EP1315410A1 - Enhanced meristematic activity and competence by overexpression of tonoplast pyrophosphatase - Google Patents

Enhanced meristematic activity and competence by overexpression of tonoplast pyrophosphatase

Info

Publication number
EP1315410A1
EP1315410A1 EP01924311A EP01924311A EP1315410A1 EP 1315410 A1 EP1315410 A1 EP 1315410A1 EP 01924311 A EP01924311 A EP 01924311A EP 01924311 A EP01924311 A EP 01924311A EP 1315410 A1 EP1315410 A1 EP 1315410A1
Authority
EP
European Patent Office
Prior art keywords
avpl
plant
homologue
plants
transgenic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01924311A
Other languages
German (de)
French (fr)
Other versions
EP1315410A4 (en
Inventor
Roberto A. Gaxiola
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
WHITEHEAD INSTITUTE
University of Connecticut
Whitehead Institute for Biomedical Research
Original Assignee
WHITEHEAD INSTITUTE
University of Connecticut
Whitehead Institute for Biomedical Research
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/US2000/030955 external-priority patent/WO2001033945A1/en
Application filed by WHITEHEAD INSTITUTE, University of Connecticut, Whitehead Institute for Biomedical Research filed Critical WHITEHEAD INSTITUTE
Priority claimed from PCT/US2001/009548 external-priority patent/WO2002015674A1/en
Publication of EP1315410A1 publication Critical patent/EP1315410A1/en
Publication of EP1315410A4 publication Critical patent/EP1315410A4/en
Withdrawn legal-status Critical Current

Links

Definitions

  • the present invention relates to genetically-altered plants that are hardy with respect to environmental stresses, such as drought and/or freezing, oversized with respect to vegetative and/or sexual structure (as compared to their normal phenotypic counterparts), and capable of growing in media of high salinity. Such plants also display high meristematic activity, and increased in cellular division activity.
  • Salinization of soil occurs when water supplies contain dissolved salt. Upon evaporation of water from such supplies, salts gradually accumulate in the soil.
  • the progressive salinization of irrigated land compromises the future of agriculture in many of the most productive areas of our planet (Serrano, R., et al, Crit. Rev. Plant Scl, 73:121-138 (1994)).
  • arid regions offer optimal photoperiod and temperature conditions for the growth of most crops, but suboptimal rainfall.
  • Artificial irrigation has solved the problem only in the short term as it has been found that soils in such environments frequently are rapidly salinized.
  • plants must maintain a much lower ratio of Na + /K + in their cytoplasm than that present in the soil, preventing the growth of a number of plants, including food crops.
  • Yet another area of agricultural interest is to improve the yield of crop plants and to improve the aesthetic qualities of certain decorative plants.
  • the yield of a plant crop, and the aesthetics of certain decorative plants may be improved by growing plants that are larger than the wild-type plant in vegetative and/or reproductive structure, as well as improving the growth rate of plants.
  • cyclodextrins applied to tissue culture media has been asserted to improve the rate of cell tissue culture growth by mechanisms including increased cell division (See, e.g., U.S. Patent No. 6,087,176).
  • Certain plant growth hormones such as auxins (which promote, among other things, root growth), cytokinins, and gibberellic acid (which promotes, among other things, stem growth) when applied to plant tissues are also known to promote increased cellular division.
  • auxins which promote, among other things, root growth
  • cytokinins cytokinins
  • gibberellic acid which promotes, among other things, stem growth
  • certain growth factors may be used to increase plant and/or plant flower size. Unfortunately, isolation and application of such growth hormones and factors is costly and time consuming.
  • U.S. Patent No. 5,859,338 discloses that modification of the CLAVATA1 gene of Arabidopsis thaliana causes a loss normal control of cell division in shoot apical meristems and floral meristems. In either case, the loss of control is said to cause an enlargement of the meristem. In flowers, the enlargement is said to lead to an increase in the number of floral organs, including an increase in carpel number, which increases fruit size and seed number.
  • U.S. Patent No. 5,859,338 provides clavatal nucleic acids and proteins, and modified clavatal nucleic acids and proteins, to result in altered meristem phenotypes.
  • U.S. Patent No. 5,750,862 discloses a method for controlling plant cell growth comprising modulating the level and or catalytic activity of a cell cycle control protein in the plant.
  • the patent discloses that by elevating levels of the protein p34 crfc2 , regeneration into plants of single or groups of cells can be facilitated. Control of regeneration may also be effectuated by control of regulatory elements which indirectly result in modulation of p34 Cfifc2 activity.
  • the present invention discloses a transgenic plant having upregulated expression of vacuolar pyrophosphatase. It has been found that plants displaying such upregulated activity are generally larger than wild-type counterparts, demonstrate improved stress resistance to drought and/or freeze, have increased tolerance to salt in the media in which they are growing, and display higher meristematic activity (cell division) leading to greater biomass in certain plant parts as compared to wild type plants.
  • exogenous nucleic acid molecule which alters expression of vacuolar pyrophosphatase in the plant can be used to transform the transgenic plants in accord with the present invention.
  • the exogenous nucleic acid can comprise nucleic acid that encodes a vacuolar pyrophosphatase protein (an exogenous vacuolar pyrophosphatase), such as AVP1, a functional portion thereof (peptide, polypeptide), or a homologue thereof, and/or nucleic acid that alters expression of the endogenous vacuolar pyrophosphatase of the plant into which the exogenous nucleic acid is introduced.
  • exogenous nucleic acid it is meant a nucleic acid from a source other than the plant cell into which it is introduced, or into a plant or plant part from which the transgenic part was produced.
  • the exogenous nucleic acid used for transformation can be RNA or DNA, (e.g., cDNA, genomic DNA).
  • the exogenous nucleic acid can be circular or linear, double-stranded or single-stranded molecules. Single-stranded nucleic acid can be the sense strand or the anti-sense strand.
  • a “functional portion” of a nucleic acid that encodes a vacuolar pyrophosphatase protein it is meant a portion of the nucleic acid that encodes a protein or polypeptide which retains a functional characteristic of a vacuolar pyrophosphatase protein.
  • the nucleic acid encodes ANP1, a functional portion or a homologue thereof.
  • the AVP1 nucleic acid may be obtained, for example, from Arabidopsis or any other plant, or synthetically synthesized.
  • Nucleic acid that alters expression of the endogenous vacuolar pyrophosphatase of the plant into which the exogenous nucleic acid is introduced includes regulatory sequences (e.g., inducible, constitutive) which function in plants and antisense nucleic acid.
  • regulatory sequences include promoters, enhancers.
  • the nucleic acid can also include, for example, polyadenylation site, reporter gene and/or intron sequences and the like whose presence may not be necessary for function or expression of the nucleic acid but can provide improved expression and/or function of the nucleic acid by affecting, for example, transcription and/or stability (e.g., of mRNA).
  • Such elements can be included in the nucleic acid molecule to obtain optimal performance of the nucleic acid.
  • the nucleic acid for use in the present invention can be obtained from a variety of sources using known methods.
  • the nucleic acid encoding a vacuolar pyrophosphatase (e.g., AVP1) for use in the present invention can be derived from a natural source, such as tobacco, bacteria, tomato or corn.
  • the nucleic acid encodes a vacuolar pyrophosphatase that corresponds to a wild type of the transgenic plant.
  • the nucleic acid encodes a vacuolar pyrophosphatase that does not correspond to a wild type of the transgenic plant.
  • Nucleic acid that alters expression of the endogenous vacuolar pyrophosphatase of the plant into which the exogenous nucleic acid is introduced can also be chemically synthesized, recombinantly produced and/or obtained from commercial sources.
  • a variety of methods for introducing the nucleic acid of the present invention into plants are known to those of skill in the art.
  • Agrobacterium- mediated plant transformation, particle bombardment, microparticle bombardment (e.g., U.S. Patent No. 4,945,050; U.S. Patent No. 5,100,792) protoplast transformation, gene transfer into pollen, injection into reproductive organs and injection into immature embryos can be used.
  • the exogenous nucleic acid can be introduced into any suitable cell(s) of the plant, such a root cell(s), stem cell(s) and/or leaf cell(s) of the plant.
  • Any suitable plant including angiosperms, monocots and dicots, and gymnosperms, and algae can be used to produce the transgenic plants, tissue cultures or cell cultures of the present invention.
  • tomato, corn, tobacco, rice, sorghum, cucumber, lettuce, turf grass, ornamental (e.g., larger flowers, larger leaves) and legume plants can be transformed as described herein to produce the transgenic plants of the present invention.
  • the transgenic plants of the present invention can be grown in any medium which supports plant growth such as soil or water (hydroponically).
  • a transgenic plant of the present invention is preferably tolerant to high salt concentrations in soil.
  • salt it is meant to include any salt, that is a compound formed when hydrogen of an acid is replaced by a metal or its equivalent, and includes, without limitation, salts comprising monovalent and divalent toxic cations, NaCl, KC1, CaCl 2 , MgCl, CdCl, ZnCl, and sulfide salts.
  • Salt tolerance may be introduced into a plant of the present invention by transforming plant cells with exogenous nucleic acid which alters the expression of vacuolar pyrophosphatase in the plant such that expression is upregulated.
  • Any suitable vacuolar pyrophosphatase can be used in the compositions and methods of the present invention (e.g., Sarasian, Z., et al, Proc. Natl. Acad. Scl, USA, 89:1775-1719 (1992); Jenslerchl, et al, Molec. Biol, 29: 833-840 (1995); Kim, Y., et al, Plant Physiol, 106:375-382 (1994)).
  • the present invention relates to a transgenic plant which is tolerant to salt comprising an exogenous nucleic acid construct which is designed to overexpress AVP1 (Sarasian, Z., et al, Proc. Natl. Acad. Sci., USA, 59:1775-1779 (1992)). Transformation of the plant cells may be carried out in a whole plant, seeds, leaves, roots or any other plant part. Such transgenic plants are preferably altered such that they grow in a concentration of salt that inhibits growth of a corresponding non-transgenic plant.
  • Plants may be regenerated from transformed cells to yield transgenic plants, which may be screened for certain levels of salt tolerance.
  • the exogenous nucleic acid encodes AVP1, or a homologue thereof.
  • expression of the vacuolar pyrophosphatase in the plant is enhanced to an extent that the transgenic plant is tolerant to sodium chloride (NaCl) when the NaCl concentration is from about 0.2M to about 0.3M.
  • a transgenic plant capable of growing in salt water may also be produced by introducing into one or more cells of a plant nucleic acid which upregulates expression of vacuolar pyrophosphatase in the plant to yield transformed cells.
  • salt water includes water characterized by the presence of salt, and preferably wherein the concentration of salt in the water is from about 0.2M to about 0.4M.
  • salt water refers to sea water.
  • the transgenic plants of the present invention can also be used to produce double transgenic plants which are tolerant to salt (about 0.2M to about 0.4M salt concentration).
  • the present invention relates to a double transgenic plant which is tolerant to salt comprising one or more plant cells transformed with exogenous nucleic acid which alters expression of a vacuolar pyrophosphatase and an Na + /H + antiporter in the plant.
  • the vacuolar pyrophosphatase in an advantageous construct is AVP1, or a homologue thereof, and the Na + /H + antiporter is AtNHXl, or a homologue thereof.
  • the present invention also encompasses transgenic progeny of the double transgenic plant, as well as seeds produced by the transgenic plant and a progeny transgenic plant grown from the seed.
  • Drought and/or freeze tolerance may also be introduced into plants by transforming plant cells with exogenous nucleic acid which alters the expression of vacuolar pyrophosphatase in the plant such that such expression is upregulated.
  • a substantially drought and/or freeze resistant transgenic plant which comprises a genome having one or more exogenously introduced vacuolar H + -translocating pump genes.
  • a particularly preferred fertile transgenic plant eliciting drought and/or freeze tolerance, as well as the ability to grow in saline soils comprises an isolated exogenous chimeric DNA construct encoding vacuolar H + - translocating pump, preferably operably linked to a promoter, such as the 35-S promoter or any other strong promoter, including, without limitation, tissue specific promoters.
  • the transgenic plant may contain a polynucleotide sequence comprising an exogenous tonoplast pyrophosphate FT 1" pump gene operably linked to a promoter.
  • the polynucleotide sequence comprises an exogenous tonoplast pyrophosphate H* pump gene operably linked to a double tandem enhancer of the 35S promoter.
  • a particularly preferred tonoplast pyrophosphate H 1" pump gene is the AVP1 gene.
  • Upregulation of expression of vacuolar pyrophosphatase by the methods described above may also be used to provide a plant having larger vegetative and/or sexual organs than wild type counterpart plants. That is, the present invention provides for a method of increasing the yield of a plant comprising introducing into one or more cells of a plant nucleic acid which alters expression of vacuolar pyrophosphatase in the plant to yield transformed cells, thereby increasing the yield of the plant. The method can further comprise regenerating plants from the transformed cells to yield transgenic plants and selecting a transgenic plant which is larger than its corresponding wild type plant, thereby producing a transgenic plant which is larger than its corresponding wild type plant.
  • a transgenic plant e.g., an ornamental plant
  • a method of making a transgenic plant comprising introducing into one or more cells of a plant nucleic acid which alters expression of vacuolar pyrophosphatase in the plant to yield transformed cells.
  • Upregulation of expression of vacuolar pyrophosphatase by the methods described above may also be used to provide a plant with meristematic activity cell division rate which is enhanced over wild-type counterpart plants.
  • meristems are central to higher plant development, as almost all post-embryonic organs, including roots, leaves, flowers and axillary meristems and cambium are initiated by either shoot or root meristems.
  • Increased meristematic activity results in higher biomass in one or more aspects of plant structure, as evidenced by dry weight of plant structure, root structure as well as stem structure.
  • Increased meristemic activity is hypothesized to result in increased rate of shoot regeneration in root, leaf, hypocotyl, and cotyledon explants, and increased overall plant growth rate.
  • the present inventor has discovered that overexpression of a pyrophosphate driven proton (H + ) pump at the vacuole leads to a greater proton pumping capacity that results in a greater ion uptake into the vacuoles that lowers the osmotic potential of the cells, and also leads to an increase in the capacity of plant cells to divide and multiply.
  • finding can have great commercial importance, e.g., reducing time for wood, corn etc. production by transforming cells so as to overexpress such pumps, and enhancing shoot regeneration capacity in plants with poor or slow regeneration capacity, such as woody plants, crops, e.g. co , and ornametals e.g., orchids.
  • a preferred construct includes a tonoplast pyrophosphate driven H+ pump gene (AVP-T) operably linked to a chimeric promoter (e.g., double tandem enhancer of 35S promoter) designed to overexpress A VP- 1.
  • AVP-T tonoplast pyrophosphate driven H+ pump gene
  • novel gene cassettes including cassettes comprising a tonoplast pyrophosphate driven H 1" pump gene operably linked to a chimeric promoter.
  • a novel gene cassette comprising an exogenous tonoplast pyrophosphate driven H pump gene operably linked to a promoter, as well as novel coding sequences comprising an exogenous tonoplast pyrophosphate driven H pump gene operably linked to a double tandem enhancer of the 35S promoter.
  • coding sequence is designed to overexpress ANP1.
  • novel expression vectors including an expression vector containing a polynucleotide sequence comprising a exogenous tonoplast pyrophosphate driven H 1" pump gene operably linked to a double tandem enhancer of the 35S promoter and further operatively linked to a multiple cloning site, and an expression vector containing a polynucleotide sequence comprising a exogenous tonoplast pyrophosphate driven T pump gene operably linked to a double tandem enhancer of the 35S promoter and further operatively linked to a heterologous coding sequence.
  • the disclosed invention may have application to any plant, including, without limitation, crop plants, ornamental plants, grasses, shrubs, or any other plant found useful or pleasing to man, including having application to monocots, dicots, angiosperms, gymnosperms, and algae.
  • Fig. 1A is an overhead view of representative (out of 10 plants each) wild type (WT) and two independent transgenic lines (1' and 2') grown hydroponically for seven weeks on a 10 hour light/dark cycle;
  • Figs. 1B(1), 1B(2) and 1B(3) are a photomicrographs of the root and root hairs of representative five day old seedlings obtained from representative WT, 1' and 2' of Fig. 1A grown parallel to the surface on vertical plant nutrient agar plates;
  • Fig. 1C is an immunoblot of membrane fractions isolated from wild type (WT) and two independent transgenic lines (1' and 2') overexpressing AVP-1;
  • Fig. 2 is an overhead view of a representative wild type plant (WT) versus representative transgenic plants overexpressing AVP-1 (1' and 2') after exposure to 7 days of water deficit stress.
  • Fig. 3 is a perspective view of wild-type plants (WT) versus representative transgenic plants overexpressing AVP-1 (1' and T) grown in salty soil.
  • Fig. 4 A is a schematic representation of a working model of the transporters involved in sodium sequestration at the yeast pre-vacuolar compartment; Nhxl (Na + /H + antiporter), Vmal (vacuolar membrane H + -ATPAse), Gefl (yeast CLC chloride channel), Enal (plasma membrane Na + -ATPase).
  • Fig. 4B is a schematic representation of a working model of the transporters involved in sodium sequestration at the yeast pre-vacuolar compartment shown in Fig. 4A, which also includes Avpl (A. thaliana vacuolar pyrophosphate- energized proton pump).
  • Fig. 5A and Fig. 5B are bar graphs showing the intracellular Na + and K + contents of wild-type yeast strains and of yeast strains carrying various mutations affecting sodium tolerance wherein the values are the mean of two determinations, and the bars represent the standard deviations.
  • Fig. 6 is an overhead view of shoot regeneration from root and cotyledon explants from wild-type (WT) and AVP-1 overexpressing (l 1 and ) Arabidopsis plants, cultured in the SIM medium of Fig. 13.
  • Fig. 7 is a bar graph of Na + and K + content of wild-type plants (WT) versus representative transgenic plants overexpressing AVP-1 (1' and ) grown in salty soil.
  • Fig. 8 is a. graph of the uptake of calcium into the 35SAVP-1 transgenic vacuolar membrane vesicles (squares) of 2' of Fig. 3 versus calcium uptake into vesicles obtained from wild type (WT) of Fig. 3.
  • Figs. 9 A and 9B are illustrations demonstrating the 35SAVP-1 theorized mechanism for a higher accumulation of solids into vacuoles via a proton driven function versus that of WT vacuoles.
  • Fig. 10 is an overhead view of the leave foliage of wild type versus transgenic (1' and ) AVP-1 overexpressing Arabidopsis plants with leaves positioned with respect to one another according to age.
  • Figs. 11 A and 11B are overhead views of watered (distilled water) leaves from wild type and transgenic (1' and 2') Arabidopsis plants overexpressing AVP-1 demonstrating growth of root structures.
  • Fig. 12 is an overhead view of shoot regeneration in representative wild type petunia leave cuttings (WT) versus representative transgenic petunia plant leave cuttings overexpressing AVP-1 (35-S AVP-1).
  • Fig. 13 is an overhead view of shoot regeneration from 5-day old cotyledons placed in SIM induction medium obtained from wild type (WT) and AVP-1 overexpressing (V and 2') Arabidiopsis plants.
  • Fig. 14 is bar graph of osmotic potential of fully hydrated leaves from WT and two AVP-1 overexpressing lines (1 ' and 2') from Arabidopsis plants.
  • Fig. 15 is an overhead view of petunia explants incubated on MS medium showing callus induction from the explants after six weeks of incubation. DETAILED DESCRIPTION OF THE INVENTION
  • vacuoles constitute 40 to 99% of the total intracellular volume of a mature plant cell, changes in the size of the vacuole have dramatic effects upon cell size (R. G. Zhen, E. J. Kim, P. A. Rea, in The Plant Vacuole . (Academic Press Limited, 1997), vol. 25, pp. 298-337).
  • the volume of the vacuole is controlled by ion and water fluxes mediated by pumps and transporters. In plants the driving force that triggers the movement of ions, solutes and water across membranes is a proton gradient.
  • vacuolar Ff ⁇ -pumps results in luminal acidification and the establishment of a H electrochemical potential gradient across the vacuolar membrane, which powers the secondary active transporters of inorganic ions, sugars, and organic acids.
  • the activity of these transporters modulates cellular pH and ion homeostasis and leads to the accumulation of solutes required to generate the osmotic potential that promotes vacuolar expansion (H. Sze, X. Li, M. G. Palmgren, The Plant Cell 11, 677-689 (1999)).
  • the present inventor has recognized that plants have a number of vacuolar H ⁇ -translocating pumps, and that by upregulating their activity, increasing their expression, upregulating their transcription and/or translation, or increasing their copy number that one can increase accumulation of solids in the vacuole due to an increase in the availability of protons in the vacuoles.
  • V-PPase encoded by the AVP-1 gene is capable of generating a H + gradient across the vacuole membrane (tonoplast) similar in magnitude to that of the vacuolar H + -ATPase (V. Sarafian, Y. Kim, R. J. Poole, P. A. Rea, Proc. Natl. Acad. Sci. 89, 1775-1779 (1992)).
  • V. Sarafian, Y. Kim, R. J. Poole, P. A. Rea, Proc. Natl. Acad. Sci. 89, 1775-1779 (1992) Similar genes in other plants should function in a similar manner.
  • H + -PPase is the main proton pump of vacuolar membranes in growing tissue.
  • the later may be due to the fact that in growing tissue, nucleic acids, DNA, RNAs, proteins and cellulose etc. are actively being synthesized for the construct of the new cells, and as a result, a large amount of PPi is produced as a by-product of these metabolic processes.
  • the energy stored in the PPi molecule may be transformed into a different source of energy, namely a H + -gradient across the vacuolar membrane.
  • This H - gradient constitutes the driving force for the vacuolar accumulation of solutes that generate the sufficient osmotic differential that enables the plant cell to initiate growth.
  • a construct comprising a vacuolar pyrophosphatase gene operably linked to a promoter designed to overexpress the vacuolar pyrophosphatase (e.g., an expression cassette) is used to produce the transgenic plants of the present invention.
  • a promoter designed to overexpress the vacuolar pyrophosphatase e.g., an expression cassette
  • overexpression refers to greater expression activity than occurs in the absence of the construct.
  • a construct comprising an AVPl gene operably linked to a chimeric promoter designed to overexpress AVPl is used to produce the transgenic plants of the present invention. More particularly, the present invention relates to a construct wherein the A VP1 gene is operably linked to a double tandem enhancer of a 35 S promoter.
  • the transgenic plants of the present invention may find utility other than those associated with the food value or ornamental value, industrial value such as, for example, wood production.
  • the transgenic plants of the present invention may uptake different or more ions than their wild-type counterparts.
  • studies with mutant yeast strains (enal) demonstrates that H + -translocating pumps at the vacuole plays an important role in cation detoxification in higher plants (the plant components involved in an intracellular cation detoxification system being identified by complementing salt-sensitive mutants of the budding yeast Saccharomyces cerevisiae).
  • Transgenic plants and/or progeny thereof comprising exogenous nucleic acid which alters expression of vacuolar pyrophosphatase in the plant in accord with such studies may be used to bioremediate soil and growth medium.
  • Such plants can be used to remove cations (e.g., monovalent and/or divalent cations) from a medium which can support plant growth (e.g., soil, water).
  • cations e.g., monovalent and/or divalent cations
  • transformed plants of the present invention can be used to remove sodium (Na), lead (Pb), manganese (Mn) and/or calcium (Ca) ions from a medium which supports plant growth.
  • the present inventor generated transgenic plants containing extra copies of a vacuolar proton pump, A VP-1.
  • Arabidopsis thaliana plants were transformed with constructs containing the AVP-1 gene. Transgenic lines containing extra copies of this gene were then isolated.
  • the AVP-1, open reading frame was cloned into the Xmal site of a modified pRT103 [R. Topfer, V. Matzeit, B. Gronenborn, J. Schell and H-H. Steinbiss, Nucleic acid Research 15, 5890 (1987)].
  • This vector contains a tandem repeat of the 35-S promoter.
  • a Hindlll fragment containing the 35-S tandem promoter, AVP-1 ORF and the polyadenylation signal was subcloned into the Hindlll site of the pPZP212 vector [ P. Hajdukiewicz, Z.
  • Agrobacterium- mediated transformation was performed via vacuum infiltration of flowering Arabidopsis thaliana (ecotype Columbia). Transgenic plants were selected by plating seeds of the transformed plants on plant nutrient agar plates supplemented with 25 mg/liter kanamycin. Plants were subsequently selected for two generations to identify transgenic plant homozygous for the transgene.
  • Fig. 1A is an overhead picture of representative (out of 10 plants each) wild type (WT) and two independent transgenic lines (1' and 2') grown hydroponically for seven weeks on a 10 hour light/dark cycle.
  • WT wild type
  • a visual comparison of transgenic line T, which expresses the AVP-1 protein at highest level, transgenic line 1 ', and wild type (WT) demonstrates that the amount of AVP-1 correlates with the size of the plants.
  • the mass of the transgenic plants was found to be greater than that of wild type.
  • WT wild-type root hairs
  • the length of the root hairs is correlated with the size of the vacuole, so the increased size of the root hair is likely to result from increased vacuolar volume.
  • Fig. IC is an immunoblot of membrane fractions isolated from wild type
  • WT and two independent transgenic lines (1' and ) overexpressing AVP-1.
  • Total membrane fractions were isolated from shoots of eight week old wild type (WT) and AVP-1 transgenic plants (1' and 2') grown in a hydroponic media for 8 weeks. Homogenate of plant shoots were sequentially centrifuged for 15 and 30 min at 8,000 and 100,000 rpms respectively.
  • the 100 mg membrane pellet was re-suspend in 10 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 10% glycerol and 1 mM PMSF Protein (10 ug) was separated on a 10% SDS-PAGE, electroblotted and immunostained with antibodies raised against a KLH-conjugated synthetic peptide corresponding to the putative hydrophilic loop IV of the AVP-1 protein (V. Sarafian, Y. Kim, R. J. Poole, P. A. Rea, Proc. Natl. Acad. Sci. 89, 1775-1779 (1992)). PPase was detected by chemiluminescence. Fig.
  • WT wild type
  • Fig. 2 is an overhead view of a representative wild type plant (WT) versus representative transgenic plants overexpressing AVP-1 (1' and 2') after exposure to 7 days of water deficit stress.
  • Wild type and transgenic plants overexpressing AVP-1 (Fig 3 A) were tested for drought tolerance (24°C).
  • WT water deficit stress wild type
  • Fig 3 A plants from both 35S AVP-1 transgenic lines (1' and 2') were turgid and alive.
  • the drought stressed plants were then watered, transgenic plants pursued normal growth, bolted and set seeds, whereas wild type plants died.
  • the relative water content of leaves from wild type and 35SAVP-1 transgenic plants were determined along the water deficit stress, demonstrating increased water retention by the transgenic lines as compared to the WT plants.
  • Fig. 14 is bar graph of osmotic potential of fully hydrated leaves from wild-type (WT) and two AVP-1 overexpressing lines (1' and 2') from Arabidopsis plants.
  • WT wild-type
  • AVP-1 overexpressing lines (1' and 2') from Arabidopsis plants.
  • the decreased osmotic potential in leaves of transgenic plants measured at a constant water content is consistent with the contention that AVP-1 overexpression results in increased solute accumulation, and therefore enhancing water retention capability.
  • FIG. 3 is a perspective view of wild type plants (WT) versus representative transgenic plants overexpressing AVP-1 (1' and 2') grown in salty soil.
  • Five wild-type plants (WT) and five of the two AVP-1 overexpressing transgenic lines (1' and 2') were grown on soil in a 10 hour light/dark cycle.
  • Plants were watered with a diluted nutrient solution (1/8 MS salts) for six weeks and subsequently watered with a diluted nutrient solution supplemented with NaCl.
  • the concentration of NaCl began with 100 mM and was increased every four days by 50 mM.
  • the illustrations in Fig. 3 corresponds to representative plants at the tenth day in the presence of 300 mM NaCl.
  • Fig. 3 corresponds to representative plants at the tenth day in the presence of 300 mM NaCl.
  • AVP-1 plant types (1' and 2') were significantly hardier in salty soil as compared to wild-type plants.
  • AVPl the pyrophosphate-energized vacuolar membrane proton pump, this work
  • AtNHXl the Na + /H + antiporter, (Apse, M., et al, Science, 2&5:1256-1258 (1999)) and this work) are capable of growing in the presence of high NaCl concentrations strongly supports the strategy described herein.
  • a double transgenic plant would be expected to demonstrate a further enhanced salt-tolerant phenotype.
  • H + -translocating pumps located at the plasma membrane and tonoplast translocated FT 1" from the cytosol to extracellular and vacuolar compartments, respectively (Rea, P.A., et al, Tonoplast Adenosine Triphosphate and inorganic Pyrophosphatase. In: Methods Plant Biochem., pp. 385-405, Academic Press Limited, London (1990)).
  • the plant tonoplast contains two tf ' -translocating pumps; the V-ATPase and the inorganic pyrophosphatase or V-PPase.
  • vacuolar membrane is implicated in a broad spectrum of physiological processes that include cytosolic pH stasis, compartmentation of regulatory Ca , sequestration of toxic ions such as Na + , turgor regulation, and nutrient storage and retrieval.
  • the vacuole constitute 40 to 99% of the total intracellular volume of a mature plant cell.
  • vacuolar proton pumping pyrophosphatase is a universal and abundant component of plant tonoplast capable of generating a steady-state trans-tonoplast H* electrochemical potential similar or greater than the one generated by the V-ATPase (Rea, P.A., et al, Tonoplast Adenosine Triphosphate and Inorganic Pyrophosphatase. ⁇ n:Methods Plant Biochem., pp. 385-405, Academic Press Limited, London (1990)).
  • Pyrophosphate is a by-product in the activation or polymerization steps of a wide range of biosynthetic pathways and in plants serves as an alternative energy donor to ATP for sucrose mobilization via sucrose synthetase, for glycolysis via PPi: fructose-6- phosphate phosphotransferase and for tonoplast energization via the vacuolar proton pumping pyrophosphatase (Stitt, M., Bot. Acta 111:167-175 (1998)).
  • Fig. 4A is a schematic representation of a working model of the transporters involved in sodium sequestration at the yeast pre-vacuolar compartment; Nhxl (Na + H + antiporter), Vmal (vacuolar membrane H + - ATPase), Gefl (yeast CLC chloride channel), Enal (plasma membrane Na + - ATPase).
  • the yeast member of the CLC voltage-gated chloride channel superfamily, Gefl is required for copper loading in late- Golgi vesicles and for cation sequestration in the pre-vacuolar compartment in yeast (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci.
  • FIG. 4B is a schematic representation of a working model of the transporters involved in sodium sequestration at the yeast pre- vacuolar compartment shown in Figure 4 A, which also includes Avpl (A. thaliana vacuolar pyrophosphate-energized proton pump). While not wishing to be bound by theory, two observations led to the proposal of the model for Na + sequestration in yeast illustrated in Figs. 4 A and 4B. First, gefl mutants are sensitive to high NaCl concentrations. Second, the Na + /H + exchanger Nhxl is localized to the pre-vacuolar compartment ( ass, R., et al., J. Biol.
  • Yeast and plant cells share pathways and signals for the trafficking of vesicles from the Golgi network to the vacuole (Neuhaus, J.M., et al, Plant Mol. Biol, 35:127-144 (1998); (Paris, N., et al, Plant Physiol, 775:29-39 (1997); Sato, M.H., et al, J. Biol. Chem., 272:24530-24535 (1997); Vitale, AN., et al, Trends Plant Scl, 4: 148-154 (1999)). Studies were therefore undertaken in yeast to identify the role of the vacuole in cation detoxification in higher plants.
  • the yeast vacuolar ATPase is a multisubunit protein, so it is difficult to increase its activity by overexpressing any one of its subunits. Instead the same effect was achieved by increasing the influx of protons by expressing the A. thaliana AVPl gene in yeast.
  • This gene encodes a single polypeptide that, when expressed in yeast, is capable of pumping protons into the lumen of the vacuole (Kim, E.J., et al, Proc. Natl. Acad. Sci. USA, 97:6128-6132 (1994)).
  • Transformation of yeast cells was performed by using the lithium acetate method (Gietz, D., et al, Nucleic Acids Res., 20:1425 (1992)).
  • Double mutants RGY324 (gefl::HIS3 enal::HIS3), RGY326 (nhxl::HIS3 enal::HIS3), and RGY343 (gefl::HIS3 nhxl::HIS3) were obtained by crossing the single-mutant strains.
  • Double mutants were identified among the meiotic progeny by scoring for the phenotypes associated with each of the single mutants. Sporulation, tetrad dissection, and mating types were scored as described (Guthrie C.
  • APG is a synthetic minimal medium containing 10 mM arginine, 8 mM phosphoric acid, 2% glucose, 2 mM MgSO 4 , 1 mM KC1, 0.2 mM CaCl 2 , and trace minerals and vitamins) (Rodriguez-Navarro, A.
  • RGY326 (nhxl::HIS3 enal::HIS3) strains were transformed with pY ⁇ S2 vector (Invitrogen) and plasmid ⁇ YES2- ⁇ P7-E229D described in Zhen, R.G., et al., J. Biol. Chem., 272:22340-22348 (1997).
  • the strain RGY343 (gefl::HIS3 nhxl::HIS3), used for histochemical analysis, was transformed with pRG151 (GEF1-GFP) (Gaxiola, R.A., et al. Proc. Natl. Acad. Sci.
  • Wild-type and RGY296 (nhxl::HIS3) strains were transformed with vector pAD4 (Ballester, R., et al, Cell, 59:681-686 (1989)).
  • RGY296 (nhxl::HIS3) was transformed with pRG308 (ADH1 : :AtNHXl) (see Cloning ofAtNHXl).
  • Intracellular cation concentrations were estimated as described (Gaxiola, R.A., et al, EMBO J., 77:3157-3164 (1992)) by using the intracellular water value calculated for cells grown in 1M NaCl.
  • the strain RGY343 (gefl::HIS3 nhxl::HIS3) was grown in SD-ura, -leu medium (Difco; synthetic medium with 2% dextrose without uracil and leucin) to mid- logarithmic phase, 0.1 mg/ml hygromycin B was added, and the culture was incubated for 1 h at 30°C. Cells were fixed with 3.7% formaldehyde (Sigma) for 45 min at room temperature without agitation. Spheroplast formation, permeablization, washing, and antibody incubation was performed as described (Pringle, J., et al.,, in Immunofluorescence Methods for Yeast, eds. Guthrie, C.
  • MAB HAH used as first antibody was from Babco (Richmond, CA). Cy3-conjugated goat anti-mouse IgG was from Jackson Immunoresearch. 4',6-Diamidino-2-phenylindole (Sigma) was added , to mounting medium to stain mitochondrial and nuclear DNA.
  • strain RGY343 (gefl::HIS3 nhxl::HIS3) was grown in APG medium (pH 7.0), and lysates fractionated on a 10-step sucrose density gradient as described (Nass,
  • AtNHXl was cloned from a phage cDNA library of A. thaliana (Kieber, J.J., et al, Cell, 72:427-441 (1993)) (obtained from the Arabidopsis Biological Resource Center) by probing with an expressed sequence tag (Arabidopsis Biological Resources Center, DNA Stock Center) containing a partial clone.
  • a full-length clone (2.1 kB) was ligated into vector pSK2 (Stratagene) at the N ⁇ tl sit, generating plasmid pRG293.
  • the AtNHXl ORF was amplified via PCR by using pRG293 as template and GGCCCGGGATGGATTCTCTAGTGTCGAAACTGCCTTCG (SEQ ID NO: 5) (italicized bases correspond to nucleotides 1-30 of the ORF) and T7 oligonucleotides.
  • the PCR product was then digested with Xbal and Sail and ligated into pAD4 vector generating plasmid pRG308.
  • the AtNHXl ORF was sequenced to verify the fidelity of the PCR product. The full-length sequence is longer than the ORF reported by the Arabidopsis Genome Initiative (A TM021B04.4), and has been deposited in GenBank (accession no. AF 106324). Cloning of AVPl -D
  • Vector pYES2 (Invitrogen) was introduced into wild-type, enal, enal nhxl, and enal gefl mutants. Plasmid pYes2-AVPl-D (Zhen, R.G., et al., J. Biol. Chem., 272:22340-22348 (1997)) was introduced into enal, enal nhxl, and enal gefl mutants. Five-fold serial dilutions (starting at 10 5 cells) of each strain were plated on YPGAL (1% yeast extract/2% peptone/2% galactose) with or without 0.5 M NaCl and incubated at 30°C for 2 days.
  • YPGAL 1% yeast extract/2% peptone/2% galactose
  • Exponentially growing cells (wild-type and enal transformed with pYES2 vector and enal, enal nhxl, and enal gefl mutants carrying pYes2--4FP7-E>) were exposed to 0.7M NaCl for 6 hours. Total cell extracts were prepared, and Na + and K + concentrations were determined. Results
  • the enal mutant of the above construct lacks the plasma membrane sodium efflux pump and therefore must rely on the internal detoxification system to overcome sodium toxicity. Growth of the enal strain is sensitive to low concentrations of sodium (200 mM), concentrations that do not inhibit the growth of wild-type strains. Overexpression of AVPl -D restored salt tolerance to salt-sensitive enal mutants. The restoration of salt tolerance to an enal strain by AVPl-D requires functional NHX7 and GEE7 genes: enalnhxl AVPl-D and enal gefl AVPl-D strains are salt sensitive.
  • Fig. 5A and Fig. 5B are bar graphs showing the intracellular ⁇ a + and K + contents of wild-type yeast strains and of yeast strains carrying various mutations affecting sodium tolerance wherein the values are the mean of two determinations, and the bars represent the standard deviations.
  • the intracellular Na + and K contents of wild-type strains and of strains carrying various mutations affecting sodium tolerance were determined after 6 h of exposure to media supplemented with 0.7 M NaCl.
  • the intracellular Na + content in the enal mutant was seen to be 8-fold higher than in the wild- type strain. There was seen to be a consistent reduction in total cell Na + in the enal AVP- D strain. The reason for this reduction is unknown.
  • the enal AVP-D strain was found to be salt-resistant, even though its intracellular Na + content was 4-fold higher than that of the wild type.
  • enal AVPI-D strains lacking either gefl or nhxl i.e., enal gefl or enal nhxl
  • the Na + content was not reduced to the extent that it was in the GEF1 NHX1 strain.
  • the genetic and physiological data are consistent with the model that Nhxl, Gefl and Avpl cooperate to sequester sodium internally.
  • the Arabidopsis Vacuolar FT 1" -Pyrophosphatase was evidenced to confer salt tolerance to yeast enal mutants.
  • the intracellular K + content was found to correlate with salt tolerance and is inversely correlated with the Na + content of the strains (Fig. 4B).
  • the wild-type K + concentration was at 100 mM, but was reduced to 20 mM in the enal mutant.
  • the intracellular concentration of K was restored almost to wild-type levels (Fig. 4B).
  • AVPl-D overexpression failed to restore wild-type levels of intracellular potassium unless both NHxl and G ⁇ F1 were functional (See, the double mutants enal nhxl or enal gefl in Fig. 4B).
  • intracellular Na + detoxification in yeast requires functional Na + /H + exchanger (Nhxl) and chloride channel (Gefl), and they co-localize to a pre-vacuolar compartment (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480- 1485 (1999)).
  • Arabidopsis thaliana homologue of the yeast NHX7 gene Arabidopsis thaliana homologue of the yeast NHX7 gene (AtNHXl) was cloned and its function in the nhx 1 yeast mutant tested, the AtNHXl gene was found to be able to suppress partially the cation sensitivity phenotypes of nhxl mutants.
  • Example 6 is alignment of the deduced amino acid sequences of ⁇ hXl homologue from Arabidopsis AtNHXl (SEQ ID ⁇ O:l), human HsNHE-6 (SEQ ID NO: 2) and yeast ScNHXl (SEQ ID NO:3); identical residues are in black boxes, and dashes indicate gaps in the sequence, * above alignment denote putative amiloride binding site from human NHE7 ( 163 DVF-FLFLLPPI 173 ) (S ⁇ Q ID NO: 4).
  • Example 2 Functionality of . and Co-localization of. Geflp and Nhxlp in Yeast Strains
  • the NHXl and GEE7 genes which have been identified as important in sodium detoxification, are also required for the detoxification of other cations.
  • the strain RGY419 (gefl nhxl) was transformed with plasmids pRG151; G ⁇ F1-GFP and pRIN73; N ⁇ X1-( ⁇ A) 3 . Transformants were grown in SD (Difco; synthetic medium with 2% dextrose).
  • the migration properties of the Geflp and Nhxlp in sucrose gradients was also determined to provide evidence of co-localization of Nhxl ( ⁇ A) 3 and GEF1-GFP.
  • the strain RGY419 (gefl nhxl) was transformed with plasmids pRG151; GEF1-GFP and pPJN73; NHX1-(HA) 3 and grown in APG medium (Rodriguez-Navarro, A. and Rea, P. A., J. Biol. Chem., 159:940-945 (1984)).
  • Gefl mutants were found to be sensitive to 3 mM MnCl 2 , 0.45 M tetramethylammonium chloride and to 0.05 ⁇ g/ml hygromycin-B.
  • the nhxl mutant was also found to be sensitive to tetramethylammonium chloride and hygromycin.
  • the extreme sensitivity of the nhxl mutant to hygromycin may provide an important tool for assaying nhxl function.
  • hemagglutinin (HA)-tagged Nhxl and Gefl-GFP fusion protein co-localize as shown via epifluorescence deconvolution microscopei Persistence of signal coincidence on 90° rotation of the image further supports co-localization of the two transporter proteins in these cells.
  • the co-localization of Nhxl (HA) 3 and GEF1-GFP is also supported by the co-migration of the two proteins in sucrose density gradients of membrane preparations obtained from cells expressing the tagged proteins.
  • the sedimentation behavior of the membrane fraction containing both proteins is consistent with that of a pre-vacuolar compartment (Nass, R. and Rao, R., J. Biol. Chem., 273:21054- 21060 (1998)).
  • Gefl-GFP (but not Nhxl) is also present in Golgi fractions, consistent with previous studies (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998), Schwappach, B., et al, J. Biol. Chem., 273:15110-15118 (1998)).
  • Example 3 Capacity of A. thaliana Homolog of NHX1 to Suppress Hygromycin Sensitivity of Mutant Yeast
  • the yeast strain described herein provides an important tool for identifying genes that mediate salt tolerance in other organisms.
  • a sequence from Arabidopsis See Materials and Methods
  • an expressed sequence tag see Materials and Methods
  • An alignment of the amino acid sequences of Nhxl homologues from Arabidopsis (AtNhxl), human (HsNhe ⁇ ), and yeast (ScNhxl) reveals segments of amino acid identity and similarity within predicted transmembrane domains (Fig. 6A-C).
  • Fig. 6A-C it is important to note that despite these relationships, neither the C-terminal regions of AtNhxl and ScNhxl show a high degree of homology (Fig. 6A-C).
  • a characteristic of mammalian Na + /H + antiporters is their inhibition by amiloride.
  • a putative amiloride binding site 163 DVFFLFLLPPI 173 ) (SEQ ID NO: 4) has been defined via point mutants in the human NHE1 antiporter gene (Counillon, T,., et al, Proc. Natl. Acad. Sci. USA, 90:4508-4512 (1993)).
  • AtNhxl, HsNhe-6 and ScNhxl have an almost identical sequence (Fig. 6).
  • attempts to inhibit the activity of either Nhxl or AtNhxl in yeast cultures with amiloride were unsuccessful.
  • the At NHX1 gene is capable of suppressing the hygromycin sensitivity of the nhxl mutant.
  • the AtNHXl gene also suppressed the NaCl sensitivity of nhxl mutant but only under conditions in which the K availability was reduced. However, AtNHXl was not capable of rescuing the Na " sensitive growth phenotype of the double mutant enal nhxl overexpressing the AVPl-D gene.
  • Example 4 Generation of Gain-of-Function Yeast AtNHX Mutants Materials and Methods
  • Gain of function mutants of the AtNHX that enhance salt tolerance may be generated in the enal yeast by mutagenizing the cloned gene to make a mutant library.
  • This library may be used to transform the salt sensitive yeast mutant enal and clones with an enhanced salt tolerant phenotype.
  • AtNHXl homologues may also be expressed in the mutant yeast to form gain-of-function mutants. It is believed that some of these AtNHXl homologues are plasma membrane transporters, so their function in yeast are frequently pH dependent, requiring precise composition and pH of the medium used for screening for success.
  • a method for introducing random mutations developed by Stratgene (Epicurian Coli XL 1 -Red competent Cells Cat#200129) may be used.
  • the method involves the propagation of a cloned gene into a strain deficient in the three primary DNA repair pathways. The random mutation rate in this strain is about 5000-fold higher than that of wild-type.
  • a library of the mutated AtNHX gene may be transformed into the enal yeast mutant and screened for salt tolerance. Yeast transformation was performed as described by Schiestl and coworkers (Gietz, D., et al, Nucl. Acid Res. 20:1425 (1992), incorporated by reference in its entirety herein).
  • An alternative to the XL 1 -Red random mutagenesis strategy is a PCR approach described by Fink and coworkers (Madhani, H.D., et al, Cell, 97:673-684
  • AtNHXl homologues To test AtNHXl homologues the same strains and conditions may be as described in Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999). However, others may be employed. When dealing with plasma-membrane AtNHXl homologues pH conditions of the assay media may be crucial. Results
  • D increases the intracellular detoxification capability in yeast (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999)). It is hypothesized (although the inventors are not limited by such hypothesis) that the latter is due to an increased influx of H 1" into the vacuolar compartment thereby improving Na + sequestration via the Nhxl exchanger.
  • the yeast system described herein permits the functional assessment of diverse heterologous proteins in salt tolerance: chloride channels, H pumps, and Na /FT 1" exchangers and other cation H + exchangers or cation/bicarbonate symporters.
  • the system is robust and flexible.
  • the function of the Arabidopsis chloride channels (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998), Hechenberger, M., et al, J. Biol. Chem., 277:33632-33638 (1996)), TU pump, and NaW exchanger can be assayed in the corresponding yeast mutant.
  • At NHXl Despite the inability of At NHXl to suppress all the phenotypes of the yeast nhxl mutant, the fact that it suppresses some phenotypes, coupled with the DNA homology between AtNHXl and yeast NHXl, indicates that the plant gene carries out a similar function to that of the yeast homologue.
  • the observation that the AtNHXl gene suppresses the sensitivity of the nhxl mutant to hygromycin but provides only a weak Na + detoxification phenotype could be a consequence either of differential regulation of the transporters in the two organisms or of distinct cation transport selectivities.
  • vacuolar sodium accumulation in salt-tolerant plants may be mediated by a tonoplast Na + /H + antiporter that utilizes the proton-motive force generated by the vacuolar H 1" - ATPase (V-ATPase) and/or -translocating pyrophosphatase (V-Ppase; refs. Barkla, BJ., et al, Symp. Soc. Exp.
  • AtNHXl gene in salt homeostasis is provided by the observation that its expression is induced in salt-stressed plants (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999)).
  • Arabidopsis thaliana in particular, has been used as a host model plant to demonstrate that overexpression of these genes results in salt tolerance in the plant.
  • a recent report shows that the overexpression of AtNHXl gene in transgenic Arabidopsis thaliana promotes sustained growth in soil watered with 200 mM NaCl plus 1/8 M.S.
  • A. thaliana plants (ecotype Columbia) were grown aseptically on unsupplemented plant nutrient agar without sucrose (Haughn, G.W. and Somerville, C, Mol. Gen. Genet., 204:430-434 (1986)) for 15 days at 19°C and under continuous illumination. NaCl or KC1 was added to a final concentration of 250 mM, and the plants were incubated for 6 h. Total RNA from tissue of salt-treated and untreated plants was isolated (Niyogi, K.K. and Fink, G.R., Plant Cell, 4:721-733 (1992)), Hybond-N (Amersham) membranes were hybridized with a 32 P-Labeled DNA probe from plasmid pRG308.
  • Hybridization was performed at 65°C overnight. Washes were performed at 65°C with 0.2% standard saline citrate (SSC)/0.1% SDS (Ausebel, F., et al, Curr. Protocols in Mol. Biol. (Wiley, NY) (1988)). 7SS probe was used as loading control (Unfried, I., et al, Nucleic Acids Res., 77:7513 (1989)). MACBAS 2.4 program was used to quantify the relative amount of RNA. Results The NaCl stress increased AtNHXl mRNA levels 4.2-fold, whereas KC1 promoted only a 2.8-fold increase.
  • RNA tissue blot hybridized with AtNHXl Ten micrograms of total RNA from 15 -day old plants exposed to 250 mM NaCl or KC1 for 6 h and a control grown without salt was subjected to electrophoresis on a denaturing formaldehyde gel. The blot was hybridized with a probe internal to -4tNHXl ORF. An 75S ribosomal probe was used as a loading control.
  • AVPl wild-type gene using the double tandem enhancer of the 35S promoter (Topfer, R., et al, Nucl. Acid Res., 75:5890 (1987)).
  • AVPl encodes the pyrophosphate-energized vacuolar membrane proton pump from Arabidopsis (Zhen, R.G., et al, J. Biol. Chem., 272:22340-22348 (1997)).
  • AVPl gene is present in a single copy in the genome of Arabidopsis (Kim, Y., et al, Plant Physiol, 106:375- 382 (1994)), however, a sequence homologous, but not identical, to AVPl on chromosome one has been tentatively designated as ORF F9K20.2 on BAC F9K20 by the Arabidopsis Genome Initiative (AGI).
  • AGI Arabidopsis Genome Initiative
  • Transgenic plants that overexpress AVPl were generated using Agrobacterium-mediated plant transformation.
  • the transgenic AVPl was expressed using a double tandem enhancer of the 35S promoter of CaMV (Topfer, R., et ⁇ l, Nucl. Acid Res., 75:5890 (1987)).
  • 15 wild-type plants and 15 35SAVP1 transgenics were grown on a 24 hours-day cycle for 16 days. During this period plants were watered every 4 days with a diluted nutrient solution (1/8 M.S. salts). 200 mM NaCl was added to the watering solution at day 17 and at day 27 plants were watered with nutrient solution containing 250 mM NaCl. Plants were photographed 10 days after the last NaCl treatment.
  • hydroponic culture has been reported to increase plant growth and provide stress-free root and shoot material (Gibeaut, D.M., et al, Plant Physiol, 317-319 (1997)). Another important advantage of hydroponic culture is that it allows one to alter the ionic composition in a more accurate manner than in soil. These advantages could be important for the physiological studies of salt stress.
  • Wild type and 35 SAVP1 transgenic plants were hydroponically grown . Wild type and 35SAVP1 transgenic plants were grown in solution culture on a 12 hour light cycle for 65 days.
  • wild type and 35SAVP1 transgenic plants were grown in solution culture on a 12 hours light cycle for 20 days. Starting at day 21, NaCl concentration was increased in a stepwise fashion by 50 mM increments every 4 days. Plants were photographed after 4 days in the presence of 200 mM NaCl.
  • transgenic plants were challenged with a commercial seawater formula that contains the complete ionic composition present in the oceans.
  • 35SAVP1, 35SAtNHXl single and double transgenics were grown together with wildtype Arabidopsis thaliana plants under hydroponic conditions for four weeks in a short day illumination cycle (Gibeaut, D.M., et al, Plant Physiol, 317-319 (1997)). Then every four days an equivalent to 50mM NaCl of Tropic Marin sea salt (worldwide web at thatpetplace.com) is added.
  • This artificial sea water mix includes all of the other major and trace elements present in real sea water. Growth was monitored and ⁇ physiological parameters, such as sodium content and distribution may be monitored.
  • 35SAVP1, 35SAtNHXl single and double transgenics that were grown together with wildtype Arabidopsis thaliana plants under hydroponic conditions for four weeks in a short day illumination cycle (Gibeaut, D.M., et al, Plant Physiol, 317-319 (1997)) and then challenged every four days with an equivalent to 50mM NaCl of Tropic Marin sea salt were found to grow in the sea salt solution better than wildtype Arabidopsis thaliana plants.
  • the tomato homologues of AVPl and AtNHXl may be isolated and the corresponding chimeras to overexpress them may be constructed (Bidone, S., et ⁇ l, Eur. J. Biochem., 253: 20-26 (1998); Burbidge, A., et ⁇ l, J. Exper. Botany, 45:2111-2112 (1997)).
  • the genes may be introduced via Agrobacterium-mediated infection of calli. Tissue culture methods may be used to regenerate transformed plants. The plants may be assayed for salt tolerance as well as physiological parameters, such as sodium content and distribution.
  • Tomato transformation with 35S AVPl and with 35S AtNHXl constructs may be performed as described by McCormick (McCormick, S., Transformation of tomato with Agrobacterium tumefaciens. In: Plant Tissue Culture Manual, pp. 1-9, Lindsey, K. (ed.), Kluwer Academic Publishers, Dordrecht, The Netherlands (1991)).
  • TO and Tl transgenics may be analyzed by polymerase chain reaction and DNA gel blotting for the presence and copy number of AVPl and AtNHXl transgenes. Heterozygous and homozygous plants may be identified after segregation analysis of each transcend within Tl seeds.
  • Homozygous plants may be assayed for salt tolerance and as well as physiological parameters, such as sodium content and distribution.
  • Degenerated oligos based on conserved sequences present in AVPl and AtNHXl homologues may be designed. These degenerated primers may be used in RT-PCR reactions with cDNAs made from poly(A)+RNA from tomato. The resulting PCR fragments may be used as probes to isolate the full length cDNA clones from commercial libraries (i.e. Stratagene Cat#936004).
  • a similar strategy was described by Caboche and coworkers (Quesada, A., et al, Plant Mol. Biol, 34:165-274 (1997)). Results
  • Fig. 7 is a graph of Na + and K + content of wild-type plants (WT) versus representative transgenic plants overexpressing AVP-1 (1' and T) grown in salty soil.
  • Five wild-type plants (WT) and two AVP-1 overexpressing transgenic lines (1' and 2') were grown on soil in a 10 hour light/dark cycle. Plants were watered with a diluted nutrient solution (1/8 MS salts) for six weeks and subsequently watered with a diluted nutrient solution supplemented with NaCl. The concentration of NaCl began with 100 mM and was increased every four days by 50 mM. The photograph corresponds to plants at the tenth day in the presence of 300 mM NaCl.
  • Fig. 5 is a graph of the uptake of calcium into the 35SAVP-1 transgenic vacuolar membrane vesicles (squares) of 2' of Fig. 4 versus calcium uptake into vesicles obtained from wild type (WT) of Fig. 4.
  • Wild-type plants (open circles) and transgenic plants from line of Fig. 4 were grown hydroponically for nine weeks on a 10 hour light cycle.
  • Vacuolar membrane vesicles were added to buffer containing 250 mM sorbitol, 25 mM BTP-Hepes pH 8.0, 50 mM KC1, 1.5 nM MgSO 4 and 10 ⁇ M Ca 4" ".
  • Ca "1" uptake capability of wild type and transgenic vacuolar membrane vesicles was determined. It is well documented that Ca 4" enters the plant vacuole via a Ca 4"4' /!! 4" antiporter (K. S. Schumaker, H. Sze, Plant Physiol. 79, 1111-1117 (1985)). Furthermore, the genes encoding the Arabidopsis thaliana Ca ⁇ /H 4" antiporters CAXl and CAX2 have been isolated and characterized (K. D. Hirschi, R.-G. Zhen, K. W. Cunningham, P. A. Rea, G. R. Fink, Proc. Natl. Acad. Sci.
  • Fig. 5 shows that Ca uptake in the 35SAVP-1 transgenic vacuolar membrane vesicles is 36% higher than it is in vesicles obtained from wild type.
  • Application of the Ca 4"1" ionophore A23 lowered the 45Ca ++ counts to background levels demonstrating the tightness of the vesicles (Fig 8) (K. S. Schumaker, H. Sze, Plant Physiol. 79, 1111-1117 (1985)).
  • a model consistent with the enhanced drought and freeze tolerance of the transgenic plants overexpressing the AVP-1 gene is depicted in Figs. 9 A and 9B.
  • the model depicts how an increase in the number of AVP-1 pumps in the vacuole of transgenic plants can provide more H that will permit the secondary transporters to import greater amounts of cations into the lumen of the vacuoles. Higher amounts of cations confer a greater osmotic pressure (See, Fig. 14) that leads to a greater water retention capability endowing plants to withstand low soil water potentials.
  • Example 10 Double Transgenic Plant with 35SAVP1 and 35S AtNHXl
  • T3 35S AVPl plants may be used as females and T3 35S AtNHXl plants may be used as males.
  • Female plants may be hand-emasculated and anthers from freshly opened flowers of donor plants are harvested. With these anthers the emasculated plants may be pollinated by touching the anthers onto the stigmas. The pollinated flowers may be labeled and any remaining opened or unopened flowers from the same female plant removed to avoid any confusion at harvest.
  • the harvested seeds should be sterilized using a 50% sodium hypochloride solution and mixed vigorously for 5 minutes and rinsed with water thoroughly. The sterilized seeds may be stored in soft agar over night at 4°C.
  • the 35S AVPl construct has the neomycin phosphotransferase II gene that confers kanamycin tolerance in plants while the 35S AtNHXl construct has a modified hygromycin B phosphotransferase that confers hygromycin tolerance in plants.
  • the resistant seedlings may be transplanted into soil and to the hydroponic media to be tested for their salt-tolerant phenotype.
  • a transgenic Arabidopsis thaliana plant to overexpress the A. thaliana gain-of-function mutant gene AVPl-D may be engineered using the same double tandem enhancer of the 35A promoter described above (Topfer, R., et al, Nucl. Acid Res., 75:5890 (1997)). Plants overexpressing the gain of function mutant gene will likely show an enhanced phenotype.
  • the A. thaliana gain-of-function mutant gene AVPl-D may be subcloned into plasmid pRT103 carrying the 35S promoter and the polyadenylation signal of CaMV (Topfer, R., et al, Nucl. Acid Res., 75:5890 (1997)).
  • a Hindlll fragment containing the chimeric 35SAVP-D gene may be subcloned into pBIBhyg (Becker, D., Nucl. Acid Res., 75:203 (1990)).
  • the resulting T-DNA vector may be transformed into Agrobacterium tumefaciens strain GV3101 via electroporation, and may be used for subsequent vacuum infiltration of Arabidopsis thaliana ecotype Columbia (Bechtold, N., et al, C.R. Jeances Acad. Sci. Ser. Ill Sci. Vie, 376:1194-1199 (1993)). Integration imay be confirmed on Southern blots of T3 plants and expression monitored on Northern blots of positive T3 plants.
  • Example 11 Comparative Transport Study With Vacuoles From The Roots Of Wild- Type and 35SAVP1 Transgenic Plants
  • a study may be undertaken to determine if the vacuoles of 35S AVPl transgenic plants show a higher proton transport activity dependent on pyrophosphate. These determinations may be done with root and shoot tissues separately from plants grown hydroponically. The transgene could show a tissue-specific regulation despite the 35S promoter.
  • H 4" translocation may be assayed fluorimetrically using acridine orange (2.5 ⁇ M) as transmembrane pH difference indicator in assay media containing vacuole membrane-enriched vesicles as described by Rea and coworkers (Zhen, R.G., et al., J. Biol. Chem., 272:22340-22348 (1997)).
  • the assay media contains 300 - ⁇ M Tris-PPi, 50mK KCl, 2.5 ⁇ M acridine orange, 5mM Tris-Mes (pH 8.0).
  • Intravesicular acidification may be triggered with the addition of 1.3 mM MgSO4 and terminated with the addition of the protonophore FCCP at 2.5 ⁇ M. Fluorescence may be measured at excitation emission wavelengths of 495 and 540 nM, respectively, at a slit width of 5 nM (Zhen, R.G., et al, J. Biol. Chem., 269:23342-23350 (1994)). A further test to support that the H + translocation is AVPl driven may be the addition of the specific inhibitor aminomethylenediphosphonate (Zhen, R.G., et al, Plant Physiol, 104:153-159 (1994)).
  • Example 12 Determination Of The Na + /K + Ratios In Leaves And Stems Of The Transgenic Plants
  • Measurements may be taken to demonstrate that the transgenic plants described herein have an increased vacuolar capacity to sequester Na in their leaves cells or elsewhere.
  • To determine the Na + /K 4" ratios in leaves and stem S wild-type and 35S AVPl /35S AtNHXl double and single transgenics in hydroponic conditions (Gibeaut, D.M., et al, Plant Physiol, 317-319 (1997) may be grown. NaCl may be added to the growth media in a stepwise fashion starting with 50 mM up to 250mM (Apse, M., et al, Science, 255:1256-1258 (1999). At every point the rosette and the stems of the treated plants may be collected and their weight determined.
  • the samples should be dried out in an oven at 80°C and their dry weight determined.
  • the dry samples may be boiled in a determined volume of water and their Na 4" and K 4" contents determined via atomic absorption spectrophotometry (Apse, M., et al, Science, 255:1256-1258 (1999); Gaxiola, R, et al, Embo J., 77:3157-2164 (1992)).
  • Example 13 Determination Of Whether 35S A VP1 Transgenic Plants Are Larger Because Their Cells Are Larger Or Because They Have More Cells, Or Both The shoot meristems labeling index may be compared with one of the wild- type plants. Morphological and anatomical observations measuring and counting cells of leaves, roots and stems may be performed. To determine if 35S AVPl transgenic plants are larger because they have more cells, their shoot meristems labeling index may be compared with the one of wild-type plants. To measure the DNA synthesis or cell proliferation 5-Bromo-2'-deoxy- uridine (BrdU) that can be incorporated into DNA in place of thymidine may be used.
  • PrdU 5-Bromo-2'-deoxy- uridine
  • Cells that have incorporated BrdU into DNA may be detected using a monoclonal antibody against BrdU monoclonal antibody and an anti-mouse Ig-alkaline phosphatase as a second antibody.
  • the bound anti-BrdU monoclonal antibody may be visualized by light microscopy and the ratio between DAPI stained and BrdU positives established.
  • the protocol is a modification of the one published by Chiatante and coworkers (Levi, M., et al, Physiol. Plant. 77:68-72 (1987)) and the BrdU labeling and detection kit II from Boehringer Mannheim.
  • the plants may be exposed for different times to the BrdU labeling medium and then fixation, paraffin embedding and sectioning may be performed as described by Meyerowitz and coworkers (Drews, G., et al, Plant Mol. Biol. Rep., 5:242-250 (1988)).
  • leaf tissue fresh tissues may be embedded in 5% agarose and slice them with a microslicer.
  • seedlings may be fixed for 4hr in 50% ethanol, 5% acetic acid, and 3.7% formaldehyde at room temperature, dehydrated in graded ethanol series, permeate them with xylene, and infiltrate them with paraffin.
  • Eight-micrometer sections may be stained with 0.05% toluidine blue and cells may be counted under a microscope.
  • the method described by Greenberg and coworkers (Rate, et al, The Plant Cell, 77:1695-1708 (1999)) may be followed. Results
  • FI plants originated by crossing transgenic lines 1' and 2' displayed rosettes with larger leaves and increased amount of leaves than wild-type plants.
  • Fig. 10 depicts the foliage of wild type and transgenic (1* and ) Arabidopsis plants overexpressing AVP-1 grown at 20°C under all white fluorescent light in 16 hours light/8 hours dark period cycle. Leaves depicted were carefully sectored with a scalpel when plants initiated to bolt and then ordered by size for comparison purposes. While having larger and more leaves than the wild-type plants, the transgenics were not seen to have larger cell sizes. Such data is consistent with the hypothesis that the meristem is more active in transgenic AVP-1 overexpressers.
  • Dry weight of the transgenic Arabidiopsis plants grown hydroponically, as compared to similarly grown wild-type plants, further indicates that cell mass increases irrespective any increased water uptake by the plant.
  • An increase in dry mass weight was seen in both the root, rosette and stem structures as indicated in Table 1 below where values represent the mean values of six plants.
  • Increased meristematic activity and/or shoot organogenesis may be produced by increasing hormone availability together with AVP-1 overexpression.
  • Petunia explants were incubated on MS medium which consists of MS salts (Gibco BRL), 1 mg/L nicotinic acid, 1 mg/L pyrodoxin HC1, lmg/L thiamine, 100 mg/L myo-inositol, 3% sucrose, 1 mg/L 2,4-D(2,4-dichlorophenoxyacetic acid) and 0.5 mg/L 6- BA (6-benzylaminopurine).
  • the medium was solidified with 0.7% agar and was adjusted to pH 5.8 before autoclave. The culture was incubated at 25oC in the dark in a growth chamber.
  • Transgenic petunia explants (35-S AVP-1) demonstrated significantly enhanced callus induction at 6 weeks of incubation as demonstrated in Fig. 15.
  • Leave segments grown in appropriate medium are known to be capable of generating shoot growth.
  • a study was undertaken to determine the effect of overexpression of 35-S AVP-1 on shoot regeneration in Petunia leaves. Segments of leaves from regenerated transformed (35-S A VP-1) and control
  • Petunia were used as explants for shoot regeneration. The leaves were cut with a sharp surgical blade into about 1 cm wide pieces.
  • the explants were cultured in MS medium which included MS salts (Gibco), B5 vitamins (1 mg/L nicotinic acid, 1 mg/L pyrodoxin HC1, 1 mg/L-thiamine and 100 mg/L myo-inositol), 3% sucrose, 2 mg L 6- benzylaminopurine and 0.01 mg/L napthaleneacitic acid, 0.7% agar, pH 5.8.
  • the cultured segments were incubated at 25°C under cool white fluorescent light in a 16 h light/8 h dark period cycle.
  • Example 17 Effect of Overexpression of AVP- 1 on Shoot and Root Regeneration From Arabidopsis Cotyledons
  • Root and cotyledon (5 days old) explants from wild-type (WT) and transgenic (1' and 2') AVP-1 overexpressing Arabidopsis plants were placed in the shoot induction medium as discribed in Example. 16. As evidenced in Fig. 6, explants from the transgenic plants (1' and ) generated new structure earlier than wild type consistent with a higher merstematic compentence.
  • Example 19 Isolation Of Mutants In The Transporters Genetic approaches are very powerful in analyzing complex biological traits (Serrano, R., Crit. Rev. Plant Sci., 73:121-138 (1994)) Reverse genetics is a very important new tool for plant biologists. The generation of a good collection of tagged knockouts by Sussman and coworkers (Krysan, P., et al, Proc. Natl. Acad. Sci. USA, 93:8145-8150 (1996)) has open a very important avenue for the analysis of gene disruptions in Arabidopsis.
  • the Arabidopsis Knock-out Facility of the University of Wisconsin Madison may be used to search among the 60,480 Arabidopsis (ecotype WS) lines that have been transformed with the T-DNA vector pD991 for the presence of T-DNA inserts within -4tCLC-c, AtCLC-d, AVPl, _4tNHXl and their homologues.
  • the phenotypes of the above knock-outs will shed light towards the understanding of the physiological roles of these transporters in normal and stress conditions.
  • An initial characterization of the knockout plants includes testing for their salt tolerance and their Na + /K + ratios.
  • the generation of double knock-outs via crosses help to further understand the interaction among the transporters as well as the crosses with the 35S AVPl and the 35S AtNHXl transgenic plants.
  • PCR primers may be designed following the guidelines detailed in the University of Wisconsin web site. Tested primers may be sent to UW-Madison, where 62 PCR reactions that are sent to us for Southern blot analysis may be performed. Positive PCR products are sequenced. If the sequence reveals that there is a T-DNA inserted within the gene the gene specific primers are sent for another set of PCR reactions in order to determine which of the 9 possible pools of 225 contains the knockout. After identifying the pool of interest, 25 tubes of ⁇ seeds are screened for the individual plant carrying the T-DNA knock-out.
  • a pre-vacuolar compartment is a dynamic entity that detoxifies the cytoplasm from toxic cations and delivers its cargo either to the vacuole, or directly to the cell exterior.
  • Both the gefl chloride channel and Nhxl Na + /H + exchanger have been localized to the yeast pre-vacuolar compartment (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999)).
  • the behavior of the gefl-GFP chimera in yeast cells in vivo have been monitored indicating that its localization varies depending the environmental conditions. Furthermore, it has been shown that two of the four A.
  • thaliana CLC chloride channel genes CLC-c and -d are capable of suppressing gefl mutant phenotypes implying a similar localization (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998)).
  • GFP-chimeras For the constructions of the GFP-chimeras the soluble versions GFP with improved fluorescence in A. thaliana reported by Davis and Viestra (Davies, S.J., Viestra, R.D., "Soluble derivatives of green fluorescent protein (GFP) for use in Arabidopsis thaliana, http:/ / brindabella.rnrc-lmb.cam.ac.uk/IndexGFP.html (1998)) may be used. Two types of GFP-chimeras may be made, namely a set under the regulation of the native promoter and another set under the regulation of the 35 S promoter.
  • GFP green fluorescent protein
  • the resulting T-DNA vectors containing the GFP-chimeras are transformed into Agrobacterium tumefaciens strain GV3101 via electroporation, and used for subsequent vacuum infiltration of Arabidopsis thaliana ecotype Columbia (Bechtold, N., et al, C.R. Jeances Acad. Sci. Ser. Ill Sci. Vie, 376:1194-1199 (1993)).
  • HA hemagglutinin
  • Futcher and coworkers designed vectors containing the URA3 yeast gene flanked by direct repeats of epitope tags (HA) (Schneider, B.L., et al, Yeast, 77:1265- 1274 (1995)).
  • HA epitope tags
  • the tag-URA3-tag cassette may be amplified such that the resulting PCR fragment possess homology at each end to the gene of interest.
  • In vivo recombination in yeast can be then used to direct the integration of the PCR-chimera to the plasmid carrying the plant ORF of interest, transformants are selected by the URA 4" phenotype.
  • the URA3 gene can be "popped out" when positive transformants are grown in the presence of 5-fluoro-orotic acid.
  • the vector carrying the plant gene has a selection marker different than the URA3 gene.
  • Drought and freeze tolerant cultivars could provide new agricultural approaches in areas lost due to drought or minimal rainfall, as well as to provide farmers with protection from unanticipated frosts (freezing rain etc.). Such crops may also be able to be raised on soils considered too saline for wild type crops.

Landscapes

  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

A transgenic plant having increased meristematic activity and competence effectuating in larger leave, stem, flower, fruit and root structures comprising a polynucleotide sequence causing upregulated expression of vacuolar pyrophosphatase.

Description

ENHANCED MERISTEMATIC ACTIVITY AND COMPETENCE BY OVEREXPRESSION OF TONOPLAST PYROPHOSPHATASE
RELATED APPLICATIONS
To the extent possible under the law of the respective countries designated with respect to this PCT application, this application claims the benefit of U.S. Provisional Application No. 60/164,808, entitled "Proton Transporters and Uses in Plants" by Roberto Gaxiola, filed November 10, 1999, U.S. Patent Application No. 09/644,039 entitled "Proton Transporters and Uses in Plants" by Roberto Gaxiola, filed August 22, 2000, U.S. Provisional Application No. 60/226223, entitled "Drought/Freeze Resistant Transgenic Plants" by Roberto Gaxiola, filed August 18, 2000, and PCT Application No. PCT/USOO/30955, entitled "Stress-Resistant Oversized Transgenic Plants Capable of Growing in Salinized Soil", filed November 10, 2000, and the entire teachings of each application, to the extent possible under the appropriate foreign law, are incorporated herein by reference.
GOVERNMENT SUPPORT
The invention described herein was supported, in whole or in part, by grants GM52414, DK54214, DK43495, DK51509, DK34854 and GM35010 from the National Institutes of Health and by grant MCB9317175 from the National Science Foundation. The Government has certain rights in the invention. BACKGROUND OF THE INVENTION
1. Field of the Invention
The present invention relates to genetically-altered plants that are hardy with respect to environmental stresses, such as drought and/or freezing, oversized with respect to vegetative and/or sexual structure (as compared to their normal phenotypic counterparts), and capable of growing in media of high salinity. Such plants also display high meristematic activity, and increased in cellular division activity.
2. Background of the Related Art
The prospects for feeding humanity as we enter the new millennium are formidable. Given the every increasing world population, it remains a major goal of agricultural research to improve crop yield. It also is a major goal of horticultural research to develop non-crop plants which are hardier, such as ornamental plants, grasses, shrubs, and other plants found useful or pleasing to man.
Until recently crop and horticultural improvements depended on selective breeding of plants having desirable characteristics. Such selective breeding techniques, however, were often less than desirable as many plants have within them heterogenous genetic complements that do not result in identical desirable traits of their parents.
Advances in molecular biology have allowed mankind to manipulate the germplasm of animals and plants. Genetic engineering of plants entails the isolation and manipulation of genetic material (typically in the form of DNA or RNA) and the subsequent introduction of that genetic material into a plant. Such technology has led to the development of plants with increased pest resistance, plants that are capable of expressing pharmaceuticals and other chemicals, and plants that express beneficial traits. Advantageously such plants not only contain a gene of interest, but remain fertile. One area of interest of late in plant sciences has been the development of plants with improved stress resistance. In general, plants possess and maintain adaptive mechanisms to ensure survival during periods of adverse environmental conditions. Two commons stresses that plants commonly encounter are freezing and drought, both of which are associated with cellular dehydration. It is known that certain plants contain genes turned on by exposure to cold or prolonged periods of dehydration that encode for products that are directly or indirectly responsible for providing greater resistance to drought and/or freeze than many of their counterparts. A number of genes responsive to heat and water stress have now been characterized (See, e.g., U.S. Pat. Nos. 5,837,545, 5,071,962, 4,707,359). These genes are believed by many to produce certain proteins, such as "Water Stress Proteins", that are postulated to aid the plants survival. For example, certain plants exposed to stress conditions produce a hormone called abcisic acid (ABA) which helps plants close their stromata, thereby reducing the severity of the stress. Unfortunately, ABA is known to inhibit the formation of new leaves, to cause flowers and fruit to drop off, and to lead to a reduction in yield.
Most tropical plants are not believed to have evolved the ability to tolerate prolonged drought and/or freezing. Conversely, many temperate plants are known to have developed at least some ability to tolerate such conditions. The productivity of plant varieties in dry conditions, and after freeze, differ dramatically. For example, tobacco (Nicotiana spp.) produces fresh leaves that are highly sensitive to drought, and cannot be produced commercially in areas with a limited water supply and high degree of evaporation. In contrast to water stress, very little is known about proteins and genes which participate in freezing tolerance. However, it has been hypothesized that a major component of freeze tolerance may involve tolerance to dehydration (See, e.g., Yelenosky, G.C., Guy, L. (1989) Plant Physiol. 89: 444-451).
Another particular area of interest of late has been the development of plants with improved abilities to grow in salinized soil. Salinization of soil occurs when water supplies contain dissolved salt. Upon evaporation of water from such supplies, salts gradually accumulate in the soil. The progressive salinization of irrigated land compromises the future of agriculture in many of the most productive areas of our planet (Serrano, R., et al, Crit. Rev. Plant Scl, 73:121-138 (1994)). For example, arid regions offer optimal photoperiod and temperature conditions for the growth of most crops, but suboptimal rainfall. Artificial irrigation has solved the problem only in the short term as it has been found that soils in such environments frequently are rapidly salinized. To grow in salinized environments, plants must maintain a much lower ratio of Na+/K+ in their cytoplasm than that present in the soil, preventing the growth of a number of plants, including food crops.
Physiological studies suggest that salt exclusion in the root, and/or salt sequestration in the leaf cell vacuoles, are critical determinants for salt tolerance (Kirsch, M., et al, Plant Mol. Biol, 32:543-547 (1996)). Toxic concentrations of sodium chloride (NaCl) build up first in the fully expanded leaves where NaCl is compartmentalized in the vacuoles. Only after their loading capacity is surpassed, do the cytosolic and apoplasmic concentrations reach toxic levels, ultimately leading to loss of turgor, ergo plant death. It has been suggested that hyperacidification of the vacuolar lumen via the V-ATPase provides extra protons required for a Na+/H exchange-activity leading to the detoxification of the cytosol (Tsiantis, M.S., et al, Plant J., P:729-736 (1996)). Salt stress is known to increase both ATP- and pyrophosphate (PPi)-dependent H+ transport in tonoplast vesicles of, for example, sunflower seedling roots. Salt treatments also induce an amiloride-sensitive Na+/H+ exchange activity (Ballesteros, E., et al, Physiologia Plantarum, 99:328-334 (1997)). In the halophyte Mesembryanthemum crystallinum, high NaCl stimulates the activities of both the vacuolar H+-ATPase (V-ATPase) and a vacuolar Na+/H+ antiporter in leaf cells.
Yet another area of agricultural interest is to improve the yield of crop plants and to improve the aesthetic qualities of certain decorative plants. The yield of a plant crop, and the aesthetics of certain decorative plants, may be improved by growing plants that are larger than the wild-type plant in vegetative and/or reproductive structure, as well as improving the growth rate of plants.
A number of compounds have been touted in the prior art as improving the rate of plant growth and biomass production in useful components of the plant. For example., cyclodextrins applied to tissue culture media has been asserted to improve the rate of cell tissue culture growth by mechanisms including increased cell division (See, e.g., U.S. Patent No. 6,087,176). Certain plant growth hormones, such as auxins (which promote, among other things, root growth), cytokinins, and gibberellic acid (which promotes, among other things, stem growth) when applied to plant tissues are also known to promote increased cellular division. It also is known in the art that certain growth factors may be used to increase plant and/or plant flower size. Unfortunately, isolation and application of such growth hormones and factors is costly and time consuming.
U.S. Patent No. 5,859,338 discloses that modification of the CLAVATA1 gene of Arabidopsis thaliana causes a loss normal control of cell division in shoot apical meristems and floral meristems. In either case, the loss of control is said to cause an enlargement of the meristem. In flowers, the enlargement is said to lead to an increase in the number of floral organs, including an increase in carpel number, which increases fruit size and seed number. U.S. Patent No. 5,859,338 provides clavatal nucleic acids and proteins, and modified clavatal nucleic acids and proteins, to result in altered meristem phenotypes.
U.S. Patent No. 5,750,862 discloses a method for controlling plant cell growth comprising modulating the level and or catalytic activity of a cell cycle control protein in the plant. In particular the patent discloses that by elevating levels of the protein p34crfc2 , regeneration into plants of single or groups of cells can be facilitated. Control of regeneration may also be effectuated by control of regulatory elements which indirectly result in modulation of p34Cfifc2 activity.
A need, therefore, exists for plants having improved stress resistance to drought and/or freeze, possessing larger size attributes than wild-type counterpart varieties, and having increased tolerance to salt in the soil in which they are growing, and which provide for increased biomass of useful components.
SUMMARY OF THE INVENTION
The present invention discloses a transgenic plant having upregulated expression of vacuolar pyrophosphatase. It has been found that plants displaying such upregulated activity are generally larger than wild-type counterparts, demonstrate improved stress resistance to drought and/or freeze, have increased tolerance to salt in the media in which they are growing, and display higher meristematic activity (cell division) leading to greater biomass in certain plant parts as compared to wild type plants.
Any suitable exogenous nucleic acid molecule which alters expression of vacuolar pyrophosphatase in the plant can be used to transform the transgenic plants in accord with the present invention. The exogenous nucleic acid can comprise nucleic acid that encodes a vacuolar pyrophosphatase protein (an exogenous vacuolar pyrophosphatase), such as AVP1, a functional portion thereof (peptide, polypeptide), or a homologue thereof, and/or nucleic acid that alters expression of the endogenous vacuolar pyrophosphatase of the plant into which the exogenous nucleic acid is introduced. By "exogenous nucleic acid" it is meant a nucleic acid from a source other than the plant cell into which it is introduced, or into a plant or plant part from which the transgenic part was produced. The exogenous nucleic acid used for transformation can be RNA or DNA, (e.g., cDNA, genomic DNA). In addition, the exogenous nucleic acid can be circular or linear, double-stranded or single-stranded molecules. Single-stranded nucleic acid can be the sense strand or the anti-sense strand. By a "functional portion" of a nucleic acid that encodes a vacuolar pyrophosphatase protein it is meant a portion of the nucleic acid that encodes a protein or polypeptide which retains a functional characteristic of a vacuolar pyrophosphatase protein. In a particular embodiment, the nucleic acid encodes ANP1, a functional portion or a homologue thereof. The AVP1 nucleic acid may be obtained, for example, from Arabidopsis or any other plant, or synthetically synthesized. Nucleic acid that alters expression of the endogenous vacuolar pyrophosphatase of the plant into which the exogenous nucleic acid is introduced includes regulatory sequences (e.g., inducible, constitutive) which function in plants and antisense nucleic acid. Examples of regulatory sequences include promoters, enhancers. The nucleic acid can also include, for example, polyadenylation site, reporter gene and/or intron sequences and the like whose presence may not be necessary for function or expression of the nucleic acid but can provide improved expression and/or function of the nucleic acid by affecting, for example, transcription and/or stability (e.g., of mRNA). Such elements can be included in the nucleic acid molecule to obtain optimal performance of the nucleic acid. The nucleic acid for use in the present invention can be obtained from a variety of sources using known methods. For example, the nucleic acid encoding a vacuolar pyrophosphatase (e.g., AVP1) for use in the present invention can be derived from a natural source, such as tobacco, bacteria, tomato or corn. In one embodiment, the nucleic acid encodes a vacuolar pyrophosphatase that corresponds to a wild type of the transgenic plant. In another embodiment, the nucleic acid encodes a vacuolar pyrophosphatase that does not correspond to a wild type of the transgenic plant. Nucleic acid that alters expression of the endogenous vacuolar pyrophosphatase of the plant into which the exogenous nucleic acid is introduced (e.g., regulatory sequence) can also be chemically synthesized, recombinantly produced and/or obtained from commercial sources.
A variety of methods for introducing the nucleic acid of the present invention into plants are known to those of skill in the art. For example, Agrobacterium- mediated plant transformation, particle bombardment, microparticle bombardment (e.g., U.S. Patent No. 4,945,050; U.S. Patent No. 5,100,792) protoplast transformation, gene transfer into pollen, injection into reproductive organs and injection into immature embryos can be used. The exogenous nucleic acid can be introduced into any suitable cell(s) of the plant, such a root cell(s), stem cell(s) and/or leaf cell(s) of the plant.
Any suitable plant, including angiosperms, monocots and dicots, and gymnosperms, and algae can be used to produce the transgenic plants, tissue cultures or cell cultures of the present invention. For example, tomato, corn, tobacco, rice, sorghum, cucumber, lettuce, turf grass, ornamental (e.g., larger flowers, larger leaves) and legume plants can be transformed as described herein to produce the transgenic plants of the present invention. In addition, the transgenic plants of the present invention can be grown in any medium which supports plant growth such as soil or water (hydroponically).
A transgenic plant of the present invention is preferably tolerant to high salt concentrations in soil. By the term "salt" it is meant to include any salt, that is a compound formed when hydrogen of an acid is replaced by a metal or its equivalent, and includes, without limitation, salts comprising monovalent and divalent toxic cations, NaCl, KC1, CaCl2, MgCl, CdCl, ZnCl, and sulfide salts.
Salt tolerance may be introduced into a plant of the present invention by transforming plant cells with exogenous nucleic acid which alters the expression of vacuolar pyrophosphatase in the plant such that expression is upregulated. Any suitable vacuolar pyrophosphatase, several of which have been cloned, can be used in the compositions and methods of the present invention (e.g., Sarasian, Z., et al, Proc. Natl. Acad. Scl, USA, 89:1775-1719 (1992); Jenslerchl, et al, Molec. Biol, 29: 833-840 (1995); Kim, Y., et al, Plant Physiol, 106:375-382 (1994)). In a particular embodiment, the present invention relates to a transgenic plant which is tolerant to salt comprising an exogenous nucleic acid construct which is designed to overexpress AVP1 (Sarasian, Z., et al, Proc. Natl. Acad. Sci., USA, 59:1775-1779 (1992)). Transformation of the plant cells may be carried out in a whole plant, seeds, leaves, roots or any other plant part. Such transgenic plants are preferably altered such that they grow in a concentration of salt that inhibits growth of a corresponding non-transgenic plant. Transgenic progeny of the transgenic plants, seeds produced by the transgenic plant and progeny transgenic plants grown from the transgenic seed, which are also the subject of the present invention, advantageously carry such salt tolerant trait. Plants may be regenerated from transformed cells to yield transgenic plants, which may be screened for certain levels of salt tolerance. In a preferred embodiment, the exogenous nucleic acid encodes AVP1, or a homologue thereof. Preferably expression of the vacuolar pyrophosphatase in the plant is enhanced to an extent that the transgenic plant is tolerant to sodium chloride (NaCl) when the NaCl concentration is from about 0.2M to about 0.3M. A transgenic plant capable of growing in salt water may also be produced by introducing into one or more cells of a plant nucleic acid which upregulates expression of vacuolar pyrophosphatase in the plant to yield transformed cells. As used herein, "salt water" includes water characterized by the presence of salt, and preferably wherein the concentration of salt in the water is from about 0.2M to about 0.4M. In one embodiment, salt water refers to sea water.
The transgenic plants of the present invention can also be used to produce double transgenic plants which are tolerant to salt (about 0.2M to about 0.4M salt concentration). In one embodiment, the present invention relates to a double transgenic plant which is tolerant to salt comprising one or more plant cells transformed with exogenous nucleic acid which alters expression of a vacuolar pyrophosphatase and an Na+/H+ antiporter in the plant. The vacuolar pyrophosphatase in an advantageous construct is AVP1, or a homologue thereof, and the Na+/H+ antiporter is AtNHXl, or a homologue thereof. The present invention also encompasses transgenic progeny of the double transgenic plant, as well as seeds produced by the transgenic plant and a progeny transgenic plant grown from the seed.
Drought and/or freeze tolerance may also be introduced into plants by transforming plant cells with exogenous nucleic acid which alters the expression of vacuolar pyrophosphatase in the plant such that such expression is upregulated. In a preferred embodiment there is provided a substantially drought and/or freeze resistant transgenic plant which comprises a genome having one or more exogenously introduced vacuolar H+-translocating pump genes. A particularly preferred fertile transgenic plant eliciting drought and/or freeze tolerance, as well as the ability to grow in saline soils, comprises an isolated exogenous chimeric DNA construct encoding vacuolar H+- translocating pump, preferably operably linked to a promoter, such as the 35-S promoter or any other strong promoter, including, without limitation, tissue specific promoters. The transgenic plant may contain a polynucleotide sequence comprising an exogenous tonoplast pyrophosphate FT1" pump gene operably linked to a promoter. In yet another particularly preferred drought and/or freeze resistant transgenic plant having the capacity to grow in saline soils, the polynucleotide sequence comprises an exogenous tonoplast pyrophosphate H* pump gene operably linked to a double tandem enhancer of the 35S promoter. A particularly preferred tonoplast pyrophosphate H1" pump gene is the AVP1 gene.
Upregulation of expression of vacuolar pyrophosphatase by the methods described above may also be used to provide a plant having larger vegetative and/or sexual organs than wild type counterpart plants. That is, the present invention provides for a method of increasing the yield of a plant comprising introducing into one or more cells of a plant nucleic acid which alters expression of vacuolar pyrophosphatase in the plant to yield transformed cells, thereby increasing the yield of the plant. The method can further comprise regenerating plants from the transformed cells to yield transgenic plants and selecting a transgenic plant which is larger than its corresponding wild type plant, thereby producing a transgenic plant which is larger than its corresponding wild type plant. Also encompassed by the present invention is a method of making a transgenic plant (e.g., an ornamental plant) having increased flower size compared to its corresponding wild type plant comprising introducing into one or more cells of a plant nucleic acid which alters expression of vacuolar pyrophosphatase in the plant to yield transformed cells. Upregulation of expression of vacuolar pyrophosphatase by the methods described above may also be used to provide a plant with meristematic activity cell division rate which is enhanced over wild-type counterpart plants. 'ι As would be recognized by one of ordinary skill in the art, meristems are central to higher plant development, as almost all post-embryonic organs, including roots, leaves, flowers and axillary meristems and cambium are initiated by either shoot or root meristems. Increased meristematic activity results in higher biomass in one or more aspects of plant structure, as evidenced by dry weight of plant structure, root structure as well as stem structure. Increased meristemic activity is hypothesized to result in increased rate of shoot regeneration in root, leaf, hypocotyl, and cotyledon explants, and increased overall plant growth rate.
The present inventor has discovered that overexpression of a pyrophosphate driven proton (H+) pump at the vacuole leads to a greater proton pumping capacity that results in a greater ion uptake into the vacuoles that lowers the osmotic potential of the cells, and also leads to an increase in the capacity of plant cells to divide and multiply. As would be understood by one of ordinary skill in the art, such finding can have great commercial importance, e.g., reducing time for wood, corn etc. production by transforming cells so as to overexpress such pumps, and enhancing shoot regeneration capacity in plants with poor or slow regeneration capacity, such as woody plants, crops, e.g. co , and ornametals e.g., orchids. Overexpression so as to produce such enhanced cell division and multiplication may be performed using any of the construct described herein. While a number of inducible promoters and tissue specific promoters may be used to trigger overexpression of the gene and/or homologues of the gene, a preferred construct includes a tonoplast pyrophosphate driven H+ pump gene (AVP-T) operably linked to a chimeric promoter (e.g., double tandem enhancer of 35S promoter) designed to overexpress A VP- 1.
There is also disclosed in the present invention novel gene cassettes including cassettes comprising a tonoplast pyrophosphate driven H1" pump gene operably linked to a chimeric promoter. A novel gene cassette comprising an exogenous tonoplast pyrophosphate driven H pump gene operably linked to a promoter, as well as novel coding sequences comprising an exogenous tonoplast pyrophosphate driven H pump gene operably linked to a double tandem enhancer of the 35S promoter. Preferably such coding sequence is designed to overexpress ANP1.
There is also disclosed in the present invention novel expression vectors including an expression vector containing a polynucleotide sequence comprising a exogenous tonoplast pyrophosphate driven H1" pump gene operably linked to a double tandem enhancer of the 35S promoter and further operatively linked to a multiple cloning site, and an expression vector containing a polynucleotide sequence comprising a exogenous tonoplast pyrophosphate driven T pump gene operably linked to a double tandem enhancer of the 35S promoter and further operatively linked to a heterologous coding sequence.
It is recognized by the present inventor, that the disclosed invention may have application to any plant, including, without limitation, crop plants, ornamental plants, grasses, shrubs, or any other plant found useful or pleasing to man, including having application to monocots, dicots, angiosperms, gymnosperms, and algae.
BRIEF DESCRIPTION OF THE DRAWINGS
The above description, as well as further objects, features and advantages present invention will be more fully understood with reference to the following detailed desci when taken in conjunction with the accompanying drawings, wherein: Fig. 1A is an overhead view of representative (out of 10 plants each) wild type (WT) and two independent transgenic lines (1' and 2') grown hydroponically for seven weeks on a 10 hour light/dark cycle;
Figs. 1B(1), 1B(2) and 1B(3) are a photomicrographs of the root and root hairs of representative five day old seedlings obtained from representative WT, 1' and 2' of Fig. 1A grown parallel to the surface on vertical plant nutrient agar plates;
Fig. 1C is an immunoblot of membrane fractions isolated from wild type (WT) and two independent transgenic lines (1' and 2') overexpressing AVP-1;
Fig. 2 is an overhead view of a representative wild type plant (WT) versus representative transgenic plants overexpressing AVP-1 (1' and 2') after exposure to 7 days of water deficit stress.
Fig. 3 is a perspective view of wild-type plants (WT) versus representative transgenic plants overexpressing AVP-1 (1' and T) grown in salty soil.
Fig. 4 A is a schematic representation of a working model of the transporters involved in sodium sequestration at the yeast pre-vacuolar compartment; Nhxl (Na+/H+ antiporter), Vmal (vacuolar membrane H+-ATPAse), Gefl (yeast CLC chloride channel), Enal (plasma membrane Na+-ATPase).
Fig. 4B is a schematic representation of a working model of the transporters involved in sodium sequestration at the yeast pre-vacuolar compartment shown in Fig. 4A, which also includes Avpl (A. thaliana vacuolar pyrophosphate- energized proton pump). Fig. 5A and Fig. 5B are bar graphs showing the intracellular Na+ and K+ contents of wild-type yeast strains and of yeast strains carrying various mutations affecting sodium tolerance wherein the values are the mean of two determinations, and the bars represent the standard deviations. Fig. 6 is an overhead view of shoot regeneration from root and cotyledon explants from wild-type (WT) and AVP-1 overexpressing (l1 and ) Arabidopsis plants, cultured in the SIM medium of Fig. 13.
Fig. 7 is a bar graph of Na+ and K+ content of wild-type plants (WT) versus representative transgenic plants overexpressing AVP-1 (1' and ) grown in salty soil. Fig. 8 is a. graph of the uptake of calcium into the 35SAVP-1 transgenic vacuolar membrane vesicles (squares) of 2' of Fig. 3 versus calcium uptake into vesicles obtained from wild type (WT) of Fig. 3.
Figs. 9 A and 9B are illustrations demonstrating the 35SAVP-1 theorized mechanism for a higher accumulation of solids into vacuoles via a proton driven function versus that of WT vacuoles.
Fig. 10 is an overhead view of the leave foliage of wild type versus transgenic (1' and ) AVP-1 overexpressing Arabidopsis plants with leaves positioned with respect to one another according to age.
Figs. 11 A and 11B are overhead views of watered (distilled water) leaves from wild type and transgenic (1' and 2') Arabidopsis plants overexpressing AVP-1 demonstrating growth of root structures.
Fig. 12 is an overhead view of shoot regeneration in representative wild type petunia leave cuttings (WT) versus representative transgenic petunia plant leave cuttings overexpressing AVP-1 (35-S AVP-1). Fig. 13 is an overhead view of shoot regeneration from 5-day old cotyledons placed in SIM induction medium obtained from wild type (WT) and AVP-1 overexpressing (V and 2') Arabidiopsis plants.
Fig. 14 is bar graph of osmotic potential of fully hydrated leaves from WT and two AVP-1 overexpressing lines (1 ' and 2') from Arabidopsis plants. Fig. 15 is an overhead view of petunia explants incubated on MS medium showing callus induction from the explants after six weeks of incubation. DETAILED DESCRIPTION OF THE INVENTION
Since plant vacuoles constitute 40 to 99% of the total intracellular volume of a mature plant cell, changes in the size of the vacuole have dramatic effects upon cell size (R. G. Zhen, E. J. Kim, P. A. Rea, in The Plant Vacuole . (Academic Press Limited, 1997), vol. 25, pp. 298-337). The volume of the vacuole is controlled by ion and water fluxes mediated by pumps and transporters. In plants the driving force that triggers the movement of ions, solutes and water across membranes is a proton gradient. The activity of the vacuolar Ff^-pumps results in luminal acidification and the establishment of a H electrochemical potential gradient across the vacuolar membrane, which powers the secondary active transporters of inorganic ions, sugars, and organic acids. The activity of these transporters modulates cellular pH and ion homeostasis and leads to the accumulation of solutes required to generate the osmotic potential that promotes vacuolar expansion (H. Sze, X. Li, M. G. Palmgren, The Plant Cell 11, 677-689 (1999)).
There are three distinct pumps that generate proton electrochemical gradients. One at the plasma membrane that extrudes T from the cell (PM H+-ATPase) and two at the vacuolar membrane or other endomembrane compartments that acidify their lumen (the vacuolar type H+-ATPase and H+-PPase) (R. A. Leigh, in The Plant Vacuole L. a. Sanders, Ed. (Academic Press, San Diego, California, 1997), vol. 25, pp. 171-194.).
Previous work has shown that a decrease in the levels of the A subunit of the vacuolar H+-ATPase of carrot, using an antisense construct, resulted in a plant with reduced cell expansion and altered leaf morphology (J. P. Gogarten, et al., 77*e Plant Cell 4, 851-864 (1992)). The present inventor has hypothesized that an increased supply of H* into the vacuole could accelerate cell expansion. Recently, based on the theory that as the availability of protons in the vacuolar function of ion accumulation, it has been hypothesized by the same inventor that accumulation of solids in the vacuoles might be useful to protect against draught and to provide for a more freeze resistant plants.
The present inventor has recognized that plants have a number of vacuolar H^-translocating pumps, and that by upregulating their activity, increasing their expression, upregulating their transcription and/or translation, or increasing their copy number that one can increase accumulation of solids in the vacuole due to an increase in the availability of protons in the vacuoles. The inventor tested this hypothesis by increasing the copy number of the vacuolar H -translocating pump, the inorganic pyrophosphatase or V-PPase that consists of a single polypeptide (R. G. Zhen, E. J. Kim, P. A. Rea, in The Plant Vacuole . (Academic Press Limited, 1997), vol. 25, pp. 298-337). In Arabidopsis the V-PPase encoded by the AVP-1 gene is capable of generating a H+ gradient across the vacuole membrane (tonoplast) similar in magnitude to that of the vacuolar H+-ATPase (V. Sarafian, Y. Kim, R. J. Poole, P. A. Rea, Proc. Natl. Acad. Sci. 89, 1775-1779 (1992)). As would be understood by one of ordinary skill in the art, similar genes in other plants should function in a similar manner.
It is known that H+-PPase is the main proton pump of vacuolar membranes in growing tissue. The later may be due to the fact that in growing tissue, nucleic acids, DNA, RNAs, proteins and cellulose etc. are actively being synthesized for the construct of the new cells, and as a result, a large amount of PPi is produced as a by-product of these metabolic processes. The energy stored in the PPi molecule may be transformed into a different source of energy, namely a H+-gradient across the vacuolar membrane. This H - gradient constitutes the driving force for the vacuolar accumulation of solutes that generate the sufficient osmotic differential that enables the plant cell to initiate growth. While the present invention is not limited in any manner to any particular hypothesis for the increased growth effects seen, the present inventor has hypothesized that in transgenic plants overexpressing AVP-1 that the greater number of H+-PPjases has a positive effect on the velocity of the generation of the H* gradient, rendering a more active meristem. In one embodiment, a construct comprising a vacuolar pyrophosphatase gene operably linked to a promoter designed to overexpress the vacuolar pyrophosphatase (e.g., an expression cassette) is used to produce the transgenic plants of the present invention. As used herein the term "overexpression" refers to greater expression activity than occurs in the absence of the construct. In a particular embodiment, a construct comprising an AVPl gene operably linked to a chimeric promoter designed to overexpress AVPl is used to produce the transgenic plants of the present invention. More particularly, the present invention relates to a construct wherein the A VP1 gene is operably linked to a double tandem enhancer of a 35 S promoter.
The transgenic plants of the present invention may find utility other than those associated with the food value or ornamental value, industrial value such as, for example, wood production. For example, the transgenic plants of the present invention may uptake different or more ions than their wild-type counterparts. As discussed below, studies with mutant yeast strains (enal) demonstrates that H+-translocating pumps at the vacuole plays an important role in cation detoxification in higher plants (the plant components involved in an intracellular cation detoxification system being identified by complementing salt-sensitive mutants of the budding yeast Saccharomyces cerevisiae). Transgenic plants and/or progeny thereof comprising exogenous nucleic acid which alters expression of vacuolar pyrophosphatase in the plant in accord with such studies may be used to bioremediate soil and growth medium. Such plants can be used to remove cations (e.g., monovalent and/or divalent cations) from a medium which can support plant growth (e.g., soil, water). For example, transformed plants of the present invention can be used to remove sodium (Na), lead (Pb), manganese (Mn) and/or calcium (Ca) ions from a medium which supports plant growth.
To demonstrate the effect that an increased supply of H+ into the vacuole would have on resistance to drought and/or freeze, and tolerance to salt growth, as well as size of the plants, the present inventor generated transgenic plants containing extra copies of a vacuolar proton pump, A VP-1.
Arabidopsis thaliana plants were transformed with constructs containing the AVP-1 gene. Transgenic lines containing extra copies of this gene were then isolated. The AVP-1, open reading frame was cloned into the Xmal site of a modified pRT103 [R. Topfer, V. Matzeit, B. Gronenborn, J. Schell and H-H. Steinbiss, Nucleic acid Research 15, 5890 (1987)]. This vector contains a tandem repeat of the 35-S promoter. A Hindlll fragment containing the 35-S tandem promoter, AVP-1 ORF and the polyadenylation signal was subcloned into the Hindlll site of the pPZP212 vector [ P. Hajdukiewicz, Z. Svab and P. Maliga, Plant Molecular Biology 25, 989-994 (1994)]. Agrobacterium- mediated transformation was performed via vacuum infiltration of flowering Arabidopsis thaliana (ecotype Columbia). Transgenic plants were selected by plating seeds of the transformed plants on plant nutrient agar plates supplemented with 25 mg/liter kanamycin. Plants were subsequently selected for two generations to identify transgenic plant homozygous for the transgene.
Fig. 1A is an overhead picture of representative (out of 10 plants each) wild type (WT) and two independent transgenic lines (1' and 2') grown hydroponically for seven weeks on a 10 hour light/dark cycle. As can be seen in Fig. 1 A, a visual comparison of transgenic line T, which expresses the AVP-1 protein at highest level, transgenic line 1 ', and wild type (WT), demonstrates that the amount of AVP-1 correlates with the size of the plants. The mass of the transgenic plants was found to be greater than that of wild type. The dry weight of the entire transgenic plants, measured after 24 hours at 75°C (n = 4), for transgenic lines 1' and 2' was found to be 1.5 and 3 times greater then that of wild-type (WT).
Fig. 1B(1), Fig. 1B(2) and Fig. 1B(3) are photomicrographs (magnification: times 40; bar length on photograph = 2mm) of the root and root hairs of representative five day old seedlings obtained from representative WT, 1 'transgenic and T transgenic of Fig. 1A grown parallel to the surface on vertical plant nutrient agar plates. Seedlings of both transgenic lines 1' and showed root hairs with an average length 40 and 70% larger than wild-type (WT) root hairs (Fig. IB) (Root hair length along the whole root was determined from five members of each set of seedlings. An average of 80 root hairs per plant were measured). The length of the root hairs is correlated with the size of the vacuole, so the increased size of the root hair is likely to result from increased vacuolar volume. This compares with the Arabidopsis mutant rdh3 which has been reported to have reduced vacuolar volume and is a short plant with abnormally short root hairs (M. E. Galway, J. W. J. Heckman, J. W. Schiefelbein, Planta 201, 209-218 (1997)). It is recognized that the increased root structure will have a positive impact on soil erosion, nitrogen fixation in legumes, and will aid in water and nutrient uptake by the plant. Fig. IC is an immunoblot of membrane fractions isolated from wild type
(WT) and two independent transgenic lines (1' and ) overexpressing AVP-1. Total membrane fractions were isolated from shoots of eight week old wild type (WT) and AVP-1 transgenic plants (1' and 2') grown in a hydroponic media for 8 weeks. Homogenate of plant shoots were sequentially centrifuged for 15 and 30 min at 8,000 and 100,000 rpms respectively. The 100 mg membrane pellet was re-suspend in 10 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 10% glycerol and 1 mM PMSF Protein (10 ug) was separated on a 10% SDS-PAGE, electroblotted and immunostained with antibodies raised against a KLH-conjugated synthetic peptide corresponding to the putative hydrophilic loop IV of the AVP-1 protein (V. Sarafian, Y. Kim, R. J. Poole, P. A. Rea, Proc. Natl. Acad. Sci. 89, 1775-1779 (1992)). PPase was detected by chemiluminescence. Fig. IC illustrates that the transgenic lines (1' and 2') express AVP-1 protein at higher levels than the wild type (WT) (that is, 1' = 1.6 fold increase and = 2.4 fold increase over WT). As wheat that has been deprived of water is rendered more drought tolerant by an increase in cell K+ content (from 100 mM to 300 mM) (S. Gupta, G. Berkowitz, P. Pier, Plant Physiol 89, 1358-1365 (1989)), it is hypothesized (but the invention is not hereby limited by such theory) that the increased drought resistance of the AVP-1 transgenic plants may be a consequence of their higher vacuolar concentration of potassium that results in a increased water retention capability. Laboratory tests appear to confirm this.
Fig. 2 is an overhead view of a representative wild type plant (WT) versus representative transgenic plants overexpressing AVP-1 (1' and 2') after exposure to 7 days of water deficit stress. Wild type and transgenic plants overexpressing AVP-1 (Fig 3 A) were tested for drought tolerance (24°C). After 7 days of water deficit stress wild type (WT) plants withered, whereas plants from both 35S AVP-1 transgenic lines (1' and 2') were turgid and alive. Furthermore, when the drought stressed plants were then watered, transgenic plants pursued normal growth, bolted and set seeds, whereas wild type plants died. The relative water content of leaves from wild type and 35SAVP-1 transgenic plants were determined along the water deficit stress, demonstrating increased water retention by the transgenic lines as compared to the WT plants.
Fig. 14 is bar graph of osmotic potential of fully hydrated leaves from wild-type (WT) and two AVP-1 overexpressing lines (1' and 2') from Arabidopsis plants. The decreased osmotic potential in leaves of transgenic plants measured at a constant water content is consistent with the contention that AVP-1 overexpression results in increased solute accumulation, and therefore enhancing water retention capability.
While not illustrated in the accompanying illustrations, similar results may be seen with respect to freeze challenge (< 0°C) over a 24 hour or more period for a number of plant species. While not limited to such hypothesis, transgenic plants overexpressing AVP-1 (1' and T) are believed to provide enhanced protection from freeze as compared to wild type (WT) plants due to the higher amounts of cations in the vacuoles. Higher amounts of cations confer a greater osmotic pressure that leads to a greater water retention capability endowing the plants not only with the ability to withstand low soil water potentials, but also providing greater protection from freezing that leads to significant desiccation of the plants. Fig. 3 is a perspective view of wild type plants (WT) versus representative transgenic plants overexpressing AVP-1 (1' and 2') grown in salty soil. Five wild-type plants (WT) and five of the two AVP-1 overexpressing transgenic lines (1' and 2') were grown on soil in a 10 hour light/dark cycle. Plants were watered with a diluted nutrient solution (1/8 MS salts) for six weeks and subsequently watered with a diluted nutrient solution supplemented with NaCl. The concentration of NaCl began with 100 mM and was increased every four days by 50 mM. The illustrations in Fig. 3 corresponds to representative plants at the tenth day in the presence of 300 mM NaCl. Fig. 3 illustrates that the two AVP-1 plant types (1' and 2') were significantly hardier in salty soil as compared to wild-type plants. The fact that genetically engineered Arabidopsis thaliana plants that overexpress either AVPl (the pyrophosphate-energized vacuolar membrane proton pump, this work) or AtNHXl (the Na+/H+ antiporter, (Apse, M., et al, Science, 2&5:1256-1258 (1999)) and this work) are capable of growing in the presence of high NaCl concentrations strongly supports the strategy described herein. A double transgenic plant would be expected to demonstrate a further enhanced salt-tolerant phenotype. These Arabidopsis thaliana transporters or their counterparts may perform similar function in important agricultural crops. The increased size of 35S AVPl Arabidopsis transgenic plants also contribute to potential yield increases in genetically engineered crops. A Working Model of Cation Homeostasis in Plant Organdies While the present invention is not limited to any particular hypothesis, the present inventor have developed a working model for cation homeostasis in plant organelles which may explain the unexpected results discovered with respect to the transgenic plants disclosed herein.
In plants, most of the transport processes are energized by the primary translocation of protons. H+-translocating pumps located at the plasma membrane and tonoplast translocated FT1" from the cytosol to extracellular and vacuolar compartments, respectively (Rea, P.A., et al, Tonoplast Adenosine Triphosphate and inorganic Pyrophosphatase. In: Methods Plant Biochem., pp. 385-405, Academic Press Limited, London (1990)). The plant tonoplast contains two tf'-translocating pumps; the V-ATPase and the inorganic pyrophosphatase or V-PPase. Their action results in luminal acidification and the establishment of a H+ electrochemical potential gradient across the tonoplast (Davies, J.M., et al, The Bioenergetics of Vacuolar H+ Pumps. In: Plant Vacuole, pp. 340-363, Leigh, R.A., Sanders, D. (eds.), Academic Press, San Diego (1997)). The vacuolar membrane is implicated in a broad spectrum of physiological processes that include cytosolic pH stasis, compartmentation of regulatory Ca , sequestration of toxic ions such as Na+, turgor regulation, and nutrient storage and retrieval. The vacuole constitute 40 to 99% of the total intracellular volume of a mature plant cell. The vacuolar proton pumping pyrophosphatase is a universal and abundant component of plant tonoplast capable of generating a steady-state trans-tonoplast H* electrochemical potential similar or greater than the one generated by the V-ATPase (Rea, P.A., et al, Tonoplast Adenosine Triphosphate and Inorganic Pyrophosphatase. ϊn:Methods Plant Biochem., pp. 385-405, Academic Press Limited, London (1990)). Pyrophosphate (PPi) is a by-product in the activation or polymerization steps of a wide range of biosynthetic pathways and in plants serves as an alternative energy donor to ATP for sucrose mobilization via sucrose synthetase, for glycolysis via PPi: fructose-6- phosphate phosphotransferase and for tonoplast energization via the vacuolar proton pumping pyrophosphatase (Stitt, M., Bot. Acta 111:167-175 (1998)).
Most of intracellular organelles, including clathrin-coated vesicles, endosomes, Golgi membranes and vacuoles have acidic interiors (Xie, X. S., et al, J. Biol. Chem., 264:18870-18873 (1989)). This acidification is mediated by a proton-translocating electrogenic ATPase and in plant vacuoles also via a pyrophosphate-driven proton pump V-PPase (Davies, J.M., et al., The Bioenergetics of Vacuolar H+ Pumps. In: Leigh R.A., Sanders, D., (eds) The Plant Vacuole, pp. 340-363, Academic Press, San Diego (1997); Zhen, R.G., et al., "The Molecular and Biochemical Basis of Pyrophosphate-Energized Proton Translocation at the Vacuolar Membrane Academic Press Limited (1997)). There exists a requirement of anion transport to maintain net electroneutrality (al-Awqati, A., Curr. Opin. Cell. Biol, 7:504-508 (1995)).
Fig. 4A is a schematic representation of a working model of the transporters involved in sodium sequestration at the yeast pre-vacuolar compartment; Nhxl (Na+ H+ antiporter), Vmal (vacuolar membrane H+- ATPase), Gefl (yeast CLC chloride channel), Enal (plasma membrane Na+- ATPase). The yeast member of the CLC voltage-gated chloride channel superfamily, Gefl, is required for copper loading in late- Golgi vesicles and for cation sequestration in the pre-vacuolar compartment in yeast (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998); Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999); Example 1). Furthermore, it has been shown that the defects of gefl mutants can be suppressed by the introduction of the prototype member of the CLC superfamily, the Torpedo marmorata CLC-0 or by the introduction of Arabidobsis thaliana CLC-c and CLC-d chloride channel genes (Hechenberger, M., et al, J. Biol. Chem., 277:33632-33638 (1996); Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998)). Fig. 4B is a schematic representation of a working model of the transporters involved in sodium sequestration at the yeast pre- vacuolar compartment shown in Figure 4 A, which also includes Avpl (A. thaliana vacuolar pyrophosphate-energized proton pump). While not wishing to be bound by theory, two observations led to the proposal of the model for Na+ sequestration in yeast illustrated in Figs. 4 A and 4B. First, gefl mutants are sensitive to high NaCl concentrations. Second, the Na+/H+ exchanger Nhxl is localized to the pre-vacuolar compartment ( ass, R., et al., J. Biol. Chem., 273:21054-21060 (1998)). The model proposed in Figs. 4A and 4B posits that Na+ sequestration by Nhxl depends on the vacuolar H+- ATPase and Gefl, the chloride channel. Gefl -mediated anion influx allows the establishment by the vacuolar T - ATPase of a proton gradient sufficient in magnitude to drive the uphill accumulation of Na via Na+/H+ exchange.
Based on such models, it was theorized that increasing the influx of protons into the postulated endosomal compartment should improve Na+ sequestration via the Nhxl exchanger. In order to increase the H+ availability the A. thaliana gain-of-function mutant gene AVP1-D that codes for the vacuolar pyrophosphate-energized proton pump was expressed (Figure 3B) (Zhen, R.G., et al, J. Biol. Chem., 272:22340-22348 (1997)). This plant pump expressed in yeast restored the Na+ resistance of the test strain, but only if the strain had functional N77Z7 and GEFl genes. Furthermore, Geflp and Νhxlp co- localize within a common organelle, the pre-vacuolar compartment (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999)). These results strongly support the model in Figs. 4A and 4B and indicate that the yeast pre-vacuolar compartment can be used to identify the elusive plant transporters involved intracellular sodium detoxification. The model set forth in Figs. 4 A and 4B is entirely consistent with the physiological data on the role of the vacuole in cation detoxification in higher plants. Yeast and plant cells share pathways and signals for the trafficking of vesicles from the Golgi network to the vacuole (Neuhaus, J.M., et al, Plant Mol. Biol, 35:127-144 (1998); (Paris, N., et al, Plant Physiol, 775:29-39 (1997); Sato, M.H., et al, J. Biol. Chem., 272:24530-24535 (1997); Vitale, AN., et al, Trends Plant Scl, 4: 148-154 (1999)). Studies were therefore undertaken in yeast to identify the role of the vacuole in cation detoxification in higher plants.
Studies of Cation Sequestration Mechanism in Yeast Example 1: Functionality of AtΝhxl and Avpl in Yeast Strains
To test the sequestration models set forth in Figs. 4A and 4B, mutant yeast strains (enal) lacking the plasma membrane sodium efflux pump, which therefore must rely on the internal detoxification system in order to grow on high salt, were constructed. The sequestration model (Νass, R. and Rao, R., J. Biol Chem., 273:21054-21060 (1998) and, Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998)) of Figs. 4A and 4B predicts that the enal strain would become salt tolerant if one could enhance the availability of protons in the postulated endosomal compartment, that is with increased influx of protons, cytoplasmic Νa+ would be sequestered via the Nhxl exchanger.
The yeast vacuolar ATPase is a multisubunit protein, so it is difficult to increase its activity by overexpressing any one of its subunits. Instead the same effect was achieved by increasing the influx of protons by expressing the A. thaliana AVPl gene in yeast. This gene encodes a single polypeptide that, when expressed in yeast, is capable of pumping protons into the lumen of the vacuole (Kim, E.J., et al, Proc. Natl. Acad. Sci. USA, 97:6128-6132 (1994)). To ensure maximum activity of this proton pump, the E229D gain-of-function mutant of the AVPl gene (AVP1-D) that has enhanced FT" pumping capability was expressed (Zhen, R.G., et al, J. Biol. Chem., 272:22340-22348 (1997)). Intracellular sodium and potassium content was determined for mutant and wild- type cells after growth on SD-ura medium with high NaCl content. Materials and Methods
Yeast strains and Plasmids
Strains isogenic to W303 (ura3-l canl-100 leu2-3, 112trpl-l his3-ll, (Gaxiola, R.A., et al, EMBO J, 77:3157-3164 (1992)) were employed. Plasmids ρRG52 ( gefl::HIS3) (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998)) and pRG197 ( -nhxl::HIS3) were used to construct the deletions of GEE7 and NHX1 genes, yielding strains RGY85 and RGY296, respectively. The enal::HIS3 mutant was obtained from Fink Lab collection (L5709). Method of Transformation
Transformation of yeast cells was performed by using the lithium acetate method (Gietz, D., et al, Nucleic Acids Res., 20:1425 (1992)). Double mutants RGY324 (gefl::HIS3 enal::HIS3), RGY326 (nhxl::HIS3 enal::HIS3), and RGY343 (gefl::HIS3 nhxl::HIS3) were obtained by crossing the single-mutant strains. Double mutants were identified among the meiotic progeny by scoring for the phenotypes associated with each of the single mutants. Sporulation, tetrad dissection, and mating types were scored as described (Guthrie C. and Fink, G.R., Guide to Yeast Genetics and Molecular Biology (Academic, San Diego (1991)). Cells were grown in YPD (1% yeast/2%peptone/2% dextrose; Difco), YPGAL (1% yeast/2%peρtone/2% galactose; Difco), SD (Difco; Synthetic medium with 2% Dextrose), or APG (APG is a synthetic minimal medium containing 10 mM arginine, 8 mM phosphoric acid, 2% glucose, 2 mM MgSO4, 1 mM KC1, 0.2 mM CaCl2, and trace minerals and vitamins) (Rodriguez-Navarro, A. and Ramos, j., J Bacterial, 759:940-945 (1984)). MnCl2 (Sigma), tetramethylammonium chloride (Sigma), NaCl (Sigma) , or hygromycin-B (Sigma were added as indicated. Wild type, L5709 (enal::HIS3), RGY324 (gefl::HIS3 enal::HIS3), and
RGY326 (nhxl::HIS3 enal::HIS3) strains were transformed with pYΕS2 vector (Invitrogen) and plasmid ρYES2-^ P7-E229D described in Zhen, R.G., et al., J. Biol. Chem., 272:22340-22348 (1997). The strain RGY343 (gefl::HIS3 nhxl::HIS3), used for histochemical analysis, was transformed with pRG151 (GEF1-GFP) (Gaxiola, R.A., et al. Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998)) and with pRTN73 [NHX1-(HA)3] (Nass, R., and Rao, R., J Biol. Chem., 273:21054-21060 (1998)). Wild-type and RGY296 (nhxl::HIS3) strains were transformed with vector pAD4 (Ballester, R., et al, Cell, 59:681-686 (1989)). RGY296 (nhxl::HIS3) was transformed with pRG308 (ADH1 : :AtNHXl) (see Cloning ofAtNHXl).
Determination of Intracellular Sodium and Potassium Content Cells were grown overnight in SD-ura medium (Difco; synthetic medium with 2% dextrose without uracil). YPGAL (1% yeast extract/2% peptone/2% galactose; Difco) media was inoculated with the overnight stocks and grow to an A60o of 0.6. At this OD, NaCl was added to a final concentration of 0.7 M. The cells were incubated for 6 h, harvested by centrifugation, washed two times with 1.1 M sorbitol and 20 mM MgCl2, and entracted with water for 30 min at 95 °C .
The amount of Na and K+ in cells was determined at the University of
Georgia Chemical Analysis Laboratory by an Inductively Coupled Plasma-MS (see world wide web at rserv/uga.edu/rsnew/chemicalanalysis/). Intracellular cation concentrations were estimated as described (Gaxiola, R.A., et al, EMBO J., 77:3157-3164 (1992)) by using the intracellular water value calculated for cells grown in 1M NaCl.
Immunofluorescence
The strain RGY343 (gefl::HIS3 nhxl::HIS3) was grown in SD-ura, -leu medium (Difco; synthetic medium with 2% dextrose without uracil and leucin) to mid- logarithmic phase, 0.1 mg/ml hygromycin B was added, and the culture was incubated for 1 h at 30°C. Cells were fixed with 3.7% formaldehyde (Sigma) for 45 min at room temperature without agitation. Spheroplast formation, permeablization, washing, and antibody incubation was performed as described (Pringle, J., et al.,, in Immunofluorescence Methods for Yeast, eds. Guthrie, C. And Fink, G.F. (Academic, Sand Diego), Vol. 194 ρp.565-602 (1991)). MAB HAH used as first antibody was from Babco (Richmond, CA). Cy3-conjugated goat anti-mouse IgG was from Jackson Immunoresearch. 4',6-Diamidino-2-phenylindole (Sigma) was added , to mounting medium to stain mitochondrial and nuclear DNA.
Subcellular Fractionation and Western Analysis
The strain RGY343 (gefl::HIS3 nhxl::HIS3) was grown in APG medium (pH 7.0), and lysates fractionated on a 10-step sucrose density gradient as described (Nass,
R. and Rao, R., J. Biol. Chem., 273:21054-21060 (1998)). Aliquots of individual fractions
(100 μg) were subjected to SDS/PAGE and transferred to nitrocellulose as described (Nass, R. and Rao, R., J. Biol. Chem., 273:21054-21060 (1998)). Western blots were probed with monoclonal anti-GFP (green fluorescent protein) antibody (1:10,000 dilution; CLONTECH), anti-hemagglutinin antibody (1:10,000 dilution: Boehringer Mannheim), and peroxidase-coupled goat anti-mouse antibody (1:5,000;) and developed by using the ECL enhanced chemiluminescence system (Amersham Pharmacia). Cloning of AtNHXl
AtNHXl was cloned from a phage cDNA library of A. thaliana (Kieber, J.J., et al, Cell, 72:427-441 (1993)) (obtained from the Arabidopsis Biological Resource Center) by probing with an expressed sequence tag (Arabidopsis Biological Resources Center, DNA Stock Center) containing a partial clone. A full-length clone (2.1 kB) was ligated into vector pSK2 (Stratagene) at the Nøtl sit, generating plasmid pRG293. The AtNHXl ORF was amplified via PCR by using pRG293 as template and GGCCCGGGATGGATTCTCTAGTGTCGAAACTGCCTTCG (SEQ ID NO: 5) (italicized bases correspond to nucleotides 1-30 of the ORF) and T7 oligonucleotides. The PCR product was then digested with Xbal and Sail and ligated into pAD4 vector generating plasmid pRG308. The AtNHXl ORF was sequenced to verify the fidelity of the PCR product. The full-length sequence is longer than the ORF reported by the Arabidopsis Genome Initiative (A TM021B04.4), and has been deposited in GenBank (accession no. AF 106324). Cloning of AVPl -D
Vector pYES2 (Invitrogen) was introduced into wild-type, enal, enal nhxl, and enal gefl mutants. Plasmid pYes2-AVPl-D (Zhen, R.G., et al., J. Biol. Chem., 272:22340-22348 (1997)) was introduced into enal, enal nhxl, and enal gefl mutants. Five-fold serial dilutions (starting at 105 cells) of each strain were plated on YPGAL (1% yeast extract/2% peptone/2% galactose) with or without 0.5 M NaCl and incubated at 30°C for 2 days. Exponentially growing cells (wild-type and enal transformed with pYES2 vector and enal, enal nhxl, and enal gefl mutants carrying pYes2--4FP7-E>) were exposed to 0.7M NaCl for 6 hours. Total cell extracts were prepared, and Na+ and K+ concentrations were determined. Results
The enal mutant of the above construct lacks the plasma membrane sodium efflux pump and therefore must rely on the internal detoxification system to overcome sodium toxicity. Growth of the enal strain is sensitive to low concentrations of sodium (200 mM), concentrations that do not inhibit the growth of wild-type strains. Overexpression of AVPl -D restored salt tolerance to salt-sensitive enal mutants. The restoration of salt tolerance to an enal strain by AVPl-D requires functional NHX7 and GEE7 genes: enalnhxl AVPl-D and enal gefl AVPl-D strains are salt sensitive.
Fig. 5A and Fig. 5B are bar graphs showing the intracellular Νa+ and K+ contents of wild-type yeast strains and of yeast strains carrying various mutations affecting sodium tolerance wherein the values are the mean of two determinations, and the bars represent the standard deviations. The intracellular Na+ and K contents of wild-type strains and of strains carrying various mutations affecting sodium tolerance were determined after 6 h of exposure to media supplemented with 0.7 M NaCl. The intracellular Na+ content in the enal mutant was seen to be 8-fold higher than in the wild- type strain. There was seen to be a consistent reduction in total cell Na+ in the enal AVP- D strain. The reason for this reduction is unknown. The enal AVP-D strain was found to be salt-resistant, even though its intracellular Na+ content was 4-fold higher than that of the wild type. In enal AVPI-D strains lacking either gefl or nhxl (i.e., enal gefl or enal nhxl), the Na+ content was not reduced to the extent that it was in the GEF1 NHX1 strain. Taken together, the genetic and physiological data are consistent with the model that Nhxl, Gefl and Avpl cooperate to sequester sodium internally. As can be seen in the graphs, the Arabidopsis Vacuolar FT1" -Pyrophosphatase (Avpl) was evidenced to confer salt tolerance to yeast enal mutants.
The intracellular K+ content was found to correlate with salt tolerance and is inversely correlated with the Na+ content of the strains (Fig. 4B). The wild-type K+ concentration was at 100 mM, but was reduced to 20 mM in the enal mutant. Interestingly, in an enal strain that overexpresses the AVPl-D gene, the intracellular concentration of K was restored almost to wild-type levels (Fig. 4B). However, AVPl-D overexpression failed to restore wild-type levels of intracellular potassium unless both NHxl and GΕF1 were functional (See, the double mutants enal nhxl or enal gefl in Fig. 4B). As shown herein, intracellular Na+ detoxification in yeast requires functional Na+/H+ exchanger (Nhxl) and chloride channel (Gefl), and they co-localize to a pre-vacuolar compartment (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480- 1485 (1999)). When the Arabidopsis thaliana homologue of the yeast NHX7 gene (AtNHXl) was cloned and its function in the nhx 1 yeast mutant tested, the AtNHXl gene was found to be able to suppress partially the cation sensitivity phenotypes of nhxl mutants. Fig. 6 is alignment of the deduced amino acid sequences of ΝhXl homologue from Arabidopsis AtNHXl (SEQ ID ΝO:l), human HsNHE-6 (SEQ ID NO: 2) and yeast ScNHXl (SEQ ID NO:3); identical residues are in black boxes, and dashes indicate gaps in the sequence, * above alignment denote putative amiloride binding site from human NHE7 (163DVF-FLFLLPPI173) (SΕQ ID NO: 4). Example 2: Functionality of . and Co-localization of. Geflp and Nhxlp in Yeast Strains The NHXl and GEE7 genes, which have been identified as important in sodium detoxification, are also required for the detoxification of other cations. An investigation was made with respect to the viability of yeast strains mutant with respect to gefl and nhxl (enal) in the presence of toxic cations, in light of the model set forth in Figs. 4A and 4B. The sequestration model postulates not only a functional connection between the anion channel Gefl and sodium exchanger Nhxl but also predicts that these two proteins co-localize within a common compartment. Because previous studies indicated that Nhxl localizes to a pre-vacuolar compartment (Nass, R. and Rao, R., J Biol. Chem., 273:21054-21060 (1998)), experiments were also performed to determine whether Gefl and Nhxl proteins co-localize to this compartment. Materials and Methods
The strain RGY419 (gefl nhxl) was transformed with plasmids pRG151; GΕF1-GFP and pRIN73; NΗX1-(ΗA)3. Transformants were grown in SD (Difco; synthetic medium with 2% dextrose). To determine the sensitivity of such transformants to toxic cations, five-fold serial dilutions (starting at 105 cells) of the indicated strains were grown at 30 C for 2 days on YPD (1% yeast extract/2% peptone/2% dextrose) with the addition of either 3 mM MnCl2, 0.45 M tetramethylammonium (TMA), or 0.05 mg/ml hygromycin B (HYG) as indicated.
Two studies were undertaken to demonstrate co-localization of Geflp and Nhxlp.
Distribution of fluorescence and immunodetection of subcellular fractions in gefl nhxl cells transformed with two constructs: a GEF1-GFP fusion and a NHXl- (H 3-tagged fusion were determined. When the cells reached OD60o = 0.5, hygromycin B (Sigma) was added to a final concentration of 0.1 mg/ml and the cells were incubated for 40 min at 30 C. Cells were fixed and stained with antibodies to ΗA epitope and 4 ',6- diamidino-2-phenylindole (DAPI). Cells were viewed by charge-coupled device microscopy and optically sectioned by using a deconvolution algorithm (Scanalytics, Billerica, MA) (Kennedy, B.K., et al., Cell, S9:381-391 (1997)); (Bar = 1 -m.).
The migration properties of the Geflp and Nhxlp in sucrose gradients was also determined to provide evidence of co-localization of Nhxl (ΗA)3 and GEF1-GFP. The strain RGY419 (gefl nhxl) was transformed with plasmids pRG151; GEF1-GFP and pPJN73; NHX1-(HA)3 and grown in APG medium (Rodriguez-Navarro, A. and Rea, P. A., J. Biol. Chem., 159:940-945 (1984)). Such was converted to spheroplasts, lysed, and fractionated on a 10-step sucrose gradient (18-54%) as described (Sorin, A., et al, J. Biol. Chem., 272:9895-9901 (1997) and Antebi, A. and Fink, G.R., Mol. Biol. Cell, 3:633-654 (1992)). Western blots showed the distribution of Gefl-GFP and Nhxl -HA. Results
Gefl mutants were found to be sensitive to 3 mM MnCl2, 0.45 M tetramethylammonium chloride and to 0.05 μg/ml hygromycin-B. The nhxl mutant was also found to be sensitive to tetramethylammonium chloride and hygromycin. The extreme sensitivity of the nhxl mutant to hygromycin may provide an important tool for assaying nhxl function.
It was found that hemagglutinin (HA)-tagged Nhxl and Gefl-GFP fusion protein co-localize as shown via epifluorescence deconvolution microscopei Persistence of signal coincidence on 90° rotation of the image further supports co-localization of the two transporter proteins in these cells. The co-localization of Nhxl (HA)3 and GEF1-GFP is also supported by the co-migration of the two proteins in sucrose density gradients of membrane preparations obtained from cells expressing the tagged proteins. The sedimentation behavior of the membrane fraction containing both proteins is consistent with that of a pre-vacuolar compartment (Nass, R. and Rao, R., J. Biol. Chem., 273:21054- 21060 (1998)). Gefl-GFP (but not Nhxl) is also present in Golgi fractions, consistent with previous studies (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998), Schwappach, B., et al, J. Biol. Chem., 273:15110-15118 (1998)). Example 3: Capacity of A. thaliana Homolog of NHX1 to Suppress Hygromycin Sensitivity of Mutant Yeast
The yeast strain described herein provides an important tool for identifying genes that mediate salt tolerance in other organisms. To test the utility of this system, a sequence from Arabidopsis (See Materials and Methods) with very high homology to the S. cerevisiae NHX1 ORF was identified and used an expressed sequence tag (see Materials and Methods) to obtain a full-length clone of this Arabidopsis gene. An alignment of the amino acid sequences of Nhxl homologues from Arabidopsis (AtNhxl), human (HsNheό), and yeast (ScNhxl) reveals segments of amino acid identity and similarity within predicted transmembrane domains (Fig. 6A-C). However, it is important to note that despite these relationships, neither the C-terminal regions of AtNhxl and ScNhxl show a high degree of homology (Fig. 6A-C).
A characteristic of mammalian Na+/H+ antiporters is their inhibition by amiloride. A putative amiloride binding site (163DVFFLFLLPPI173) (SEQ ID NO: 4) has been defined via point mutants in the human NHE1 antiporter gene (Counillon, T,., et al, Proc. Natl. Acad. Sci. USA, 90:4508-4512 (1993)). AtNhxl, HsNhe-6 and ScNhxl have an almost identical sequence (Fig. 6). However, attempts to inhibit the activity of either Nhxl or AtNhxl in yeast cultures with amiloride were unsuccessful. The extreme sensitivity of yeast nhxl mutants to hygromycin permitted the testing of whether the cloned Arabidopsis AtNHXl ORF could provide Na+/H+ exchange function in yeast. Vector pAD4 (Ballester, R., et al, Cell, 59:681-686 (1989) was introduced into wild-type and nhxl strains. Plasmid pRG308; ADH; -4tNHXl was introduced into nhxl mutants as indicated. Five-fold serial dilutions (starting at 105 cells) of the indicated strains were grown at 30°C for 2 days on YPD (-) or on YPD supplemented with 0.05 mg/ml hygromycin (+). Serial dilutions of the same strains were grown on APG medium (see Materials and Methods) (-) or on APG supplemented with 0.4 M NaCl (Rodriguez-Navarro, A. and Ramos, J., J. Bacteriol, 759:940-945 (1984).
The At NHX1 gene is capable of suppressing the hygromycin sensitivity of the nhxl mutant. The AtNHXl gene also suppressed the NaCl sensitivity of nhxl mutant but only under conditions in which the K availability was reduced. However, AtNHXl was not capable of rescuing the Na " sensitive growth phenotype of the double mutant enal nhxl overexpressing the AVPl-D gene. Example 4: Generation of Gain-of-Function Yeast AtNHX Mutants Materials and Methods
Gain of function mutants of the AtNHX that enhance salt tolerance may be generated in the enal yeast by mutagenizing the cloned gene to make a mutant library.
This library may be used to transform the salt sensitive yeast mutant enal and clones with an enhanced salt tolerant phenotype.
Other genes that show similarity to the AtNHXl gene, as reported by the
Arabidopsis Genome Initiative (AGI), may also be expressed in the mutant yeast to form gain-of-function mutants. It is believed that some of these AtNHXl homologues are plasma membrane transporters, so their function in yeast are frequently pH dependent, requiring precise composition and pH of the medium used for screening for success.
Identification of plasma membrane transporters helps to engineer plants with an enhanced salt tolerance due to a reduced sodium uptake. In addition, plant cDNA expression libraries in yeast may be used to identify other families of transporters involved in NaCl detoxification.
To generate gain of function mutants of the AtNHX a method for introducing random mutations developed by Stratgene (Epicurian Coli XL 1 -Red competent Cells Cat#200129) may be used. The method involves the propagation of a cloned gene into a strain deficient in the three primary DNA repair pathways. The random mutation rate in this strain is about 5000-fold higher than that of wild-type. A library of the mutated AtNHX gene may be transformed into the enal yeast mutant and screened for salt tolerance. Yeast transformation was performed as described by Schiestl and coworkers (Gietz, D., et al, Nucl. Acid Res. 20:1425 (1992), incorporated by reference in its entirety herein). An alternative to the XL 1 -Red random mutagenesis strategy is a PCR approach described by Fink and coworkers (Madhani, H.D., et al, Cell, 97:673-684
(1997)).
To test AtNHXl homologues the same strains and conditions may be as described in Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999). However, others may be employed. When dealing with plasma-membrane AtNHXl homologues pH conditions of the assay media may be crucial. Results
The overexpression of the A. Thaliana gain-of-function mutant gene AVPl -
D increases the intracellular detoxification capability in yeast (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999)). It is hypothesized (although the inventors are not limited by such hypothesis) that the latter is due to an increased influx of H1" into the vacuolar compartment thereby improving Na+ sequestration via the Nhxl exchanger.
Conclusions from Yeast Cation Sequestration Studies The yeast studies described above provide evidence for the importance of the pre-vacuolar pH for intracellular Na+ sequestration in yeast. Overexpression of the plant H+ -pyrophosphatase (Avpl) confers salt tolerance to yeast only in those strains containing a functional chloride channel (Gefl) and the Na /H4" exchanger (Nhxl).
These data support a model in which the Nhxl Na+/H exchanger acts in concert with the vacuolar ATPase and the GEFl anion channel to sequester cations in a pre-vacuolar compartment. Several studies suggest that the pre-vacuolar compartment may be derived both from the plasma membrane and the late Golgi. These vesicles are likely involved in the assembly of the vacuole or delivery of cargo to this organelle. It is reasonable to expect that these pre-vacuolar vesicles detoxify cations by sequestration, thereby lowering their concentrations in the cytoplasm and in other organelles.
The yeast system described herein permits the functional assessment of diverse heterologous proteins in salt tolerance: chloride channels, H pumps, and Na /FT1" exchangers and other cation H+ exchangers or cation/bicarbonate symporters. The system is robust and flexible. The function of the Arabidopsis chloride channels (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998), Hechenberger, M., et al, J. Biol. Chem., 277:33632-33638 (1996)), TU pump, and NaW exchanger can be assayed in the corresponding yeast mutant. Despite the inability of At NHXl to suppress all the phenotypes of the yeast nhxl mutant, the fact that it suppresses some phenotypes, coupled with the DNA homology between AtNHXl and yeast NHXl, indicates that the plant gene carries out a similar function to that of the yeast homologue. The observation that the AtNHXl gene suppresses the sensitivity of the nhxl mutant to hygromycin but provides only a weak Na+ detoxification phenotype could be a consequence either of differential regulation of the transporters in the two organisms or of distinct cation transport selectivities.
The regulation of AtNHXl by salt and the ability of the plant gene to suppress the yeast nhxl mutant suggest that the mechanism by which cations are detoxified in yeast and plants may be similar. Indeed, previous work suggested that vacuolar sodium accumulation in salt-tolerant plants may be mediated by a tonoplast Na+/H+ antiporter that utilizes the proton-motive force generated by the vacuolar H1"- ATPase (V-ATPase) and/or -translocating pyrophosphatase (V-Ppase; refs. Barkla, BJ., et al, Symp. Soc. Exp. Biol, 4S.T41-153 (1994), Zhen, R.G., et al, The Molecular and Biochemical Basis of Pyrophosphate-Energized Proton Translocation at the Vacuolar Membrane (Academic, San Diego), Kirsh, M, et al, Plant Mol. Biol, 32:543-547 (1996)). The finding described herein that both ge/7 and nhxl mutants are hypersensitive to hygromycin indicate that the level of resistance to hygromycin depends on the function of the vacuolar and pre-vacuolar organelles. Yeast mutants impaired in K uptake (trλ:7) are hypersensitive to hygromycin (Madrid, R., et al, J. Biol. Chem., 273:14838-14844 (1998)); reduced K+ uptake hyperpolarizes the plasma membrane potential and drives the uptake of alkali cations such as hygromycin. Mutations that reduce the T pumping activity of the plasma membrane H+ -ATPase, Pmal, depolarize the plasma membrane potential and confer resistance to hygromycin (McCusker, J.H., et al., Mol. Cell. Biol, 7:4082-4088 (1987)). Thus, mutants such as gefl or nhxl that affect the pH or membrane potential of the vacuolar and pre-vacuolar compartments may be expected to affect hygromycin compartmentation.
Transgenic Plants With Upregulated Vacuolar H+-translocating Pump Activity Further support for the role of the Arabidopsis AtNHXl gene in salt homeostasis is provided by the observation that its expression is induced in salt-stressed plants (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999)). Arabidopsis thaliana, in particular, has been used as a host model plant to demonstrate that overexpression of these genes results in salt tolerance in the plant. A recent report shows that the overexpression of AtNHXl gene in transgenic Arabidopsis thaliana promotes sustained growth in soil watered with 200 mM NaCl plus 1/8 M.S. salts under short-day cycle conditions (Apse, M., et al, Science, 255:1256-1258 (1999)). It is worth noting that every addition of 1/8 M.S. salts provides 2.5 mM potassium reducing the stringency of the NaCl stress, and that a short-day cycle reduces oxidative stress.
Example 5: Enhanced Expression of AtNHXl Gene in Salt-Stressed Plants Materials and Methods
A. thaliana plants (ecotype Columbia) were grown aseptically on unsupplemented plant nutrient agar without sucrose (Haughn, G.W. and Somerville, C, Mol. Gen. Genet., 204:430-434 (1986)) for 15 days at 19°C and under continuous illumination. NaCl or KC1 was added to a final concentration of 250 mM, and the plants were incubated for 6 h. Total RNA from tissue of salt-treated and untreated plants was isolated (Niyogi, K.K. and Fink, G.R., Plant Cell, 4:721-733 (1992)), Hybond-N (Amersham) membranes were hybridized with a 32P-Labeled DNA probe from plasmid pRG308. Hybridization was performed at 65°C overnight. Washes were performed at 65°C with 0.2% standard saline citrate (SSC)/0.1% SDS (Ausebel, F., et al, Curr. Protocols in Mol. Biol. (Wiley, NY) (1988)). 7SS probe was used as loading control (Unfried, I., et al, Nucleic Acids Res., 77:7513 (1989)). MACBAS 2.4 program was used to quantify the relative amount of RNA. Results The NaCl stress increased AtNHXl mRNA levels 4.2-fold, whereas KC1 promoted only a 2.8-fold increase. This increase in mRNA level produced by sodium resembles that described for the yeast NHX1 gene (Nass, R. and Rao, R., J Biol. Chem., 273:21054-21060 (1998)). RNA tissue blot hybridized with AtNHXl . Ten micrograms of total RNA from 15 -day old plants exposed to 250 mM NaCl or KC1 for 6 h and a control grown without salt was subjected to electrophoresis on a denaturing formaldehyde gel. The blot was hybridized with a probe internal to -4tNHXl ORF. An 75S ribosomal probe was used as a loading control.
Example 6: Salt tolerance of Transgenic plants overexpressing AtNHXl
Transgenic plants that overexpress the AtNHXl show sustained growth in soil watered with 200 mM sodium chloride. (Apsem M., et al., Science, 285:1256-1258 (1999). Example 7: Salt tolerance of Transgenic plants overexpressing 35SAVP1
Materials and Methods A transgenic Arabidopsis thaliana plant was engineered to overexpress the
AVPl wild-type gene using the double tandem enhancer of the 35S promoter (Topfer, R., et al, Nucl. Acid Res., 75:5890 (1987)). AVPl encodes the pyrophosphate-energized vacuolar membrane proton pump from Arabidopsis (Zhen, R.G., et al, J. Biol. Chem., 272:22340-22348 (1997)). Previous investigations suggest that the AVPl gene is present in a single copy in the genome of Arabidopsis (Kim, Y., et al, Plant Physiol, 106:375- 382 (1994)), however, a sequence homologous, but not identical, to AVPl on chromosome one has been tentatively designated as ORF F9K20.2 on BAC F9K20 by the Arabidopsis Genome Initiative (AGI).
Transgenic plants that overexpress AVPl were generated using Agrobacterium-mediated plant transformation. The transgenic AVPl was expressed using a double tandem enhancer of the 35S promoter of CaMV (Topfer, R., et αl, Nucl. Acid Res., 75:5890 (1987)). 15 wild-type plants and 15 35SAVP1 transgenics were grown on a 24 hours-day cycle for 16 days. During this period plants were watered every 4 days with a diluted nutrient solution (1/8 M.S. salts). 200 mM NaCl was added to the watering solution at day 17 and at day 27 plants were watered with nutrient solution containing 250 mM NaCl. Plants were photographed 10 days after the last NaCl treatment. Identical conditions and treatment as described in Example 6 were used. Results Five different lines of 35SAVP1 plants showed an enhanced salt tolerance as compared to wild-type plants in the T2 stage. However, the most dramatic phenotype was apparent in the homozygous T3 plants. These transgenic plants are larger than wild- type plants. Furthermore, homozygous 35SAVP1 plants showed sustained growth in the presence of 250 mM NaCl plus 1/8 M.S. salts when grown in a 24 hours light regimen. When 35SAVP1 plants were grown under short-day cycle conditions (12 hour day/light cycle) sustained growth in the presence of 300 mM NaCl plus 1/8 M.S. salts was observed. Example 8: Growth of Wild Type Plants and 35SAVP1 Transgenic Plants in Hydroponic Solution
The reduced availability of fresh water for standard agriculture may force the use of alternative agricultural arts. It is conceivable that with salt tolerant crops the use of hydroponics with seawater will create a new era in crop production. Hydroponic culture has been reported to increase plant growth and provide stress-free root and shoot material (Gibeaut, D.M., et al, Plant Physiol, 317-319 (1997)). Another important advantage of hydroponic culture is that it allows one to alter the ionic composition in a more accurate manner than in soil. These advantages could be important for the physiological studies of salt stress.
Conditions for hydroponics culture of Arabidopsis plants were established and their performance in increasing concentrations of NaCl in their media were tested.
Materials and Methods In one test, wild type and 35 SAVP1 transgenic plants were hydroponically grown . Wild type and 35SAVP1 transgenic plants were grown in solution culture on a 12 hour light cycle for 65 days.
In another test, wild type and 35SAVP1 transgenic plants were grown in solution culture on a 12 hours light cycle for 20 days. Starting at day 21, NaCl concentration was increased in a stepwise fashion by 50 mM increments every 4 days. Plants were photographed after 4 days in the presence of 200 mM NaCl.
And yet in another hydroponic test, transgenic plants were challenged with a commercial seawater formula that contains the complete ionic composition present in the oceans. 35SAVP1, 35SAtNHXl single and double transgenics were grown together with wildtype Arabidopsis thaliana plants under hydroponic conditions for four weeks in a short day illumination cycle (Gibeaut, D.M., et al, Plant Physiol, 317-319 (1997)). Then every four days an equivalent to 50mM NaCl of Tropic Marin sea salt (worldwide web at thatpetplace.com) is added. This artificial sea water mix includes all of the other major and trace elements present in real sea water. Growth was monitored and ^physiological parameters, such as sodium content and distribution may be monitored.
Results
When wild type and 35SAVP1 transgenic plants were grown hydroponically the size differences in root, leaves and stems among wild type and 35 SAVP1 transgenic plants were found to be dramatic, with 35SAVP1 transgenic plant parts being much larger.
When NaCl concentration were increased stepwise by 50 mM every 4 days (Apse, M., et al, Science, 255:1256-1258 (1999), 35SAVP1 transgenic plants appeared healthy in the presence of 200 mM NaCl while wild type controls showed severe deleterious effects in their leaves and stems.
35SAVP1, 35SAtNHXl single and double transgenics that were grown together with wildtype Arabidopsis thaliana plants under hydroponic conditions for four weeks in a short day illumination cycle (Gibeaut, D.M., et al, Plant Physiol, 317-319 (1997)) and then challenged every four days with an equivalent to 50mM NaCl of Tropic Marin sea salt were found to grow in the sea salt solution better than wildtype Arabidopsis thaliana plants.
Example 9: Effect of Overexpression of Arabidopsis thaliana Proton Transporters in Tomato Plants
The effects of the overexpression of these Arabidopsis thaliana proton transporters (AVPl and AtNHXl) in a more agriculturally important plant, the tomato plant, may be examined. It is believed that increasing the salt-tolerance of tomato plants will likely have important economic repercussions.
The tomato homologues of AVPl and AtNHXl may be isolated and the corresponding chimeras to overexpress them may be constructed (Bidone, S., et αl, Eur. J. Biochem., 253: 20-26 (1998); Burbidge, A., et αl, J. Exper. Botany, 45:2111-2112 (1997)). The genes may be introduced via Agrobacterium-mediated infection of calli. Tissue culture methods may be used to regenerate transformed plants. The plants may be assayed for salt tolerance as well as physiological parameters, such as sodium content and distribution.
Tomato transformation with 35S AVPl and with 35S AtNHXl constructs may be performed as described by McCormick (McCormick, S., Transformation of tomato with Agrobacterium tumefaciens. In: Plant Tissue Culture Manual, pp. 1-9, Lindsey, K. (ed.), Kluwer Academic Publishers, Dordrecht, The Netherlands (1991)). TO and Tl transgenics may be analyzed by polymerase chain reaction and DNA gel blotting for the presence and copy number of AVPl and AtNHXl transgenes. Heterozygous and homozygous plants may be identified after segregation analysis of each transcend within Tl seeds. Homozygous plants may be assayed for salt tolerance and as well as physiological parameters, such as sodium content and distribution. Degenerated oligos based on conserved sequences present in AVPl and AtNHXl homologues may be designed. These degenerated primers may be used in RT-PCR reactions with cDNAs made from poly(A)+RNA from tomato. The resulting PCR fragments may be used as probes to isolate the full length cDNA clones from commercial libraries (i.e. Stratagene Cat#936004). A similar strategy was described by Caboche and coworkers (Quesada, A., et al, Plant Mol. Biol, 34:165-274 (1997)). Results
Positive test results would indicate that the sequestration model described herein is also applicable to an important crop.
Fig. 7 is a graph of Na+ and K+ content of wild-type plants (WT) versus representative transgenic plants overexpressing AVP-1 (1' and T) grown in salty soil. Five wild-type plants (WT) and two AVP-1 overexpressing transgenic lines (1' and 2') were grown on soil in a 10 hour light/dark cycle. Plants were watered with a diluted nutrient solution (1/8 MS salts) for six weeks and subsequently watered with a diluted nutrient solution supplemented with NaCl. The concentration of NaCl began with 100 mM and was increased every four days by 50 mM. The photograph corresponds to plants at the tenth day in the presence of 300 mM NaCl. Parts of the plant above ground were harvested after 24 hours in the presence of 200 mM NaCl and their fresh weigh measured. After 48 hours at 75°C, the dry weight was measured. Na+ and K+ content was determined by atomic absorption. Values in the graphs of Fig. 4 are the mean +/- SE (n = 4). As can be seen from the graphs Na+ and K content in the transgenic lines (1' and 2') was significantly higher than that of wild-type counterparts.
Fig. 5 is a graph of the uptake of calcium into the 35SAVP-1 transgenic vacuolar membrane vesicles (squares) of 2' of Fig. 4 versus calcium uptake into vesicles obtained from wild type (WT) of Fig. 4. Wild-type plants (open circles) and transgenic plants from line of Fig. 4 were grown hydroponically for nine weeks on a 10 hour light cycle. Vacuolar membrane vesicles were added to buffer containing 250 mM sorbitol, 25 mM BTP-Hepes pH 8.0, 50 mM KC1, 1.5 nM MgSO4 and 10 μM Ca4"". This mix was incubated at 20°C for 10 minutes before adding 200 μM PPi to trigger the reaction. Ca4"*" ionophore A23187 was added to a final concentration of 5 μg/ml to dissipate the Ca4""1" gradient. Aliquot (200 μl) were filtered at the indicated times and washed with cold buffer as described (11). As is evidenced by the graphs, the transgenic plants from line 2' have greater calcium uptake than wild-type plants. The above data is consistent with the hypothesis that transgenic plants overexpressing A VP-1 have an enhanced H+ pumping capability at their tonoplast and that an enhanced H+ supply results in greater ion accumulation in the vacuole through the action of H^-driven ion transporters. To further support this theory, Ca "1" uptake capability of wild type and transgenic vacuolar membrane vesicles was determined. It is well documented that Ca 4" enters the plant vacuole via a Ca4"4'/!!4" antiporter (K. S. Schumaker, H. Sze, Plant Physiol. 79, 1111-1117 (1985)). Furthermore, the genes encoding the Arabidopsis thaliana Ca^/H4" antiporters CAXl and CAX2 have been isolated and characterized (K. D. Hirschi, R.-G. Zhen, K. W. Cunningham, P. A. Rea, G. R. Fink, Proc. Natl. Acad. Sci. USA 93, 8782-8786 (1996)). Fig. 5 shows that Ca uptake in the 35SAVP-1 transgenic vacuolar membrane vesicles is 36% higher than it is in vesicles obtained from wild type. Application of the Ca4"1" ionophore A23 lowered the 45Ca++ counts to background levels demonstrating the tightness of the vesicles (Fig 8) (K. S. Schumaker, H. Sze, Plant Physiol. 79, 1111-1117 (1985)).
While not limited by such theory, a model consistent with the enhanced drought and freeze tolerance of the transgenic plants overexpressing the AVP-1 gene is depicted in Figs. 9 A and 9B. The model depicts how an increase in the number of AVP-1 pumps in the vacuole of transgenic plants can provide more H that will permit the secondary transporters to import greater amounts of cations into the lumen of the vacuoles. Higher amounts of cations confer a greater osmotic pressure (See, Fig. 14) that leads to a greater water retention capability endowing plants to withstand low soil water potentials. Example 10: Double Transgenic Plant with 35SAVP1 and 35S AtNHXl
Overexpression of the pyrophosphate-energized vacuolar membrane proton pump AVPl likely increases the availability of H+ in the lumen of the vacuole, and the AtNHXl Na+/H+ antiporter uses these H4" to sequester Na4" cations into the vacuole.
Therefore, higher expression of these transporters likely maximizes the sequestration capability of the vacuole.
To generate transgenic Arabidopsis plants that overexpress both genes
AVPl and AtNHXl, T3 35S AVPl plants may be used as females and T3 35S AtNHXl plants may be used as males. Female plants may be hand-emasculated and anthers from freshly opened flowers of donor plants are harvested. With these anthers the emasculated plants may be pollinated by touching the anthers onto the stigmas. The pollinated flowers may be labeled and any remaining opened or unopened flowers from the same female plant removed to avoid any confusion at harvest. The harvested seeds should be sterilized using a 50% sodium hypochloride solution and mixed vigorously for 5 minutes and rinsed with water thoroughly. The sterilized seeds may be stored in soft agar over night at 4°C.
Then they may be sprinkled onto solidified kanamycin-hygromycin selective medium.
The 35S AVPl construct has the neomycin phosphotransferase II gene that confers kanamycin tolerance in plants while the 35S AtNHXl construct has a modified hygromycin B phosphotransferase that confers hygromycin tolerance in plants. The resistant seedlings may be transplanted into soil and to the hydroponic media to be tested for their salt-tolerant phenotype.
A transgenic Arabidopsis thaliana plant to overexpress the A. thaliana gain-of-function mutant gene AVPl-D (Zhen, et al, J. Biol. Chem., 272:22340-22348 (1997)) may be engineered using the same double tandem enhancer of the 35A promoter described above (Topfer, R., et al, Nucl. Acid Res., 75:5890 (1997)). Plants overexpressing the gain of function mutant gene will likely show an enhanced phenotype.
These plants amay be characterized in parallel with the 35SAVP1, 35S AtNHX singles and doubles trangenics. The A. thaliana gain-of-function mutant gene AVPl-D may be subcloned into plasmid pRT103 carrying the 35S promoter and the polyadenylation signal of CaMV (Topfer, R., et al, Nucl. Acid Res., 75:5890 (1997)). A Hindlll fragment containing the chimeric 35SAVP-D gene may be subcloned into pBIBhyg (Becker, D., Nucl. Acid Res., 75:203 (1990)). The resulting T-DNA vector may be transformed into Agrobacterium tumefaciens strain GV3101 via electroporation, and may be used for subsequent vacuum infiltration of Arabidopsis thaliana ecotype Columbia (Bechtold, N., et al, C.R. Jeances Acad. Sci. Ser. Ill Sci. Vie, 376:1194-1199 (1993)). Integration imay be confirmed on Southern blots of T3 plants and expression monitored on Northern blots of positive T3 plants.
Example 11 : Comparative Transport Study With Vacuoles From The Roots Of Wild- Type and 35SAVP1 Transgenic Plants
A study may be undertaken to determine if the vacuoles of 35S AVPl transgenic plants show a higher proton transport activity dependent on pyrophosphate. These determinations may be done with root and shoot tissues separately from plants grown hydroponically. The transgene could show a tissue-specific regulation despite the 35S promoter.
In order to compare the PPI-dependent H+ translocation activities of wild- type and 35S AVPl transgenic plants sealed tonoplast-enriched vesicles from roots and leaves of the above plants may be prepared. The homogenization and differential centrifugation procedure described by Rea and Turner (Rea, P.A., et al, Tonoplast Adenosine Triphosphate and Inorganic Pyrophosphatase. In: Meth. Plant Biochem., pp. 385-405, Academic Press limited, London (1990)) may be followed. H4" translocation may be assayed fluorimetrically using acridine orange (2.5 μM) as transmembrane pH difference indicator in assay media containing vacuole membrane-enriched vesicles as described by Rea and coworkers (Zhen, R.G., et al., J. Biol. Chem., 272:22340-22348 (1997)). The assay media contains 300 - μM Tris-PPi, 50mK KCl, 2.5 μM acridine orange, 5mM Tris-Mes (pH 8.0). Intravesicular acidification may be triggered with the addition of 1.3 mM MgSO4 and terminated with the addition of the protonophore FCCP at 2.5 μM. Fluorescence may be measured at excitation emission wavelengths of 495 and 540 nM, respectively, at a slit width of 5 nM (Zhen, R.G., et al, J. Biol. Chem., 269:23342-23350 (1994)). A further test to support that the H+ translocation is AVPl driven may be the addition of the specific inhibitor aminomethylenediphosphonate (Zhen, R.G., et al, Plant Physiol, 104:153-159 (1994)). Example 12 : Determination Of The Na+/K+ Ratios In Leaves And Stems Of The Transgenic Plants
Toxic concentrations of NaCl build up first in the fully expanded leaves where NaCl is compartmentalized in the vacuoles. Exposure to NaCl can disrupt or reduce K+ uptake leading to K+ deficiency and growth inhibition (Wu, S.J., et al, Plant
Cell, 5:617-627 (1996). A cytosolic consequence of reduced K content and high Na+ is the inhibition of important enzymes. An example of such enzymes is the 3'(2'), 5'- bisphosphate nucleotidase of yeast whose activity is more sensitive to Na4" when K+ content is low (Murguia, JR., et al, Science, 267:232-234 (1995).
Measurements may be taken to demonstrate that the transgenic plants described herein have an increased vacuolar capacity to sequester Na in their leaves cells or elsewhere. To determine the Na+/K4" ratios in leaves and stem S wild-type and 35S AVPl /35S AtNHXl double and single transgenics in hydroponic conditions (Gibeaut, D.M., et al, Plant Physiol, 317-319 (1997) may be grown. NaCl may be added to the growth media in a stepwise fashion starting with 50 mM up to 250mM (Apse, M., et al, Science, 255:1256-1258 (1999). At every point the rosette and the stems of the treated plants may be collected and their weight determined. The samples should be dried out in an oven at 80°C and their dry weight determined. The dry samples may be boiled in a determined volume of water and their Na4" and K4" contents determined via atomic absorption spectrophotometry (Apse, M., et al, Science, 255:1256-1258 (1999); Gaxiola, R, et al, Embo J., 77:3157-2164 (1992)).
Example 13 : Determination Of Whether 35S A VP1 Transgenic Plants Are Larger Because Their Cells Are Larger Or Because They Have More Cells, Or Both The shoot meristems labeling index may be compared with one of the wild- type plants. Morphological and anatomical observations measuring and counting cells of leaves, roots and stems may be performed. To determine if 35S AVPl transgenic plants are larger because they have more cells, their shoot meristems labeling index may be compared with the one of wild-type plants. To measure the DNA synthesis or cell proliferation 5-Bromo-2'-deoxy- uridine (BrdU) that can be incorporated into DNA in place of thymidine may be used. Cells that have incorporated BrdU into DNA may be detected using a monoclonal antibody against BrdU monoclonal antibody and an anti-mouse Ig-alkaline phosphatase as a second antibody. The bound anti-BrdU monoclonal antibody may be visualized by light microscopy and the ratio between DAPI stained and BrdU positives established. The protocol is a modification of the one published by Chiatante and coworkers (Levi, M., et al, Physiol. Plant. 77:68-72 (1987)) and the BrdU labeling and detection kit II from Boehringer Mannheim. The plants may be exposed for different times to the BrdU labeling medium and then fixation, paraffin embedding and sectioning may be performed as described by Meyerowitz and coworkers (Drews, G., et al, Plant Mol. Biol. Rep., 5:242-250 (1988)).
For observation of leaf tissue, fresh tissues may be embedded in 5% agarose and slice them with a microslicer. For primary root observation, seedlings may be fixed for 4hr in 50% ethanol, 5% acetic acid, and 3.7% formaldehyde at room temperature, dehydrated in graded ethanol series, permeate them with xylene, and infiltrate them with paraffin. Eight-micrometer sections may be stained with 0.05% toluidine blue and cells may be counted under a microscope. As an alternative for the visualization and determination of cell size the method described by Greenberg and coworkers (Rate, et al, The Plant Cell, 77:1695-1708 (1999)) may be followed. Results
Microscopic studies indicate that the cells of the transgenic Arabidopsis plants are not larger, but that the number of cells is greater in the transgenics versus wild- type. Macroscopically it was seen that in the AVP-1 line-2' an average of eight more leaves in the rosette was noted over wild-type. FI plants originated by crossing transgenic lines 1' and 2' displayed rosettes with larger leaves and increased amount of leaves than wild-type plants. Fig. 10 depicts the foliage of wild type and transgenic (1* and ) Arabidopsis plants overexpressing AVP-1 grown at 20°C under all white fluorescent light in 16 hours light/8 hours dark period cycle. Leaves depicted were carefully sectored with a scalpel when plants initiated to bolt and then ordered by size for comparison purposes. While having larger and more leaves than the wild-type plants, the transgenics were not seen to have larger cell sizes. Such data is consistent with the hypothesis that the meristem is more active in transgenic AVP-1 overexpressers.
Dry weight of the transgenic Arabidiopsis plants grown hydroponically, as compared to similarly grown wild-type plants, further indicates that cell mass increases irrespective any increased water uptake by the plant. An increase in dry mass weight was seen in both the root, rosette and stem structures as indicated in Table 1 below where values represent the mean values of six plants.
Table 1
Dry Weight of Arabidopsis Plant Parts Grown Hydroponically
Example 14: Effect of Overexpression of AVP-1 on Hormonal Activity
Increased meristematic activity and/or shoot organogenesis may be produced by increasing hormone availability together with AVP-1 overexpression.
The effect of overexpression of AVP-1 on hormone activity was adjudged placing true leaves from wild type (WT) and transgenic (1', ) Arabidopsis plants overexpressing AVP-1 by careful sectoring with a scalpel. Leaves were placed on 5 layers of filter paper saturated with distilled water in Petri dishes. The Petri dishes were incubated at 20°C under cool white fluorescent light in a 16 h light/8 h dark cycles. As seen in Figs. 11 A (view of leaves on the petri dishes) and 775 (view of leaves from petri dishes of Fig. 11 A positioned so as to more clearly set depict root structure developing form the leaves), leaves from transgenic plants remain greener and had. an enhanced rooting capability. An enhanced rooting capability suggests increased auxin content and delayed senescence consistent with increased cytokinin levels.
Example 15. Effect of Overexpression of AVP-1 on Callus Induction in Petunia Explants Method
Petunia explants were incubated on MS medium which consists of MS salts (Gibco BRL), 1 mg/L nicotinic acid, 1 mg/L pyrodoxin HC1, lmg/L thiamine, 100 mg/L myo-inositol, 3% sucrose, 1 mg/L 2,4-D(2,4-dichlorophenoxyacetic acid) and 0.5 mg/L 6- BA (6-benzylaminopurine). The medium was solidified with 0.7% agar and was adjusted to pH 5.8 before autoclave. The culture was incubated at 25oC in the dark in a growth chamber. Results
Transgenic petunia explants (35-S AVP-1) demonstrated significantly enhanced callus induction at 6 weeks of incubation as demonstrated in Fig. 15.
Example 16: Effect of Overexpression of AVP-1 on Shoot Regeneration From Leave Segments
Leave segments grown in appropriate medium are known to be capable of generating shoot growth. A study was undertaken to determine the effect of overexpression of 35-S AVP-1 on shoot regeneration in Petunia leaves. Segments of leaves from regenerated transformed (35-S A VP-1) and control
Petunia were used as explants for shoot regeneration. The leaves were cut with a sharp surgical blade into about 1 cm wide pieces. The explants were cultured in MS medium which included MS salts (Gibco), B5 vitamins (1 mg/L nicotinic acid, 1 mg/L pyrodoxin HC1, 1 mg/L-thiamine and 100 mg/L myo-inositol), 3% sucrose, 2 mg L 6- benzylaminopurine and 0.01 mg/L napthaleneacitic acid, 0.7% agar, pH 5.8. The cultured segments were incubated at 25°C under cool white fluorescent light in a 16 h light/8 h dark period cycle.
As shown in Fig. 12, petunia leaves transformed with the AVP-1 gene (35- S AVP-1 petri dish) under a constitutive promoter show an enhanced shoot regeneration capability over wild-type petunia leave segment (WT) similar to results with transgenic Arabidopsis plants. These results are consistent with the idea that overexpression of this vacuolar proton pump will improve the shoot regeneration capacity of any plant.
A blast search using AVP-1 ORF as a probe showed this gene is highly conserved (rice = 86% identities; tobacco = 89% identities; barley = 86% identities; Vitis vinifera (grapes) = 82% identities, Hordeum vulgare (barley) = 86% identities and Zea mays (corn) = 90% identities). The latter indicates that overexpression of the AVP-1 gene would similarly cause such effects in other plant types. Example 17 : Effect of Overexpression of AVP- 1 on Shoot and Root Regeneration From Arabidopsis Cotyledons
With appropriate medium, it is known that shoots and roots may be , regenerated from cotyledons. Shoot and root regeneration from cotyledons was adjudged for wild-type (WT) and AVP-1 transgenic Arabidopsis (V and ).
Five (5) day old cotyledons were used as explants for regeneration. Explants were incubated on shoot induction medium (SIM) at 20°C under 16 h light/8 h dark period. The SIM contained MS salts (Gibco), B5 vitamins including 1 mg/L nicotinic acid, 1 mg L pyrodoxin HC1, 1 mg 1-thiamine, and 100 mgL myoinositol, 3% sucrose, 1 mg/L 6-(gama-gama-dimethylallylamino)purine riboside (2-iP) and 0.1 mg/L naphtaleneacitic acid and solidified with 0.7% agar. The pH of the medium was adjusted to 5.8. 2-iP was filter-sterilized and added to the medium after autoclave.
As is evidenced in the pictures of Figs. 13 A and 13B, explants from transgenic plants (1' and 2') regenerate shoots and roots at a higher frequency and earlier than wild type (WT) , consistent with a higher meristematic competence. The evidence of difference between the transformed and wild-type cotyledons was dramatically evidenced at day 23 (Fig. 13A) and more so 37 days into culturing (Fig. 735).
Example 18: Effect of overexpression of AVP-1 on Shoot Regeneration from Root and Cotyledon Explants in Arabidopsis Plants
Root and cotyledon (5 days old) explants from wild-type (WT) and transgenic (1' and 2') AVP-1 overexpressing Arabidopsis plants were placed in the shoot induction medium as discribed in Example. 16. As evidenced in Fig. 6, explants from the transgenic plants (1' and ) generated new structure earlier than wild type consistent with a higher merstematic compentence.
Example 19: Isolation Of Mutants In The Transporters Genetic approaches are very powerful in analyzing complex biological traits (Serrano, R., Crit. Rev. Plant Sci., 73:121-138 (1994)) Reverse genetics is a very important new tool for plant biologists. The generation of a good collection of tagged knockouts by Sussman and coworkers (Krysan, P., et al, Proc. Natl. Acad. Sci. USA, 93:8145-8150 (1996)) has open a very important avenue for the analysis of gene disruptions in Arabidopsis.
The Arabidopsis Knock-out Facility of the University of Wisconsin Madison (world wide web at biotech.wisc.edu/NewServicesAndResearch /Arabidopsis) may be used to search among the 60,480 Arabidopsis (ecotype WS) lines that have been transformed with the T-DNA vector pD991 for the presence of T-DNA inserts within -4tCLC-c, AtCLC-d, AVPl, _4tNHXl and their homologues. The phenotypes of the above knock-outs will shed light towards the understanding of the physiological roles of these transporters in normal and stress conditions. An initial characterization of the knockout plants includes testing for their salt tolerance and their Na+/K+ ratios. The generation of double knock-outs via crosses help to further understand the interaction among the transporters as well as the crosses with the 35S AVPl and the 35S AtNHXl transgenic plants.
To search for Arabidopsis knock-out PCR primers may be designed following the guidelines detailed in the University of Wisconsin web site. Tested primers may be sent to UW-Madison, where 62 PCR reactions that are sent to us for Southern blot analysis may be performed. Positive PCR products are sequenced. If the sequence reveals that there is a T-DNA inserted within the gene the gene specific primers are sent for another set of PCR reactions in order to determine which of the 9 possible pools of 225 contains the knockout. After identifying the pool of interest, 25 tubes of < seeds are screened for the individual plant carrying the T-DNA knock-out.
Example 20: Cation Detoxification In Plant Cells
The studies described herein together with other evidence strongly indicate that yeast and plants share pathways and signals for the trafficking of vesicles from Golgi network to the vacuole (Gaxiola, R., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999); Marty, F., "The Biogenesis of Vacuoles: Insights from Microscopy. In: The Plant Vacuole, 1-42, Leigh, R.A. and Sanders, D., Academic Press, San Diego (1997); Bassham, D.C., et al, Plant Physiol, 777:407-415 (1998)). Without wishing to be bound by theory, it is believe likely by the present inventor that in both systems a pre-vacuolar compartment is a dynamic entity that detoxifies the cytoplasm from toxic cations and delivers its cargo either to the vacuole, or directly to the cell exterior. Both the gefl chloride channel and Nhxl Na+/H+ exchanger have been localized to the yeast pre-vacuolar compartment (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999)). The behavior of the gefl-GFP chimera in yeast cells in vivo have been monitored indicating that its localization varies depending the environmental conditions. Furthermore, it has been shown that two of the four A. thaliana CLC chloride channel genes CLC-c and -d are capable of suppressing gefl mutant phenotypes implying a similar localization (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998)).
In order to understand how and where this cation detoxification takes place in plant cells the intracellular localization of GFP chimeras of AVPl, AtNHXl and AtCLC-c and -d (Hong, B., et al, Plant Physiol, 779:1165-1175 (1999)) may be monitored in vivo. Confocal microscopy may be also used to address co-localization of the different transporters. For this purpose HA-tagged versions or antibodies of the transporters under study are required (Guiltinan, M.J., et al, Meth. Cell Biol, 49:143-151 (1995); Jauh, G. -Y., et al, Plant Cell, 77:1867-1882 (1999); Mullen, R.T., et al.., Plant. J., 72:313-322 (1997)).
For the constructions of the GFP-chimeras the soluble versions GFP with improved fluorescence in A. thaliana reported by Davis and Viestra (Davies, S.J., Viestra, R.D., "Soluble derivatives of green fluorescent protein (GFP) for use in Arabidopsis thaliana, http:/ / brindabella.rnrc-lmb.cam.ac.uk/IndexGFP.html (1998)) may be used. Two types of GFP-chimeras may be made, namely a set under the regulation of the native promoter and another set under the regulation of the 35 S promoter. The resulting T-DNA vectors containing the GFP-chimeras are transformed into Agrobacterium tumefaciens strain GV3101 via electroporation, and used for subsequent vacuum infiltration of Arabidopsis thaliana ecotype Columbia (Bechtold, N., et al, C.R. Jeances Acad. Sci. Ser. Ill Sci. Vie, 376:1194-1199 (1993)). For the hemagglutinin (HA) epitope tagging a PCR strategy designed for yeast but modified to tag plant genes expressed in yeast vectors may be used. Futcher and coworkers designed vectors containing the URA3 yeast gene flanked by direct repeats of epitope tags (HA) (Schneider, B.L., et al, Yeast, 77:1265- 1274 (1995)). Via PCR the tag-URA3-tag cassette may be amplified such that the resulting PCR fragment possess homology at each end to the gene of interest. In vivo recombination in yeast can be then used to direct the integration of the PCR-chimera to the plasmid carrying the plant ORF of interest, transformants are selected by the URA4" phenotype. The URA3 gene can be "popped out" when positive transformants are grown in the presence of 5-fluoro-orotic acid. The vector carrying the plant gene has a selection marker different than the URA3 gene. In conclusion, the manipulation of vacuolar V-PPases in economically important crops could provide an important avenue for crop improvement. Drought and freeze tolerant cultivars could provide new agricultural approaches in areas lost due to drought or minimal rainfall, as well as to provide farmers with protection from unanticipated frosts (freezing rain etc.). Such crops may also be able to be raised on soils considered too saline for wild type crops.
While the invention has been described with respect to preferred embodiments, those skilled in the art will readily appreciate that various changes and/or modifications can be made to the invention without departing from the spirit or scope of the invention as defined by the appended claims. All references cited in this specification are herein incorporated by reference to the same extent as if each individual reference was specifically and individually indicated to be incorporated by reference.

Claims

What is claimed is:
1. A method of making a transgenic plant with increased meristematic activity comprising introducing into one or more cells of a plant exogenous nucleic acid which alters expression of vacuolar pyrophosphatase in the plant so to increase vacuolar pyrophosphatase activity, to yield transformed cells in the plant, thereby producing a transgenic plant which has increased meristematic activity.
2. The method of Claim 1 further comprising regenerating plants from the transformed cells to yield transgenic plants and selecting a transgenic plant which has increased meristematic activity, thereby producing a transgenic plant with improved meristematic activity.
3. The method of Claim 1 wherein the exogenous nucleic acid encodes AVPl or homologue thereof.
4. The method of Claim 3 wherein the AVPl or AVPl homologue is present in a construct designed to overexpress AVPl.
5. The method of Claim 4 wherein the construct comprises the AVPl gene or AVPl homologue is operably linked to a chimeric promoter designed to overexpress AVPl or homologue thereof.
6. The method of Claim 5 wherein the AVP 1 gene or homologue thereof is operably linked to a chimeric promoter selected from the group consisting of: tissue specfic promoters, constitutive promoters, inducible promoters and combinations thereof.
7. The method of Claim 5 wherein the AVPl gene or AVPl homologue is operably linked to a double tandem enhancer of a 35S promoter.
8. The method of Claim 3 wherein the AVPl, or homologue thereof, is derived from' a wild type plant.
9. The method of Claim 3 wherein the AVPl, or homologue thereof, is derived from a transgenic plant.
10. The method of Claim 3 wherein the AVPl, or homologue thereof, is derived from a mutant plant.
11. The method of Claim 3 wherein the AVPl, or homologue thereof, is synthetically derived.
12. The method of Claim 3 wherein the AVPl, or homologue thereof, is naturally and synthetically derived.
13. A transgenic plant produced by the method of Claim 1.
14. A method of making a transgenic plant with increased meristematic competence comprising introducing into one or more cells of a plant exogenous nucleic acid which alters expression of vacuolar pyrophosphatase so as to increase vacuolar pyrophosphatase activity in the plant to yield transformed cells in the plant, thereby producing a transgenic plant which has increased meristematic competence.
15. The method of Claim 14 further comprising regenerating plants from the transformed cells to yield transgenic plants and selecting a transgenic plant which
has increased meristematic activity, thereby producing a transgenic plant with improved meristematic activity.
16. The method of Claim 14 wherein the exogenous nucleic acid encodes AVPl or homologue thereof.
17. The method of Claim 16 wherein the AVPl or AVPl homologue is present in a construct designed to overexpress AVPl.
18. The method of Claim 17 wherein the construct comprises the AVPl gene or AVPl homologue is operably linked to a chimeric promoter designed to overexpress AVPl or homologue thereof.
19. The method of Claim 18 wherein the AVP 1 gene or homologue thereof is operably linked to a chimeric promoter selected from the group consisting of: tissue specfic promoters, constitutive promoters, inducible promoters and combinations thereof.
20. The method of Claim 18 wherein the AVPl gene or AVPl homologue is operably linked to a double tandem enhancer of a 35S promoter.
21. The method of Claim 16 wherein the AVPl , or homologue thereof, is derived from a wild type plant.
22. The method of Claim 16 wherein the AVP 1 , or homologue thereof, is derived from a transgenic plant.
23. The method of Claim 16 wherein the AVP 1 , or homologue thereof, is derived from a mutant plant.
24. The method of Claim 16 wherein the AVP 1 , or homologue thereof, is synthetically derived.
25. The method of Claim 16 wherein the AVP 1 , or homologue thereof, is naturally and synthetically derived.
26. A method of making a transgenic plant with increased biomass comprising introducing into one or more cells of a plant a nucleic acid construct which alters expression of vacuolar pyrophosphatase so as to increase vacuolar pyrophosphatase activity in the cell to yield transformed cells thereby producing a transgenic plant with increased biomass.
27. The method of Claim 26 further comprising regenerating plants from the transformed cells to yield transgenic plants and selecting a transgenic plant with increased biomass.
28. A transgenic plant produced by the method of Claim 26
29. A method of making a transgenic plant with an increased biomass over its corresponding wild type plant, wherein the increased biomass relates to an increase in the biomass of a plant part selected from the group consisting of: leaves, stems, roots, seeds, flowers, and fruits, said method comprising introducing into one or more cells of a plant, an exogenous nucleic acid which alters expression of vacuolar pyrophosphatase such so as to enhance the activity of the vacuolar pyrophosphatase in the plant to yield transformed cells, thereby producing a transgenic plant with an increased biomass.
30. The method of Claim 29 further comprising regenerating plants from the transformed cells to yield transgenic plants and selecting a transgenic plant which is larger than its corresponding wild type plant, thereby producing a transgenic plant with an increased biomass.
31. The method of Claim 29 wherein the exogenous nucleic acid encodes AVPl, or homologue thereof.
32. The method of Claim 31 wherein the AVPl, or homologue thereof, is present in a construct designed to overexpress AVPl, or homologue thereof.
33. The method of Claim 32 wherein the construct comprises the AVPl gene, or homologue thereof, operably linked to a chimeric promoter designed to- overexpress AVPl.
34. The method of Claim 33 wherein the AVPl gene or homologue thereof is Operably linked to a chimeric promoter selected from the group consisting of: tissue specfic promoters, constitutive promoters, inducible promoters and combinations thereof
35. The method of Claim 32 wherein the AVPl gene, or homologue thereof, is operably linked to a double tandem enhancer of a 35S promoter.
36. The method of Claim 31 wherein the AVPl , or homologue thereof, is derived from a wild type plant.
37. The method of Claim 31 wherein the AVPl, or homologue thereof, is derived from a transgenic plant.
38. The method of Claim 31 wherein the AVPl, or homologue thereof, is derived from a mutant plant.
39. The method of Claim 29 wherein the transgenic plant is grown in soil.
40. The method of Claim 29 wherein the transgenic plant is grown hydroponically.
41. The method of Claim 29 wherein a cell from the transgenic plant is grown in culture.
42. A transgenic plant produced by the method of Claim 29.
43. A method of producing a transgenic plant with a stem structure thicker than wild type comprising introducing into one or more cells of a plant exogenous nucleic acid which alters expression of vacuolar pyrophosphatase so as to increase vacuolar pyrophosphatase activity in the plant to yield transformed cells, thereby producing a fransgenic plant with a thickened stem structure.
44. The method of claim 43 wherein the stem structure is selected from group consisting of: wood, bark and cambium.
45. The method of Claim 43 further comprising regenerating plants from the transformed cells to yield transgenic plants and selecting a transgenic plant with a thickened stem structure, thereby producing a transgenic plant with thickened stem structure.
46. A method of making a transgenic plant having increased root structure compared to its corresponding wild type plant comprising introducing into one or more cells of a exogenous nucleic acid which alters expression of vacuolar pyrophosphatase so as to increase vacuolar pyrophosphatase activity in the plant to yield transformed cells, thereby producing a transgenic plant having increased root structure.
47. The method of Claim 46 wherein the exogenous nucleic acid encodes AVPl, or homologue thereof.
48. A transgenic plant produced by the method of Claim 46.
49. A method of making a transgenic plant having increased shoot regeneration capacity as compared to its corresponding wild type plant comprising introducing into one or more cells of a plant nucleic acid which alters expression of vacuolar pyrophosphatase so as to increase vacuolar pyrophosphatase activity in the plant to yield fransformed cells, thereby producing a transgenic plant having increased shoot regeneration capacity.
50. The method of Claim 49 further comprising regenerating plants from the fransformed cells to yield fransgemc plants and selecting a fransgenic plant which has increased shoot regeneration capacity, thereby producing a transgenic plant with improved shoot regeneration capacity.
51. The method of Claim 49 wherein the exogenous nucleic acid encodes AVPl, or homologue thereof.
52. The method of Claim 51 wherein the AVPl, or AVPl homologue, is present in a construct designed to overexpress AVPl.
53. The method of Claim 52 wherein the construct that comprises the AVPl gene or AVPl homologue is operably linked to a chimeric promoter designed to overexpress AVPl or homologue thereof.
54. The method of Claim 53 wherein the AVPl gene or homologue thereof is operably linked to a chimeric promoter selected from the group consisting of: tissue specfic promoters, constitutive promoters, inducible promoters and combinations thereof.
55. The method of Claim 53 wherein the AVPl gene or AVPl homologue is operably linked to a double tandem enhancer of a 35S promoter.
56. The method of Claim 52 wherein the AVPl , or homologue thereof, is derived from a wild type plant.
57. The method of Claim 52 wherein the AVP 1 , or homologue thereof, is derived from a fransgenic plant.
58. The method of Claim 52 wherein the AVPl, or homologue thereof, is derived from a mutant plant.
59. The method of Claim 52 wherein the AVP 1 , or homologue thereof, is synthetically derived.
60. The method of Claim 52 wherein the AVPl, or homologue thereof, is naturally and synthetically derived.
61. A transgenic plant produced by the method of Claim 49.
62. A method of making a transgenic plant having increased root regeneration capacity as compared to its corresponding wild type plant comprising introducing into one or more cells of a plant nucleic acid which alters expression of vacuolar pyrophosphatase so as to increase vacuolar pyrophosphatase activity in the plant to yield transformed cells, thereby producing a fransgenic plant having increased root structure.
63. The method of Claim 62 further comprising regenerating plants from the transformed cells to yield transgenic plants and selecting a transgenic plant which has increased root regeneration capacity, thereby producing a transgenic plant with improved root regeneration capacity.
64. The method of Claim 62 wherein the exogenous nucleic acid encodes AVPl, or homologue thereof.
65. The method of Claim 64 wherein the AVPl, or AVPl homologue, is present in a construct designed to overexpress AVPl.
66. The method of Claim 65 wherein the construct that comprises the AVPl gene or AVPl homologue is operably linked to a chimeric promoter designed to overexpress AVPl or homologue thereof.
67. The method of Claim 66 wherein the AVPl gene or homologue thereof is operably linked to a chimeric promoter selected from the group consisting of: tissue specfic promoters, constitutive promoters, inducible promoters and combinations thereof.
68. The method of Claim 64 wherein the AVPl gene or AVPl homologue is operably linked to a double tandem enhancer of a 35S promoter.
69. The method of Claim 64 wherein the AVP 1 , or homologue thereof, is derived from a wild type plant.
70. The method of Claim 64 wherein the AVP 1 , or homologue thereof, is derived from a transgenic plant.
71. The method of Claim 64 wherein the AVP 1 , or homologue thereof, is derived from a mutant plant.
72. The method of Claim 64 wherein the AVPl , or homologue thereof, is synthetically derived.
73. The method of Claim 64 wherein the AVP 1 , or homologue thereof, is naturally and synthetically derived.
74. A transgenic plant produced by the method of Claim 62.
EP01924311A 2000-08-18 2001-03-24 INCREASED MERISTEMATIC ACTIVITY AND COMPETENCE BY OVER-EXPRESSION OF TONOPLASTIC PYROPHOSPHATASE Withdrawn EP1315410A4 (en)

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
US22622300P 2000-08-18 2000-08-18
US226223P 2000-08-18
US64403900A 2000-08-22 2000-08-22
US644039 2000-08-22
PCT/US2000/030955 WO2001033945A1 (en) 1999-11-10 2000-11-10 Stress-resistant oversized transgenic plants capable of growing in salinized soil
WOPCT/US00/30955 2000-11-10
PCT/US2001/009548 WO2002015674A1 (en) 2000-08-18 2001-03-24 Enhanced meristematic activity and competence by overexpression of tonoplast pyrophosphatase

Publications (2)

Publication Number Publication Date
EP1315410A1 true EP1315410A1 (en) 2003-06-04
EP1315410A4 EP1315410A4 (en) 2004-06-23

Family

ID=30002737

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01924311A Withdrawn EP1315410A4 (en) 2000-08-18 2001-03-24 INCREASED MERISTEMATIC ACTIVITY AND COMPETENCE BY OVER-EXPRESSION OF TONOPLASTIC PYROPHOSPHATASE

Country Status (5)

Country Link
EP (1) EP1315410A4 (en)
CN (1) CN1469705A (en)
AU (2) AU5097401A (en)
BR (1) BR0113466A (en)
CA (1) CA2418127A1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101457234A (en) * 2007-12-14 2009-06-17 中国科学院遗传与发育生物学研究所 Method for improving plant products and expression box thereof
US9238819B2 (en) * 2011-05-04 2016-01-19 Versitech Limited Method for speeding up plant growth and improving yield by altering expression levels of kinases and phosphatases

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU8604898A (en) * 1997-07-30 1999-02-22 Purdue Research Foundation Transgenic plants tolerant of salinity stress
CA2323756C (en) * 1998-03-18 2010-09-21 Eduardo Blumwald Genetic engineering salt tolerance in crop plants
IL124653A0 (en) * 1998-05-26 1998-12-06 Yeda Res & Dev Magnesium-proton exchanger and transgenic plants expressing same

Also Published As

Publication number Publication date
EP1315410A4 (en) 2004-06-23
AU2001250974C1 (en) 2008-10-30
AU2001250974B2 (en) 2007-06-21
AU5097401A (en) 2002-03-04
CN1469705A (en) 2004-01-21
CA2418127A1 (en) 2002-02-28
BR0113466A (en) 2004-02-17

Similar Documents

Publication Publication Date Title
US8003852B2 (en) Transgenic plants overexpressing a plant vacuolar pyrophosphatase
US8058515B2 (en) Plant cells and plants overexpressing vacuolar proton pyrophosphatases
AU782483B2 (en) Stress-resistant oversized transgenic plants capable of growing in salinized soil
Aharon et al. Characterization of a family of vacuolar Na+/H+ antiporters in Arabidopsis thaliana
US7041875B1 (en) Genetic engineering salt tolerance in crop plants
US8697950B2 (en) Vacuolar pyrophosphatases and uses in plants
WO1999047679A2 (en) Genetic engineering salt tolerance in crop plants
CN107105627A (en) The method improved for monocotyledon
CN102348803A (en) Drought tolerant plants and methods involving genes encoding type c3hc4 ring finger zinc-finger family polypeptides
AU2001250974C1 (en) Enhanced meristematic activity and competence by overexpression of tonoplast pyrophosphatase
WO2002015674A1 (en) Enhanced meristematic activity and competence by overexpression of tonoplast pyrophosphatase
US20050028235A1 (en) Plant fruit with elevated potassium levels
US7442852B2 (en) High salt plants and uses for bioremediation
AU2001250974A1 (en) Enhanced meristematic activity and competence by overexpression of tonoplast pyrophosphatase
NZ524616A (en) Enhanced meristematic activity and competence by overexpression of tonoplast pyrophosphatase
US20110016579A1 (en) Gene of transporter selective to mugineic acid-iron complex
CN111205355B (en) Plant stress tolerance-related protein SiWRKY76 and its encoding gene and application
AU2001285459B9 (en) Methods for imparting desirable phenotypic traits, including drought, freeze, and high salt tolerance and methods for increasing seed production
CN113136389A (en) Genetic engineering application of gene GhCLcg-1A and/or gene GhCLcg-1D
CA2648516A1 (en) Abiotic stress tolerant gene from avicennia marina encoding a protein

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20030318

AK Designated contracting states

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

A4 Supplementary search report drawn up and despatched

Effective date: 20040507

RIC1 Information provided on ipc code assigned before grant

Ipc: 7C 12N 15/87 B

Ipc: 7C 12N 15/82 B

Ipc: 7C 12N 15/74 B

Ipc: 7C 12N 15/70 B

Ipc: 7C 12N 15/63 B

Ipc: 7C 12N 15/09 B

Ipc: 7C 12N 15/00 B

Ipc: 7C 07H 21/04 B

Ipc: 7A 01H 5/00 B

Ipc: 7A 01H 1/00 A

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20041001