Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/52—Cytokines; Lymphokines; Interferons
  • C07K14/54—Interleukins [IL]
  • C07K14/5434—IL-12

Definitions

• the genetics of the porcine IL-12 receptor are determined.
• the genes encoding the porcine beta-1 and beta-2 chains of the porcine interleukin-12 receptor were cloned.
• the complete sequence of the complementary DNA of both chains was determined.
• Variants polymorphisms
• Interleukin-12 is a heterodimeric cytoldne consisting of two subunits having molecular weights of 35 and 40 kDa. Both subunits are highly conserved across species, with the predicted amino acid sequences of the two porcine IL-12 subunits being approximately 85% homologous with their human counterparts (Foss and Murtaugh, 1997). IL-12 is the single major factor that is required for the efficient differentiation of naive T cells into memory/effector T-cells capable of producing IFN-gamma. Also known as an NK cell stimulatory factor, IL-12 is a cytoldne with clear pro-inflammatory functions.
• IL-12 stimulates the proliferation of activated T and NK cells, and also stimulates the lytic activity of both cytotoxic T lymphocytes and NK cells (Romani, et al, 1997; Trinchieri and Scott, 1994; Trinchieri, 1997).
• the biological activity of IL-12 is mediated via binding to specific cell surface receptors.
• the human IL-12 receptor consists of a disulfide-linked oligomer composed of two beta-type cytoldne receptor subunits termed IL-12 receptor beta-1 and IL-12 receptor beta-2 and having an estimated molecular weight of 130 kDa each. Together these two subunits give rise to the high affinity IL-12 receptor, whereas each independently expressed chain exhibits low affinity for IL-12 (Presl y et al, 1996, 1998).
• the expression of both IL-12 receptor beta-1 and IL-12 receptor beta-2 subunits is upregulated following activation in CD4 + , CD8 + lymphocytes as well as in NK cells (Szabo et al, 1997; Wu et al, 1997).
• IL-12 receptor subunits appear to be differentially regulated, at least at the transcriptional level.
• transcription of the IL-12 receptor beta-2 gene appears to be more tightly regulated, in that only this subunit, but not the beta-1 subunit is inhibited by IL-10 and TGF-beta (Wu et al, 1997).
• the biological activity of IL-12 is dependent on the cell surface expression of the receptors for this cytokine.
• Allelic variants of this beta-1 receptor have been shown to affect the ability of humans to develop a protective immunity against intracellular pathogens such as Salmonella and Mycobacteria.
• Interleukin-12 pays a major role in determining the nature of the immunity that develops in response to infection or vaccination against an infectious agent. This effect is mediated through the binding of this cytokine to its cell surface receptor on lymphoid cells.
• IL-12 plays a key role in regulating the development of cell-mediated immunity, it is possible that within the swine population there are animals that possess IL-12 receptor alleles that have a superior ability to respond to the differentiation signals provided by IL-12. These animals may consequently be genetically predisposed to develop a strong cellular immune response upon infection or vaccination against a pathogen. Superior cellular immune response is likely to provide a higher level of protective immunity against infectious diseases in where this type of immunity plays a role in protection from disease. What is needed is to develop a genetic marker that will identify animals such as swine capable of developing a strong cellular immune response to a given pathogen.
• the present invention relates genetic markers that can identify swine with superior cellular immunity.
• the markers are allelic variants of the IL-12 receptor gene, which consists of 2 subunits.
• An aspect of the invention is a porcine IL-12 receptor encoded by the cDNA molecules disclosed herein.
• a cDNA molecule encoding the porcine beta-1 chain of the porcine interleukin-12 receptor has a nucleotide sequence as shown in FIGS. 1 and 2.
• a molecule with an amino acid sequence deduced from the cDNA sequence of the beta-1 chain is also shown in FIGS. 1 and 2.
• a variant of a cDNA molecule encoding the porcine beta-1 chain of the porcine interleuldn-12 receptor which lacks 37 nucleotides from positions 628-664 and results in a premature termination of the IL- 12R beta portion as shown in FIGS. 3 and 4.
• a molecule with an amino acid sequence deduced from the cDNA sequence is also shown in FIGS. 5 and 6.
• a cDNA molecule encoding the porcine beta-2 chain of the porcine interleukin-12 receptor has a nucleotide sequence as shown in FIGS. 5 and 6.
• a molecule with an amino acid sequence deduced from the cDNA sequence is also shown in FIGS. 5 and 6. This molecule is present in pigs found to have a high IFN-g response or cell mediated immunity to an infectious agent.
• An aspect of the invention is a molecule with an amino acid sequence having an allelic variant at position 1254 that results in a serine at amino acid position #342 as shown in FIG. 5.
• the variant results from a nucleotide change at position 1254 from adenine to cytosine.
• the variant is present in pigs found to have a high IFN- gamma response or cell-mediated immunity to an infectious agent PRRSV (Porcine Reproductive and Respiratory Syndrome Virus) in a pig.
• PRRSV Permanent Reproductive and Respiratory Syndrome Virus
• the invention also relates a method of identifying pigs capable of developing a strong cellular immune response to a given pathogen.
• the method includes the steps of:
• An aspect of the invention is a method for improving the cellular immune response of pig herds. The method includes the following steps:
• FIG. 1 shows the cDNA sequence for the pig IL-12R beta- 1 chain.
• the nucleotide sequence is on the bottom with the deduced amino acid sequence on top.
• a variant of the IL-12 receptor beta- 1 chain that results in a premature termination of the coding sequence and a truncated protein has a deletion (underlined). The resulting sequence follows in order the full sequence of the beta - 1 chain. A portion of a gene is deleted in the variant resulting in a stop codon downstream. This results in premature termination of protein translation.
• FIG. 2 is the nucleotide sequence of FIG. 1 in a more compact form without the amino acid sequence on top.
• FIG. 3 is a variant that lacks 37 nucleotides from positions 628-664 in the pig IL-12R beta-1 cDNA. The deletion results in premature termination of the IL-12R beta - 1 protein.
• the nucleotide sequence of the variant extends from positions 58- 2318 in FIG. 1 in the pig IL-12R beta-1 cDNA (position 1 in FIG. 3 is position 58 in FIG. 1).
• FIG. 4 is FIG. 3 without the amino acids corresponding to the nucleotide code.
• FIG. 5 shows the amino acid and corresponding nucleotide sequence for pig IL-12R beta-2 cDNA.
• a variation on the beta - 2 chain changes the amino acid sequence from a tyrosine to a serine.
• FIG. 6 is FIG. 5 showing only the nucleotide sequence.
• FIG. 7 shows the intensity of the cellular immune response of swine following immunization with a PRRSV MLV vaccine.
• Twenty-four full-sibling pigs (shown in Table 1) were immunized at 9 and 12 weeks of age with a PRRSV MLV vaccine.
• Peripheral blood mononuclear cells were isolated from them at 2 weeks after the second immunization and stimulated with PRRSV virus for 20 hours.
• the frequency of IFN-gamma secreting cells was determined with an IFN-gamma ELISPOT assay as described in the Materials and Methods section herein (Zuckermann et al, 1988).
• the results obtained were separated into two groups according to the genotype of the responder pig into IL-12R beta-2 c/c (8 pigs), IL-12R beta-2 ⁇ (9 pigs), IL-12R beta-2 ⁇ 3 (7 pigs). The data for these four weeks was analyzed by ANOVA (Analysis of Variance).
• the present invention relates methods and compositions to identify pigs with superior cell-mediated immunity based on their IL-12R genotype.
• the receptor and its coding sequences were identified.
• cDNA sequences and deduced amino acid sequences of the 2 subunits forming porcine IL-12 receptor are disclosed. These cloned porcine genes and predicted immune response of pigs due to IL-12 receptor genotype differences, have not been previously reported.
• IL-12 binds to its receptor on the surface of T cells, structural (sequence) variations on the gene may affect the functionality of the receptor.
• the invention relates to effects of allelic variations on the functionality of the IL-12 receptor which are likely to have an impact on the ability of a pig to develop a cellular immune response to an infectious agent. As discussed in the Background, IL-12 is known to control the development of cell-mediated immunity.
• the cloning and sequencing of the porcine IL-12 receptor is a first step in the identification of animals with superior cellular immunity. Having obtained the sequence of the genes encoding for the two chains of the receptor (FIGS. 1-4, showing the beta-1 chain and FIGS. 5 and 6 showing the beta-2), allelic variants of these genes were identified that allow for a higher level of a cellular immune response to microorganisms as compared to pigs without the variants.
• the IL-12 receptor consists of two chains (subunits), the IL-12R beta-1 and
• FIGS. 1-4 show the DNA sequences of the IL12R beta-1 chain.
• a variant of the IL-12 receptor beta-1 chain was discovered which results in premature termination of the coding sequence. In this variant, the resulting protein translation terminates prematurely (see FIGS. 1 and 2).
• the variant of the IL-12R beta-1 chain lacks 37 nucleotides from positions 628 through 664. This deletion results in a premature termination of the IL- 12R beta-1 protein.
• To determine the IL-12R beta-2 cDNA sequence four groups of pigs were obtained from the Pig Improvement Company (PIC). Each group of pigs was sequenced to determine the IL-12R beta-2 cDNA.
• Position 245 G to T changes: Glycine to Cysteine. Non-conservative replacement. Located in leader sequence
• Position 556 T to G changes: Aspartic acid to Glutamic acid. Conservative replacement
• Position 890 A to G changes: Isoleucing to Valine. Conservative Replacement
• Position 1254 A to C changes: Tyrosine to Serine. Non-conservative replacement
• Position 2233 C to T changes: Aspartic acid to Aspartic acid. No change in identity
• Position 2440 C to T changes: Histidine to histidine. No change in identity).
• IL-12 receptor beta-2 (IL-12RBeta-2) chain of this molecule has an impact on the ability of a pig to develop a cellular immune response to an infectious agent.
• a polymorphism at position 1254 (a nucleotide change from A to C) within the porcine IL-12 beta-2 subunit gene) (FIG. 5 and 6), which results in either a serine or a tyrosine at amino acid position #342 of the intact swine IL-12R beta-2 chain was of particular interest.
• This change has an impact on the intensity of the cell-mediated immune response to an infectious agent. Only the former amino acid has been detected at the corresponding site in IL-12R beta-2 of either human, murine or bovine origin.
• the IL-12 beta-2 allele expressing a serine at nucleotide position 1254 in pigs is associated with a greater host interferon- gamma response to immunization with porcine reproductive and respiratory virus (FIG. 7).
• the expression of this allele is likely associated with a higher interferon gamma response to other microorganisms of swine in general.
• the virus-specific immunity elicited in a group of pigs in response to vaccination with a modified live virus (MLV) vaccine against porcine reproductive and respiratory syndrome virus (PRRSV) was evaluated.
• the MLV is a non- virulent attenuated vaccine manufactured by Boehringer Ihgelheim Vet Medica.
• the PRRSV is a stock arterivirus (strain VR2332 from the American Type Culture Collection).
• One pig from this injection experiment (designated No. 785g) was unique.
• the frequency of PRRSV-specific IFN secreting cells in the peripheral blood elicited in response to immunization with this virus was more than double that of any of the other nine pigs in the group.
• this pig appeared to be a high responder to PRRSV antigens.
• the genotype of these pigs for the IL-12R beta-2 chain at positions 1254 is shown in Table 1.
• a change in nucleotide position 1254 from A to C results in a non-conservative replacement of amino acid 342 from tyrosine to serine.
• mice expressing a "c" allele for the IL- 12R beta-2 were more likely to have the ability to develop a high virus-specific IFN- gamma response following an immunization with a PRRSV modified live virus vaccine than those not expressing this allele.
• the virus-specific IFN-gamma response of pigs with the IL-12R beta-2 ⁇ genotype was significantly higher (p ⁇ 0.01) than pigs with the IL-12R beta-2 a/a genotype at 6 weeks following vaccination.
• primers were engineered to create either one or two novel EcoR I sites in the amplicon generated during amplification of a portion of this template.
• the forward PCR primer (GACTACACAAGACAACAGAATT) is nearly identical to the nucleotide stretch (GACTAC AAAAGACAAC AGATTT) immediately upstream of the polymorphic site.
• GACTACACAAGACAACAGAATT is nearly identical to the nucleotide stretch immediately upstream of the polymorphic site.
• GACTAC AAAAGACAAC AGATTT the nucleotide stretch immediately upstream of the polymorphic site.
• IL- 12R Beta 2 transcripts are not present in detectable levels in quiescent cells, their production needs to be stimulated. Then, the RNA is reverse transcribed by using random hexamers as primers and a portion of the resultant IL-12R Beta 2 cDNAs are amplified by a "proof-reading" polymerase. Amplicons generated by the two above mentioned primers are 127 bp in length and contain either one or two acquired EcoR I recognition sites depending on whether an adenosine or cytosine moiety is present at the polymorphic site, respectively. Digestion of the products with EcoR I yields either a 110 (adenosine) or 90 (cytosine) bp product which can easily be identified based on their relative mobilities in polyacrylamide gels.
• the magnitude of the cellular immune response to immunization with the PRRS virus vaccine was quantified by utilizing an IFN- ELISPOT assay. Briefly, 96- well Immulon IITM plates (Dynatech Inc.) were coated with 50 ml per well of a 24 ⁇ g/ml solution of mAb P2G10 in 0.1 M carbonate buffer, pH 9.6. After an overnight incubation at 4 ° C, each well was washed three times with sterile PBS and then incubated with 50 ⁇ l of RPMI supplemented with 5% fetal porcine serum for two hours at 37° C in a 5% CO2 atmosphere.
• PBMC Peripheral blood mononuclear cells
• the pigs will first be screened through the method for differentiation of A and C homozygotes and heterozygotes at nucleotide position 1254 of the sequenced porcine IL-12R Beta-2 cDNA as previously stated in the Materials and Method section. After that screening process has occurred, pigs will be selected which contain the C marker. After selection these pigs will be bred by conventional methods known to those of skill in the art of pig breeding to increase the frequency of the "C" polymorphism in the herd.
• RNAs were sequenced overlapping RT-PCR products derived from the respective transcripts.
• the source of RNAs was from activated T cells obtained from three pigs selected at random from each of the four above mentioned groups of swine provided by POC.
• POC Proliferative Control
• similar determinations were made for pigs derived from GENETIPORC breeding stock (University of Illinois Veterinary Medicine Swine research Farm). These animals had been participants in an unrelated experiment evaluating immunity elicited in response to vaccination with a PRRS modified live virus (MLV).
• MMV PRRS modified live virus
• pig 758g was unique in that the frequency of its PRRS virus-specific IFN-gamma secreting cells was more than double that of any of the other nine pigs. Moreover, the novelty of pig 758g's response was even more apparent in view of the fact that immunization with a PRRS MLV vaccine has been shown to elicit a weak cell-mediated immune response. In this regard, the frequency of IFN-gamma secreting cells usually ranges between 50-150 per million mononuclear cells. Thus, based on these values, pig 758g was considered to be a high responder whereas pig 834b for example was considered to be a low responder to recall PRRS virus antigens. Due to the divergence in their immune response phenotypes, the predicted primary structures of the IL-12 receptors were determined. Method of Discovering Receptors
• pairs of degenerate primers representative of conserved sequences in cDNA encoding the beta-1 and beta-2 subunits of the mouse and human IL-12 were used to amplify internal portions of the respective porcine cDNAs by RT-PCR. Subsequently, the remainder of both cDNAs was obtained by 5' and 3' RACE combined with "primer walking.” Both entities have been completely sequenced in both directions.
• the coding portion of the IL-12R beta-1 cDNA is 2196 nucleotide, while that for IL-12R beta-2 is 2583 nucleotides.
• Both chains of the IL-12R are members of the class I cytokine receptor family which includes gpl30, granulocyte colony stimulating factor receptor, and leukemia inhibitory factor receptor. All members of this family share several structural characteristics. Accordingly, both of the porcine IL-12R chains have these characteristics which include a Cys-Cys pair (C/CxW) motif in the amino terminal part of their extracellular domain and a Trp-Ser-x-Trp-Ser (WS x WS) motif in the C- terminal portion. Presumably, these sequences contribute to ligand interaction and protein architecture. Moreover, the intracellular portion of the porcine IL- 12R beta-2 chain contains three tyrosine conserved in the human and mouse counterparts.
• both porcine IL-12R chains has two regions of amino acids, termed box 1 and box 2, which are required fro signal transduction.
• Box 1 is comprised of a Pro-X-Pro sequence preceded by a cluster of hydrophobic amino acids.
• the second motif, box 2 has a distinct sequence that is not conserved in all members of the family. The presence of all these structural features demonstrates unequivocally that the identified two porcine IL-12R subunits are indeed members of the superfamily of cytoldne receptors.
• a functional interleuldn 12 receptor complex is composed of two Beta-type cytoldne receptor subunits. Proc. Natl. Acad. Sci. U S A. 1996 Nov 26;93(24): 14002- 7.
• IL-12RBeta-l interleukin-12 receptor Beta-1
• Lammas DA Kumararatne DS, Sanal O, Kroon FP, van Dissel JT, Sinigaglia F, OttenhoffTH.

Landscapes

• Chemical & Material Sciences (AREA)
• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Molecular Biology (AREA)
• Biochemistry (AREA)
• Biophysics (AREA)
• Zoology (AREA)
• Genetics & Genomics (AREA)
• Medicinal Chemistry (AREA)
• Gastroenterology & Hepatology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Toxicology (AREA)
• Peptides Or Proteins (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=22903308

Family Applications (1)

Country Status (6)

Families Citing this family (1)

Family Cites Families (1)

• 2001
  • 2001-10-11 WO PCT/US2001/032088 patent/WO2002031153A2/en not_active Application Discontinuation
  • 2001-10-11 JP JP2002534521A patent/JP2004511231A/ja not_active Withdrawn
  • 2001-10-11 MX MXPA03003188A patent/MXPA03003188A/es unknown
  • 2001-10-11 CA CA002425885A patent/CA2425885A1/en not_active Abandoned
  • 2001-10-11 AU AU2002211727A patent/AU2002211727A1/en not_active Abandoned
  • 2001-10-11 EP EP01979802A patent/EP1349937A2/de not_active Withdrawn

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events