promoter is according to that in pcDNA3.1(+). G-CSFR intron 1 sequence is shown in lower case. The G-CSFR transcription start site of either RACE products is in bold and labeled as +1 (for RACE-1) or +1 ' (for RACE-2).
  • Figure 6 shows the DNA sequence (SEQ ID NO. 17) of the G-CSFR genomic
  • the H elll site located immediately upstream of the insertion site is in bold.
  • G-CSFR intron 1 sequence is in lower case.
  • Figure 7 shows schematic diagrams of two G-CSFR-specific PCR products (31A10-2 RACE 1 and 2) generated from 5' RACE analysis that shows linkage between the CMV promoter and the G-CSFR gene in the 31A10-2 cell clone.
  • the nucleotide number of the ampicillin resistance gene is according to numbers in pcDNA3.1 (+).
  • Figure 8 shows the DNA sequence (SEQ ID NO.18) and deduced amino acid sequence (SEQ ID NO. 19) of the 31A10-2 RACE product 1.
  • the ampicillin resistance gene and G-CSFR exon 4 sequences are indicated and underlined.
  • a previously unidentified genomic DNA sequence region flanked in between is in lower case.
  • Figure 9 shows the DNA sequence (SEQ ID NO. 20) of the 31A10-2 RACE product 2.
  • the ampicillm resistance gene and G-CSFR exon 4 sequences are indicated and underlined.
  • a previously unidentified genomic DNA sequence region flanked in between is in lower case.
  • Figure 10 shows schematic diagrams of two G-CSFR-specific PCR products (31B5-10 RACE 1 and 2) generated from 5' RACE analysis that demonstrates linkage between the CMV promoter and the G-CSFR gene in the 31B5-10 cell clone.
  • Figure 11 shows the DNA sequence (SEQ ID NO. 21) and deduced amino acid sequence (SEQ ID NO. 22) of the 31B5-10 RACE product 1.
  • the CMV promoter sequence is in bold; G-CSFR -1.1 kb region and exon 4 sequences are indicated and underlined.
  • a previously unidentified genomic DNA sequence region flanked between - 1.1 kb region and exon 4 is in lower case.
  • Predicted translation in RACE 1 is indicated, initiating from the unidentified genomic DNA sequence.
  • the 40 th amino acid (cysteine) (coding sequence underlined) encoded in exon 4 is the start of the matured G-CSFR peptide.
  • Figure 12 shows the DNA sequence (SEQ ID NO. 23) of the 31B5-10 RACE product 2.
  • the CMV promoter sequence is in bold; G-CSFR -1.1 kb region and exon 4 sequences are indicated and underlined.
  • Figure 13 shows a schematic diagram of the genomic PCR product amplified with CMV promoter- and G-CSFR-specific (located in intron 1) primers from the 31B5- 10 cell clone.
  • Figure 14 shows the DNA sequence (SEQ ID NO. 24) of the genomic PCR product amplified with CMV promoter- and G-CSFR-specific (located in -1.1 kb region) primers from the 31B5-10 cell clone. CMV promoter and G-CSFR -1.1 kb regions are underlined and indicated. The transcriptional start site of the 31B5-10 mRNA is indicated as +1 and in bold.
  • Figure 15 shows a schematic diagram of the G-CSFR-specific PCR products generated from 5' RACE analysis of the 31B9-3 cell clone.
  • Figure 16 shows the DNA sequence (SEQ ID NO. 25) and deduced amino acid sequence (SEQ ID NO. 26) of the RACE products from the 31B9-3 cell clone.
  • the G- CSFR -1.2 kb region, exon 3, and exon 4 sequences are indicated and underlined. Amino acid sequence of the G-CSFR protein initiated from exon 3 is also indicated.
  • Figures 17 shows a schematic diagram of the location of the pcDNA3.1(+) insertion in relation to the G-CSFR gene in the 31B9-3 cell clone.
  • Figure 18 A and B show the DNA sequence (SEQ ID NO. 31) of sequenced nucleotides from the rescued plasmid from the 31B9-3 cell clone.
  • the G-CSFR exons 1 and 2, and intron 1 and partial intron 2 sequences are indicated and underlined.
  • the present invention relates to a method for producing a mutant mammalian cell by introducing into mammalian cells a nucleic acid construct and a restriction enzyme.
  • the method involves introducing the cells under conditions where the restriction enzyme is active, and where the nucleic acid construct may integrate into sites generated in the genome.
  • the method involves growing the mammalian cells and selecting for a mutant mammalian cell having a trait of interest.
  • the methods of the present invention now make it possible to create large libraries of even those mammalian cells which have a low transfection efficiency, and can be used for discovering and isolating new genes.
  • the trait which is observed in the mutant mammalian cell may result from altered expression of a naturally-occurring polypeptide, either in quantity, or by expression in a modified form.
  • the trait may comprise a phenotype which occurs with either increased or reduced expression of a naturally-occurring polypeptide.
  • the methods of the present invention are particularly useful for identifying and isolating genes that are unknown as a result of their expression being undetectable. Thus, the instant methods require no knowledge of the existence of a gene. However, the methods of the present invention can be used to over-express a known endogenous gene that is expressed poorly.
  • a restriction enzyme and a restriction enzyme- digested nucleic acid construct comprising a regulatory sequence into a multiplicity of mammalian cells
  • a gene endogenous to a mammalian cell is activated or over-expressed allowing its isolation and characterization.
  • the nucleic acid construct is generally devoid of any nucleic acid sequence that would promote homologous recombination of the construct at a predetermined site of the cell's genome. Rather, the construct integrates into the mammalian cell's genome by restriction enzyme-mediated integration through the action of the restriction enzyme.
  • the nucleic acid construct may be a restriction enzyme cleaved nucleic acid fragment, or a synthetic DNA, cDNA and a PCR product. Though the construct is preferably a linear construct, it may be linearized by said restriction enzyme upon introduction to the mammalian cells. Alternatively, the nucleic acid construct may be linearized by the restriction enzyme before being introduced into said mammalian cells. The nucleic acid construct may even be linearized by a second restriction enzyme before being introduced into said mammalian cells, though it is preferable that the restriction enzyme used to linearize the fragment produce similar ends. In the methods of the present invention, the integration preferably occurs by restriction enzyme-mediated integration.
  • restriction enzyme-mediated integration is defined herein as the non-homologous end-joining of DNA molecules that contain an end capable of being joined to a second DNA end either directly, or following repair or processing, but do not share significant sequence homology.
  • the DNA end can consist of a 5 ' overhang, 3 ' overhang, or blunt end.
  • the present invention also relates to methods for isolating a gene by identifying and isolating a mutant mammalian cell having altered expression of a gene encoding a polypeptide which confers a phenotype.
  • the expression of the gene results from the integration of the introduced linearized nucleic acid construct such that the expression of the gene encoding the polypeptide is altered and results in the phenotype.
  • the mutant mammalian cell is then cultivated under conditions suitable for observation of the phenotype, and the locus of the mutant mammalian cell is identified at the site of integration, leading to isolation of the gene controlling the trait of interest.
  • the present invention further relates to methods for producing a polypeptide, comprisingcultivating the mutant mammalian cell of under conditions suitable for expressing the gene; and isolating the polypeptide so expressed.
  • introduction of a restriction enzyme into a mammalian cell cleaves at specific sites of the genomic DNA of the cell. These cleavage breaks can serve as sites for integration of the nucleic acid construct linearized with the same or a different restriction enzyme.
  • the presence of the restriction enzyme may induce cleavage at non-specific sites in the genome which may serve as integration sites.
  • the restriction enzyme can be at least a four, five, six, seven, eight, or nine base restriction enzyme.
  • restriction enzymes including 4- base to 8-base cutters with differing specificities as to which sites are cleaved.
  • many breaks or a few breaks in the genomic DNA can be achieved. If a recognition site for a restriction enzyme is located near an unknown gene, then treatment of the cells with the restriction enzyme can increase the probability of integrating the construct in a configuration to activate or over-express the gene.
  • the restriction enzyme can be any enzyme that is useful in the methods of the present invention.
  • a 4-base recognition enzyme can be preferred over a 6- base recognition enzyme, because more 4-base target sites are generally present in the genome than 6-base sites.
  • 4-base recognition sites can be used in combination with a linearized plasmid by a 6- or 8-base recognition sites as shown below:
  • Restriction enzymes that recognize different sequences from the ends of the linearized plasmid can also be used, i.e., the ends of the linearized construct do not need to be compatible with the restriction enzyme being introduced into the cell during transfection. Therefore, additional 4-base recognition enzymes can be used under such circumstances. Examples are HinP ⁇ , Hpa ⁇ !, Msel, Msp ⁇ , and Taq ⁇ . If using a 4 base- recognition enzyme does not generate positive clones, 6 or 8 base-recognition enzymes can be used. Examples of 6 base-recognition enzymes include, but not limited to,
  • Examples of 8 base-recognition enzymes include, but not limited to, Asc ⁇ , Not!, Pad, Pme ⁇ , Sbfi, SgrA ⁇ , Sg ⁇ , Swa ⁇ , and &e83871.
  • restriction enzymes can be used since the introduction of each enzyme into a cell will create different integration sites resulting in a different integration pattern.
  • integration of the construct can be biased to a desired site in the genome to create "biased" libraries enriched for certain types of activated genes.
  • restriction enzyme sites containing CpG dinucleotides are generally under-represented in the genome at large, but over- represented in the form of CpG islands at the 5' end of many genes. Enzymes recognizing these sites, therefore, will preferentially cleave at the 5' end of gene sequences.
  • Restriction enzymes recognizing CpG containing sites include Eag!, Bsi-J47, A4Q and B sHII.
  • the nucleic acid construct comprises suitable restriction sites to facilitate restriction enzyme-mediated integration of the construct in the cell's genome.
  • the construct also comprises a regulatory sequence such that when the regulatory sequence integrates at a locus in a cell's genome the regulatory sequence can be operably linked to an endogenous gene thereby affecting transcription, post-transcriptional modification, translation, or post-translation modification.
  • the instant methods are particularly useful for activating or over-expressing an endogenous gene.
  • the restriction enzyme sites are located downstream and upstream of the regulatory sequence such that they do not affect the functional integrity of the regulatory sequence.
  • the construct preferably contains multiple restriction sites to increase the construct's versatility for generating different libraries.
  • the sites can be separated from the regulatory sequence by a "spacer arm” to protect the functional regulatory sequence from exonucleolytic degradation during the transfection process (see Example 14).
  • upstream region and downstream region are defined herein as regions 5' or 3', respectively, of the coding sequence of a gene.
  • regulatory sequence is defined herein to include any component which is necessary or advantageous for the expression of a polypeptide in a mammalian cell. Expression of a polypeptide is understood in the present invention to include transcription, post transcriptional modification, translation, and post-translational modification.
  • the regulatory sequence can be native or foreign to the cell. Such regulatory sequences include, but are not limited to, an enhancer, leader, propeptide sequence, promoter, and signal peptide sequence.
  • operably linked is defined herein as a configuration in which, a regulatory sequence is appropriately placed at a position relative to the coding sequence of the gene's DNA sequence such that the regulatory sequence directs the expression or localization of a polypeptide.
  • the regulatory sequences can be obtained from genes of eukaryotes, viruses, retroviruses, and the like. Such genes include, but are not limited to, the actin gene, metallothionein I gene, immunoglobulin genes, casein 1 gene, serum albumin gene, collagen gene, globin genes, laminin gene, spectrin gene, ankyrin gene, sodium/potassium ATPase gene, tubulin gene. Cytomegalovirus (CMV) immediate early gene, adenovirus late genes, SV40 genes, retroviral LTRs, and Herpes virus genes.
  • CMV Cytomegalovirus
  • the regulatory sequence can be an appropriate promoter sequence, a nucleic acid sequence which contains transcriptional control sequences which mediate the expression of the gene.
  • the promoter can be any nucleic acid sequence which shows transcriptional activity in the cell including mutant, truncated, and hybrid promoters, and can be obtained from genes encoding extracellular or intracellular polypeptides.
  • the promoter can be native to the cell or foreign thereto. Moreover, the promoter can be inducible or a tissue specific promoter.
  • a promoter sequence is located in the 5' non-coding region of a gene, proximal to the transcriptional start site of a structural gene.
  • a "core promoter” contains essential nucleotide sequences for promoter function, including the TATA box and start of transcription. By this definition, a core promoter can or can not have detectable activity in the absence of specific sequences that can enhance the activity or confer tissue specific activity. Sequence elements within promoters that function in the initiation of transcription are often characterized by consensus nucleotide sequences. These promoter elements include RNA polymerase binding sites, TATA sequences, CAAT sequences, differentiation-specific elements (DSEs; McGehee et al, 1993, Moi. Endocrinol. 7: 551), cyclic AMP response elements (CREs), serum response elements (SREs; Treisman,
  • GREs glucocorticoid response elements
  • a promoter is an inducible promoter, then the rate of transcription increases in response to an inducing agent. In contrast, the rate of transcription is not regulated by an inducing agent if the promoter is a constitutive promoter. Repressible promoters are also known.
  • a “regulatory element” is a nucleotide sequence that modulates the activity of a core promoter.
  • a regulatory element can contain a nucleotide sequence that binds with cellular factors enabling transcription exclusively or preferentially in particular cells, tissues, or organelles. These types of regulatory elements are typically associated with genes that are expressed in a "cell-specific,” “tissue-specific,” or “organelle-specific” manner.
  • An “enhancer” is a type of regulatory element that can increase the efficiency of transcription, regardless of the distance or orientation of the enhancer relative to the start site of transcription. Effective enhancer sequences include, but are not limited to, the cytomegaloviris immediate early gene enhancer and cellular, non-viral enhancers, ABC enhancer, myoD, Spl, and human elongation factor 1A-1.
  • Suitable promoters for directing the transcription of a gene in a mammalian cell include, but are not limited to, the Cytomegalovirus (CMV) immediate early gene promoter (Foecking et al, 1980, Gene 45: 101), tetracycline inducible promoter, metallothionein promoter (Hamer et al, 1982, J. Molec. Appl. Genet. 1: 273), TK promoter of Herpes virus (McKnight, 1982, Cell 31: 355), SV40 early promoter (Benoist et al, 1981, Nature 290: 304), and Rous sarcoma virus promoter (Gorman et al, 1982, Proc. Nat'l Acad.
  • CMV Cytomegalovirus
  • TK TK promoter of Herpes virus
  • SV40 early promoter Benoist et al, 1981, Nature 290: 304
  • Rous sarcoma virus promoter Rous
  • the regulatory sequence can also comprise a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the cell.
  • the leader sequence is operably linked to the 5' terminus of the nucleic acid sequence encoding the polypeptide. Any leader sequence that is functional in a mammalian cell can be used in the present invention.
  • Preferred leaders are obtained from the promoters of the Cytomegalovirus (CMV) immediate early gene promoter, tetracycline inducible promoter, metallothionein promoter, TK promoter of Herpes virus, SV40 early promoter, Rous sarcoma virus promoter, beta-casein promoter, elongation factor 1A (EF-lc) promoter, unbiquitin conjugating enzyme (UbC) promoter, and cytomegalovirus promoter.
  • the regulatory sequence can also comprise a signal peptide coding region that codes for an amino acid sequence linked to the amino terminus of a polypeptide and directs the encoded polypeptide into the cell's secretory pathway.
  • the 5' end of the coding sequence of the nucleic acid sequence can inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region which encodes the secreted polypeptide.
  • the 5' end of the coding sequence can contain a signal peptide coding region which is foreign to the coding sequence.
  • the foreign signal peptide coding region can be required where the coding sequence does not naturally contain a signal peptide coding region.
  • the foreign signal peptide coding region can simply replace the natural signal peptide coding region in order to enhance secretion of the polypeptide.
  • the signal sequence will allow a protein which is normally located intracellularly to be secreted.
  • any signal peptide coding region which directs the expressed polypeptide into the secretory pathway of a mammalian cell can be used in the present invention.
  • Effective signal peptide coding regions include, but are not limited to, the signal peptide coding regions obtained from the genes for the interleukins (interleukin-2, interleukin-3, interleukin-4, interleukin-6, interleukin-8, interleukin-10, interleukin-11, interleukin-12, interleukin-13, interleukin-14), granulocyte macrophage colony stimulating factor, and V-J2-C region of the mouse Ig kappa chain.
  • interleukins interleukin-2, interleukin-3, interleukin-4, interleukin-6, interleukin-8, interleukin-10, interleukin-11, interleukin-12, interleukin-13, interleukin-14
  • granulocyte macrophage colony stimulating factor and V-J2-C region of the mouse I
  • the control sequence can also comprise a propeptide coding region that codes for an amino acid sequence positioned at the amino terminus of a polypeptide.
  • the resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases).
  • a propolypeptide is generally inactive and can be converted to a mature active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide.
  • the nucleic acid construct can further comprise one or more selectable markers to facilitate the identification and isolation of cells containing a restriction enzyme integrated construct.
  • a selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.
  • selectable markers include genes encoding adenosine deaminase, aspartate dihydro-orotase, dihyrofolate reductase, glutamine synthetase, histidine D, hygromycin resistance, hypoxanthine phosphoribosyl transferase, carbamyl phosphate synthase, multidrug resistance, neomycin resistance, puromycin resistance, transcarbamylase, zeocin resistance and xanthine-guanine phosphoribosyl transferase.
  • the nucleic acid construct can also contain one or more amplifiable markers to allow for selection of cells containing increased copies of the integrated construct and the adjacent activated endogenous gene.
  • a preferred amplifiable selectable marker is dihydrofolate reductase, which confers resistance to methotrexate.
  • Other drug resistance genes e.g., hygromycin resistance, multi-drug resistance, puromycin acetyltransferase, adenosine deaminase, dihydro-orotase glutamine synthetase, and carbamyl phosphate synthase
  • drug resistance genes e.g., hygromycin resistance, multi-drug resistance, puromycin acetyltransferase, adenosine deaminase, dihydro-orotase glutamine synthetase, and carbamyl phosphate synthase
  • Alternative markers that introduce an altered phenotype such as green fluorescent protein, or cell surface proteins such as CD4, CD8, Class I MHC, and placental alkaline phosphatase can be used to sort transfected cells from untransfected cells by such means as FACS sorting or magnetic bead separation technology.
  • the presence of the amplifiable marker allows the copy number of the gene to be increased.
  • the increase in copy number is accomplished by cultivating the cells in the presence of increasing amounts of one or more appropriate selectable agents such as a drug or metabolite, e.g., methotrexate for amplification of the dihydrofolate reductase gene, and selecting for increased copy number of integrated construct and the adjacent activated endogenous gene expression.
  • a drug or metabolite e.g., methotrexate for amplification of the dihydrofolate reductase gene
  • the nucleic acid construct can contain a screenable marker, in place of or in addition to, the selectable marker.
  • a screenable marker allows the cells containing the integrated construct to be isolated without drug or other selective pressure. Examples of screenable markers include genes encoding cell surface proteins, fluorescent proteins (Green fluorescent protein), and enzymes.
  • a selectable marker can also be omitted from the construct when transfected cells are screened for gene activation products without selecting for the stable integrants. This is particularly useful when the efficiency of stable integration is high.
  • the nucleic acid construct can also contain a nucleic acid sequence encoding an affinity tag, such as an epitope tag, which consists of an amino acid sequence that allows affinity purification of the activated protein (e.g., on immunoaffinity or chelating matrices).
  • an affinity tag such as an epitope tag
  • the epitope tag becomes a part of the polypeptide allowing purification of the polypeptide from cellular and media proteins.
  • the construct can further contain a protease recognition sequence to enable removal of the epitope tag from the polypeptide of interest.
  • protease recognition sequence e.g., enterokinase cleavage site, thrombin, prescission protease, and Factor XA
  • a protease recognition sequence e.g., enterokinase cleavage site, thrombin, prescission protease, and Factor XA
  • affinity tag is used herein to denote a polypeptide segment that can be attached to a second polypeptide to provide for purification or detection of the second polypeptide or provide sites for attachment of the second polypeptide to a substrate.
  • Affinity tags include a poly-histidine tract, protein A (Nilsson et al, 1985, EMBO J. 4: 1075; Nilsson et al, 1991, Methods Enzymol. 198: 3), glutathione S transferase (Smith and Johnson, 1988, Gene 67: 31), Glu-Glu affinity tag (Grussenmeyer et al, 1985, Proc.
  • the nucleic acid construct can further contain eukaryotic viral origins of replication useful for gene amplification. These origins can be present in place of, or in conjunction with, an amplifiable marker.
  • eukaryotic viral origins of replication useful for gene amplification.
  • These origins can be present in place of, or in conjunction with, an amplifiable marker.
  • the presence of the viral origin of replication allows the integrated vector and adjacent endogenous gene to be isolated as an episome and/or amplified to high copy number upon introduction of the appropriate viral replication protein.
  • useful viral origins include, but are not limited to, adeno-associated virus ori, SV40 ori, and Epstein-Barr virus ori P.
  • a nucleic acid construct comprising a viral origin of replication can allow the amplification of the activated gene and the viral origin of replication in the cell by introducing the viral replication protein(s) in trans.
  • EBNA-I can be expressed transiently or stably.
  • EBNA-1 will initiate replication bi-directionally from the integrated ori P locus.
  • Each replication product created can initiate replication resulting . in many copies of the viral origin and flanking genomic sequences yielding a higher copy number of the gene and ultimately higher levels of the polypeptide are produced.
  • the nucleic acid construct can also contain genetic elements useful for the propagation of the construct in microorganisms.
  • useful genetic elements include microbial origins of replication and selectable markers.
  • An origin of replication enables a vector to replicate autonomously in the host cell in question.
  • bacterial origins of replication are the origins of replication of pBR322, pUC19, pACYC177, and ⁇ ACYC184 permitting replication in E. coli, and pUBHO, ⁇ E194, pTA1060, and pAM ⁇ l permitting replication in Bacillus.
  • origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN6.
  • the origin of replication can be one having a mutation which makes its functioning temperature-sensitive in the host cell (see, e.g., Ehrlich, 1978, Proc. Nat'lAcad. Sci. USA 75: 1433).
  • bacterial selectable markers are the dal genes from Bacillus subtilis or Bacillus licheniformis, or markers which confer antibiotic resistance such as ampicillin, kanamycin, chloramphenicol, tetracycline, or zeocin resistance.
  • Suitable markers for yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3.
  • Selectable markers for use in a filamentous fungal host cell include, but are not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetylfransferase), hph (hygromycin phosphoteansferase), niaD (nitrate reductase), pyrG
  • the regulatory sequence can also comprise scaffold-attachment regions or matrix attachment sites, negative regulatory elements, transcription factor binding sites, and locus control regions.
  • the linearized, nucleic acid construct can be introduced into a multiplicity of mammalian cells as a single nucleic acid construct or as separate constructs that are allowed to concatemerize.
  • the construct is preferably a double-stranded DNA construct, but can also be single-stranded DNA, combinations of single- and double-stranded DNA, single-stranded RNA, double-stranded RNA, and combinations of single- and double- stranded RNA. Where single-stranded RNA is used, the single-stranded RNA is converted by reverse teanscriptase to cDNA, which is then converted to double-stranded DNA. The double-stranded DNA then integrates by restriction-enzyme mediated integration into the genome of the mammalian cell.
  • two or more constructs can be introduced into a mammalian cell or multiplicity of mammalian cells to activate or over-express a number of different genes. These constructs can be transfected separately into cells to produce libraries with different sets of activated genes. It will be understood in the methods of the present invention that the term
  • nucleic acid construct can be contained in a vector, plasmid, cosmid, PCR product, and the like, which is then linearized before restriction enzyme-mediated integration.
  • the linearized nucleic acid construct ranges between about 200 bp to about 30,000 bp, preferably between about 300 bp to about 20,000 bp, more preferably between about 400 bp to about 15,000 bp, and most preferably between about 500 bp to about 10,000 bp.
  • the present invention also relates to methods for producing transfectants of mammalian cells, comprising introducing into a multiplicity of mammalian cells a restriction enzyme and a nucleic acid construct linearized with the same or a different restriction enzyme, wherein the linearized nucleic acid construct comprises a marker, and the linearized plasmid inserts into a site of the genome of one or more mammalian cells by integration at a transfection efficiency of at least 0.4%, preferably at least 0.8%, more preferably 1%, even more preferably at least 2%, and most preferably at least 3%; and
  • the integration preferably occurs by restriction enzyme mediated integration.
  • transfection is defined herein as the introduction of a nucleic acid construct into a mammalian cell.
  • the nucleic acid construct can be introduced into a mammalian cell by several methods known in the art which include, but are not limited to, electroporation, liposome-mediated introduction, calcium phosphate precipitation, DEAE dextran, lipofection, receptor mediated endocytosis, polybrene, particle bombardment, and microinjection.
  • the construct can be introduced into the mammalian cell as a viral particle (either replication competent or deficient). Examples of such viruses include, but are not limited to, adenoviruses, adeno-associated viruses, He ⁇ es viruses, retroviruses, and vaccinia viruses.
  • transfection efficiency is defined herein as the percentage of the number of transfectants obtained from the total number of cells transfected with DNA normalized by viability after transfection.
  • the nucleic acid construct Prior to transfection of the mammalian cells, the nucleic acid construct is preferably linearized with one or more restriction enzymes before introduction into the cell, or the construct can be introduced into the cell with one or more restriction enzymes such that linearization occurs inside the cell. It is preferable that the construct is linearized before being introduced into the cell.
  • the restriction enzyme(s) can be introduced into a mammalian cell before, during, or after introduction of the construct.
  • naturally linear double stranded DNAs such as synthetic DNA, or DNA which is a PCR product, may be utilized.
  • the present method allows the generation of sufficient numbers of transfectants enabling creation of a library of a size that will cover the mammalian cellular genome.
  • polypeptide encoded by a gene that is activated or over-expressed by the methods of the present invention can be known or unknown and its function can be known or unknown.
  • polypeptide is not meant herein to refer to a specific length of the encoded product and, therefore, encompasses peptides, oligopeptides, and proteins.
  • the polypeptide can be an antigen, enzyme, growth factor, hormone, immunomodulator, neurotransmitter, receptor (intracellular or cell surface), reporter protein, structural protein, and transcription factor.
  • the polypeptide is an antigen.
  • An "antigenic peptide” is a peptide which will bind a major histocompatibility complex molecule to form a complex of a major histocompatibility complex molecule and the peptide which is recognized by a T cell, thereby inducing a cytotoxic lymphocyte response upon presentation to the T cell.
  • antigenic peptides are capable of binding to an appropriate major histocompatibility complex molecule and inducing a cytotoxic T cells response, such as cell lysis or specific cytokine release against the target cell which binds or expresses the antigen.
  • the antigenic peptide can be bound in the context of a class I or class II major histocompatibility complex molecule, on an antigen presenting cell or on a target cell.
  • antigens include, but are not limited to, the CD antigens such as CD2, CD3, CD4, CD8, and CD34 antigens.
  • the polypeptide is an immunomodulator.
  • immunomodulator includes cytokines, stem cell growth factors, lymphotoxins, co-stimulatory molecules, hematopoietic factors, and synthetic analogs of these molecules.
  • the polypeptide is a cytokine.
  • the biological responses of cytokines include, but are not limited to, proliferation, differentiation, growth inhibition, immune regulation, growth, wound healing, metabolic responses, chemotaxis, and innate immunity. Cytokmes are classified as 4 ⁇ :-helix, /3-sheet, and , ⁇ - cytokines.
  • Examples of 4 ⁇ -helix cytokines include, but are not limited to, interleukins (IL-2, IL-3, IL-4, IL-5, IL-7, IL-9, and IL-13), granulocyte macrophage colony stimulating factor (GM-CSF), macrophage colony stimulating factor (M-CSF), stem cell factor (SCF), insulin-like growth factor (IFN ⁇ ), interleukin 6 (IL-6), leukemic inhibitory factor (LIF), oncostatin (OSM), ciliary neurotrophic factor (CNTF), erythropoietin (EPO), and granulocyte colony stimulating factor (G-CSF).
  • Examples of /3-sheet cytokines include, but are not limited to, transforming growth factor (TGF), platelet derived growth factors (PDGF-A and PDGF-B), vascular endothelial growth factor
  • VEGF nerve growth factor
  • NGF nerve growth factor
  • BDNF brain-derived neurotrophic factor
  • NT3 and NT4 neurotrophins
  • TNFc and TNF 3 tumor necrosis factor
  • IL- lc and IL-1/3 interleukins
  • FGF fibroblast growth factor
  • KGF keratinocyte growth factor
  • o;j3-cytokines include, but are not limited to, epidermal growth factor (EGF), transforming growth factor (TGFo.), insulin growth factors (IGF-1 and IGF-11), interleukin 8 (IL-8), monocyte chemoattractant proteins (MCP-1, MCP-2 and MCP-3), and macrophage inflammatory proteins (MIP-lo MIP-1 ⁇ , and MIP-2).
  • the polypeptide is a hormone.
  • hormones include, but are not limited to, bone growth factor-2, bone growth factor-7, steroid hormones, parathyroid hormone, follicle stimulating hormone, the interferons, parathyroid hormone, platelet derived growth factor, and tumor necrosis factor.
  • the hormone or growth factor is glucagon, growth hormone, gonadoteopin, hepatocyte growth factor, and insulin.
  • the polypeptide is a receptor.
  • the term "receptor” denotes a cell-associated protein that binds to a bioactive molecule termed a "ligand.” This interaction mediates the effect of the ligand on the cell.
  • Receptors can be membrane bound, cytosolic or nuclear; monomeric (e.g., thyroid stimulating hormone receptor, beta-adrenergic receptor) or multimeric (e.g., PDGF receptor, growth hormone receptor, IL-3 receptor, GM-CSF receptor, G-CSF receptor, erythropoietin receptor and IL-6 receptor).
  • Membrane-bound receptors are characterized by a multi-domain structure comprising an extracellular ligand-binding domain and an inteacellular effector domain that is typically involved in signal teansduction.
  • the exteacellular ligand-binding domain and the inteacellular effector domain are located in separate polypeptides that comprise the complete functional receptor.
  • Other receptors include a cholesterol receptor, immunoglobulin receptor, and lipoprotein receptor (including LDLs and HDLs).
  • the receptor may also be a chimeric receptor (see, for example, Sprecher et al, 1998, Biochemical and Biophysical Research communication 246: 82-90; Takaki et al, 1994, Molecular and Cellular Biology 14: 7404-7413; Sakamaki et al, 1993, Journal of Biological Chemistry 268: 15833-15839).
  • the binding of ligand to a receptor results in a conformational change in the receptor that causes an interaction between the effector domain and other molecule(s) in the cell, which in turn leads to an alteration in the metabolism of the cell.
  • Metabolic events that are often linked to receptor-ligand interactions include gene transcription, phosphorylation, dephosphorylation, increases in cyclic AMP production, mobilization of cellular calcium, mobilization of membrane lipids, cell adhesion, hydrolysis of inositol lipids, and hydrolysis of phospholipids.
  • the polypeptide is blood clotting factor V, blood clotting factor VII, blood clotting factor VIII, blood clotting factor IX, blood clotting factor X, chorionic complement inhibitors, cytoskeletal anchoring protein, integrins, insulinotropin, lactoferrin, neuroteopin-3, Protein C, protein kinase C, stem cell factor, tissue plasminogen activator, TGF-J3, TSH-P, thrombomodulin, and transmembrane ion channels.
  • Membrane-associated proteins such as receptors are particularly useful for developing drugs using combinatorial chemistry libraries and high through-put screening assays.
  • the proteins or soluble forms of the proteins e.g., truncated proteins lacking the transmembrane region
  • Identification of membrane proteins can also be used to identify new ligands (e.g., cytokines, growth factors, and other effector molecules) using, for example, affinity capture techniques.
  • the polypeptide is an oxidoreductase, transferase, hydrolase, lyase, isomerase, or ligase.
  • the polypeptide is an alpha-glucosidase, aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosylteansferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, glucocerebrosidase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phospholip
  • Ba/F3 cells are dependent on interleukin-3 (IL-3) for growth, such that proliferation in the absence of IL-3 can be used to select for novel genes.
  • IL-3 interleukin-3
  • a receptor for a novel cytokine can be isolated by selecting for transfectants in the absence of IL-3, but in the presence of a novel cytokine.
  • a ligand for a novel receptor can be isolated by engineering a Ba/F3 cell line over-expressing the novel receptor or a chimeric variant thereof and selecting transfectants in the absence of IL-3.
  • Presumptive mutants of factor-dependent cells such as Ba/F3 can be screened for activation or over-expression of a gene by several methods to enable identification of the desired mutant.
  • a selectable marker based on biocide or viral resistance, resistance to heavy metals, prototeophy to auxoteophs, and the like, as described earlier, can be used to first eliminate those transfectants that do not contain the regulatory sequence.
  • Phenotypic selection for a trait provided by expression of the endogenous gene can also be used to screen for the desired mutant cell.
  • selectable or screenable phenotypes include enzyme expression, cellular proliferation, growth factor independent growth, acquired factor-dependent growth, colony formation, cellular differentiation (e.g., differentiation into a neuronal cell, muscle cell, epithelial cell, etc.), anchorage independent growth, activation of cellular factors (e.g., kinases, transcription factors, nucleases, etc.), expression of cell surface receptors/proteins, gain or loss of cell- cell adhesion, migration, and cellular activation (e.g., resting versus activated T cells).
  • enzyme expression e.g., cellular proliferation, growth factor independent growth, acquired factor-dependent growth, colony formation, cellular differentiation (e.g., differentiation into a neuronal cell, muscle cell, epithelial cell, etc.), anchorage independent growth, activation of cellular factors (e.g., kinases, transcription
  • Isolation of mutant Ba/F3 cells demonstrating such a phenotype is important because the activation of an endogenous gene by the integrated construct is presumably responsible for the observed cellular phenotype.
  • the activated gene can be an important therapeutic drug or drug target for treating or inducing the observed phenotype.
  • Another method for screening cells for expression of a gene is enzyme-linked immunoabsorbent assay (ELISA) according to established methods in the art. See, for example, E. Harlow and D. Lane, editors, 1988, Antibodies, A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, New York. If the polypeptide is secreted, culture supernatants from pools of transfectants are incubated in wells containing bound antibody specific for the polypeptide of interest. By screening pools of library clones (the pools can be from 1 to greater than 100,000 library members), pools containing a cell(s) that has activated the gene of interest can be identified. The cell of interest can then be purified away from the other library members by sib selection, limiting dilution, or other techniques known in the art.
  • ELISA enzyme-linked immunoabsorbent assay
  • ELISA can also be used to screen for cells expressing inteacellular and membrane-bound proteins. In these cases, instead of screening culture supernatants, a small number of cells is removed from the library pool (each cell is represented at least 100-1000 times in each pool), lysed, clarified, and added to the antibody-coated wells.
  • FACS fluorescence- activated cell sorter
  • the cell As protein is secreted by the cell, it is captured by the antibody bound to the cell surface. The presence of the protein of interest is then detected by a second antibody which is fluorescently labeled. For both secreted and membrane bound proteins, the cells can then be sorted according to their fluorescence signal. Fluorescent cells can then be isolated, expanded, and further enriched by FACS, limiting dilution, or other cell purification techniques known in the art.
  • Another method for screening mutant cells involves magnetic bead separation (Iinuma et al, 2000, International Journal of Cancer 89: 337-344). Such a method is useful for detecting membrane-bound proteins and captured secreted proteins.
  • the method involves incubating an activation library with antibody-conjugated magnetic beads that are specific for a particular polypeptide or polypeptide family. If the polypeptide is present on the surface of a cell, the cell will bind to the magnetic beads separating the cell from other cells. The cell can then be isolated from the magnetic beads and the polypeptide and/or cell further characterized.
  • a further method for screening mutant cells involves microdrop technology
  • Microdrop technology provides cell separation of rare and high producer cells based on quantitative determination of cell function (e.g., growth, lack of growth, drug susceptibility, secretion of proteins, specific enzyme activity, and production of small metabolites) and/or of cell composition (e.g., surface markers, internal proteins, nucleic acid sequences).
  • mutant mammalian cell Other methods known in the art for screening and purification of a mutant mammalian cell include, but are not limited to, limiting dilution, sib selection, soft agar cloning, and single colony purification using cloning rings.
  • the present invention also relates to mutant cells obtained by the methods of the present invention.
  • the invention encompasses cells containing the vector constructs, cells in which the vector constructs have integrated, and cells which are over-expressing desired gene products from an endogenous gene, over-expression being driven by the introduced transcriptional regulatory sequence.
  • a mutant cell made by the methods described above can over-express a single gene or more than one gene.
  • More than one gene can be activated by the integration of a single construct or by the integration of multiple constructs in the same mutant cell (i.e., more than one type of construct). Therefore, a mutant cell can contain only one type of vector construct or different types of constructs, each capable of altering expression, by disruption or activating an endogenous gene.
  • the present invention also relates to isolated genes obtained by the instant methods and to nucleic acid constructs, expression vectors, and host cells containing the isolated genes.
  • the gene encoding a polypeptide identified by the methods of the present invention can be obtained from a cell using cloning methods well known in the art.
  • the term "obtained from” as used herein in connection with a given source shall mean that the gene is present in the source.
  • the gene can be isolated by employing methods for rescuing a locus containing the inserted nucleic acid construct from the identified mutant cell.
  • the method requires isolating (i) the nucleic acid construct and (ii) the 3' and/or 5' flanking regions of the locus of the genome where the nucleic acid construct has been integrated; and identifying the 3' and/or 5' flanking regions of the locus.
  • the nucleic acid construct and flanking regions can be isolated or rescued by methods well known in the art such as cleaving with restriction enzymes and subsequent ligation and transformation of E. coli, inverse PCR, random primed gene walking PCR, or probing a library of the tagged mutant.
  • restriction enzyme mediated integration results on average in one to a few integrated copies of the nucleic acid construct in the mutant cell. This low copy number facilitates the rescue of the locus from the mutant cell.
  • the rescued construct and flanking region(s) can be used as is, i.e., a restriction enzyme cleaved linear nucleotide sequence, or can be circularized or inserted into a suitable expression vector for producing the polypeptide recombinantly in a host system as described herein.
  • the isolation of a gene can be also accomplished by a cDNA or genomic library of the mutant mammalian cell using polynucleotide probes based upon partial amino acid sequences of the polypeptide encoded by the gene. These techniques are standard and well-established.
  • a nucleic acid molecule containing the gene can be isolated from a cell cDNA library.
  • the first step would be to prepare the cDNA library by isolating RNA from the mutant cell, using methods well-known to those of skill in the art.
  • RNA isolation techniques must provide a method for breaking cells, a means of inliibiting RNase-directed degradation of RNA, and a method of separating RNA from DNA, protein, and polysaccharide contaminants.
  • total RNA can be isolated by homogenizing the cells in a denaturing solution, followed by sodium acetate, phenol, and finally chloroform/isoamyl alcohol treatment.
  • RNA from DNA and proteins see, for example, Ausubel et al. (eds.), 1995, Short Protocols in Molecular Biology, 3 rd Edition, pages 4-1 to 4-2 (John Wiley & Sons); and Wu et al, 1997, Methods in Gene Biotechnology, pages 33-41 (CRC Press, Inc.).
  • total RNA can be isolated from the mutant cells with guanidinium isothiocyanate, extracting with organic solvents, and separating RNA from contaminants using differential centrifugation (see, for example, Chirgwin et al, 1979, Biochemistry 18: 52; Ausubel et al, 1995, supra, at pages 4-1 to 4-6; Wu et al, 1997. supra, at pages 33-41).
  • kits can be used to extract RNA from mammalian cell lines. For example, such a kit is available from QIAGEN, Valencia, CA.
  • poly(A) + RNA is preferably isolated from a total RNA preparation.
  • Poly(A) + RNA can be isolated from total RNA using the standard technique of oligo(dT)-cellulose chromatography (see, for example, Aviv and Leder, 1972, Proc. Nat'lAcad. Sci. USA 59:1408; Ausubel et al, !995, supra at pages 4-11 to 4-12).
  • Double-stranded cDNA molecules are synthesized from poly(A) RNA using techniques well-known to those in the art. (see, for example, Wu, 1997. supra, at pages 41-46). Moreover, commercially available kits can be used to synthesize double- steanded cDNA molecules. For example, such kits are available from Life Technologies, Inc. (Gaithersburg, MD), Clontech Laboratories, Inc. (Palo Alto, CA), Promega Corporation (Madison, WI) and Steatagen (La Jolla, CA).
  • a cDNA library can be prepared in a vector derived from bacteriophage, such as a ⁇ gtlO vector. See, for example, Huynh et al., "Constructing and Screening cDNA Libraries in ⁇ gtlO and ⁇ gtl l," in DNA Cloning: A Practical Approach Vol. ⁇ I,
  • double-stranded cDNA molecules can be inserted into a plasmid vector, such as a pBlueScript vector (Stratagene; La Jolla, CA), a LamdaGem-4 (Promega Corp.) or other commercially available vectors.
  • a plasmid vector such as a pBlueScript vector (Stratagene; La Jolla, CA), a LamdaGem-4 (Promega Corp.) or other commercially available vectors.
  • Suitable cloning vectors also can be obtained from the American Type Culture Collection (Manassas, VA).
  • the cDNA library is inserted into a prokaryotic host, using standard techniques.
  • a cDNA library can be introduced into competent E. coli DH5 ⁇ cells, which can be obtained, for example, from Life Technologies, Inc. (Gaithersburg, MD).
  • a library can also be prepared by other means well-known in the art (see, for example, Ausubel et al, 1995, supra, at pages 5-1 to 5-6; Wu et al, 1997, supra, at pages 307-327).
  • Genomic DNA can be isolated by lysing cells with the detergent Sarkosyl, digesting the lysate with proteinase K, clearing insoluble debris from the lysate by centrifugation, precipitating nucleic acid from the lysate using isopropanol, and purifying resuspended DNA on a cesium chloride density gradient.
  • the Puregene system Gibbonucleic Acid, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen, Copenhagen
  • Genomic DNA fragments that are suitable for the production of a genomic library can be obtained by the random shearing of genomic DNA or by the partial digestion of genomic DNA with restriction endonucleases.
  • Genomic DNA fragments can be inserted into a vector, such as a bacteriophage or cosmid vector, in accordance with conventional techniques, such as the use of restriction enzyme digestion to provide appropriate termini, the use of alkaline phosphatase teeatment to avoid undesirable joining of DNA molecules, and ligation with appropriate ligases. Techniques for such manipulation are well-known in the art (see, for example, Ausubel et al, 1995, supra, at pages 5-1 to 5-6; Wu et al, 1997, supra, at pages 307-327).
  • Nucleic acid molecules containing the gene can also be obtained using the polymerase chain reaction (PCR) with oligonucleotide primers having nucleotide sequences that are based upon the nucleotide sequences of the gene.
  • PCR polymerase chain reaction
  • General methods for screening libraries with PCR are provided by, for example, Yu et al, 1993, "Use of the Polymerase Chain Reaction to Screen Phage Libraries," in Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods and Applications, White (ed.), pages 211-215 (Humana Press, Inc.), and Innis et al, 1990, PCR Protocols: A Guide to
  • a library containing cDNA or genomic clones can be screened with one or more polynucleotide probes based upon partial amino acid sequences of the polypeptide encoded by the gene, using standard methods (see, for example, Ausubel et al, 1995, supra, at pages 6-1 to 6-11).
  • Anti-polypeptide antibodies produced as described below, can also be used to isolate DNA sequences that encode the gene from cDNA libraries.
  • the antibodies can be used to screen ⁇ gtl 1 expression libraries, or the antibodies can be used for immunoscreening following hybrid selection and translation (see, for example, Ausubel et al, 1995, supra, at pages 6-12 to 6-16; Margolis et al, 1995, "Screening ⁇ expression libraries with antibody and protein probes," in DNA Cloning 2: Expression Systems, 2nd Edition, Glover et al. (eds.), pages 1-14 (Oxford University Press)).
  • An alternative way to isolate a full-length gene is to synthesize a specified set of overlapping oligonucleotides (40 to 100 nucleotides). After the 3' and 5' extensions (6 to 10 nucleotides) are annealed, large gaps still remain, but the base-paired regions are both long enough and stable enough to hold the structure together. The duplex is completed and the gaps filled by enzymatic DNA synthesis with E. coli DNA polymerase I. This enzyme uses the 3 '-hydroxyl groups as replication initiation points and the single- stranded regions as templates. After the enzymatic synthesis is completed, the nicks are sealed with T4 DNA ligase.
  • the complete gene sequence is usually assembled from double-steanded fragments that are each put together by joining four to six overlapping oligonucleotides (20 to 60 base pairs each). If there is a sufficient amount of the double-steanded fragments after each synthesis and annealing step, they are simply joined to one another. Otherwise, each fragment is cloned into a vector to amplify the amount of DNA available. In both cases, the double-steanded constructs are sequentially linked to one another to form the entire gene sequence. Each double- steanded fragment and the complete sequence should be characterized by DNA sequence analysis to verify that the chemically synthesized gene has the correct nucleotide sequence.
  • the present invention also relates to methods for producing a polypeptide resulting from activation or over-expression of a gene in a cell or a recombinant host system.
  • the mutant cells can be cultivated using standard techniques for large-scale culture of mammalian cells. See, for example, Wu and Aunins, 1997, Current Opinion in Biotechnology 8: 148-153; Reiter and Bluml, 1994, Current Opinion in Biotechnology 5: 175-179; and Europa et al, 2000, Biotechnology and Bioengineering 67: 25-34. If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates. Scale-up of mammalian cells for growth in roller bottles involves increase in the surface area on which cells can attach. Microcarrier beads are, therefore, often added to increase the surface area for commercial growth.
  • Scale-up of cells in spinner culture can involve large increases in volume. Five liters or greater can be required for both microcarrier and spinner growth. Depending on the inherent potency (specific activity) of the protein of interest, the volume can be as low as 1 - 10 liters; 10- 15 liters is more common. However, up to 50-100 liters can be necessary and volume can be as high as 10,000-15,000 liters. In some cases, higher volumes can be required. Cells can also be grown in large numbers of T flasks, for example 50-100.
  • polypeptides including full-length polypeptides, functional fragments, and fusion proteins, can also be produced in recombinant host cells following conventional techniques.
  • a nucleic acid molecule encoding the polypeptide must be operably linked to regulatory sequences that control transcriptional expression in an expression vector and then, introduced into a host cell.
  • expression vectors can include teanslational regulatory sequences and a marker gene which is suitable for selection of cells that carry the expression vector.
  • Expression vectors that are suitable for production of a foreign polypeptide in eukaryotic cells typically contain (1) prokaryotic DNA elements coding for a bacterial replication origin and an antibiotic resistance marker to provide for the growth and selection of the expression vector in a bacterial host; (2) eukaryotic DNA elements that control initiation of transcription, such as a promoter; and (3) DNA elements that control the processing of transcripts, such as a transcription termination/polyadenylation sequence.
  • expression vectors can also include nucleotide sequences encoding a secretory sequence that directs the heterologous polypeptide into the secretory pathway of a host cell.
  • an expression vector can comprise a gene and a secretory sequence derived from a gene identified in the present invention or another secreted gene.
  • Polypeptides identified by the methods of the present invention can be expressed in mammalian cells.
  • suitable mammalian host cells include African green monkey kidney cells (Vero; ATCC CRL 1587), human embryonic kidney cells (293- HEK; ATCC CRL 1573), baby hamster kidney cells (BHK-21, BHK-570; ATCC CRL 8544, ATCC CRL 10314), canine kidney cells (MDCK; ATCC CCL 34), Chinese hamster ovary cells (CHO-K1; ATCC CCL61), rat pituitary cells (GH1; ATCC CCL82), HeLa S3 cells (ATCC CCL2.2), rat hepatoma cells (H-4-II-E; ATCC CRL 1548) SV40- teansformed monkey kidney cells (COS-1; ATCC CRL 1650) and murine embryonic cells (NIH-3T3; ATCC CRL 1658).
  • African green monkey kidney cells Vero; ATCC CRL 1587
  • human embryonic kidney cells (293-
  • the transcriptional and teanslational regulatory signals can be derived from viral sources, such as adenovirus, bovine papilloma virus, simian virus, or the like, in which the regulatory signals are associated with a particular gene which has a high level of expression.
  • viral sources such as adenovirus, bovine papilloma virus, simian virus, or the like, in which the regulatory signals are associated with a particular gene which has a high level of expression.
  • Suitable transcriptional and teanslational regulatory sequences also can be obtained from mammalian genes, such as actin, collagen, myosin, and metallothionein genes.
  • Transcriptional regulatory sequences include a promoter region sufficient to direct the initiation of RNA synthesis.
  • Suitable eukaryotic promoters include the promoter of the mouse metallothionein I gene (Hamer et al, 1982, J. Molec. Appl. Genet. 1: 273), TK promoter o ⁇ Herpes virus (McKnight, 1982, Cell 31: 355), SV40 early promoter (Benoist et al, 1981, Nature 290: 304), Rous sarcoma virus promoter (Gorman et al, 1982, Proc. Nat'l Acad. Sci.
  • a prokaryotic promoter such as the bacteriophage T3 RNA polymerase promoter, can be used to conteol gene expression in mammalian cells if the prokaryotic promoter is regulated by a eukaryotic promoter (Zhou et al, 1990, Moi Cell
  • An expression vector can be introduced into host cells using a variety of standard techniques including calcium phosphate transfection, liposome-mediated transfection, microprojectile-mediated delivery, electroporation, and the like.
  • the transfected cells are selected and propagated to provide recombinant host cells that comprise the expression vector stably integrated in the host cell genome.
  • Techniques for introducing vectors into eukaryotic cells and techniques for selecting such stable teansformants using a dominant selectable marker are described, for example, by Ausubel et al, 1995, supra, and by Murray (ed.), 1991, Gene Transfer and Expression Protocols, Humana Press.
  • one suitable selectable marker is a gene that provides resistance to the antibiotic neomycin.
  • selection is carried out in the presence of a neomycin-type drug, such as G-418 or the like.
  • Selection systems can also be used to increase the expression level of the gene of interest, a process referred to as "amplification.” Amplification is carried out by culturing transfectants in the presence of a low level of the selective agent and then increasing the amount of selective agent to select for cells that produce high levels of the products of the introduced genes.
  • a preferred amplifiable selectable marker is dihydrofolate reductase, which confers resistance to methoteexate.
  • markers that introduce an altered phenotype such as green fluorescent protein, or cell surface proteins (e.g., CD4, CD8, Class I MHC, and placental alkaline phosphatase) can be used to sort transfected cells from unteansfected cells by such means as FACS sorting or magnetic bead separation technology.
  • markers that introduce an altered phenotype such as green fluorescent protein, or cell surface proteins (e.g., CD4, CD8, Class I MHC, and placental alkaline phosphatase) can be used to sort transfected cells from unteansfected cells by such means as FACS sorting or magnetic bead separation technology.
  • a polypeptide encoded by an isolated gene can also be produced by cultured cells using a viral delivery system.
  • viruses for this purpose include adenovirus, herpesvirus, vaccinia virus and adeno-associated virus (AAV).
  • Adenovirus a double- steanded DNA virus, is currently the best studied gene transfer vector for delivery of heterologous nucleic acid (for a review, see Becker et al, 1994, Meth. Cell Biol. 43: 161, and Douglas and Curiel, 1997, Science & Medicine 4: 44).
  • Advantages of the adenovirus system include the accommodation of relatively large DNA inserts, the ability to grow to high-titer, the ability to infect a broad range of mammalian cell types, and flexibility that allows use with a large number of available vectors containing different promoters.
  • By deleting portions of the adenovirus genome larger inserts (up to 7 kb) of heterologous DNA can be accommodated. These inserts can be incorporated into the viral DNA by direct ligation or by homologous recombination with a co-teansfected plasmid.
  • An option is to delete the essential El gene from the viral vector, which results in the inability to replicate unless the El gene is provided by the host cell.
  • adenovirus vector infected human 293 cells can be grown as adherent cells or in suspension culture at relatively high cell density to produce significant amounts of protein (see Gamier etal, 1994, Cytotechnol 15: 145).
  • Genes identified by the methods of the present invention can also be expressed in other higher eukaryotic cells, such as avian, fungal, insect, yeast, or plant cells.
  • the baculovirus system provides an efficient means to introduce cloned genes into insect cells.
  • Suitable expression vectors are based upon the Autographa californica multiple nuclear polyhedrosis virus (AcMNPV), and contain well-known promoters such as Drosophila heat shock protein (hsp 70 promoter), Autographa californica nuclear polyhedrosis virus immediate-early gene promoter (ie-1) and the delayed early 39K promoter, baculovirus plO promoter, and the Drosophila metallothionein promoter.
  • a second method of making a recombinant baculovirus system utilizes a teansposon-based system described by Luckow (Luckow, et al, 1993, J. Virol. 67:4566).
  • This system which utilizes teansfer vectors, is sold in the BAC-to-BAC kit (Life Technologies, Rockville, MD).
  • This system utilizes a teansfer vector, pFASTBAC (Life Technologies) containing a Tn7 teansposon to move the DNA encoding the polypeptide into a baculovirus genome maintained in E. coli as a large plasmid called a "bacmid.” See, Hill-Perkins and Possee, 1990, J. Gen. Virol.
  • transfer vectors can include an in-frame fusion with DNA encoding an epitope tag at the C- or N-terminus of the expressed polypeptide, for example, a Glu-Glu epitope tag (Grussenmeyer et al, 1985, Proc. Nat'l Acad. Sci. USA 82: 7952).
  • a teansfer vector containing the gene of interest is transformed into E. coli, and screened for bacmids which contain an interrupted lacZ gene indicative of recombinant baculovirus.
  • the bacmid DNA containing the recombinant baculovirus genome is then isolated using common techniques.
  • Suitable insect host cells include cell lines derived from IPLB-S -21, a Spodoptera frugiperda pupal ovarian cell line, such as S ⁇ (ATCC CRL 1711), S/21A ⁇ , and ⁇ 21 (Invitrogen Co ⁇ oration; San Diego, CA), as well as Drosophila Schneider-2 cells, and the HIGH
  • FIVEO cell line (Invitrogen) derived from Trichoplusia ni (U.S. Patent No. 5,300,435).
  • Suitable media are Sf900 IF M (Life Technologies) or ESF 921TM (Expression Systems) for the Sf9 cells; and Ex-cellO405TM (JRH Biosciences, Lenexa, KS) or Express FiveOTM (Life Technologies) for the T. ni cells.
  • the cells are typically grown up from an inoculation density of approximately 2-5 x 10 5 cells to a density of 1-2 x 10 6 cells at which time a recombinant viral stock is added at a multiplicity of infection (MOI) of 0.1 to 10, more typically near 3.
  • MOI multiplicity of infection
  • yeast cells can also be used to express genes isolated by the methods of the present invention.
  • yeast species of particular interest in this regard include Saccharomyces cerevisiae, Pichia pastoris, and Pichia methanolica.
  • Suitable promoters for expression in yeast include, but are not limited to, promoters from GAL1 (galactose kinase), PGK (phosphoglycerate kinase), ADH (alcohol dehydrogenase), AOXl (alcohol oxidase), and H!S4 (histidinol dehydrogenase) genes.
  • GAL1 galactose kinase
  • PGK phosphoglycerate kinase
  • ADH alcohol dehydrogenase
  • AOXl alcohol oxidase
  • H!S4 histidinol dehydrogenase
  • Many yeast cloning vectors have been designed and are readily available. These vectors include YIp- based vectors, such as YIp5, YRp vectors, such as YRpl7, YEp vectors such as YEpl3 and YCp vectors, such
  • cerevisiae cells with exogenous DNA and producing recombinant polypeptides therefrom are disclosed by, for example,, Kawasaki, U.S. Patent No. 4,599,311; Kawasaki et al, U.S. Patent No. 4,931,373; Brake, U.S. Patent No. 4,870,008; Welch et al, U.S. Patent No. 5,037,743; and Murray et al, U.S. Patent No. 4,845,075.
  • Transformed cells are selected by phenotype determined by the selectable marker, commonly drug resistance or the ability to grow in the absence of a particular nutrient (e.g., leucine).
  • a preferred vector system for use in Saccharomyces cerevisiae is the POTl vector system disclosed by Kawasaki et al. (U.S. Patent No. 4,931,373), which allows transformed cells to be selected by growth in glucose-containing media. Additional suitable promoters and terminators for use in yeast include those from glycolytic enzyme genes (see, e.g., Kawasaki, U.S. Patent No.
  • Transformation systems for other yeasts including Hansenula polymorpha, Schizosaccharomyces pombe, Kluyveromyces lactis, Kluyveromyces fragilis, Ustilago candis, Pichia pastoris, Pichia methanolica, Pichia guillermondii and Candida maltosa are known in the art. See, for example, Gleeson et al, J. Gen. Microbiol 132:3459 (1986), and Cregg, U.S. Patent No. 4,882,279. Aspergillus cells can be utilized according to the methods of McKnight et al, U.S. Patent No. 4,935,349.
  • Pichia methanolica as host for the production of recombinant proteins is disclosed by Raymond, U.S. Patent No. 5,716,808, Raymond, U.S. Patent No. 5,736,383, Raymond et al, 1998, Yeast 14: 11-23, and in international publication Nos. WO 97/17450, WO 97/17451, WO 98/02536, and WO 98/02565.
  • DNA molecules for use in transforming P. methanolica will commonly be prepared as double- steanded, circular plasmids, which are preferably linearized prior to transformation. For polypeptide production in P.
  • the promoter and terminator in the plasmid be that of a P. methanolica gene, such as a P. methanolica alcohol utilization gene (AUGl or AUG2).
  • P. methanolica alcohol utilization gene AUG2
  • Other useful promoters include those of the dihydroxyacetone synthase (DHAS), formate dehydrogenase (FMD), and catalase (CAT) genes.
  • DHAS dihydroxyacetone synthase
  • FMD formate dehydrogenase
  • CAT catalase
  • a preferred selectable marker for use in Pichia methanolica is a P.
  • methanolica ADE2 gene which encodes phosphoribosyl-5-aminoimidazole carboxylase (AIRC; EC 4.1.1.21), and which allows ade2 host cells to grow in the absence of adenine.
  • methanolica ADE2 gene which encodes phosphoribosyl-5-aminoimidazole carboxylase (AIRC; EC 4.1.1.21), and which allows ade2 host cells to grow in the absence of adenine.
  • methanol utilization genes (AUGl and AUGl) are deleted.
  • PEP4 and PRB1 are preferred.
  • E. methanolica cells can be transformed by electeoporation using an exponentially decaying, pulsed electric field having a field strength of from 2.5 to 4.5 kV/cm, preferably about 3.75 kV/cm, and a time constant (t) of from 1 to 40 milliseconds, most preferably about 20 milliseconds.
  • Expression vectors can also be introduced into plant protoplasts, intact plant tissues, or isolated plant cells.
  • Methods for introducing expression vectors into plant tissue include the direct infection or co-cultivation of plant tissue with Agrobacterium tumefaciens, microprojectile-mediated delivery, DNA injection, electeoporation, and the like. See, for example, Horsch et al, Science 227:1229 (1985), Klein et al, Biotechnology 70:268 (1992), and Miki et al, "Procedures for Introducing Foreign DNA into Plants," in Methods in Plant Molecular Biology and Biotechnology, Glick et al. (eds.), pages 67-88 (CRC Press, 1993).
  • genes can be expressed in prokaryotic host cells.
  • Suitable promoters that can be used to express polypeptides in a prokaryotic host are well-known to those of skill in the art and include promoters capable of recognizing the T4, T3, Sp6 and T7 polymerases, the P and PL promoters of bacteriophage lambda, the trp, recA, heat shock, lacUVS, tac, Ipp-lacSpr, phoA, and lacZ promoters of E. coli, promoters of B.
  • subtilis the promoters of the bacteriophages of Bacillus, Streptomyces promoters, the int promoter of bacteriophage lambda, the bla promoter of pBR322, and the CAT promoter of the chloramphe ⁇ icol acetyl transferase gene.
  • Prokaryotic promoters have been reviewed by Glick, 1987, J. ⁇ nd. Microbiol 1: 277, Watson et al, Molecular Biology of the Gene, 4th Ed. (Benjamin Cummins 1987), and by Ausubel et al, 1995, supra.
  • Preferred prokaryotic hosts include E. coli and Bacillus subtilus. Suitable strains of E.
  • coli include BL21(DE3), BL21(DE3) pLysS, BL21(DE3) pLysE, DH1, DH4I, DH5, DH5I, DH5IF', DH5IMCR, DH10B, DH10B/p3, DH11S, C600, HB101, JM101, JM105, JM109, JM110, K38, RR1, Y1088, Y1089, CSH18, ER1451, and ER1647 (see, for example, Brown (ed.), 1991, Molecular Biology Labfax, Academic Press).
  • Suitable strains of Bacillus subtilus include BR151, YB886, Mil 19, MI 120, and B170 (see, for example, Hardy, 1985, “Bacillus Cloning Methods,” in DNA Cloning: A Practical Approach, Glover (ed.), IRL Press).
  • the polypeptide When expressing a polypeptide in bacteria such as E. coli, the polypeptide can be retained in the cytoplasm, typically as insoluble granules, or can be directed to the periplasmic space by a bacterial secretion sequence. In the former case, the cells are lysed, and the granules are recovered and denatured using, for example, guanidine isothiocyanate or urea. The denatured polypeptide can then be refolded and dimerized by diluting the denaturant, such as by dialysis against a solution of urea and a combination of reduced and oxidized glutathione, followed by dialysis against a buffered saline solution.
  • the denaturant such as by dialysis against a solution of urea and a combination of reduced and oxidized glutathione
  • the polypeptide can be recovered from the periplasmic space in a soluble and functional form by disrupting the cells (by, for example, sonication or osmotic shock) to release the contents of the periplasmic space and recovering the protein, thereby obviating the need for denaturation and refolding.
  • Methods for expressing proteins in prokaryotic hosts are well-known to those of skill in the art (see, for example, Williams et al, "Expression of foreign proteins in E. coli using plasmid vectors and purification of specific polyclonal antibodies," in DNA Cloning 2: Expression Systems, 2nd Edition, Glover et al.
  • serum-free medium Another commercial growth condition, especially when the ultimate product is used clinically, is cell growth in serum-free medium, by which is intended medium containing no serum or not in amounts that are required for cell growth. This obviously avoids the undesired co-purification of toxic contaminants (e.g., viruses) or other types of contaminants, for example, proteins that would complicate purification.
  • Serum-free media for growth of cells, commercial sources for such media, and methods for cultivation of cells in serum-free media are well-known to those of ordinary skill in the art.
  • a polypeptide obtained by the methods of the present invention can be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electeophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or exteaction (see, e.g., Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).
  • polypeptide It is preferred to purify the polypeptide to at least about 80% purity, more preferably to at least about 90% purity, even more preferably to at least about 95% purity, or even greater than 95% purity with respect to contaminating macromolecules, particularly other proteins and nucleic acids, and free of infectious and pyrogenic agents.
  • the polypeptide can also be purified to a pharmaceutically pure state, which is greater than 99.9% pure.
  • a purified polypeptide is substantially free of other polypeptides, particularly other polypeptides of animal origin.
  • Fractionation and/or conventional purification methods can be used to obtain preparations of polypeptide purified from a cell or mutant thereof and a recombinant polypeptide and fusion polypeptide purified from recombinant host cells.
  • ammonium sulfate precipitation and acid or chaoteope exteaction can be used for fractionation of samples.
  • Exemplary purification steps can include hydroxyapatite, size exclusion, FPLC and reverse-phase high performance liquid chromatography. Suitable chromatographic media include derivatized dexteans, agarose, cellulose, polyacrylamide, specialty silicas, and the like. PEI, DEAE, QAE and Q derivatives are preferred.
  • Exemplary chromatographic media include those media derivatized with phenyl, butyl, or octyl groups, such as Phenyl-Sepharose FF (Pharmacia), Toyopearl butyl 650 (Toso Haas, Montgomeryville, PA), Octyl-Sepharose (Pharmacia) and the like; or polyacrylic resins, such as Amberchrom CG 71 (Toso Haas) and the like.
  • Suitable solid supports include glass beads, silica-based resins, cellulosic resins, agarose beads, cross-linked agarose beads, polystyrene beads, cross-linked polyacrylamide resins and the like that are insoluble under the conditions in which they are to be used. These supports can be modified with reactive groups that allow attachment of proteins by amino groups, carboxyl groups, sulfhydryl groups, hydroxyl groups and/or carbohydrate moieties.
  • Examples of coupling chemistries include cyanogen bromide activation, N- hydroxysuccinimide activation, epoxide activation, sulfhydryl activation, hydrazide activation, and carboxyl and amino derivatives for carbodiimide coupling chemistries. These and other solid media are well known and widely used in the art, and are available from commercial suppliers. Selection of a particular method for polypeptide isolation and purification is a matter of routine design and is determined in part by the properties of the chosen support. See, for example, Affinity Chromatography: Principles & Methods (Pharmacia LKB Biotechnology 1988), and Doonan, Protein Purification Protocols (The Humana Press 1996).
  • polypeptides obtained as described below, can be used to isolate large quantities of protein by immunoaffinity purification.
  • methods for binding ligands to receptor polypeptides bound to support media are well known in the art.
  • a polypeptide can also be isolated by exploitation of particular properties.
  • immobilized metal ion adso ⁇ tion (IMAC) chromatography can be used to purify histidine-rich proteins, including those comprising polyhistidine tags. Briefly, a gel is first charged with divalent metal ions to form a chelate (Sulkowski, 1985, Trends in Biochem. 3: 1). Histidine-rich proteins will be adsorbed to this matrix with differing affinities, depending upon the metal ion used, and will be eluted by competitive elution, lowering the pH, or use of steong chelating agents.
  • Other methods of purification include purification of glycosylated proteins by lectin affinity chromatography and ion exchange chromatography (M.
  • a fusion of the polypeptide of interest and an affinity tag e.g., maltose-binding protein, histidine-tagged protein, an immunoglobulin domain
  • an affinity tag e.g., maltose-binding protein, histidine-tagged protein, an immunoglobulin domain
  • the present invention further relates to methods for isolating a gene, comprising: (a) introducing into a multiplicity of growth factor-dependent mammalian cells a restriction enzyme and a nucleic acid construct linearized with the same or a different restriction enzyme, wherein the linearized nucleic acid construct comprises a regulatory sequence and the linearized construct inserts by integration into the genome of one or more of the mammalian cells; (b) identifying from the multiplicity of mammalian cells in step (a) a mutant cell expressing a gene encoding a growth factor or growth factor receptor, wherein the expression of the gene results from the integration of the introduced linearized nucleic acid construct such that the regulatory sequence upon integration into the cell's genome promotes the expression of the gene encoding the growth factor or the growth factor receptor; and (c) isolating the gene from the mutant cell identified in step (b).
  • selection is by phenotypic selection with a cultured parent mammalian cell that is dependent on an exogenous growth factor, or an engineered variant of such cell expressing a novel receptor or chimeric receptor such as those defined herein, for its proliferation.
  • phenotypic selection begins with a cultured parent mammalian cell that is dependent on an exogenous growth factor for its proliferation.
  • Such cultured mammalian cells include, but are not limited to, Ba/F3, DAI (mouse IL-3 -dependent), FDC-pl (mouse IL-3 -dependent), TF-1 (human IL-2- dependent), M-07e (human IL-3-dependent), A375 (human IL-1 -dependent), 3TP1 (mouse IL-3 or TPO-dependent), Pre-B (mouse IL-7-dependent), 32D (mouse), CCL-185 (human IL-4-dependent), WEHI164 (human TNF- ⁇ -dependent), 2D9+EMCF (human IFN- ⁇ -dependent), Daudi (human IFN-Q!-dependent), COLO205 (human IFN- ⁇ - dependent), B9 (mouse IL-6-dependent), KIT-225 (mouse IL-7-dependent), B9-11 (mouse IL-11 -dependent), GNFS-60 (mouse G-CSF-dependent), MNFS-60 (mouse M- CSF-dependent), BAF
  • the growth factor or receptor may be any of the factors or receptors thereof mentioned herein.
  • the cell is one in which growth is dependent upon an exogenous growth factor.
  • growth factor denotes a polypeptide that stimulates proliferation of a cell, the activity of which is mediated by a cell-surface receptor. Examples of growth factors include the interleukins and colony stimulating factors. Growth factor-dependent myeloid and lymphoid progenitor cells are preferred. These are cells that give rise to differentiated blood cells and that are found in hematopoietic tissue such as bone marrow, spleen and fetal liver. Myeloid and lymphoid precursors are also found in peripheral blood after treatment of an animal with cytokines.
  • Preferred growth factor-dependent cell lines that can be transfected to express o ⁇ han receptors or o ⁇ han ligands include Ba/F3 (Palacios and Steinmetz, 1985, Cell 41: 727-
  • growth factor-dependent cell lines can be established according to published methods (e.g. Greenberger et al, 1984, Leukemia Res. 8: 363- 375; Dexter et al., 1980, in Baum et al, Eds., Experimental Hematology Today, 8th Ann. Mtg. Int. Soc. Exp. Hematol. 1979, 145-156).
  • cells are removed from the tissue of interest (e.g., bone marrow, spleen, fetal liver) and cultured in a conventional, serum-supplemented medium, such as RPMI 1640 supplemented with 10% fetal bovine serum (FBS), 15% horse serum and 10 "6 M hydrocortisone.
  • a conventional, serum-supplemented medium such as RPMI 1640 supplemented with 10% fetal bovine serum (FBS), 15% horse serum and 10 "6 M hydrocortisone.
  • FBS fetal bovine serum
  • FBS fetal bovine serum
  • 10 "6 M hydrocortisone 10 "6 M hydrocortisone.
  • non-adherent cells are harvested, and the cultures are fed fresh medium.
  • the harvested, non-adherent cells are washed and cultured in medium with an added source of growth factor (e.g., RPMI 1640 + 10% FBS + 5-20% WEHI-3 conditioned medium as a source of IL-3).
  • These cells are fed fresh medium at one- to two-week intervals and expanded as the culture grows. After several weeks to several months, individual clones are isolated by plating the cells onto semi-solid medium (e.g., medium containing methylcellulose) or by limiting dilution. Factor dependence of the clones is confirmed by culturing individual clones in the absence of the growth factor. Reteoviral infection or chemical mutagenesis can be used to obtain a higher frequency of growth factor-dependent cells.
  • semi-solid medium e.g., medium containing methylcellulose
  • the present invention also relates to isolated genes obtained by such methods.
  • the present invention also relates to methods for expressing such an endogenous gene in a growth factor-dependent mammalian cell by integration of a regulatory sequence such that expression of the gene is activated or increased, according to the procedures described herein.
  • the present invention also relates to methods of obtaining mutant growth factor-dependent mammalian cells having activated or increased expression of an endogenous gene, and to mutant growth factor-dependent mammalian cells obtained by such methods, according to the procedures described herein.
  • Plasmid pcDNA3.1(+) which contains the cytomegalovirus (CMV) enhancer promoter, was obtained from Invitrogen (Carlsbad, CA). Plasmid pcDNA3.1(+) was isolated from E. coli JLin0605 (E. coli strain DH5o; containing plasmid pcDNA3.1(+)) by using the QIAGEN Plasmid Mega Kit (QIAGEN, Valencia, CA) according to the manufacturer's instructions. Plasmid DNA was then digested with an excess of BamH!
  • CMV cytomegalovirus
  • Murine Ba/F3 cells are an interleukin-3 (IL-3)-dependent, murine lymphoid precursor cell line (Palacios et al, 1984, Nature 309: 126-131; Palacios and Steinmetz, 1985, Cell 41: 727-734).
  • IL-3 interleukin-3
  • Ba/F3 cells were subcultured the day before electeoporation so that they were in the exponential phase when used for electeoporation.
  • the cells were cultured in RPMI 1640 (GIBCO-BRL, Gaithersburg, MD) containing 10% fetal bovine serum (HyClone, Logan, UT), 1 mM sodium pyruvate, 10 mM H ⁇ P ⁇ S buffer, 2 mM L- glutamine, and 2 ng/ml recombinant mouse interleukin-3 (IL-3) (R&D Systems, Minneapolis, MN).
  • Geneticin, also known as G-418 sulfate, was used at 500 ⁇ g/ml in selective medium.
  • % transfection efficiency % neomycin-resistant colonies/% plating efficiency
  • Plasmid pcDNA3.1(+) was linearized with BamH! and transfected into Ba/F3 cells either in the absence or presence of BamH!.
  • BHK570 cells were run as a conteol.
  • the results as shown in Table 1 demonstrated that transfection efficiency of Ba/F3 cells in the absence of the restriction enzyme was 6-fold less than that of BHK570 cells.
  • the results also showed that restriction enzyme mediated integration increased Ba/F3 teansfection efficiency by about 2.5-fold, which was the same degree of stimulation by restriction enzyme mediated integration of BHK570 teansfection.
  • H ⁇ elll The optimal enzyme concentration of H ⁇ elll was determined for teansfecting Ba/F3 cells. Plasmid pcDNA3.1(+) was digested with EcoRV, generating blunt ends. After the EcoRV enzyme was inactivated, the linear DNA was co-teansfected with the H ⁇ elll enzyme, which also generates blunt ends. The transfection efficiencies obtained are shown in Table 2.
  • the optimal DNA concentration was determined for teansfection. Varying amounts of DNA (10-200 ⁇ g) were added to each teansfection reaction, and the teansfection efficiency was determined. H ⁇ elll enzyme (0.4 unit/ ⁇ g DNA) was added to two reactions to determine the restriction enzyme mediated integration teansfection efficiency (Table 3).
  • Plasmid pJTL0106 is the same as pcDNA3.1(+) except that the CMV promoter located between Nru! and BamH! is deleted (see Figure 13).
  • 1 ⁇ g of pcDNA3.1 (+) was digested with 5 units of BamH! for 1 hour at 37°C.
  • the restriction digestion mixture was then teeated with 5 units of Klenow in the presence of 25 ⁇ M dNTPs at 30°C for 15 minutes before inactivating the enzyme at 75°C for 10 minutes. Digestion with Nrwl was performed by adding 5 units of the enzyme followed by incubation at 37°C for 1 hour.
  • the restriction enzyme digestion mixture was loaded onto 1% agarose gel for electeophoresis and the upper band containing the deletion of the BamHi-Nru ⁇ fragment was extracted from the gel by using QIAquick Gel Exteaction Kit (QIAGEN, Valencia, CA).
  • the subsequent ligation reaction was performed by Rapid DNA Ligation Kit from Roche Molecular Biochemicals, resulting in pJTL0106.
  • the EcoRV site is located downstream of BamH! in pcDNA3.1(+), so it remains intact in pJTL0106.
  • pJTL0106 was transformed into E. coli TOP 10 cells and a teansformant containing the plasmid was isolated and designated E. coli JLin0609.
  • Plasmid pcDNA3.1(+) or pJTL0106 was isolated from E. coli JLin0605 or E. coli JLin0609, respectively, by using the QIAGEN Plasmid Mega Kit (QIAGEN, Valencia,
  • EcoRV were added for an additional hour of incubation to ensure complete digestion of the plasmid. After digestion, EcoRV was inactivated at 80°C for 20 minutes. The linearized DNA was stored at -20°C prior to use in teansfection.
  • Example 7 Restriction enzyme mediated integration transfection of Ba/F3 cells and neomycin-selection
  • Restriction enzyme mediated integration teansfection of Ba/F3 cells was performed as follows: 100 ⁇ g EcoRV linearized pcDNA3.1(+) or pJTL0106 plasmid was introduced into 3xl0 7 Ba/F3 cells in the presence of 40 units H ⁇ elll by electeoporation. After electeoporation, the cuvettes were incubated for 3 minutes at room temperature followed by 7 minutes on ice before plating. Live cells were counted after electeoporation in a hemacytometer to determine the survival rate. Finally, the teansfection mixtures were resuspended in 50 ml non-selective medium and incubated at 37°C overnight.
  • Neomycin-resistant teansfectants were then selected. After overnight incubation at 37°C with 5% C0 2 , cells were collected by centrifugation and cell numbers were determined. The cells were then resuspended at a concenteation of 2xl0 5 cells/ml in geneticin-containing media to select for neomycin-resistant teansfectants. A teansfection reaction without addition of DNA served as a negative conteol. The teansfection efficiency was determined by plating on average 50 and 10 cells/well in 96-well plates with geneticin-containing medium. Cell plating efficiency was also determined by plating on average 0.1 cell/well in 96-well plates containing non-selective medium.
  • Example 8 Selection of granulocyte colony stimulating factor receptor expressing clones in agarose-containing selective medium
  • the Ba/F3 cell line is an interleukin-3 (IL-3)-dependent, murine lymphoid precursor cell line
  • selection in the absence of IL-3 for proliferation of a Ba/F3 clone allows for the isolation mutants Ba/F3 mutant cells were isolated that grow in the presence of granulocyte colony stimulating factor (G-CSF).
  • G-CSF granulocyte colony stimulating factor
  • wild type Ba/F3 does not grow in the absence of IL-3, colonies that grow on the selective medium should express the receptor for G-CSF.
  • the transfectants were plated in agarose media containing granulocyte colony stimulating factor (G-CSF).
  • the neomycin- resistant teansfectants were washed twice with 2X assay medium (2X RPMI 1640 containing glutamine, 20% fetal bovine serum, 2 mM sodium pyruvate and 20 mM HEPES buffer) to remove IL-3.
  • the cells were then plated 15-fold magnitude over the number of independent teansfectants in 5 ml of IX assay medium containing 1.25% agarose (SeaPlaque low melting temperature agarose; FMC; Rockland, ME) in the presence of 10 ng/ml mouse G-CSF (R&D Systems, Minneapolis, MN).
  • the colonies were resuspended in 0.2 ml of liquid selective medium RPMI 1640 medium (GIBCO-BRL, Gaithersburg, MD) containing 10% fetal bovine serum (HyClone, Logan, UT), 1 mM sodium pyruvate, 10 mM HEPES buffer, 2 mM L- glutamine, 10 ng/ml recombinant mouse G-CSF (R&D Systems, Minneapolis, MN), and 500 ⁇ g/ml geneticin to allow amplification. Amplified cell clones were moved to 2 ml, and then 6 ml selective medium containing geneticin before freezing in liquid nitrogen to store.
  • Example 9 Characterization of the positive clones by proliferation assay The Alamar Blue Dye Proliferation assay (TREK Diagnostic Systems, Westlake,
  • OH hydroxy-3-phosphate-activated cytokine-responsive proliferation phenotypes of the positive clones.
  • Cells were washed twice with 0.5 volume of medium that is identical to Ba/F3 culture medium except without addition of IL-3. After resuspension in the same medium, cells were resuspended at 50,000 cells/ml in RPMI 1640. A volume of 0.1 ml (5000 cells) was teansferred to each well of a 96 well plate followed by 100 ⁇ l of 2X assay medium containing no cytokine, 4 ng/ml IL-3, or 20 ng/ml G-CSF.
  • G-CSF-responsive clones originated from four independent pools (3.1.A6, 3.1.A10, 3.1.B5, and 3.1.B9). Since the number of the G-CSF-responsive colonies was less than the magnitude of colonies plated in each teansfection, it was concluded that the clones within each teansfection pool were siblings. Results of the quantitative proliferation assay of G-CSF-responsive clones are shown in Figure 1. Proliferation in response to IL-3 of the clones were comparable to that of wild type Ba/F3 cells. The proliferation in response to G-CSF was at least two-fold above background in these clones. The positive clones exhibited up to 24% of the proliferation in response to G-
  • Example 10 Transcription of G-CSFR is stimulated in all G-CSF-responsive clones.
  • the G-CSF-responsive phenotypes of the positive clones were hypothetically due to expression of the G-CSF receptor.
  • Northern analysis was performed to determine whether transcription of the G-CSF receptor (G-CSFR) gene was induced in these clones.
  • the probes used for Northern blot analyses were generated by genomic PCR.
  • the G-CSFR genomic fragment containing sequence from exon 7 to 8 was generated by using an upper primer 5'- CATTGGCCCTGATGTAGTCTC-3' (G-CSFR ex.7.35U21) (SEQ ID NO: 1) and a lower primer 5'- GCTCCAGAATCCAGGCAGAGA -3* (G- CSFR ex.8.94L21) (SEQ ID NO: 2) with genomic DNA isolated from Ba/F3 cells as template. Genomic DNA was isolated from the Ba F3 mutant cells using the Puregene system (Gentea Systems, Minneapolis, MN) according to the manufacturer's instructions. DNA concentrations were determined by absorbance at 260 nm. The genomic PCR mix was boiled at 100°C for 2 minutes prior to addition of the Taq polymerase.
  • the PCR * reaction was performed for 3 minutes at 72°C followed by 30 cycles at 94°C for 40 seconds, 56°C for 1 minute, and 72°C for 1 minute, followed by a 10 minute incubation at 72°C in the presence of 2.5 units of Taq Polymerase (Perkin Elmer, Branchburg, NJ).
  • An actin gene fragment was generated by using an upper primer 5'- ACCCCAGCCATGTACGTAGCC-3' (clw-36) (SEQ ID NO: 3) and a lower primer 5'- GGAAGGCTGGAAAAGAGCCTC-3' (clw-37) (SEQ ID NO: 4).
  • the PCR reaction was performed as described above except the PCR reaction was 35 cycles at 94°C for 40 seconds, 55°C for 1 minute, and 72°C for 1 minute.
  • the PCR-generated G-CSFR and actin fragments were then labeled with o;- 32 P-dCTP (Amersham, Arlington Heights, IL) by the random priming method of the Prime-It II system (Stratagene, La Jolla, CA).
  • the labeled G-CSFR DNA probe (5xl0 5 cpm per ml of hybridization buffer) was denatured in 0.5 N NaOH at 37°C for 5 minutes before being added to the pre- hybridization buffer. Hybridization was performed overnight at 65°C. The membrane was then washed once with 2X SSC buffer (0.3 M NaCl, 30 mM sodium citrate) at room temperature for 5 minutes, twice with 0.1X SSC/0.1% sodium dodecyl sulfate (SDS) at 55°C for 10 minutes, and finally with 2X SSC for 5 minutes at room temperature. The membrane was exposed to a Phosphor screen and visualized and quantified with the ImageQuant program (Molecular Dynamics, Sunnyvale, CA). The G-CSFR probe was stripped off the membrane by applying boiled 0.1% SDS to the membrane. The membrane was then hybridized with the labeled actin probe as described above to ensure equal RNA loading.
  • 2X SSC buffer 0.3 M NaCl, 30 mM sodium citrate
  • 5' RACE Rapid Amplification of cDNA Ends
  • CMV-leader sequence should be identifiable in the 5' end of the transcript. If CMV leader sequence is identified in the G-CSFR transcript, genomic PCR using the CMV promoter- and G- CSFR-specific primers should show whether there is linkage between the CMV promoter and the target gene.
  • the amplified PCR products can then be cloned and sequenced to identify the location of the CMV promoter insertion.
  • Representatives of the four independent G-CSF-responsive Ba/F3 clones (31A6-9, 31A10-2, 31B5-10, and 31B9-3) were subjected to these analyses.
  • RACE was performed according to the manufacturer's protocol (GIBCO-BRL,
  • G-CSFR cDNA was synthesized by using a G-CSFR specific primer 5'-GCCTCTTCTTTGCCACAC-3' (G-CSFR.734L18) (SEQ ID NO: 5), located 734 nucleotides downstream of the teanscription start site of the G-CSFR gene.
  • RNA 5 ⁇ g isolated from four G-CSF-responsive clones was incubated with 2.5 pmoles of the G- CSFR.734L18 primer in a total volume of 15.5 ⁇ l at 70°C for 10 min.
  • the cDNA was synthesized in the presence of PCR buffer (20 mM Tris-HCl (pH 8.4), 50 mM KC1), 2.5 mM MgCl2, 0.4 mM dNTP mix, and 10 mM DTT by Superscript® II Reverse
  • Transcriptase 200 units at 42°C for 50 minutes. Following eirzymatic degradation of the RNA templates, reaction products were subjected to TdT tailing to add sequence complementary to the abridged anchor primer at the 3' end of the cDNA.
  • the cDNA sample was incubated with tailing buffer (10 mM Tris-HCl (pH 8.4), 25 mM KC1, 1.5 mM MgCl2), 0.2 mM dCTP at 94°C for 3 minutes. Then 15 units of terminal deoxynucleotidyl transferase (TdT) was added followed by incubation at 37°C for 10 minutes. Finally, the TdT was inactivated at 65 °C for 10 minutes.
  • a PCR reaction was performed to amplify the target cDNA, using a nested gene-specific primer, 5'- CTCCCACTGGCAGACC-3' (G-CSFR.624L 16) (SEQ ID NO. 6), in conjunction with the abridged anchor primer (GIBCO BRL).
  • the G-CSFR.624L16 primer is located 624 nucleotides downstream of the transcription start site of the G-CSFR gene.
  • a second round of nested amplification was performed by using 1 ⁇ l PCR reaction from the previous PCR reaction as template, and the abridged anchor primer and G-CSFR.498L19 (5'- TGGCACTAAGCAGAAGAGG-3') (SEQ ID NO.7) as upper and lower primers, respectively.
  • the G-CSFR.498L19 primer is located in exon 4 and 498 nucleotides downstream of the transcription start site of the G-CSFR gene.
  • Both PCR reactions were performed for 1 minute at 94°C followed by 35 cycles each at 94°C for 40 seconds, 55°C for 1 minute, and 72°C for 3 minutes, followed by 10 minutes incubation at 72°C.
  • the amplified cDNA products were visualized on 1% agarose gels in IX TBE buffer (89 mM Tris base, 89 mM boric acid, 2 mM EDTA, pH 8.0), and then extracted from the gel using the QIAquick Gel Exteaction Kit (QIAGEN, Valencia, CA).
  • the PCR products were then cloned into pCR2.1-TOPO vector according to the manufacturer's protocol (Invitrogen, Carlsbad, CA) before being subjected to sequence analysis.
  • Genomic DNA isolated from the Ba/F3 mutant cells was prepared as described in Example 10. Genomic PCR analysis was performed to determine the linkage between the CMV promoter and G-CSFR gene in several G-CSF-responsive clones. Two G- CSFR-specific fragments from the 31A6-9 cell clone were amplified.
  • the first fragment was amplified with a CMV promoter-specific primer, 5'- TTCCCATAGTAACGCCAATA-3' (CMV-G-CSFR.391U20) (SEQ ID NO: 8), and a G-CSFF-specific primer, 5'-GGGCTTAACAATACCACTCAT-3' (CMV-G- CSFR.1059L21) (SEQ ID NO: 9), located in exon 2 of the G-CSFR gene.
  • a CMV promoter-specific primer 5'- TTCCCATAGTAACGCCAATA-3' (CMV-G-CSFR.391U20)
  • G-CSFF-specific primer 5'-GGGCTTAACAATACCACTCAT-3' (CMV-G- CSFR.1059L21) (SEQ ID NO: 9) located in exon 2 of the G-CSFR gene.
  • the second fragment was amplified by a CMV promoter-specific primer, 5'- TGGATAGCGGTTTGACTCAC-3' (36D56.647U20) (SEQ ID NO: 10), and a G-CSFF- specific primer, 5'-GCCTACAGACCAGCATTTG-3' (36D56.1562L19) (SEQ ID NO: 11), located in intron 1 of the G-CSFR gene.
  • the genomic PCR mixtures were boiled at 100°C for 2 minutes before addition of Taq polymerase.
  • the PCR reaction was performed with 3 minutes incubation at 72°C, 35 cycles each at 94°C for 40 seconds, 55°C for 1 minute, and 72°C for 3 minutes, followed by 10 minutes at 72°C.
  • a G-CSFR-specific fragment from the 31B5-10 cell clone was also amplified using the same primers 36D56.647U20 and 36D56.1562L19 with the PCR parameters as described above.
  • the results for each G-CSF-responsive cell clones are shown below:
  • the CMV promoter is inserted in intron 1 of the G-CSFR gene in the 31A6-9 cell clone.
  • the 5' RACE analysis showed that the sequence of the G-CSFR transcripts contained 110 nucleotide-long intron 1 sequence followed by exon 2 or 3, apparently resulting from an alternative splicing event ( Figures 2, 3, and 4, SEQ ID NOs. 12-15).
  • genomic PCR analysis was performed to amplify DNA fragment from the CMV promoter to either intron 1 or exon 2 of the G-CSFR gene.
  • the CMV promoter is inserted upstream of the exon 3 of the G-CSFR gene in the 31A10-2 cell clone.
  • Two classes of G-CSFR transcripts were identified by 5' RACE analysis. Both classes of transcripts contained more than 100 nucleotides of ampicillin- resistance gene sequence and a stretch of previously unidentified genomic DNA sequence, followed by exon 3 or 4 ( Figures 7, 8 and 9, SEQ ID NOs. 18-20).
  • the orientation of the ampicillin-resistance gene was consistent with the result that CMV promoter was oriented toward the direction of G-CSFR gene expression.
  • the presence of the ampicillin-resistance gene sequence in the 5' teanscript suggested that pcDNA3.1(+) was located upstream of the exon 3 of the G-CSFR gene.
  • the CMV promoter is inserted 1.1 kb upstream of the G-CSFR transcriptional start site in the 31B5-10 cell clone.
  • the RACE analysis showed that the G-CSFR transcripts of the 31B5-10 cell clone initiated from +4 of the CMV leader sequence for 43 nucleotides, followed by 27 nucleotides of the region 1.1 kb upstream of the G-CSFR gene (designated here as the "-1.1 kb G-CSFR region"), and spliced to the exon 4 of the G-CSFR gene ( Figures 10, 11, and 12, SEQ ID NOs. 21-23).
  • G-CSFR teanscript of the 31B9-3 cell clone was initiated from the G-CSFR -1.1 kb region mentioned above for 170 nucleotides, then spliced to exon 3 ( Figures 15 and 16, SEQ ID NOs. 25 and 26).
  • Figures 15 and 16, SEQ ID NOs. 25 and 26 no pcDNA3.1(+) sequence was found in the transcript. Since the transcript was different from the wild-type G-CSFR transcript, there is a possibility that a heterogeneous promoter such as CMV promoter was responsible for the transcription. It was subsequently demonsteated that the CMV promoter is located upstream of the G-CSFR gene in the 31B9-3 cell clone (see Example 13 below).
  • CSFR+ clones Southern blotting was performed to determine the copy number of the CMV promoter insertion in the G-CSFR 1" clones.
  • a CMV promoter-containing fragment was generated for use in the Southern blot analyses.
  • the CMV promoter-containing fragment was labeled with digoxigenin using the PCR DIG Synthesis Probe Kit (Roche, Indianapolis, IN) according to the manufacturer's instructions.
  • the CMV promoter- containing fragment was generated by using an upper primer 5'- TGTGTTGGAGGTCGCTGAGT-3' (CMV.95U20) (SEQ ID NO: 27) and a lower primer 5'- ACGCCTACCGCCCATTT -3' (CMV.772L17) (SEQ ID NO: 28) with 0.2 ng pcDNA3.1(+) as template in the presence of PCR DIG Probe Synthesis mix. Then 0.75 ⁇ l of enzyme mix was added to the reactions on ice. The PCR reaction was performed for 2 minutes at 94°C, 30 cycles each at 94°C for 40 seconds, 56°C for 1 minute, and 72°C for 2 minutes, followed by 10 minutes incubation at 72°C.
  • the DIG-labeled PCR product was purified by the QIAquick PCR Purification Kit (QIAGEN, Valencia, CA). The amount of the labeled probe was estimated by visualizing aliquots of the PCR products on an agarose gel.
  • the agarose gel was then subjected to depurination in 0.25 N HC1 for 10 minutes, denaturation twice in 0.5 M NaOH/1.5 M NaCl solution for 15 minutes, and neutralization twice in 1 M Tris pH 8/1.5 M NaCl solution for 15 minutes. DNA was then transferred to a Hybond N+ membrane in 20 X SSC buffer.
  • the membrane was prehybridized with 10 ml DIG Easy Hyb solution (Roche, Indianapolis, IN) for 2 hours at 42°C, followed by hybridization with 120 ng DIG-labeled PCR fragment containing the CMV promoter in 10 ml of DIG Easy Hyb solution overnight at 42 °C. The membrane was then washed twice with 2X SSC/0.1% SDS buffer at room temperature for 5 minutes, and twice with 0.5X SSC/0.1%
  • the washing and blocking buffer was obtained from DIG Wash and Block Buffer
  • a genomic DNA fragment containing the linearized pcDNA3.1(+) and flanking region was isolated by a rescue method described as follows: A total of 3 ⁇ g of genomic DNA, isolated as described in Example 10, was digested with 40 units of EcoRV or Nde ⁇ for 2 hours at 37°C. A second aliquot of 40 units of the same restriction enzymes were added and the incubation was continued for an additional 2 hours. The digest comprising the EcoRV- or Ni-M-linearized plasmids were then circularized at a concentration of 10 ng/ ⁇ l using 10 or 7.5 units of T4 D ⁇ A ligase at room temperature or 16°C, respectively, and incubated overnight. Then 200 or 100 ng of ligated D ⁇ A was introduced into E.
  • E. coli teansformants containing pcD ⁇ A3.1(+) and flanking DNA were selected on 2X YT medium (16 g tryptone, 10 g yeast extract, and 5 g NaCl per liter) supplemented with 100 ⁇ g/ml ampicillin— Plasmid DNA was isolated from representative ampicillin-resistant teansformants using a QIAGEN Plasmid Mini Kit (QIAGEN, Valencia, CA) and sequenced with a primer extending outward from pcDNA3.1 (+). Two different primers were used to sequence different plasmid clones:
  • the results of the plasmid rescue analysis are summarized in Table 8.
  • the sequence analysis confirmed that the G-CSFR gene can be isolated from at least three G- CSFR positive clones by plasmid rescue.
  • Sequence analysis of the isolated plasmid from clones 31A6-9 indicated consistent insertion location of the pcDNA3.1(+) which correlated with the results of the genomic PCR studies.
  • Sequence analysis of the plasmid rescued from 31B5-10 further revealed that that 152 nucleotides of G-CSFR genomic DNA were deleted during insertion of pcDNA3.1(+), in which a total of 146 nucleotides (60 nucleotides from 5' end and 86 nucleotides from 3' end) were also deleted.
  • Plasmid pBM76a was created by modification of plasmid pcDNA3.1(+) (Invitrogen, Carlsbad, CA). A 564 bp. ⁇ Hind!!! fragment was obtained using PCR amplification of ⁇ DNA/ Hindi!! fragments (Gibco BRL, Rockville, MA) with the following primer pairs (SEQ ID NOs. 32 and 33, respectively):
  • the amplification reaction (50 ⁇ l) was carried out using the Advantage-GC®
  • Genomic PCR kit (Clontech, Palo Alto, CA) with the following components: 0.5 ug ⁇ ONA/HindHi fragments (Gibco BRL, Rockville, MA), IX GC Genomic PCR Reaction Buffer, 2.2 ⁇ l 25 mM Mg(Oac) 2 , 50 pmol of the sense primer, 50 pmol of the antisense primer, IX dNTP mix, and IX Advantage-GC Genomic Polymerase Mix.
  • the reactions were cycled in an Ericomp Twin Block System Easy Cycler®, programmed as follows: Cycle 1; 95°C for 30". Cycles 2-11: 94°C for 30", 68°C for 1 ', Cycles 12-21: 94°C for 30", 60°C for 30", 68°C for 1'. Cycle 22; 68°C for 3'.
  • the PCR reaction was purified using the Qiaquick® PCR Purification kit (Qiagen, Valencia, CA). The purified PCR product was then digested with Hind!!!, purified by 1.5% NuSieve 3:1 agarose gel electeophoresis using standard methods (Samsbrook et al, 1989, supra), and followed by gel purification using the QIAquick Gel Extraction kit (Qiagen, Valencia, CA) according to manufacturer's instructions.
  • Vector pcDNA3.1(+) Invitrogen, Carlsbad, CA
  • the digested vector was purified by 0.7% gel electeophoresis, followed by gel purification using the QIAquick
  • the purified PCR product was then ligated into vector pcDNA3.1(+) using standard methods (Samsbrook et al, 1989, supra).
  • the resulting plasmid was designated pBM76a. This plasmid has a reduced chance of truncating the CMV promoter by exonucleases following teansfection.
  • REMI teansfection in Ba F3 is optimized with other restriction enzymes Rsal and Alu ⁇ , which recognize 4-base sequences GTAC and AGCT, respectively.
  • Plasmid pcDNA3.1(+) which contains the cytomegalovirus (CMV) enhancer promoter, was obtained from Invitrogen (Carlsbad, CA). Plasmid pcDNA3.1(+) was isolated from E. coli JLin0605 (E. coli strain DH5 ⁇ ; containing plasmid pcDNA3.1(+)) by using the QIAGEN Plasmid Mega Kit (QIAGEN, Valencia, CA) according to the manufacturer's instructions.
  • CMV cytomegalovirus
  • Plasmid DNA was then digested with an excess of EcoRV enzyme, for which the recognition site is located immediately downstream of the CMV promoter. After digestion, EcoRV was inactivated at 80°C for 20 minutes. The linearized DNA was stored at -20°C prior to use in teansfection.
  • Ba/F3 cells were subcultured the day before electeoporation so that they were in the exponential phase when used for electeoporation.
  • the cells were cultured in RPMI 1640 (GIBCO-BRL, Gaithersburg, MD) containing 10% fetal bovine serum (HyClone, Logan, UT), 1 mM sodium pyruvate, 10 mM H ⁇ P ⁇ S buffer, 2 mM L-glutamine, and 2 ng/ml recombinant mouse interleukin-3 (IL-3) (R&D Systems, Minneapolis, MN).
  • Geneticin, also known as G-418 sulfate, was used at 500 ⁇ g/ml in selective medium.
  • the cell DNA mixture was incubated on ice for 5 minutes.
  • Rsal (Roche, Indianapolis, IN) was added immediately prior to electeoporation.
  • the cell/DNA mixture was subjected to two sequential electric shocks at room temperature, 800 ⁇ F, 300 V once, followed by 1180 ⁇ F, 300 V once, using a Cell Porator electeoporator (GIBCO-BRL, Gaithersburg, MD) according to the manufacturer's instructions. After electeoporation, the cuvettes were incubated for 3 minutes at room temperature followed by 7 minutes on ice before plating.
  • GEBCO-BRL Cell Porator electeoporator
  • the teansfection mixtures were resuspended in non-selective medium at a concenteation of 6x10 5 cells/ml. After overnight incubation at 37°C with 5% C0 2 , cells were collected by centrifugation and cell numbers were determined. Cell plating efficiency was determined by plating on average 0.1 cell/well in 96-well plates containing non-selective medium. The number of neomycin-resistant transfectants was determined by plating on average 50 and 10 cells/well in 96-well plates containing selective medium. Growing cell clones were enumerated 11 days after plating. Transfection efficiency was determined as described in Example 1.
  • Table 9 The results shown in Table 9 are transfection efficiency of two independent samples and average transfection efficiency.
  • the results as shown in Table 9 demonsteate that restriction enzyme mediated integration with Rsa! stimulated transfection efficiency by 2- to 5-fold. Maximal teansfection efficiency was achieved with 0.2 unit Rsa ⁇ / ⁇ g DNA.
  • Plasmid pBM76a described in previous example, was isolated from E. coli strain XL 1 -blue by using the QIAGEN Plasmid Mega Kit
  • Restriction enzyme mediated integration was performed in a Ba F3 cell line expressing both gpl30 and LIF receptors (designated as Ba/F3/gpl30/LIFR herein).
  • Ba F3/gpl30/LIFR was created by electroporated Ba/F3 cells with mouse gpl30/pZeoSV and mouse gpl90(LIFR)/pCP-12 (with the puro resistance gene) .
  • the pCP-12 vector is composed of a puromycin resistance gene as the mammalian cell selectable marker, coupled to an SV40 promoter.
  • the mouse LIFR cDNA is coupled to the MT-1 promoter and has an SV40 terminator.
  • the bacterial selectable marker is ampicillin resistance gene.
  • Ba/F3/gpl30/LIFR cells were selected with 200 ug/ml Zeocin and 1 ug/ml puromycin and then selected for the ability to grow on LIF without IL-3.
  • Ba/F3 except for the following modifications.
  • IL-3 (2 ng/ml) is added to the media to increase teansfection efficiency (data not shown).
  • Cell plating efficiency is determined by plating on average 0.2 cell/well in 96-well plates containing non-selective medium.
  • the number of neomycin-resistant teansfectants is determined by plating on average 200 and 40 cells/well in 96-well plates containing selective medium. Growing cell clones are enumerated 7 days after plating.
  • Transfection efficiency is determined as described in Example 1.
  • the optimal concenteation of enzyme for Rsa 1 (GT/AC), Nde 11 (/GATC/), or H ⁇ e 111 (GG/CC) in Ba/F3/gpl30/LIFR teansfection is 0.05, 0.025, or 0.05 U/ug DNA, respectively (Tables 11 to 13).
  • Example 18 Restriction enzyme mediated integration teansfection in Jurkat E6-1
  • a previous study (Whitney et al, 1998, Nature Biotechnology 16: 1329-1333) showed that only 3500-4000 G418-resistant Jurkat teansfectants can be generated using electeoporation.
  • REMI teansfection was applied to Jurkat E6-1 (ATCC catalog no. TIB- 152, Manassas, VA), a human T cell line.
  • the REMI teansfection procedure for Jurkat E6-1 is identical to the Ba F3 electeoporation method described previously except for a few modification.
  • TF-1 was teansfected to demonsteate that REMI teansfection can be applied to another cell line, and to expand the technology to factor-dependent human cell lines.
  • TF- 1 (ATCC catalog no. CRL-2003, Manassas, VA) is an IL-3 or GM-CSF-dependent human erythroleukemic cell line.
  • REMI teansfection procedure for TF-1 is similar to that of Ba/F3 with a few exceptions mentioned below.
  • the number of neomycin-resistant transfectants was determined by plating on average 1000 and 250 cells/well in 96-well plates containing
  • H ⁇ elll GG/CC
  • Rsa ⁇ GG/CC
  • Nde II /GATC/
  • Alu ⁇ AG/CT
  • Example 20 Isolation of interleukin-5-responsive Ba/F3 cell clones a. Restriction enzyme mediated integration transfection of Ba/F3 cells and neomycin-selection
  • Restriction enzyme mediated integration teansfection of Ba/F3 cells was performed as described previously. 100 ⁇ g EcoRV linearized pBM76a plasmid was introduced into 3xl0 7 Ba/F3 cells in the presence of 40 units H ⁇ elll by electeoporation. After overnight incubation at 37°C with 5% C0 2 , cells were collected by centrifugation and cell numbers were determined. The cells were then resuspended at a concenteation of 2x10 cells/ml in geneticin-containing media to select for neomycin-resistant transfectants. The teansfection efficiency was determined by plating on average 50 and 10 cells/well in 96-well plates with geneticin-containing medium.
  • BMcA109 250,000 6 BMcAllO 120,000 5 BMcAlll 350,000 1 BMcA112 340,000 0
  • interleukin-5 stimulated clones in agarose-containing selective medium Since the Ba/F3 cell line is an interleukin-3 (IL-3)-dependent, murine lymphoid precursor cell line, selection in the absence of IL-3 for proliferation of a Ba/F3 clone allows for the isolation of mutants. Ba/F3 mutant cells that grow in the presence of interleukin-5 (IL-5) were isolated. Ba/F3 colonies that grow on the selective medium could express the receptor for IL-5. After selection for resistance to G-418, the teansfectants were plated in agarose media containing IL-5.
  • IL-3 interleukin-3
  • IL-5 interleukin-5
  • the neomycin-resistant teansfectants were washed twice with 2X assay medium (2X RPMI 1640 containing glutamine, 20% fetal bovine serum, 2 mM sodium pyruvate and 20 mM HEPES buffer) to remove IL-3.
  • the cells were then plated 15 to 38-fold magnitude over the number of independent teansfectants in 5 ml of IX assay medium containing 1.25% agarose (SeaPlaque low melting temperature agarose; FMC; Rockland, ME) in the presence of 50 ng/ml mouse IL-5 (R&D Systems, Minneapolis, MN).
  • the colonies were resuspended in 0.2 ml of liquid selective medium RPMI 1640 medium (GIBCO-BRL, Gaithersburg, MD) containing 10% fetal bovine serum (HyClone, Logan, UT), 1 mM sodium pyruvate, 10 mM HEPES buffer, 2 mM L-glutamine, 50 ng/ml recombinant mouse IL-5 (R&D Systems, Minneapolis, MN), and 500 ⁇ g/ml geneticin to allow amplification. Amplified cell clones were moved to 2 ml, and then 6 ml selective medium containing geneticin before freezing in liquid nitrogen to store.
  • 0.1 ml (5000 cells) was teansferred to each well of a 96 well plate followed by addition of 100 ⁇ l of 2X assay medium containing no cytokine, 4 ng/ml IL-3, or 100 ng/ml IL-5. After a 3 day-incubation at 37°C, 20 ⁇ l of Alamar Blue dye was added and incubation was continued for another 24 hours. The reduced form of the dye, indicating proliferation, was measured using a fluorimeter (Perkin Elmer, Branchburg, NJ) with 544 nm excitation/590 nm emission wavelength.
  • a fluorimeter Perkin Elmer, Branchburg, NJ
  • the proliferation in response to IL-5 was at least two-fold above background in these clones.
  • the positive clones exhibited up to 75% of the proliferation in response to IL-5 compared with that in response to IL-3.
  • the integrated tagging plasmid results in this IL-5-responsive phenotype.

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Mycology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention relates to methods for producing a mutant mammalian cell by introducing into mammalian cells a nucleic acid construct and a restriction enzyme under conditions where the nucleic acid construct integrates into the genome of the mammalian cells at sites generated by the restriction enzyme.

Description

METHODS FOR EXPRESSING ENDOGENOUS GENES BY RESTRICTION ENZYME MEDIATED INTEGRATION
Background of the Invention
Field of the Invention
The present invention relates to methods for identifying and isolating endogenous genes in mammalian cells by restriction enzyme mediated integration of a regulatory sequence and to isolated genes obtained by such methods. The present invention also relates to methods for expressing endogenous genes of mammalian cells.
Description of the Related Art
The identification of genes involved in human disease is critical for developing new therapeutic treatments. Mammalian cell lines have been used to isolate such genes mostly by cloning from cDNA libraries using either hybridization, PCR, or expression screening, or searching for conserved DNA elements in EST databases. However, many of these genes are expressed in very small quantities or are only expressed during specific developmental stages or in specific tissues, which makes it very difficult to identify new genes. The EST approach is limited because identification is based on homology with known genes or conservation of motifs.
WO 99/15650 discloses methods for activating gene expression or causing over- expression of a gene in human HH1 cells by non-homologous or illegitimate recombination with a vector having a splice donor sequence which directs a regulatory sequence of a non-homologously integrated vector to become operably linked to the endogenous gene.
There is a need in the art for developing new methods for identifying and isolating unknown genes in mammalian cell lines without any knowledge of the gene such as its sequence, regulation, expression pattern, or genomic organization. For instance, large libraries of Ba/F3 or Jurkat E6-1 transfectants have not been generated because of the low transfection efficiency compared to other cell lines.
It is an object of the present invention to provide methods for identifying and isolating unknown genes in mammalian cells.
Summary of the Invention
The present invention relates to a method for producing a mutant mammalian cell by introducing into mammalian cells a nucleic acid construct and a restriction enzyme under conditions where the nucleic acid construct integrates into the genome of the mammalian cells at sites generated by the restriction enzyme. The method involves growing the mammalian cells and selecting for a mutant mammalian cell having a trait of interest.
The nucleic acid construct preferably includes a regulatory region, and the present invention also relates to methods for expressing an endogenous gene in mammalian cells by integration of a regulatory sequence such that expression of the gene is altered, preferably by being activated or increased.
The present invention also relates to isolated genes obtained from mammalian cells produced by such methods and to nucleic acid constructs, expression vectors, and host cells containing the isolated genes, and methods of producing polypeptides with such host cells. In one embodiment such genes are isolated by identifying the locus at the site of integration of the nucleic acid construct and isolating the gene controlling the trait of interest.
The present invention also relates to methods of obtaining mutant mammalian cells having an altered expression of an endogenous gene, and to mutant mammalian cells obtained by such methods.
The present invention further relates to methods of obtaining mutant mammalian cells having activated or increased expression of an endogenous gene, and to mutant mammalian cells obtained by such methods.
The present invention further relates to methods for producing transfectants of mammalian cells.
In a preferred embodiment of the methods described above, the integration is by restriction enzyme mediated integration. Brief Description of the Figures
Figure 1 shows proliferation phenotypes of wild type Ba F3 and four positive clones in response to G-CSF. The proliferation of each clone in the presence of IL-3 is normalized as 100%. The percentage of proliferation in the presence of G-CSF compared with that in response to IL-3 for each clone is indicated.
Figure 2 shows schematic diagrams of two G-CSFR-specific PCR products (31A6-9 Race 1 and 2) generated from 5' RACE analysis that determine linkage between the CMV promoter and the G-CSFR gene in the 31A6-9 cell clone. Figure 3 shows the DNA sequence (SEQ ID NO. 12) of the 31A6-9 RACE product 1. The CMV promoter sequence is in bold; G-CSFR intron 1 sequence is in lower case; and regions of G-CSFR exon 2, 3, and 4, are indicated and underlined. The two nucleotides (ac) at the junction of CMV promoter and intron 1 could be either CMV promoter or intron 1 sequence, thus labeled bold and lower case. The amino acid sequence (SEQ ID NO. 13) of the G-CSFR protein initiated from exon 3 is also indicated.
Figure 4 shows the DNA sequence (SEQ ID NO. 14) of the 31A6-9 RACE product 2. The CMV promoter sequence is in bold; G-CSFR intron 1 sequence is in lower case; and regions of G-CSFR exon 2, 3, and 4, are indicated and underlined. The two nucleotides (ac) at the junction of CMV promoter and intron 1 could be either CMV promoter or intron 1 sequence, thus labeled bold and lower case. The amino acid sequence (SEQ ID NO. 15) of the G-CSFR protein initiated from exon 3 is also indicated.
Figures 5 A and B show the DNA sequence (SEQ ID NO. 16) of the genomic PCR product amplified with CMV promoter- and G-CSFR-specific primers from the 31A6-9 cell clone. Regions of CMV promoter are labeled. A stretch of DNA rearrangement resulting in a flipped CMV promoter region (772-696) is indicated. The assigned nucleotide number of the CMV promoter is according to that in pcDNA3.1(+). G-CSFR intron 1 sequence is shown in lower case. The G-CSFR transcription start site of either RACE products is in bold and labeled as +1 (for RACE-1) or +1 ' (for RACE-2).
Figure 6 shows the DNA sequence (SEQ ID NO. 17) of the G-CSFR genomic
DNA region where the CMV promoter/pcDNA3.1(+) is inserted in the 31A6-9 cell clone. The insertion site of the CMV promoter/pcDNA3.1(+) is indicated by an arrow.
The H elll site located immediately upstream of the insertion site is in bold. G-CSFR intron 1 sequence is in lower case.
Figure 7 shows schematic diagrams of two G-CSFR-specific PCR products (31A10-2 RACE 1 and 2) generated from 5' RACE analysis that shows linkage between the CMV promoter and the G-CSFR gene in the 31A10-2 cell clone. The nucleotide number of the ampicillin resistance gene is according to numbers in pcDNA3.1 (+).
Figure 8 shows the DNA sequence (SEQ ID NO.18) and deduced amino acid sequence (SEQ ID NO. 19) of the 31A10-2 RACE product 1. The ampicillin resistance gene and G-CSFR exon 4 sequences are indicated and underlined. A previously unidentified genomic DNA sequence region flanked in between is in lower case. Figure 9 shows the DNA sequence (SEQ ID NO. 20) of the 31A10-2 RACE product 2. The ampicillm resistance gene and G-CSFR exon 4 sequences are indicated and underlined. A previously unidentified genomic DNA sequence region flanked in between is in lower case.
Figure 10 shows schematic diagrams of two G-CSFR-specific PCR products (31B5-10 RACE 1 and 2) generated from 5' RACE analysis that demonstrates linkage between the CMV promoter and the G-CSFR gene in the 31B5-10 cell clone.
Figure 11 shows the DNA sequence (SEQ ID NO. 21) and deduced amino acid sequence (SEQ ID NO. 22) of the 31B5-10 RACE product 1. The CMV promoter sequence is in bold; G-CSFR -1.1 kb region and exon 4 sequences are indicated and underlined. A previously unidentified genomic DNA sequence region flanked between - 1.1 kb region and exon 4 is in lower case. Predicted translation in RACE 1 is indicated, initiating from the unidentified genomic DNA sequence. The 40th amino acid (cysteine) (coding sequence underlined) encoded in exon 4 is the start of the matured G-CSFR peptide. Figure 12 shows the DNA sequence (SEQ ID NO. 23) of the 31B5-10 RACE product 2. The CMV promoter sequence is in bold; G-CSFR -1.1 kb region and exon 4 sequences are indicated and underlined.
Figure 13 shows a schematic diagram of the genomic PCR product amplified with CMV promoter- and G-CSFR-specific (located in intron 1) primers from the 31B5- 10 cell clone.
Figure 14 shows the DNA sequence (SEQ ID NO. 24) of the genomic PCR product amplified with CMV promoter- and G-CSFR-specific (located in -1.1 kb region) primers from the 31B5-10 cell clone. CMV promoter and G-CSFR -1.1 kb regions are underlined and indicated. The transcriptional start site of the 31B5-10 mRNA is indicated as +1 and in bold.
Figure 15 shows a schematic diagram of the G-CSFR-specific PCR products generated from 5' RACE analysis of the 31B9-3 cell clone.
Figure 16 shows the DNA sequence (SEQ ID NO. 25) and deduced amino acid sequence (SEQ ID NO. 26) of the RACE products from the 31B9-3 cell clone. The G- CSFR -1.2 kb region, exon 3, and exon 4 sequences are indicated and underlined. Amino acid sequence of the G-CSFR protein initiated from exon 3 is also indicated.
Figures 17 shows a schematic diagram of the location of the pcDNA3.1(+) insertion in relation to the G-CSFR gene in the 31B9-3 cell clone. Figure 18 A and B show the DNA sequence (SEQ ID NO. 31) of sequenced nucleotides from the rescued plasmid from the 31B9-3 cell clone. The G-CSFR exons 1 and 2, and intron 1 and partial intron 2 sequences are indicated and underlined.
Detailed Description of the Invention
The present invention relates to a method for producing a mutant mammalian cell by introducing into mammalian cells a nucleic acid construct and a restriction enzyme. The method involves introducing the cells under conditions where the restriction enzyme is active, and where the nucleic acid construct may integrate into sites generated in the genome. The method involves growing the mammalian cells and selecting for a mutant mammalian cell having a trait of interest.
The methods of the present invention now make it possible to create large libraries of even those mammalian cells which have a low transfection efficiency, and can be used for discovering and isolating new genes. The trait which is observed in the mutant mammalian cell may result from altered expression of a naturally-occurring polypeptide, either in quantity, or by expression in a modified form. Hence the trait may comprise a phenotype which occurs with either increased or reduced expression of a naturally-occurring polypeptide.
The methods of the present invention are particularly useful for identifying and isolating genes that are unknown as a result of their expression being undetectable. Thus, the instant methods require no knowledge of the existence of a gene. However, the methods of the present invention can be used to over-express a known endogenous gene that is expressed poorly. By introducing a restriction enzyme and a restriction enzyme- digested nucleic acid construct comprising a regulatory sequence into a multiplicity of mammalian cells, a gene endogenous to a mammalian cell is activated or over-expressed allowing its isolation and characterization. The nucleic acid construct is generally devoid of any nucleic acid sequence that would promote homologous recombination of the construct at a predetermined site of the cell's genome. Rather, the construct integrates into the mammalian cell's genome by restriction enzyme-mediated integration through the action of the restriction enzyme.
The nucleic acid construct may be a restriction enzyme cleaved nucleic acid fragment, or a synthetic DNA, cDNA and a PCR product. Though the construct is preferably a linear construct, it may be linearized by said restriction enzyme upon introduction to the mammalian cells. Alternatively, the nucleic acid construct may be linearized by the restriction enzyme before being introduced into said mammalian cells. The nucleic acid construct may even be linearized by a second restriction enzyme before being introduced into said mammalian cells, though it is preferable that the restriction enzyme used to linearize the fragment produce similar ends. In the methods of the present invention, the integration preferably occurs by restriction enzyme-mediated integration. The term "restriction enzyme-mediated integration" is defined herein as the non-homologous end-joining of DNA molecules that contain an end capable of being joined to a second DNA end either directly, or following repair or processing, but do not share significant sequence homology. The DNA end can consist of a 5 ' overhang, 3 ' overhang, or blunt end.
The present invention also relates to methods for isolating a gene by identifying and isolating a mutant mammalian cell having altered expression of a gene encoding a polypeptide which confers a phenotype. In a preferred method the expression of the gene results from the integration of the introduced linearized nucleic acid construct such that the expression of the gene encoding the polypeptide is altered and results in the phenotype. The mutant mammalian cell is then cultivated under conditions suitable for observation of the phenotype, and the locus of the mutant mammalian cell is identified at the site of integration, leading to isolation of the gene controlling the trait of interest.
The present invention further relates to methods for producing a polypeptide, comprisingcultivating the mutant mammalian cell of under conditions suitable for expressing the gene; and isolating the polypeptide so expressed.
Restriction Enzymes
In the methods of the present invention, introduction of a restriction enzyme into a mammalian cell cleaves at specific sites of the genomic DNA of the cell. These cleavage breaks can serve as sites for integration of the nucleic acid construct linearized with the same or a different restriction enzyme. In addition, the presence of the restriction enzyme may induce cleavage at non-specific sites in the genome which may serve as integration sites.
The restriction enzyme can be at least a four, five, six, seven, eight, or nine base restriction enzyme. For example, there are a variety of restriction enzymes including 4- base to 8-base cutters with differing specificities as to which sites are cleaved. Depending on the restriction enzyme used, many breaks or a few breaks in the genomic DNA can be achieved. If a recognition site for a restriction enzyme is located near an unknown gene, then treatment of the cells with the restriction enzyme can increase the probability of integrating the construct in a configuration to activate or over-express the gene.
The restriction enzyme can be any enzyme that is useful in the methods of the present invention. For example, a 4-base recognition enzyme can be preferred over a 6- base recognition enzyme, because more 4-base target sites are generally present in the genome than 6-base sites. Several 4-base recognition sites can be used in combination with a linearized plasmid by a 6- or 8-base recognition sites as shown below:
Restriction enzymes that recognize different sequences from the ends of the linearized plasmid can also be used, i.e., the ends of the linearized construct do not need to be compatible with the restriction enzyme being introduced into the cell during transfection. Therefore, additional 4-base recognition enzymes can be used under such circumstances. Examples are HinPΪ, Hpaϊ!, Msel, Mspϊ, and Taqϊ. If using a 4 base- recognition enzyme does not generate positive clones, 6 or 8 base-recognition enzymes can be used. Examples of 6 base-recognition enzymes include, but not limited to,
BamH!, EcoR!, Hind!!!, Sal!, Xbaϊ, BgHΪ, and Xhoϊ. Examples of 8 base-recognition enzymes include, but not limited to, Ascϊ, Not!, Pad, Pmeϊ, Sbfi, SgrAΪ, Sgβ, Swaϊ, and &e83871.
More than one restriction enzyme can be used since the introduction of each enzyme into a cell will create different integration sites resulting in a different integration pattern. Depending on which restriction enzyme(s) is used, integration of the construct can be biased to a desired site in the genome to create "biased" libraries enriched for certain types of activated genes. For example, restriction enzyme sites containing CpG dinucleotides are generally under-represented in the genome at large, but over- represented in the form of CpG islands at the 5' end of many genes. Enzymes recognizing these sites, therefore, will preferentially cleave at the 5' end of gene sequences. Restriction enzymes recognizing CpG containing sites include Eag!, Bsi-J47, A4Q and B sHII.
Nucleic Acid Constructs In the methods of the present invention, the nucleic acid construct comprises suitable restriction sites to facilitate restriction enzyme-mediated integration of the construct in the cell's genome. The construct also comprises a regulatory sequence such that when the regulatory sequence integrates at a locus in a cell's genome the regulatory sequence can be operably linked to an endogenous gene thereby affecting transcription, post-transcriptional modification, translation, or post-translation modification. The instant methods are particularly useful for activating or over-expressing an endogenous gene.
The restriction enzyme sites are located downstream and upstream of the regulatory sequence such that they do not affect the functional integrity of the regulatory sequence. The construct preferably contains multiple restriction sites to increase the construct's versatility for generating different libraries. The sites can be separated from the regulatory sequence by a "spacer arm" to protect the functional regulatory sequence from exonucleolytic degradation during the transfection process (see Example 14). The terms "upstream region" and "downstream region" are defined herein as regions 5' or 3', respectively, of the coding sequence of a gene.
The term "regulatory sequence" is defined herein to include any component which is necessary or advantageous for the expression of a polypeptide in a mammalian cell. Expression of a polypeptide is understood in the present invention to include transcription, post transcriptional modification, translation, and post-translational modification. The regulatory sequence can be native or foreign to the cell. Such regulatory sequences include, but are not limited to, an enhancer, leader, propeptide sequence, promoter, and signal peptide sequence.
The term "operably linked" is defined herein as a configuration in which, a regulatory sequence is appropriately placed at a position relative to the coding sequence of the gene's DNA sequence such that the regulatory sequence directs the expression or localization of a polypeptide.
The regulatory sequences can be obtained from genes of eukaryotes, viruses, retroviruses, and the like. Such genes include, but are not limited to, the actin gene, metallothionein I gene, immunoglobulin genes, casein 1 gene, serum albumin gene, collagen gene, globin genes, laminin gene, spectrin gene, ankyrin gene, sodium/potassium ATPase gene, tubulin gene. Cytomegalovirus (CMV) immediate early gene, adenovirus late genes, SV40 genes, retroviral LTRs, and Herpes virus genes.
The regulatory sequence can be an appropriate promoter sequence, a nucleic acid sequence which contains transcriptional control sequences which mediate the expression of the gene. The promoter can be any nucleic acid sequence which shows transcriptional activity in the cell including mutant, truncated, and hybrid promoters, and can be obtained from genes encoding extracellular or intracellular polypeptides. The promoter can be native to the cell or foreign thereto. Moreover, the promoter can be inducible or a tissue specific promoter.
Typically, a promoter sequence is located in the 5' non-coding region of a gene, proximal to the transcriptional start site of a structural gene. A "core promoter" contains essential nucleotide sequences for promoter function, including the TATA box and start of transcription. By this definition, a core promoter can or can not have detectable activity in the absence of specific sequences that can enhance the activity or confer tissue specific activity. Sequence elements within promoters that function in the initiation of transcription are often characterized by consensus nucleotide sequences. These promoter elements include RNA polymerase binding sites, TATA sequences, CAAT sequences, differentiation-specific elements (DSEs; McGehee et al, 1993, Moi. Endocrinol. 7: 551), cyclic AMP response elements (CREs), serum response elements (SREs; Treisman,
1990, Seminars in Cancer Biol. 1: 47), glucocorticoid response elements (GREs), and binding sites for other transcription factors, such as CRE/ATF (O'Reilly et al, 1992, J.
Biol Chem. 267: 19938), AP2 (Ye et al, 1994, J. Biol. Chem. 269: 25728), SP1, cAMP response element binding protein (CREB; Loeken, 1993, Gene Expr. 3: 253 ) and octamer factors (see, in general, Watson et al, eds., Molecular Biology of the Gene, 4th ed. (The Benjamin/Cummings Publishing Company, Inc. 1987), and Lemaigre and Rousseau, 1994, Biochem. J. 303: 1). If a promoter is an inducible promoter, then the rate of transcription increases in response to an inducing agent. In contrast, the rate of transcription is not regulated by an inducing agent if the promoter is a constitutive promoter. Repressible promoters are also known.
A "regulatory element" is a nucleotide sequence that modulates the activity of a core promoter. For example, a regulatory element can contain a nucleotide sequence that binds with cellular factors enabling transcription exclusively or preferentially in particular cells, tissues, or organelles. These types of regulatory elements are typically associated with genes that are expressed in a "cell-specific," "tissue-specific," or "organelle-specific" manner. An "enhancer" is a type of regulatory element that can increase the efficiency of transcription, regardless of the distance or orientation of the enhancer relative to the start site of transcription. Effective enhancer sequences include, but are not limited to, the cytomegaloviris immediate early gene enhancer and cellular, non-viral enhancers, ABC enhancer, myoD, Spl, and human elongation factor 1A-1.
Examples of suitable promoters for directing the transcription of a gene in a mammalian cell include, but are not limited to, the Cytomegalovirus (CMV) immediate early gene promoter (Foecking et al, 1980, Gene 45: 101), tetracycline inducible promoter, metallothionein promoter (Hamer et al, 1982, J. Molec. Appl. Genet. 1: 273), TK promoter of Herpes virus (McKnight, 1982, Cell 31: 355), SV40 early promoter (Benoist et al, 1981, Nature 290: 304), and Rous sarcoma virus promoter (Gorman et al, 1982, Proc. Nat'l Acad. Sci. USA 79: 6777), beta-casein, elongation factor 1A (EF-lc), and unbiquitin conjugating enzyme (UbC). The regulatory sequence can also comprise a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the cell. The leader sequence is operably linked to the 5' terminus of the nucleic acid sequence encoding the polypeptide. Any leader sequence that is functional in a mammalian cell can be used in the present invention. Preferred leaders are obtained from the promoters of the Cytomegalovirus (CMV) immediate early gene promoter, tetracycline inducible promoter, metallothionein promoter, TK promoter of Herpes virus, SV40 early promoter, Rous sarcoma virus promoter, beta-casein promoter, elongation factor 1A (EF-lc) promoter, unbiquitin conjugating enzyme (UbC) promoter, and cytomegalovirus promoter. The regulatory sequence can also comprise a signal peptide coding region that codes for an amino acid sequence linked to the amino terminus of a polypeptide and directs the encoded polypeptide into the cell's secretory pathway. The 5' end of the coding sequence of the nucleic acid sequence can inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region which encodes the secreted polypeptide. Alternatively, the 5' end of the coding sequence can contain a signal peptide coding region which is foreign to the coding sequence. The foreign signal peptide coding region can be required where the coding sequence does not naturally contain a signal peptide coding region. Alternatively, the foreign signal peptide coding region can simply replace the natural signal peptide coding region in order to enhance secretion of the polypeptide. In other cases, the signal sequence will allow a protein which is normally located intracellularly to be secreted. However, any signal peptide coding region which directs the expressed polypeptide into the secretory pathway of a mammalian cell can be used in the present invention. Effective signal peptide coding regions include, but are not limited to, the signal peptide coding regions obtained from the genes for the interleukins (interleukin-2, interleukin-3, interleukin-4, interleukin-6, interleukin-8, interleukin-10, interleukin-11, interleukin-12, interleukin-13, interleukin-14), granulocyte macrophage colony stimulating factor, and V-J2-C region of the mouse Ig kappa chain. The control sequence can also comprise a propeptide coding region that codes for an amino acid sequence positioned at the amino terminus of a polypeptide. The resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases). A propolypeptide is generally inactive and can be converted to a mature active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide.
Where both signal peptide and propeptide regions are present at the amino terminus of a polypeptide, the propeptide region is positioned next to the amino terminus of a polypeptide and the signal peptide region is positioned next to the amino terminus of the propeptide region. The nucleic acid construct can further comprise one or more selectable markers to facilitate the identification and isolation of cells containing a restriction enzyme integrated construct. A selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like. Examples of selectable markers include genes encoding adenosine deaminase, aspartate dihydro-orotase, dihyrofolate reductase, glutamine synthetase, histidine D, hygromycin resistance, hypoxanthine phosphoribosyl transferase, carbamyl phosphate synthase, multidrug resistance, neomycin resistance, puromycin resistance, transcarbamylase, zeocin resistance and xanthine-guanine phosphoribosyl transferase. The nucleic acid construct can also contain one or more amplifiable markers to allow for selection of cells containing increased copies of the integrated construct and the adjacent activated endogenous gene. A preferred amplifiable selectable marker is dihydrofolate reductase, which confers resistance to methotrexate. Other drug resistance genes (e.g., hygromycin resistance, multi-drug resistance, puromycin acetyltransferase, adenosine deaminase, dihydro-orotase glutamine synthetase, and carbamyl phosphate synthase) can also be used. Alternative markers that introduce an altered phenotype, such as green fluorescent protein, or cell surface proteins such as CD4, CD8, Class I MHC, and placental alkaline phosphatase can be used to sort transfected cells from untransfected cells by such means as FACS sorting or magnetic bead separation technology.
Once an endogenous gene is activated or overexpressed, the presence of the amplifiable marker allows the copy number of the gene to be increased. The increase in copy number is accomplished by cultivating the cells in the presence of increasing amounts of one or more appropriate selectable agents such as a drug or metabolite, e.g., methotrexate for amplification of the dihydrofolate reductase gene, and selecting for increased copy number of integrated construct and the adjacent activated endogenous gene expression. As drug-resistant colonies arise at each increasing drug concentration, individual colonies can be selected and characterized for copy number of the amplifiable marker and gene of interest, and analyzed for expression of the gene of interest. Individual colonies with the highest levels of gene expression can be selected for further amplification at higher concentrations of the selective agent. At the highest concentrations, the clones will express greatly increased amounts of the protein of interest. Methods for determining the copy number of a gene are well known in the art and include Southern analysis, quantitative PCR, or real time PCR. Examples of amplifiable markers include, but are not limited to, genes encoding dihydrofolate reductase, adenosme deammase, aspartate transcarbamylase, dihydro- orotase, and carbamyl phosphate synthase.
Alternatively, the nucleic acid construct can contain a screenable marker, in place of or in addition to, the selectable marker. A screenable marker allows the cells containing the integrated construct to be isolated without drug or other selective pressure. Examples of screenable markers include genes encoding cell surface proteins, fluorescent proteins (Green fluorescent protein), and enzymes.
A selectable marker can also be omitted from the construct when transfected cells are screened for gene activation products without selecting for the stable integrants. This is particularly useful when the efficiency of stable integration is high.
The nucleic acid construct can also contain a nucleic acid sequence encoding an affinity tag, such as an epitope tag, which consists of an amino acid sequence that allows affinity purification of the activated protein (e.g., on immunoaffinity or chelating matrices). The epitope tag becomes a part of the polypeptide allowing purification of the polypeptide from cellular and media proteins. The construct can further contain a protease recognition sequence to enable removal of the epitope tag from the polypeptide of interest. This can be accomplished by including a protease recognition sequence (e.g., enterokinase cleavage site, thrombin, prescission protease, and Factor XA) downstream from the nucleic acid sequence encoding the epitope tag on the construct. Incubation of the polypeptide with an appropriate protease will release the epitope tag from the polypeptide.
The term "affinity tag" is used herein to denote a polypeptide segment that can be attached to a second polypeptide to provide for purification or detection of the second polypeptide or provide sites for attachment of the second polypeptide to a substrate. In principal, any peptide or protein for which an antibody or other specific binding agent is available can be used as an affinity tag. Affinity tags include a poly-histidine tract, protein A (Nilsson et al, 1985, EMBO J. 4: 1075; Nilsson et al, 1991, Methods Enzymol. 198: 3), glutathione S transferase (Smith and Johnson, 1988, Gene 67: 31), Glu-Glu affinity tag (Grussenmeyer et al, 1985, Proc. Natl Acad. Sci. USA 82: 7952), substance P, FLAG peptide (Hopp et al, 1988, Biotechnology 6: 1204), streptavidin binding peptide, or other antigenic epitope or binding domain. See, in general, Ford et al, 1991, Protein Expression and Purification 2: 95. Nucleic acid molecules encoding affinity tags are available from commercial suppliers (e.g., Pharmacia Biotech, Piscataway, NJ).
The nucleic acid construct can further contain eukaryotic viral origins of replication useful for gene amplification. These origins can be present in place of, or in conjunction with, an amplifiable marker. The presence of the viral origin of replication allows the integrated vector and adjacent endogenous gene to be isolated as an episome and/or amplified to high copy number upon introduction of the appropriate viral replication protein. Examples of useful viral origins include, but are not limited to, adeno-associated virus ori, SV40 ori, and Epstein-Barr virus ori P.
The integration of a nucleic acid construct comprising a viral origin of replication can allow the amplification of the activated gene and the viral origin of replication in the cell by introducing the viral replication protein(s) in trans. For example, when ori P (the origin of replication on Epstein-Barr virus) is utilized, EBNA-I can be expressed transiently or stably. EBNA-1 will initiate replication bi-directionally from the integrated ori P locus. Each replication product created can initiate replication resulting . in many copies of the viral origin and flanking genomic sequences yielding a higher copy number of the gene and ultimately higher levels of the polypeptide are produced.
The nucleic acid construct can also contain genetic elements useful for the propagation of the construct in microorganisms. Examples of useful genetic elements include microbial origins of replication and selectable markers. An origin of replication enables a vector to replicate autonomously in the host cell in question. Examples of bacterial origins of replication are the origins of replication of pBR322, pUC19, pACYC177, and ρACYC184 permitting replication in E. coli, and pUBHO, ρE194, pTA1060, and pAMβl permitting replication in Bacillus. Examples of origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN6. The origin of replication can be one having a mutation which makes its functioning temperature-sensitive in the host cell (see, e.g., Ehrlich, 1978, Proc. Nat'lAcad. Sci. USA 75: 1433).
Examples of bacterial selectable markers are the dal genes from Bacillus subtilis or Bacillus licheniformis, or markers which confer antibiotic resistance such as ampicillin, kanamycin, chloramphenicol, tetracycline, or zeocin resistance. Suitable markers for yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3. Selectable markers for use in a filamentous fungal host cell include, but are not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetylfransferase), hph (hygromycin phosphoteansferase), niaD (nitrate reductase), pyrG
(orotidine-5' -phosphate decarboxylase), sC (sulfate adenylteansferase), and trpC
(anthranilate synthase), as well as equivalents thereof.
The regulatory sequence can also comprise scaffold-attachment regions or matrix attachment sites, negative regulatory elements, transcription factor binding sites, and locus control regions.
The linearized, nucleic acid construct can be introduced into a multiplicity of mammalian cells as a single nucleic acid construct or as separate constructs that are allowed to concatemerize. The construct is preferably a double-stranded DNA construct, but can also be single-stranded DNA, combinations of single- and double-stranded DNA, single-stranded RNA, double-stranded RNA, and combinations of single- and double- stranded RNA. Where single-stranded RNA is used, the single-stranded RNA is converted by reverse teanscriptase to cDNA, which is then converted to double-stranded DNA. The double-stranded DNA then integrates by restriction-enzyme mediated integration into the genome of the mammalian cell.
In the methods of the present invention, two or more constructs can be introduced into a mammalian cell or multiplicity of mammalian cells to activate or over-express a number of different genes. These constructs can be transfected separately into cells to produce libraries with different sets of activated genes. It will be understood in the methods of the present invention that the term
"nucleic acid construct" can be contained in a vector, plasmid, cosmid, PCR product, and the like, which is then linearized before restriction enzyme-mediated integration.
In the methods of the present invention, the linearized nucleic acid construct ranges between about 200 bp to about 30,000 bp, preferably between about 300 bp to about 20,000 bp, more preferably between about 400 bp to about 15,000 bp, and most preferably between about 500 bp to about 10,000 bp.
Transfection
The present invention also relates to methods for producing transfectants of mammalian cells, comprising introducing into a multiplicity of mammalian cells a restriction enzyme and a nucleic acid construct linearized with the same or a different restriction enzyme, wherein the linearized nucleic acid construct comprises a marker, and the linearized plasmid inserts into a site of the genome of one or more mammalian cells by integration at a transfection efficiency of at least 0.4%, preferably at least 0.8%, more preferably 1%, even more preferably at least 2%, and most preferably at least 3%; and
(b) selecting one or more mammalian transfectants expressing the selectable marker from the multiplicity of mammalian cells. The integration preferably occurs by restriction enzyme mediated integration.
The term "transfection" is defined herein as the introduction of a nucleic acid construct into a mammalian cell. The nucleic acid construct can be introduced into a mammalian cell by several methods known in the art which include, but are not limited to, electroporation, liposome-mediated introduction, calcium phosphate precipitation, DEAE dextran, lipofection, receptor mediated endocytosis, polybrene, particle bombardment, and microinjection. Alternatively, the construct can be introduced into the mammalian cell as a viral particle (either replication competent or deficient). Examples of such viruses include, but are not limited to, adenoviruses, adeno-associated viruses, Heφes viruses, retroviruses, and vaccinia viruses.
The term "transfection efficiency" is defined herein as the percentage of the number of transfectants obtained from the total number of cells transfected with DNA normalized by viability after transfection..
Prior to transfection of the mammalian cells, the nucleic acid construct is preferably linearized with one or more restriction enzymes before introduction into the cell, or the construct can be introduced into the cell with one or more restriction enzymes such that linearization occurs inside the cell. It is preferable that the construct is linearized before being introduced into the cell. The restriction enzyme(s) can be introduced into a mammalian cell before, during, or after introduction of the construct. Alternatively, naturally linear double stranded DNAs, such as synthetic DNA, or DNA which is a PCR product, may be utilized. The present method allows the generation of sufficient numbers of transfectants enabling creation of a library of a size that will cover the mammalian cellular genome. There has been no Ba/F3 library generated by DNA transfection, possibly due to the low transfection efficiency of the cell line. Prior to the present invention, the transfection efficiency of Ba/F3 cells was normally 5 to 10-fold lower than other cell lines making it difficult to generate a suitable number of transfectants.
Polypeptides
The polypeptide encoded by a gene that is activated or over-expressed by the methods of the present invention can be known or unknown and its function can be known or unknown. The term "polypeptide" is not meant herein to refer to a specific length of the encoded product and, therefore, encompasses peptides, oligopeptides, and proteins. The polypeptide 'can also be a truncated protein, wherein the nucleic acid activation construct can be inserted into introns or exons in the 5' region of an endogenous gene. The polypeptide can be an antigen, enzyme, growth factor, hormone, immunomodulator, neurotransmitter, receptor (intracellular or cell surface), reporter protein, structural protein, and transcription factor.
In a preferred embodiment, the polypeptide is an antigen. An "antigenic peptide" is a peptide which will bind a major histocompatibility complex molecule to form a complex of a major histocompatibility complex molecule and the peptide which is recognized by a T cell, thereby inducing a cytotoxic lymphocyte response upon presentation to the T cell. Thus, antigenic peptides are capable of binding to an appropriate major histocompatibility complex molecule and inducing a cytotoxic T cells response, such as cell lysis or specific cytokine release against the target cell which binds or expresses the antigen. The antigenic peptide can be bound in the context of a class I or class II major histocompatibility complex molecule, on an antigen presenting cell or on a target cell.
Examples of antigens include, but are not limited to, the CD antigens such as CD2, CD3, CD4, CD8, and CD34 antigens.
In another preferred embodiment, the polypeptide is an immunomodulator. As used herein, the term "immunomodulator" includes cytokines, stem cell growth factors, lymphotoxins, co-stimulatory molecules, hematopoietic factors, and synthetic analogs of these molecules. In a more preferred embodiment, the polypeptide is a cytokine. The biological responses of cytokines include, but are not limited to, proliferation, differentiation, growth inhibition, immune regulation, growth, wound healing, metabolic responses, chemotaxis, and innate immunity. Cytokmes are classified as 4α:-helix, /3-sheet, and ,β- cytokines. Examples of 4α-helix cytokines include, but are not limited to, interleukins (IL-2, IL-3, IL-4, IL-5, IL-7, IL-9, and IL-13), granulocyte macrophage colony stimulating factor (GM-CSF), macrophage colony stimulating factor (M-CSF), stem cell factor (SCF), insulin-like growth factor (IFNγ), interleukin 6 (IL-6), leukemic inhibitory factor (LIF), oncostatin (OSM), ciliary neurotrophic factor (CNTF), erythropoietin (EPO), and granulocyte colony stimulating factor (G-CSF). Examples of /3-sheet cytokines include, but are not limited to, transforming growth factor (TGF), platelet derived growth factors (PDGF-A and PDGF-B), vascular endothelial growth factor
(VEGF), nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophins (NT3 and NT4), tumor necrosis factor (TNFc and TNF 3), interleukins (IL- lc and IL-1/3), fibroblast growth factor (FGF), and keratinocyte growth factor (KGF). Examples of o;j3-cytokines include, but are not limited to, epidermal growth factor (EGF), transforming growth factor (TGFo.), insulin growth factors (IGF-1 and IGF-11), interleukin 8 (IL-8), monocyte chemoattractant proteins (MCP-1, MCP-2 and MCP-3), and macrophage inflammatory proteins (MIP-lo MIP-1 β, and MIP-2). In another preferred embodiment, the polypeptide is a hormone. Examples of hormones include, but are not limited to, bone growth factor-2, bone growth factor-7, steroid hormones, parathyroid hormone, follicle stimulating hormone, the interferons, parathyroid hormone, platelet derived growth factor, and tumor necrosis factor. In a more preferred embodiment, the hormone or growth factor is glucagon, growth hormone, gonadoteopin, hepatocyte growth factor, and insulin.
In another preferred embodiment, the polypeptide is a receptor. The term "receptor" denotes a cell-associated protein that binds to a bioactive molecule termed a "ligand." This interaction mediates the effect of the ligand on the cell. Receptors can be membrane bound, cytosolic or nuclear; monomeric (e.g., thyroid stimulating hormone receptor, beta-adrenergic receptor) or multimeric (e.g., PDGF receptor, growth hormone receptor, IL-3 receptor, GM-CSF receptor, G-CSF receptor, erythropoietin receptor and IL-6 receptor). Membrane-bound receptors are characterized by a multi-domain structure comprising an extracellular ligand-binding domain and an inteacellular effector domain that is typically involved in signal teansduction. In certain membrane-bound receptors, the exteacellular ligand-binding domain and the inteacellular effector domain are located in separate polypeptides that comprise the complete functional receptor. Other receptors include a cholesterol receptor, immunoglobulin receptor, and lipoprotein receptor (including LDLs and HDLs). The receptor may also be a chimeric receptor (see, for example, Sprecher et al, 1998, Biochemical and Biophysical Research communication 246: 82-90; Takaki et al, 1994, Molecular and Cellular Biology 14: 7404-7413; Sakamaki et al, 1993, Journal of Biological Chemistry 268: 15833-15839).
In general, the binding of ligand to a receptor results in a conformational change in the receptor that causes an interaction between the effector domain and other molecule(s) in the cell, which in turn leads to an alteration in the metabolism of the cell. Metabolic events that are often linked to receptor-ligand interactions include gene transcription, phosphorylation, dephosphorylation, increases in cyclic AMP production, mobilization of cellular calcium, mobilization of membrane lipids, cell adhesion, hydrolysis of inositol lipids, and hydrolysis of phospholipids.
In a preferred embodiment, the polypeptide is blood clotting factor V, blood clotting factor VII, blood clotting factor VIII, blood clotting factor IX, blood clotting factor X, chorionic complement inhibitors, cytoskeletal anchoring protein, integrins, insulinotropin, lactoferrin, neuroteopin-3, Protein C, protein kinase C, stem cell factor, tissue plasminogen activator, TGF-J3, TSH-P, thrombomodulin, and transmembrane ion channels.
Membrane-associated proteins such as receptors are particularly useful for developing drugs using combinatorial chemistry libraries and high through-put screening assays. Alternatively, the proteins or soluble forms of the proteins (e.g., truncated proteins lacking the transmembrane region) can be useful as therapeutically active agents in humans or animals. Identification of membrane proteins can also be used to identify new ligands (e.g., cytokines, growth factors, and other effector molecules) using, for example, affinity capture techniques.
In another preferred embodiment, the polypeptide is an oxidoreductase, transferase, hydrolase, lyase, isomerase, or ligase. In a more preferred embodiment, the polypeptide is an alpha-glucosidase, aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosylteansferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, glucocerebrosidase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phospholipase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, teansglutaminase, urokinase, or xylanase.
One of ordinary skill in the art will appreciate that other cellular proteins and receptors known in the art can also be produced by the methods of the present invention.
Screening and Isolation of Mutant Mammalian Cells
Ba/F3 cells are dependent on interleukin-3 (IL-3) for growth, such that proliferation in the absence of IL-3 can be used to select for novel genes. For example, a receptor for a novel cytokine can be isolated by selecting for transfectants in the absence of IL-3, but in the presence of a novel cytokine. Moreover, a ligand for a novel receptor can be isolated by engineering a Ba/F3 cell line over-expressing the novel receptor or a chimeric variant thereof and selecting transfectants in the absence of IL-3.
Presumptive mutants of factor-dependent cells such as Ba/F3 can be screened for activation or over-expression of a gene by several methods to enable identification of the desired mutant. A selectable marker based on biocide or viral resistance, resistance to heavy metals, prototeophy to auxoteophs, and the like, as described earlier, can be used to first eliminate those transfectants that do not contain the regulatory sequence.
Phenotypic selection for a trait provided by expression of the endogenous gene can also be used to screen for the desired mutant cell. Examples of selectable or screenable phenotypes include enzyme expression, cellular proliferation, growth factor independent growth, acquired factor-dependent growth, colony formation, cellular differentiation (e.g., differentiation into a neuronal cell, muscle cell, epithelial cell, etc.), anchorage independent growth, activation of cellular factors (e.g., kinases, transcription factors, nucleases, etc.), expression of cell surface receptors/proteins, gain or loss of cell- cell adhesion, migration, and cellular activation (e.g., resting versus activated T cells).
Isolation of mutant Ba/F3 cells demonstrating such a phenotype is important because the activation of an endogenous gene by the integrated construct is presumably responsible for the observed cellular phenotype. Thus, the activated gene can be an important therapeutic drug or drug target for treating or inducing the observed phenotype.
Another method for screening cells for expression of a gene is enzyme-linked immunoabsorbent assay (ELISA) according to established methods in the art. See, for example, E. Harlow and D. Lane, editors, 1988, Antibodies, A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, New York. If the polypeptide is secreted, culture supernatants from pools of transfectants are incubated in wells containing bound antibody specific for the polypeptide of interest. By screening pools of library clones (the pools can be from 1 to greater than 100,000 library members), pools containing a cell(s) that has activated the gene of interest can be identified. The cell of interest can then be purified away from the other library members by sib selection, limiting dilution, or other techniques known in the art. In addition to secreted proteins, ELISA can also be used to screen for cells expressing inteacellular and membrane-bound proteins. In these cases, instead of screening culture supernatants, a small number of cells is removed from the library pool (each cell is represented at least 100-1000 times in each pool), lysed, clarified, and added to the antibody-coated wells.
Another method for screening mutant mammalian involves fluorescence- activated cell sorter (FACS), which can be used to screen the random activation library in a number of ways. If the gene of interest encodes a cell surface protein, then fluorescently-labeled antibodies can be incubated with cells from the activation library. If the gene of interest encodes a secreted protein, then cells can be biotinylated and incubated with steeptavidin conjugated to an antibody specific to the protein of interest (Manz et αE 1995, Proc. Nat'l Acad. Sci. USA 92: 1921). Following incubation, the cells are placed in a high concentration of gelatin (or other polymer such as agarose or methylcellulose) to limit diffusion of the secreted protein. As protein is secreted by the cell, it is captured by the antibody bound to the cell surface. The presence of the protein of interest is then detected by a second antibody which is fluorescently labeled. For both secreted and membrane bound proteins, the cells can then be sorted according to their fluorescence signal. Fluorescent cells can then be isolated, expanded, and further enriched by FACS, limiting dilution, or other cell purification techniques known in the art.
Another method for screening mutant cells involves magnetic bead separation (Iinuma et al, 2000, International Journal of Cancer 89: 337-344). Such a method is useful for detecting membrane-bound proteins and captured secreted proteins. The method involves incubating an activation library with antibody-conjugated magnetic beads that are specific for a particular polypeptide or polypeptide family. If the polypeptide is present on the surface of a cell, the cell will bind to the magnetic beads separating the cell from other cells. The cell can then be isolated from the magnetic beads and the polypeptide and/or cell further characterized. A further method for screening mutant cells involves microdrop technology
(Weaver et al, 1991, Biotechnology 9: 873-877; Weaver et al, 1997, Nature Medicine 3: 583-584). Microdrop technology provides cell separation of rare and high producer cells based on quantitative determination of cell function (e.g., growth, lack of growth, drug susceptibility, secretion of proteins, specific enzyme activity, and production of small metabolites) and/or of cell composition (e.g., surface markers, internal proteins, nucleic acid sequences).
Other methods known in the art for screening and purification of a mutant mammalian cell include, but are not limited to, limiting dilution, sib selection, soft agar cloning, and single colony purification using cloning rings. The present invention also relates to mutant cells obtained by the methods of the present invention. The invention encompasses cells containing the vector constructs, cells in which the vector constructs have integrated, and cells which are over-expressing desired gene products from an endogenous gene, over-expression being driven by the introduced transcriptional regulatory sequence. A mutant cell made by the methods described above can over-express a single gene or more than one gene. More than one gene can be activated by the integration of a single construct or by the integration of multiple constructs in the same mutant cell (i.e., more than one type of construct). Therefore, a mutant cell can contain only one type of vector construct or different types of constructs, each capable of altering expression, by disruption or activating an endogenous gene.
Isolation of Gene
The present invention also relates to isolated genes obtained by the instant methods and to nucleic acid constructs, expression vectors, and host cells containing the isolated genes. The gene encoding a polypeptide identified by the methods of the present invention can be obtained from a cell using cloning methods well known in the art. For purposes of the present invention, the term "obtained from" as used herein in connection with a given source shall mean that the gene is present in the source. The gene can be isolated by employing methods for rescuing a locus containing the inserted nucleic acid construct from the identified mutant cell. The method requires isolating (i) the nucleic acid construct and (ii) the 3' and/or 5' flanking regions of the locus of the genome where the nucleic acid construct has been integrated; and identifying the 3' and/or 5' flanking regions of the locus. The nucleic acid construct and flanking regions can be isolated or rescued by methods well known in the art such as cleaving with restriction enzymes and subsequent ligation and transformation of E. coli, inverse PCR, random primed gene walking PCR, or probing a library of the tagged mutant.
The use of restriction enzyme mediated integration results on average in one to a few integrated copies of the nucleic acid construct in the mutant cell. This low copy number facilitates the rescue of the locus from the mutant cell.
The rescued construct and flanking region(s) can be used as is, i.e., a restriction enzyme cleaved linear nucleotide sequence, or can be circularized or inserted into a suitable expression vector for producing the polypeptide recombinantly in a host system as described herein. The isolation of a gene can be also accomplished by a cDNA or genomic library of the mutant mammalian cell using polynucleotide probes based upon partial amino acid sequences of the polypeptide encoded by the gene. These techniques are standard and well-established.
As an illustration, a nucleic acid molecule containing the gene can be isolated from a cell cDNA library. In this case, the first step would be to prepare the cDNA library by isolating RNA from the mutant cell, using methods well-known to those of skill in the art. In general, RNA isolation techniques must provide a method for breaking cells, a means of inliibiting RNase-directed degradation of RNA, and a method of separating RNA from DNA, protein, and polysaccharide contaminants. For example, total RNA can be isolated by homogenizing the cells in a denaturing solution, followed by sodium acetate, phenol, and finally chloroform/isoamyl alcohol treatment. The resulting mixture is centrifuged to separate RNA from DNA and proteins (see, for example, Ausubel et al. (eds.), 1995, Short Protocols in Molecular Biology, 3rd Edition, pages 4-1 to 4-2 (John Wiley & Sons); and Wu et al, 1997, Methods in Gene Biotechnology, pages 33-41 (CRC Press, Inc.).
Alternatively, total RNA can be isolated from the mutant cells with guanidinium isothiocyanate, extracting with organic solvents, and separating RNA from contaminants using differential centrifugation (see, for example, Chirgwin et al, 1979, Biochemistry 18: 52; Ausubel et al, 1995, supra, at pages 4-1 to 4-6; Wu et al, 1997. supra, at pages 33-41). Moreover, commercially available kits can be used to extract RNA from mammalian cell lines. For example, such a kit is available from QIAGEN, Valencia, CA.
In order to construct a cDNA library, poly(A)+ RNA is preferably isolated from a total RNA preparation. Poly(A)+ RNA can be isolated from total RNA using the standard technique of oligo(dT)-cellulose chromatography (see, for example, Aviv and Leder, 1972, Proc. Nat'lAcad. Sci. USA 59:1408; Ausubel et al, !995, supra at pages 4-11 to 4-12).
Double-stranded cDNA molecules are synthesized from poly(A) RNA using techniques well-known to those in the art. (see, for example, Wu, 1997. supra, at pages 41-46). Moreover, commercially available kits can be used to synthesize double- steanded cDNA molecules. For example, such kits are available from Life Technologies, Inc. (Gaithersburg, MD), Clontech Laboratories, Inc. (Palo Alto, CA), Promega Corporation (Madison, WI) and Steatagen (La Jolla, CA).
Various cloning vectors are appropriate for the construction of a cDNA library. For example, a cDNA library can be prepared in a vector derived from bacteriophage, such as a λgtlO vector. See, for example, Huynh et al., "Constructing and Screening cDNA Libraries in λgtlO and λgtl l," in DNA Cloning: A Practical Approach Vol. ΪI,
Glover (ed.), page 49 (IRL Press, 1985); Wu et al, 1997, supra, at pages 47-52.
Alternatively, double-stranded cDNA molecules can be inserted into a plasmid vector, such as a pBlueScript vector (Stratagene; La Jolla, CA), a LamdaGem-4 (Promega Corp.) or other commercially available vectors. Suitable cloning vectors also can be obtained from the American Type Culture Collection (Manassas, VA).
To amplify the cloned cDNA molecules, the cDNA library is inserted into a prokaryotic host, using standard techniques. For example, a cDNA library can be introduced into competent E. coli DH5α cells, which can be obtained, for example, from Life Technologies, Inc. (Gaithersburg, MD).
A library can also be prepared by other means well-known in the art (see, for example, Ausubel et al, 1995, supra, at pages 5-1 to 5-6; Wu et al, 1997, supra, at pages 307-327). Genomic DNA can be isolated by lysing cells with the detergent Sarkosyl, digesting the lysate with proteinase K, clearing insoluble debris from the lysate by centrifugation, precipitating nucleic acid from the lysate using isopropanol, and purifying resuspended DNA on a cesium chloride density gradient. There are also many commercial kits for recovering genomic DNA, for example, the Puregene system (Gentea Systems, Minneapolis, MN). DNA fragments that are suitable for the production of a genomic library can be obtained by the random shearing of genomic DNA or by the partial digestion of genomic DNA with restriction endonucleases. Genomic DNA fragments can be inserted into a vector, such as a bacteriophage or cosmid vector, in accordance with conventional techniques, such as the use of restriction enzyme digestion to provide appropriate termini, the use of alkaline phosphatase teeatment to avoid undesirable joining of DNA molecules, and ligation with appropriate ligases. Techniques for such manipulation are well-known in the art (see, for example, Ausubel et al, 1995, supra, at pages 5-1 to 5-6; Wu et al, 1997, supra, at pages 307-327).
Nucleic acid molecules containing the gene can also be obtained using the polymerase chain reaction (PCR) with oligonucleotide primers having nucleotide sequences that are based upon the nucleotide sequences of the gene. General methods for screening libraries with PCR are provided by, for example, Yu et al, 1993, "Use of the Polymerase Chain Reaction to Screen Phage Libraries," in Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods and Applications, White (ed.), pages 211-215 (Humana Press, Inc.), and Innis et al, 1990, PCR Protocols: A Guide to
Methods and Application, Academic Press, New York. Moreover, techniques for using
PCR to isolate related genes are described by, for example, Preston, 1993, "Use of
Degenerate Oligonucleotide Primers and the Polymerase Chain Reaction to Clone Gene
Family Members," in Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods and Applications, White (ed.), pages 317-337 (Humana Press, Inc.).
A library containing cDNA or genomic clones can be screened with one or more polynucleotide probes based upon partial amino acid sequences of the polypeptide encoded by the gene, using standard methods (see, for example, Ausubel et al, 1995, supra, at pages 6-1 to 6-11).
Anti-polypeptide antibodies, produced as described below, can also be used to isolate DNA sequences that encode the gene from cDNA libraries. For example, the antibodies can be used to screen λgtl 1 expression libraries, or the antibodies can be used for immunoscreening following hybrid selection and translation (see, for example, Ausubel et al, 1995, supra, at pages 6-12 to 6-16; Margolis et al, 1995, "Screening λ expression libraries with antibody and protein probes," in DNA Cloning 2: Expression Systems, 2nd Edition, Glover et al. (eds.), pages 1-14 (Oxford University Press)).
An alternative way to isolate a full-length gene is to synthesize a specified set of overlapping oligonucleotides (40 to 100 nucleotides). After the 3' and 5' extensions (6 to 10 nucleotides) are annealed, large gaps still remain, but the base-paired regions are both long enough and stable enough to hold the structure together. The duplex is completed and the gaps filled by enzymatic DNA synthesis with E. coli DNA polymerase I. This enzyme uses the 3 '-hydroxyl groups as replication initiation points and the single- stranded regions as templates. After the enzymatic synthesis is completed, the nicks are sealed with T4 DNA ligase. For larger genes, the complete gene sequence is usually assembled from double-steanded fragments that are each put together by joining four to six overlapping oligonucleotides (20 to 60 base pairs each). If there is a sufficient amount of the double-steanded fragments after each synthesis and annealing step, they are simply joined to one another. Otherwise, each fragment is cloned into a vector to amplify the amount of DNA available. In both cases, the double-steanded constructs are sequentially linked to one another to form the entire gene sequence. Each double- steanded fragment and the complete sequence should be characterized by DNA sequence analysis to verify that the chemically synthesized gene has the correct nucleotide sequence. For reviews on polynucleotide synthesis, see, for example, Glick and Pasternak, 1994, Molecular Biotechnology, Principles and Applications of Recombinant DNA (ASM Press); Itakura et al, 1984, Annu. Rev. Biochem. 53: 323; and Climie et al, 1990, Proc. Nat'lAcad. Sci. USA 87: 633.
Methods of Production of a Polypeptide The present invention also relates to methods for producing a polypeptide resulting from activation or over-expression of a gene in a cell or a recombinant host system.
The mutant cells can be cultivated using standard techniques for large-scale culture of mammalian cells. See, for example, Wu and Aunins, 1997, Current Opinion in Biotechnology 8: 148-153; Reiter and Bluml, 1994, Current Opinion in Biotechnology 5: 175-179; and Europa et al, 2000, Biotechnology and Bioengineering 67: 25-34. If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates. Scale-up of mammalian cells for growth in roller bottles involves increase in the surface area on which cells can attach. Microcarrier beads are, therefore, often added to increase the surface area for commercial growth. Scale-up of cells in spinner culture can involve large increases in volume. Five liters or greater can be required for both microcarrier and spinner growth. Depending on the inherent potency (specific activity) of the protein of interest, the volume can be as low as 1 - 10 liters; 10- 15 liters is more common. However, up to 50-100 liters can be necessary and volume can be as high as 10,000-15,000 liters. In some cases, higher volumes can be required. Cells can also be grown in large numbers of T flasks, for example 50-100.
The polypeptides, including full-length polypeptides, functional fragments, and fusion proteins, can also be produced in recombinant host cells following conventional techniques. To express a gene, a nucleic acid molecule encoding the polypeptide must be operably linked to regulatory sequences that control transcriptional expression in an expression vector and then, introduced into a host cell. In addition to transcriptional regulatory sequences, such as promoters and enhancers, expression vectors can include teanslational regulatory sequences and a marker gene which is suitable for selection of cells that carry the expression vector.
Expression vectors that are suitable for production of a foreign polypeptide in eukaryotic cells typically contain (1) prokaryotic DNA elements coding for a bacterial replication origin and an antibiotic resistance marker to provide for the growth and selection of the expression vector in a bacterial host; (2) eukaryotic DNA elements that control initiation of transcription, such as a promoter; and (3) DNA elements that control the processing of transcripts, such as a transcription termination/polyadenylation sequence. As discussed below, expression vectors can also include nucleotide sequences encoding a secretory sequence that directs the heterologous polypeptide into the secretory pathway of a host cell. For example, an expression vector can comprise a gene and a secretory sequence derived from a gene identified in the present invention or another secreted gene.
Polypeptides identified by the methods of the present invention can be expressed in mammalian cells. Examples of suitable mammalian host cells include African green monkey kidney cells (Vero; ATCC CRL 1587), human embryonic kidney cells (293- HEK; ATCC CRL 1573), baby hamster kidney cells (BHK-21, BHK-570; ATCC CRL 8544, ATCC CRL 10314), canine kidney cells (MDCK; ATCC CCL 34), Chinese hamster ovary cells (CHO-K1; ATCC CCL61), rat pituitary cells (GH1; ATCC CCL82), HeLa S3 cells (ATCC CCL2.2), rat hepatoma cells (H-4-II-E; ATCC CRL 1548) SV40- teansformed monkey kidney cells (COS-1; ATCC CRL 1650) and murine embryonic cells (NIH-3T3; ATCC CRL 1658).
For a mammalian host, the transcriptional and teanslational regulatory signals can be derived from viral sources, such as adenovirus, bovine papilloma virus, simian virus, or the like, in which the regulatory signals are associated with a particular gene which has a high level of expression. Suitable transcriptional and teanslational regulatory sequences also can be obtained from mammalian genes, such as actin, collagen, myosin, and metallothionein genes.
Transcriptional regulatory sequences include a promoter region sufficient to direct the initiation of RNA synthesis. Suitable eukaryotic promoters include the promoter of the mouse metallothionein I gene (Hamer et al, 1982, J. Molec. Appl. Genet. 1: 273), TK promoter oϊ Herpes virus (McKnight, 1982, Cell 31: 355), SV40 early promoter (Benoist et al, 1981, Nature 290: 304), Rous sarcoma virus promoter (Gorman et al, 1982, Proc. Nat'l Acad. Sci. USA 79: 6777), cytomegalovirus promoter (Foecking et al, 1980, Gene 45: 101), and mouse mammary tumor virus promoter (see, generally, Etcheverry, 1996, "Expression of Engineered Proteins in Mammalian Cell Culture," in Protein Engineering: Principles and Practice, Cleland et al. (eds.), pages 163-181, John Wiley & Sons, Inc.).
Alternatively, a prokaryotic promoter, such as the bacteriophage T3 RNA polymerase promoter, can be used to conteol gene expression in mammalian cells if the prokaryotic promoter is regulated by a eukaryotic promoter (Zhou et al, 1990, Moi Cell
Biol. 10: 4529, and Kaufinan et al, 1991, Nucl. Acids Res. 19: 4485).
An expression vector can be introduced into host cells using a variety of standard techniques including calcium phosphate transfection, liposome-mediated transfection, microprojectile-mediated delivery, electroporation, and the like. Preferably, the transfected cells are selected and propagated to provide recombinant host cells that comprise the expression vector stably integrated in the host cell genome. Techniques for introducing vectors into eukaryotic cells and techniques for selecting such stable teansformants using a dominant selectable marker are described, for example, by Ausubel et al, 1995, supra, and by Murray (ed.), 1991, Gene Transfer and Expression Protocols, Humana Press.
For example, one suitable selectable marker is a gene that provides resistance to the antibiotic neomycin. In this case, selection is carried out in the presence of a neomycin-type drug, such as G-418 or the like. Selection systems can also be used to increase the expression level of the gene of interest, a process referred to as "amplification." Amplification is carried out by culturing transfectants in the presence of a low level of the selective agent and then increasing the amount of selective agent to select for cells that produce high levels of the products of the introduced genes. A preferred amplifiable selectable marker is dihydrofolate reductase, which confers resistance to methoteexate. Other drug resistance genes (e.g., hygromycin resistance, multi-drug resistance, puromycin acetylteansferase) can also be used. Alternatively, markers that introduce an altered phenotype, such as green fluorescent protein, or cell surface proteins (e.g., CD4, CD8, Class I MHC, and placental alkaline phosphatase) can be used to sort transfected cells from unteansfected cells by such means as FACS sorting or magnetic bead separation technology.
A polypeptide encoded by an isolated gene can also be produced by cultured cells using a viral delivery system. Exemplary viruses for this purpose include adenovirus, herpesvirus, vaccinia virus and adeno-associated virus (AAV). Adenovirus, a double- steanded DNA virus, is currently the best studied gene transfer vector for delivery of heterologous nucleic acid (for a review, see Becker et al, 1994, Meth. Cell Biol. 43: 161, and Douglas and Curiel, 1997, Science & Medicine 4: 44). Advantages of the adenovirus system include the accommodation of relatively large DNA inserts, the ability to grow to high-titer, the ability to infect a broad range of mammalian cell types, and flexibility that allows use with a large number of available vectors containing different promoters. By deleting portions of the adenovirus genome, larger inserts (up to 7 kb) of heterologous DNA can be accommodated. These inserts can be incorporated into the viral DNA by direct ligation or by homologous recombination with a co-teansfected plasmid. An option is to delete the essential El gene from the viral vector, which results in the inability to replicate unless the El gene is provided by the host cell. For example, adenovirus vector infected human 293 cells (ATCC Nos. CRL-1573, 45504, 45505) can be grown as adherent cells or in suspension culture at relatively high cell density to produce significant amounts of protein (see Gamier etal, 1994, Cytotechnol 15: 145).
Genes identified by the methods of the present invention can also be expressed in other higher eukaryotic cells, such as avian, fungal, insect, yeast, or plant cells. The baculovirus system provides an efficient means to introduce cloned genes into insect cells. Suitable expression vectors are based upon the Autographa californica multiple nuclear polyhedrosis virus (AcMNPV), and contain well-known promoters such as Drosophila heat shock protein (hsp 70 promoter), Autographa californica nuclear polyhedrosis virus immediate-early gene promoter (ie-1) and the delayed early 39K promoter, baculovirus plO promoter, and the Drosophila metallothionein promoter. A second method of making a recombinant baculovirus system utilizes a teansposon-based system described by Luckow (Luckow, et al, 1993, J. Virol. 67:4566). This system, which utilizes teansfer vectors, is sold in the BAC-to-BAC kit (Life Technologies, Rockville, MD). This system utilizes a teansfer vector, pFASTBAC (Life Technologies) containing a Tn7 teansposon to move the DNA encoding the polypeptide into a baculovirus genome maintained in E. coli as a large plasmid called a "bacmid." See, Hill-Perkins and Possee, 1990, J. Gen. Virol. 71: 971, Bonning, et al, 1994, J. Gen. Virol. 75: 1551, and Chazenbalk, and Rapoport, 1995, J. Biol. Chem. 270: 1543. In addition, transfer vectors can include an in-frame fusion with DNA encoding an epitope tag at the C- or N-terminus of the expressed polypeptide, for example, a Glu-Glu epitope tag (Grussenmeyer et al, 1985, Proc. Nat'l Acad. Sci. USA 82: 7952). Using a technique known in the art, a teansfer vector containing the gene of interest is transformed into E. coli, and screened for bacmids which contain an interrupted lacZ gene indicative of recombinant baculovirus. The bacmid DNA containing the recombinant baculovirus genome is then isolated using common techniques.
The recombinant virus or bacmid is used to teansfect host cells. Suitable insect host cells include cell lines derived from IPLB-S -21, a Spodoptera frugiperda pupal ovarian cell line, such as Sβ (ATCC CRL 1711), S/21AΕ, and ^21 (Invitrogen Coφoration; San Diego, CA), as well as Drosophila Schneider-2 cells, and the HIGH
FIVEO cell line (Invitrogen) derived from Trichoplusia ni (U.S. Patent No. 5,300,435).
Commercially available serum-free media can be used to grow and to maintain the cells.
Suitable media are Sf900 IFM (Life Technologies) or ESF 921™ (Expression Systems) for the Sf9 cells; and Ex-cellO405™ (JRH Biosciences, Lenexa, KS) or Express FiveO™ (Life Technologies) for the T. ni cells. When recombinant virus is used, the cells are typically grown up from an inoculation density of approximately 2-5 x 105 cells to a density of 1-2 x 106 cells at which time a recombinant viral stock is added at a multiplicity of infection (MOI) of 0.1 to 10, more typically near 3. Established techniques for producing recombinant proteins in baculovirus systems are provided by Bailey et al, 1991, "Manipulation of Baculovirus Vectors," in Methods in Molecular Biology, Volume 7: Gene Transfer and Expression Protocols, Murray (ed.), pages 147-168 (The Humana Press, Inc.), Patel et al, 1995, "The baculovirus expression system," in DNA Cloning 2: Expression Systems, 2nd Edition, Glover et al. (eds.), pages 205-244 (Oxford University Press), Ausubel et al, 1995. supra, at pages 16-37 to 16-57; Richardson (ed.), 1995, Baculovirus Expression Protocols (The Humana Press, Inc.), and Lucknow, 1996, "Insect Cell Expression Technology," in Protein Engineering: Principles and Practice, Cleland et al (eds.), pages 183-218 (John Wiley & Sons, Inc.). Fungal cells, including yeast cells, can also be used to express genes isolated by the methods of the present invention. Yeast species of particular interest in this regard include Saccharomyces cerevisiae, Pichia pastoris, and Pichia methanolica. Suitable promoters for expression in yeast include, but are not limited to, promoters from GAL1 (galactose kinase), PGK (phosphoglycerate kinase), ADH (alcohol dehydrogenase), AOXl (alcohol oxidase), and H!S4 (histidinol dehydrogenase) genes. Many yeast cloning vectors have been designed and are readily available. These vectors include YIp- based vectors, such as YIp5, YRp vectors, such as YRpl7, YEp vectors such as YEpl3 and YCp vectors, such as YCpl9. Methods for transforming S. cerevisiae cells with exogenous DNA and producing recombinant polypeptides therefrom are disclosed by, for example,, Kawasaki, U.S. Patent No. 4,599,311; Kawasaki et al, U.S. Patent No. 4,931,373; Brake, U.S. Patent No. 4,870,008; Welch et al, U.S. Patent No. 5,037,743; and Murray et al, U.S. Patent No. 4,845,075. Transformed cells are selected by phenotype determined by the selectable marker, commonly drug resistance or the ability to grow in the absence of a particular nutrient (e.g., leucine). A preferred vector system for use in Saccharomyces cerevisiae is the POTl vector system disclosed by Kawasaki et al. (U.S. Patent No. 4,931,373), which allows transformed cells to be selected by growth in glucose-containing media. Additional suitable promoters and terminators for use in yeast include those from glycolytic enzyme genes (see, e.g., Kawasaki, U.S. Patent No.
4,599,311; Kingsman et al, U.S. Patent No. 4,615,974; and Bitter, U.S. Patent No. 4,977,092), and alcohol dehydrogenase genes. See also U.S. Patents Nos. 4,990,446, 5,063,154, 5,139,936, and 4,661,454.
Transformation systems for other yeasts, including Hansenula polymorpha, Schizosaccharomyces pombe, Kluyveromyces lactis, Kluyveromyces fragilis, Ustilago candis, Pichia pastoris, Pichia methanolica, Pichia guillermondii and Candida maltosa are known in the art. See, for example, Gleeson et al, J. Gen. Microbiol 132:3459 (1986), and Cregg, U.S. Patent No. 4,882,279. Aspergillus cells can be utilized according to the methods of McKnight et al, U.S. Patent No. 4,935,349. Methods for transforming Acremonium chrysogenum are disclosed by Sumino et al, U.S. Patent No. 5,162,228. Methods for transforming Neurospora are disclosed by Lambowitz, U.S. Patent No. 4,486,533. Fusarium venenatum can also be used according to U.S. Patent No. 6,066,493.
For example, the use of Pichia methanolica as host for the production of recombinant proteins is disclosed by Raymond, U.S. Patent No. 5,716,808, Raymond, U.S. Patent No. 5,736,383, Raymond et al, 1998, Yeast 14: 11-23, and in international publication Nos. WO 97/17450, WO 97/17451, WO 98/02536, and WO 98/02565. DNA molecules for use in transforming P. methanolica will commonly be prepared as double- steanded, circular plasmids, which are preferably linearized prior to transformation. For polypeptide production in P. methanolica, it is preferred that the promoter and terminator in the plasmid be that of a P. methanolica gene, such as a P. methanolica alcohol utilization gene (AUGl or AUG2). Other useful promoters include those of the dihydroxyacetone synthase (DHAS), formate dehydrogenase (FMD), and catalase (CAT) genes. To facilitate integration of the DNA into the host chromosome, it is preferred to have the entire expression segment of the plasmid flanked at both ends by host DNA sequences. A preferred selectable marker for use in Pichia methanolica is a P. methanolica ADE2 gene, which encodes phosphoribosyl-5-aminoimidazole carboxylase (AIRC; EC 4.1.1.21), and which allows ade2 host cells to grow in the absence of adenine. For large-scale, industrial processes where it is desirable to minimize the use of methanol, it is preferred to use host cells in which both methanol utilization genes (AUGl and AUGl) are deleted. For production of secreted proteins, host cells deficient in vacuolar protease genes (PEP4 and PRB1) are preferred.
Εlecteoporation is used to facilitate the introduction of a plasmid containing DNA encoding a polypeptide of interest into E. methanolica cells. E. methanolica cells can be transformed by electeoporation using an exponentially decaying, pulsed electric field having a field strength of from 2.5 to 4.5 kV/cm, preferably about 3.75 kV/cm, and a time constant (t) of from 1 to 40 milliseconds, most preferably about 20 milliseconds.
Expression vectors can also be introduced into plant protoplasts, intact plant tissues, or isolated plant cells. Methods for introducing expression vectors into plant tissue include the direct infection or co-cultivation of plant tissue with Agrobacterium tumefaciens, microprojectile-mediated delivery, DNA injection, electeoporation, and the like. See, for example, Horsch et al, Science 227:1229 (1985), Klein et al, Biotechnology 70:268 (1992), and Miki et al, "Procedures for Introducing Foreign DNA into Plants," in Methods in Plant Molecular Biology and Biotechnology, Glick et al. (eds.), pages 67-88 (CRC Press, 1993). Alternatively, genes can be expressed in prokaryotic host cells. Suitable promoters that can be used to express polypeptides in a prokaryotic host are well-known to those of skill in the art and include promoters capable of recognizing the T4, T3, Sp6 and T7 polymerases, the P and PL promoters of bacteriophage lambda, the trp, recA, heat shock, lacUVS, tac, Ipp-lacSpr, phoA, and lacZ promoters of E. coli, promoters of B. subtilis, the promoters of the bacteriophages of Bacillus, Streptomyces promoters, the int promoter of bacteriophage lambda, the bla promoter of pBR322, and the CAT promoter of the chlorampheηicol acetyl transferase gene. Prokaryotic promoters have been reviewed by Glick, 1987, J. ϊnd. Microbiol 1: 277, Watson et al, Molecular Biology of the Gene, 4th Ed. (Benjamin Cummins 1987), and by Ausubel et al, 1995, supra. Preferred prokaryotic hosts include E. coli and Bacillus subtilus. Suitable strains of E. coli include BL21(DE3), BL21(DE3) pLysS, BL21(DE3) pLysE, DH1, DH4I, DH5, DH5I, DH5IF', DH5IMCR, DH10B, DH10B/p3, DH11S, C600, HB101, JM101, JM105, JM109, JM110, K38, RR1, Y1088, Y1089, CSH18, ER1451, and ER1647 (see, for example, Brown (ed.), 1991, Molecular Biology Labfax, Academic Press). Suitable strains of Bacillus subtilus include BR151, YB886, Mil 19, MI 120, and B170 (see, for example, Hardy, 1985, "Bacillus Cloning Methods," in DNA Cloning: A Practical Approach, Glover (ed.), IRL Press).
When expressing a polypeptide in bacteria such as E. coli, the polypeptide can be retained in the cytoplasm, typically as insoluble granules, or can be directed to the periplasmic space by a bacterial secretion sequence. In the former case, the cells are lysed, and the granules are recovered and denatured using, for example, guanidine isothiocyanate or urea. The denatured polypeptide can then be refolded and dimerized by diluting the denaturant, such as by dialysis against a solution of urea and a combination of reduced and oxidized glutathione, followed by dialysis against a buffered saline solution. In the latter case, the polypeptide can be recovered from the periplasmic space in a soluble and functional form by disrupting the cells (by, for example, sonication or osmotic shock) to release the contents of the periplasmic space and recovering the protein, thereby obviating the need for denaturation and refolding. Methods for expressing proteins in prokaryotic hosts are well-known to those of skill in the art (see, for example, Williams et al, "Expression of foreign proteins in E. coli using plasmid vectors and purification of specific polyclonal antibodies," in DNA Cloning 2: Expression Systems, 2nd Edition, Glover et al. (eds.), page 15 (Oxford University Press, 1995), Ward et al, "Genetic Manipulation and Expression of Antibodies," in Monoclonal Antibodies: Principles and Applications, page 137 (Wiley- Liss, Inc. 1995), and Georgiou, "Expression of Proteins in Bacteria," in Protein Engineering: Principles and Practice, Cleland et al (eds.), page 101 (John Wiley & Sons, Inc. 1996)).
Standard methods for introducing expression vectors into bacterial, yeast, insect, and plant cells are provided, for example, by Ausubel, 1995, supra.
General methods for expressing and recovering foreign protein produced by a mammalian cell system are provided by, for example, Etcheverry, 1996, "Expression of Engineered Proteins in Mammalian Cell Culture," in Protein Engineering: Principles and Practice, Cleland et al. (eds.), pages 163 (Wiley-Liss, Inc.). Standard techniques for recovering protein produced by a bacterial system is provided by, for example, Grisshammer et al, 1995, "Purification of over-produced proteins from E. coli cells," in DNA Cloning 2: Expression Systems, 2nd Edition, Glover et al (eds.), pages 59-92 (Oxford University Press). Established methods for isolating recombinant proteins from a baculovirus system are described by Richardson (ed.), 1995, Baculovirus Expression Protocols (The Humana Press, Inc.). A method for isolating recombinant proteins from a filamentous fungi system are also, know, with one such method as described in United States Patent Number 5,679,543.
Another commercial growth condition, especially when the ultimate product is used clinically, is cell growth in serum-free medium, by which is intended medium containing no serum or not in amounts that are required for cell growth. This obviously avoids the undesired co-purification of toxic contaminants (e.g., viruses) or other types of contaminants, for example, proteins that would complicate purification. Serum-free media for growth of cells, commercial sources for such media, and methods for cultivation of cells in serum-free media, are well-known to those of ordinary skill in the art.
Purification of Isolated Polypeptides
A polypeptide obtained by the methods of the present invention can be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electeophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or exteaction (see, e.g., Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989). It is preferred to purify the polypeptide to at least about 80% purity, more preferably to at least about 90% purity, even more preferably to at least about 95% purity, or even greater than 95% purity with respect to contaminating macromolecules, particularly other proteins and nucleic acids, and free of infectious and pyrogenic agents. The polypeptide can also be purified to a pharmaceutically pure state, which is greater than 99.9% pure. Preferably, a purified polypeptide is substantially free of other polypeptides, particularly other polypeptides of animal origin.
Fractionation and/or conventional purification methods can be used to obtain preparations of polypeptide purified from a cell or mutant thereof and a recombinant polypeptide and fusion polypeptide purified from recombinant host cells. In general, ammonium sulfate precipitation and acid or chaoteope exteaction can be used for fractionation of samples. Exemplary purification steps can include hydroxyapatite, size exclusion, FPLC and reverse-phase high performance liquid chromatography. Suitable chromatographic media include derivatized dexteans, agarose, cellulose, polyacrylamide, specialty silicas, and the like. PEI, DEAE, QAE and Q derivatives are preferred. Exemplary chromatographic media include those media derivatized with phenyl, butyl, or octyl groups, such as Phenyl-Sepharose FF (Pharmacia), Toyopearl butyl 650 (Toso Haas, Montgomeryville, PA), Octyl-Sepharose (Pharmacia) and the like; or polyacrylic resins, such as Amberchrom CG 71 (Toso Haas) and the like. Suitable solid supports include glass beads, silica-based resins, cellulosic resins, agarose beads, cross-linked agarose beads, polystyrene beads, cross-linked polyacrylamide resins and the like that are insoluble under the conditions in which they are to be used. These supports can be modified with reactive groups that allow attachment of proteins by amino groups, carboxyl groups, sulfhydryl groups, hydroxyl groups and/or carbohydrate moieties.
Examples of coupling chemistries include cyanogen bromide activation, N- hydroxysuccinimide activation, epoxide activation, sulfhydryl activation, hydrazide activation, and carboxyl and amino derivatives for carbodiimide coupling chemistries. These and other solid media are well known and widely used in the art, and are available from commercial suppliers. Selection of a particular method for polypeptide isolation and purification is a matter of routine design and is determined in part by the properties of the chosen support. See, for example, Affinity Chromatography: Principles & Methods (Pharmacia LKB Biotechnology 1988), and Doonan, Protein Purification Protocols (The Humana Press 1996).
Additional variations in isolation and purification of a polypeptide can be devised by those skilled in the art. For example, anti-polypeptide antibodies, obtained as described below, can be used to isolate large quantities of protein by immunoaffinity purification. Moreover, methods for binding ligands to receptor polypeptides bound to support media are well known in the art.
A polypeptide can also be isolated by exploitation of particular properties. For example, immobilized metal ion adsoφtion (IMAC) chromatography can be used to purify histidine-rich proteins, including those comprising polyhistidine tags. Briefly, a gel is first charged with divalent metal ions to form a chelate (Sulkowski, 1985, Trends in Biochem. 3: 1). Histidine-rich proteins will be adsorbed to this matrix with differing affinities, depending upon the metal ion used, and will be eluted by competitive elution, lowering the pH, or use of steong chelating agents. Other methods of purification include purification of glycosylated proteins by lectin affinity chromatography and ion exchange chromatography (M. Deutscher, (ed.), 1990, Meth. Enzymol 182: 529). Within additional embodiments of the invention, a fusion of the polypeptide of interest and an affinity tag (e.g., maltose-binding protein, histidine-tagged protein, an immunoglobulin domain) can be constructed to facilitate purification.
Isolation of Genes Encoding Growth Factors or Growth Factor Receptors Based on
Growth Factor-Dependent Selection
The present invention further relates to methods for isolating a gene, comprising: (a) introducing into a multiplicity of growth factor-dependent mammalian cells a restriction enzyme and a nucleic acid construct linearized with the same or a different restriction enzyme, wherein the linearized nucleic acid construct comprises a regulatory sequence and the linearized construct inserts by integration into the genome of one or more of the mammalian cells; (b) identifying from the multiplicity of mammalian cells in step (a) a mutant cell expressing a gene encoding a growth factor or growth factor receptor, wherein the expression of the gene results from the integration of the introduced linearized nucleic acid construct such that the regulatory sequence upon integration into the cell's genome promotes the expression of the gene encoding the growth factor or the growth factor receptor; and (c) isolating the gene from the mutant cell identified in step (b).
In such methods of the present invention, selection is by phenotypic selection with a cultured parent mammalian cell that is dependent on an exogenous growth factor, or an engineered variant of such cell expressing a novel receptor or chimeric receptor such as those defined herein, for its proliferation. Such phenotypic selection begins with a cultured parent mammalian cell that is dependent on an exogenous growth factor for its proliferation. Such cultured mammalian cells include, but are not limited to, Ba/F3, DAI (mouse IL-3 -dependent), FDC-pl (mouse IL-3 -dependent), TF-1 (human IL-2- dependent), M-07e (human IL-3-dependent), A375 (human IL-1 -dependent), 3TP1 (mouse IL-3 or TPO-dependent), Pre-B (mouse IL-7-dependent), 32D (mouse), CCL-185 (human IL-4-dependent), WEHI164 (human TNF-α-dependent), 2D9+EMCF (human IFN-α-dependent), Daudi (human IFN-Q!-dependent), COLO205 (human IFN-δ- dependent), B9 (mouse IL-6-dependent), KIT-225 (mouse IL-7-dependent), B9-11 (mouse IL-11 -dependent), GNFS-60 (mouse G-CSF-dependent), MNFS-60 (mouse M- CSF-dependent), BAF-LRgpCR (mouse CNTF-dependent), DA- la (mouse LIF- dependent), and CTLL-2 (mouse IL-2-dependent) cells.
The growth factor or receptor may be any of the factors or receptors thereof mentioned herein.
As noted above, the cell is one in which growth is dependent upon an exogenous growth factor. As used herein, the term "growth factor" denotes a polypeptide that stimulates proliferation of a cell, the activity of which is mediated by a cell-surface receptor. Examples of growth factors include the interleukins and colony stimulating factors. Growth factor-dependent myeloid and lymphoid progenitor cells are preferred. These are cells that give rise to differentiated blood cells and that are found in hematopoietic tissue such as bone marrow, spleen and fetal liver. Myeloid and lymphoid precursors are also found in peripheral blood after treatment of an animal with cytokines.
Preferred growth factor-dependent cell lines that can be transfected to express oφhan receptors or oφhan ligands include Ba/F3 (Palacios and Steinmetz, 1985, Cell 41: 727-
734; Mathey-Prevot et al, 1986, Moi Cell Biol. 6: 4133-4135), FDC-P1 (Hapel et al, 1984, Blood 64: 786-790), and M-07e (Kiss et al, 1993, Leukemia 1: 235-240). Additional growth factor-dependent cell lines are known and available in the art and are disclosed by, for example, Greenberger et al, 1983, Proc. Nail. Acad. Sci. USA 80:2931- 2935; Dexter et al, 1980, J. Exp. Med. 152:1036-1047; and Greenberger et al, Virology 105:425-435. In addition, growth factor-dependent cell lines can be established according to published methods (e.g. Greenberger et al, 1984, Leukemia Res. 8: 363- 375; Dexter et al., 1980, in Baum et al, Eds., Experimental Hematology Today, 8th Ann. Mtg. Int. Soc. Exp. Hematol. 1979, 145-156).
In a typical procedure, cells are removed from the tissue of interest (e.g., bone marrow, spleen, fetal liver) and cultured in a conventional, serum-supplemented medium, such as RPMI 1640 supplemented with 10% fetal bovine serum (FBS), 15% horse serum and 10"6 M hydrocortisone. At one- to two-week intervals non-adherent cells are harvested, and the cultures are fed fresh medium. The harvested, non-adherent cells are washed and cultured in medium with an added source of growth factor (e.g., RPMI 1640 + 10% FBS + 5-20% WEHI-3 conditioned medium as a source of IL-3). These cells are fed fresh medium at one- to two-week intervals and expanded as the culture grows. After several weeks to several months, individual clones are isolated by plating the cells onto semi-solid medium (e.g., medium containing methylcellulose) or by limiting dilution. Factor dependence of the clones is confirmed by culturing individual clones in the absence of the growth factor. Reteoviral infection or chemical mutagenesis can be used to obtain a higher frequency of growth factor-dependent cells.
The present invention also relates to isolated genes obtained by such methods. The present invention also relates to methods for expressing such an endogenous gene in a growth factor-dependent mammalian cell by integration of a regulatory sequence such that expression of the gene is activated or increased, according to the procedures described herein.
The present invention also relates to methods of obtaining mutant growth factor- dependent mammalian cells having activated or increased expression of an endogenous gene, and to mutant growth factor-dependent mammalian cells obtained by such methods, according to the procedures described herein.
The present invention is further described by the following examples which should not be construed as limiting the scope of the invention. Examples
Example 1 : Restriction enzyme mediated integration transfection
The effect of restriction enzyme mediated integration in stimulating Ba/F3 cell transfection efficiency was determined using linearized plasmid pcDNA3.1(+). Plasmid pcDNA3.1(+), which contains the cytomegalovirus (CMV) enhancer promoter, was obtained from Invitrogen (Carlsbad, CA). Plasmid pcDNA3.1(+) was isolated from E. coli JLin0605 (E. coli strain DH5o; containing plasmid pcDNA3.1(+)) by using the QIAGEN Plasmid Mega Kit (QIAGEN, Valencia, CA) according to the manufacturer's instructions. Plasmid DNA was then digested with an excess of BamH! or EcoRV enzyme, the recognition sites for which are located immediately downstream of the CMV promoter. After digestion, BamH! was removed by Micropure-ΕZ Enzyme Removers columns (Amicon, Beverly, MA) whereas EcoRV was inactivated at 80°C for 20 minutes. The linearized DNA was stored at -20 °C prior to use in transfection. Murine Ba/F3 cells are an interleukin-3 (IL-3)-dependent, murine lymphoid precursor cell line (Palacios et al, 1984, Nature 309: 126-131; Palacios and Steinmetz, 1985, Cell 41: 727-734). Ba/F3 cells were subcultured the day before electeoporation so that they were in the exponential phase when used for electeoporation. The cells were cultured in RPMI 1640 (GIBCO-BRL, Gaithersburg, MD) containing 10% fetal bovine serum (HyClone, Logan, UT), 1 mM sodium pyruvate, 10 mM HΕPΕS buffer, 2 mM L- glutamine, and 2 ng/ml recombinant mouse interleukin-3 (IL-3) (R&D Systems, Minneapolis, MN). Geneticin, also known as G-418 sulfate, (GIBCO-BRL, Gaithersburg, MD) was used at 500 μg/ml in selective medium. Cells were grown at 37°C with 5% C02. The Ba/F3 cells were washed twice and resuspended in 1 ml of cold RPMI 1640 medium prior to addition of indicated amounts of linearized pcDNA3.1(+). The cell/DNA mixture was incubated on ice for 5 minutes. For the "restriction enzyme mediated integration" samples, the restriction enzyme was added immediately prior to electeoporation. The cell/DNA mixture was subjected to two sequential electric shocks at room temperature, 800 μF, 300 V once, followed by 1180 μF, 300 V once, using a Cell Porator electeoporator (GIBCO-BRL, Gaithersburg, MD) according to the manufacturer's instructions. After electeoporation, the cuvettes were incubated for 3 minutes at room temperature followed by 7 minutes on ice before plating. The transfection mixtures were resuspended in non-selective medium at a concentration of
105 to 6xl05 cells/ml. After overnight incubation at 37°C with 5% C02, cells were collected by centrifugation and cell numbers were determined. Cell plating efficiency was determined by plating on average 0.1 cell/well in 96-well plates containing non- selective medium. The number of neomycin-resistant transfectants was determined by plating on average 200, 50, and 10 cells/well in 96-well plates containing selective medium. Growing cell clones were enumerated 11 days after plating. Transfection efficiency was determined using the following formula:
% transfection efficiency = % neomycin-resistant colonies/% plating efficiency
Plasmid pcDNA3.1(+) was linearized with BamH! and transfected into Ba/F3 cells either in the absence or presence of BamH!. BHK570 cells were run as a conteol. The results as shown in Table 1 demonstrated that transfection efficiency of Ba/F3 cells in the absence of the restriction enzyme was 6-fold less than that of BHK570 cells. The results also showed that restriction enzyme mediated integration increased Ba/F3 teansfection efficiency by about 2.5-fold, which was the same degree of stimulation by restriction enzyme mediated integration of BHK570 teansfection. These results, therefore, indicated that restriction enzyme mediated integration stimulates Ba/F3 teansfection efficiency.
Table 1. Restriction enzyme mediated integration transfection of Ba/F3 cells with Bam HI
1. 10 μg of linearized DNA was used for each reaction.
2. 3x10 cells were used in each reaction. Example 2: Optimal Haeϋ! concentration for restriction enzyme mediated integration teansfection of Ba/F3 cells
After demonstrating that restriction enzyme mediated integration stimulates Ba/F3 teansfection efficiency, the integration procedure was optimized to achieve maximal transfection efficiency. Hαelll, a 4-base restriction enzyme, rather than BamH!, a 6-base restriction enzyme, was used for the rest of the studies. Sites for a 4-base sequence are theoretically present in the genome 16 times more frequently than 6-base sequences.
Using a 4-base restriction enzyme in the restriction enzyme mediated integration studies suggests that the insertion events will be more widely distributed among the mutants generated. Hαelll enzyme, which recognizes 4-base sequence GGCC, was used in the following restriction enzyme mediated integration studies.
Previous studies have shown that the concentration of the restriction enzymes is critical for restriction enzyme mediated integration teansfection (Shi et al, 1995; Yorifuji
& Mikawa, 1990). The optimal enzyme concentration of Hαelll was determined for teansfecting Ba/F3 cells. Plasmid pcDNA3.1(+) was digested with EcoRV, generating blunt ends. After the EcoRV enzyme was inactivated, the linear DNA was co-teansfected with the Hαelll enzyme, which also generates blunt ends. The transfection efficiencies obtained are shown in Table 2.
Restriction enzyme mediated integration with Hαelll stimulated teansfection efficiency by 2- to 4-fold. Maximal teansfection efficiency resulted with 0.4 unit
Hαelll/μg DNA.
Table 2. Optimal HaeUl concentration for restriction enzyme mediated integration transfection of Ba/F3 cells
1. 10 μg of linearized DNA was used for each reaction.
2. 3xl06 cells were used in each reaction. Example 3: Optimal DNA concentration for restriction enzyme mediated integration transfection of Ba/F3 cells
The optimal DNA concentration was determined for teansfection. Varying amounts of DNA (10-200 μg) were added to each teansfection reaction, and the teansfection efficiency was determined. Hαelll enzyme (0.4 unit/μg DNA) was added to two reactions to determine the restriction enzyme mediated integration teansfection efficiency (Table 3).
The results showed that under non-restriction enzyme mediated integration conditions (i.e., without addition of Hαelll), 90 μg of teansfected DNA resulted in maximal transfection efficiency (0.66%). Further increases in DNA concentration did not enhance the teansfection efficiency, indicating that the DNA concentration was saturating. Therefore, 90 μg DNA teansfected into 107 Ba/F3 cells was the optimal DNA/cell ratio. Transfection efficiency was also stimulated by adding Hαelll enzyme in both reactions tested. The magnitude of stimulation by restriction enzyme mediated integration was similar in the both reactions (7-fold in the reaction with 30 μg DNA and 5-fold in that with 90 μg DNA).
Table 3: Optimal DNA concentration for restriction enzyme mediated integration transfection of Ba/F3 cells
1. 10 cells were used for each reaction.
2. The concenteation of Hαelll used here was 0.4 unit/μg DNA.
3. NA: Not applicable.
Example 4: Optimal cell number for restriction enzyme mediated integration teansfection of Ba/F3 cells
The influence of Ba/F3 cell number on teansfection efficiency was determined by increasing proportionally both cell number (3 x 10 - 3 x 10 ) and DNA concentration (10-100 μg). The resulting transfection efficiencies were determined as shown in Table
4.
Table 4: Optimal cell number for restriction enzyme mediated integration transfection of Ba/F3 cells
NA: Not applicable.
When the cell number was increased 10-fold to 3xl07, the non-restriction enzyme mediated integration teansfection efficiency increased slightly (from 0.1% to 0.4%). However, the stimulative effect by restriction enzyme mediated integration remained the same (5- to 6-fold). A total of 3xl07 cells per reaction in combination with restriction enzyme mediated integration resulted in maximal teansfection efficiency. Thus, if 3x107 cells are used per reaction instead of the original 3xl06, more than 30 times more Ba/F3 teansfectants can be generated in one teansfection reaction, thereby significantly reducing the number of teansfection reactions required to generate a tagged library.
In the studies summarized above, Ba/F3 restriction enzyme mediated integration transfection efficiency was highest in transfection reactions containing 3xl07 cells versus those containing 107 cells (Table 4). Transfecting 90 μg of DNA into 107 cells resulted in maximal teansfection efficiency (Table 3).
The effect of further enhancing teansfection efficiency was determined using a ratio of 90 μg DNA/107 cells in a reaction containing 3xl07 cells. The results are summarized in Table 5.
Table 5: Optimal cell number/DNA concentration for restriction enzyme mediated integration transfection of Ba/F3 cells
NA: Not applicable. Whereas using the ratio of 90 μg DNA 107 cells in a reaction containing 3xl07 cells raised teansfection efficiency to 3%, the effect was not linear.
Overall, the results demonstrated that by altering several variable factors in the Ba/F3 cell restriction enzyme mediated integration teansfection procedures, a much improved teansfection efficiency was achieved. In summary, maximal Ba/F3 teansfection efficiency can be achieved by applying 3xl07 cells, 100 μg EcoR V-linearized DNA, and 40 units of Hαelll during electeoporation. This procedure will generate many more teansfectants in a given electeoporation reaction for restriction enzyme mediated integration mutagenesis studies.
Example 5 : Construction of pJTLO 106
Plasmid pJTL0106 is the same as pcDNA3.1(+) except that the CMV promoter located between Nru! and BamH! is deleted (see Figure 13). To construct pJTL0106, 1 μg of pcDNA3.1 (+) was digested with 5 units of BamH! for 1 hour at 37°C. The restriction digestion mixture was then teeated with 5 units of Klenow in the presence of 25 μM dNTPs at 30°C for 15 minutes before inactivating the enzyme at 75°C for 10 minutes. Digestion with Nrwl was performed by adding 5 units of the enzyme followed by incubation at 37°C for 1 hour.
The restriction enzyme digestion mixture was loaded onto 1% agarose gel for electeophoresis and the upper band containing the deletion of the BamHi-Nruϊ fragment was extracted from the gel by using QIAquick Gel Exteaction Kit (QIAGEN, Valencia, CA). The subsequent ligation reaction was performed by Rapid DNA Ligation Kit from Roche Molecular Biochemicals, resulting in pJTL0106. The EcoRV site is located downstream of BamH! in pcDNA3.1(+), so it remains intact in pJTL0106. pJTL0106 was transformed into E. coli TOP 10 cells and a teansformant containing the plasmid was isolated and designated E. coli JLin0609.
Example 6: Plasmid DNA preparation and restriction enzyme digestion
Plasmid pcDNA3.1(+) or pJTL0106 was isolated from E. coli JLin0605 or E. coli JLin0609, respectively, by using the QIAGEN Plasmid Mega Kit (QIAGEN, Valencia,
CA) according to the manufacturer's instructions. Aliquots of 80 μg of plasmid DNA were digested with 100 units of EcoRV enzyme, for which the. recognition site is located immediately downstream of the CMV promoter, at 37°C for 1 hour. Then 10 units of
EcoRV were added for an additional hour of incubation to ensure complete digestion of the plasmid. After digestion, EcoRV was inactivated at 80°C for 20 minutes. The linearized DNA was stored at -20°C prior to use in teansfection.
Example 7: Restriction enzyme mediated integration transfection of Ba/F3 cells and neomycin-selection
Restriction enzyme mediated integration teansfection of Ba/F3 cells was performed as follows: 100 μg EcoRV linearized pcDNA3.1(+) or pJTL0106 plasmid was introduced into 3xl07 Ba/F3 cells in the presence of 40 units Hαelll by electeoporation. After electeoporation, the cuvettes were incubated for 3 minutes at room temperature followed by 7 minutes on ice before plating. Live cells were counted after electeoporation in a hemacytometer to determine the survival rate. Finally, the teansfection mixtures were resuspended in 50 ml non-selective medium and incubated at 37°C overnight.
Neomycin-resistant teansfectants were then selected. After overnight incubation at 37°C with 5% C02, cells were collected by centrifugation and cell numbers were determined. The cells were then resuspended at a concenteation of 2xl05 cells/ml in geneticin-containing media to select for neomycin-resistant teansfectants. A teansfection reaction without addition of DNA served as a negative conteol. The teansfection efficiency was determined by plating on average 50 and 10 cells/well in 96-well plates with geneticin-containing medium. Cell plating efficiency was also determined by plating on average 0.1 cell/well in 96-well plates containing non-selective medium. Growing cell clones were enumerated 6 days after plating, at which time no living cells can be found in the negative conteol plate (teansfection without DNA). Total number of independent neomycin-resistant teansfectants was calculated according to survival rate, plating efficiency, and teansfection efficiency.
The results are shown in Tables 6 and 7. A total of 1.16xl07 and 2.1 xlO6 neomycin-resistant pcDNA3.1(+) and pJTL0106 teansfectants were generated, respectively. Transfection efficiency was 2% to 3%.
Table 6. Number of independent transfectants and positive clones generated by restriction enzyme mediated integration transfection with pcDNA3.1(+)
Reaction Transfectants G-CSFR+ colonies 3.1.A1 636,930 0
3.1.A2 444,600 0
3.1. A3 444,600 0
3.1.A4 370,500 0 ■ 3.1.A5 282,000 0
3.1.A6 260,850 5
3.1.A7 331,350 0
3.1.A8 331,350 0
3.1.A9 373,650 0 3.1.A10 253,800 1
3.1.A11 303,150 0
3.1.A12 204,450 0
3.1.B1 495,600 0
3.1.B2 646,800 0 3.1.B3 478,800 0
3.1.B4 537,600 0
3.1.B5 402,600 , 7
3.1.B6 369,600 0
3.1.B7 495,000 0 3.1.B8 435,600 0
3.1.B9 204,000 2
3.1.B10 117,600 0
3.1.B11 175,200 0
3.1.B12 105,600 0 3.1.D5 720,000 0
3.1.D6 513,000 0
3.1.D7 321,600 0
3.1.D8 192,000 0
3.1.G5 252,000 0 3.1.G6 288,600 0
3.1.G7 330,000 0
3.1.G8 307,200 0
Total 11,625,630 15 Table 7. Number of independent transfectants and clones generated by restriction enzyme mediated integration transfection with pJTL0106 (ΔCMVp)
Reaction Transfectants G-CSFR+ colonies 3.1.D1 315,000 0 3.1.D2 238,500 0 3.1.D3 288,000 0 3.1.D4 169,200 0
3.1.G1 232,200 0 3.1.G2 453,600 0 3.1.G3 193,500 0 3.1.G4 168,000 0 Total 2,060,000 0
Example 8: Selection of granulocyte colony stimulating factor receptor expressing clones in agarose-containing selective medium
Since the Ba/F3 cell line is an interleukin-3 (IL-3)-dependent, murine lymphoid precursor cell line, selection in the absence of IL-3 for proliferation of a Ba/F3 clone allows for the isolation mutants Ba/F3 mutant cells were isolated that grow in the presence of granulocyte colony stimulating factor (G-CSF). Since wild type Ba/F3 does not grow in the absence of IL-3, colonies that grow on the selective medium should express the receptor for G-CSF. After selection for resistance to G-418, the transfectants were plated in agarose media containing granulocyte colony stimulating factor (G-CSF). The neomycin- resistant teansfectants were washed twice with 2X assay medium (2X RPMI 1640 containing glutamine, 20% fetal bovine serum, 2 mM sodium pyruvate and 20 mM HEPES buffer) to remove IL-3. The cells were then plated 15-fold magnitude over the number of independent teansfectants in 5 ml of IX assay medium containing 1.25% agarose (SeaPlaque low melting temperature agarose; FMC; Rockland, ME) in the presence of 10 ng/ml mouse G-CSF (R&D Systems, Minneapolis, MN). -Two vials of teansfectants (each vial contained at least 20-fold magnitude over the number of the independent teansfectants) were frozen as backups. Colonies were counted and moved out of the agarose medium with a Pasteur pipette 6 days after plating. A total of 15 colonies were obtained from transfection with pcDNA3.1(+) (Table 6). No colonies were found from the promoterless conteol transfection (Table 7), indicating that any pcDNA3.1(+) transfectant which proliferates specifically in response to G-CSF are likely to be promoter-specific.
The colonies were resuspended in 0.2 ml of liquid selective medium RPMI 1640 medium (GIBCO-BRL, Gaithersburg, MD) containing 10% fetal bovine serum (HyClone, Logan, UT), 1 mM sodium pyruvate, 10 mM HEPES buffer, 2 mM L- glutamine, 10 ng/ml recombinant mouse G-CSF (R&D Systems, Minneapolis, MN), and 500 μg/ml geneticin to allow amplification. Amplified cell clones were moved to 2 ml, and then 6 ml selective medium containing geneticin before freezing in liquid nitrogen to store.
Example 9: Characterization of the positive clones by proliferation assay The Alamar Blue Dye Proliferation assay (TREK Diagnostic Systems, Westlake,
OH) was used to quantitatively determine the cytokine-responsive proliferation phenotypes of the positive clones. Cells were washed twice with 0.5 volume of medium that is identical to Ba/F3 culture medium except without addition of IL-3. After resuspension in the same medium, cells were resuspended at 50,000 cells/ml in RPMI 1640. A volume of 0.1 ml (5000 cells) was teansferred to each well of a 96 well plate followed by 100 μl of 2X assay medium containing no cytokine, 4 ng/ml IL-3, or 20 ng/ml G-CSF. After a 3 day-incubation at 37°C, 20 μl of Alamar Blue dye was added and incubation was continued for another 24 hours. The reduced form of the dye, indicating proliferation, was measured using a fluorimeter (Perkin Elmer, Branchburg, NJ) with 544 nm excitation/590 nm emission wavelength.
Fifteen G-CSF-responsive clones originated from four independent pools (3.1.A6, 3.1.A10, 3.1.B5, and 3.1.B9). Since the number of the G-CSF-responsive colonies was less than the magnitude of colonies plated in each teansfection, it was concluded that the clones within each teansfection pool were siblings. Results of the quantitative proliferation assay of G-CSF-responsive clones are shown in Figure 1. Proliferation in response to IL-3 of the clones were comparable to that of wild type Ba/F3 cells. The proliferation in response to G-CSF was at least two-fold above background in these clones. The positive clones exhibited up to 24% of the proliferation in response to G-
CSF compared with that in response to IL-3. Example 10: Transcription of G-CSFR is stimulated in all G-CSF-responsive clones.
The G-CSF-responsive phenotypes of the positive clones were hypothetically due to expression of the G-CSF receptor. Northern analysis was performed to determine whether transcription of the G-CSF receptor (G-CSFR) gene was induced in these clones. The probes used for Northern blot analyses were generated by genomic PCR. The G-CSFR genomic fragment containing sequence from exon 7 to 8 was generated by using an upper primer 5'- CATTGGCCCTGATGTAGTCTC-3' (G-CSFR ex.7.35U21) (SEQ ID NO: 1) and a lower primer 5'- GCTCCAGAATCCAGGCAGAGA -3* (G- CSFR ex.8.94L21) (SEQ ID NO: 2) with genomic DNA isolated from Ba/F3 cells as template. Genomic DNA was isolated from the Ba F3 mutant cells using the Puregene system (Gentea Systems, Minneapolis, MN) according to the manufacturer's instructions. DNA concentrations were determined by absorbance at 260 nm. The genomic PCR mix was boiled at 100°C for 2 minutes prior to addition of the Taq polymerase. The PCR * reaction was performed for 3 minutes at 72°C followed by 30 cycles at 94°C for 40 seconds, 56°C for 1 minute, and 72°C for 1 minute, followed by a 10 minute incubation at 72°C in the presence of 2.5 units of Taq Polymerase (Perkin Elmer, Branchburg, NJ).
An actin gene fragment was generated by using an upper primer 5'- ACCCCAGCCATGTACGTAGCC-3' (clw-36) (SEQ ID NO: 3) and a lower primer 5'- GGAAGGCTGGAAAAGAGCCTC-3' (clw-37) (SEQ ID NO: 4). The PCR reaction was performed as described above except the PCR reaction was 35 cycles at 94°C for 40 seconds, 55°C for 1 minute, and 72°C for 1 minute. The PCR-generated G-CSFR and actin fragments were then labeled with o;-32P-dCTP (Amersham, Arlington Heights, IL) by the random priming method of the Prime-It II system (Stratagene, La Jolla, CA). Total RNA was isolated from Ba/F3 and representatives of the G-CSF-responsive clones followed by Northern analysis with a G-CSFR probe. Total RNA was isolated by the RNeasy kit (QIAGEN, Valencia, CA) according to the manufacturer's mstructiuons. The concentrations and purity of the RNA samples were determined by absorbances at 260 nm and 280 nm. A total of 15 μg of RNA was subjected to electeophoresis on a 1% agarose gel containing formaldehyde, and then teansferred overnight onto a Hybond N+ membrane (Amersham, Arlington Heights, IL) in 20 X SSPE buffer (3 M NaCl, 0.2 M
NaH2P04, and 20 mM EDTA). RNA was fixed to the membrane by UV cross-linking and pre-hybridized in Rapid-Hyb buffer (Amersham, Arlington Heights, IL) for 1 hour at
65°C. The labeled G-CSFR DNA probe (5xl05 cpm per ml of hybridization buffer) was denatured in 0.5 N NaOH at 37°C for 5 minutes before being added to the pre- hybridization buffer. Hybridization was performed overnight at 65°C. The membrane was then washed once with 2X SSC buffer (0.3 M NaCl, 30 mM sodium citrate) at room temperature for 5 minutes, twice with 0.1X SSC/0.1% sodium dodecyl sulfate (SDS) at 55°C for 10 minutes, and finally with 2X SSC for 5 minutes at room temperature. The membrane was exposed to a Phosphor screen and visualized and quantified with the ImageQuant program (Molecular Dynamics, Sunnyvale, CA). The G-CSFR probe was stripped off the membrane by applying boiled 0.1% SDS to the membrane. The membrane was then hybridized with the labeled actin probe as described above to ensure equal RNA loading.
The results showed the presence of a 4 kb band, close to the expected size (3.7 kb) of the G-CSFR mRNA, was present in all G-CSF-responsive clones while no obvious signals were detected in Ba/F3. It was also noted that signal patterns between the presumed siblings were very similar. The stimulation of G-CSFR transcription in these clones was 2- to 5-fold over the Ba/F3 cell background, as determined by the ImageQuant program (Molecular Dynamics, Sunnyvale, CA). The result showed that teanscription of the G-CSFR gene was stimulated in all G-CSF-responsive clones, indicating that the G-CSF-specific proliferation phenotype of these clones was probably due to expression of the G-CSF receptor.
Example 11: 5' RACE and genomic PCR analyses of G-CSF-responsive clones
5' RACE (Rapid Amplification of cDNA Ends) was used to identify 5' end sequences of the induced G-CSFR transcript in the G-CSF-responsive clones to show that the CMV promoter/pcDNA3.1(+) vector was inserted upstream of the G-CSFR gene. If G-CSFR teanscription is initiated from the CMV promoter, CMV-leader sequence should be identifiable in the 5' end of the transcript. If CMV leader sequence is identified in the G-CSFR transcript, genomic PCR using the CMV promoter- and G- CSFR-specific primers should show whether there is linkage between the CMV promoter and the target gene. The amplified PCR products can then be cloned and sequenced to identify the location of the CMV promoter insertion. Representatives of the four independent G-CSF-responsive Ba/F3 clones (31A6-9, 31A10-2, 31B5-10, and 31B9-3) were subjected to these analyses.
RACE was performed according to the manufacturer's protocol (GIBCO-BRL,
Gaithersburg, MD). G-CSFR cDNA was synthesized by using a G-CSFR specific primer 5'-GCCTCTTCTTTGCCACAC-3' (G-CSFR.734L18) (SEQ ID NO: 5), located 734 nucleotides downstream of the teanscription start site of the G-CSFR gene. RNA (5 μg) isolated from four G-CSF-responsive clones was incubated with 2.5 pmoles of the G- CSFR.734L18 primer in a total volume of 15.5 μl at 70°C for 10 min. The cDNA was synthesized in the presence of PCR buffer (20 mM Tris-HCl (pH 8.4), 50 mM KC1), 2.5 mM MgCl2, 0.4 mM dNTP mix, and 10 mM DTT by Superscript® II Reverse
Transcriptase (200 units) at 42°C for 50 minutes. Following eirzymatic degradation of the RNA templates, reaction products were subjected to TdT tailing to add sequence complementary to the abridged anchor primer at the 3' end of the cDNA. The cDNA sample was incubated with tailing buffer (10 mM Tris-HCl (pH 8.4), 25 mM KC1, 1.5 mM MgCl2), 0.2 mM dCTP at 94°C for 3 minutes. Then 15 units of terminal deoxynucleotidyl transferase (TdT) was added followed by incubation at 37°C for 10 minutes. Finally, the TdT was inactivated at 65 °C for 10 minutes. A PCR reaction was performed to amplify the target cDNA, using a nested gene-specific primer, 5'- CTCCCACTGGCAGACC-3' (G-CSFR.624L 16) (SEQ ID NO. 6), in conjunction with the abridged anchor primer (GIBCO BRL). The G-CSFR.624L16 primer is located 624 nucleotides downstream of the transcription start site of the G-CSFR gene.
A second round of nested amplification was performed by using 1 μl PCR reaction from the previous PCR reaction as template, and the abridged anchor primer and G-CSFR.498L19 (5'- TGGCACTAAGCAGAAGAGG-3') (SEQ ID NO.7) as upper and lower primers, respectively. The G-CSFR.498L19 primer is located in exon 4 and 498 nucleotides downstream of the transcription start site of the G-CSFR gene.
Both PCR reactions were performed for 1 minute at 94°C followed by 35 cycles each at 94°C for 40 seconds, 55°C for 1 minute, and 72°C for 3 minutes, followed by 10 minutes incubation at 72°C. The amplified cDNA products were visualized on 1% agarose gels in IX TBE buffer (89 mM Tris base, 89 mM boric acid, 2 mM EDTA, pH 8.0), and then extracted from the gel using the QIAquick Gel Exteaction Kit (QIAGEN, Valencia, CA). The PCR products were then cloned into pCR2.1-TOPO vector according to the manufacturer's protocol (Invitrogen, Carlsbad, CA) before being subjected to sequence analysis.
Genomic DNA isolated from the Ba/F3 mutant cells was prepared as described in Example 10. Genomic PCR analysis was performed to determine the linkage between the CMV promoter and G-CSFR gene in several G-CSF-responsive clones. Two G- CSFR-specific fragments from the 31A6-9 cell clone were amplified. The first fragment was amplified with a CMV promoter-specific primer, 5'- TTCCCATAGTAACGCCAATA-3' (CMV-G-CSFR.391U20) (SEQ ID NO: 8), and a G-CSFF-specific primer, 5'-GGGCTTAACAATACCACTCAT-3' (CMV-G- CSFR.1059L21) (SEQ ID NO: 9), located in exon 2 of the G-CSFR gene. The second fragment was amplified by a CMV promoter-specific primer, 5'- TGGATAGCGGTTTGACTCAC-3' (36D56.647U20) (SEQ ID NO: 10), and a G-CSFF- specific primer, 5'-GCCTACAGACCAGCATTTG-3' (36D56.1562L19) (SEQ ID NO: 11), located in intron 1 of the G-CSFR gene. The genomic PCR mixtures were boiled at 100°C for 2 minutes before addition of Taq polymerase. The PCR reaction was performed with 3 minutes incubation at 72°C, 35 cycles each at 94°C for 40 seconds, 55°C for 1 minute, and 72°C for 3 minutes, followed by 10 minutes at 72°C. A G-CSFR- specific fragment from the 31B5-10 cell clone was also amplified using the same primers 36D56.647U20 and 36D56.1562L19 with the PCR parameters as described above. The results for each G-CSF-responsive cell clones are shown below:
1. The CMV promoter is inserted in intron 1 of the G-CSFR gene in the 31A6-9 cell clone. The 5' RACE analysis showed that the sequence of the G-CSFR transcripts contained 110 nucleotide-long intron 1 sequence followed by exon 2 or 3, apparently resulting from an alternative splicing event (Figures 2, 3, and 4, SEQ ID NOs. 12-15). There were also heterogeneous nucleotide sequences in the 5' end of the G-CSFR transcripts. To investigate whether these 5' sequences were derived from CMV promoter, genomic PCR analysis was performed to amplify DNA fragment from the CMV promoter to either intron 1 or exon 2 of the G-CSFR gene. The genomic PCR and sequencing analyses indicated that the CMV promoter, with one stretch of DNA flipped backwards resulting from DNA rearrangement, of pcDNA3.1(+) was inserted in intron 1 of the G-CSFR gene (Figures 5 A and B, SEQ ID NO. 16). A Hαelll site (GGCC) (the restriction site recognized by the restriction enzyme introduced during restriction enzyme mediated integration) was located immediately upstream of the insertion site (Figure 6, SEQ ID NO. 17), indicating that insertion of the pcDNA3.1(+) was via a restriction enzyme mediated integration event. The teanslational start codon resided in exon 3 (see Figures 3 and 4), thus a functional G-CSF receptor protein could be made from these classes of transcripts.
2. The CMV promoter is inserted upstream of the exon 3 of the G-CSFR gene in the 31A10-2 cell clone. Two classes of G-CSFR transcripts were identified by 5' RACE analysis. Both classes of transcripts contained more than 100 nucleotides of ampicillin- resistance gene sequence and a stretch of previously unidentified genomic DNA sequence, followed by exon 3 or 4 (Figures 7, 8 and 9, SEQ ID NOs. 18-20). The orientation of the ampicillin-resistance gene was consistent with the result that CMV promoter was oriented toward the direction of G-CSFR gene expression. The presence of the ampicillin-resistance gene sequence in the 5' teanscript suggested that pcDNA3.1(+) was located upstream of the exon 3 of the G-CSFR gene.
3. The CMV promoter is inserted 1.1 kb upstream of the G-CSFR transcriptional start site in the 31B5-10 cell clone. The RACE analysis showed that the G-CSFR transcripts of the 31B5-10 cell clone initiated from +4 of the CMV leader sequence for 43 nucleotides, followed by 27 nucleotides of the region 1.1 kb upstream of the G-CSFR gene (designated here as the "-1.1 kb G-CSFR region"), and spliced to the exon 4 of the G-CSFR gene (Figures 10, 11, and 12, SEQ ID NOs. 21-23). The genomic PCR analysis with the CMV promoter-specific primer in combination with either the G-CSFR -1.1 kb region- or intron 1 -specific primer was consistent with the RACE analysis (Figures 13 and 14, SEQ ID NO. 24). This result indicated that the CMV promoter was inserted 1.1 kb upstream of the G-CSFR gene and was responsible for the G-CSFR teanscription. No Hαelll sites were found within 400 nucleotides upstream of the insertion site according to published sequence. Although the teanslational start codon resides in exon 3, the mature peptide sequence initiated from exon 4 (Figures 11 and 12). It is possible that a cryptic leader peptide was translated and a functional mature protein was made from this class of mRNA. However, it also remains possible that not all classes of G-CSFR mRNA were identified by the 5' RACE analysis.
4. A hybrid G-CSFR teanscript was found in the 31B9-3 cell clone. G-CSFR teanscript of the 31B9-3 cell clone was initiated from the G-CSFR -1.1 kb region mentioned above for 170 nucleotides, then spliced to exon 3 (Figures 15 and 16, SEQ ID NOs. 25 and 26). However, no pcDNA3.1(+) sequence was found in the transcript. Since the transcript was different from the wild-type G-CSFR transcript, there is a possibility that a heterogeneous promoter such as CMV promoter was responsible for the transcription. It was subsequently demonsteated that the CMV promoter is located upstream of the G-CSFR gene in the 31B9-3 cell clone (see Example 13 below).
Example 12. Determination of copy number of the CMN promoter insertions in the G-
CSFR+ clones Southern blotting was performed to determine the copy number of the CMV promoter insertion in the G-CSFR1" clones. A CMV promoter-containing fragment was generated for use in the Southern blot analyses. The CMV promoter-containing fragment was labeled with digoxigenin using the PCR DIG Synthesis Probe Kit (Roche, Indianapolis, IN) according to the manufacturer's instructions. The CMV promoter- containing fragment was generated by using an upper primer 5'- TGTGTTGGAGGTCGCTGAGT-3' (CMV.95U20) (SEQ ID NO: 27) and a lower primer 5'- ACGCCTACCGCCCATTT -3' (CMV.772L17) (SEQ ID NO: 28) with 0.2 ng pcDNA3.1(+) as template in the presence of PCR DIG Probe Synthesis mix. Then 0.75 μl of enzyme mix was added to the reactions on ice. The PCR reaction was performed for 2 minutes at 94°C, 30 cycles each at 94°C for 40 seconds, 56°C for 1 minute, and 72°C for 2 minutes, followed by 10 minutes incubation at 72°C. The DIG-labeled PCR product was purified by the QIAquick PCR Purification Kit (QIAGEN, Valencia, CA). The amount of the labeled probe was estimated by visualizing aliquots of the PCR products on an agarose gel.
A total of 10 μg of isolated genomic DNA, prepared as described in Example 10, was digested with 40 units of Nde I, which resides in the CMV promoter, in the presence of 8 μg RNase A for 2 hours at 37°C. A second aliquot of 40 units of the same restriction enzyme was added and incubation was continued for another 2 hours. Digested DNA was electeophoresed on a 0.7% agarose gel made in 0.5X TBE, with 0.5X TBE as the running buffer. Electeophoresis was carried out overnight at 10 volts.
The agarose gel was then subjected to depurination in 0.25 N HC1 for 10 minutes, denaturation twice in 0.5 M NaOH/1.5 M NaCl solution for 15 minutes, and neutralization twice in 1 M Tris pH 8/1.5 M NaCl solution for 15 minutes. DNA was then transferred to a Hybond N+ membrane in 20 X SSC buffer.
After UV crosslinking, the membrane was prehybridized with 10 ml DIG Easy Hyb solution (Roche, Indianapolis, IN) for 2 hours at 42°C, followed by hybridization with 120 ng DIG-labeled PCR fragment containing the CMV promoter in 10 ml of DIG Easy Hyb solution overnight at 42 °C. The membrane was then washed twice with 2X SSC/0.1% SDS buffer at room temperature for 5 minutes, and twice with 0.5X SSC/0.1%
SDS at 68°C for 15 minutes.
The washing and blocking buffer was obtained from DIG Wash and Block Buffer
Set (Roche, Indianapolis, IN). The membrane was equilibrated in IX washing buffer for
1 minute, followed by blocking in blocking solution for 60 minutes with agitation. The blocking solution was then replaced with 50 ml of blocking solution containing 1:20,000 dilution of anti-Digoxigenin-AP Fab fragment (Roche, Indianapolis, IN) for 30 minutes. After washing twice with IX washing buffer for 15 minutes, the membrane was equilibrated in 100 mM Tris-HCl pH 7.5/300 mM NaCl/0.3% (v/v) Tween 20 for 10 minutes. Vistea Detection solution (Vistea Systems: Signal amplification module for the Fluorlmager, Amersham, Sunnyvale, CA) was applied to the membrane at a concenteation of 25 μl/cm2 for 5 minutes at room temperature. Then the membrane was removed to a clean plastic bag for continuing incubation. The membrane was visualized after 24 hours with the ImageQuant program (Molecular Dynamics, Sunnyvale, CA). The results indicated that two copies of the CMV promoter were present in the
31A6-9 genome and only one copy in the other G-CSFR+ cell clones (31A10-2, 31B5- 10, and 31B9-3). The simplicity of the insertion patterns facilitated the task of isolating a phenotypically related target gene by plasmid rescuing.
Example 13. Isolation of the target gene by plasmid rescue
A genomic DNA fragment containing the linearized pcDNA3.1(+) and flanking region was isolated by a rescue method described as follows: A total of 3 μg of genomic DNA, isolated as described in Example 10, was digested with 40 units of EcoRV or Ndeϊ for 2 hours at 37°C. A second aliquot of 40 units of the same restriction enzymes were added and the incubation was continued for an additional 2 hours. The digest comprising the EcoRV- or Ni-M-linearized plasmids were then circularized at a concentration of 10 ng/μl using 10 or 7.5 units of T4 DΝA ligase at room temperature or 16°C, respectively, and incubated overnight. Then 200 or 100 ng of ligated DΝA was introduced into E. coli strain DH10B (GIBCO-BRL, Gaithersburg, MD), by electeoporation (2.5 kV, 25 μF, and 100 0 ) using a Bio-Rad Gene Pulser. E. coli teansformants containing pcDΝA3.1(+) and flanking DNA were selected on 2X YT medium (16 g tryptone, 10 g yeast extract, and 5 g NaCl per liter) supplemented with 100 μg/ml ampicillin— Plasmid DNA was isolated from representative ampicillin-resistant teansformants using a QIAGEN Plasmid Mini Kit (QIAGEN, Valencia, CA) and sequenced with a primer extending outward from pcDNA3.1 (+). Two different primers were used to sequence different plasmid clones:
5'-AGGGTCAAGGAAGGCACGGG-3' (pcDNA-RV.108L20) (SEQ ID NO:
29)
5'-CATAGTAACGCCAATAGGGA-3' (36D56.395U20) (SEQ ID NO: 30)
The results of the plasmid rescue analysis are summarized in Table 8. The sequence analysis confirmed that the G-CSFR gene can be isolated from at least three G- CSFR positive clones by plasmid rescue. Sequence analysis of the isolated plasmid from clones 31A6-9 indicated consistent insertion location of the pcDNA3.1(+) which correlated with the results of the genomic PCR studies. Sequence analysis of the plasmid rescued from 31B5-10 further revealed that that 152 nucleotides of G-CSFR genomic DNA were deleted during insertion of pcDNA3.1(+), in which a total of 146 nucleotides (60 nucleotides from 5' end and 86 nucleotides from 3' end) were also deleted. The result indicated that significant length of both donor and recipient DNA was deleted during restriction enzyme mediated integration teansfection. In previous analyses it could not be confirmed that the CMV promoter was linked to the G-CSFR gene in the 31B9-3 clone. Interestingly, through plasmid rescue analysis the CMV promoter was found to be located upsteeam of the G-CSFR gene in the opposite orientation of G-CSFR transcription (Figures 17, 18A and 18B, SEQ ID NO. 31). pcDNA3.1(+) was estimated to be inserted 1.7 kb upsteeam of the transcription start site of G-CSFR, and causing teanscription of the G-CSFR gene to initiate 1.2 kb upsteeam of the gene. It is hypothesized that the enhancer of the CMV promoter activated G-CSFR teanscription 1.2 kb upstream of the G-CSFR gene. An alternative hypothesis is that insertion of pcDNA3.1(+) in the regulatory element interrupts a negative control of G-CSFR gene expression. No G-CSFR gene sequence was found in the sequenced nucleotides of the rescued plasmid from 31A10-2, which can indicate that the insertion location of pcDNA3.1(+) resides in a previously unidentified region (such as intron region).
Table 8. Results of the plasmid rescue analysis
G-CSFR+ Clones CMVp copies Digested A ■ colonies G-CSFR gene
Restriction enzyme in rescued plasmid 31A6-9 2 Eco RV 1 Yes
31A10-2 1 Nde! 1 inconclusive
31B5-10 1 Ndeϊ 49 Yes
31B9-3 1 Nde! 3 Yes
Example 14. Construction of new tagging plasmid pBM76a
A DNA fragment was inserted downstream of the CMV promoter in pcDNA3.1(+). This creates a spacer arm, which protects the functional regulatory sequence from exonucleolytic degradation during the teansfection process. Plasmid pBM76a was created by modification of plasmid pcDNA3.1(+) (Invitrogen, Carlsbad, CA). A 564 bp. λ Hind!!! fragment was obtained using PCR amplification of λ DNA/ Hindi!! fragments (Gibco BRL, Rockville, MA) with the following primer pairs (SEQ ID NOs. 32 and 33, respectively):
Primer 1 (sense):
5 '-dGTACAAGCTTTAGAGCGATTTATC-3 ' Hindi!!
Primer 2 (antisense):
5'-dCATGAAGCTTAAGCTTTCCCTTGACGGAATG-3 ' Hind!!!
The amplification reaction (50 μl) was carried out using the Advantage-GC®
Genomic PCR kit (Clontech, Palo Alto, CA) with the following components: 0.5 ug λ ONA/HindHi fragments (Gibco BRL, Rockville, MA), IX GC Genomic PCR Reaction Buffer, 2.2 μl 25 mM Mg(Oac)2, 50 pmol of the sense primer, 50 pmol of the antisense primer, IX dNTP mix, and IX Advantage-GC Genomic Polymerase Mix. The reactions were cycled in an Ericomp Twin Block System Easy Cycler®, programmed as follows: Cycle 1; 95°C for 30". Cycles 2-11: 94°C for 30", 68°C for 1 ', Cycles 12-21: 94°C for 30", 60°C for 30", 68°C for 1'. Cycle 22; 68°C for 3'.
The PCR reaction was purified using the Qiaquick® PCR Purification kit (Qiagen, Valencia, CA). The purified PCR product was then digested with Hind!!!, purified by 1.5% NuSieve 3:1 agarose gel electeophoresis using standard methods (Samsbrook et al, 1989, supra), and followed by gel purification using the QIAquick Gel Extraction kit (Qiagen, Valencia, CA) according to manufacturer's instructions. Vector pcDNA3.1(+) (Invitrogen, Carlsbad, CA) was cleaved with Hindi!! followed by dephosphorylation using shrimp alkaline phosphatase (Roche Molecular Biochemicals, Indianapolis, IN) according to manufacturer's instructions. The digested vector was purified by 0.7% gel electeophoresis, followed by gel purification using the QIAquick
Gel Extraction kit (Qiagen, Valencia, CA) according to the manufacturer's instructions.
The purified PCR product was then ligated into vector pcDNA3.1(+) using standard methods (Samsbrook et al, 1989, supra). The resulting plasmid was designated pBM76a. This plasmid has a reduced chance of truncating the CMV promoter by exonucleases following teansfection.
Example 15. Optimal R-sαl concenteation for restriction enzyme mediated integration teansfection of Ba/F3 cells
REMI teansfection in Ba F3 is optimized with other restriction enzymes Rsal and Aluϊ, which recognize 4-base sequences GTAC and AGCT, respectively.
The effect of Rsaϊ mediated integration in stimulating Ba/F3 cell teansfection efficiency was determined using linearized plasmid pcDNA3.1 (*+■). Plasmid pcDNA3.1(+), which contains the cytomegalovirus (CMV) enhancer promoter, was obtained from Invitrogen (Carlsbad, CA). Plasmid pcDNA3.1(+) was isolated from E. coli JLin0605 (E. coli strain DH5α; containing plasmid pcDNA3.1(+)) by using the QIAGEN Plasmid Mega Kit (QIAGEN, Valencia, CA) according to the manufacturer's instructions. Plasmid DNA was then digested with an excess of EcoRV enzyme, for which the recognition site is located immediately downstream of the CMV promoter. After digestion, EcoRV was inactivated at 80°C for 20 minutes. The linearized DNA was stored at -20°C prior to use in teansfection.
Ba/F3 cells were subcultured the day before electeoporation so that they were in the exponential phase when used for electeoporation. The cells were cultured in RPMI 1640 (GIBCO-BRL, Gaithersburg, MD) containing 10% fetal bovine serum (HyClone, Logan, UT), 1 mM sodium pyruvate, 10 mM HΕPΕS buffer, 2 mM L-glutamine, and 2 ng/ml recombinant mouse interleukin-3 (IL-3) (R&D Systems, Minneapolis, MN). Geneticin, also known as G-418 sulfate, (GIBCO-BRL, Gaithersburg, MD) was used at 500 μg/ml in selective medium. Cells were grown at 37°C with 5% C02. The Ba/F3 cells were washed twice and resuspended in 1 ml of cold RPMI 1640 medium prior to addition of indicated amounts of linearized pcDNA3.1(+).
The cell DNA mixture was incubated on ice for 5 minutes. For the "restriction enzyme mediated integration" samples, Rsal (Roche, Indianapolis, IN) was added immediately prior to electeoporation. The cell/DNA mixture was subjected to two sequential electric shocks at room temperature, 800 μF, 300 V once, followed by 1180 μF, 300 V once, using a Cell Porator electeoporator (GIBCO-BRL, Gaithersburg, MD) according to the manufacturer's instructions. After electeoporation, the cuvettes were incubated for 3 minutes at room temperature followed by 7 minutes on ice before plating.
The teansfection mixtures were resuspended in non-selective medium at a concenteation of 6x105 cells/ml. After overnight incubation at 37°C with 5% C02, cells were collected by centrifugation and cell numbers were determined. Cell plating efficiency was determined by plating on average 0.1 cell/well in 96-well plates containing non-selective medium. The number of neomycin-resistant transfectants was determined by plating on average 50 and 10 cells/well in 96-well plates containing selective medium. Growing cell clones were enumerated 11 days after plating. Transfection efficiency was determined as described in Example 1.
The results shown in Table 9 are transfection efficiency of two independent samples and average transfection efficiency. The results as shown in Table 9 demonsteate that restriction enzyme mediated integration with Rsa! stimulated transfection efficiency by 2- to 5-fold. Maximal teansfection efficiency was achieved with 0.2 unit Rsaϊ/μg DNA.
Table 9. Restriction enzyme mediated integration transfection of Ba/F3 cells with Rsa!
Linearized DNA Rsa! Units TE (1) TE (2 Average TE pcDNA3.1(+)/EcoRV 0 0.28% 0.35% 0.31% pcDNA3.1(+)/EcoRV 20 2% 1% 1.5% pcDNA3.1(+)/EcoRV 40 0.86% 0.86% 0.86% pcDNA3.1(+)/EcoRV 80 0.33% 0.40 0.37%
1. 1 ml of the 3 x 107/ml cells were used in each reaction.
2. 100 μg of EcoR V-linearized pcDNA3.1(+) plasmid DNA was used for each reaction. 3. TΕ: Transfection efficiency
Example 16. Optimal Aluϊ concentration for restriction enzyme mediated integration teansfection of Ba/F3 cells
The optimal concenteation of restriction enzyme Aluϊ for restriction enzyme mediated integration in stimulating Ba/F3 cell teansfection efficiency was determined using linearized plasmid pBM76a. Plasmid pBM76a, described in previous example, was isolated from E. coli strain XL 1 -blue by using the QIAGEN Plasmid Mega Kit
(QIAGEN, Valencia, CA) according to the manufacturer's instructions. REMI transfection procedure is identical to the Ba/F3 electeoporation method described previously. The maximum teansfection efficiency was obtained with 0.01 U Aluϊ/ug DNA. (Table 10)
Table 10. Restriction enzyme mediated integration transfection of Ba/F3 cells with Aluϊ
Linearized DNA Alul Units TΕ (1) TE (2 TE (3) Average TE pBM76a/EcoR V 0 0.17% 0.13% 0.3% 0.2% pBM76a/EcoR V 1 1.04% 1.17% n/a 1.10% pBM76a/EcoRV 2 0.32% 0.36% 0.72% 0.46% pBM76a/EcoR V 5 0.64% 0.66% 0.66% 0.65% pBM76a/EcoR V 8 0.5% 0.47% n/a 0.48%
1. 1 ml of the 3 x 107/ml cells were used in each reaction. 2. 100 μg of EcoR V-linearized pBM76a plasmid DNA was used for each reaction.
3. TΕ: Transfection efficiency
4. n a: Not applicable
Example 17. Optimal Rsa! . Nde 11. and Hαelll concentration for restriction enzyme mediated integration teansfection of Ba/F3/gpl30/LIFR cells
Restriction enzyme mediated integration was performed in a Ba F3 cell line expressing both gpl30 and LIF receptors (designated as Ba/F3/gpl30/LIFR herein).
Ba F3/gpl30/LIFR was created by electroporated Ba/F3 cells with mouse gpl30/pZeoSV and mouse gpl90(LIFR)/pCP-12 (with the puro resistance gene) . The pCP-12 vector is composed of a puromycin resistance gene as the mammalian cell selectable marker, coupled to an SV40 promoter. The mouse LIFR cDNA is coupled to the MT-1 promoter and has an SV40 terminator. The bacterial selectable marker is ampicillin resistance gene. Ba/F3/gpl30/LIFR cells were selected with 200 ug/ml Zeocin and 1 ug/ml puromycin and then selected for the ability to grow on LIF without IL-3.
Restriction enzyme mediated integration transfection using EcoRV-linearized pcDNA3.1(+) is performed for Ba/F3/gρl30/LIFR cells as described previously for
Ba/F3, except for the following modifications. When Ba/F3/gpl30/LIFR cells are subcultured the day before electeoporation, IL-3 (2 ng/ml) is added to the media to increase teansfection efficiency (data not shown). Cell plating efficiency is determined by plating on average 0.2 cell/well in 96-well plates containing non-selective medium. The number of neomycin-resistant teansfectants is determined by plating on average 200 and 40 cells/well in 96-well plates containing selective medium. Growing cell clones are enumerated 7 days after plating.
Transfection efficiency is determined as described in Example 1. The optimal concenteation of enzyme for Rsa 1 (GT/AC), Nde 11 (/GATC/), or Hαe 111 (GG/CC) in Ba/F3/gpl30/LIFR teansfection is 0.05, 0.025, or 0.05 U/ug DNA, respectively (Tables 11 to 13).
Table 11. Optimal Rsa! concentration for restriction enzyme mediated integration transfection of Ba/F3/gpl30/LIFR cells
Linearized DNA Rsαl Units TΕ m TΕ (2 Average TE pcDNA3.1(+)/EcoRV 0 0.42% 0.45% 0.44% pcDNA3.1(+)/EcoRV 2.5 0.73% 0.37% 0.55% pcDNA3.1(+)/EcoRV 5 0.71% 0.6% 0.66% pcDNA3.1(+)/EcoRV 10 0.6% 0.49% 0.55% pcDNA3.1(+)/EcoRV 40 0.42% 0.48% 0.45%
1. 1 ml of the 3 x 107/ml cells were used in each reaction.
2. 100 μg of EcoRV-linearized pcDNA3.1(+) plasmid DNA was used for each reaction. 3. TΕ: Transfection efficiency
Table 12. Optimal Nde 11 concentration for restriction enzyme mediated integration transfection of Ba/F3/gpl30/LIFR cells
Linearized DNA Ndeϊϊ Units TΕ (I) TΕ (2) Average TE pcDNA3.1(+)/EcoR V 0 0.25% 0.24% 0.25% pcDNA3.1(+)/EcoRV 2.5 0.78% 0.9% 0.84% pcDNA3.1(+)/EcoR V 10 0.39% 0.22% 0.31% pcDNA3.1(+)/EcoR V 40 0.22% 0.20% 0.21%
1. 1 ml of the 3xl07/ml cells were used in each reaction, 2. 100 μg of EcoR V-linearized pcDNA3.1(+) plasmid DNA was used for each reaction.
3. TΕ: Transfection efficiency
Table 13. Optimal Hae 111 concentration for restriction enzyme mediated integration transfection of Ba/F3/gpl30/LIFR cells
Linearized DNA Hαelll Units TΕ (D TE (2) Average TE pcDNA3.1(+)/EcoRV 0 0.66% 0.54% 0.6% pcDNA3.1(+)/EcoRV 5 1.2% 0.94% 1.1% pcDNA3.1(+)/EcoRV 10 0.5% 0.6% 0.55% pcDNA3.1(+)/EcoRV 20 0.39% 0.57% 0.48% pcDNA3.1(+)/EcoRV 40 0.55% 0.53% 0.54%
1. 1 ml of the 3 x 107/ml cells were used in each reaction. 2. 100 μg of EcoR V-linearized pcDNA3.1(+) plasmid DNA was used for each reaction.
3. TΕ: Transfection efficiency
Example 18. Restriction enzyme mediated integration teansfection in Jurkat E6-1 A previous study (Whitney et al, 1998, Nature Biotechnology 16: 1329-1333) showed that only 3500-4000 G418-resistant Jurkat teansfectants can be generated using electeoporation. To demonsteate that REMI teansfection can stimulate teansfection efficiency in cell lines other than Ba/F3, REMI was applied to Jurkat E6-1 (ATCC catalog no. TIB- 152, Manassas, VA), a human T cell line. The REMI teansfection procedure for Jurkat E6-1 is identical to the Ba F3 electeoporation method described previously except for a few modification. Briefly, 0.4 ml of the 5xl07/ml cells (2xl07 cells) are transfected with 30 μg EcoRV-linearized pcDNA3.1(+) in the presence of a given restriction enzyme. The cell/DNA mixture is subjected to electric shock at 800 μF, 250 V at room temperature. Cell plating efficiency is determined by plating on average 0.2 cell/well in 96-well plates containing non- selective medium. The number of neomycin-resistant transfectants is determined by plating on average 1000 and 200 cells/well in 96-well plates containing 1250 μg/ml geneticin-containing medium. Growing cell clones were enumerated 14 days after plating. Transfection efficiency was determined as described in Example 1. The teansfection efficiencies of Dpnϊ (GACH3/TC), Rsal (GT/AC), Nde II (/GATC/), or Aluϊ (AG/CT)-mediated teansfection are shown in Table 14. All restriction enzymes tested here stimulated teansfection efficiency by 2-3 fold. REMI teansfection efficiency was then mediated by Hαelll to determine optimal enzyme concenteation (Table 15). Not only does 0.2 or 0.4 unit Hαelll/μg DNA stimulate teansfection efficiency by 2 fold, but also average of more than 7500 teansfectants are generated in each restriction enzyme-applied electeoporation (# of teansfectants = # of starting cells x % survival rate x % teansfection efficiency) (Table 15, survival rate for each reaction not shown). This demonstrates that REMI teansfection can stimulate teansfection efficiency for another cell line besides Ba/F3, and that more Jurkat teansfectants can be generated by this method.
Table 14. Restriction enzyme mediated integration transfection of Jurkat E6-1 cells with a variety of restriction enzymes
Restriction enz meUnits TE (n TE (2Ϊ TE (3) Average TE
- 0 0.02% 0.03% 0.03% 0.02%
Dpnϊ 3 0.04% 0.06% 0.03% 0.04%
Rsaϊ 3 0.03% 0.04% 0.06% 0.04%
Ndeϊϊ 0.9 0.08% 0.1% 0.02% 0.07%
Aluϊ 0.3 0.04% 0.02% 0.09% 0.05%
1. 0.4 ml of the 5x 107/ml cells were used in each reaction.
2. 30 μg of EcoRV-linearized pcDNA3.1(+) plasmid DNA was used for each reaction.
3. TΕ: Transfection efficiency
Table 15. HαelΗ-mediated integration transfection of Jurkat Ε6-1 cells
Restriction enzvmeUnits TE (1) TE (2) TE (3) Average TENumber of
TFant
0 0.02% 0.02% 0.02% 0.02% 2,900
HαelΗ 6 0.11% 0.04% 0.02% 0.05% 9,200 Hαelll 12 0.02% 0.04% 0.07% 0.04% 7,500
1. 0.4 ml of the 5xl07/ml cells were used in each reaction.
2. 30 μg of EcoR V-linearized pcDNA3.1(+) plasmid DNA was used for each reaction.
3. TΕ: Transfection efficiency
4. TFant: Transfectant
Example 19. Restriction enzyme mediated integration teansfection in TF-1 TF-1 was teansfected to demonsteate that REMI teansfection can be applied to another cell line, and to expand the technology to factor-dependent human cell lines. TF- 1 (ATCC catalog no. CRL-2003, Manassas, VA) is an IL-3 or GM-CSF-dependent human erythroleukemic cell line.
REMI teansfection procedure for TF-1 is similar to that of Ba/F3 with a few exceptions mentioned below. The number of neomycin-resistant transfectants was determined by plating on average 1000 and 250 cells/well in 96-well plates containing
1000 μg/ml geneticin-containing medium. Growing cell clones were enumerated 14 days after plating. Transfection efficiency was determined as described in Example 1.
The teansfection efficiencies of Hαelll (GG/CC), Rsaϊ (GT/AC), Nde II (/GATC/), or Aluϊ (AG/CT)-mediated teansfection are shown in Table 16. Hαelll, Rsaϊ, and Aluϊ increased teansfection efficiency by 2 to 4 fold, while Nde II had no effect at the concentration tested.
Table 16. Restriction enzyme mediated integration transfection of TF-1 cells with a variety of restriction enzymes
Restriction enzymeUnits TE TE (2) TE (3 Average TE
- 0 0.1% 0.35% 0.2% 0.22%
Hαelll 3 1.7% 0.4% 0.8% 0.97%
Rsaϊ 3 0.63% 0.7% 0.7% 0.68%
Nde ϊϊ 0.9 0.1% 0.3% 0.13% 0.18%
Aluϊ 0.3 0.45% 0.5% 0.37% 0.44%
1. 1 ml of the 3 x 107/ml cells were used in each reaction. 2. 100 μg of EcoRV-linearized pcDNA3.1(+) plasmid DNA was used for each reaction.
3. TΕ: Transfection efficiency
Example 20. Isolation of interleukin-5-responsive Ba/F3 cell clones a. Restriction enzyme mediated integration transfection of Ba/F3 cells and neomycin-selection
Restriction enzyme mediated integration teansfection of Ba/F3 cells was performed as described previously. 100 μg EcoRV linearized pBM76a plasmid was introduced into 3xl07 Ba/F3 cells in the presence of 40 units Hαelll by electeoporation. After overnight incubation at 37°C with 5% C02, cells were collected by centrifugation and cell numbers were determined. The cells were then resuspended at a concenteation of 2x10 cells/ml in geneticin-containing media to select for neomycin-resistant transfectants. The teansfection efficiency was determined by plating on average 50 and 10 cells/well in 96-well plates with geneticin-containing medium. Cell plating efficiency was also determined by plating on average 0.1 cell/well in 96-well plates containing non- selective medium. Growing cell clones were enumerated 6 days after plating. Total number of independent neomycin-resistant teansfectants was calculated according to survival rate and teansfection efficiency (# of independent teansfectants = # of starting cells x %> survival rate x % transfection efficiency).
A total of 1.84x10 neomycin-resistant pBM76a independent teansfectants were generated. Transfection efficiency was 0.7% to 2.8%. (Table 17)
Table 17. Number of independent transfectants and positive clones generated by restriction enzyme mediated integration transfection with pBM76a
Reaction Transfectants IL-5- -responsive clones BMcA105 126,000 7 BMcA106 300,000 0 BMcA107 100,000 1 • BMcA108 250,000 5
BMcA109 250,000 6 BMcAllO 120,000 5 BMcAlll 350,000 1 BMcA112 340,000 0
b. Selection of interleukin-5 stimulated clones in agarose-containing selective medium Since the Ba/F3 cell line is an interleukin-3 (IL-3)-dependent, murine lymphoid precursor cell line, selection in the absence of IL-3 for proliferation of a Ba/F3 clone allows for the isolation of mutants. Ba/F3 mutant cells that grow in the presence of interleukin-5 (IL-5) were isolated. Ba/F3 colonies that grow on the selective medium could express the receptor for IL-5. After selection for resistance to G-418, the teansfectants were plated in agarose media containing IL-5. The neomycin-resistant teansfectants were washed twice with 2X assay medium (2X RPMI 1640 containing glutamine, 20% fetal bovine serum, 2 mM sodium pyruvate and 20 mM HEPES buffer) to remove IL-3. The cells were then plated 15 to 38-fold magnitude over the number of independent teansfectants in 5 ml of IX assay medium containing 1.25% agarose (SeaPlaque low melting temperature agarose; FMC; Rockland, ME) in the presence of 50 ng/ml mouse IL-5 (R&D Systems, Minneapolis, MN). Two vials of teansfectants (each vial contained at least 20-fold magnitude over the number of the independent teansfectants) were frozen as backups. Colonies were counted and moved out of the agarose medium with a Pasteur pipette 6 days after plating. A total of 25 colonies from 6 teansfection reactions were obtained from teansfection with pBM76a (Table 17). The colonies were resuspended in 0.2 ml of liquid selective medium RPMI 1640 medium (GIBCO-BRL, Gaithersburg, MD) containing 10% fetal bovine serum (HyClone, Logan, UT), 1 mM sodium pyruvate, 10 mM HEPES buffer, 2 mM L-glutamine, 50 ng/ml recombinant mouse IL-5 (R&D Systems, Minneapolis, MN), and 500 μg/ml geneticin to allow amplification. Amplified cell clones were moved to 2 ml, and then 6 ml selective medium containing geneticin before freezing in liquid nitrogen to store.
To assess whether the colonies isolated from IL-5-containing agarose plates are due to the inserted promoter of pBM76a, we plated transfectants containing a promoterless construct, pJTL0106, to the same selective medium described above. A total of 7 colonies arise from 4 teansfection reactions were obtained from 2.06x106 neomycin-resistant pJTL0106 independent teansfectants plated (Table 18). Since the number of the IL-5 responsive colonies was less than the magnitude of colonies plated in each teansfection, it was concluded that the clones within each teansfection pool were siblings. When comparing the number of independent IL-5-responsive clones divided by the total number of independent transfectants, we found a 1.7-fold higher frequency with pBM76a teansfectants (Table 19). The results indicate that some IL-5 responsive pBM76a teansfectants may be promoter-specific.
Table 18. Number of independent transfectants and positive clones generated by restriction enzyme mediated integration transfection with pJTL0106
Reaction Transfectants IL-5-responsive clones
3.1D1 260,000 1
3.1D2 260,000 0
3.1D3 270,000 4
3.1D4 270,000 1
3.1G1 230,000 1
3.1G2 420,000 0
3.1G3 190,000 0
3.1G4 160,000 0
Table 19. Frequency of IL-5 responsive clones generated by transfection with pJTL0106 or pBM76a #IL-5 resp.clones /
Transfected plasmid#IL-5 resp. clones #indep. clones #inde .clones frequency pJTL0106 4 2,000,000 2x10-6 lx
pBM76a 6 1,800,000 3.3xl0"6 1.7x
c. Characterization of the positive clones by proliferation assay
The proliferation of phenotypes of clones was demonstrated from four independent pools (BMcA105, BMcA108, BMcA109, and BMcAllO). The Alamar
Blue Dye Proliferation assay (TREK Diagnostic Systems, Westlake, OH) was used to quantitatively determine the cytokine-responsive proliferation phenotypes of the positive clones. Cells were washed twice with 0.5 volume of medium that is identical to Ba/F3 culture medium except without addition of IL-3. After washes, cell number was determined and cells were resuspended at 50,000 cells/ml in RPMI 1640. A volume of
0.1 ml (5000 cells) was teansferred to each well of a 96 well plate followed by addition of 100 μl of 2X assay medium containing no cytokine, 4 ng/ml IL-3, or 100 ng/ml IL-5. After a 3 day-incubation at 37°C, 20 μl of Alamar Blue dye was added and incubation was continued for another 24 hours. The reduced form of the dye, indicating proliferation, was measured using a fluorimeter (Perkin Elmer, Branchburg, NJ) with 544 nm excitation/590 nm emission wavelength.
The proliferation in response to IL-5 was at least two-fold above background in these clones. The positive clones exhibited up to 75% of the proliferation in response to IL-5 compared with that in response to IL-3. The integrated tagging plasmid results in this IL-5-responsive phenotype.
The invention described and claimed herein is not to be limited in scope by the specific embodiments herein disclosed, since these embodiments are intended as illustrations of several aspects of the invention. Any equivalent embodiments are intended to be within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In the case of conflict, the present disclosure including definitions will conteol.
Various references are cited herein, the disclosures of which are incoφorated by reference in their entireties.

Claims

ClaimsWhat is claimed is:
1. A method for producing a mutant mammalian cell, said method comprising: (a) introducing into mammalian cells a nucleic acid construct and a restriction enzyme under conditions whereby said nucleic acid construct integrates into the genome of said mammalian cells at sites generated by said restriction enzyme, and wherein said nucleic acid construct comprises a regulatory sequence;
(b) growing mammalian cells comprising said integrated constructs; and (c) selecting a mutant mammalian cell having a trait of interest.
2. The method of Claim 1, wherein said nucleic acid construct is a linear construct.
3. The method of Claim 2, wherein said nucleic acid construct is linearized by said restriction enzyme upon introduction to said mammalian cells.
4. The method of Claim 2, wherein said nucleic acid construct is linearized by said restriction enzyme before being introduced into said mammalian cells.
5. The method of Claim 2, wherein said nucleic acid construct is linearized by a second restriction enzyme before being introduced into said mammalian cells.
6. The method of Claim 5 wherein said second restriction enzyme produces terminal sequences complementary to those generated by said restriction enzyme in step (a).
7. The method of Claim 2, wherein said nucleic acid construct is selected from the group consisting of a restriction enzyme cleaved nucleic acid fragment, synthetic DNA, cDNA and a PCR product.
8. The method of claim 1, wherein said nucleic acid construct includes a spacer arm.
9. The method of claim 1, wherein said regulatory sequence comprises one or more elements selected from the group consisting of an enhancer, a leader, a propeptide sequence, a promoter, and a signal peptide sequence.
10. The method of Claim 9, wherein said promoter is selected from the group consisting of a Cytomegalovirus (CMV) immediate early gene promoter, tetracycline inducible promoter, metallothionein promoter, TK promoter of Herpes virus, SV40 early promoter, and Rous sarcoma virus promoter, beta-casein promoter, elongation factor 1A promoter, and unbiquitin conjugating enzyme promoter.
11. The method of Claim 8, wherein said regulatory sequence promotes the expression of a gene relating to said trait.
12. The method of Claim 1, wherein said nucleic acid construct further comprises a mammalian selectable marker.
13. The method of claim 12, wherein said mammalian selectable marker is selected from the group consisting of adenosine deaminase, aminoglycoside phosphoteansferase, bleomycin resistance, cytosine deaminase, dihydrofolate reductase gene, diptheria toxin, histidinol dehydrogenase, hygromycin-B-phosphoteansferase, ήeomycin resistance, puromycin-N-acetyl transferase, thymidine kinase, xanthine-guanine phosphoribosylteansferase, and zeocin resistance.
14. The method 12, further comprising in step (c) selecting from said mutant mammalian cells one or more cells expressing said selectable marker.
15. The method of claim 1, wherein said nucleic acid construct further comprises a prokaryotic selectable marker.
16. The method of Claim 15, wherein said prokaryotic selectable marker is selected from the group consisting of ampicillin, kanamycin, chloramphenicol, tetracycline, and zeocin resistance.
17. The method of Claim 1, wherein said trait of said mutant mammalian cell results from altered expression of a naturally-occurring polypeptide.
18. The method of any of Claim 17, wherein said polypeptide is selected from the group consisting of an antigen, enzyme, growth factor, hormone, immunodilator, neuroteansmitter, receptor, reporter protein, structural protein, and teanscription factor.
19. The method of Claim 17, wherein said teait results from reduced expression of said naturally-occurring polypeptide.
20. The method of Claim 17, wherein said teait results from increased expression of said naturally-occurring polypeptide.
21. The method of Claim 1, wherein said teait results from expression of a modified polypeptide.
22. The method of Claim 1, wherein said teait is a phenotype selected from the group consisting of cellular proliferation, growth factor independent growth, colony formation, acquired factor-dependent growth phenotype, cellular differentiation, anchorage independent growth, activation of cellular factors, expression of cell surface receptors/proteins, gain or loss of cell-cell adhesion, migration, and cellular activation.
23. The method of claim 22, wherein said enzyme is selected from the group consisting of alpha-glucosidase, aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, glucocerebrosidase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phospholipase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, teansglutaminase, urokinase, and xylanase.
24. The method of claim 22, wherein said hormone is selected from the group consisting of a bone growth factor, steroid hormone, parathyroid hormone, follicle stimulating hormone, interferon, and parathyroid hormone.
25. The method of claim 22, wherein said immunomodulator is a cytokine.
26. The method of claim 25, wherein said cytokine is selected from the group consisiting of 4o<-helix, /3-sheet, or 04/3-cytokine.
27. The method of claim 26, wherein 4c-helix cytokine is selected from the group consisting of interleukins (IL-2, IL-3, IL-4, IL-5, IL-7, IL-9, and IL-13), granulocyte macrophage colony stimulating factor (GM-CSF), macrophage colony stimulating factor (M-CSF), stem cell factor (SCF), insulin-like growth factor (IFNγ), interleukin 6 (IL-6), leukemic inhibitory factor (LIF), oncostatin (OSM), cioliary neurotrophic factor (CNTF), erythropoietin (EPO), and granulocyte colony stimulating factor (G-CSF).
28. The method of claim 26, wherein said 0-sheet cytokine is selected from the group consisting of transforming growth factor (TGF), platelet derived growth factors (PDGF- A, PDGF-B), vascular endothelial growth factor (VEGF), nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neuroteophins (NT3 and NT4), tumor necrosis factor (TNFo; and TNF ), interleukins (IL-lα and IL-1/3), fibroblast growth factor (FGF), and keratinocyte growth factor (KGF).
29. The method of claim 26, wherein α,/3-cytokine is selected from the group consisting of epidermal growth factor (EGF), transforming growth factor (TGFα), insulin growth factors (IGF-1 and IGF-11), interleukin 8 (IL-8), monocyte chemoatteactant proteins (MCP-1, MCP-2 and MCP-3), macrophage inflammatory proteins (MIP-lo; MIP-1 β, and MIP-2).
30. The method of Claim 1, wherein said nucleic acid construct ranges between about 200 bp to about 30,000 bp.
31. The method of Claim 1, wherein said nucleic acid construct integrates by restriction enzyme mediated integration.
32. The method of Claim 1, wherein said mammalian cells are factor dependent cells.
33. The method of claim 32, wherein said factor dependent cells are growth factor- dependent mammalian cells selected from the group consisting of Ba/F3, DAI (mouse IL-3 -dependent), FDC-pl (mouse IL-3 -dependent), TF-1 (human IL-2-dependent), M-
07e (human IL-3-dependent), A375 (human IL-1 -dependent), 3TP1 (mouse IL-3 or TPO- dependent), Pre-B (mouse IL-7 -dependent), 32D (mouse), CCL-185 (human IL-4- dependent), WEHI164 (human TNF-oi-dependent), 2D9+EMCF (human IFN-α- dependent), Daudi (human IFN-α-dependent), COLO205 (human IFN-δ-dependent), B9 (mouse IL-6-dependent), KIT-225 (mouse IL-7-dependent), B9-11 (mouse IL-11- dependent), GNFS-60 (mouse G-CSF-dependent), MNFS-60 (mouse M-CSF- dependent), BAF-LRgpCR (mouse CNTF-dependent), DA- la (mouse LIF-dependent), and CTLL-2 (mouse IL-2-deρendent) cells
34. The method of claim 33, wherein said growth factor-dependent mammalian cells are Ba/F3 cells.
35. The method of claim 33, wherein said growth factor-dependent mammalian cells are TF-1 cells.
36. The method of claim 1, wherein said mammalian cells are Jurkat E6-1 cells.
37. A mutant mammalian cell produced by the method of Claim 1.
38. A method for isolating a gene controlling a teait of interest from a mammalian cell, said method comprising:
(a) introducing into mammalian cells a nucleic acid construct and a restriction enzyme under conditions whereby said nucleic acid construct integrates into the genome of said mammalian cells at sites generated by said restriction enzyme, and wherein said nucleic acid construct comprises a regulatory sequence; (b) growing mammalian cells comprising said integrated constructs; and
(c) selecting a mutant mammalian cell having a trait of interest;
(d) identifying the locus of said mutant mammalian cells at the site of integration of said nucleic acid construct; and
(e) isolating the gene controlling said trait of interest.
39. The method of Claim 38, wherein said teait results from altered expression of a naturally-occurring polypeptide.
40. The method of any of Claim 39, wherein said polypeptide is selected from the group consisting of an antigen, enzyme, growth factor, hormone, immunodilator, neurotransmitter, receptor, reporter protein, structural protein, and teanscription factor.
41. The method of Claim 39, wherein said trait results from reduced expression of said naturally-occurring polypeptide.
42. The method of Claim 39, wherein said teait results from increased expression of said naturally-occurring polypeptide.
43. The method of Claim 38, wherein said trait results from expression of a modified polypeptide.
44. The method of Claim 38, wherein said teait is a phenotype selected from the group consisting of cellular proliferation, growth factor independent growth, colony formation, acquired factor-dependent growth phenotype, cellular differentiation, anchorage independent growth, activation of cellular factors, expression of cell surface receptors/proteins, gain or loss of cell-cell adhesion, migration, and cellular activation.
45. The method of claim 44, wherein said enzyme is selected from the group consisting of alpha-glucosidase, aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, glucocerebrosidase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phospholipase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, urokinase, and xylanase.
46. The method of claim 44, wherein said hormone is selected from the group consisting of a bone growth factor, steroid hormone, parathyroid hormone, follicle stimulating hormone, interferon, and parathyroid hormone.
47. The method of claim 44, wherein said immunomodulator is a cytokine.
48. The method of claim 47, wherein said cytokine is selected from the group consisiting of 4o;-helix, /3-sheet, or α,/3-cytokine.
49. The method of claim 48, wherein 4o;-helix cytokine is selected from the group consisting of interleukins (IL-2, IL-3, IL-4, IL-5, IL-7, IL-9, and IL-13), granulocyte macrophage colony stimulating factor (GM-CSF), macrophage colony stimulating factor (M-CSF), stem cell factor (SCF), insulin-like growth factor (IFNγ), interleukin 6 (IL-6), leukemic inhibitory factor (LIF), oncostatin (OSM), cioliary neurotrophic factor (CNTF), erythropoietin (EPO), and granulocyte colony stimulating factor (G-CSF).
50. The method of claim 48, wherein said /3-sheet cytokine is selected from the group consisting of transforming growth factor (TGF), platelet derived growth factors (PDGF- A, PDGF-B), vascular endothelial growth factor (VEGF), nerve growth factor (NGF), brain-derived neuroteophic factor (BDNF), neuroteophins (NT3 and NT4), tumor necrosis factor (TNFα and TNF/3), interleukins (IL-lo; and IL-1/3), fibroblast growth factor (FGF), and keratinocyte growth factor (KGF).
51. The method of claim 48, wherein o;/3-cytokine is selected from the group consisting of epidermal growth factor (EGF), transforming growth factor (TGFo;), insulin growth factors (IGF-1 and IGF- 11), interleukin 8 (IL-8), monocyte chemoatteactant proteins (MCP-1, MCP-2 and MCP-3), macrophage inflammatory proteins (MIP-1 a, MIP-1 β, and MIP-2).
52. The method of Claim 38, wherein said nucleic acid construct ranges between about 200 bp to about 30,000 bp.
53. The method of Claim 38, wherein said nucleic acid construct integrates by restriction enzyme mediated integration.
54. The method of Claim 38, wherein said mammalian cells are factor dependent cells.
55. The method of claim 54, wherein said factor dependent cells are growth factor- dependent mammalian cells selected from the group consisting of Ba/F3, DAI (mouse
IL-3-dependent), FDC-pl (mouse IL-3-dependent), TF-1 (human IL-2-dependent), M- 07e (human IL-3-deρendent), A375 (human IL-1 -dependent), 3TP1 (mouse IL-3 or TPO- dependent), Pre-B (mouse IL-7-dependent), 32D (mouse), CCL-185 (human IL-4- dependent), WEHI164 (human TNF-o^dependent), 2D9+EMCF (human JFN-a- dependent), Daudi (human IFN-α-dependent), COLO205 (human IFN-δ-dependent), B9 (mouse IL-6-dependent), KIT-225 (mouse IL-7-dependent), B9-11 (mouse IL-11- dependent), GNFS-60 (mouse G-CSF-dependent), MNFS-60 (mouse M-CSF- dependent), BAF-LRgpCR (mouse CNTF-dependent), DA-la (mouse LIF-dependent), and CTLL-2 (mouse IL-2-dependent) cells
56. The method of claim 55, wherein said growth factor-dependent mammalian cells are Ba/F3 cells.
57. The method of claim 55, wherein said growth factor-dependent mammalian cells are TF-1 cells.
58. The method of claim 38, wherein said mammalian cells are Jurkat E6-1 cells.
59. An isolated gene obtained by the method of Claim 38.
60. A nucleic acid construct comprising the isolated gene of claim 59.
61. A recombinant expression vector comprising the nucleic acid construct of claim 60.
62. A recombinant host cell comprising the nucleic acid construct of claim 60.
63. The recombinant host cell of claim 62, selected from the group consisting of a mammalian cell, fungus, baculovirus, and bacterium.
64. A method for producing a polypeptide comprising (a) cultivating the host cell of claim 62 under conditions suitable for production of the polypeptide; and (b) recovering the polypeptide.
65. A polypeptide obtained by the method of claim 64.
EP01992773A 2000-10-30 2001-10-30 Methods for expressing endogenous genes by restriction enzyme mediated integration Withdrawn EP1352060A2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US70217700A 2000-10-30 2000-10-30
US702177 2000-10-30
PCT/US2001/045045 WO2002036760A2 (en) 2000-10-30 2001-10-30 Methods for expressing endogenous genes by restriction enzyme mediated integration

Publications (1)

Publication Number Publication Date
EP1352060A2 true EP1352060A2 (en) 2003-10-15

Family

ID=24820153

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01992773A Withdrawn EP1352060A2 (en) 2000-10-30 2001-10-30 Methods for expressing endogenous genes by restriction enzyme mediated integration

Country Status (3)

Country Link
EP (1) EP1352060A2 (en)
AU (1) AU2002227069A1 (en)
WO (1) WO2002036760A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105101979A (en) * 2012-12-21 2015-11-25 奥卡塔治疗公司 Method for preparing platelets from pluripotent stem cells and composition thereof

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005078069A1 (en) * 2003-05-09 2005-08-25 Codegrok, Inc., Dba Auilix Biopharma Method for identifying cellular targets
US20220192166A1 (en) * 2019-03-28 2022-06-23 Central Institute For Experimental Animals Immunodeficient rodent

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5377806B2 (en) * 1997-09-26 2013-12-25 アサーシス,インコーポレイテッド Expression of endogenous genes by non-homologous recombination of vector constructs with cellular DNA

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0236760A3 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105101979A (en) * 2012-12-21 2015-11-25 奥卡塔治疗公司 Method for preparing platelets from pluripotent stem cells and composition thereof
US11400118B2 (en) 2012-12-21 2022-08-02 Astellas Institute For Regenerative Medicine Methods for production of platelets from pluripotent stem cells and compositions thereof
US12076347B2 (en) 2012-12-21 2024-09-03 Astellas Institute For Regenerative Medicine Methods for production of platelets from pluripotent stem cells and compositions thereof
US12109239B2 (en) 2012-12-21 2024-10-08 Astellas Institute For Regenerative Medicine Methods for production of human hemogenic endothelial cells from pluripotent stem cells and compositions thereof

Also Published As

Publication number Publication date
AU2002227069A1 (en) 2002-05-15
WO2002036760A2 (en) 2002-05-10
WO2002036760A3 (en) 2003-08-14

Similar Documents

Publication Publication Date Title
EP1694850B1 (en) Plasmid system for multigene expression
EP0173552A1 (en) Recombinant DNA compounds and the expression of polypeptides such as tPA
JP2011152152A (en) Inducible eukaryotic expression system
JP2010213718A (en) Expression cassette and vector for transient or stable expression of exogenous molecule
JP2006296438A (en) Method for selecting high expression host cells
EP3844288A1 (en) Ssi cells with predictable and stable transgene expression and methods of formation
JP2023076667A (en) Efficient selectivity of recombinant proteins
EP1997892A1 (en) Screening for expressible transfectants in a eukaryotic system
US6908751B2 (en) Methods for enhancing the expression of a protein of interest by recombinant host cells
WO2002036760A2 (en) Methods for expressing endogenous genes by restriction enzyme mediated integration
US6730500B1 (en) Methods for generating a continuous nucleotide sequence from noncontiguous nucleotide sequences
US7262025B2 (en) Hybrid vector having a cytomegalovirus enhancer and myeloproliferative sarcoma virus promoter
RU2230751C2 (en) Peptide mpi without signal sequence, dna encoding thereof, vector, method for assay capacity for secretion of testing peptide, method for isolating cdna
EP1276881B1 (en) Methods for enhancing the expression of a protein of interest by recombinant host cells
US5686263A (en) Method for enhancing gene expression
KR102918089B1 (en) PaCas9 nuclease
US20040209323A1 (en) Protein expression by codon harmonization and translational attenuation
RU2839373C1 (en) RECOMBINANT PLASMID pVEAL3-XBB.1.5, WHICH PROVIDES SYNTHESIS AND SECRETION OF RECEPTOR-BINDING DOMAIN RBD S OF SARS-CoV-2 PROTEIN OF VARIANT XBB.1.5, AND RECOMBINANT STRAIN CHO-XBB.1.5 - PRODUCER OF RECEPTOR-BINDING DOMAIN RBD S PROTEIN SARS-CoV-2 VERSION XBB.1.5 INTENDED FOR PRODUCING IMMUNOBIOLOGICAL PREPARATIONS
CA2390017A1 (en) Cell surface display of proteins by recombinant host cells
TW202525834A (en) Method for constructing cells producing defucosylated proteins and application thereof
Hudson Development of vectors allowing efficient heterologous-gene expression in stable myeloma-cell transfectants
EA043898B1 (en) NUCLEASE PaCas9
HK40032919A (en) Multi-site specific integration cells for difficult to express proteins

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

17P Request for examination filed

Effective date: 20040216

RIN1 Information on inventor provided before grant (corrected)

Inventor name: HOLLY, RICHARD

Inventor name: FOSTER, DONALD

Inventor name: YAVER, DEBBIE

Inventor name: LIN, JANINE

17Q First examination report despatched

Effective date: 20040722

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: ZYMOGENETICS, INC.

Owner name: NOVOZYMES, INC.

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20060209