EP1350507A1 - Délivrance d'une substance à un site prédéterminé - Google Patents

Délivrance d'une substance à un site prédéterminé Download PDF

Info

Publication number
EP1350507A1
EP1350507A1 EP02076316A EP02076316A EP1350507A1 EP 1350507 A1 EP1350507 A1 EP 1350507A1 EP 02076316 A EP02076316 A EP 02076316A EP 02076316 A EP02076316 A EP 02076316A EP 1350507 A1 EP1350507 A1 EP 1350507A1
Authority
EP
European Patent Office
Prior art keywords
vehicle according
delivery vehicle
mscl
substance
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP02076316A
Other languages
German (de)
English (en)
Inventor
Robert Heinz Edward Friesen
Jan Willem Meijberg
Cornelis Johannes Leenhouts
Harm Jan Hektor
Gert Nikolaas Moll
Anthony Jacques Ronald Lambert Hulst
Johannes Henricus Van Esch
André Heeres
George Thomas Robillard
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Applied Nanosystems BV
Original Assignee
Applied Nanosystems BV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Applied Nanosystems BV filed Critical Applied Nanosystems BV
Priority to EP02076316A priority Critical patent/EP1350507A1/fr
Priority to AU2003225432A priority patent/AU2003225432A1/en
Priority to PCT/NL2003/000256 priority patent/WO2003084508A1/fr
Priority to EP03746007A priority patent/EP1490028A1/fr
Publication of EP1350507A1 publication Critical patent/EP1350507A1/fr
Priority to US10/957,887 priority patent/US20050272677A1/en
Withdrawn legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/16—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing nitrogen, e.g. nitro-, nitroso-, azo-compounds, nitriles, cyanates
    • A61K47/18—Amines; Amides; Ureas; Quaternary ammonium compounds; Amino acids; Oligopeptides having up to five amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/22—Heterocyclic compounds, e.g. ascorbic acid, tocopherol or pyrrolidones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/107—Emulsions ; Emulsion preconcentrates; Micelles
    • A61K9/1075—Microemulsions or submicron emulsions; Preconcentrates or solids thereof; Micelles, e.g. made of phospholipids or block copolymers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A61K9/1271—Non-conventional liposomes, e.g. PEGylated liposomes, liposomes coated with polymers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A61K9/1271—Non-conventional liposomes, e.g. PEGylated liposomes, liposomes coated with polymers
    • A61K9/1272—Non-conventional liposomes, e.g. PEGylated liposomes, liposomes coated with polymers with substantial amounts of non-phosphatidyl, i.e. non-acylglycerophosphate, surfactants as bilayer-forming substances, e.g. cationic lipids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/5005—Wall or coating material
    • A61K9/5021—Organic macromolecular compounds
    • A61K9/5052—Proteins, e.g. albumin

Definitions

  • the invention relates to the field of delivery of substances.
  • the invention is useful in several areas among which some of the more important ones are the field of health, medicine, agriculture and cosmetic.
  • compositions are formulated, for instance, to allow for appropriate dosage, delivery or application of the substance of interest.
  • the present invention provides means and methods for broadening the use of substances even further.
  • the present invention allows control over the availability of the substance at the site of interest. Through this control another level of accuracy and predictability is introduced which can be utilized to increase the utility of substances to be delivered and to increase the number of substances that can be used for a certain application.
  • the problems and solutions provided by the present invention will be exemplified predominantly using medical and general health examples. However, the invention is by no means limited to these fields.
  • the formulation typically is used as a means for obtaining slow release of the substance. Though this may be of great help in some instances, it is still not optimal. Though slow release formulations may help to provide a more or less continuous source of substance to be made bioavailable, they do nothing with respect to making the substance available at the site where the action of the drug is desired.
  • the present invention provides a solution to problems encountered with delivering substances in that it allows control of availability of the substance at the pre-determined site.
  • the invention provides a delivery vehicle for delivering a substance of interest to a predetermined site, said vehicle comprising said substance and a means for inducing availability of at least one compartment of said vehicle toward the exterior, thereby allowing access of said substance to the exterior of said vehicle at said predetermined site.
  • a delivery vehicle for delivering a substance of interest to a predetermined site, said vehicle comprising said substance and a means for inducing availability of at least one compartment of said vehicle toward the exterior, thereby allowing access of said substance to the exterior of said vehicle at said predetermined site.
  • Such transport will generally also encompass dilution of the substance in at least said transport fluid thereby lowering the effective concentration of said substance, thereby rendering the substance less effective at said other sites.
  • the toxic effects can be restricted to the predetermined site, thereby at least limiting the overall toxicity of the substance.
  • a vehicle of the invention not only allows availability of the substance at the predetermined site. It also allows for control over the availability. Through the means for inducing availability of at least one compartment of said vehicle toward the exterior of said vehicle it is possible to at least change the availability of the substance at the predetermined site after said vehicle has been delivered to said predetermined site.
  • Induction of availability of at least one compartment at the predetermined site can be achieved in various ways depending on the nature of the vehicle and the nature of the induction means.
  • vehicle formulations are detailed below.
  • Non-limiting examples of vehicles and induction means that can advantageously be used for the present invention are for instance various gel formulations, wherein the gel comprises a means for at least in part inducing fluidisation of the gel at the predetermined site. Fluidisation can be induced for instance under the influence of a specific pH, salt concentration, temperature and/or radiation at the predetermined site.
  • the means for inducing availability of said compartment in this case being incorporated in specific formulation of the gel composition, for instance in the choice of specific pH, salt concentration or temperature sensitive gels and/or side chain. Gels of various nature can be used in this respect.
  • Organicgelators are small organic compounds that already at low concentrations can from gels with solvents ranging from hexane to water (F.M. Congress, K.L. Caran, J. Am. Chem. Soc, 2000, 122, 11679; J.H. Jung, M. Amaike, K. Nakashima, S. Shinkai, J. Chem. Soc, Perkin Trans. 2, 2001, 1938), via self-assembly of the organo/hydrogelator through highly specific non-covalent interactions (J. van Esch, F. Schoonbeek, M. de Loos, M. Veen, R.M. Kellogg, B.L. Feringa, NATO ASI Series, Kluwer Academic Publishers, 527 (1998) 223; P. Terech, R.G. Weiss, Chem. Rev., 97 (1997) 3133)"
  • said means for inducing availability of said compartment responds to conditions that can be controlled. For instance, control over the specific pH, salt concentration or temperature at the site of interest allows one to control availability of the substance of interest.
  • said inducing means comprises a light sensitive compound that upon exposure to light undergoes a change in conformation thereby allowing availability of the compartment, for instance by enhancing fluidisation of the gel.
  • the control over the specific light at the predetermined site allows control over the availability of the substance at the site of interest.
  • the availability of the compartment is induced by means of the application of an electrical field at the predetermined site.
  • said signal-receptor combination comprises radiation in combination with a radiation sensitive receptor.
  • receptor in this embodiment are, iron-oxide or cobalt alloys. These receptors are sensitive to various kinds of radiation and utilize the energy contained in the radiation to induce availability of the substance. Iron-oxide and cobalt alloys are particularly suited to raise the temperature in the vehicle of the invention as a result of the adsorption of radiation. Increase in heat can be used to for instance fluidize at least part of the vehicle at the predetermined site.
  • the signal for inducing availability of said compartment in this embodiment is radiation. Radiation can be provided to predetermined site in a sufficiently specific fashion to allow preferential induction of availability of said compartment at or near said predetermined site.
  • induction of availability of said compartment is achieved by inducing opening of at least one compartment toward the exterior of said vehicle.
  • Inducing opening can be achieved using various means for instance by inducing the generation of a physical opening in a compartment of the vehicle. This embodiment will be discussed in more detail elsewhere in this document.
  • Induction of availability and/or opening of a compartment toward the exterior is useful for allowing the entrapped substance to passage out of the vehicle. However, it is also useful for allowing compounds to enter the vehicle and associate with the substance. In this way vehicles of the invention can be used to take up desired compound at the predetermined site and discontinue their availability at the predetermined site.
  • vehicles of the invention may make the substance specifically available to the predetermined site by allowing passage of said substance outside the vehicle or it may specifically allow uptake of compounds at the predetermined site by inducing availability of the substance at said site.
  • said induction allows passage of said substance to the exterior of said vehicle.
  • An inducing means of the invention comprises both an effector, capable of making the compartment available and a signal with which the effector can be switched (activated) into a situation wherein said compartment is available to the exterior of the vehicle. It is clear that an effector must be able to respond directly or indirectly to the provision of a signal.
  • the response can be any type of response that makes the compartment available. For instance, it may be that indeed a physical opening of a compartment of the vehicle is induced. However, it is also possible that the effector induces availability in a different way, for instance by fluidisation of (a compartment of) the vehicle.
  • an effector of the invention comprises a radiation responsive molecule.
  • said radiation sensitive molecule comprises a light responsive molecule.
  • a light responsive molecule of the invention is a molecule that can assume a different conformation upon exposure to light. The difference in conformation is utilized to allow a physical change in the vehicle of the invention wherein said physical change induces the availability of at least one compartment of said vehicle toward the exterior.
  • Preferred radiation sensitive effectors are light switchable gelling or thickening molecules and light switchable molecules that are part of a film. Non-limiting examples of the latter are light-switchable lipids and light-switchable channel proteins.
  • an effector comprises a binding molecule that upon binding induces the vehicle to induce availability of said compartment toward the exterior of said vehicle. Preferably to induce release of the substance from said vehicle (for instance by fluidisation).
  • the signal in this case can be the binding event.
  • a binding molecule as an effector may also induce the prolonged presence of the vehicle at the predetermined site thereby induce availability by conditions at the predetermined site, for instance a lower pH at the site of a solid tumor.
  • a non-limiting example of such a binding molecule is a binding molecule that undergoes a change in conformation under the influence of conditions at the predetermined site wherein said conformation change allows preferential binding of said binding molecule to its binding partner at the predetermined site.
  • a binding molecule is a pH-sensitive binding molecule.
  • said pH-sensitive binding molecule comprises a pH-sensitive AcmA and/or AcmD protein.
  • the specific pH at which a vehicle of the invention is specifically retained at the site of interest can be tailored.
  • One way of tailoring said vehicle is by manipulating the ratio of AcmA and AcmD in the vehicle.
  • suitable AcmA and AcmD proteins reference is made to the examples and to WO 99/25836.
  • a compartment is induced to become available by inducing opening of at least one compartment in said vehicle thereby allowing access of said substance to the exterior of said vehicle.
  • said vehicle comprises a film wherein the continuity of the film can be controlled by providing a signal.
  • said opening is achieved by inducing opening of a pore in said film.
  • said film comprises an effector molecule capable of forming a pore.
  • said effector molecule comprises a proteinaceous channel that allows availability by forming a pore through which compartment is made available toward the exterior of said vehicle.
  • the proteinaceous channel can be any proteinaceous channel that allows induced opening of at least one compartment of said vehicle.
  • said proteinaceous channel comprises a solute channel.
  • a solute channel is capable of allowing passage of ions and small hydrophilic molecules.
  • said proteinaceous channel comprises an ion channel.
  • said proteinaceous channel comprises a mechanosensitive channel.
  • a mechanosensitive channel of large conductance (MscL) or a functional equivalent thereof In nature MscL allows bacteria to rapidly adapt to a sudden change in environmental conditions such as osmolarity. The MscL channel opens in response to increases in membrane tension, which allows for the efflux of cytoplasmic constituents.
  • MscL homologues from various prokaryotes are cloned (Moe, P.C., Blount, P. and Kung, C. (1998) Mol. Microbiol . 28 , 583-592). Nucleic acid and amino acid sequences are available and have been used to obtain heterologous (over)-expression of several MscL (Moe, P.C., Blount, P. and Kung, C. (1998) Mol. Microbiol . 28 , 583-592).
  • vehicles preferably liposomes, comprising MscL or a functional equivalent thereof are loaded with small hydrophilic molecules whereupon loaded small molecules can be released from said vehicle under activation or opening of the channel.
  • Loading of the lipid vesicle can be accomplished in many ways as long as the small molecules are dissolved in a hydrophilic solvent which is separated from the surrounding hydrophilic solvent by a lipid bilayer.
  • Activation of MscL has been found to be controllable. It is possible to tune the type and relative amount of lipids in the vehicle such that the amount of membrane tension required to activate the channel is altered.
  • the lipid vehicle can be tuned to allow preferential activation of the channel and thus preferential release of said small molecule in the vicinity of said cells of said tissue.
  • compositions comprising lipid vehicles have been used in vivo, for instance to enable delivery of nucleic acid or anti-tumor drugs to cells. It has been observed that blood stream administration of such vehicles often leads to uptake of vehicles by cells. Uptake by cells seems to correlate with the charge of the lipid in the vehicle. Uptake is particularly a problem with negatively charged lipid vehicles, these vehicles are very quickly removed from the blood stream by the mononuclear phagocytic system in the liver and the spleen. Although the present invention may be used to facilitate uptake of small molecules by cells, it is preferred that the small molecules are delivered to the outside of cells. In the present invention it has been found that MscL is also active in lipid vehicles that consist of positively and/or neutrally charged lipids.
  • Lipid vehicles comprising said positively and/or neutrally charged lipids are more resistant to uptake by cells of the mononuclear phagocytic system.
  • Lipid vehicles of the invention therefore preferably comprise positively and/or neutrally charged lipids.
  • Such vehicles exhibit improved half-lifes in the bloodstream.
  • Such vehicles demonstrate improved targeting to non-mononuclear phagocytic system cells.
  • the lipid part directed toward the exterior of a lipid vehicle of the invention preferably consists predominantly of positively and/or neutrally charged lipids, thereby nearly completely avoiding cellular uptake through negatively charged lipid and thereby further increasing the bloodstream half life of lipid vehicles of the invention.
  • positively and/or neutrally charged lipids can also be used to alter the amount of added pressure needed to activate the channel in the vehicle.
  • Vehicles of the invention wherein the outwardly directed lipid part of a lipid vehicle consists predominantly of positively and/or neutrally charged lipids postpone the rapid cellular uptake as seen for vehicles wherein the outwardly directed part consists of negatively charged lipid. Postponed uptake through the mononuclear phagocytic system leads to increased circulation times.
  • positively and/or negatively charged lipids can also be used to alter the amount of membrane tension needed to activate the channel.
  • the signal or event leading to activation of a channel of the invention can also be changed by altering the MscL in the vehicle.
  • other mutants are available that have a higher open probability as compared to the wild type MscL from Escherichia coli (Blount, P., Sukharev, S.I., Schroeder, M.J., Nagle, S.K., and Kung, C. (1996) Proc. Natl. Acad. Sci USA 93 , 11652-11657; Ou, X., Blount, P., Hoffman, R.J., and Kung C. (1998) Proc. Natl. Acad. Sci. USA 95 , 11471-11475).
  • This property can be used to tune the activation potential of the channel in a method or vehicle of the invention. For instance, it is known that in tumors the pH is very often considerably lower than in the normal tissue surrounding the tumor. Other areas in the body that have a lowered pH are the liver, area's of inflammation and ischemic area's. A lower pH can be used as a trigger for activation of the MscL in a vehicle of the invention. Mutant MscL's are available that activate (open) in response to a pH that is frequently encountered in tumors. One non-limiting example of such a pH-sensitive mutant is the G22H mutant.
  • This mutant exhibits a higher open probability at (low) pH values that are frequently encountered in tumors, as compared to normal pH values of circulating blood (Yoshimura, K., Batiza, A., Schroeder, M., Blount P., and Kung, C. (1999) Biophys. J. 77 , 1960-1972).
  • said mutant allows preferred release of said small molecule in said target tissue.
  • a small molecule can be any hydrophilic molecule small enough to pass through the pore of a channel of the invention.
  • said small molecule comprises a diameter of no more than 60 ⁇ , more preferably no more than 50 ⁇ and still more preferably no more than 40 ⁇ .
  • Particularly peptides are preferred for the present invention.
  • Peptides typically have very poor pharmacodynamic properties when injected into the bloodstream. With the present invention it is possible to significantly increase the half life of peptides in the circulation.
  • by enabling controlled release of a small molecule with a vehicle of the invention it is also possible to have a relatively high bioavailability of the peptide at the predetermined site, whereas systemically the bioavailability is low or even absent. This also allows for the therapeutic use of molecules that are otherwise too toxic when bioavailable systemically.
  • Induction of availability of a small molecule by means of a proteinaceous channel in a vehicle of the invention can be achieved in many ways. For instance, by tuning of the composition of the lipid vehicle and/or the use of a mutant MscL it is possible to control how and where release of the small molecule will occur.
  • activation of said channel is triggered upon the availability of a signal.
  • the signal for activation can for instance be exposure of the vehicle to a certain pH, to light or to a certain temperature. Exposure to the signal can directly or indirectly (through an intermediary signal) lead to the activation of the channel.
  • said signal comprises light.
  • hydrophobic compounds such as azobenzene phospholipids and related compounds available (Song, X., Perlstein, J., and Whitten, D.G. (1997) J . Am. Chem. Soc. 119 , 9144-9159), that mix with the lipids in the vehicle, and that upon exposure to light undergo a structural change such that the gating of the MscL channel can be controlled. It is also possible to insert a photosenstive mutant MscL in the lipid vehicle. Upon exposure to light, a photoreactive molecule conjugated to a specific site of the MscL protein alters conformation thereby controlling the gating of the MscL channel.
  • Activation through light is just one example of an embodiment wherein opening/activation of the channel can be induced by another signal than membrane tension.
  • An alteration in the redox-potential is another non-limiting example.
  • MscL can be made sensitive to the local redox-potential after conjugation of a redox-sensitive molecule, such as a nicotinamide adenine dinucleotide derivative, to a specific site of the MscL protein.
  • a redox-sensitive MscL can be (de)activated by changing the redox-potential of the environment.
  • said signal comprises an altered pH, preferably said pH is equal or less then 6.5.
  • binding molecule Recognition of only the open conformation of MscL by a binding molecule is another non-limiting example of an embodiment that gating of the channel can be induced by another signal than membrane tension.
  • a binding molecule is preferably an antibody.
  • the binding molecule can for instance be used to preferentially increase the open probability of the channel near target cells.
  • a binding molecule capable of binding MscL in the open state is a preferred embodiment of an effector molecule that upon binding induces the vehicle to the substance available for the exterior at the predetermined site.
  • a vehicle comprising a proteinaceous channel can also in another way make the substance of interest available at the predetermined site.
  • said vehicle further comprises a targeting means.
  • a vehicle of the invention can be used to make the substance of interest available at the predetermined site.
  • the means for inducing availability can in these cases comprise the targeting means.
  • Targeting is preferably achieved using a binding molecule capable of binding to a target cell at said predetermined site. The binding of the targeting molecule holds the vehicle in place so that with gradual availability of the substance, the substance is still induced to become preferably available at the predetermined site.
  • said targeting means comprises PrtP or a functional part, derivative and/or analogue thereof.
  • said targeting means is capable of binding preferably to said target at the predetermined site.
  • a preferred targeting means of the invention comprises AcmA or AcmD type protein anchors.
  • AcmA type protein anchors can be made to bind its target preferentially in a pH dependent fashion.
  • a vehicle of the invention provided with AcmA is capable of inducible binding as a result of the signal pH.
  • suitable AcmA and AcmD proteins reference is made to the examples and to WO 99/25836.
  • substance can be made preferentially available to the predetermined site. Preferably availability is induced upon providing the binding molecule capable of binding MscL in the open state.
  • said means for inducing availability comprises both said AcmA protein and said binding molecule capable of binding MscL in the open state.
  • a bi-specific antibody comprising the above mentioned specificity for the open state and a specificity for a target cell can be used to accumulate open vehicles near target cells.
  • a signal that triggers activation of a MscL is local anesthetics (Martinac, B., Adler, J., and Kung, C. (1990) Nature 348, 261-263). Local anesthetics most probably work to activate the channel through their incorporation in the lipid bilayer, which changes the bilayer properties.
  • MTSES [2-(trimethylammonium)ethyl]methanethiosulfonate bromide
  • MTSET Various polar and non-polar variants of MTSET exist that can be used depending on whether the channel should be easier or more difficult to activate. It is also possible and for some applications even preferred to change the signal needed for activation of the channel from membrane pressure to another signal. Signals such as light, local anesthetics, pH, temperature, etc., can be used. For instance, through local illumination a circulating lipid vehicle can be triggered to release incorporated molecules only in the illuminated area of the body. This is an important additional advantage of having another signal or an intermediate signal than pressure for activation of the channel.
  • a vehicle of the invention comprises an asymmetrical bilayer.
  • An asymmetrical bilayer is yet another example of a method to tune the lipid vehicle such that the activation of the channel is altered.
  • a signal required for activation is provided through an intermediate.
  • the intermediate is here capable of transforming the given signal into a pressure signal thereby allowing, if sufficient, the opening of the channel.
  • the invention provides a composition comprising a lipid vehicle comprising a proteinaceous channel and a small hydrophilic molecule, wherein said lipid vehicle and/or said proteinaceous channel is formulated such that said proteinaceous channel is in the open state in the vicinity of a target cell.
  • said proteinaceous channel comprises an MscL or functional part, derivative and/or analogue thereof.
  • the invention provides a composition comprising a lipid vehicle comprising an MscL or functional part, derivative and/or analogue thereof, wherein said composition is formulated and prepared for use in a human.
  • said lipid vehicle comprises a small hydrophilic molecule capable of passing through an activated MscL.
  • said composition is used in the preparation of a medicament.
  • said small molecule is intended to be delivered to the outside of a cell in said tissue.
  • a composition as described is of course ideally suited to be used in a method of the invention.
  • said MscL is a mutant MscL or a functional part, derivative and/or analogue thereof.
  • a functional part of MscL comprises at least the region that in E.coli comprises residue 4 to 110 (Blount, P., Sukharev, S.I., Schroeder, M.J., Nagle, S.K., and Kung, C. (1996) Proc. Natl. Acad. Sci USA 93 , 11652-11657).
  • MscL proteins that comprise amino-acid substitution(s), insertion(s) and/or deletion(s) compared to the protein found in bacteria.
  • Such derivatives can of course also be used for the present invention provided that the derivative is functional, i.e. comprises the channel activity in kind, not necessarily in amount.
  • the channel activity may, as will be apparent from the description, be inducible by means other than pressure.
  • activity in kind is meant, the capability of the channel protein to allow passage of a hydrophilic substance from one side of the lipid obstruction to the other.
  • the amount of activity both in the amount of small molecules that may pass per time unit, or the size of the pore through which the small molecule can pass, may differ.
  • a derivative of MscL is also an MscL that comprise more or less or different (post-translational) modifications as compared to the native protein.
  • Other options with mutant or derivative channels would be using MscL with genetically engineered changes in the outside loop, like receptor recognizing domains (e.g. RGD) that upon binding with the receptor undergo conformation changes that induce opening of the channel.
  • RGD receptor recognizing domains
  • An MscL analogue is a molecule comprising the same activity in kind to allow passage of hydrophilic molecules through a lipid obstruction than MscL itself, not necessarily in amount.
  • the invention provides a method for generating a vehicle for delivery of a small hydrophilic molecule to a cell, said method comprising generating in an aqueous fluid, a lipid vehicle comprising a proteinaceous channel, said vehicle formulated such that said proteinaceous channel is in the open state in the vicinity of said cell.
  • said proteinaceous channel assumes said open state upon the presence of a signal in the vicinity of said cell.
  • said lipid vehicle further comprises said small molecule.
  • a lipid vehicle of the invention further comprises a non-channel protein.
  • said non-channel protein is a binding molecule capable of binding to a binding partner in said tissue thereby enabling at least a prolonged stay of said vehicle in said tissue and/or near a target cell.
  • the invention provides the use of a lipid vehicle comprising an MscL for controlling delivery of a small hydrophilic molecule to a target tissue in a body.
  • a lipid vehicle of the invention may be used to deliver a small molecule to any part of the body. However, preferably it is used to deliver to tissue with permeable endothelium such as the liver, the spleen, area's of inflammation or tumor bearing tissues.
  • a lipid vehicle of the invention can comprise lipid but may also comprise other molecules. Glycolipids or lipids modified in other ways, that maintain the classical bipolarity of a lipid molecule in kind, not necessarily in amount are also called lipids in the present invention.
  • said lipid vehicle comprises a liposome, more preferably a long circulating liposome. Long circulating liposomes are typically small (150 nm or smaller). Preferably said long circulating liposome comprises neutral lipid. Said long circulation liposome preferably comprises cholesterol with either phosphatidylcholine and PEG or sphingomyelin).
  • a vehicle of the invention may comprise a molecule that is regarded as foreign to the human body it is preferred in these cases that said vehicle further comprises a masking group.
  • a masking group at least in part prevents that the immune system of the individual to which said vehicle is administered, to respond to the vehicle.
  • MscL is typically a protein foreign to the human body, it is therefore conceivable that the immune system of a human administered with a vehicle comprising MscL, responds to said MscL either upon first administration or upon repeated administration.
  • masking groups can be attached to the outside of the vehicle of the invention.
  • said masking groups comprise PEG.
  • a vehicle comprising MscL comprises a gel or thickening agent.
  • said gel or thickening agent comprises an anionic polymer that under the influence of an electrical field decondensates and thus results in swelling of the polymer matrix.
  • said anionic polymer comprises Vietnamese (Qiu, Y. and Park, K., 2001, Advanced Drug Delivery Reviews 53: 321-339) Swelling can be achieved at field strenghts of 2.5V accross a 5 ⁇ m vehicle which corresponds to a field strength of 5000Vcm -1 . This is a factor of 10 less than the field strength needed to induce leakage of ions through the ion channels.
  • the swelling is translated into a membrane stress or internal pressure sufficient to induce opening of the MscL or functional equivalent thereof, thereby allowing availability of the compartment toward the exterior of the vehicle at the predetermined site.
  • the vehicle is the vehicle.
  • the vehicle can be generated using various means.
  • the vehicle may comprise a film that forms a barrier between the interior of the vehicle and the exterior.
  • the vehicle can comprise a gel which more or less traps the substance of interest in the interior.
  • Such gels may be continuous or discontinuous.
  • a vehicle of the invention comprises a gel and a film. In this way unintended leakage of the substance from continuous and discontinuous gels can at least in part be reduced.
  • said film comprises a membrane.
  • Said membrane preferably generates at least one compartment in said vehicle.
  • said inducing means comprise means to brake up or dissolve or otherwise interrupt the membrane. Creating a discontinuity in the membrane makes the compartment comprising the substance in the interior available to the exterior of the vehicle.
  • the membrane may consist of many different substances.
  • said membrane comprises lipid.
  • said membrane comprises a lipid bilayer.
  • the membrane comprises an amphiphile.
  • Amphiphile are capable of self-assembly to form vehicles in a predominantly polar or predominantly apolar environment. Amphiphiles are widely used for generation of membranes.
  • said amphiphile comprises a lipid, in particular a phospholipid.
  • Vehicles comprising such films are generically called liposomes.
  • a vehicle of the invention comprises a liposome or a functional equivalent thereof. Liposomes typically have a size between 50 and 2000nm. For use in human the size is preferable between 50 and 200 nm.
  • a functional equivalent of a liposome comprises a film comprising lipid, in particular phospholipid but with a smaller size, for instance the so-called nanosomes. Nanosomes typically have a size not exceeding 100 nm and are considered to be a functional equivalent of a liposome in the present invention.
  • Typical liposome formulations comprise (Banerjee, R.J., 2001, Biomat. Appli. 16:3-21).
  • the membrane comprises a cationic amphiphile. Since the introduction of the quaternary ammonium containing amphiphile dioleoyloxypropyl trimethyl ammonium choride by Felgner et al (Proc. Natl. Acad. Sci USA, 1987, Vol 84:7413-7417), which in combination with the phospholipid dioleoylphosphatidylethanolamine (DOPE) is commercially available as LipofectamineTM, many more cationic amphiphiles have been developed and marketed.
  • DOPE phospholipid dioleoylphosphatidylethanolamine
  • cationic amphiphiles having a pyridinium group, which is an aromatic ring comprising a nitrogen atom, as cationic part, for introducing biologically active compounds into eukaryotic cells have been developed and are disclosed in EP 0755924. (Miller, A.D., 1998, Angew. Chem.Int.Ed.Engl. 37: 1768-1785).
  • a film comprising a cationic amphiphile is therefore also part of the invention.
  • said cationic amphiphile comprises a cationic amphiphile having an aromatic ring comprising a nitrogen atom according to the following formula (I): in which:
  • Cationic amphiphiles comprise of an aromatic ring to which two carbon chains (R1 and R2) are attached.
  • the aromatic ring comprises a nitrogen atom.
  • One of the two carbon chains (R1) is attached to the nitrogen atom in the ring.
  • the second carbon chain (R2) is attached to the ortho-, meta- or para-position relative to this nitrogen.
  • Both groups R1 and R2 in the formula can be identical but this is not necessary.
  • A is CH 2 and is attached in the para-position relative to the nitrogen atom in the aromatic ring.
  • Preferred is also a cationic amphiphile wherein A is OC O and is attached in the meta-position relative to the nitrogen atom in the aromatic ring.
  • R1 is a carbon chain selected from the group consisting of C16, C18, C20 and C22 carbon atoms, optionally containing one or more double or triple carbon-carbon bonds or combinations thereof and R2 is selected from the group consisting of C14, C16 and C18 carbon atoms, optionally containing one or more double or triple carbon-carbon bonds or combinations thereof.
  • R1 is a carbon chain selected from the group consisting of C16, C18, C20 and C22 carbon atoms, optionally containing one or more double or triple carbon-carbon bonds or combinations thereof and R2 is selected from the group consisting of C11, C13, C15 and C17 carbon atoms, optionally containing one or more double or triple carbon-carbon bonds or combinations thereof.
  • R1 is longer than R2.
  • the carbon chains R1 and R2 are linear alkyl chains of 6-24 carbon atoms.
  • one of the two or both carbon chains comprise one or more unsaturations in the form of double or triple carbon-carbon bonds.
  • the carbon chains comprise, optionally in combination with one or more unsaturations, one or more heteroatoms in the chain and/or one or more functional groups in the chain and/or substitutions on the chain.
  • the carbon chain is branched. Preferably such branching does not occur on the first six carbon atoms calculated starting from the aromatic ring. Such branching can occur in combination with the presence of unsaturated carbon-carbon bonds and also in combination with the presence of heteroatoms in the chain and/or with the presence of functional groups and/or in the presence of substitutions.
  • the carbon chain R1 on the aromatic nitrogen atom comprises an aromatic group.
  • the aromatic group can be a phenyl group.
  • the aromatic group, represented by Ar, in R1 is positioned near the nitrogen atom containing the aromatic ring. Near in this respect means that the carbon chain connecting the nitrogen containing aromatic ring and the aromatic group in R1 is of such a length that "backfolding" of R1 towards the nitrogen atom containing aromatic ring allows alignment of the aromatic group in R1 with the nitrogen atom containing aromatic ring.
  • R3 is a C2-C10 carbon chain.
  • A-R2 in the ortho-, meta- or para-position relative to R3, in which R2 is defined as above and A as will follow.
  • Another particular embodiment is a cationic amphiphile in which Ar is a heteroaromatic ring.
  • a heteroaromatic ring is an aromatic ring comprising one or more heteroatoms such as O, N and S.
  • Ar is a heteroaromtaic ring which comprises a nitrogen atom.
  • R3 is attached to the nitrogen in this aromatic ring Ar.
  • A-R2 is attached.
  • R1 is directly attached to the nitrogen atom in the aromatic ring.
  • R2 is attached to a carbon atom in the aromatic ring via group A.
  • X- represents a physiologically acceptable anion.
  • the cationic amphiphiles of the invention can be used for in vitro as well as in vivo purposes. In this respect it may vary what anions are physiologically acceptable. The skilled person will be able to determine for what purpose which anion may be suitable. Examples of suitable anions are Cl - , Br - , I - , HSO 4 - , H 2 PO 4 - , ClO 4 - and organic anions such as CH 3 CO 2 - , - O 2 CCO 2 - and the like.
  • R1 and R2 groups in preferred cationic amphiphiles may contain one or more unsaturated carbon-carbon bonds.
  • the R1 and R2 groups may contain, in any position, one or more heteroatoms such as O, N and S. Such a heteroatom can be part of a functional group.
  • R1 and R2 may contain, in any position one or more functional groups such as ethers, disulphides, esters, amides, phosphates, imines, amidines and the like.
  • R1 or R2 or both may also comprise fluorescent groups, such as fluorescein rhodamine, acridine, diphenylhexatrienepropionic acid and the like in the chain or as substituent attached to the chain or, R1 and/or R2 may comprise or be substituted with radioactive labels.
  • substituents that can be involved in targeting of cells. For instance ligands for particular receptors on cells or antibodies or parts of antibodies comprising binding domains for a particular epitope at or in the neighbourhood of the site where the incorporated biologically active compound has to exert its activity can be attached to R1 and/or R2.
  • Such targeting substituents can be attached directly or for instance through a spacer.
  • functional groups and/or substituents that can be involved in the release from endosomes in cells such as pH labile groups or substituents can be of interest.
  • the carbon chains in the vicinity of the nitrogen containing aromatic ring are substituted with groups introducing additional positive charge such as for instance amino groups that are protonated under physiological conditions and trialkylammonium groups.
  • groups introducing additional positive charge such as for instance amino groups that are protonated under physiological conditions and trialkylammonium groups.
  • substituents which can be involved in hydrogen bonding are considered.
  • Cationic amphiphiles can be synthesised following known procedures such as described in EP 0755924 and as will be further illustrated in the examples.
  • 4-methylpyridine is treated with base and subsequently mono-alkylated on the 4-methyl group to introduce R2.
  • the nitrogen in the pyridine ring is quaternized with an alkyl halide to introduce R1 followed by ion-exchange to obtain the desired X - as counterion.
  • the general known method described above is not always satisfactory.
  • it has been found that cationic amphiphiles that would not be available in an economic acceptable manner using known procedures can be synthesised by applying the microwave technique in the procedure.
  • the attachment of R1 to the nitrogen in the aromatic ring is carried out under microwave conditions.
  • the attachment reaction is particularly substitution of a halide in the group to be attached.
  • the skilled person will be able to determine the optimal reaction time and settings for the microwave oven.
  • the reaction time and settings are given in detail in the examples.
  • said film comprises a hydrophobin.
  • Hydrophobins are capable of forming tight membranous structures that are impermeable to fluid or dissolved molecules.
  • the membranes can be very thin.
  • Hydrophobin membranes are particularly suited in vehicles that also comprise a viscous material and/or a lipid membrane. In these cases undesired leakage of the substance from the vehicle can be prevented to a large extent. Particularly for vehicles comprising viscous material and/or lipid membranes leakage is a problem.
  • said film comprises an amphiphile and a hydrophobin and/or rodlin. Vehicles of this preferred embodiment are less prone to release of the substance of interest in the absence of induction of availability. These vehicles are less leaky, thereby allowing more control over the availability of the substance of interest at the predetermined site.
  • Hydrophobins are a well-defined class of proteins (described in Wessels, 1997 Adv. Microb. Physiol. 38, pp 1-45) capable of self-assembly at a hydrophobic-hydrophilic interface, and having a conserved sequence wherein X represents any amino acid, and n and m represent an integer.
  • a hydrophobin has a length of up to 125 amino acids.
  • the cysteine residues (C) in the conserved sequence are part of disulfide bridges.
  • hydrophobin has a wider meaning to include functionally equivalent proteins, and encompass a group of proteins comprising the sequence or functional parts thereof still displaying the characteristics of self-assembly at a hydrophobic-hydrophilic interface resulting in a protein film.
  • Means and methods for the manipulation, purification and the formation of films comprising hydrophobin are described or can be derived from (Lugones, L.G. et al., 1998, Microbiology 144 (Pt8):2345-2353; Martin, G.G.
  • a vehicle of the invention may comprise a gel, either alone or in combination with a film. Any type of gel may be used for the vehicle of the present invention as long as said vehicle comprises a means for inducing availability of a compartment formed by the gel at the predetermined site.
  • the gel may comprise a so-called organogel, a hydrogel or a combination of both.
  • organogels such as (a) amino acid type,b) carbohydrate derived, c) bis urea derivatives, d) steroid derivatives, e) fatty acid derivatives (J. van Esch, F. Schoonbeek, M. de Loos, M. Veen, R.M. Kellogg, B.L.
  • hydrogels such as a) amino acid based (F.M. Menger, K.L. Caran, J. Am. Chem. Soc , 2000, 122, 11679), b) carbohydrate derived (J.H. Jung, M. Amaike, K. Nakashima, S. Shinkai, J. Chem. Soc, Perkin Trans. 2, 2001, 1938), c) bis urea derivatives, d) cis,cis 1,3,5-trisubstituted cyclohexane derivatives.
  • said gel comprises a so-called thermally reversible gelling or thickening agent.
  • a gel is formed from reversible gelling in solvents (typically organic solvents) of low molecular weight compounds, These gelators are of particular interest for many technical applications. The self assembly of these gelator molecules often occurs by means of non-covalent interactions such as hydrophobic interaction, ⁇ - ⁇ interactions, electronic interactions, hydrogen bonding or combinations thereof.
  • solvents typically organic solvents
  • a suitable gel for the present invention can be found in Kiser et al, (Nature 394, 1998, 459-462).
  • a preferred gelling or thickening agent of the invention therefore relates to a gelling agent in the form of a N,N'-disubstituted aldaramides and N,N'-disubstituted pentaramides and derivatives thereof.
  • the gelling or thickening agent relates to a gelling agent having the following structure wherein n is 3 or 4, and wherein R and R' represent the same or different substituents chosen from the group of substituted or unsubstituted, branched, possibly aromatic groups containing, cyclic or linear alkyl, alkenyl, alkynyl groups having from 1 to 40 carbon atoms.
  • R and R' each represent independently a linear, branched, or cyclic alkyl group having 4-20 carbon atoms. More preferred is that R and R' each are independently selected from the group of cycloalkyl groups having 4-16 carbon atoms.
  • R and R' represent the same substituent.
  • the present gelling agents or thickeners can be based on naturally occurring products, such as carbohydrates.
  • the starting materials for producing them are from a renewable source.
  • a gelling agent or thickener according to this embodiment of the invention may be prepared by converting an aldose or pentose to its corresponding aldaric or pentaric acid, or a salt thereof, such as an alkali metal salt or an (alkyl)ammonium salt. It is preferred to use an aldose or pentose chosen from the group of allose, altrose, glucose, mannose, gulose, idose, galactose, talose, ribose, arabinose, xylose, lyxose and derivatives thereof, as these lead to products having particularly favorable gelling and/or thickening properties.
  • Suitable derivatives of the mentioned aldoses and pentoses include deoxy aldoses or pentoses, ethers, esters and the like.
  • D-glucose is chosen as aldose.
  • the conversion of the aldose or pentose to its corresponding aldaric or pentaric acid is generally achieved by oxidation.
  • the oxidation can suitably be carried out using Pt/O 2 ,TEMPO/NaOCl/(NaBr) or HNO 3 /(NaNO 2 ) as an oxidizing agent. Further details for the manner in which the oxidation may be carried out can be found in US patents 5,831,043, 5,599,977 and 6,049,004, and in J. Org. Chem., 1977, 42, 3562-3567; J-F. Thaburet et al ., Carbohydr. Res. 330 (2001), 21-29, all of which are incorporated herein by reference.
  • the thus obtained aldaric or pentaric acid or salt thereof is subsequently condensed with a primary amine to obtain the objective gelling agent or thickener.
  • the aldaric or pentaric acid can be condensed with an amount of at least 200 mole%, with respect to the aldaric or pentaric acid, of a primary amine. It is preferred to activate the aldaric or pentaric acid first by means of lactonization and/or esterification, depending on the stereochemistry of the carbohydrate. Further details may be found in Kurtz et al., J. Biol. Chem., 1939, 693-699; Hoagland, Carbohydrate Res., 1981, 98, 203-208, and US patent 5,312,967, which are incorporated herein by reference.
  • non-symmetrical N,N'-dialkylaldaramides or N,N'-dialkylpentaramides may be prepared, wherein R and R' represent different substituents.
  • the aldaric or pentaric acid may be converted into an N-alkyl-1-aldar/pentaramid-6-ate or N-alkyl-6-aldar/pentaramid-1-ate (as disclosed in US patent 5,239,044; L. Chen et al ., J. Org. Chem., 61 (1996) 5847-5851; R. Lee et al ., Carbohydr. Res. 64 (1978) 302-308; and K. Hashimoto et al ., J.
  • the thus obtained gelling agent or thickener precipitates from the reaction mixture in which it is formed and can be easily isolated by filtration. Further purification can be performed by conventional techniques like crystallization or, in the case of products based on galactaric acid derivatives, by thoroughly washing with ethanol, water, acetone or hexane.
  • the use of the present gelling agents or thickeners to prepare a gel or to thicken a composition is also encompassed by the invention.
  • gelling behavior of compounds or compositions is highly unpredictable.
  • a solution of a specific compound in a solvent e.g. an organic solvent
  • the gelling phenomenon is thermoreversible.
  • the present compounds may be used as a thickener or rheology controlling agent as their addition to a composition may give rise to an increase in viscosity of the composition.
  • compositions in which the present compound have been found to produce a gel include compositions in numerous organic solvents.
  • Preferred examples include aromatic and non-aromatic hydrocarbons, alcohols, ethers, esters, aldehydes, alkanoic acids, epoxides, amines, halogenated hydrocarbons, silicon oils, vegetable oils, phosphoric esters, sulfoxides and mixtures thereof.
  • the compound also produces a gel in hydrophilic solvents such as water.
  • the choice of composition for gelling can be tuned to the invented use. For instance in situations where clinical application of a vehicle of the invention is intended biocompatibility of the composition is preferred.
  • the gelling agent or thickener is preferably mixed with the composition to be transformed to a gel in an amount of between 0.01 and 50 wt.%, based on the weight of the composition.
  • the mixture of the gelling agent or thickener and the composition is heated to allow for an even better gel formation or thickening. Typically, the heating will involve raising the temperature of the mixture to about 30 - 175 °C until a clear solution is obtained.
  • the gelling agent is first dissolved in a polar or apolar solvent and then added to or sprayed into a composition or solvent to be converted into a gel.
  • the conditions may be changed such that those favorable for gelling are used to prepare the gel, whereupon the gelforming conditions are altered, removed or replaced by conditions favoring other aspects, such as the formulation of a biocompatible gel.
  • the substance to be made available in an induced way at the predetermined site is incorporated in the gel at the time of gelformation. However, this need not always be true. Substance may also be allowed to enter a preformed gel under the appropriate conditions.
  • the substance to be made available i.e. the substance of interest
  • This is preferably achieved by allowing for an interaction of the substance with the gel. Said interaction can be achieved using a covalent bond or a non-covalent bond.
  • release of the substance from the gel can be achieved in a number of ways known to the person skilled in the art and depending on the type of gel, substance and environment.
  • said gelling and or thickener agent comprises a light switchable gelator.
  • Photo-controlled gelation has been reported by Murata et al., J. Am. Chem. Soc., (1994), 116, 6664-6676. They disclose certain cholesterol-azobenzene derivatives which isomerize from the trans-state into the cis-state upon irradiation with light.
  • Gelators comprising a light switch resulting in altered gelling behaviour between the ground state and the light-activated state are very suited for a vehicle of the invention.
  • a further suitable light-switchable gelator is provided by the invention.in the from of a light-switchable gelator is provided having the formula (III): wherein
  • a compound according to the invention can be used to form a stable gel.
  • the gellation phenomenon can be induced by light and has been found to be reversible. This opens a wide range of possible applications of a compound according to the invention, including the generation of a delivery vehicle for delivering a substance of interest to a predetermined site.
  • An additional advantage of use of a light-switchable gelator with said characteristics is that induction of availability of said substance can be achieved by providing the correct light at the pre-determined site.
  • the means for inducing availabiltiy include the signal comprising of the correct type of light and the receptor comprising the light-switchable gelator.
  • the alkyl group refers to a straight-chain or a branched-chain alkyl radical containing from 1 to 10, preferably from 1 to 8, carbon atoms.
  • the term (cyclo)alkyl group refers to an alkyl group or a cyclic alkyl radical. The latter includes saturated or partially saturated monocyclic, bicyclic or tricyclic alkyl radicals wherein each cyclic moiety contains 3 to 8 carbon atoms.
  • radicals include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, iso-amyl, hexyl, octyl, cyclopentyl, cyclopentenyl, cyclohexenyl and cyclohexyl.
  • aryl group for the compound of the formula (III) refers to an aromatic or hetero-aromatic ring system, such as a phenyl, naphtyl or anthracene group, preferably a phenyl, radical which optionally carries one or more substituents chosen from the group of alkyl, methoxy, halogen, hydroxy, amino, nitro, and cyano.
  • substituents chosen from the group of alkyl, methoxy, halogen, hydroxy, amino, nitro, and cyano.
  • examples of such radicals include phenyl, p-tolyl, 4-methoxyphenyl, 4-(tert-butoxy) phenyl, 4-chlorophenyl, 4-hydroxyphenyl, 1-naphtyl, and 2-naphtyl.
  • aralkyl group means an alkyl radical as defined above in which one hydrogen atom is replaced by an aryl radical as defined above, such as benzyl, or 2-phenylethyl.
  • the invention relates to a light-switchable gelator as defined above having the formula (IV): wherein R 1 and R 3 are both methyl, and the other symbols having the same meanings as defined above. It is further preferred that R 2 and R 4 each are hydrogen or a methyl group. Preferably, R 2 and R 4 have the same meaning.
  • M 1 and M 2 have the same meaning.
  • M 1 and M 2 are phenyl or -CR 9 R 10 R 11 , wherein R 9 is hydrogen, R 10 is cyclohexyl, cyclopentyl, or an aryl group, and R 11 is an alkyl group.
  • M 1 and M 2 are phenyl, -CH(CH 3 )(C 6 H 5 ), or -CH(CH 3 )(C 6 H 11 ).
  • the invention further relates to a process for preparing a light-switchable gelator as described above.
  • suitable starting materials are materials having formula (I) wherein X is (CH 2 ) 3 , Y and Z are sulfur, R 1 and R 3 represent a CH 3 group, R 2 and R 4 are hydrogen, and A 1 and A 2 are each chosen from the group of hydrogen, chloride, bromide and iodide.
  • These materials may be prepared using any known method. Suitable ways of preparing them have been disclosed in Lucas et al., Chem. Commun., 2001, 759, and Lucas et al., Chem. Commun., 1998, 2313, the contents of which are incorporated herein by reference.
  • the starting materials may be converted to produce a gelator according to the invention according to the reaction scheme shown in Figure 18, which illustrates a convenient preparation method starting from the above mentioned starting materials wherein A 1 and A 2 are both chloride (compound Z , figure 18).
  • these materials may be converted to their corresponding formyl derivatives (compound A , Figure 18), for instance by reaction with n-butyl lithium and dimethylformamide. It will be understood that other lithiating agents can also be used.
  • a solvent any ether may be employed. Preferred solvents are tetrahydrofuran (THF) and diethyl ether.
  • THF tetrahydrofuran
  • the temperature at which the lithiation reaction can be performed may range from -80°C to 50°C, but is preferably between -10°C and 10°C, more preferably around 0°C.
  • the formyl group may be converted to a carboxylic acid group to produce a diacid derivative (compound B , Figure 18).
  • a diacid derivative compound B , Figure 18
  • This is may be done using any oxidizing agent, but is preferably involves silver oxide in water under reflux conditions as described by Gronowitz et al., Heterocycles, 1981, 15, 947.
  • the starting material is directly converted to the diacid derivative by quenching the reaction mixture with solid or gaseous carbon dioxide after lithiation has taken place, as described by Norsten et al., J. Am. Chem. Soc., 2001, 123, 1784. It is furthermore possible to perform this step by quenching with a carbamate in order to obtain the corresponding ester, which can be hydrolysed to the diacid.
  • the final step involves the transformation of the carboxylic acid derivative to the desired amide derivative, by known methods involving first the activation of the carboxylic acid, and secondly reaction of the activated carboxylic acid with the amine ( Figure 18) (see e.g. J. March, Advanced Organic Chemistry, Wiley, NY, 1992)
  • the diacid derivative ( B ) is treated with N-methylmorpholine and subsequently activated with 2-chloro-4,6-dimethoxytriazine in any chlorinated solvent, such as CH 2 Cl 2 , or ether or dimethylformamide, at a temperature which may vary between -50°C and 30°C, but is preferably between -5°C and 5°C.
  • N-methylmorpholine can be substituted for any other suitable base.
  • Compounds with A 1 and A 2 groups present can be synthesized via a cross coupling reaction, preferably the Suzuki-coupling.
  • the same compound as described above ( Z ) can be used as starting material.
  • the compound is lithiated first (see above) and subsequently quenched with a boronic ester, preferably n-butyl boronic ester.
  • the formed bis boronic ester derivative is directly used in the cross coupling reaction with a compound of the formula Q 1,2 -A 1,2 -(CR 5,7 R 6,8 ) m,o -P 1,2 , in which Q 1,2 can be Cl, Br or I, but preferably Br or I, and P 1,2 is an amine or carboxylic acid, or any functional group which can be converted to an amine or carboxylic acid.
  • the solution of the bis boronic ester may be added, preferably dropwise, to a mixture of Q 1,2 -A 1,2 -(CR 5,7 R 6,8 ) m,o -P 1,2 , a catalyst, base and a few drops of ethylene glycol just below reflux temperatures.
  • the solvent is preferably THF, but also other ethers, or aromatic solvents like toluene can be used.
  • the catalyst can be any palladium-, iron- or nickel catalyst, but is preferably palladium tetrakistriphenylphosphine (Pd(PPh 3 ) 4 ).
  • a solution of Na 2 CO 3 in H 2 O or Na 2 CO 3 xH 2 O is preferably used, however, any other inorganic base can also be used.
  • a modified Suzuki reaction can be used in which only one side of the molecule undergoes this reaction. This can be accomplished by using the procedure described above for the synthesis of the bis boronic ester derivative wherein only one equivalent of the lithiating agent is used. In this way only one boronic ester per molecule is formed (bis and no substitution less than 5%). This mono boronic ester derivative is then coupled to one equivalent of Q 1 -A 1 -(CR 5 R 6 ) m- P 1. This reaction sequence can be repeated with a different Q 2 -A 2 -(CR 7 R 8 ) o -P 2 to give a the non-symmetrical substituted precursor for the objective gelator.
  • Functional group P can be converted to a carboxylic acid group or an amine ( Figure 19).
  • P is a halogen it can be transformed to an azide, which can be reduced to an amine or it can react with succinimide to form a protected amine.
  • P is a nitro group, which can be reduced to an amine.
  • P can be an aldehyde which can be oxidized to a carboxylic acid.
  • P is a nitrile group, it can be hydrolysed to a carboxylic acid.
  • the amine in its turn can be converted to a urea group or an amide by known methods (ref J. March, Advanced Organic Chemistry, Wiley, NY, 1992). ( Figure 19).
  • the carboxylic acid can be converted to an amide ( Figure 19).
  • the carboxylic acid precursors are then converted to the corresponding carboxylic acid azides, which in an Curtius rearrangement are converted to the corresponding isocyanates by known methods (ref J. March, Advanced Organic Chemistry, chapter 18, Wiley, NY,1992).
  • the isocyanate can be turned into an urea group by means of an amine.
  • the symmetric precursor compound P 1,2 is a methyl ester.
  • the ester can be hydrolysed to the corresponding carboxylic acid.
  • the hydrolysis can be carried out using any standard saponification conditions, e.g. with a base in water or a water/organic solvent mixture.
  • 4M NaOH in a water/THF mixture is used ( Figure 20).
  • This compound can thus be treated in the same way as described above in order to obtain the amide derivatives, or used as starting material to prepare a bis-urea derivative or -NHCO- group (see above and Figure 19).
  • 1,4-dibromobenzene is used in a Suzuki reaction with compound Z ( Figure 21). In this way a precursor with a halogen is synthesized.
  • the invention further relates to the use of a light-switchable gelator as described herein to prepare a gel.
  • a gel may be prepared by dissolving the gelator in a suitable solvent by heating (if necessary), and subsequently inducing gel formation by cooling and/or irradiating it with light.
  • Suitable solvents may be chosen from the group of aliphatic hydrocarbons, aromatic hydrocarbons, halogenated hydrocarbons, non-aromatic hydrocarbons, aromatic solvents, alcohols, ethers, esters, aldehydes, alkanoic acids, epoxides, amines, silicon oils, vegetable oils, phosporic esters, sulfoxides, ketones and mixtures thereof.
  • Preferred solvents are hydrocarbons, aromatic hydrocarbons and other aromatic solvents.
  • a light-switchable gelator of formula (III) or formula (IV) will typically be present in the solution in a concentration of between 0.01 and 10 wt.%, based on the weight of the solution.
  • the temperature needed in order to form a gel will depend on the solvent chosen as well as on the exact structure of the gelator and its concentration.
  • the mixture of the gelling agent and the solvent is heated to dissolve the gelling agent, and subsequent cooling allows the formation of a gel.
  • the heating will involve raising the temperature of the mixture to about 30 - 175°C.
  • the minimal temperature needed to achieve gelation will lie in the range of -10 to 100°C, preferably in the range of 30 to 80°C.
  • the gelation process can be monitored by rheology, microscopic methods, and spectroscopic methods.
  • M 1 and/or M 2 are chiral
  • gelation results in a strong enhancement of the elipticity of the samples as measured by circular dichroism (CD) spectroscopy.
  • gelators according to the present invention can exist as two thermally stable valence isomers, which can be converted into each other by irradiation with light in the range of 200-800 nm ( Figure 22). It will be understood that both valence isomers are encompassed by the invention.
  • Irradiation of the open form of the gelator causes conversion to a photostationary state (PSS) in which the ring closed form is predominant, and irradiation of the PSS with light of higher wavelength ( ⁇ 2 ) causes conversion to the open form of the gelator.
  • ⁇ 1 is preferably in the range of 250 to 600 nm, and even more preferably 300 to 450 nm
  • ⁇ 2 is preferably in the range of 350 to 900 nm, and even more preferably 450 to 700 nm.
  • the isomerization process can be monitored by spectroscopic methods, and especially UV-VIS spectroscopy, due to the presence of a strong absorption of the closed form with a maximum between 400 and 700 nm, which is absent for the open form.
  • a gelator with the structure of formula IV can be switched from the open form to the closed form by irradiation with light between 300nm and 450 nm, which is accompanied by an change of the melting point of the gel by 5-50°C, the exact value depending on the structure of the gelator, the solvent used, and the concentration of the gelator.
  • the melting point of the closed form of a gelator according to Formula IV is by 5-50°C higher than that of the open form, and gel formation in solutions of the closed form of the gelling agent is faster than gel formation in solutions of the open form.
  • the differences in thermal stability and kinetics of gelation between the open and closed form of the gelators may be exploited to induce gel formation by irradiation with light.
  • photoinduced gelation can be achieved at a temperature between the melting point of the open and closed form, by irradiation of such a solution with light of wavelength ⁇ 2 which causes isomerization from the closed to the open form.
  • a gel of the open form has a lower melting temperature than that of the closed form, and gelation can be achieved at a temperatures between the melting point of the open and closed form, by irradiation of such a solution with light of wavelength ⁇ 1 which causes isomerization from the open to the closed form.
  • a solution of a gelator according to Formula II is cooled to 10-50°C below the melting point, and irradiation of such a solution with light of wavelength ⁇ 1 causing isomerization to the PSS (see above) together with gelation within 10 minutes, whereas a similar nonirradiated solution does not turn into a gel within this period.
  • gelation by a gelator according to the invention is reversible. This reversibility also holds for the photo-induced isomerization processes, and all the photo-induced gelation processes described above can be reversed by performing the back-isomerization by irradiation with light as depicted in Figure 22. It is clear that both the induction of gel-formation and the reverse process by switching between open or closed states can be used to work the present invention. Induction of gel-formation in or of a vehicle of the invention can be used to limit availability at sites that are not the predetermined site, where the induction of fluidization of the gel is typically used to allow for availability of the entrapped substance at the predetermined site. However, the reverse is also true.
  • the substance when the substance is made available to bind another compound at the predetermined site whereupon inadvertent release of the bound other compound or substance at further sites should be at least in part prevented.
  • said gel or components thereof are enclosed in a film.
  • the film in this embodiment at least in part prevents leakage of the loose components and substrate in the fluidized state at the predetermined site.
  • the substrate is maximally available for binding another compound at the predetermined site.
  • Inadvertent release of substrate or compound bound thereto can then be at least in part prevented by providing light of the wavelength suitable to induce gel-formation thereby effectively trapping the substance and bound compound in the gel at or subsequent to passage from the predetermined site.
  • the predetermined site can be any site where said compartment should be made available toward the exterior of said vehicle.
  • a predetermined sites preferably comprises a site in a mammalian body. Preferably, a human body. Said site can be, on the outside of said body for instance the skin or eye.
  • Preferably said site is an internal site.
  • An internal site is preferably characterised by a certain molecule that is present at said predetermined site.
  • said characterising molecule is not present at other sites in said body.
  • said characterising molecule is present on a cell.
  • said target molecule is used to target the vehicle of the invention to the predetermined site. It is possible to use a vehicle comprising a targeting means.
  • a targeting means is meant a means for concentrating the vehicle at the predetermined site.
  • a targeting means is typically provided to the vehicle, though this is not necessarily so.
  • Targeting means typically comprises proteinaceous molecules capable of specifically binding a target molecule. Concentration at the predetermined site can in these situations be achieved by providing a targeting means for target that is specifically present at the predetermined site. It is possible that the target is also present at "a limited number" of other sites. In these cases it is preferred that the means for inducing availability of said compartment are not responsive to conditions at these "limited number" of other sites.
  • a preferred such means comprises a pH-sensitive AcmA protein.
  • the inducing means are responsive, and thus induce availability of the said compartment at a number of these other sites, it is still possible to achieve advantageous effects with a delivery vehicle of the invention, depending on the nature of the other sites where the compartment is made available. It can be that at the mentioned other sites, the substance is less toxic, or that limited loss of substance at non-relevant site can be tolerated without affecting the effectivity of a delivery vehicle of the invention. Similarly it is within the scope of the invention that said inducing means is also active at a limited number of other site, independent of the presence or absence of a targeting means. Such activation of the inducing means at other than relevant sites can be tolerated to some extent as long as the reasons for which a delivery vehicle of the invention was used are not negated.
  • a vehicle of the invention further comprises a targeting means for directing said vehicle to said predetermined site.
  • a preferred internal predetermined site is the blood stream, where compound should be made available without suffering from rapid clearance or deactivation problems typical for peptidic substances.
  • Other preferred internal sites are the lymph, the gastro-intestinal tract, the urogenital system, the central nervous system, the respiratory system, the peritoneum, organs and tumor.
  • sites comprise invading organisms such as bacteria, fungi, yeast and virus, such sites can for instance comprise of a certain tissue or cell type that is otherwise distributed throughout, or over more places in the body.
  • Targeting to invading micro-organisms is preferably achieved using AcmA, AcmD protein anchors.
  • suitable AcmA and AcmD proteins reference is made to the examples and to WO 99/25836.
  • the substance of interest is the substance of interest.
  • any type of substance can be made available using a vehicle of the invention.
  • Substances can range from herbicides, insecticides, cosmetics and drugs.
  • the vehicle is used in a mammalian body or for mammalian cells the substance preferably comprises a biologically active substance.
  • a biologically active substance can be any substance. Examples of suitable substances include,
  • Example 1-A MscL-containing liposomes as drug delivery vehicles
  • E.coli PB104 cells containing the plasmid pB104 carrying the MscL-6His construct was grown to mid-logarithmic phase in Luria Bertani medium (10L fermentor) and induced for 4 h with 0.8 mM IPTG [Blount, P. et al., 1996, EMBO J. 15: 4798-4805]. Cells were French-pressed and membranes were isolated by differential centrifugation, as previously described [Arkin, I.T. et al., 1998, Biochim.Biophys.Acta 1369: 131-140].
  • the membrane pellet (5-8 g wet weight) was solubilized in 100 mL of buffer A (50 mM Na 2 HPO 4 .NaH 2 PO 4 , 300 mM NaCl 10 mM imidazole) containing 3% n-octyl ⁇ -glucoside.
  • buffer A 50 mM Na 2 HPO 4 .NaH 2 PO 4 , 300 mM NaCl 10 mM imidazole
  • the extract was cleared by centrifugation at 120 000 x g for 35 min, mixed with 4 mL (bed volume) Ni 2+ -NTA agarose beads (Qiagen, Chatworth, CA) equilibrated with buffer A and gently rotated for 15 min (batch loading).
  • the column material was poured into a Bio-Spin column (Bio-Rad) and washed with 10 column volumes of buffer B (as buffer A, except 1% n-octyl ⁇ -glucoside) followed by 5 column volumes of the buffer B but with 100 mM imidazole.
  • the protein was eluted with buffer B but with 300 mM imidazole.
  • Eluted protein samples were analysed by fractionation on a SDS-15 % polyacrylamide gel followed by staining with Coomassie Blue or transferring the fractionated proteins to PVDF membranes by semi-dry electrophoretic blotting for immunodetection with a anti-His antibody (Amerham Pharmacia Biotech). Immunodetection was performed with an alkaline phosphatase conjugated secondary antibody as recommended by the manufacturer (Sigma). Electrospray Ionization Mass Spectrometry of Detergent Solubilized MscL proteins.
  • the single cysteine mutant, G22C-MscL-6His was labeled with (2-sulfonatoethyl)methanethiosulfonate (MTSES) .
  • MTSES (2-sulfonatoethyl)methanethiosulfonate
  • Dry lipid mixtures were prepared by co-dissolving lipids (Avanti Polar Lipids, Alabaster, AL) in chloroform, in weight-fractions as indicated in the experiments, and removing the chloroform by evaporation under vacuum for 4 h. All acyl chains of the synthetic lipids were of the type, dioleoyl, unless indicated otherwise.
  • the dried lipid film was dissolved (20 mg/mL) in 50 mM potassium phosphate, pH 7.0, followed by three freeze/thaw cycles. An aliquot, 200 ⁇ L of the rehydrated liposomes and 5% n-octyl ⁇ -glucoside, was added to 200 ⁇ L purified 6His-MscL.
  • MscL was reconstituted into liposomes of different lipid composition and aliquots of 200 ⁇ L were centrifuged at 48 000 rpm in a tabletop ultracentrifuge (Beckmann). Pelleted proteoliposomes were resuspended into 40 ⁇ L buffer C (10 mM 4-morpholinepropanesulfonic acid (MOPS)-buffer, 5% ethylene glycol, pH 7.2), and 20 ⁇ L droplets were subjected to dehydration-rehydration cycle on glass slides [Delcour, A.H. et al., 1989, Biophys.J. 56: 631-636]. Rehydrated proteoliposomes were analysed employing patch-clamp experiments as described previously [Blount, P. et al., 1996, EMBO J. 15: 4798-4805].
  • MOPS 4-morpholinepropanesulfonic acid
  • Excitation and emission wavelengths were, respectively, 490 (slit 2 nm) and 520 nm (slit 4 nm).
  • the experiments were performed at lipid concentrations of approximately 50 ⁇ M.
  • Control, and MscL-containing liposomes were prepared as described above followed by mixing with an equal volume of 200 mM calcein in PBS buffer. Then a freeze-thaw cycle has been repeated three times followed by extrusion through a 100 nm polycarbonate membrane [Mayer, L.D. et al., 1986, Biochim.Biophys.Acta 858: 161-168].
  • the liposomes were separated from free calcein by using Sephadex 50 column chromatography equilibrated with PBS (160 mM NaCl 3.2 mM KCl, 1.8 mM KH 2 PO 4 , 0.12 mM Na 2 HPO 4 , 1.2 mM EGTA, pH 8.0), which was isotonic to the calcein-containing buffer.
  • PBS 160 mM NaCl 3.2 mM KCl, 1.8 mM KH 2 PO 4 , 0.12 mM Na 2 HPO 4 , 1.2 mM EGTA, pH 8.0
  • His-MscL Since the expression level of His-MscL in E. coli was relatively low, based on the absence of a significant IPTG-inducible band on a SDS-PAGE, attention was focused on obtaining a high biomass during fermentation and a high yield after protein purification.
  • the His-tagged MscL could be purified to apparent homogeneity in a single step using nickel chelate affinity chromatography as shown by SDS-PAGE (Fig. 1, lane B). The yield of this eluted His-tagged MscL was ⁇ 2 mg per Liter of cell-culture with an estimated purity of >98% based on analysis using SDS-PAGE and Coomassie Brilliant Blue staining.
  • the rate of excretion via MscL of small molecules is > 10 000 nmol/sec. x mg of cell protein, i.e. when the protein is in the open state. Since the expression level of mscL in wild-type bacteria is 4-10 functional units per cell and the MscL channel is a homopentamer of 15 000 Da, it can be concluded that the flux via a functional MscL channel is > 10 6 x s -1 . This activity of MscL is such that on average 5 molecules of pentameric MscL per liposome with a diameter of 400 nm should suffice.
  • Such a liposome contains approximately 1.67 x 10 6 molecules of lipid; the molar ratio of lipid over MscL will thus be 0.67 x 10 5 . Consequently, 2 mg of MscL will yield 6 g of proteoliposomes.
  • ESI-MS is an accurate and effective method to verify primary sequences of the 6His-MscL protein and the stoichiometry of conjugation reactions.
  • Figure 2 shows the ESI-MS spectra of the G22C-MscL-6His and the MTSES conjugated G22C-MscL-6His samples. Based on the deduced amino acids, the average molecular weight of G22C-MscL-6His is 15 826 Da.
  • ESI-MS analysis of G22C-MscL-6His resulted in a molecular weight of 15 697 Da, which corresponds to the deduced molecular weight minus a methionine.
  • Membrane reconstitution into liposomes of different lipid compositions Purified detergent-solubilized MscL was reconstituted into preformed liposomes, which were titrated with low amounts of detergent. After removal of the detergent by adsorption onto polystyrene beads, proteoliposomes were formed. The proteoliposomes were characterized by equilibrium sedimentation on a sucrose gradient as shown in figure 3. All 6His-MscL protein detected by the Western blot (inset in Fig. 3) was associated with the lipid bilayer as detected by octadecylrhodamine- ⁇ -chloride (R 18 ) fluorescence.
  • MscL exhibits drug release from drug laden synthetic liposomes.
  • This patent includes MscL conjugates that will release drugs at the target site as a function of pH, light activation and specific interactions with target associated molecules.
  • a photo reactive molecule 4- ⁇ 2-[5-(2-Bromo-acetyl)-2-methyl-thiophen-3-yl]-cyclopent-1-enyl ⁇ -5-methyl-thiophene-2-carboxylic acid (DTCP1), was designed and synthesized to reversibly switch conformation after light absorption of specific wavelengths. Nuclear Magnetic Resonance and spectroscopic analysis indicated DTCP1 was chemically and functionally correct as shown in Fig. 10. DTCP1 was designed to specifically react with the free sulfhydryl group of a single cysteine at position 22 of MscL (G22C-MscL). Position 22 in the MscL channel was chosen for its involvement in the gating mechanism of the channel.
  • ESI-MS electrospray ionization mass spectrometry
  • absorption spectroscopy A conjugation protocol was developed and the products were analyzed employing electrospray ionization mass spectrometry (ESI-MS) and absorption spectroscopy.
  • ESI-MS indicated that the mass of all MscL subunits increased with 344 Da, a mass increase expected for a conjugation of DTCP1 to a sulfhydryl group of MscL as shown in Fig. 11.
  • the two photoisomer states of modified G22C-MscL exhibit different absorption spectra that can be used to monitor the switching of DTCP1 after conjugation to MscL as shown by the absorption spectra in Fig. 12.
  • the detergent-solubilized G22C-MscL-DTCP1 conjugate was subsequently reconstituted into a DOPC:DOPS (90:10 m%) containing lipid bilayer and absorption at 535 nm was used to monitor the switching of DTCP1 in the membrane reconstituted channel (insert Fig. 12).
  • DOPC:DOPS 90:10 m% containing lipid bilayer
  • absorption at 535 nm was used to monitor the switching of DTCP1 in the membrane reconstituted channel (insert Fig. 12).
  • Example 1-C pH dependent opening of the MscL channel
  • the G22H-MscL mutant exhibits a higher open probability at (low) pH values that are frequently encountered in tumours, as compared to normal pH values of circulating blood.
  • the G22H-MscL mutant and a double histidine mutant, G22H-V23H-MscL, were constructed to produce a pH-sensitive channel. Both the single and double histidine mutants exhibited very low overproduction levels in the E.coli expression systems.
  • the mutants were overexpressed, purified and membrane-reconstituted.
  • the membrane reconstituted histidine-mutants exhibited pH-sensitive drug-release profiles.
  • the G22C-MscL is used for conjugation to 2-Bromo-3-(5-imidazolyl) propionic acid (BI) as shown in Fig. 13, effectively introducing a imidazole at the position of the imidazole of the histidine in G22H-MscL.
  • BI conjugated G22C-MscL mimics the pH-dependent properties of the G22H-MscL, except that the G22C-MscL overproduction is relatively high.
  • BI was synthesized and covalently attached to the G22C-MscL using the same protocol as used for DTCP1.
  • Electrophysiological characterization of the membrane-reconstituted conjugate showed a significantly higher MscL channel open probability at pH 6 compared to pH 7, allowing controlled release of drugs at specific tumour sites.
  • the BI is synthesized with different substituents to change the pKa of the imidazole. This allows fine-tuning of the gating properties of the conjugated channel to the specific application.
  • Example 1-D Induced opening of the MscL channel by specific recognition
  • Example 1-E Controlled and/or localized release of a small molecule by tuning the composition of the lipid vesicle and/or the use of a mutant MscL.
  • Electrophysiological characterization was performed on MscL, reconstituted in membranes of different lipid compositions. Lipid compositions were chosen to significantly effect lateral pressure profiles of the lipid membranes to gain insight in the gating of the channel. Figure 14 shows that when the percentage of DOPE increases, the membrane tension necessary to open the channel decreases.
  • C-DOPE N-Citraconyl-dioleoylphosphatidyl-ethanolamine
  • the C-DOPE undergoes a proton catalyzed elimation reaction at pH 5.0, resulting in an increased fraction of DOPE in the bilayer.
  • This increase in DOPE in the bilayer results in a higher open probability of MscL (see Fig. 14).
  • This pH induced activation of MscL is used to effectively release drugs at the target site.
  • Example 1-F Controlled release of molecules at a target site by means of membrane proteins selected from a large library.
  • Membrane channel proteins allow the exchange of molecules between compartments seperated by the membrane in which they are embedded by forming a channel in the membrane.
  • the channel can be either in a closed (no exchange) or open (exchange) conformation, and the membrane protein can switch between the two conformations.
  • the signal is either pH, temperature, ionic strength or binding.
  • the membrane proteins that are sensitive to one or more of these signals are selected from a large random library of mutant membrane proteins using appropiate selection methods.
  • Example 1-G pH dependent release of antibiotics by mutant OmpF.
  • a library of genes encoding for mutants of the E. coli outer membrane protein F was created from the wild type OmpF gene by error prone PCR methods.
  • the wild type OmpF gene in plasmid pGompF-Tet was replaced by the mutant genes using standard restriction and ligation methods.
  • PGompF-Tet is an expression plasmid for OmpF in E.coli and was created from plasmid pGompF (Prilipov, A. et al., 1998, FEMS Microbiol Lett. 163: 65) by introducing a tetracycline resistance marker into the ampicillin resistance gene, thereby disrupting the latter.
  • coli strain BL21(DE3)omp8 (Prilipov, A. et al, 1998, FEMS Microbiol Lett. 163: 65), a strain that does not express the outer membrane proteins OmpA, OmpC and OmpF, was transformed with the plasmid library to obtain a library of E. coli clones expressing mutant OmpF proteins in their outer membrane. Selection of suitable clones for the delivery of antibiotics was performed by using antibiotic sensitivity of E. coli as a tool. Antibiotics of the ⁇ -lactam class use the OmpF channel lumen as their pathway to enter the periplasmic space where they interfere with cell wall synthesis, leading to lysis of the cells.
  • OmpF mutants that are mostly in the closed conformation (as opposed to wild type protein that is mostly in the open conformation) have a higher chance of survival when grown in the presence these antibiotics since the rate of access to the periplasm, and consequently the effective concentration of the antibiotic, is impeded (Nikaido, H., 1994, Science 264: 382).
  • E. coli clones containing the random OmpF were plated on agar plates at pH 7.4 containing the ⁇ -lactam cephalotin at a concentration 10 ⁇ g/ml. This concentration is sufficient to inhibit growth of E. coli expressing wild type OmpF but allows growth of the bacterium in the absence of OmpF expression.
  • the Protein Anchor is the cell-wall binding domain (Anchor) of the major cell-wall hydrolase AcmA of Lactococcus lactis , a Generally Recognized As Safe (GRAS) Gram-positive bacterium.
  • the Protein Anchor consists of 3 homologous repeats of 45 amino acids that contain a specific consensus sequence (Table A; patent applications WO99/25836 and EP 01202239.8), separated by intervening sequences of about 30 amino acids that are highly enriched for serine, threonine and asparagines residues.
  • This Protein Anchor has the ability to attach from the outside to a wide variety of Gram-positive (G+) bacteria, also when part of a chimaeric fusion protein.
  • This trait offers the possibility to use this Protein Anchor in therapeutic applications as a device to target pathogenic bacteria in order to inactivate them. Inactivation may be achieved by coupling antibodies, cytokines (signaling molecules for the immune system) or drugs to the Protein Anchor. In another approach the drugs or other compounds may be incorporated in nano- or micro delivery-vehicles to which the Protein Anchor is attached in order to direct these vehicles to a specific target, in the case of the unmodified AcmA Protein Anchor mostly G+ bacteria.
  • the Protein Anchor has many homologs (domains in other proteins that resemble the Protein Anchor) in a wide variety of microbes and higher organisms (Table A; patent applications WO99/25836 and EP 01202239.8, incorporated herein by reference).
  • the AcmA Protein Anchor can be used to target Gram-positive bacteria.
  • Example 3-A demonstrates that homologs of the AcmA anchor can be used to extend the range of micro-organisms that can be targeted.
  • a reporter molecule is fused to the Anchor.
  • Anchors are coupled to delivery vehicles that have the ability to make the drugs available upon induction (e.g. liposomes with MscL).
  • Examples 3-B and 3-C demonstrate that modified AcmA-type Anchors can be made in order to obtain pH-dependent binding (induced availability) to the target.
  • a reporter molecule is fused to the Anchor and a model target is used.
  • modified Anchors are coupled to delivery vehicles (e.g. liposomes, hydrophobin particles, etc.).
  • Targeting means is a Protein Anchor homolog
  • Example 3-A Targeting of a reporter molecule through the use of a Protein Anchor homolog to a microorganism other than a Gram-positive bacterium.
  • Plasmid pPA9 was used for cloning the MltD anchor (cMD).
  • This plasmid contains the acmA gene (cell-wall hydrolase) devoid of its native Protein Anchor (acmA').
  • This truncated AcmA has no or little cell wall hydrolase activity.
  • the cell wall hydrolase activity can be restored by cloning Protein Anchor homologs behind the truncated acmA.
  • the cell wall hydrolase activity can be easily detected in plate- and gel assays.
  • the c-myc epitope is present in pPA9 in frame downstream the truncated acmA.
  • PCR Polymerase Chain Reaction
  • the cMD PCR fragment was digested with Bgl II and Hin dIII (underlined sequences in the primers) and was cloned into the Bam HI and Hin dIII sites of pPA9, resulting in plasmid pPA10 (produces protein: AcmA'::myc::cMD).
  • Expression of AcmA'::myc::cMD using pPA10 in L. lactis NZ9000 ⁇ acmA was done as described in Kuipers et al. (1997, Tibtech 15: 135-140). Detection of AcmA activity in plate- and SDS-polyacrylamide gel assays was described by Buist et al. (1995, J. Bacteriol.
  • TSM buffer 200 mM Tris pH 8.0; 0.5 M sucrose; 10mM MgCl 2
  • the L. lactis fusion protein AcmA'::myc::cMD was then incubated with the E. coli cells.
  • the cells were subsequently washed with buffer TSM in order to remove unbound AcmA'::myc::cMD.
  • L. lactis NZ9000 ⁇ acmA(pPA10) was induced for expression of AcmA'::myc::cMD and culture supernatants were analyzed on SDS-PAA gels containing either peptidoglycan of L. lactis or of E. coli.
  • the proteins in the gels were renatured and activity was only observed in the gels containing the E. coli peptidoglycan. From this result we concluded that the MltD anchor binds to the Gram-negative E. coli peptidoglycan, but not to that of the Gram-positive L. lactis peptidoglycan and that binding is a prerequisite for activity of the AcmA enzyme. This is in agreement with the observations of Buist et al.
  • Targeting means is a Protein Anchor chimaera
  • Example 3-B pH dependent binding of AcmA protein anchor homologs and hybrids.
  • the cell wall binding domain of the lactococcal cell wall hydrolase AcmA consists of three repeats of 45 amino acids that show a high degree of homology (Buist, G. et al., 1995, J.Bacteriol. 177: 1554-1563). These repeats belong to a family of domains that meet the consensus criteria (Table A) as defined in patent application WO99/25836 and can be found in various surface located proteins in a wide variety of organisms. Another feature that most of these domains have in common is that their calculated pI values are high: approximately 8 or higher (Table A). At pH lower than 8 these binding domains are positively charged.
  • the AcmA protein anchor (cA) homolog of the lactococcal cell wall hydrolase AcmD (cD) consists also of three repeats with a calculated pI that is much lower (approximately pI 3.8) than that of the cA domain (Table B). Consequently, the cD anchor was negatively charged at pH 4 and higher.
  • MSA2::cD reporter protein occurred under these conditions. Therefore, we investigated here the influence of the pH during binding of a cD fusion protein (MSA2::cD).
  • a AcmA anchor (cA)/cD hybrid can be made that has showed binding at pH6 (usual in tumor tissues) but not at pH7.4 (usual in other body fluids).
  • cell wall binding domain homologs consist only of repeats with a pI that are representatives of one of the two groups, i.e. only repeats with a high or low pI.
  • some proteins with putative cell wall binding domains e.g. those of DniR of Trepanoma pallidum and an amidase of Borrelia burgdorferi, consist of repeats with high and low pI.
  • the binding pH of such 'natural hybrid' cell-wall binding domains is below the intermediate pI value of the total number of repeats present in the domain. Therefore, using the cA and cD repeats that we have designed hybrid cell-wall binding domains that have an intermediate pI value.
  • Table C lists a number of examples of such hybrids.
  • Using a fusion of the reporter MSA2 with A3D1D2 we observed that binding to TCA pretreated L. lactis cells occurred at pH6 but not at pH7.4.
  • This Example demonstrates the induced availability (by pH) of a hybrid Protein Anchor for binding to a target.
  • a model reporter molecule (MSA2) is used and a model target is used (TCA pretreated L. lactis ).
  • modified Anchors are coupled to delivery vehicles (e.g. liposomes, hydrophobin particles, etc.) and targeted to micro-organisms or specific animal or human organs or tumors.
  • L. lactis ghost cells were prepared as described in patent application EP 01202239.8.
  • Vector T7Select10-3 and E. coli strains BLT5403 and 5615 were used for cloning of the mutagenized Protein Anchor gene fragments according to the instructions of the supplier.
  • Gene fragments of the AcmA and AcmD Protein Anchor homologs of L. lactis (Table A; Genbank accession numbers U17696, QGC125) were used for in vitro recombination. The cloning of the fragments was done such that the 15 amino acid S-tag was included. This tag allows easy immunological detection of the recombinant phages using the S-protein HRP-conjugate (Novagen).
  • the Protein Anchor gene fragments of acmA and acmD were amplified by the polymerase chain reaction (PCR). After removal of the free primers, about 2 to 4 ⁇ g of the DNA substrates were digested with 0.15 units of DNAseI in 100 ⁇ l of Tris-Cl pH 7.5, 1 mM MgCl 2 , for 5 to 10 minutes at roomtemperature. Fragments of 70 to 200 bp were extracted from 2% low melting point agarose gel.
  • the purified DNA fragments (10 - 30 ng/ ⁇ l) were resuspended in PCR mix and reassembled in a primerless PCR reaction using Taq DNA polymerase (2.5 U) and a program of 94° C for 60 s, 40 cycles of [30 s 94° C, 30 s 50° C, 30 s 72° C] and a final extension of 5 min 72° C.
  • the reassembly mixture was 40-fold diluted into fresh PCR mix with primers. After 15 cycles of PCR, consisting of [30 s 94° C, 30 s 50° C, 30 s 72° C] a single amplification products of the correct size were obtained.
  • the resulting full-length amplification product was digested and ligated into the expression vector.
  • Library construction and screening Construction, amplification and storage of the phage library was done according to the instructions of the supplier (Novagen). Screening for binding variants to L. lactis ghost cells was done by incubation of the phage library in phospate buffered saline (PBS) of pH6. After binding the ghost cells were extensively washed to remove unbound phages. The phages were released from the ghost cells by incubation with mutanolysin (Sigma). The released phages were amplified and the binding, washing and amplification procedure was repeated two times.
  • PBS phospate buffered saline
  • modified Protein Anchor for binding to a target.
  • mutagenized Anchors are used to target a model substrate (TCA pretreated L. lactis 'ghosts').
  • modified Anchors are coupled to delivery vehicles (e.g. liposomes, hydrophobin particles, etc.) and are targeted to micro-organisms or specific animal or human organs or tumors.
  • the Protein Anchor of L. lactis AcmA has many homologs (domains in other proteins that resemble the Protein Anchor) in a wide variety of microbes and higher organisms (Table A; patent applications WO99/25836 and EP 01202239.8). These homologs may have a different binding spectrum, including eukaryotic cells.
  • New Protein Anchors can be obtained by combining the traits of the homologs. This was done by in vitro recombination of a set of Protein Anchor homologs and this resulted in an Anchor that is able to attach to human intestine tumor cells.
  • Antibodies or other cell surface binding domains e.g. lectins
  • Example 3-D Selection of mutagenized Protein Anchors to a preselected human tumor cell-line.
  • L. lactis ghost cells were prepared as described in patent application EP 01202239.8.
  • Vector T7Select10-3 and E. coli strains BLT5403 and 5615 were used for cloning of the mutagenized Protein Anchor gene fragments according to the instructions of the supplier.
  • coli Drosophila melanogaster, Caenorhabditis elegans, Listeria monocytogenes, Enterococcus hirae, Staphylococcus aureus (Table A; Genbank accession numbers U17696, QGC125, P24204, P43261, AF125384, Z79755, U41109, U64836, U70858, P21171, P39046, A04512) were used for in vitro recombination. The cloning of the fragments was done such that the 15 amino acid S-tag was included. This tag allows easy immunological detection of the recombinant phages using the S-protein HRP-conjugate (Novagen).
  • Human intestine cancer cells (Intestine 407 / ATCC CCL6 also designated as Henle cells) were cultivated to confluence in RPMI 1640 medium (Gibco) supplemented with 10% fetal calf serum (Gibco), 1% L-glutamine, 1% non-essential amino acids, and penicillin-streptomycin followed by cultivation in microtiter plates. In vitro recombination.
  • the Protein Anchor gene fragments of the selected homologs were amplified by the polymerase chain reaction (PCR).
  • DNA substrates After removal of the free primers, about 2 to 4 ⁇ g of the DNA substrates were digested with 0.15 units of DNAseI in 100 ⁇ l of Tris-HCl pH 7.5, 1 mM MgCl 2 , for 5 to 10 minutes at room temperature. Fragments of 70 to 200 bp were extracted from 2% low melting point agarose gel.
  • the purified DNA fragments (10 - 30 ng/ ⁇ l) were resuspended in PCR mix and reassembled in a primerless PCR reaction using Taq DNA polymerase (2.5 U) and a program of 94° C for 60 s, 40 cycles of [30 s 94° C, 30 s 50° C, 30 s 72° C] and a final extension of 5 min 72° C.
  • the reassembly mixture was 40-fold diluted into fresh PCR mix with primers. After 15 cycles of PCR, consisting of [30 s 94° C, 30 s 50° C, 30 s 72° C] a single amplification products of the correct size were obtained.
  • the resulting full-length amplification product was digested and ligated into the expression vector.
  • Library construction and screening Construction, amplification and storage of the phage library was done according to the instructions of the supplier (Novagen). Screening for binding variants was done by incubation of the phage library in phosphate buffered saline (PBS) with Henle cells immobilized on tissue culture plates. After binding the Henle cells were extensively washed to remove unbound phages. The phages were released from the Henle cells by using release buffers recommended by the supplier of the display kit (Novagen). The released phages were amplified and the binding, washing and amplification procedure was repeated three times.
  • PBS phosphate buffered saline
  • the biopanning of the recombinant phages resulted in a phage population that bound to Henle cells.
  • the mutagenized protein anchor DNA insert in one of these phages was isolated and subsequently cloned into a lactococcal expression vector that allows fusion of protein anchors to the reporter MSA2 (see example 3-B). Expression of the fusion protein, designated MSA2::X2, resulted in its secretion. Binding of MSA2::X2 to Henle cells was analyzed by Western blotting. The results demonstrate that the X2 protein anchor binds to human intestine cancer cells.
  • Anchors are coupled to delivery vehicles that have the ability to make the drugs available upon induction (e.g. liposomes with MscL).
  • Example 3-E Multiple cell wall spanning domains of the lactococcal proteinase PrtP cause adherence to eukaryotic cells
  • the C-terminal part of PrtP consists of (i) a helical spacer, followed by (ii) a hydrophobic Gly/Thr/Asp-rich putative cell wall spacer (CWS) domain that can span the peptidoglycan layer and, (iii) a cell wall anchoring domain.
  • CWS cell wall spacer
  • Some of the bacterial cell wall-anchored proteins are known to have adhesive properties (Navarre and Schneewind. 1999. Microbiol. Mol. Biol. Rev. 63: 174-229).
  • L. lactis cells can adhere to one another via the sex factor CluA, in order to allow conjugal transfer of DNA. The cell-to-cell binding causes a cell aggregation phenotype (Godon et al. 1994. Mol.
  • Pathogenic Gram-positive bacteria carry cell wall-anchored surface proteins that contribute to virulence (Foster and McDevitt. 1994. FEMS Microbiol. Lett. 118: 199-205). They do so by promoting adherence to the host cells and/or tissue components, and by binding a variety of serum proteins including albumin, collagen, complement regulatory factors, soluble forms of fibronectin and fibrinogen, and the proinflammatory plasminogen and kininogen (Patti et al . 1994. Annu. Rev. Microbiol. 48: 585-617).
  • streptococcal M proteins as well as fibrinogen binding protein (FgBP) from Streptococcus equi can also mediate bacterial autoaggregation, a property shown to be crucial for adherence and resistance to phagocytosis (Frick et al. 2000. Mol. Microbiol. 37: 1232-1247, Meehan et al. 2001. Microbiology 147: 3311-3322).
  • FgBP fibrinogen binding protein
  • L. lactis was grown at 30°C in M17 (Difco, West Molesey, United Kingdom) or 1 ⁇ 2 M17 broth (containing 0.95% ⁇ -glycerophosphate, Sigma Chemicals Co., St. Louis, Mo) as standing cultures or on 1 ⁇ 2 M17 agar plates containing 1.5% (wt/vol) agar. All media were supplemented with 0.5% (wt/vol) glucose, while 5 ⁇ g/ml chloramphenicol (Sigma Chemicals Co), or 5 ⁇ g/ml erythromycin (Roche Molecular Biochemicals, Mannheim) were added when appropriate. DNA techniques and transformation.
  • lactis NZ9000 was transformed by electroporation using a gene pulser (Bio Rad Laboratories, Richmond, Calif.) as described by Leenhouts and Venema (1993, Plasmids a practical, 2 nd Ed. Oxford University Press, Oxford). Analytical grade chemicals were obtained from Merck (Darmstadt, Germany), or BDH (Poole, United Kingdom). Overexpression of fusion proteins. The DNA fragment encoding the CWS domain and cell wall anchor domain of the proteinase of L.
  • lactis Wg2 was amplified from plasmid pGKV552 by PCR with oligonucleotides CWS1 (5'-ATATA AAGCTT GCAAAGTCTGAA AACGAAGG), and CWS2 (5'-C CGTCTC AAGCTCACTATTCTTCACGTTGTTTCCG).
  • the purified 402-bp PCR product was digested with Hin dIII/ Esp 3I (underlined) and ligated into the Hin dIII site of pNG300, resulting in pNG301.
  • the merozoite surface antigen of Plasmodium falciparum strain 3D7 (MSA2) was chosen as localization reporter protein.
  • MSA2 As this protein contains a eukaryotic GPI membrane anchor, which could obstruct secretion of the fusion proteins, a truncated version of MSA2 (lacking this membrane-spanning domain) was used. It was amplified using the oligonucleotides MSA2-1 (5'-A CCATGG CAAAAAATGAAAGT AAATATAGC) and MSA2-4 (5'-CGGTCTCTAGCTTAT AAGCTT AGAATTCGGGATG TTGCTGCTCCACAG). The PCR product was digested with Nco I/ Hin dIII (underlined) and ligated into the corresponding restriction enzymes sites of pNG301, resulting in pCWS1a.
  • One or two copies of the 264-bp PCR product obtained with oligonucleotides CWS1 and CWS3 (5'-ATTT AAGCTT TTACCGGATGTAAGTTGACCATTACG), encoding the CWS domain, was/were introduced in the Hin dIII site of pCWS1a, resulting in pCWS2a and pCWS3a, respectively.
  • Anchor-less variants of the CWS-containing fusion proteins were obtained using oligonucleotides MSA2-1 and Prt.Myc2 (5'-A AGATC TTCTTTGAAATAAG TTTTTGTTCCGTGCT) with pCWS1a, pCWS2a or pCWS3a as templates, respectively.
  • PCR products were digested with Nco I and Xho I and ligated into these sites of pNG300, resulting in pCWS1, pCWS2 and pCWS3, respectively.
  • Nisin induction of the nisA promoter upstream of the fusion protein-encoding fragments was performed as described by de Ruyter et al. (1996, Appl. Environ. Microbiol. 62: 3662-3667).
  • Adherence to human intestine 407 cells via multiple CWS domains Adherence to human intestine 407 cells via multiple CWS domains. Surface located bacterial proteins can be involved in adherence to eukaryotic cells. Some of these adherence proteins show autoaggregation properties. Since we anticipated that the lactococcal proteinase CWS domain has autoaggregation properties, we investigated whether the expression of the CWS domain on the surface of the lactococcal cells can result in adherence to eukaryotic cells. Cells of the human small intestine cancer cell line 407 (Henle) were used in this study. The adhering ability was tested of L.
  • two types of NZ9000 strains were used: (i) one secreting MSA2 and, (ii) one that attaches MSA2 to the bacterial cell wall in a non-covalent way through the AcmA repeats (Leenhouts et al. 1999. Antonie van Leeuwenhoek 76: 367-376, patent applications WO99/25836 and EP01202239.8).
  • Example 3-F pH Dependent binding of a mutagenized PrtP cell-wall spanning domain.
  • Human intestine cancer cells (Intestine 407 / ATCC CCL6 also designated as Henle cells) were cultivated to confluence in RPMI 1640 medium (Gibco) supplemented with 10% fetal calf serum (Gibco), 1% L-glutamine, 1% non-essential amino acids, and penicillin-streptomycin followed by cultivation in microtiter plates.
  • Vector T7Select10-3 and E. coli strains BLT5403 and 5615 (T7Select Phage display System, Novagen) were used for cloning of the mutagenized PrtP CWS domain gene fragments according to the instructions of the supplier.
  • the cloning of the fragment was done such that the 15 amino acid S-tag was included. This tag allows easy immunological detection of the recombinant phages using the S-protein HRP-conjugate (Novagen). Mutagenesis. Random point mutations were introduced by error-prone PCR.
  • the 100- ⁇ l reaction mixture contained 10 ⁇ l of 10 ⁇ reaction buffer (10 mM Tris-HCl, 10 mM KCl, 1.5 mM (NH 4 )SO 4 , 0.1% (v/v) Triton X-100) with 2.5 mM MgCl 2 , 0.2 mM MnCl 2 , 200 ⁇ M dATP and dGTP, 1 mM dTTP and dCTP, 30 pmol each primer, and 5 units of Taq polymerase.
  • the PCR schedule was 2 min at 94 °C, followed by 25 cycles of 94 °C for 30 s, 50 °C for 30 s, and 72 °C for 30 s.
  • the product was purified using Qiaquick (QIAGEN) and after digestion, ligated into an expression vector.
  • Library construction and screening Construction, amplification and storage of the phage library was done according to the instructions of the supplier (Novagen). Screening for binding variants was done by incubation of the phage library in phospate buffered saline (PBS) of pH6 with Henle cells immobilized on culture plates. After binding the Henle cells were extensively washed to remove unbound phages. The phages were released from the Henle cells by using buffer recommended by the suppliers of the phage display kit (Novagen). The released phages were amplified and the binding, washing and amplification procedure was repeated three times.
  • PBS phospate buffered saline
  • mutagenized PrtP CWS domain for binding to a target.
  • a mutagenized Anchor is used to target a model substrate (human small intestine cancer cells).
  • mutagenized Anchors are coupled to delivery vehicles (e.g. liposomes, hydrophobin particles, etc.) and are targeted to micro-organisms or specific animal or human organs or tumors.
  • Hydrophobins are self-assembling proteins which are capable of forming an amphipathic film on an interface. By choosing the proper conditions the film can be formed in different shapes and manipulated to have alternative characteristics. Examples of interfaces can be Teflon - water, where the hydrophobic Teflon is coated with a hydrophilic layer, and water - oil. For a recent review see Wösten (1) 2001, Annu.Rev.Microbiol. 55:625-646). This example describes assembly of hydrophobins in to small vesicles that can be used as delivery vehicles. Hydrophobins are known to have low immunogenicity, which makes vesicles consisting of hydrophobins ideally suitable for drug delivery.
  • Hydrophobin SC3 was purified from the culture medium of strain 4-40 of Schizophylum commune (CBS 340.81) as described by Wessels and Wösten et al (Wessels, J. G.,1997, Adv.Microb.Physiol 38:1-45; Wösten, H. A. B. et al., 1993, The Plant Cell 5 :1567-1574). Before use, the freeze-dried SC3 was disassembled with pure TFA and dried in a stream of nitrogen. The monomeric protein was then dissolved in 50 mM phosphate buffer or water.
  • Hydrophobin vesicles can be made with the hydrophobic site inwards, by coating oil droplets, or with the hydrophilic site inwards, by coating water droplets (Wösten, H. A. et al., 1994, EMBO J. 13:5848-5854). Coating of oil droplets was achieved by emulsifying 10 ⁇ l of an oil (kitchen grade olive oil, mineral oil or organic solvents that do not mix with water) in 300 ⁇ l water by sonication and adding 300 ⁇ l of an aqueous solution of hydrophobin (200 ⁇ g ml -1 ). Alternatively, the oil was directly emulsified in the hydrophobin solution and 300 ⁇ l water was added.
  • the emulsions were centrifuged at 10,000 g for 30 min and the oil droplets washed four times with water by centrifugation to remove monomeric hydrophobin. Oil droplets coated with assembled hydrophobin were then resuspended in a small volume of water to study stability, size and leakage of encapsulated substances.
  • a micro filtration membrane was used for assembly of hydrophobins on oil droplets of a uniform size. At the hydrophilic side of the membrane an aqueous solution of hydrophobin (100 ⁇ g ml -1 ) was applied and at the hydrophobic side of the membrane the oil with the substance of interest was present.
  • the oil was forced through the filter into the aqueous solution by pressure, generating an emulsion of precisely sized droplets of as small as 0.1 ⁇ m. After overnight incubation at room temperature or 60°C, the emulsion was washed with water and concentrated as described above. Substances to be included in the vesicles are added to the waterphase while generating these vesicles.
  • the emulsion was centrifuged at 10,000 g for 30 min, washed four times with oil by centrifugation to remove excess of hydrophobin.
  • the concentrated emulsion was studied for stability, size and leakage.
  • the water in oil emulsions of uniform droplet size were made with the micro filtration membrane as described above. Rodlet structures or the so-called ⁇ -sheet form of hydrophobins are spontaneously formed at the oil/water interface. Stability of the emulsion and the size of the coated droplets were assessed by electron microscopy and atomic force microscopy according to standard techniques. Leakage of the vesicles was studied with an efflux assay with a fluorescent model drug, calcein.
  • F 0 is the fluorescence intensity at zero time incubation
  • F x is the fluorescence at the given incubation time-points
  • F t is the total fluorescence, obtained after lysis by shearing of the vesicles. Fluorescence was monitored with a SLM 500 spectrofluorimeter in a thermostatted cuvette (1 mL) at 37°C, under constant stirring. Excitation and emission wavelengths were, respectively, 490 (slit 2 nm) and 520 nm (slit 4 nm). The experiments were performed at hydrophobin concentrations of approximately 2.5 ⁇ M.
  • hydrophobin vesicles were separated from free calcein by using Sephadex 50 column chromatography equilibrated with PBS (160 mM NaCl, 3.2 mM KCl, 1.8 mM KH 2 PO 4 , 0.12 mM Na 2 HPO 4 , 1.2 mM EGTA, pH 8.0), which was isotonic to the calcein-containing buffer.
  • PBS 160 mM NaCl, 3.2 mM KCl, 1.8 mM KH 2 PO 4 , 0.12 mM Na 2 HPO 4 , 1.2 mM EGTA, pH 8.0
  • Liposomes are a commonly used vehicle for the delivery of drugs. Their characteristics are quite suitable for this purpose, though there are several features that could be improved. One of those is the stability of liposomes and therefore the leakage of the drug. The fluidity of the liposome membrane makes it susceptible for rupture, which can be avoided by adding a support to the membrane.
  • hydrophobins were shown to be ideal support for the lipids, which results in a more stable and/or less leaky liposome.
  • Hydrophobins are self-assembling molecules which can form a highly amphipathic film on a hydrophobic-hydrophilic interface. In nature this film is used, for example, to cover aerial structures of fungi, which results in a hydrophobic surface, with all the effects on the organism and its environment.
  • Hydrophobin SC3 was purified from the culture medium of strain 4-40 of Schizophylum commune (CBS 340.81) as described by Wessels and Wösten et al. (Wessels, J. G, 1997, Adv.Microb.Physiol 38:1-45; Wösten, H. A. B. et al., 1993, The Plant Cell 5:1567-1574). Before use, the freeze-dried SC3 was disassembled with pure TFA and dried in a stream of nitrogen. The monomeric protein was, subsequently, dissolved in 50 mM phosphate buffer or water.
  • Dry lipid mixtures were prepared by co-dissolving lipids (Avanti Polar Lipids, Alabaster, AL) in chloroform, in weight-fractions as indicated in the experiments, and removing the chloroform by evaporation under vacuum for 4 h. All acyl chains of the synthetic lipids were of the type, dioleoyl, unless indicated otherwise.
  • the dried lipid film was dissolved (20 mg/mL) in 50 mM potassium phosphate, pH 7.0, followed by three freeze/thaw cycles and extrusion through polycarbonate filters to form unilamellar liposomes with a diameter of approximately 100 nm.
  • Formed liposomes were coated with hydrophobins by incubating the liposomes overnight in an aqueous solution of hydrophobins (200 ⁇ g ml -1 ) at room temperature or 60 °C in the presence of 0.02 % NaN 3 .
  • the hydrophobins were added before the freeze/thaw cycles during the preparation of the liposomes. This method resulted in coated inverted hexagonal liposome structures which were much more stable compared to inverted hexagonal liposome structures in the absence of hydrophobins.
  • the coating could be manipulated by adding ethanol, propanol or butanol to the hydrophobin solution, decreasing the hydrophilicity.
  • hydrophobin liposome structures Three parameters could be manipulated in the formation of the hydrophobin liposome structures: the lipid composition, the type of hydrophobin and the hydrophobicity of the buffer.
  • Another method of obtaining hydrophobin coated liposomes consisted of hydrophobins in a water/oil emulsion (see Example 4), which was dialyzed in a dialysis tube in a lipid containing solution to obtain lipid covered hydrophobin vesicles or internally coated liposomes.
  • the formed liposomes were analysed with electron microscopy and atomic force microscopy, which visualized the assembly of the rodlet structure of the hydrophobins on the surface.
  • the composition of the hybrid vesicles was analysed with discontinuous sucrose gradients as described (Knol, J. et al.,1998, Biochemistry 37:16410-16415).
  • the stability of the vesicles was measured with an efflux assay with a fluorescent model drug, calcein.
  • the drug was introduced when the liposomes were being made, by dissolving the calcein in the buffer.
  • the percentage release of calcein was calculated from the dequenching of calcein fluorescence as described in Example 4.
  • a Protein Anchor is a cell-wall binding domain (Anchor) of, for example, the major cell-wall hydrolase AcmA of Lactococcus lactis , a Generally Recognized As Safe (GRAS) Gram-positive bacterium.
  • This Protein Anchor consists of 3 homologous repeats of 45 amino acids that contain a specific consensus sequence (see patent applications WO99/25836 and EP 01202239.8), separated by intervening sequences of about 30 amino acids that are highly enriched for serine, threonine and asparagines residues.
  • This protein Anchor has the ability to attach from the outside to a wide variety of Gram-positive (G+) bacteria, also when part of a chimaeric fusion protein.
  • Protein Anchor in therapeutic applications as a device to target pathogenic bacteria in order to inactivate them. Inactivation may be achieved by coupling antibodies, cytokines (signaling molecules for the immune system) or drugs to the Protein Anchor. In another approach the drugs or other compounds are incorporated in nano- or micro delivery-vehicles to which the Protein Anchor is attached in order to direct these vehicles to a specific target, in the case of the unmodified AcmA Protein Anchor mostly G+ bacteria.
  • Mutagenized Protein Anchors that show pH-dependent binding and/or binding to specific eukaryotic cells are obtained in a similar way as described under Example 3. They can be used in combination with these delivery vehicles to target specific human or animal cells providing induced availability of the substance of interest.
  • Example 6-A Targeting of liposomes through the use of the Protein Anchor to Gram-positive bacteria
  • the coupling of the Protein Anchor to liposomes and sterically stabilized liposomes is described.
  • the liposomes contain calcein as reporter drug.
  • the liposomes with the coupled Protein Anchor displayed on the surface were then incubated with TCA pretreated L. lactis cells (ghost cells). After washing the ghost cells to remove unbound liposomes, binding to the ghost cells was demonstrated by measuring an increase in fluorescence in a fluorometer and microscopically by using a fluorescence microscope.
  • the Protein Anchor (cA) fusion used contained in the N-terminal domain a unique cysteine (cys) that is used as the functional element for the coupling to lipids in the liposome, in addition it contained an epitope than can be used for detection (myc-epitope).
  • This Protein Anchor fusion (cys::myc::cA) was designated PA3.
  • Protein PA3 was produced in L. lactis using vector pPA3. Plasmid pPA3 is based on the nisin inducible expression vector pNZ8048 (Kuipers et al. 1997.
  • Tibtech 15: 135-140 contains a modified multiple cloning site in which the cysteine and c-myc reporter epitope was cloned. An in frame fusion of this reporter was made with at the 5'-end the lactococcal Usp45 signal sequence, and at the 3'-end the AcmA protein anchor sequence. Growth of L. lactis and induction for expression was as described before (Kuipers et al. 1997. Tibtech 15: 135-140). Isolation of PA3 from the culture medium was done by using a Sepharose SP cation exchange column (Pharmacia). The culture supernatant was loaded on the column at pH5.8.
  • the three types of calcein loaded liposomes one in which the PA3 anchor was coupled to the lipid, one that has PA3 coupled to the PEG-PE and control liposomes (with or without PEG-GE), were used to analyze targeting to lactococcal ghost cells. After binding, the ghost cells were extensively washed and analyzed in a Spectrofluorometer. Fluorescence, which is an indication for the presence of liposomes, was only observed in the case that PA3 coupled liposomes were used. The type of coupling, to the lipid or to the PEG-PE, had no influence on the binding. The presence of the targeted liposomes on the surface of the ghost cells was confirmed using fluorescence microscopy.
  • the AcmA-type Protein Anchor can be used to target liposomal delivery vehicles to bacteria.
  • the liposomes may either provide slow release or can be induced to release the drugs upon an external signal (see Example 1). This may have applications in combating pathogenic bacteria.
  • mutagenized AcmA-type Protein Anchors similar to those described in Example 3 can be used to target specific human or animal cells.
  • variants of the PrtP CWS domain, also described in Example 3 can be used for this purpose.
  • Example 6-B Targeting of polymer particles through the use of the Protein Anchor to Gram-positive bacteria
  • the coupling of the Protein Anchor to a polymer particle is described.
  • the particles contain an organogel with a reporter drug (calcein).
  • the Protein Anchor was displayed on the particle surface, which were then incubated with TCA pretreated L. lactis cells (ghost cells). After washing the ghost cells to remove unbound polymer particles, binding of calcein loaded polymer particles to the ghost cells was demonstrated.
  • Crosslinking reagents N-[ p -Maleimidophenyl]isocyanate PMPI (couples sulfhydryl groups to hydroxyl groups); N- ⁇ -Maleimidocaproic acid EMCA (couples sulfhydryl groups to amino groups); N- ⁇ -Maleimidopropionic acid BMPA (couples sulfhydryl groups to amino groups [peptide bond]); N-[ ⁇ -Maleimidopropionic acid]hydrazide BMPH (couples sulfhydryl groups to aldehyde groups).
  • Coupling conditions of PA3 to the polymer particles were according to the specifications of the supplier (Pierce, IL, USA). The particles were then loaded with organogel containing calcein (as described in Example 7). Specific binding to the bacteria was demonstrated by detection of calcein as described in Example 6-A.
  • Example 6-C Targeting of hydrophobin vesicles through the use of the Protein Anchor to Gram-positive bacteria
  • the coupling of the Protein Anchor PA3 to SC3 vesicles loaded with calcein is described.
  • the SC3 vesicles with the coupled PA3 displayed on the surface were then incubated with TCA pretreated L. lactis cells (ghost cells). After washing the ghost cells to remove unbound vesicles, binding of calcein loaded hydrophobin vesicles to the ghost cells was demonstrated.
  • Example 6-A Production and isolation of PA3 as described in Example 6-A. Preparation of ghost cells was as described before (patent application EP 01202239.8). Preparation of SC3 vesicles loaded with calcein as reporter drug was according to the method as described in Example 4 . Coupling of PA3 to the monomeric form of SC3 or to the SC3 vesicles was done by coupling the carbohydrates of SC3 to the unique cysteine in PA3 using the cross-linking reagent N- ⁇ -Maleimidopropionic acid (BMPH), which was used according to the instructions of the supplier (Pierce, IL, USA). The hydrophobin vesicles were then incubated with ghost cells. Specific binding to the bacteria was demonstrated by detection of calcein as described in Example 6-A.
  • BMPH cross-linking reagent N- ⁇ -Maleimidopropionic acid
  • hydrophobin vesicles either provide slow release or can be induced to release the drugs upon an external signal when they are filled with a responsive organogel (see Example 7). This has applications in combating pathogenic bacteria.
  • mutagenized AcmA-type Protein Anchors similar to those described in Example 3 can be used to target specific human or animal cells.
  • variants of the PrtP CWS domain, also described in Example 3 can be used for this purpose.
  • Organogelators are small organic compounds that, already at low concentrations, can form gels with solvents ranging form hexane to water (F.M. Congress, K.L. Caran, J. Am. Chem. Soc, 2000, 122, 11679, J.H. Jung, M. Amaike, K. Nakashima, S. Shinkai, J. Chem. Soc, Perkin Trans. 2, 2001, 1938), via self-assembly of the organo/hydrogelator through highly specific non-covalent interactions (J. van Esch, F. Schoonbeek, M. de Loos, M. Veen, R.M. Kellogg, B.L.
  • the gelation process is fully reversible, and dependent on the structure of the organo/hydrogelator, can be modulated by several signals e.g. temperature, light, pH, magnetic fields, electric currents, ultrasound and chemical or biological compounds (N.A. Peppas, P. Bures, W. Leobandung, H. Ichikawa, Eur. J. Pharm. Biopharm. 50 (2000) 27 and references cited therein).
  • organo/hydrogelator molecules as gelling tags to which the substance to be delivered is coupled and, subsequently, immobilized in a gel through self-assembly of the gelling tag.
  • Liposomes as in Example 1 with and without MscL-6His were prepared in the presence of the dye, calcein and heparin sulfate, a natural polymer found in secretory granules.
  • a liposome was inserted into the tip of a glass pipette with the application of suction.
  • the pipette voltage relative to the bath was controlled by a current-to-voltage converter.
  • the solution in both bath and the pipette was buffered to 6.5 with histamine dichloride and phosphoric acid.
  • We used a Axopatch 200B to apply voltages and to sample the currents at 2.5 ms intervals.
  • the heparin sulfate matrix swelled instantaneously and predictably with the application of a negative voltage as reported (Nanavati, C. and Fernandez, J.M., 1993, Science 259: 963-965).
  • the swelling was accompanied by an instantaneous current and a visible diffusion of the calcein dye into the bath.
  • the voltage was turned off, the current and swelling returned to control levels but the calcein remained in the bath.
  • This example embodies the enhanced availability of substances of interest following induced morphological changes of the macromolecular vehicle system.
  • a sequential morphology-altering pathway has been implemented in order to direct morphological behaviour e.g. from bilayer vesicular into micellar into none or vice versa.
  • the same sequentially modified vehicle performs all steps.
  • the following example describes the concept: bilayer vesicles (comprising compound 1) are used for transport; after hydrolysis releasing R2, micelles (comprising compound 2) are formed inducing endocytosis and finally the second hydrolysis (yielding compound 3 and releasing R1) induces the actual release by destroying the micellar structure.
  • Hydrolysis is used as a signal, although other signals (e.g. reduction potential, light, H-bridges) can be used as well.
  • Morphology changes include vesicular into micellar into none, but changes from lamellar into hexagonal into micellar into none or vice versa as well.
  • -Citronellylamine (5.00 g, 32.4 mmole) was added to a solution of D-Glucaric acid (lactone) (Example 2, 2.90 g, about 14.5 mmole) in EtOH (40 ml). After 20 h stirring the precipitate was filtered off and recrystallized from 2-propanol to yield dicitronellyl glucaramide (2.30 g, 4.75 mmole, 33%).
  • n-Butyllithium (7.85 ml of 1.6M solution in hexane, 12.56 mmol) was added to a stirred solution of 1,2-bis(5'-chloro-2'-methylthien-3'-l)cyclopentene (compound Z in Figure 20) (1.97 g, 5.98 mmol) in anhydrous THF (20 ml) under nitrogen at room temperature.
  • anhydrous dimethylformamide (0.97 ml, 12.56 mmol).
  • the mixture was stirred then for an additional hour at room temperature, before it was poured into HCl (2N, 50 ml).
  • the mixture was extracted with diethyl ether (3 x 25 ml).
  • Silver oxide was used to oxidize dithienylcyclopentene bisaldehyde (compound A)which was prepared as described under compound A. This was done in situ by adding AgNO 3 (1.64 g, 9.6 mmol) to a solution of NaOH (0.75g, 18.7 mmol) in H 2 O (15 ml). Silver oxide immediately precipitated. This suspension was then added to compound A (0.74 g, 2.34 mmol) and refluxed for 1h, subsequently filtered over a glass filter and rinsed with hot water. The filtrate was cooled and acidified with 2M HCl in an ice bath. The compound precipitated and was filtered over a glassfilter (G4). The residual water was azeotropically removed with toluene to yield an off-white solid (0.51g, 62%).
  • Dicarboxylic acid-thienylcyclopentene derivative (Compound B, 0.5 g, 1.44 mmol), which was prepared as described under compound B , was suspended in CH 2 Cl 2 (5 ml) and placed in an ice bath. Subsequently N-methylmorpholine (0.31 ml, 2.9 mmol) was added and the suspension became a solution. Then 2-chloro-4,6-dimethoxytriazine (0,48 g, 2.9 mmol) was added, and a white precipitate was formed immediately after this addition.
  • This compound was prepared as described above for C , starting from diacid B (1.34 g, 3.85 mmol) and (R)-cyclohexylamine (1.1 ml, 7.7 mmol). After purification by stirring in CH 2 Cl 2 /MeOH (60/1), filtration (G4-glass filter) and drying under vacuum at 50°C, a white solid was obtained (0.59g, 44%) molecular formula C 33 H 46 N 2 O 2 S 2 .
  • 1,4-dibromobenzene (3.4 g, 14.4 mmol) was dissolved in THF (12 ml) and after addition of Pd(PPh 3 ) 4 (0.4 g, 0.3 mmol), the solution was stirred for 15 min at r.t.. Then aqueous Na 2 CO 3 (17 ml, 2M) and 6 drops of ethylene glycol were added, and the resulting two-phase system was heated in an oil bath till reflux (60°C). The solution of compound F was added dropwise by a syringe in a few minutes. After addition was complete, the reaction mixture was refluxed for 2 h, and then allowed to cool to r.t..
  • Gels of the closed form of D can also be dissolved by converting the closed form to the open form by irradiation with light of wavelength ⁇ ⁇ .
  • Irradiation of gel(c,I) or gel(c,II) with ⁇ ⁇ > 450 nm at while keeping the temperature between 30°C and 60°C causes dissolution of the gel to give a solution of the open form D, of which the UV-vis and CD spectra are identical to that of the starting solution.
  • This process of gelation-dissolution by alternating irradiations with UV (313 nm) and Vis (> 450 nm) light can be repeated many times, showing that the photo-induced gelation process is fully reversible.
  • the product was purified over a column of 300 g neutral Al 2 O 3 (act. III, freshly prepared) using n-hexane/diethyl ether as gradient eluent mixture (100:0 > 80:20) yielding 4-(10'-cis)-nonadecenyl pyridine as a colourless viscous oil. Yield after purification 12.20 g, 36.9 mmol, 76%.
  • the cis:trans ratio at the double bonds was unchanged 85:15 based upon 1 H NMR integration of the protons at ⁇ 5.25 and 5.33 ppm, which are broad singlets when selectively homo nuclear decoupled at ⁇ ⁇ 1.90 ppm.
  • the cis:trans ratio at the double bonds was unchanged 85:15 based upon 1 H NMR integration of the protons at ⁇ 5.32 and 5.40 ppm, which are broad singlets when selectively homo nuclear decoupled at ⁇ ⁇ 2.00 ppm.
  • the cis:trans ratio at the double bonds was unchanged 85:15 based upon 1 H NMR integration of the protons at ⁇ 5.30 and 5.38 ppm, which are broad singlets when selectively homo-nuclear decoupled at ⁇ ⁇ 2.00 ppm.
  • the cis:trans ratio at the double bonds was unchanged 85:15 based upon 1 H NMR integration of the protons at ⁇ 5.27 and 5.33 ppm, which are broad singlets when selectively homo nuclear decoupled at ⁇ ⁇ 1.95 ppm.
  • the cis:trans ratio at the double bonds was unchanged 85:15 based upon 1 H NMR integration of the protons at ⁇ 5.25 and 5.31 ppm, which are broad singlets when selectively homo nuclear decoupled at ⁇ ⁇ 1.90 ppm.
  • Transfections are carried out following standard protocols as is described in EP 0755924. In numerous publications variations of transfection protocols are given. A person acquainted with the field of non-viral transfections, in particular transfections using cationic amphiphiles will be able to use the cationic amphiphiles of the invention in transfection methods known per se.
  • COS-7 cells are transfected with plasmid DNA containing the ⁇ -galactosidase reporter gene. Upon successful transfection the cell produces the enzyme ⁇ -galactosidase whose activity can be easily measured.
  • Other plasmids comprising alternative reporter genes such as the gene encoding Green Fluoerscent Protein or Chloroamphenicol Acetyl Transferase are suited as well. For analyzing stable transfection a plasmid containing the neomycin resistance gene can be used. Toxicity of the cationic amphiphiles towards the cells can be monitored qualitatively and quantitatively by visual inspection of the cells and by a protein determination
  • a solution of cationic amphiphile in a 50/50 molar ratio with DOPE in chloroform was dried under a stream of nitrogen. The residual solvent was removed under vacuum. The lipid film was hydrated in water at room temperature and sonicated to clarity in a bath sonicator immediately before use.
  • COS-7 cells were cultured in Dulbecco's Modified Eagle Medium (DMEM Gibco The Netherlands) containing 7% of fetal calf serum, 2 mM L-Glutamine, 100 units/ml of penicilin and 100 mg/ml of streptomycin at 37 °C in CO 2 /air (1:19). Cells (1x 10 5 cells/well) were seeded in 12-well plates and were allowed to grow overnight.
  • DMEM Gibco The Netherlands Dulbecco's Modified Eagle Medium
  • ⁇ -galactosidase activity was observed whereas in control wells no activity was detected.
  • the ⁇ -galactosidase activity obtained using the cationic amphiphile according to the invention was substantially higher than the activity obtained with LipofectinTM (Felgner et al. Proc. Natl. Acad. Sci USA, 1987, 84, 7413-7417).
  • the cationic amphiphile displayed no toxicity towards the cells as was analyzed in a protein determination and compared with the reference value of control wells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Dispersion Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
EP02076316A 2002-04-04 2002-04-04 Délivrance d'une substance à un site prédéterminé Withdrawn EP1350507A1 (fr)

Priority Applications (5)

Application Number Priority Date Filing Date Title
EP02076316A EP1350507A1 (fr) 2002-04-04 2002-04-04 Délivrance d'une substance à un site prédéterminé
AU2003225432A AU2003225432A1 (en) 2002-04-04 2003-04-04 Delivery of a substance to a pre-determined site
PCT/NL2003/000256 WO2003084508A1 (fr) 2002-04-04 2003-04-04 Administration d'une substance sur un site predetermine
EP03746007A EP1490028A1 (fr) 2002-04-04 2003-04-04 Administration d'une substance sur un site predetermine
US10/957,887 US20050272677A1 (en) 2002-04-04 2004-10-04 Delivery of a substance to a pre-determined site

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
EP02076316A EP1350507A1 (fr) 2002-04-04 2002-04-04 Délivrance d'une substance à un site prédéterminé

Publications (1)

Publication Number Publication Date
EP1350507A1 true EP1350507A1 (fr) 2003-10-08

Family

ID=27838114

Family Applications (1)

Application Number Title Priority Date Filing Date
EP02076316A Withdrawn EP1350507A1 (fr) 2002-04-04 2002-04-04 Délivrance d'une substance à un site prédéterminé

Country Status (1)

Country Link
EP (1) EP1350507A1 (fr)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7144450B2 (en) 2004-12-04 2006-12-05 Xerox Corporation Phase change inks containing trans-1,2-cyclohexane bis(urea-urethane) compounds
US7153349B2 (en) 2004-12-04 2006-12-26 Xerox Corporation Phase change inks containing curable trans-1,2-cyclohexane bis(urea-urethane) compounds
US7220300B2 (en) 2004-12-04 2007-05-22 Xerox Corporation Phase change inks containing bis(urea-urethane) compounds
US7314949B2 (en) 2004-12-04 2008-01-01 Xerox Corporation Trans-1,2-cyclohexane bis(urea-urethane) compounds
US7317122B2 (en) 2004-12-04 2008-01-08 Xerox Corporation Curable trans-1,2-cyclohexane bis(urea-urethane) compounds
US7560587B2 (en) 2004-12-04 2009-07-14 Xerox Corporation Bis[urea-urethane] compounds
US7576235B2 (en) 2004-12-04 2009-08-18 Xerox Corporation Processes for preparing bis(urea-urethane) compounds
WO2010060811A2 (fr) * 2008-11-27 2010-06-03 Basf Se Protéines tensioactives en tant qu’excipients dans des formulations pharmaceutiques solides
CN110115764A (zh) * 2019-05-07 2019-08-13 天津大学 一种声控肿瘤高效协同免疫治疗可视化微纳载体系统及其制备方法、应用
WO2023019389A1 (fr) * 2021-08-16 2023-02-23 Xianzhong Yu Fantômes bactériens fermés, et compositions, procédés et utilisations de ceux-ci

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997005899A2 (fr) * 1995-08-04 1997-02-20 University Of Guelph Nouveaux vaccins et nouvelles compositions pharmaceutiques utilisant des vesicules de membrane de micro-organismes et leurs procedes d'elaboration
US5820879A (en) * 1993-02-12 1998-10-13 Access Pharmaceuticals, Inc. Method of delivering a lipid-coated condensed-phase microparticle composition
WO1999025836A1 (fr) * 1997-11-13 1999-05-27 Biomade B.V. Fixation de substances a des micro-organismes
WO2000018377A1 (fr) * 1998-09-28 2000-04-06 Warner-Lambert Company Administration enterique et colique par capsules en hpmc
WO2000042987A2 (fr) * 1999-01-25 2000-07-27 Panacea Biotec Limited Produits de recombinaison vesiculaires cibles utilises pour la protection des cellules et le traitement d'infections provoquees par $i(helicobacter pylori)

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5820879A (en) * 1993-02-12 1998-10-13 Access Pharmaceuticals, Inc. Method of delivering a lipid-coated condensed-phase microparticle composition
WO1997005899A2 (fr) * 1995-08-04 1997-02-20 University Of Guelph Nouveaux vaccins et nouvelles compositions pharmaceutiques utilisant des vesicules de membrane de micro-organismes et leurs procedes d'elaboration
WO1999025836A1 (fr) * 1997-11-13 1999-05-27 Biomade B.V. Fixation de substances a des micro-organismes
WO2000018377A1 (fr) * 1998-09-28 2000-04-06 Warner-Lambert Company Administration enterique et colique par capsules en hpmc
WO2000042987A2 (fr) * 1999-01-25 2000-07-27 Panacea Biotec Limited Produits de recombinaison vesiculaires cibles utilises pour la protection des cellules et le traitement d'infections provoquees par $i(helicobacter pylori)

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ANONYMOUS: "National refining photo album - tank trucks", INTERNET ARTICLE, 1 January 2002 (2002-01-01), XP002210455, Retrieved from the Internet <URL:http://www.enarco.com/trucks.htm> [retrieved on 20020819] *
GUTOWSKA A ET AL: "Thermosensitive polymers for drug delivery", POLYMER PREPRINTS, AMERICAN CHEMICAL SOCIETY, vol. 37, no. 2, 1996, pages 115 - 116, XP000874751, ISSN: 0032-3934 *
SIMÕES S ET AL: "Enhancement of cationic liposome-mediated gene delivery by transferrin and fusogenic peptides", PROCEEDINGS OF THE 24TH. INTERNATIONAL SYMPOSIUM ON CONTROLLED RELEASE OF BIOACTIVE MATERIALS, vol. SYMP. 24, 1997, pages 659 - 660, XP002098090, ISSN: 1022-0178 *

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7144450B2 (en) 2004-12-04 2006-12-05 Xerox Corporation Phase change inks containing trans-1,2-cyclohexane bis(urea-urethane) compounds
US7153349B2 (en) 2004-12-04 2006-12-26 Xerox Corporation Phase change inks containing curable trans-1,2-cyclohexane bis(urea-urethane) compounds
US7220300B2 (en) 2004-12-04 2007-05-22 Xerox Corporation Phase change inks containing bis(urea-urethane) compounds
US7314949B2 (en) 2004-12-04 2008-01-01 Xerox Corporation Trans-1,2-cyclohexane bis(urea-urethane) compounds
US7317122B2 (en) 2004-12-04 2008-01-08 Xerox Corporation Curable trans-1,2-cyclohexane bis(urea-urethane) compounds
US7560587B2 (en) 2004-12-04 2009-07-14 Xerox Corporation Bis[urea-urethane] compounds
US7576235B2 (en) 2004-12-04 2009-08-18 Xerox Corporation Processes for preparing bis(urea-urethane) compounds
WO2010060811A2 (fr) * 2008-11-27 2010-06-03 Basf Se Protéines tensioactives en tant qu’excipients dans des formulations pharmaceutiques solides
WO2010060811A3 (fr) * 2008-11-27 2010-10-21 Basf Se Protéines tensioactives en tant qu’excipients dans des formulations pharmaceutiques solides
US8226967B2 (en) 2008-11-27 2012-07-24 Basf Se Surface active proteins as excipients in solid pharmaceutical formulations
CN110115764A (zh) * 2019-05-07 2019-08-13 天津大学 一种声控肿瘤高效协同免疫治疗可视化微纳载体系统及其制备方法、应用
CN110115764B (zh) * 2019-05-07 2021-10-29 天津大学 一种声控肿瘤高效协同免疫治疗可视化微纳载体系统及其制备方法、应用
WO2023019389A1 (fr) * 2021-08-16 2023-02-23 Xianzhong Yu Fantômes bactériens fermés, et compositions, procédés et utilisations de ceux-ci

Similar Documents

Publication Publication Date Title
Kulkarni et al. On the formation and morphology of lipid nanoparticles containing ionizable cationic lipids and siRNA
Heyes et al. Cationic lipid saturation influences intracellular delivery of encapsulated nucleic acids
US20050272677A1 (en) Delivery of a substance to a pre-determined site
Cao et al. Multistimuli-responsive supramolecular vesicles based on water-soluble pillar [6] arene and SAINT complexation for controllable drug release
Asokan et al. Exploitation of intracellular pH gradients in the cellular delivery of macromolecules
Holland et al. Poly (ethylene glycol)− lipid conjugates regulate the calcium-induced fusion of liposomes composed of phosphatidylethanolamine and phosphatidylserine
Guo et al. Chemical approaches to triggerable lipid vesicles for drug and gene delivery
US5635487A (en) Amphipathic, micellar delivery systems for biologically active polyions
AU776047B2 (en) Ortho ester lipids
Hyvönen et al. Novel cationic amphiphilic 1, 4-dihydropyridine derivatives for DNA delivery
KR20080082956A (ko) 양쪽성 리포솜의 개선 또는 양쪽성 리포솜에 관련된 개선
Perouzel et al. Synthesis and formulation of neoglycolipids for the functionalization of liposomes and lipoplexes
Mozafari Bioactive entrapment and targeting using nanocarrier technologies: an introduction
JP6887020B2 (ja) 生分解性化合物、脂質粒子、脂質粒子を含む組成物、およびキット
EP1350507A1 (fr) Délivrance d&#39;une substance à un site prédéterminé
JPH09285290A (ja) 高分子輸送ビヒクル
Tajik-Ahmadabad et al. Metallo-cubosomes: zinc-functionalized cubic nanoparticles for therapeutic nucleotide delivery
AU2002317402B2 (en) Pharmaceutical composition comprising lipids comprising a polar and a nonpolar moiety
Xu et al. A smart nanoassembly consisting of acid-labile vinyl ether PEG− DOPE and protamine for gene delivery: Preparation and in vitro transfection
AU2002317402A1 (en) Pharmaceutical composition comprising lipids comprising a polar and a nonpolar moiety
Shelar et al. Spontaneous Formation of cationic vesicles in aqueous DDAB-lecithin mixtures for efficient plasmid DNA complexation and gene transfection
Zhong et al. Structural and componential design: new strategies regulating the behavior of lipid-based nanoparticles in vivo
Makhlouf et al. Gemini surfactant-based systems for drug and gene delivery
Huang et al. Bioresponsive liposomes and their use for macromolecular delivery
KR101567108B1 (ko) 핵산 복합체 및 핵산 송달용 조성물

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

AKX Designation fees paid
REG Reference to a national code

Ref country code: DE

Ref legal event code: 8566

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20040409