EP1315410A1 - Enhanced meristematic activity and competence by overexpression of tonoplast pyrophosphatase - Google Patents
Enhanced meristematic activity and competence by overexpression of tonoplast pyrophosphataseInfo
- Publication number
- EP1315410A1 EP1315410A1 EP01924311A EP01924311A EP1315410A1 EP 1315410 A1 EP1315410 A1 EP 1315410A1 EP 01924311 A EP01924311 A EP 01924311A EP 01924311 A EP01924311 A EP 01924311A EP 1315410 A1 EP1315410 A1 EP 1315410A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- avpl
- plant
- homologue
- plants
- transgenic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Definitions
- the present invention relates to genetically-altered plants that are hardy with respect to environmental stresses, such as drought and/or freezing, oversized with respect to vegetative and/or sexual structure (as compared to their normal phenotypic counterparts), and capable of growing in media of high salinity. Such plants also display high meristematic activity, and increased in cellular division activity.
- Salinization of soil occurs when water supplies contain dissolved salt. Upon evaporation of water from such supplies, salts gradually accumulate in the soil.
- the progressive salinization of irrigated land compromises the future of agriculture in many of the most productive areas of our planet (Serrano, R., et al, Crit. Rev. Plant Scl, 73:121-138 (1994)).
- arid regions offer optimal photoperiod and temperature conditions for the growth of most crops, but suboptimal rainfall.
- Artificial irrigation has solved the problem only in the short term as it has been found that soils in such environments frequently are rapidly salinized.
- plants must maintain a much lower ratio of Na + /K + in their cytoplasm than that present in the soil, preventing the growth of a number of plants, including food crops.
- Yet another area of agricultural interest is to improve the yield of crop plants and to improve the aesthetic qualities of certain decorative plants.
- the yield of a plant crop, and the aesthetics of certain decorative plants may be improved by growing plants that are larger than the wild-type plant in vegetative and/or reproductive structure, as well as improving the growth rate of plants.
- cyclodextrins applied to tissue culture media has been asserted to improve the rate of cell tissue culture growth by mechanisms including increased cell division (See, e.g., U.S. Patent No. 6,087,176).
- Certain plant growth hormones such as auxins (which promote, among other things, root growth), cytokinins, and gibberellic acid (which promotes, among other things, stem growth) when applied to plant tissues are also known to promote increased cellular division.
- auxins which promote, among other things, root growth
- cytokinins cytokinins
- gibberellic acid which promotes, among other things, stem growth
- certain growth factors may be used to increase plant and/or plant flower size. Unfortunately, isolation and application of such growth hormones and factors is costly and time consuming.
- U.S. Patent No. 5,859,338 discloses that modification of the CLAVATA1 gene of Arabidopsis thaliana causes a loss normal control of cell division in shoot apical meristems and floral meristems. In either case, the loss of control is said to cause an enlargement of the meristem. In flowers, the enlargement is said to lead to an increase in the number of floral organs, including an increase in carpel number, which increases fruit size and seed number.
- U.S. Patent No. 5,859,338 provides clavatal nucleic acids and proteins, and modified clavatal nucleic acids and proteins, to result in altered meristem phenotypes.
- U.S. Patent No. 5,750,862 discloses a method for controlling plant cell growth comprising modulating the level and or catalytic activity of a cell cycle control protein in the plant.
- the patent discloses that by elevating levels of the protein p34 crfc2 , regeneration into plants of single or groups of cells can be facilitated. Control of regeneration may also be effectuated by control of regulatory elements which indirectly result in modulation of p34 Cfifc2 activity.
- the present invention discloses a transgenic plant having upregulated expression of vacuolar pyrophosphatase. It has been found that plants displaying such upregulated activity are generally larger than wild-type counterparts, demonstrate improved stress resistance to drought and/or freeze, have increased tolerance to salt in the media in which they are growing, and display higher meristematic activity (cell division) leading to greater biomass in certain plant parts as compared to wild type plants.
- exogenous nucleic acid molecule which alters expression of vacuolar pyrophosphatase in the plant can be used to transform the transgenic plants in accord with the present invention.
- the exogenous nucleic acid can comprise nucleic acid that encodes a vacuolar pyrophosphatase protein (an exogenous vacuolar pyrophosphatase), such as AVP1, a functional portion thereof (peptide, polypeptide), or a homologue thereof, and/or nucleic acid that alters expression of the endogenous vacuolar pyrophosphatase of the plant into which the exogenous nucleic acid is introduced.
- exogenous nucleic acid it is meant a nucleic acid from a source other than the plant cell into which it is introduced, or into a plant or plant part from which the transgenic part was produced.
- the exogenous nucleic acid used for transformation can be RNA or DNA, (e.g., cDNA, genomic DNA).
- the exogenous nucleic acid can be circular or linear, double-stranded or single-stranded molecules. Single-stranded nucleic acid can be the sense strand or the anti-sense strand.
- a “functional portion” of a nucleic acid that encodes a vacuolar pyrophosphatase protein it is meant a portion of the nucleic acid that encodes a protein or polypeptide which retains a functional characteristic of a vacuolar pyrophosphatase protein.
- the nucleic acid encodes ANP1, a functional portion or a homologue thereof.
- the AVP1 nucleic acid may be obtained, for example, from Arabidopsis or any other plant, or synthetically synthesized.
- Nucleic acid that alters expression of the endogenous vacuolar pyrophosphatase of the plant into which the exogenous nucleic acid is introduced includes regulatory sequences (e.g., inducible, constitutive) which function in plants and antisense nucleic acid.
- regulatory sequences include promoters, enhancers.
- the nucleic acid can also include, for example, polyadenylation site, reporter gene and/or intron sequences and the like whose presence may not be necessary for function or expression of the nucleic acid but can provide improved expression and/or function of the nucleic acid by affecting, for example, transcription and/or stability (e.g., of mRNA).
- Such elements can be included in the nucleic acid molecule to obtain optimal performance of the nucleic acid.
- the nucleic acid for use in the present invention can be obtained from a variety of sources using known methods.
- the nucleic acid encoding a vacuolar pyrophosphatase (e.g., AVP1) for use in the present invention can be derived from a natural source, such as tobacco, bacteria, tomato or corn.
- the nucleic acid encodes a vacuolar pyrophosphatase that corresponds to a wild type of the transgenic plant.
- the nucleic acid encodes a vacuolar pyrophosphatase that does not correspond to a wild type of the transgenic plant.
- Nucleic acid that alters expression of the endogenous vacuolar pyrophosphatase of the plant into which the exogenous nucleic acid is introduced can also be chemically synthesized, recombinantly produced and/or obtained from commercial sources.
- a variety of methods for introducing the nucleic acid of the present invention into plants are known to those of skill in the art.
- Agrobacterium- mediated plant transformation, particle bombardment, microparticle bombardment (e.g., U.S. Patent No. 4,945,050; U.S. Patent No. 5,100,792) protoplast transformation, gene transfer into pollen, injection into reproductive organs and injection into immature embryos can be used.
- the exogenous nucleic acid can be introduced into any suitable cell(s) of the plant, such a root cell(s), stem cell(s) and/or leaf cell(s) of the plant.
- Any suitable plant including angiosperms, monocots and dicots, and gymnosperms, and algae can be used to produce the transgenic plants, tissue cultures or cell cultures of the present invention.
- tomato, corn, tobacco, rice, sorghum, cucumber, lettuce, turf grass, ornamental (e.g., larger flowers, larger leaves) and legume plants can be transformed as described herein to produce the transgenic plants of the present invention.
- the transgenic plants of the present invention can be grown in any medium which supports plant growth such as soil or water (hydroponically).
- a transgenic plant of the present invention is preferably tolerant to high salt concentrations in soil.
- salt it is meant to include any salt, that is a compound formed when hydrogen of an acid is replaced by a metal or its equivalent, and includes, without limitation, salts comprising monovalent and divalent toxic cations, NaCl, KC1, CaCl 2 , MgCl, CdCl, ZnCl, and sulfide salts.
- Salt tolerance may be introduced into a plant of the present invention by transforming plant cells with exogenous nucleic acid which alters the expression of vacuolar pyrophosphatase in the plant such that expression is upregulated.
- Any suitable vacuolar pyrophosphatase can be used in the compositions and methods of the present invention (e.g., Sarasian, Z., et al, Proc. Natl. Acad. Scl, USA, 89:1775-1719 (1992); Jenslerchl, et al, Molec. Biol, 29: 833-840 (1995); Kim, Y., et al, Plant Physiol, 106:375-382 (1994)).
- the present invention relates to a transgenic plant which is tolerant to salt comprising an exogenous nucleic acid construct which is designed to overexpress AVP1 (Sarasian, Z., et al, Proc. Natl. Acad. Sci., USA, 59:1775-1779 (1992)). Transformation of the plant cells may be carried out in a whole plant, seeds, leaves, roots or any other plant part. Such transgenic plants are preferably altered such that they grow in a concentration of salt that inhibits growth of a corresponding non-transgenic plant.
- Plants may be regenerated from transformed cells to yield transgenic plants, which may be screened for certain levels of salt tolerance.
- the exogenous nucleic acid encodes AVP1, or a homologue thereof.
- expression of the vacuolar pyrophosphatase in the plant is enhanced to an extent that the transgenic plant is tolerant to sodium chloride (NaCl) when the NaCl concentration is from about 0.2M to about 0.3M.
- a transgenic plant capable of growing in salt water may also be produced by introducing into one or more cells of a plant nucleic acid which upregulates expression of vacuolar pyrophosphatase in the plant to yield transformed cells.
- salt water includes water characterized by the presence of salt, and preferably wherein the concentration of salt in the water is from about 0.2M to about 0.4M.
- salt water refers to sea water.
- the transgenic plants of the present invention can also be used to produce double transgenic plants which are tolerant to salt (about 0.2M to about 0.4M salt concentration).
- the present invention relates to a double transgenic plant which is tolerant to salt comprising one or more plant cells transformed with exogenous nucleic acid which alters expression of a vacuolar pyrophosphatase and an Na + /H + antiporter in the plant.
- the vacuolar pyrophosphatase in an advantageous construct is AVP1, or a homologue thereof, and the Na + /H + antiporter is AtNHXl, or a homologue thereof.
- the present invention also encompasses transgenic progeny of the double transgenic plant, as well as seeds produced by the transgenic plant and a progeny transgenic plant grown from the seed.
- Drought and/or freeze tolerance may also be introduced into plants by transforming plant cells with exogenous nucleic acid which alters the expression of vacuolar pyrophosphatase in the plant such that such expression is upregulated.
- a substantially drought and/or freeze resistant transgenic plant which comprises a genome having one or more exogenously introduced vacuolar H + -translocating pump genes.
- a particularly preferred fertile transgenic plant eliciting drought and/or freeze tolerance, as well as the ability to grow in saline soils comprises an isolated exogenous chimeric DNA construct encoding vacuolar H + - translocating pump, preferably operably linked to a promoter, such as the 35-S promoter or any other strong promoter, including, without limitation, tissue specific promoters.
- the transgenic plant may contain a polynucleotide sequence comprising an exogenous tonoplast pyrophosphate FT 1" pump gene operably linked to a promoter.
- the polynucleotide sequence comprises an exogenous tonoplast pyrophosphate H* pump gene operably linked to a double tandem enhancer of the 35S promoter.
- a particularly preferred tonoplast pyrophosphate H 1" pump gene is the AVP1 gene.
- Upregulation of expression of vacuolar pyrophosphatase by the methods described above may also be used to provide a plant having larger vegetative and/or sexual organs than wild type counterpart plants. That is, the present invention provides for a method of increasing the yield of a plant comprising introducing into one or more cells of a plant nucleic acid which alters expression of vacuolar pyrophosphatase in the plant to yield transformed cells, thereby increasing the yield of the plant. The method can further comprise regenerating plants from the transformed cells to yield transgenic plants and selecting a transgenic plant which is larger than its corresponding wild type plant, thereby producing a transgenic plant which is larger than its corresponding wild type plant.
- a transgenic plant e.g., an ornamental plant
- a method of making a transgenic plant comprising introducing into one or more cells of a plant nucleic acid which alters expression of vacuolar pyrophosphatase in the plant to yield transformed cells.
- Upregulation of expression of vacuolar pyrophosphatase by the methods described above may also be used to provide a plant with meristematic activity cell division rate which is enhanced over wild-type counterpart plants.
- meristems are central to higher plant development, as almost all post-embryonic organs, including roots, leaves, flowers and axillary meristems and cambium are initiated by either shoot or root meristems.
- Increased meristematic activity results in higher biomass in one or more aspects of plant structure, as evidenced by dry weight of plant structure, root structure as well as stem structure.
- Increased meristemic activity is hypothesized to result in increased rate of shoot regeneration in root, leaf, hypocotyl, and cotyledon explants, and increased overall plant growth rate.
- the present inventor has discovered that overexpression of a pyrophosphate driven proton (H + ) pump at the vacuole leads to a greater proton pumping capacity that results in a greater ion uptake into the vacuoles that lowers the osmotic potential of the cells, and also leads to an increase in the capacity of plant cells to divide and multiply.
- finding can have great commercial importance, e.g., reducing time for wood, corn etc. production by transforming cells so as to overexpress such pumps, and enhancing shoot regeneration capacity in plants with poor or slow regeneration capacity, such as woody plants, crops, e.g. co , and ornametals e.g., orchids.
- a preferred construct includes a tonoplast pyrophosphate driven H+ pump gene (AVP-T) operably linked to a chimeric promoter (e.g., double tandem enhancer of 35S promoter) designed to overexpress A VP- 1.
- AVP-T tonoplast pyrophosphate driven H+ pump gene
- novel gene cassettes including cassettes comprising a tonoplast pyrophosphate driven H 1" pump gene operably linked to a chimeric promoter.
- a novel gene cassette comprising an exogenous tonoplast pyrophosphate driven H pump gene operably linked to a promoter, as well as novel coding sequences comprising an exogenous tonoplast pyrophosphate driven H pump gene operably linked to a double tandem enhancer of the 35S promoter.
- coding sequence is designed to overexpress ANP1.
- novel expression vectors including an expression vector containing a polynucleotide sequence comprising a exogenous tonoplast pyrophosphate driven H 1" pump gene operably linked to a double tandem enhancer of the 35S promoter and further operatively linked to a multiple cloning site, and an expression vector containing a polynucleotide sequence comprising a exogenous tonoplast pyrophosphate driven T pump gene operably linked to a double tandem enhancer of the 35S promoter and further operatively linked to a heterologous coding sequence.
- the disclosed invention may have application to any plant, including, without limitation, crop plants, ornamental plants, grasses, shrubs, or any other plant found useful or pleasing to man, including having application to monocots, dicots, angiosperms, gymnosperms, and algae.
- Fig. 1A is an overhead view of representative (out of 10 plants each) wild type (WT) and two independent transgenic lines (1' and 2') grown hydroponically for seven weeks on a 10 hour light/dark cycle;
- Figs. 1B(1), 1B(2) and 1B(3) are a photomicrographs of the root and root hairs of representative five day old seedlings obtained from representative WT, 1' and 2' of Fig. 1A grown parallel to the surface on vertical plant nutrient agar plates;
- Fig. 1C is an immunoblot of membrane fractions isolated from wild type (WT) and two independent transgenic lines (1' and 2') overexpressing AVP-1;
- Fig. 2 is an overhead view of a representative wild type plant (WT) versus representative transgenic plants overexpressing AVP-1 (1' and 2') after exposure to 7 days of water deficit stress.
- Fig. 3 is a perspective view of wild-type plants (WT) versus representative transgenic plants overexpressing AVP-1 (1' and T) grown in salty soil.
- Fig. 4 A is a schematic representation of a working model of the transporters involved in sodium sequestration at the yeast pre-vacuolar compartment; Nhxl (Na + /H + antiporter), Vmal (vacuolar membrane H + -ATPAse), Gefl (yeast CLC chloride channel), Enal (plasma membrane Na + -ATPase).
- Fig. 4B is a schematic representation of a working model of the transporters involved in sodium sequestration at the yeast pre-vacuolar compartment shown in Fig. 4A, which also includes Avpl (A. thaliana vacuolar pyrophosphate- energized proton pump).
- Fig. 5A and Fig. 5B are bar graphs showing the intracellular Na + and K + contents of wild-type yeast strains and of yeast strains carrying various mutations affecting sodium tolerance wherein the values are the mean of two determinations, and the bars represent the standard deviations.
- Fig. 6 is an overhead view of shoot regeneration from root and cotyledon explants from wild-type (WT) and AVP-1 overexpressing (l 1 and ) Arabidopsis plants, cultured in the SIM medium of Fig. 13.
- Fig. 7 is a bar graph of Na + and K + content of wild-type plants (WT) versus representative transgenic plants overexpressing AVP-1 (1' and ) grown in salty soil.
- Fig. 8 is a. graph of the uptake of calcium into the 35SAVP-1 transgenic vacuolar membrane vesicles (squares) of 2' of Fig. 3 versus calcium uptake into vesicles obtained from wild type (WT) of Fig. 3.
- Figs. 9 A and 9B are illustrations demonstrating the 35SAVP-1 theorized mechanism for a higher accumulation of solids into vacuoles via a proton driven function versus that of WT vacuoles.
- Fig. 10 is an overhead view of the leave foliage of wild type versus transgenic (1' and ) AVP-1 overexpressing Arabidopsis plants with leaves positioned with respect to one another according to age.
- Figs. 11 A and 11B are overhead views of watered (distilled water) leaves from wild type and transgenic (1' and 2') Arabidopsis plants overexpressing AVP-1 demonstrating growth of root structures.
- Fig. 12 is an overhead view of shoot regeneration in representative wild type petunia leave cuttings (WT) versus representative transgenic petunia plant leave cuttings overexpressing AVP-1 (35-S AVP-1).
- Fig. 13 is an overhead view of shoot regeneration from 5-day old cotyledons placed in SIM induction medium obtained from wild type (WT) and AVP-1 overexpressing (V and 2') Arabidiopsis plants.
- Fig. 14 is bar graph of osmotic potential of fully hydrated leaves from WT and two AVP-1 overexpressing lines (1 ' and 2') from Arabidopsis plants.
- Fig. 15 is an overhead view of petunia explants incubated on MS medium showing callus induction from the explants after six weeks of incubation. DETAILED DESCRIPTION OF THE INVENTION
- vacuoles constitute 40 to 99% of the total intracellular volume of a mature plant cell, changes in the size of the vacuole have dramatic effects upon cell size (R. G. Zhen, E. J. Kim, P. A. Rea, in The Plant Vacuole . (Academic Press Limited, 1997), vol. 25, pp. 298-337).
- the volume of the vacuole is controlled by ion and water fluxes mediated by pumps and transporters. In plants the driving force that triggers the movement of ions, solutes and water across membranes is a proton gradient.
- vacuolar Ff ⁇ -pumps results in luminal acidification and the establishment of a H electrochemical potential gradient across the vacuolar membrane, which powers the secondary active transporters of inorganic ions, sugars, and organic acids.
- the activity of these transporters modulates cellular pH and ion homeostasis and leads to the accumulation of solutes required to generate the osmotic potential that promotes vacuolar expansion (H. Sze, X. Li, M. G. Palmgren, The Plant Cell 11, 677-689 (1999)).
- the present inventor has recognized that plants have a number of vacuolar H ⁇ -translocating pumps, and that by upregulating their activity, increasing their expression, upregulating their transcription and/or translation, or increasing their copy number that one can increase accumulation of solids in the vacuole due to an increase in the availability of protons in the vacuoles.
- V-PPase encoded by the AVP-1 gene is capable of generating a H + gradient across the vacuole membrane (tonoplast) similar in magnitude to that of the vacuolar H + -ATPase (V. Sarafian, Y. Kim, R. J. Poole, P. A. Rea, Proc. Natl. Acad. Sci. 89, 1775-1779 (1992)).
- V. Sarafian, Y. Kim, R. J. Poole, P. A. Rea, Proc. Natl. Acad. Sci. 89, 1775-1779 (1992) Similar genes in other plants should function in a similar manner.
- H + -PPase is the main proton pump of vacuolar membranes in growing tissue.
- the later may be due to the fact that in growing tissue, nucleic acids, DNA, RNAs, proteins and cellulose etc. are actively being synthesized for the construct of the new cells, and as a result, a large amount of PPi is produced as a by-product of these metabolic processes.
- the energy stored in the PPi molecule may be transformed into a different source of energy, namely a H + -gradient across the vacuolar membrane.
- This H - gradient constitutes the driving force for the vacuolar accumulation of solutes that generate the sufficient osmotic differential that enables the plant cell to initiate growth.
- a construct comprising a vacuolar pyrophosphatase gene operably linked to a promoter designed to overexpress the vacuolar pyrophosphatase (e.g., an expression cassette) is used to produce the transgenic plants of the present invention.
- a promoter designed to overexpress the vacuolar pyrophosphatase e.g., an expression cassette
- overexpression refers to greater expression activity than occurs in the absence of the construct.
- a construct comprising an AVPl gene operably linked to a chimeric promoter designed to overexpress AVPl is used to produce the transgenic plants of the present invention. More particularly, the present invention relates to a construct wherein the A VP1 gene is operably linked to a double tandem enhancer of a 35 S promoter.
- the transgenic plants of the present invention may find utility other than those associated with the food value or ornamental value, industrial value such as, for example, wood production.
- the transgenic plants of the present invention may uptake different or more ions than their wild-type counterparts.
- studies with mutant yeast strains (enal) demonstrates that H + -translocating pumps at the vacuole plays an important role in cation detoxification in higher plants (the plant components involved in an intracellular cation detoxification system being identified by complementing salt-sensitive mutants of the budding yeast Saccharomyces cerevisiae).
- Transgenic plants and/or progeny thereof comprising exogenous nucleic acid which alters expression of vacuolar pyrophosphatase in the plant in accord with such studies may be used to bioremediate soil and growth medium.
- Such plants can be used to remove cations (e.g., monovalent and/or divalent cations) from a medium which can support plant growth (e.g., soil, water).
- cations e.g., monovalent and/or divalent cations
- transformed plants of the present invention can be used to remove sodium (Na), lead (Pb), manganese (Mn) and/or calcium (Ca) ions from a medium which supports plant growth.
- the present inventor generated transgenic plants containing extra copies of a vacuolar proton pump, A VP-1.
- Arabidopsis thaliana plants were transformed with constructs containing the AVP-1 gene. Transgenic lines containing extra copies of this gene were then isolated.
- the AVP-1, open reading frame was cloned into the Xmal site of a modified pRT103 [R. Topfer, V. Matzeit, B. Gronenborn, J. Schell and H-H. Steinbiss, Nucleic acid Research 15, 5890 (1987)].
- This vector contains a tandem repeat of the 35-S promoter.
- a Hindlll fragment containing the 35-S tandem promoter, AVP-1 ORF and the polyadenylation signal was subcloned into the Hindlll site of the pPZP212 vector [ P. Hajdukiewicz, Z.
- Agrobacterium- mediated transformation was performed via vacuum infiltration of flowering Arabidopsis thaliana (ecotype Columbia). Transgenic plants were selected by plating seeds of the transformed plants on plant nutrient agar plates supplemented with 25 mg/liter kanamycin. Plants were subsequently selected for two generations to identify transgenic plant homozygous for the transgene.
- Fig. 1A is an overhead picture of representative (out of 10 plants each) wild type (WT) and two independent transgenic lines (1' and 2') grown hydroponically for seven weeks on a 10 hour light/dark cycle.
- WT wild type
- a visual comparison of transgenic line T, which expresses the AVP-1 protein at highest level, transgenic line 1 ', and wild type (WT) demonstrates that the amount of AVP-1 correlates with the size of the plants.
- the mass of the transgenic plants was found to be greater than that of wild type.
- WT wild-type root hairs
- the length of the root hairs is correlated with the size of the vacuole, so the increased size of the root hair is likely to result from increased vacuolar volume.
- Fig. IC is an immunoblot of membrane fractions isolated from wild type
- WT and two independent transgenic lines (1' and ) overexpressing AVP-1.
- Total membrane fractions were isolated from shoots of eight week old wild type (WT) and AVP-1 transgenic plants (1' and 2') grown in a hydroponic media for 8 weeks. Homogenate of plant shoots were sequentially centrifuged for 15 and 30 min at 8,000 and 100,000 rpms respectively.
- the 100 mg membrane pellet was re-suspend in 10 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 10% glycerol and 1 mM PMSF Protein (10 ug) was separated on a 10% SDS-PAGE, electroblotted and immunostained with antibodies raised against a KLH-conjugated synthetic peptide corresponding to the putative hydrophilic loop IV of the AVP-1 protein (V. Sarafian, Y. Kim, R. J. Poole, P. A. Rea, Proc. Natl. Acad. Sci. 89, 1775-1779 (1992)). PPase was detected by chemiluminescence. Fig.
- WT wild type
- Fig. 2 is an overhead view of a representative wild type plant (WT) versus representative transgenic plants overexpressing AVP-1 (1' and 2') after exposure to 7 days of water deficit stress.
- Wild type and transgenic plants overexpressing AVP-1 (Fig 3 A) were tested for drought tolerance (24°C).
- WT water deficit stress wild type
- Fig 3 A plants from both 35S AVP-1 transgenic lines (1' and 2') were turgid and alive.
- the drought stressed plants were then watered, transgenic plants pursued normal growth, bolted and set seeds, whereas wild type plants died.
- the relative water content of leaves from wild type and 35SAVP-1 transgenic plants were determined along the water deficit stress, demonstrating increased water retention by the transgenic lines as compared to the WT plants.
- Fig. 14 is bar graph of osmotic potential of fully hydrated leaves from wild-type (WT) and two AVP-1 overexpressing lines (1' and 2') from Arabidopsis plants.
- WT wild-type
- AVP-1 overexpressing lines (1' and 2') from Arabidopsis plants.
- the decreased osmotic potential in leaves of transgenic plants measured at a constant water content is consistent with the contention that AVP-1 overexpression results in increased solute accumulation, and therefore enhancing water retention capability.
- FIG. 3 is a perspective view of wild type plants (WT) versus representative transgenic plants overexpressing AVP-1 (1' and 2') grown in salty soil.
- Five wild-type plants (WT) and five of the two AVP-1 overexpressing transgenic lines (1' and 2') were grown on soil in a 10 hour light/dark cycle.
- Plants were watered with a diluted nutrient solution (1/8 MS salts) for six weeks and subsequently watered with a diluted nutrient solution supplemented with NaCl.
- the concentration of NaCl began with 100 mM and was increased every four days by 50 mM.
- the illustrations in Fig. 3 corresponds to representative plants at the tenth day in the presence of 300 mM NaCl.
- Fig. 3 corresponds to representative plants at the tenth day in the presence of 300 mM NaCl.
- AVP-1 plant types (1' and 2') were significantly hardier in salty soil as compared to wild-type plants.
- AVPl the pyrophosphate-energized vacuolar membrane proton pump, this work
- AtNHXl the Na + /H + antiporter, (Apse, M., et al, Science, 2&5:1256-1258 (1999)) and this work) are capable of growing in the presence of high NaCl concentrations strongly supports the strategy described herein.
- a double transgenic plant would be expected to demonstrate a further enhanced salt-tolerant phenotype.
- H + -translocating pumps located at the plasma membrane and tonoplast translocated FT 1" from the cytosol to extracellular and vacuolar compartments, respectively (Rea, P.A., et al, Tonoplast Adenosine Triphosphate and inorganic Pyrophosphatase. In: Methods Plant Biochem., pp. 385-405, Academic Press Limited, London (1990)).
- the plant tonoplast contains two tf ' -translocating pumps; the V-ATPase and the inorganic pyrophosphatase or V-PPase.
- vacuolar membrane is implicated in a broad spectrum of physiological processes that include cytosolic pH stasis, compartmentation of regulatory Ca , sequestration of toxic ions such as Na + , turgor regulation, and nutrient storage and retrieval.
- the vacuole constitute 40 to 99% of the total intracellular volume of a mature plant cell.
- vacuolar proton pumping pyrophosphatase is a universal and abundant component of plant tonoplast capable of generating a steady-state trans-tonoplast H* electrochemical potential similar or greater than the one generated by the V-ATPase (Rea, P.A., et al, Tonoplast Adenosine Triphosphate and Inorganic Pyrophosphatase. ⁇ n:Methods Plant Biochem., pp. 385-405, Academic Press Limited, London (1990)).
- Pyrophosphate is a by-product in the activation or polymerization steps of a wide range of biosynthetic pathways and in plants serves as an alternative energy donor to ATP for sucrose mobilization via sucrose synthetase, for glycolysis via PPi: fructose-6- phosphate phosphotransferase and for tonoplast energization via the vacuolar proton pumping pyrophosphatase (Stitt, M., Bot. Acta 111:167-175 (1998)).
- Fig. 4A is a schematic representation of a working model of the transporters involved in sodium sequestration at the yeast pre-vacuolar compartment; Nhxl (Na + H + antiporter), Vmal (vacuolar membrane H + - ATPase), Gefl (yeast CLC chloride channel), Enal (plasma membrane Na + - ATPase).
- the yeast member of the CLC voltage-gated chloride channel superfamily, Gefl is required for copper loading in late- Golgi vesicles and for cation sequestration in the pre-vacuolar compartment in yeast (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci.
- FIG. 4B is a schematic representation of a working model of the transporters involved in sodium sequestration at the yeast pre- vacuolar compartment shown in Figure 4 A, which also includes Avpl (A. thaliana vacuolar pyrophosphate-energized proton pump). While not wishing to be bound by theory, two observations led to the proposal of the model for Na + sequestration in yeast illustrated in Figs. 4 A and 4B. First, gefl mutants are sensitive to high NaCl concentrations. Second, the Na + /H + exchanger Nhxl is localized to the pre-vacuolar compartment ( ass, R., et al., J. Biol.
- Yeast and plant cells share pathways and signals for the trafficking of vesicles from the Golgi network to the vacuole (Neuhaus, J.M., et al, Plant Mol. Biol, 35:127-144 (1998); (Paris, N., et al, Plant Physiol, 775:29-39 (1997); Sato, M.H., et al, J. Biol. Chem., 272:24530-24535 (1997); Vitale, AN., et al, Trends Plant Scl, 4: 148-154 (1999)). Studies were therefore undertaken in yeast to identify the role of the vacuole in cation detoxification in higher plants.
- the yeast vacuolar ATPase is a multisubunit protein, so it is difficult to increase its activity by overexpressing any one of its subunits. Instead the same effect was achieved by increasing the influx of protons by expressing the A. thaliana AVPl gene in yeast.
- This gene encodes a single polypeptide that, when expressed in yeast, is capable of pumping protons into the lumen of the vacuole (Kim, E.J., et al, Proc. Natl. Acad. Sci. USA, 97:6128-6132 (1994)).
- Transformation of yeast cells was performed by using the lithium acetate method (Gietz, D., et al, Nucleic Acids Res., 20:1425 (1992)).
- Double mutants RGY324 (gefl::HIS3 enal::HIS3), RGY326 (nhxl::HIS3 enal::HIS3), and RGY343 (gefl::HIS3 nhxl::HIS3) were obtained by crossing the single-mutant strains.
- Double mutants were identified among the meiotic progeny by scoring for the phenotypes associated with each of the single mutants. Sporulation, tetrad dissection, and mating types were scored as described (Guthrie C.
- APG is a synthetic minimal medium containing 10 mM arginine, 8 mM phosphoric acid, 2% glucose, 2 mM MgSO 4 , 1 mM KC1, 0.2 mM CaCl 2 , and trace minerals and vitamins) (Rodriguez-Navarro, A.
- RGY326 (nhxl::HIS3 enal::HIS3) strains were transformed with pY ⁇ S2 vector (Invitrogen) and plasmid ⁇ YES2- ⁇ P7-E229D described in Zhen, R.G., et al., J. Biol. Chem., 272:22340-22348 (1997).
- the strain RGY343 (gefl::HIS3 nhxl::HIS3), used for histochemical analysis, was transformed with pRG151 (GEF1-GFP) (Gaxiola, R.A., et al. Proc. Natl. Acad. Sci.
- Wild-type and RGY296 (nhxl::HIS3) strains were transformed with vector pAD4 (Ballester, R., et al, Cell, 59:681-686 (1989)).
- RGY296 (nhxl::HIS3) was transformed with pRG308 (ADH1 : :AtNHXl) (see Cloning ofAtNHXl).
- Intracellular cation concentrations were estimated as described (Gaxiola, R.A., et al, EMBO J., 77:3157-3164 (1992)) by using the intracellular water value calculated for cells grown in 1M NaCl.
- the strain RGY343 (gefl::HIS3 nhxl::HIS3) was grown in SD-ura, -leu medium (Difco; synthetic medium with 2% dextrose without uracil and leucin) to mid- logarithmic phase, 0.1 mg/ml hygromycin B was added, and the culture was incubated for 1 h at 30°C. Cells were fixed with 3.7% formaldehyde (Sigma) for 45 min at room temperature without agitation. Spheroplast formation, permeablization, washing, and antibody incubation was performed as described (Pringle, J., et al.,, in Immunofluorescence Methods for Yeast, eds. Guthrie, C.
- MAB HAH used as first antibody was from Babco (Richmond, CA). Cy3-conjugated goat anti-mouse IgG was from Jackson Immunoresearch. 4',6-Diamidino-2-phenylindole (Sigma) was added , to mounting medium to stain mitochondrial and nuclear DNA.
- strain RGY343 (gefl::HIS3 nhxl::HIS3) was grown in APG medium (pH 7.0), and lysates fractionated on a 10-step sucrose density gradient as described (Nass,
- AtNHXl was cloned from a phage cDNA library of A. thaliana (Kieber, J.J., et al, Cell, 72:427-441 (1993)) (obtained from the Arabidopsis Biological Resource Center) by probing with an expressed sequence tag (Arabidopsis Biological Resources Center, DNA Stock Center) containing a partial clone.
- a full-length clone (2.1 kB) was ligated into vector pSK2 (Stratagene) at the N ⁇ tl sit, generating plasmid pRG293.
- the AtNHXl ORF was amplified via PCR by using pRG293 as template and GGCCCGGGATGGATTCTCTAGTGTCGAAACTGCCTTCG (SEQ ID NO: 5) (italicized bases correspond to nucleotides 1-30 of the ORF) and T7 oligonucleotides.
- the PCR product was then digested with Xbal and Sail and ligated into pAD4 vector generating plasmid pRG308.
- the AtNHXl ORF was sequenced to verify the fidelity of the PCR product. The full-length sequence is longer than the ORF reported by the Arabidopsis Genome Initiative (A TM021B04.4), and has been deposited in GenBank (accession no. AF 106324). Cloning of AVPl -D
- Vector pYES2 (Invitrogen) was introduced into wild-type, enal, enal nhxl, and enal gefl mutants. Plasmid pYes2-AVPl-D (Zhen, R.G., et al., J. Biol. Chem., 272:22340-22348 (1997)) was introduced into enal, enal nhxl, and enal gefl mutants. Five-fold serial dilutions (starting at 10 5 cells) of each strain were plated on YPGAL (1% yeast extract/2% peptone/2% galactose) with or without 0.5 M NaCl and incubated at 30°C for 2 days.
- YPGAL 1% yeast extract/2% peptone/2% galactose
- Exponentially growing cells (wild-type and enal transformed with pYES2 vector and enal, enal nhxl, and enal gefl mutants carrying pYes2--4FP7-E>) were exposed to 0.7M NaCl for 6 hours. Total cell extracts were prepared, and Na + and K + concentrations were determined. Results
- the enal mutant of the above construct lacks the plasma membrane sodium efflux pump and therefore must rely on the internal detoxification system to overcome sodium toxicity. Growth of the enal strain is sensitive to low concentrations of sodium (200 mM), concentrations that do not inhibit the growth of wild-type strains. Overexpression of AVPl -D restored salt tolerance to salt-sensitive enal mutants. The restoration of salt tolerance to an enal strain by AVPl-D requires functional NHX7 and GEE7 genes: enalnhxl AVPl-D and enal gefl AVPl-D strains are salt sensitive.
- Fig. 5A and Fig. 5B are bar graphs showing the intracellular ⁇ a + and K + contents of wild-type yeast strains and of yeast strains carrying various mutations affecting sodium tolerance wherein the values are the mean of two determinations, and the bars represent the standard deviations.
- the intracellular Na + and K contents of wild-type strains and of strains carrying various mutations affecting sodium tolerance were determined after 6 h of exposure to media supplemented with 0.7 M NaCl.
- the intracellular Na + content in the enal mutant was seen to be 8-fold higher than in the wild- type strain. There was seen to be a consistent reduction in total cell Na + in the enal AVP- D strain. The reason for this reduction is unknown.
- the enal AVP-D strain was found to be salt-resistant, even though its intracellular Na + content was 4-fold higher than that of the wild type.
- enal AVPI-D strains lacking either gefl or nhxl i.e., enal gefl or enal nhxl
- the Na + content was not reduced to the extent that it was in the GEF1 NHX1 strain.
- the genetic and physiological data are consistent with the model that Nhxl, Gefl and Avpl cooperate to sequester sodium internally.
- the Arabidopsis Vacuolar FT 1" -Pyrophosphatase was evidenced to confer salt tolerance to yeast enal mutants.
- the intracellular K + content was found to correlate with salt tolerance and is inversely correlated with the Na + content of the strains (Fig. 4B).
- the wild-type K + concentration was at 100 mM, but was reduced to 20 mM in the enal mutant.
- the intracellular concentration of K was restored almost to wild-type levels (Fig. 4B).
- AVPl-D overexpression failed to restore wild-type levels of intracellular potassium unless both NHxl and G ⁇ F1 were functional (See, the double mutants enal nhxl or enal gefl in Fig. 4B).
- intracellular Na + detoxification in yeast requires functional Na + /H + exchanger (Nhxl) and chloride channel (Gefl), and they co-localize to a pre-vacuolar compartment (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480- 1485 (1999)).
- Arabidopsis thaliana homologue of the yeast NHX7 gene Arabidopsis thaliana homologue of the yeast NHX7 gene (AtNHXl) was cloned and its function in the nhx 1 yeast mutant tested, the AtNHXl gene was found to be able to suppress partially the cation sensitivity phenotypes of nhxl mutants.
- Example 6 is alignment of the deduced amino acid sequences of ⁇ hXl homologue from Arabidopsis AtNHXl (SEQ ID ⁇ O:l), human HsNHE-6 (SEQ ID NO: 2) and yeast ScNHXl (SEQ ID NO:3); identical residues are in black boxes, and dashes indicate gaps in the sequence, * above alignment denote putative amiloride binding site from human NHE7 ( 163 DVF-FLFLLPPI 173 ) (S ⁇ Q ID NO: 4).
- Example 2 Functionality of . and Co-localization of. Geflp and Nhxlp in Yeast Strains
- the NHXl and GEE7 genes which have been identified as important in sodium detoxification, are also required for the detoxification of other cations.
- the strain RGY419 (gefl nhxl) was transformed with plasmids pRG151; G ⁇ F1-GFP and pRIN73; N ⁇ X1-( ⁇ A) 3 . Transformants were grown in SD (Difco; synthetic medium with 2% dextrose).
- the migration properties of the Geflp and Nhxlp in sucrose gradients was also determined to provide evidence of co-localization of Nhxl ( ⁇ A) 3 and GEF1-GFP.
- the strain RGY419 (gefl nhxl) was transformed with plasmids pRG151; GEF1-GFP and pPJN73; NHX1-(HA) 3 and grown in APG medium (Rodriguez-Navarro, A. and Rea, P. A., J. Biol. Chem., 159:940-945 (1984)).
- Gefl mutants were found to be sensitive to 3 mM MnCl 2 , 0.45 M tetramethylammonium chloride and to 0.05 ⁇ g/ml hygromycin-B.
- the nhxl mutant was also found to be sensitive to tetramethylammonium chloride and hygromycin.
- the extreme sensitivity of the nhxl mutant to hygromycin may provide an important tool for assaying nhxl function.
- hemagglutinin (HA)-tagged Nhxl and Gefl-GFP fusion protein co-localize as shown via epifluorescence deconvolution microscopei Persistence of signal coincidence on 90° rotation of the image further supports co-localization of the two transporter proteins in these cells.
- the co-localization of Nhxl (HA) 3 and GEF1-GFP is also supported by the co-migration of the two proteins in sucrose density gradients of membrane preparations obtained from cells expressing the tagged proteins.
- the sedimentation behavior of the membrane fraction containing both proteins is consistent with that of a pre-vacuolar compartment (Nass, R. and Rao, R., J. Biol. Chem., 273:21054- 21060 (1998)).
- Gefl-GFP (but not Nhxl) is also present in Golgi fractions, consistent with previous studies (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998), Schwappach, B., et al, J. Biol. Chem., 273:15110-15118 (1998)).
- Example 3 Capacity of A. thaliana Homolog of NHX1 to Suppress Hygromycin Sensitivity of Mutant Yeast
- the yeast strain described herein provides an important tool for identifying genes that mediate salt tolerance in other organisms.
- a sequence from Arabidopsis See Materials and Methods
- an expressed sequence tag see Materials and Methods
- An alignment of the amino acid sequences of Nhxl homologues from Arabidopsis (AtNhxl), human (HsNhe ⁇ ), and yeast (ScNhxl) reveals segments of amino acid identity and similarity within predicted transmembrane domains (Fig. 6A-C).
- Fig. 6A-C it is important to note that despite these relationships, neither the C-terminal regions of AtNhxl and ScNhxl show a high degree of homology (Fig. 6A-C).
- a characteristic of mammalian Na + /H + antiporters is their inhibition by amiloride.
- a putative amiloride binding site 163 DVFFLFLLPPI 173 ) (SEQ ID NO: 4) has been defined via point mutants in the human NHE1 antiporter gene (Counillon, T,., et al, Proc. Natl. Acad. Sci. USA, 90:4508-4512 (1993)).
- AtNhxl, HsNhe-6 and ScNhxl have an almost identical sequence (Fig. 6).
- attempts to inhibit the activity of either Nhxl or AtNhxl in yeast cultures with amiloride were unsuccessful.
- the At NHX1 gene is capable of suppressing the hygromycin sensitivity of the nhxl mutant.
- the AtNHXl gene also suppressed the NaCl sensitivity of nhxl mutant but only under conditions in which the K availability was reduced. However, AtNHXl was not capable of rescuing the Na " sensitive growth phenotype of the double mutant enal nhxl overexpressing the AVPl-D gene.
- Example 4 Generation of Gain-of-Function Yeast AtNHX Mutants Materials and Methods
- Gain of function mutants of the AtNHX that enhance salt tolerance may be generated in the enal yeast by mutagenizing the cloned gene to make a mutant library.
- This library may be used to transform the salt sensitive yeast mutant enal and clones with an enhanced salt tolerant phenotype.
- AtNHXl homologues may also be expressed in the mutant yeast to form gain-of-function mutants. It is believed that some of these AtNHXl homologues are plasma membrane transporters, so their function in yeast are frequently pH dependent, requiring precise composition and pH of the medium used for screening for success.
- a method for introducing random mutations developed by Stratgene (Epicurian Coli XL 1 -Red competent Cells Cat#200129) may be used.
- the method involves the propagation of a cloned gene into a strain deficient in the three primary DNA repair pathways. The random mutation rate in this strain is about 5000-fold higher than that of wild-type.
- a library of the mutated AtNHX gene may be transformed into the enal yeast mutant and screened for salt tolerance. Yeast transformation was performed as described by Schiestl and coworkers (Gietz, D., et al, Nucl. Acid Res. 20:1425 (1992), incorporated by reference in its entirety herein).
- An alternative to the XL 1 -Red random mutagenesis strategy is a PCR approach described by Fink and coworkers (Madhani, H.D., et al, Cell, 97:673-684
- AtNHXl homologues To test AtNHXl homologues the same strains and conditions may be as described in Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999). However, others may be employed. When dealing with plasma-membrane AtNHXl homologues pH conditions of the assay media may be crucial. Results
- D increases the intracellular detoxification capability in yeast (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999)). It is hypothesized (although the inventors are not limited by such hypothesis) that the latter is due to an increased influx of H 1" into the vacuolar compartment thereby improving Na + sequestration via the Nhxl exchanger.
- the yeast system described herein permits the functional assessment of diverse heterologous proteins in salt tolerance: chloride channels, H pumps, and Na /FT 1" exchangers and other cation H + exchangers or cation/bicarbonate symporters.
- the system is robust and flexible.
- the function of the Arabidopsis chloride channels (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998), Hechenberger, M., et al, J. Biol. Chem., 277:33632-33638 (1996)), TU pump, and NaW exchanger can be assayed in the corresponding yeast mutant.
- At NHXl Despite the inability of At NHXl to suppress all the phenotypes of the yeast nhxl mutant, the fact that it suppresses some phenotypes, coupled with the DNA homology between AtNHXl and yeast NHXl, indicates that the plant gene carries out a similar function to that of the yeast homologue.
- the observation that the AtNHXl gene suppresses the sensitivity of the nhxl mutant to hygromycin but provides only a weak Na + detoxification phenotype could be a consequence either of differential regulation of the transporters in the two organisms or of distinct cation transport selectivities.
- vacuolar sodium accumulation in salt-tolerant plants may be mediated by a tonoplast Na + /H + antiporter that utilizes the proton-motive force generated by the vacuolar H 1" - ATPase (V-ATPase) and/or -translocating pyrophosphatase (V-Ppase; refs. Barkla, BJ., et al, Symp. Soc. Exp.
- AtNHXl gene in salt homeostasis is provided by the observation that its expression is induced in salt-stressed plants (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999)).
- Arabidopsis thaliana in particular, has been used as a host model plant to demonstrate that overexpression of these genes results in salt tolerance in the plant.
- a recent report shows that the overexpression of AtNHXl gene in transgenic Arabidopsis thaliana promotes sustained growth in soil watered with 200 mM NaCl plus 1/8 M.S.
- A. thaliana plants (ecotype Columbia) were grown aseptically on unsupplemented plant nutrient agar without sucrose (Haughn, G.W. and Somerville, C, Mol. Gen. Genet., 204:430-434 (1986)) for 15 days at 19°C and under continuous illumination. NaCl or KC1 was added to a final concentration of 250 mM, and the plants were incubated for 6 h. Total RNA from tissue of salt-treated and untreated plants was isolated (Niyogi, K.K. and Fink, G.R., Plant Cell, 4:721-733 (1992)), Hybond-N (Amersham) membranes were hybridized with a 32 P-Labeled DNA probe from plasmid pRG308.
- Hybridization was performed at 65°C overnight. Washes were performed at 65°C with 0.2% standard saline citrate (SSC)/0.1% SDS (Ausebel, F., et al, Curr. Protocols in Mol. Biol. (Wiley, NY) (1988)). 7SS probe was used as loading control (Unfried, I., et al, Nucleic Acids Res., 77:7513 (1989)). MACBAS 2.4 program was used to quantify the relative amount of RNA. Results The NaCl stress increased AtNHXl mRNA levels 4.2-fold, whereas KC1 promoted only a 2.8-fold increase.
- RNA tissue blot hybridized with AtNHXl Ten micrograms of total RNA from 15 -day old plants exposed to 250 mM NaCl or KC1 for 6 h and a control grown without salt was subjected to electrophoresis on a denaturing formaldehyde gel. The blot was hybridized with a probe internal to -4tNHXl ORF. An 75S ribosomal probe was used as a loading control.
- AVPl wild-type gene using the double tandem enhancer of the 35S promoter (Topfer, R., et al, Nucl. Acid Res., 75:5890 (1987)).
- AVPl encodes the pyrophosphate-energized vacuolar membrane proton pump from Arabidopsis (Zhen, R.G., et al, J. Biol. Chem., 272:22340-22348 (1997)).
- AVPl gene is present in a single copy in the genome of Arabidopsis (Kim, Y., et al, Plant Physiol, 106:375- 382 (1994)), however, a sequence homologous, but not identical, to AVPl on chromosome one has been tentatively designated as ORF F9K20.2 on BAC F9K20 by the Arabidopsis Genome Initiative (AGI).
- AGI Arabidopsis Genome Initiative
- Transgenic plants that overexpress AVPl were generated using Agrobacterium-mediated plant transformation.
- the transgenic AVPl was expressed using a double tandem enhancer of the 35S promoter of CaMV (Topfer, R., et ⁇ l, Nucl. Acid Res., 75:5890 (1987)).
- 15 wild-type plants and 15 35SAVP1 transgenics were grown on a 24 hours-day cycle for 16 days. During this period plants were watered every 4 days with a diluted nutrient solution (1/8 M.S. salts). 200 mM NaCl was added to the watering solution at day 17 and at day 27 plants were watered with nutrient solution containing 250 mM NaCl. Plants were photographed 10 days after the last NaCl treatment.
- hydroponic culture has been reported to increase plant growth and provide stress-free root and shoot material (Gibeaut, D.M., et al, Plant Physiol, 317-319 (1997)). Another important advantage of hydroponic culture is that it allows one to alter the ionic composition in a more accurate manner than in soil. These advantages could be important for the physiological studies of salt stress.
- Wild type and 35 SAVP1 transgenic plants were hydroponically grown . Wild type and 35SAVP1 transgenic plants were grown in solution culture on a 12 hour light cycle for 65 days.
- wild type and 35SAVP1 transgenic plants were grown in solution culture on a 12 hours light cycle for 20 days. Starting at day 21, NaCl concentration was increased in a stepwise fashion by 50 mM increments every 4 days. Plants were photographed after 4 days in the presence of 200 mM NaCl.
- transgenic plants were challenged with a commercial seawater formula that contains the complete ionic composition present in the oceans.
- 35SAVP1, 35SAtNHXl single and double transgenics were grown together with wildtype Arabidopsis thaliana plants under hydroponic conditions for four weeks in a short day illumination cycle (Gibeaut, D.M., et al, Plant Physiol, 317-319 (1997)). Then every four days an equivalent to 50mM NaCl of Tropic Marin sea salt (worldwide web at thatpetplace.com) is added.
- This artificial sea water mix includes all of the other major and trace elements present in real sea water. Growth was monitored and ⁇ physiological parameters, such as sodium content and distribution may be monitored.
- 35SAVP1, 35SAtNHXl single and double transgenics that were grown together with wildtype Arabidopsis thaliana plants under hydroponic conditions for four weeks in a short day illumination cycle (Gibeaut, D.M., et al, Plant Physiol, 317-319 (1997)) and then challenged every four days with an equivalent to 50mM NaCl of Tropic Marin sea salt were found to grow in the sea salt solution better than wildtype Arabidopsis thaliana plants.
- the tomato homologues of AVPl and AtNHXl may be isolated and the corresponding chimeras to overexpress them may be constructed (Bidone, S., et ⁇ l, Eur. J. Biochem., 253: 20-26 (1998); Burbidge, A., et ⁇ l, J. Exper. Botany, 45:2111-2112 (1997)).
- the genes may be introduced via Agrobacterium-mediated infection of calli. Tissue culture methods may be used to regenerate transformed plants. The plants may be assayed for salt tolerance as well as physiological parameters, such as sodium content and distribution.
- Tomato transformation with 35S AVPl and with 35S AtNHXl constructs may be performed as described by McCormick (McCormick, S., Transformation of tomato with Agrobacterium tumefaciens. In: Plant Tissue Culture Manual, pp. 1-9, Lindsey, K. (ed.), Kluwer Academic Publishers, Dordrecht, The Netherlands (1991)).
- TO and Tl transgenics may be analyzed by polymerase chain reaction and DNA gel blotting for the presence and copy number of AVPl and AtNHXl transgenes. Heterozygous and homozygous plants may be identified after segregation analysis of each transcend within Tl seeds.
- Homozygous plants may be assayed for salt tolerance and as well as physiological parameters, such as sodium content and distribution.
- Degenerated oligos based on conserved sequences present in AVPl and AtNHXl homologues may be designed. These degenerated primers may be used in RT-PCR reactions with cDNAs made from poly(A)+RNA from tomato. The resulting PCR fragments may be used as probes to isolate the full length cDNA clones from commercial libraries (i.e. Stratagene Cat#936004).
- a similar strategy was described by Caboche and coworkers (Quesada, A., et al, Plant Mol. Biol, 34:165-274 (1997)). Results
- Fig. 7 is a graph of Na + and K + content of wild-type plants (WT) versus representative transgenic plants overexpressing AVP-1 (1' and T) grown in salty soil.
- Five wild-type plants (WT) and two AVP-1 overexpressing transgenic lines (1' and 2') were grown on soil in a 10 hour light/dark cycle. Plants were watered with a diluted nutrient solution (1/8 MS salts) for six weeks and subsequently watered with a diluted nutrient solution supplemented with NaCl. The concentration of NaCl began with 100 mM and was increased every four days by 50 mM. The photograph corresponds to plants at the tenth day in the presence of 300 mM NaCl.
- Fig. 5 is a graph of the uptake of calcium into the 35SAVP-1 transgenic vacuolar membrane vesicles (squares) of 2' of Fig. 4 versus calcium uptake into vesicles obtained from wild type (WT) of Fig. 4.
- Wild-type plants (open circles) and transgenic plants from line of Fig. 4 were grown hydroponically for nine weeks on a 10 hour light cycle.
- Vacuolar membrane vesicles were added to buffer containing 250 mM sorbitol, 25 mM BTP-Hepes pH 8.0, 50 mM KC1, 1.5 nM MgSO 4 and 10 ⁇ M Ca 4" ".
- Ca "1" uptake capability of wild type and transgenic vacuolar membrane vesicles was determined. It is well documented that Ca 4" enters the plant vacuole via a Ca 4"4' /!! 4" antiporter (K. S. Schumaker, H. Sze, Plant Physiol. 79, 1111-1117 (1985)). Furthermore, the genes encoding the Arabidopsis thaliana Ca ⁇ /H 4" antiporters CAXl and CAX2 have been isolated and characterized (K. D. Hirschi, R.-G. Zhen, K. W. Cunningham, P. A. Rea, G. R. Fink, Proc. Natl. Acad. Sci.
- Fig. 5 shows that Ca uptake in the 35SAVP-1 transgenic vacuolar membrane vesicles is 36% higher than it is in vesicles obtained from wild type.
- Application of the Ca 4"1" ionophore A23 lowered the 45Ca ++ counts to background levels demonstrating the tightness of the vesicles (Fig 8) (K. S. Schumaker, H. Sze, Plant Physiol. 79, 1111-1117 (1985)).
- a model consistent with the enhanced drought and freeze tolerance of the transgenic plants overexpressing the AVP-1 gene is depicted in Figs. 9 A and 9B.
- the model depicts how an increase in the number of AVP-1 pumps in the vacuole of transgenic plants can provide more H that will permit the secondary transporters to import greater amounts of cations into the lumen of the vacuoles. Higher amounts of cations confer a greater osmotic pressure (See, Fig. 14) that leads to a greater water retention capability endowing plants to withstand low soil water potentials.
- Example 10 Double Transgenic Plant with 35SAVP1 and 35S AtNHXl
- T3 35S AVPl plants may be used as females and T3 35S AtNHXl plants may be used as males.
- Female plants may be hand-emasculated and anthers from freshly opened flowers of donor plants are harvested. With these anthers the emasculated plants may be pollinated by touching the anthers onto the stigmas. The pollinated flowers may be labeled and any remaining opened or unopened flowers from the same female plant removed to avoid any confusion at harvest.
- the harvested seeds should be sterilized using a 50% sodium hypochloride solution and mixed vigorously for 5 minutes and rinsed with water thoroughly. The sterilized seeds may be stored in soft agar over night at 4°C.
- the 35S AVPl construct has the neomycin phosphotransferase II gene that confers kanamycin tolerance in plants while the 35S AtNHXl construct has a modified hygromycin B phosphotransferase that confers hygromycin tolerance in plants.
- the resistant seedlings may be transplanted into soil and to the hydroponic media to be tested for their salt-tolerant phenotype.
- a transgenic Arabidopsis thaliana plant to overexpress the A. thaliana gain-of-function mutant gene AVPl-D may be engineered using the same double tandem enhancer of the 35A promoter described above (Topfer, R., et al, Nucl. Acid Res., 75:5890 (1997)). Plants overexpressing the gain of function mutant gene will likely show an enhanced phenotype.
- the A. thaliana gain-of-function mutant gene AVPl-D may be subcloned into plasmid pRT103 carrying the 35S promoter and the polyadenylation signal of CaMV (Topfer, R., et al, Nucl. Acid Res., 75:5890 (1997)).
- a Hindlll fragment containing the chimeric 35SAVP-D gene may be subcloned into pBIBhyg (Becker, D., Nucl. Acid Res., 75:203 (1990)).
- the resulting T-DNA vector may be transformed into Agrobacterium tumefaciens strain GV3101 via electroporation, and may be used for subsequent vacuum infiltration of Arabidopsis thaliana ecotype Columbia (Bechtold, N., et al, C.R. Jeances Acad. Sci. Ser. Ill Sci. Vie, 376:1194-1199 (1993)). Integration imay be confirmed on Southern blots of T3 plants and expression monitored on Northern blots of positive T3 plants.
- Example 11 Comparative Transport Study With Vacuoles From The Roots Of Wild- Type and 35SAVP1 Transgenic Plants
- a study may be undertaken to determine if the vacuoles of 35S AVPl transgenic plants show a higher proton transport activity dependent on pyrophosphate. These determinations may be done with root and shoot tissues separately from plants grown hydroponically. The transgene could show a tissue-specific regulation despite the 35S promoter.
- H 4" translocation may be assayed fluorimetrically using acridine orange (2.5 ⁇ M) as transmembrane pH difference indicator in assay media containing vacuole membrane-enriched vesicles as described by Rea and coworkers (Zhen, R.G., et al., J. Biol. Chem., 272:22340-22348 (1997)).
- the assay media contains 300 - ⁇ M Tris-PPi, 50mK KCl, 2.5 ⁇ M acridine orange, 5mM Tris-Mes (pH 8.0).
- Intravesicular acidification may be triggered with the addition of 1.3 mM MgSO4 and terminated with the addition of the protonophore FCCP at 2.5 ⁇ M. Fluorescence may be measured at excitation emission wavelengths of 495 and 540 nM, respectively, at a slit width of 5 nM (Zhen, R.G., et al, J. Biol. Chem., 269:23342-23350 (1994)). A further test to support that the H + translocation is AVPl driven may be the addition of the specific inhibitor aminomethylenediphosphonate (Zhen, R.G., et al, Plant Physiol, 104:153-159 (1994)).
- Example 12 Determination Of The Na + /K + Ratios In Leaves And Stems Of The Transgenic Plants
- Measurements may be taken to demonstrate that the transgenic plants described herein have an increased vacuolar capacity to sequester Na in their leaves cells or elsewhere.
- To determine the Na + /K 4" ratios in leaves and stem S wild-type and 35S AVPl /35S AtNHXl double and single transgenics in hydroponic conditions (Gibeaut, D.M., et al, Plant Physiol, 317-319 (1997) may be grown. NaCl may be added to the growth media in a stepwise fashion starting with 50 mM up to 250mM (Apse, M., et al, Science, 255:1256-1258 (1999). At every point the rosette and the stems of the treated plants may be collected and their weight determined.
- the samples should be dried out in an oven at 80°C and their dry weight determined.
- the dry samples may be boiled in a determined volume of water and their Na 4" and K 4" contents determined via atomic absorption spectrophotometry (Apse, M., et al, Science, 255:1256-1258 (1999); Gaxiola, R, et al, Embo J., 77:3157-2164 (1992)).
- Example 13 Determination Of Whether 35S A VP1 Transgenic Plants Are Larger Because Their Cells Are Larger Or Because They Have More Cells, Or Both The shoot meristems labeling index may be compared with one of the wild- type plants. Morphological and anatomical observations measuring and counting cells of leaves, roots and stems may be performed. To determine if 35S AVPl transgenic plants are larger because they have more cells, their shoot meristems labeling index may be compared with the one of wild-type plants. To measure the DNA synthesis or cell proliferation 5-Bromo-2'-deoxy- uridine (BrdU) that can be incorporated into DNA in place of thymidine may be used.
- PrdU 5-Bromo-2'-deoxy- uridine
- Cells that have incorporated BrdU into DNA may be detected using a monoclonal antibody against BrdU monoclonal antibody and an anti-mouse Ig-alkaline phosphatase as a second antibody.
- the bound anti-BrdU monoclonal antibody may be visualized by light microscopy and the ratio between DAPI stained and BrdU positives established.
- the protocol is a modification of the one published by Chiatante and coworkers (Levi, M., et al, Physiol. Plant. 77:68-72 (1987)) and the BrdU labeling and detection kit II from Boehringer Mannheim.
- the plants may be exposed for different times to the BrdU labeling medium and then fixation, paraffin embedding and sectioning may be performed as described by Meyerowitz and coworkers (Drews, G., et al, Plant Mol. Biol. Rep., 5:242-250 (1988)).
- leaf tissue fresh tissues may be embedded in 5% agarose and slice them with a microslicer.
- seedlings may be fixed for 4hr in 50% ethanol, 5% acetic acid, and 3.7% formaldehyde at room temperature, dehydrated in graded ethanol series, permeate them with xylene, and infiltrate them with paraffin.
- Eight-micrometer sections may be stained with 0.05% toluidine blue and cells may be counted under a microscope.
- the method described by Greenberg and coworkers (Rate, et al, The Plant Cell, 77:1695-1708 (1999)) may be followed. Results
- FI plants originated by crossing transgenic lines 1' and 2' displayed rosettes with larger leaves and increased amount of leaves than wild-type plants.
- Fig. 10 depicts the foliage of wild type and transgenic (1* and ) Arabidopsis plants overexpressing AVP-1 grown at 20°C under all white fluorescent light in 16 hours light/8 hours dark period cycle. Leaves depicted were carefully sectored with a scalpel when plants initiated to bolt and then ordered by size for comparison purposes. While having larger and more leaves than the wild-type plants, the transgenics were not seen to have larger cell sizes. Such data is consistent with the hypothesis that the meristem is more active in transgenic AVP-1 overexpressers.
- Dry weight of the transgenic Arabidiopsis plants grown hydroponically, as compared to similarly grown wild-type plants, further indicates that cell mass increases irrespective any increased water uptake by the plant.
- An increase in dry mass weight was seen in both the root, rosette and stem structures as indicated in Table 1 below where values represent the mean values of six plants.
- Increased meristematic activity and/or shoot organogenesis may be produced by increasing hormone availability together with AVP-1 overexpression.
- Petunia explants were incubated on MS medium which consists of MS salts (Gibco BRL), 1 mg/L nicotinic acid, 1 mg/L pyrodoxin HC1, lmg/L thiamine, 100 mg/L myo-inositol, 3% sucrose, 1 mg/L 2,4-D(2,4-dichlorophenoxyacetic acid) and 0.5 mg/L 6- BA (6-benzylaminopurine).
- the medium was solidified with 0.7% agar and was adjusted to pH 5.8 before autoclave. The culture was incubated at 25oC in the dark in a growth chamber.
- Transgenic petunia explants (35-S AVP-1) demonstrated significantly enhanced callus induction at 6 weeks of incubation as demonstrated in Fig. 15.
- Leave segments grown in appropriate medium are known to be capable of generating shoot growth.
- a study was undertaken to determine the effect of overexpression of 35-S AVP-1 on shoot regeneration in Petunia leaves. Segments of leaves from regenerated transformed (35-S A VP-1) and control
- Petunia were used as explants for shoot regeneration. The leaves were cut with a sharp surgical blade into about 1 cm wide pieces.
- the explants were cultured in MS medium which included MS salts (Gibco), B5 vitamins (1 mg/L nicotinic acid, 1 mg/L pyrodoxin HC1, 1 mg/L-thiamine and 100 mg/L myo-inositol), 3% sucrose, 2 mg L 6- benzylaminopurine and 0.01 mg/L napthaleneacitic acid, 0.7% agar, pH 5.8.
- the cultured segments were incubated at 25°C under cool white fluorescent light in a 16 h light/8 h dark period cycle.
- Example 17 Effect of Overexpression of AVP- 1 on Shoot and Root Regeneration From Arabidopsis Cotyledons
- Root and cotyledon (5 days old) explants from wild-type (WT) and transgenic (1' and 2') AVP-1 overexpressing Arabidopsis plants were placed in the shoot induction medium as discribed in Example. 16. As evidenced in Fig. 6, explants from the transgenic plants (1' and ) generated new structure earlier than wild type consistent with a higher merstematic compentence.
- Example 19 Isolation Of Mutants In The Transporters Genetic approaches are very powerful in analyzing complex biological traits (Serrano, R., Crit. Rev. Plant Sci., 73:121-138 (1994)) Reverse genetics is a very important new tool for plant biologists. The generation of a good collection of tagged knockouts by Sussman and coworkers (Krysan, P., et al, Proc. Natl. Acad. Sci. USA, 93:8145-8150 (1996)) has open a very important avenue for the analysis of gene disruptions in Arabidopsis.
- the Arabidopsis Knock-out Facility of the University of Wisconsin Madison may be used to search among the 60,480 Arabidopsis (ecotype WS) lines that have been transformed with the T-DNA vector pD991 for the presence of T-DNA inserts within -4tCLC-c, AtCLC-d, AVPl, _4tNHXl and their homologues.
- the phenotypes of the above knock-outs will shed light towards the understanding of the physiological roles of these transporters in normal and stress conditions.
- An initial characterization of the knockout plants includes testing for their salt tolerance and their Na + /K + ratios.
- the generation of double knock-outs via crosses help to further understand the interaction among the transporters as well as the crosses with the 35S AVPl and the 35S AtNHXl transgenic plants.
- PCR primers may be designed following the guidelines detailed in the University of Wisconsin web site. Tested primers may be sent to UW-Madison, where 62 PCR reactions that are sent to us for Southern blot analysis may be performed. Positive PCR products are sequenced. If the sequence reveals that there is a T-DNA inserted within the gene the gene specific primers are sent for another set of PCR reactions in order to determine which of the 9 possible pools of 225 contains the knockout. After identifying the pool of interest, 25 tubes of ⁇ seeds are screened for the individual plant carrying the T-DNA knock-out.
- a pre-vacuolar compartment is a dynamic entity that detoxifies the cytoplasm from toxic cations and delivers its cargo either to the vacuole, or directly to the cell exterior.
- Both the gefl chloride channel and Nhxl Na + /H + exchanger have been localized to the yeast pre-vacuolar compartment (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999)).
- the behavior of the gefl-GFP chimera in yeast cells in vivo have been monitored indicating that its localization varies depending the environmental conditions. Furthermore, it has been shown that two of the four A.
- thaliana CLC chloride channel genes CLC-c and -d are capable of suppressing gefl mutant phenotypes implying a similar localization (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998)).
- GFP-chimeras For the constructions of the GFP-chimeras the soluble versions GFP with improved fluorescence in A. thaliana reported by Davis and Viestra (Davies, S.J., Viestra, R.D., "Soluble derivatives of green fluorescent protein (GFP) for use in Arabidopsis thaliana, http:/ / brindabella.rnrc-lmb.cam.ac.uk/IndexGFP.html (1998)) may be used. Two types of GFP-chimeras may be made, namely a set under the regulation of the native promoter and another set under the regulation of the 35 S promoter.
- GFP green fluorescent protein
- the resulting T-DNA vectors containing the GFP-chimeras are transformed into Agrobacterium tumefaciens strain GV3101 via electroporation, and used for subsequent vacuum infiltration of Arabidopsis thaliana ecotype Columbia (Bechtold, N., et al, C.R. Jeances Acad. Sci. Ser. Ill Sci. Vie, 376:1194-1199 (1993)).
- HA hemagglutinin
- Futcher and coworkers designed vectors containing the URA3 yeast gene flanked by direct repeats of epitope tags (HA) (Schneider, B.L., et al, Yeast, 77:1265- 1274 (1995)).
- HA epitope tags
- the tag-URA3-tag cassette may be amplified such that the resulting PCR fragment possess homology at each end to the gene of interest.
- In vivo recombination in yeast can be then used to direct the integration of the PCR-chimera to the plasmid carrying the plant ORF of interest, transformants are selected by the URA 4" phenotype.
- the URA3 gene can be "popped out" when positive transformants are grown in the presence of 5-fluoro-orotic acid.
- the vector carrying the plant gene has a selection marker different than the URA3 gene.
- Drought and freeze tolerant cultivars could provide new agricultural approaches in areas lost due to drought or minimal rainfall, as well as to provide farmers with protection from unanticipated frosts (freezing rain etc.). Such crops may also be able to be raised on soils considered too saline for wild type crops.
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
Claims
Applications Claiming Priority (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US22622300P | 2000-08-18 | 2000-08-18 | |
| US226223P | 2000-08-18 | ||
| US64403900A | 2000-08-22 | 2000-08-22 | |
| US644039 | 2000-08-22 | ||
| WOPCT/US00/30955 | 2000-11-10 | ||
| PCT/US2000/030955 WO2001033945A1 (en) | 1999-11-10 | 2000-11-10 | Stress-resistant oversized transgenic plants capable of growing in salinized soil |
| PCT/US2001/009548 WO2002015674A1 (en) | 2000-08-18 | 2001-03-24 | Enhanced meristematic activity and competence by overexpression of tonoplast pyrophosphatase |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP1315410A1 true EP1315410A1 (en) | 2003-06-04 |
| EP1315410A4 EP1315410A4 (en) | 2004-06-23 |
Family
ID=30002737
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP01924311A Withdrawn EP1315410A4 (en) | 2000-08-18 | 2001-03-24 | INCREASED MERISTEMATIC ACTIVITY AND COMPETENCE BY OVER-EXPRESSION OF TONOPLASTIC PYROPHOSPHATASE |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP1315410A4 (en) |
| CN (1) | CN1469705A (en) |
| AU (2) | AU2001250974C1 (en) |
| BR (1) | BR0113466A (en) |
| CA (1) | CA2418127A1 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101457234A (en) * | 2007-12-14 | 2009-06-17 | 中国科学院遗传与发育生物学研究所 | Method for improving plant products and expression box thereof |
| US9238819B2 (en) * | 2011-05-04 | 2016-01-19 | Versitech Limited | Method for speeding up plant growth and improving yield by altering expression levels of kinases and phosphatases |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU8604898A (en) * | 1997-07-30 | 1999-02-22 | Purdue Research Foundation | Transgenic plants tolerant of salinity stress |
| CA2323756C (en) * | 1998-03-18 | 2010-09-21 | Eduardo Blumwald | Genetic engineering salt tolerance in crop plants |
| IL124653A0 (en) * | 1998-05-26 | 1998-12-06 | Yeda Res & Dev | Magnesium-proton exchanger and transgenic plants expressing same |
-
2001
- 2001-03-24 CA CA002418127A patent/CA2418127A1/en not_active Abandoned
- 2001-03-24 BR BR0113466-3A patent/BR0113466A/en not_active Application Discontinuation
- 2001-03-24 AU AU2001250974A patent/AU2001250974C1/en not_active Expired
- 2001-03-24 AU AU5097401A patent/AU5097401A/en active Pending
- 2001-03-24 CN CNA018172369A patent/CN1469705A/en active Pending
- 2001-03-24 EP EP01924311A patent/EP1315410A4/en not_active Withdrawn
Also Published As
| Publication number | Publication date |
|---|---|
| CN1469705A (en) | 2004-01-21 |
| AU2001250974B2 (en) | 2007-06-21 |
| EP1315410A4 (en) | 2004-06-23 |
| AU2001250974C1 (en) | 2008-10-30 |
| AU5097401A (en) | 2002-03-04 |
| BR0113466A (en) | 2004-02-17 |
| CA2418127A1 (en) | 2002-02-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8003852B2 (en) | Transgenic plants overexpressing a plant vacuolar pyrophosphatase | |
| US8058515B2 (en) | Plant cells and plants overexpressing vacuolar proton pyrophosphatases | |
| AU782483B2 (en) | Stress-resistant oversized transgenic plants capable of growing in salinized soil | |
| Aharon et al. | Characterization of a family of vacuolar Na+/H+ antiporters in Arabidopsis thaliana | |
| CA2911623A1 (en) | Transgenic plants | |
| US7041875B1 (en) | Genetic engineering salt tolerance in crop plants | |
| US8697950B2 (en) | Vacuolar pyrophosphatases and uses in plants | |
| WO1999047679A2 (en) | Genetic engineering salt tolerance in crop plants | |
| CN107105627A (en) | The method improved for monocotyledon | |
| CN102348803A (en) | Drought tolerant plants and methods involving genes encoding type c3hc4 ring finger zinc-finger family polypeptides | |
| AU2001250974C1 (en) | Enhanced meristematic activity and competence by overexpression of tonoplast pyrophosphatase | |
| WO2002015674A1 (en) | Enhanced meristematic activity and competence by overexpression of tonoplast pyrophosphatase | |
| US20050028235A1 (en) | Plant fruit with elevated potassium levels | |
| US7442852B2 (en) | High salt plants and uses for bioremediation | |
| AU2001250974A1 (en) | Enhanced meristematic activity and competence by overexpression of tonoplast pyrophosphatase | |
| NZ524616A (en) | Enhanced meristematic activity and competence by overexpression of tonoplast pyrophosphatase | |
| US20110016579A1 (en) | Gene of transporter selective to mugineic acid-iron complex | |
| CN111205355B (en) | Plant stress tolerance-related protein SiWRKY76 and its encoding gene and application | |
| AU2001285459B9 (en) | Methods for imparting desirable phenotypic traits, including drought, freeze, and high salt tolerance and methods for increasing seed production | |
| US20050034191A1 (en) | Salt tolerant oil crops | |
| CN113136389A (en) | Genetic engineering application of gene GhCLcg-1A and/or gene GhCLcg-1D | |
| CA2648516A1 (en) | Abiotic stress tolerant gene from avicennia marina encoding a protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20030318 |
|
| AK | Designated contracting states |
Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK RO SI |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20040507 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: 7C 12N 15/87 B Ipc: 7C 12N 15/82 B Ipc: 7C 12N 15/74 B Ipc: 7C 12N 15/70 B Ipc: 7C 12N 15/63 B Ipc: 7C 12N 15/09 B Ipc: 7C 12N 15/00 B Ipc: 7C 07H 21/04 B Ipc: 7A 01H 5/00 B Ipc: 7A 01H 1/00 A |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20041001 |