CA2648516A1 - Abiotic stress tolerant gene from avicennia marina encoding a protein - Google Patents

Abstract

The present invention relates to an abiotic stress tolerant transgenic plant comprising an Am244 DNA from Avicennia marina. The invention also relates to isolation and characterization of a cDNA corresponding to abiotic stress tolerant gene (Am244 DNA) from Avicennia marina. It further relates to a method for producing abiotic salt-tolerant transgenic plants, plant cells and plant tissues capable of over expressing the Am244 DNA thereby conferring abiotic stress tolerance such as salt, drought and dehydration to otherwise abiotic stress sensitive plant species.

Description

Abiotic stress tolerant gene from Avicennia zariizcc encoding a protein involved in salt tolerance FIELI) OF INVENTION

The present invention relates to transgenic plants exhibiting enhanced tolerance to abiotic stresses such as drought, salt and dehydration. In particular, the transgenic plant comprises an abiotic stress tolerant Am244 DNA derived from Avieeniiia iarina.
I3ACKGROUNI) Bnviroiuilenlal factors such as drought, extreme temperatures, high or fluctuating salinity can affect plant growth and performance and in the case of agronomically important plants this may translate to reduce yield. Increasing soil salinization in irrigated areas has necessitated the identif cation of crop traits or genes, which confer resistance to salinity, either by conventional breeding or through molecular biology techniques (Munns et al. 2002; Cushman and Bohnert 2000). IIyperosmotic stress, such as that caused by exposLire of cells to high concentrations of NaCl causes imbalance of cellular ions, change in turgor pressure and cell volume and alters the activity and stability of macromolecules. Although the basic cellular responses appear to be conserved among all plants, plant species employ a variety of inechanisms to cope with osmotic stress. While extensive work on salinity tolerance in Arabidopsis and Mesembryanthemum has led to the identification of candidate salinity sensitive determinants, these plants are not true halophytes (Zhu 2002; Chauhan et al.
2000).
Mangroves are facultative halophytes and exclude most of the salt in seawater.
In addition, some species such as A. tTaar=iyza actively secrete salt. Avicennia is a monotypic pantropical mangrove genus with eight species of which A. nnarina is widely distributed both latitudinally and longitudinally. The high salt tolerance of A. rnarina is a consequence of water use efficiency which balances the relation between carbon gains, water loss and ion uptake with the transpiration stream on a low but constant level. A.
inarina grows in coastal regions where the salt concentration can be as high as 9% (Rao 1987). Regulation of inorganic ions occurs partially by exclusion at the roots and also by excretion via salt glands, the excretion rate for sodium and chloride ions being 0.4 and 0.046 mol m-2 s-1 (Shimony et al. 1973; Boon and Allaway 1982). It is thus an ideal candidate plant for identifying genes conferring salt and drought tolerance.
SUMMARY OF TNVEN'T1ON

The present invention relates to an abiotic stress tolerant transgenic plant comprising Am244 DNA from Avicennia marina. In particular, the invention is directed to transgenic plants exhibiting enhanced tolerance to drougllt, salt and dehydration. The invention also relates to isolation and characterization of cDNA corresponding to abiotic stress tolerant gene (Am244 gene) derived from Avicennia mat-ina.
Further the invention also provides a method for producing abiotic stress-tolerant transgenic plants.

One aspect of the invention relates to an isolated nucleic acid molecule for enhanced tolerance to abiotic stress in a plant having a nucleotide seqtlence with at least 90%
homology to the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2, wllerein said sequence codes for a polypeptide having amino acid sequence as shown in SEQ ID NO: 3.

Another aspect of the invention relates to an isolated nucleic acid molecule for enhanced tolerance to abiotic stress in a plant, wherein said nucleic acid molecule comprises a nucleotide sequence as shown in SEQ ID NO: 1, or SEQ ID NO: 2.

Another aspect of the invention is a polypeptide having an ainino acid sequence as shown in SEQ ID NO: 3, whereuz said polypeptide is encoded by the nucleic acid molecule having polynucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO:
2.

Yet another aspect of the invention provides an expression cassette for ei-dzanced tolerance to abiotic stress in plant, wherein said expression cassette comprises the, nucleic acid molecule having polynucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 operably linlced to a plant expressible regulatory sequence.

Further the invention also provides a recombinant vector comprising the DNA
construct comprising the expression cassette, wherein said expression cassette comprises the nucleic acid molecule having polynucleotide sequence as shown in SEQ
ID NO: I or SEQ ID NO: 2 operably linked to a plant expressible regulatory sequence.

~
-~-Yet another aspect of the invention provides a recombinant host cell comprising the recombinant vector wherein the recombinant vector comprises the DNA construct comprising the expression cassette, said expression cassette comprises the nucleic acid molecule having polynucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO:

operably linked to a plant expressible regulatory sequence.

Yet another aspect of the invention relates to an abiotic stress tolerant transgenic plant or plant cell or plant tissue comprising a polynucleotide sequence as shown in SEQ ID
NO: 1 or SEQ ID NO: 2, wherein the expression of said nucleic acid molecule restilts in the enhanced tolerance to abiotic stress in said plant, plant cell and plant tissue thereof.

Furtl-ier aspect of the invention is directed to a method of producing an abiotic stress tolerant transgenic plant, said method comprising introducing nucleic acid molecule having polynucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 in plant genome by using transformation method, thereby producing abiotic stress tolerant transgenic plant.

BRIEF DESCRIPTION OF ACCOMPANYING 1)RAWYNGS

FIG 1 a: Expression pattern of the Am244 transcript in leaves and roots of A.
1yiarina seedlings under conditions of salinity stress (500mM NaCl/top panel) and ABA
treatment (100 M/bottom panel) at different time intervals.

FIG 1b: Expression pattern of the Am244 transcript in leaves and roots of A.
117ar ina seedlings under conditions of NaC1 (500mM), KC1 (500mM) and mannitol (800mM) treatment at different time intervals.

FIG 2: T-DNA segment of the plasmid pGFP-Ala-Am244-C 1.
FIG 3: T-DNA seginent of the pMyc-Am244-C 1.

FIG 4: Guard cells of pGFP-Ala-Am244-C1 transformed Nicotiana tabacum var.
Wisconsin 38 tobacco show localization of the green fluorescence at the plasma membrane and close to the cell wall.

X)ESCR.IPTION OF TC-IE INVENTION

The present invention relates to an abiotic stress tolcrant transgenic plants comprising Anz244 DNA from Avicennia inarina. In particular, the invention is directed to a transgenic plant exhibiting enhanced tolerance to drought, salt or dehydration. The invention also relates to isolation and characterization of a cDNA
corresponding to abiotic stress tolerant gene (Am244 DNA) derived from Avicennia marina.
Further the invention is also directed to a method for producing the abiotic stress-tolerant transgenic plaiits.

One embodiment of the present invention relates to an isolated nucleic acid molecule for enhanced tolerance to abiotic stress in plant having a nucleotide sequence with at least 90% homology to the nucleotide seclucnce set forth in SEQ ID NO: 1 or SEQ ID
NO: 2, wherein said sequence codes for a polypeptide having amino acid sequence as shown in SEQ ID NO: 3.

Yet another embodiment of the invention relates to the isolated nucleic acid molecule having nucleotide sequence as shown in SEQ ID NO: 1.

Yet another embodiment of the invention relates to the isolated nucleic acid molecule having nucleotide sequence as shown in SEQ ID NO: 2.

Still another embodiment of the invention is directed to an isolated nucleic acid molecule encoding a polypeptide comprising an amino acid sequence as shown in SEQ
ID NO: 3.

Still yet another embodiment of the invention relates to a polypeptide having an amino acid sequence as shown in SEQ ID NO: 3, wherein said polypeptide is encoded by the nucleic acid of the present invention.

In another embodiment the invention provides the isolated nucleic acid molecule having nucleotide sequence as shown in SEQ ID NO: 1 and SEQ ID NO: 2 for enhanced tolerance to abiotic stress such as drought stress, salt stress and dehydration stress in plants.

In yet another embodiment the invention relates to an expression cassette for conferring enlianced tolerance to abiotic stress in a plant, wherein said expression cassette comprises the aforemenfioned nucleic acid molecule operably linked to a plant expressible regulatoiy sequence.

Further embodiment provides the regulatory sequence such as CaMV 35S, NOS, OCS, Adhl, AdhII and Ubi-1.

Additional embodiment of the invention relates to a DNA construct comprising the expression cassette having nucleic acid molecule as set forth in SEQ ID NO: 1 or SEQ
ID NO: 2, Aforementioned DNA construct further comprising another expression cassette comprising a selectable marker gene operably linked to the regulatory sequenee.

The selectable marlcer' gene such as nptll, hptll, pat and bar can be used for the selection ofthe transformed plant, plant cell and plant tissues thereof.

Yet another embodiment of the invention provides the DNA construct further comprising another expression cassette coinprising a scorable marker gene selected from a group consisting of GUS, GFP, LUC and CAT operably liiilced to the regulatory sequence.

Yet another embodinlent of the invention discloses a recombinant vector comprising the aforementioned DNA constructs wherein the constructs comprises the nucleic acid molecule having polynucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO:
2.

Further embodiment of the invention provides the recombinant plant transformation vector comprising the nucleic acid molecule having polynucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2.

Still another embodiment of the invention relates to a recombinant host cell comprising the recombinant vector comprising the nucleic acid molecule having polynucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2, wherein the host cell can be prokaryotic or eukaryotic cell such as E. coli or Agrobacterizrm or plant cell.

Various strains of E. coli luiown in the art such as JMIOI, DH5a, BL21, HBI01, and XLI-Blue can be used for the production of recombinant E. coli cell comprising the nticleic acid molecule having polynucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2.

Yet additional embodiment of the invention provides recombinant Agl=obcreterizrm cells comprising the nucleic acid molecule having polynucleotide sequence as shown in SEQ
ID NO: 1 or SEQ ID NO: 2.

Different Agr-obacterium strains provided in the art for example LBA4404, EHA101, EIIA105, GV3101 and A281 may be tised for the production of the recombinant Agrobactel iz1rra.

Additional embodiment of the invention provides a plant cell comprising the nucleic acid molecule having polynucleotide sequence as shown in SEQ ID NO: 1 or SEQ
ID
NO: 2.

In one preferred embodiment the invention provides an abiotic stress tolerant transgenic plant or plant cell or plant tissue comprising the nucleic acid molecule of the present invention, wherein the expression of the said nucleic acid inolecule results in ei-ilianced tolerance to abiotic stress in said plant, plant cell and plant tissue.
Further it also provides the progeny derived from the transgenic plants and seeds produced from them.
Yet another preferred embodiment of the invention is directed to a method of producing an abiotic stress tolerant transgenic plant, said method comprising introducing nucleic acid molecule as shown in SEQ ID NO: 1 or SEQ ID NO: 2 in plant genome by using transformation method, thereby producing abiotic stress tolerant transgenic plant.

Still another preferred embodiment of the invention relates to the transformation methods used to develop abiotic stress tolerant transgenic plants.

Plant transformation can be carried out by several methods already known in the art such as Agrobactei^izrn1 mediated transformation, particle bombardment, vacuum-infiltration, in planta transfonmation and chemical methods.

Further embodiment of the invention is directed to an Agrobacteriurra mediated transformation method for producing abiotic stress tolerant transgenic plant, said method comprising:

a) obtaining suitable explants from a plant;

b) constructing the recombinant vector as described in the instant invention;

c) mobilizing said vector in an Agrobcrcteriurn cell to produce a recombinant Agrobercterium cell;

d) co-cultivating said explants with said reconibinant Agrobcrcteri11177 cell to produce transformed plant cells, e) culturing said transformed plant cells to produce abiotic stress-tolerant transgenic plant.

Plants suitable for transformation with the vectors of the invention can be a monocotyledonous and dicotyledonous plant. The monocotyledonous plant is selected from a group consisting of rice, maize, wheat, barley and sorghum. Further the monocotyledonous plant is a rice plant. The dicotyledonous plant is selected from a group consisting of tobacco, tomato, pea, soybean, Brassica, olcra, chickpea and pigeon pea. The dicotyledonous plant is a tobacco plant.

A broad range of other monocotyledonous or a dicotyledonous plant including cereal crops, pulse crops, vegetables, and other crops can also be used.

Examples of the nionocotyledonous plant include wheat, rice, barley, maize, oats, millets, sorghum, sugarcane and rye.

Examples of dicotyledonous plant includes pea, chickpea, tobacco, pigeonpea, Arabidopsis, soybean, brinjal, toma.to, cucumber, brassicas, cauliflower, cabbage, cotton.

Still another preferred embodilnent of the invention relates to the explants used for transformation. Further they are selected from a group consisting of cotyledons, hypocotyls, leaves, anthers, callus, cotyledonary nodes, stems and roots.

Abiotic stress tolerant gene designated as A771244 gene derived from A.
7ncrr'Incr, belongs to the uncharacterized upf0057 family of putative plasma membrane proteins and is found to be strongly upregulated in the present study in response to abiotic stresses. As with Am244, hoinologous genes identified in other plant species have also been associated with abiotic stress response -and this has also been observed for Sacclzaronzyees. In the salt stress tolerant Lophopyr=um, ESI3 was upregulated witllin 2 -g -hours of treatment with 250 mM NaC1 and also by treatment with KCI, ABA and osmotic shock (Gulick et al, 1994). The Phytophthora Ricl gene has been shown to be induced by extremes of pII as well as NaCI treatment (van West et al, 1999).
Sczcchar=oniyces PMP3 transcript is rapidly and strongly upregulated (17 fold) within 10 minutes of treatnzent growth in 1M NaCI (Yale and Bohnert, 2001). Further, deletion of the yeast homolog, PMP3 causes salt sensitivity and inembrane hyperpolarization and expression of Ai abidopsis RCI2A cDNA can complement the pmp3 deletion mtttant, indicating that the plant and yeast proteins have similar funetions during high salt stress.

A preferred embodiment of the present invention relates to plant growth conditions and RNA and DNA isolation. Seeds of A. rnarincc collected from their natural mangrove habitat Pichavaram, Tamil Nadu, India. Seeds were grown in sand-filled trays in the green house at 37 C and 12 h light/dark photoperiod (illuminated from 06:00 to 18:00) in near-submergence conditions and watered daily.

Leaf tissue was harvested and total RNA was isolated according to the method given by Chomezynski & Sacchi, 987. RNA isolation can also be carried out by other methods known in art. Total niRNA can also be extracted using such laiown protocols optimized for isolation of plant RNA using TRIZOL method. The RNA isolation from A. 7nar ina seedling can also be carried out using commercially available plant RNA
isolation kits.
Details of growth conditions and RNA isolation are given in Example 1 Yet another embodiment of the present invention is directed to a eDNA library eonstruetion. The method for synthesis of eDNA and cloning in suitable vectors are well known in art. Several kits are available for cDNA synthesis from (A+) enriched RNA and well known to the person skilled in the art. Kits for cloning cDNA
inserts both directionally and randomly are also well luiown and can be employed. Many kinds of commercially available vectors can alternatively be used for library preparation such as k gt10 and kgtll. The ligated cDNA library was transformed into E. coli DII5a.
For ftirther details see Example 2. A library of approximately 105 recombinants was obtained (Parani M, 1999). Plasmid DNA from several randomly selected clones was extracted by alkaline lysis (Feliciello and Chinali 1993). The DNA sequence of the selected clones was determined by using conventional methods of sequencing to generate expressed sequenced tags (ESTs). 10-12 ESTs were randomly selected and analysed for expression (Northern) under salinity stress conditions (0.5M
NaCI) in Avicennia marina. One of these genes was found to be up-regulated in both leaves and roots of ~lvicennia nzarina under salinity stress. The clone was designated as Am244 and was selected for ftirther analysis. For details see Exaniple 2.

The polynucleoticle sequence of eDNA ofAin244 gene is shown in SEQ ID NO: 1.
The eDNA oPA ?244 gene is 600 bp in length and encodes a protein consisting of 57 amino acids (SEQ ID NO: 3). The nucleotide sequence ORF of Am244 cDNA is given in SEQ
ID NO: 2.

Yet another embodiment relates to the expression analysis of Am244 gene in response to diverse abiotic stresses. Regulation of Am244 gene was analyzed by, studying the effect of various abiotic stresses such as NaC1, KCI, ABA and Mannitol. Total RNA
was isolated from the plants subjected to various stress condition according to the method given by Chomezynski and Saechi, 1987 and northern analysis was carried out.
Details are provided in Example 3. Am244 was identified to be upregulated for salt, ABA and drought stress. See FIG la and lb.

Additional embodiment provides the BLAST analysis of Am244 protein. The Am244 protein sequence compared with the protein sequences available in various databases for searching the homology with other related protein sequence wliich show up-regulation in response to abiotic stress conditions. Details are given in Example 4.

Yet another embodiment of the present invention is directed towards GFP fusion with Am244 eDNA (GFP-Alanineln-Am244) and construction of plant transformation vector comprising a fragment comprising of GFP (Green Fluorescent protein) with a flexible (Alanine) 10 linker to the N-terminus of the Am244 ORF (SEQ ID NO: 2). This was accomplished by Splice Overlap Extension (SOEing). (See FIG 2). Such expression or recombinant vectors may be constructed by methods lalown in the art.

Various recombinant vectors comprising GFP gene fiised to Am244 ORF having nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 operably liiilced to the regulatory sequences such as CaMV 35S, NOS, OCS, Adhl, AdhII and Ubi-l.
Details are provided in Example 5.

Still yet another embodiment of the invention provides epitope tagging of the Am244 gene. The Am244 ORF codes for a small protein of 57 amino acids of wbich a substantial part is buried in the plasma membrane as two transmembrane domains.
Raising antibodies against membrane spanning proteins is not easy. This can be circumvented liy epitope tagging of the Am244 ORF.

Epitope tagging is a versatile tool used to study proteins, wherein a well characterized peptide tag is fiised in-frame with tlie protein open reading frame (ORF) using recombinant DNA techniques. Epitope tagging can be used to characterize proteins (especially specific members of multigene families), determine subcellular localization, establish topology of membrane proteins, identify interacting partners and track movement within the celt. Epitope-specific commercial antibodies (usually monoclonal) can be then used to address questions about protein localization and function. The c-myc epitope is a well characterized one against which numerous commercially generated monoclonal antibodies are available. The 5' and 3' UTRs of the Am244 cDNA were not disturbed and by insertion mutagenesis using partially complementary primers a c-myc epitope was introduced at the N-terminus of the Am244 ORF. Detailed procedure is given in Example 6. (See FIG 3).

It involves mobilization of various recombinant plant transforination vectors as described . above and in the given cxamples into Agrobacterium t11777efaciens strain LBA4404 by the freeze-thaw method. Various other strains of Agrobacteriuan known in the art such as EHA101, EHA105, A281 may be used for the transformation. For details see Example 5. Yet another embodiment of the present invention is directed to a method for producing abiotic stress tolerant transgenic tobacco plant (Nicotiana tabaculn) cv. Petit Havana expressing Am244 DNA from A. mai iraa (See Example and 7 for details).

Other methods lcr-iown to persons skilled in the art can also be employed for Agr=obacteyium traiisformation. Apart from freeze thaw method, one may mobilize the vectors into the Agrobacterium strain also by electroporatiorr or tri-parental mating. All these techniques are well lazown in the art.

Similarly, transgcnie rice plant expressing the Arra2,44 gene fi=om A, r arincr was produccd by using the recombinant vectors disclosed in the invention by the transformation method known in the art. Details are given in Example 8.

Microscopy and Imaging of the leaf tissue of the transgenic tobacco and rice plant was carried out for the localization of GFP protein in the transgenic plant tissue. Details are given in Example 9. (See FIG 4).

One embodiment of the invention provides the screening of presence Am244 DNA
in transgenic tobacco and rice by PCR using gene specific primers. Othcr methods well known to persons skilled in the art can also be employed.

Another- einbodiment of the invention relates to confirming the integration of DNA in single copy in transgenic tobacco and rice by southern hybridization method (Sambrook et al. 2001). For details see Example 7.

Further embodiment of the invention provides the expression analysis of the transgenic tobacco and rice plants subjected to various abiotic stress treatments. For details refer L,xample 10.

EXAMPLES
'fhe examples given are merely illustrative of the uses, processes and products claimed in this invention, and the practice of the invention itself is not restricted to or by the examples described.

Plant Growth Conditions Seeds were grown in sand-filled trays in the green house at 37 C and 12 h light/dark photoperiod (illuminated from 6hrs to 18hrs) in near-submergence conditions and watered daily. One-month-old A. mczi=ina seedlings (four-leaf stage) were acclimatized for 72 hours in 0.5 X Murashige & Skoog (MS) medium (no pH adjustment).
Subsequently the plants were transferred into 0.5X MS medium supplemented with 0.5M NaCI for 48 hours.

RNA Isolation Leaf and root tissue from plants grown under conditions as mentioned above was harvested and total RNA was isolated according to the method given by Chomczynski and Sacchi, 1987. Leaf and root tissue was harvested from pooled plants and f'ive grams of tissue was macerated in liquid nitrogen and suspended in 18 ml of RNA
extraction buffer. To the slurry, 1.8 ml of 2 M sodium acetate (pH 4.0), 18 ml of water saturated phenol and 3.6 ml of 49:1 chloroform: isoamyl alcohol were seqtientially added and mixed by inversion. The contents were mixed and cooled on ice for 15 minutes.
Finally, the suspension was centriftlged at 10,000 x g for 10 minutes at 4 C.
After centrifugation, the aqueous pliase was -transferred to a fresh tube and mixed with equal volume of ice-cold isopropanol and incubated at -20 C for overnight. The samples were centriftiged at 10,000 x g for 20 minutes at 4 C and the pellet was dissolved in 5 ml of RNA extraction buffer. The RNA was again re-precipitated with equal volume of ice-cold isopropanol. 'The pellet was washed in 70% etlianol and finally dissolved in formamide. Purity of the RNA preparation was checked spectrophotometrically by measuring A260/A280 ratio as well as checked for integrity on a formaldehyde-MOPS
gel. An A260/A280 value between 1.8 and 2.0 suggested that the RNA was intact and pure. Finally, the total RNA in the sainples was estimated by measuring A260.
Poly (A) mRNA was isolated by affinity chromatography on oligo (dT)-cellulose as described by Sambrook et al. (1989).

eDNA library construction cDNA prepared from poly (A+) mRNA using Oligo-dT columns was size fractionated over SizeSep-400 spun column and directionally cloned in the Sal I(5') /Not I(3') sites of pSPORTI. The cDNA library was constructed using SuperScript II Reverse Transcriptase and primer-adapters for Sall and Noil enzyme sites enabling eDNA
inserts to be directionally cloned in plasmid vectors well lazown in art. The vector pSPORTI was utilized for cloning eDNA fragments. The common methods for eDNA
synthesis involve using poly (A}) RNA as a template for reverse transcription employing an oligo (dT) primer and a reverse transcriptase enzyme to synthesize first strand eDNA. These methods for synthesis of cDNA and cloning in suitable vectors are well known in art. The ligated eDNA library was transformed into E coli DI-I5-a strain. E coli transformation was carried out by the method well lclown in the art. A
library of approximately 105 recombinants was obtained (Parani M, 1999).
Plasmid DNA from approximately (-1800) randomly selected clones was extracted by alkaline lysis (Feliciello and China-li 1993). The DNA sequence of the selected clones was determined by single pass sequencing of the 5' end using M13 reverse primer and the BigDye Terminator method (ABI Prism 310 DNA sequencer, Applied Biosystems) to generate expressed sequenced tags (ESTs). 10-12 ESTs were randomly selected and analysed for expression (Northern) under salinity stress conditions (0.5M
NaCI) in Avicennia inarina. One of these genes was found to be up-regulated in both leaves and roots of Avicennia mar=ina under salinity stress. The clone was designated as Am244 and was used for further analysis. As a result of the sequence determination of the ftill length Am244 gene (SEQ ID NO: 1) it was found that cDNA was 600 bp in length.

Expression of Arn244 gene in response to diverse abiotic stresses NaCl stress One-month-old A. rnarin.a seedlings were conditioned for 72 hours in 0.5X MS
nutrient solution with the roots dipping in the solution. Subsequently, plants were stressed with 0.5X MS containing 0.5M NaCI and leaf and root tissue frozen at 6, 12, 24 and hours NaCl treatment and 12 and 24 hours after salt withdrawal. Leaf tissue was harvested and total RNA was isolated according to the method given by Chomczynski and Sacchi, 1987. The total RNA was then used for northern analysis.

Total RNA was isolated as mentioned before. Equal amounts of total RNA
(301.1g) were electrophoresed on a 1.5 % MOPS-formaldehyde gel, transferred to nylon membrane (I-Iybond-N, Amersham) and fixed by UV cross liillcing according to the manufacturers instructions. PCR amplified product Am244 was labeled by the random primer method (Rediprime, Amersham) using a32P-dCTP and used as probe. Radio-labeled probe were denatured and hybridized to the membrane at 65 C in an aqueous buffer (5X SSC, 5%
dextran sulphate, 0.05M Na-phosphate pH 7.2, 5X Denhardt's solution, 0.0025M

EDTA, 0.4% SDS and 100 g/mi salmon sperm DNA) for 12-16 h at 65 C and washed for 15 min each with 2X SSC, 0.1% SDS and 1X SSC, 0.1%SDS. IIybridization signals were observed on Kodak X ray films after 2-3 days of exposure.

In A. anarincr roots, Am244 was rapidly upregulated, peaking at 6 hotus of salt stress and being sustained thereafter up to 48 hours; upon withdrawal of the salt stress down regulation was also rapid. In the leaf however, the induction was more gradual and reached a peak at 48 hours of NaCl treatment; salt stress withdrawal did not bring about such a dramatic drop in the transcript level as was seen in the root. Fig la shows up regulation of Am244 in response to salt stress in roots and leaves of A.
nwrina. Am244 was then fully sequenced from both ends with universal M13F and M13R primers using the same BigDye terminator method mentioned above. The compiled Am244 sequence was then compared with those in the public database using BLASTX.

In one another experiment two month old A. nzarina seedlings were acclimatized in half strength MS salts for 2-3 days. Subsequently the seedlings were shill:ed to half strength MS salts supplemented with 500 mM NaCI. Leaf and root tissues were harvested prior to giving the stress (0 time point) and subsequently at intervals of 10', 20', 30', 60', two four and six hours after the application of NaCI stress. This stress application, unlike the previous one, was for a shorter time period. Total RNA was isolated as described previously. Northern blotting has been mentioned above.

In the leaf tissue of A. mar=ina seedlings, there was a marginal induction of Am244 transcript seen at 20' of NaC1 application which increased at 30' and was sustained at 60'. At 2 hours of NaCI application, the up-regulation of the Am244 transcript was four fold which was sustained up to 6 hours of stress examined. In the root tissue, the basal levels of expression of the Am244 transcript were higher than in leaf tissue.
Upon application of stress, a two fold induction of the transcript was seen at one hour of stress that was sustained up to six hours (see Fig lb).

Abscisic Acid stress For studying the effect of abscisic acid (ABA) treatment, one-montll-old A.
marina seedlings were acclimatized for 72 hours in 0.5X MS nutrient solution with the roots dipping in the solution. Subsequently, plants were treated with 0.5X MS
containing 100 M ABA and leaf and root tissue frozen at 6, 12, 24, 48 hours NaC.I treatment and 12 and 24 hours after salt withdrawal. This tissue was siinilarly used for RNA
isolation and subsequent Northern analysis.

As with salt stress, ABA treatment induced the Am244 gradually in the leaf tissue upon with maximum levels of transcript being observed at 48 hours of treatment. The expression level of the transcript dropped gradually with ABA withdrawal. In thc roots, ABA treatment brought about negligible changes in Am244 expression. Fig la shows expression profile of Am244 in response to ABA application in roots and leaves of A.
1?2aYil?a KC1 stress Two month old A. inrn ina seedlings were acclimatized in half strength MS
salts for 2-3 days. Subsequently the seedlings were shifted to half strength MS salts supplenzented with 500 mM KCI. Leaf and root tissues were harvested prior to giving the stress (0 time point) and subsequently at intervals of 6, 10 and 24 hours ail.er KC1 treatment.
Total RNA was isolated as described previously. Northern blotting has been mentioned before.

In the leaf tissue of A. niat-ina seedlings, there was a two-fold induction of the Am244 transcript at six hours of KCI treatment that was sustained up to 24 hours. In the root tissue, there was a one-fold induction of the transcript at 10 hours of KCI
treatment (Fig I b).

Mannitol stress Two month old A. inai ina seedlings were acclimatized in half strength MS
salts for 2-3 days. Subsequently the seedlings were shifted to half strengtll MS salts supplemented with 800 mM mannitol. Leaf and root tissues were harvested prior to giving the stress (0 time point) and subsequently at intervals of 6, 12 and 24 hours after marulitol treatment. Thereafter the seedlings were removed from the mannitol-containing medium and transferred to half strength MS salts only. Leaves and roots were harvested at 12 and 24 hours of mannitol withdrawal. Total RNA was isolated as described previously. Northern blotting has been mentioned before.

In the leaf tissue of A. nzurina seedlings, there was a three-fold induction of the Am244 transcript at 12 hours of mannitol treatment. Upon witlidrawal of mannitol fi=om the medium, transcript levels were seen to decline but not to basal levels (i.e.
prior to mannitol application). In the root tissue, mannitol treatment led to a two-fold increase in the Am244 transcript that was maintained at 24 hours. Upon withdrawal of the mannitol from the medium, the transcript levels dropped below basal levels (Fig lb).

In all the experiments carried out for studying the regulation of Am244 gene in various abiotic stress conditions in A. rnat ina the Am244 gene was found to be up-regulated.
Example 4 in silico sequence analysis of Am244 enNA

The Am244 cDNA sequence was subjected to BLASTX comparisons with the non-redundant protein database at the NCBI website (Altschul et al. 1990) to look for similarities for reported proteins. Protein translations fiom the nucleotide query sequence followed by amino acid sequence alignments for deduced protein against protein database is performed using BLASTX. The BLASTX algorithm uses the BLAST algorithm to compare the six-frame conceptual translation products of a nucleotide query sequence (both strands) against a protein sequence database.
Default parameters of the program were used in all cases. A minimum P cutoff value of (the probability that alignment would be generated randomly is 1<1000) was used to determine homology of Am244 to known proteins. The fitll length Am244 eDNA
(SEQ
ID NO: 1) sequence was analyzed for the presence of coinplete ORF using the ORF
Finder prograni at the NCBI website. AN ORF of 57 amino acids (SEQ ID NO: 3) was identified in the Am244 cDNA. The Am244 ORF sequence is shown in SEQ ID NO: 2.
This translated Am244 ORF was subjected to PSORT analysis to determine the presence of sorting signals within it Nakai and Horton, 1999). Similarly, HMMTOP
analysis was undertalcen to identify the presence of putative transmembrane segments (Tusnady and Simon, 1998). A search through the protein databases showed that homologs of the Am244 gene could be found in different groups including plants, animal fungi and bacteria, suggesting a common ancestor and a high degree of conservation tl-irougli evolution. Am244 exhibits extensive similarity to proteins from Arabidopsis (RC12A and RCI2B), barley (BLt101), wheat grass Lophopyrum (rS13)and to predicted proteins from bactcria(YqaE), fungi (Ricl), nematodes (T23F23) and yeast (PmP3/SnAl) and belongs to the uncharacterized upf0057 family of putative plasma membrane proteins. CLUSTALW was utilized for generating nntltiple sequence alignment of both the ftill length Am244 eDNA sequence as well as the translated Am244 ORF along with its orthologs retrieved froin the database to identify conserved and divergent blocks (IIiggins D et al., 1994). As a result of the seqtience determination of the fitll length Am244 gene (SEQ ID NO: 1) it was found that cDNA was 600 bp in length encoding a protein consisting of 57 amino acids (SEQ
ID NO: 3). Four GATTT repeats are present in the 3' untranslated region of the Am244 cDNA. PSORT analysis of Am244 gene product indicated putative plasma membrane localization and an uncleavable N-terminus signal peptide. The presence of the two transmembrane domains was predicted by HMMTOP.

Example 5 Construction of recombinant plant transformation vectors Construction pGFP-Ala-Am244-C I and pGFP-Ala-Am244-U 1 GFP along with a flexible (Alanine)1o linker was fused to the N-terminus of the Am244 cDNA fragment as shown in SEQ ID No: 2 by Splice Overlap Extension (SOEing).
The use of the flexible (Alanine)1Q linker was based on the design by Cutler et al., 2000.
The primers used for SOEing are as follows: Ala-SOE FWD (SEQ ID NO: 4), Ala-SOE
REV (SEQ ID NO: 5), GFP FWD (SEQ ID NO: 6), GFP REV (SEQ ID NO: 7) and Am244 FUSION REV (SEQ ID NO: 8). The nucleotide sequence of the primers are given below.

5' GCTGCCGCAGCTGCAGCCGCTATGGCTGAAGGGACACAACT 3' SEQ ID NO:

5'AGCGGCTGCAGCTGCGGCAGCTGCGGCTGCTTTGTATAGTTCATCCATGCCATG3' SEQ ID NO:

5' CTAGTCTAGAATGAGTAAAGGAGAAGAACTTTTCA 3' SEQ ID NO:

5' CCGCTCGAGTTATTTGTATAGTTCATCCATGCCATG 3' SEQ ID NO:

5' CGC GGA TCC TCA GTC CCT GGT GAT GGC C 3' SEQ ID NO:

All primers were diluted to a 100 ng/ l stock. Am244 cDNA fragment as shown in SEQ ID NO: 1 was eloned in the Ps/I and KpnI sites of pBluescript SK II. The construct thus derived was called pBSSK II-Am244. The clone for GFP (mGFP6) was obtained as part of a plasmid pMDC83 (Curtis M et al., 2003). The GFP fragment was digested with Sacl and KpnI and the 0.75 Kb fragment cloned in the same sites in pBluescript SK II. The construct thus derived was called as pBSSK II-GFP. The pBSSK I1-Am244 and pBSSK lI-GFP clones were diluted to ing/ l and were used as templates for amplification prior to SOEing.

I) Ala-SOE FWD and Am244 FUSION REV were used to ainplify the Am244 cDNA
fragment as shown in SEQ ID NO: I with the following reaction conditions:
Reaction volume 50 LLl; 1mM total dNTPs, Am244 in PBSSK II (template) 10 ng/ l; Ala-SOE
FWD 150 ng; Am244 FUSION REV 100 ng, 2.5U Pfu TurboTM (Stratagene) in IX

Pfu Turbo buffer. PCR parameters were as follows: 94 C for 3' (pre-amplification denaturation); 18 PCR cycles of 94 C for 1', 59 C for 1, 68 C for 2'; Final extension at 68 C for 7'.

II) Ala-SOE REV and GFP FWD were used to amplify GFP with the following reaction conditions: Reaction volume 50 l; 1mM total dNTPs, GFP in PBSSK II
(template) 10 ng/ l; Ala-SOE REV 150 ng; GFP FWD 100 ng, 2.5U Pfu in 1X Pfu buffer. PCR parameters: 94 C for 3' (pre-amplification denaturation); 18 PCR
cycles of 94 C for 1', 59 C for 1', 68 C for 2'; Final extension at 6 C for 7.

Amplification (I) gave a band size of about 170 bp while ainplification (II) gave a band size of about 720 bp. The amplification products were gel eluted and quantified.
(I/Am244) and (II/GFP) were mixed in a 4.2:1.0 molar ratio (lOng: 2.5 ng), heated to 68 C for 2' and chilled. This aiuzealed product was used as template to amplify the GFP-(Alanine)lo-An244 fragment. The reaction conditions for this were as follows:
Reaction volume 50 iLl; 1mM total dNTPs, amplification (I/Am244) and amplification (II/GFP) products in a molar ratio of 4.2: 1.0 (2.5 ng: 10 ng; GFP FWD 125 ng;
Am244 FUSION REV 100 ng, 2.5U Pfti in 1X Pfu buffer. PCR parameters: 94 C for 3' (pre-amplification denaturation); 18 PCR cycles of 94 C for 1', 59 C for 1', 68 C for 2'; Final extension at 68 C for 7'. Finally, a fragment of about 900 bp was obtained wherein 3' GFP-(Alanine)io was fiised to 5' end of Am244 cDNA fragment as shown in SEQ ID NO: 2.

The fused fragment was gel eluted and cloned in Sma I site of pBSSK 11 to give rise to the plasmid called pBSSK II-GFP-A1ai0-An1244 The sequence of the GFP-(Alanine)lo-Am244 ORF was verified by sequencing with conventional primers such as Ml3F
and M13R primers and also the primers Am244 FUSION REV, GFP FWD and GFP RBV.
The reads were subseduently compiled and checked for an intact ORF using translation tools available at EXPASY (www. expasy.eom; Bairoch A et al, 2003). Following this, the 921 bp band was excised liom pBSSK II using the restriction enzymes Bam III and Xbcz I and cloned in the pCAMBIA 1301+35S also digested with 13cna III and Xba I.
These restriction sites were introduced in the Am244 FUSION RBV and GFP FWD
primers, respectively. The pCAMBIA 1301+35S is a modiCied binary plasmid vector where the CaMV 35S promoter is cloned in the IDnd III and Xba I sites (multiple cloning site) of the binary plasmid vector pCAMBIA 1301 (I-Iajduleiewicz et al., 1994).
The orientation of the GFP-(Alanine) 10-Am244 ORF in the pCAMBIA 1301+35S is shown in Fig 2 and the construct has been named pGFP-Ala-Am244-C 1.

Another construct designated as pGFP-Ala-Am244-U1 comprises of pCAMBIA 1301+
Ubiquitin and the GFP-(Alanine)j0-Am244 ORF sequence cloned downstream of the ubiquitin promoter.

Construction of plant transformation vectors pAm244-C1, pAm244-C2, pAm244-U1, and pAm244-U2 Different plasmid vectors were constructed by cloning Am244 cDNA fragment as shown in SEQ ID NO: 1 or 2 in a modified binary vectors pCAMBIA 1301+CaMV35S
to form pAm244-C 1 and pAm244-C2 respectively. Similarly recombinant vectors pAm244-U 1 and pAm244-U2 were constructed by cloning Am244 eDNA fi=agnient as set forth in SEQ ID NO: I or 2 in modired binary vector pCAMBIA 1301+ubiquitin downstream of Ubiquitin promoter. The recombinant vector thus constructed were mobilized in the Agrobaeter iunr cells by the freeze thaw method (Holsters M D
et al., 1978) and used for the plant transforination.

Tobncco Transforination witli pGFP-AIa-Am244-C1 Agr=obacteriuin-mediated transforination of tobacco (Nicotiana tabcacu777) cv.
Wisconsin was carried out by the standard protocol (Ilorsch RB et al., 1985).
Briefly, sterile tobacco leaf discs were cut and transferred to Murashige and Skoog (MS) medium containing 3% sucrose, lmg/L BAP, lmg/L NAA, 0.8 % Bacto-Agar, pH 5.6 at 28 C in 16 hours light and 8 llours darkness for 24 hours prior to transforffiatlon. 100 ml of an overnight grown cultlue of pGFP-Ala-Am244-Cl transformed Agrobacteriuin strain was resuspended in 0.5X MS liquid medium with 3% sucrose, pII5.6 (5 ml). The leaf discs were subsequently co-cultivated with the Agrobactet iuM
(transformed with 10, pGrP-AIa-Am244-C1) for 30 minutes. The discs were dried on sterile No. 1 Whatmann discs and transferred to MS medium containing 3% sucrose, lmg/L
Benzylaminopurine (BAP), lmg/L Napthaleneaceticacid (NAA), 0.8 % Bacto-Agar, aild pII 5.6 at 28 C in 16 hours light and 8 hours darkness for 48 hrs. The leaf discs were given several washes in half strength liquid MS medium with 1.5 % sucrose, pH 5.6 containing mg/hnL cefotaxime. Excess moisture on the leaf discs was blotted on sterile Whatmaiin No. 1 filter paper. The discs were tllen placed on selection media, that is, MS medium containing 3% sucrose, lmg/L BAP, lmg/L NAA, 0.8 % Bacto-Agar, pIl 5.6 containing 250 mg/mL cefotaxime and 25mg/L hygromycin at 28 C in 16 hours light and 8 hours darkness. The leaf discs were transferred to fresh selection media every 14 days until multiple shoot regeneration was seen. Shoot regeneration was seen between 20-45 days after first placing on the selection media. Regenerated independent shoots were then transferred to rooting medium (MS medium containing 3% sucrose, 0.8 %
Bacto-Agar, pI-I 5.6 containing 250 mg/mL cefotaxime and 25mg/L hygromycin at 28 C in 16 hours light and 8 hours darkness). After establishment of roots in the medium, the plants were transCerred to fresh rooting medium every one month, each time transferring a shoot cut from the previous plant. Transformation of plants was confirmed by (3-glucouronidase (GUS) staining of stem, leaf and root sections of the plant. The protocol for GUS staining was according to Jefferson RA et al.
1987. GUS
positive plants comprising the for the pGrP-Ala-Am244-C1 T-DNA were then screened for GFP fluorescence using the Nikon Epifluorescence microscope.

Example 6 Epitope tagging of the Am244 cllNA

The Am244 cDNA as shown in SEQ ID No. 1 cloned in the IIindIIl and Pstl sites of pBSSK lI (pBSSK-Am244) was used as template for epitope tag insertion. Two partially overlapping and complementary primers were designed to introduce the c-myc tag sequence in the middle of the Am244 cDNA and at the N-terminus of the Am244 ORF without disturbing the Am244 5' UTR. The two primers used are Am244-Mut-Fwd (SEQ ID NO: 9) and Am244-Mut-Rev (SEQ ID NO: 10). Nucleotide sequence of these primers is given below.

5'GAACAAAAGTTGATTTCTGAAGAAGATCTGATGGCTGAAGGGACAGCAACTTGTATCGATATTG3' SDQID NO:

5'CAGATCTTCTTCAGAAATCAACTTTTGTTCCATTTTTGCCTTCCCTTGTTTGATTTTACCAAGAC3' SEQ ID
NO: 10 Am244-Mut-Fwd (SEQ ID NO: 9) codes for part of the c-myc tag (marked in bold) and the beginning of the Am244 ORF. Am244-Mut-Rev (SEQ ID NO: 10) codes for the entire c-myc tag (marked in bold) as well as part of the Am244 5' UTR.

PCR conditions The insertion of the c-myc tag sequence within the Am244 cDNA was achieved according to Wang and Malcolm. Briefly, two single primer PCR reactions are carried out generating `hybrid' linearized plasmids (with one wild type and one newly generated mutagenised strand). These linearized hybrid plasmids are then mixed and used as templates in the subsequent PCR steps to obtain hemi-methylated DNA as well as newly synthesized mutagenized non-methylated DNA. The parent and hemi-methylated DNA are removed by Dpnl digestion while the newly synthesized mutagenized non-methylated DNA remains undigested. The reaction conditions employed were as follows: Two separate single primer reactions (25 l each) were set up, one with the Am244-Mut-Fwd primer and the other with the Am244-Mut-Rev primer. The following coznponents were mixed together template DNA (pBSSK-Am244) - 50 ng; dNTPs - 250 M; l OX PCR buffer - 2.5 1, Am244-Mut-Fwd or Rev primers - 12 pmoles and heated to 95 C for 3'. 1.25 U of Pfu Polymerase was added and four PCR cycles were carried out under the following conditions: 95 C -30s; 55 C

- 1'; 68 C - 8'. The two single primer reactions were mixed and allowed to proceed for 16 more cycles under the following conditions: 95 C - 30s; 55 C - 1'; 68 C -8. 1 1 of Dpnl was added to the reaction mix and lield at 37 C for 90'. 5 1 of the PCR
reaction mix was used for transformation into ultracompetent XL-2 Blue cells. Seven colonies were obtained and were `size' screened for the c-myc insertion using the universal M13R (SEQ ID NO: 11) and An244 REVl primer (SEQ ID NO: 12) 5' AGCGGATAACATTTCACACA GG 3' SEQ ID NO: 11 5' GATACAAGTTGCTGTCCCTTG 3' SEQ ID NO: 12 PCR reaction conditions: 95 C - 3'; 95 C - 30s, 57 C - 30s; 72 C - 30s (30 cycles); 72 C
- 7'; 4 C - oo. All seven colonies screened showed a larger fragment size (with a 33 bp inser-lion) as compared to the PCR-generated fraginent obtained froni pBSSK-Am244.
Plasmids were prepared from all the seven colonies and sequenced with the M13R
and M13F primers using terminator method. The 33 nucleotide insertion was found at the N-terminus of the Am244 ORF. This plasmid is referred to as pBSSK-mycAm244, pBSSK-mycAm244 was digested with BamHI and the excised myc-tagged Am244 eDNA cloned in the modified binary plasmid vector pCAMBIA1301+35S (where the CaMV 35S promoter was cloned in the Flirzd III and Xficr I sites in the multiple cloning sites of the binary plasmid vector pCAMBIA 1301). The orientation of the myc-tagged Am244 eDNA in the plasmid vector pCAMBIA1301+35S is shown in FIG 3 and the construct has been named pMyc-Am244-C 1.

Similarly other recombinant transformation vector comprising c-myc tag sequence in the middle of the Am244 eDNA (SEQ ID NO: 1) operably linlced to ubiquitin promoter. The recombinant vector thus constructed was designated as pMyc-Am244-U1.

Another recombinant vector coinprising c-myc tag sequence at the N-terminus of the Am244 (SEQ ID NO: 2) operably linked to CaMV 35S promoter. The recombinant vector thi.is constructed was designated as pMyc-Am244-C2.

Another recombinant vector comprising c-myc tag sequence at the N-terminus of the Am244 (SEQ ID NO: 2) operably linked to ubiquitin promoter. The recombinant vector thus constructed was designated as pMyc-Am244-U2.

E1Rmnlc 7 Tobacco '['ransformntion witli pMyc-Arn244-C1 Various recombinant plant transformation vectors describe as above were mobilizes into Agrobacterhrrn strain LBA 4404 and EIIA 105 and used for tobacco and rice transformation. The pMye-Am244-C1 construct was mobilized into Agrobtaeter=ium tiarnefaciens strain LBA4404 by the freeze-thaw method.

Agrobcrcterhrrn-mediated transformation of tobacco (Nicoticana tabactrrlz) ev.
Petit Havana was carried out by the standard protocol. Briefly, sterile tobacco leaf discs were cut and transferred to Murashige and Skoog (MS) medium containing 3 %
sucrose, lmg/L BAP, lmg/L NAA, 0.8 % Bacto-Agar, pH 5.6 at 28 C in 16 hours light and 8 hours darlaless for 24 hours prior to transformation. 100 ml of an overnight grown culture of pGFP-Ala-Am244 transformed Agrobacterium strain was resuspended in 0.5X MS liquid medium with 3 % sucrose, pII 5.6 (5 ml). The leaf discs were subsequently co-cultivated with the resuspended pMyc-Am244 transformed Agro6actei iuJ77 for 30 minutes. The discs were dried on sterile No. 1 Whatmann discs and transferred to MS medium containing 3 % sucrose, lmg/L BAP, lmg/L NAA, 0.8 % Bacto-Agar, pH 5.6 at 28 C in 16 hours liglit and 8 hours darlazess for 48 hrs. The leaf discs were given several washes in liquid MS medium with 3 % sucrose, pH
5.6 containing 250 mg/mL cefotaxime. Excess moisture on the leaf discs was blotted on sterile Whatmaiuz No. 1 filter paper. The discs were then placed on selection media, that is, MS medium containing 3% sucrose, lmg/L BAP, lmg/L NAA, 0.8 % Bacto-Agar, pH 5.6 containing 250 mghnL cefotaxime and 25mg/L hygromycin at 28 C in hours light and 8 hours darkness. The leaf discs were transferred to fresh selection media every 14 days until multiple shoot regeneration was seen. Shoot regeneration was seen between 20-35 days after first placing on the selection media.
Regenerated independent shoots were then transferred to rooting medium (MS medium containing 3 % sucrose, 0.8 % Bacto-Agar, pH 5.6 containing 250 mg/hnL cefotaxime and 25 mg/L
hygromycin at 28 C in 16 hours light and 8 hours darlcness). After establishment of roots in the medium the plants transferred to fresh rooting medium every 14 days, each time transferring a shoot cut from the previous plant. Transformation of plants was confirmed by (3-glucouronidase (GUS) staining of steiii, leaf and root sections of the plant. The protocol for GUS staining was according to Jefferson RA et al, 1987.

Twenty GUS positive lines were obtained from 23 independently transformed regenerants obtained. Leaves were harvested from these plants for genomic DNA
isolation.

Isolation of Genomic DNA

Genomic DNA from the transCormed tobacco plant was isolated using the protocol of Richards EJ (1987). 2-3 grams of tobacco leaves (harvested from sixteen Myc-Am244 transformed lines as well as control untransformed tobacco cv. Petit Ilavana) were ground to a fine powder using liquid nitrogen in a mortar and pestle. The ground tissue was suspended in 8-10 ml of CTAB buffer (2% cetyltrimethylammonium bromide, 100mM Tris-Cl pH 8.0, 20mM EDTA, 1.4M NaCI and 0.2% (3-mercaptoethanol) and incubated in a water batl7 at 65 C for 30 minutes in centrifiige tubes. An equal volume of choloroform: isoamyl alcohol (24:1) was added and after inversion the tubes centrifuged at 10,000 rpm for 15 C to allow for phase separation. The upper aqueous phase was transferred to a new tube and 0.6 volumes of isopropanol were added.
The samples were left overnight at -20 C for DNA precipitation. The tubes were then centrifuged at 12,000 rpm to pellet the DNA and the supernatant decanted. The pellet was allowed to air dry and resuspended in TE buffer (0.5 ml). The resuspended sample was treated with RNAse A(10~Lg/ml) and incubated at 37 C for two hours. An equal of phenol: choloroform (1:1) was added, mixed by inversion and centrifitged at 10,000 rpm for 10' to separate the phases. The upper aqueous phase was transferred to a new Eppendorf and an equal volume of chloroform added, mixed by inversion and centrifuged at 10,000 rpm for 10' to separate the phases. The upper aqueous phase was transferred to a new Eppendorf and 0.1 volume of 3M sodium acetate pH 5.2 was added followed by 2.5 volumes of absolute ethanol and kept for precipitation overnight at -20 C. The samples were then centrifitged at 12,000 rpm to pellet the genomic DNA
and the supernatant discarded. The pellet was rinsed with 70 ethanol and centrifuged at 12,000 rpm, the wash discarded and allowed to air dry. The genomic DNA
pellet was resuspended in TE.

PCR analysis was carried out with gene specific primers for confirming the presence of Am244 DNA in transgenic plants.

Southcrn Hybridization 'The genoinic DNA (40 g) isolated froin sixteen lines Myc-Am244 lines and control (untransformed tobacco cv. Petit IIavana) was digested with Hindlll overnight.
The digested genomic DNA was loaded on a 0.8% agarose gel (1X TBE) and run at 35 V
for 16 hours. The gel was photographed and transferred to nylon membrane (Hybond N+, Amersham) using the allcaline transfer method mentioned in Sainbroolc et al.
Briefly, the gel was incubated in denaturation solution (0.4N NaOH, 1M NaCI) for 30'.
The capillary transfer metllod was used to transfer the genomic DNA to nylon membrane (Hybond N+, Amersham). Following transfer for 14-16 hours, the nylon membrane was rinsed twice with neutralization buffer (0.5M Tris-Cl pH 8.0, 1M
NaCI) for 30'. The DNA was then cross-linked to the nylon blot was using a UV-crosslinker (Hoefer, UVC500). Pre-hybridization of the Southern blots was carried out at 56 C in the phosphate hybridization buffer (0.5M Na2HPO4, 7 % SDS and 1 mM EDTA @
150 1 of buffer/cm2 of the membrane) for 2 hours in a hybridization chainber (Hybridization Incubator Combi-H, Finemould Precision Inc.). 100 ng of PCR
amplified and gel-purified Am244 cDNA was labeled in the presence of 5 1 of a dCTP (BRIT, 3500 Ci/mmol) using the RediPrime Kit (Amershain) as per the manufacturer's instructions. The a 32P-dCTP was purified through a Sephadex G-column to remove un-incorporated nucleotides. The probe was denatured for 5-7' in ' boiling water, chilled on ice and added to the blot with fresh phosphate hybridization buffer (@ 150 1 ofbuffer/cm2 of the membrane) and incubated at 56 C for 14-16 hours in the hybridization oven. The membrane was washed with 2X SSC, 0.1% SDS for 15' and exposed to the Phosphorlmager screen (Personal Molecular Imager, BioRad) for 14-16 hours. The exposed images were scanned and analysed using the Quantity One siftware (BioRad).

The pMyc-Am244-C1 T-DNA has a single HindIIl site flaiilcing the 35S CaMV
promoter driving the expression of myc-tagged Am244 cDNA. Digestion of the genoinic DNA obtained from GUS positive Myc-Arn244 transformed lines with HindIII would thus help in the identification of single copy insertions of the pMyc-Am244 T-DNA in the tobacco plants examined. Southein analysis of Myc-Am244 transformed lines revealed that there were single copy insertions of the Myc-Am244 eDNA in Lines 1, 6, 7, 8, 11 and 17.

Exanxple 8 Transformation of Rice using AgroGneferiuun niediated metliod Rice calli were transformed with the recombinant vectors disclosed in the invention by Agrobactet~iurn-transformation inethods as described in Example 5 and Exainple 7.
Other standard protocols wliieh are well known to the person skilled in art can also be used.

Rice c;alli was generated from mature seed scutella of pusa basmati 1 on a callus induction medium (MS inorganic + MS vitamins + 2,4D (2mg/ml)). 'Three week old calli were then infected with the Agrobcccteriuiii lunzef'acicns LBA4404 carrying any one of the recombinant vectors as described above such as pGFP-AIa-Ain244-Ul, pAm244-Ul, pAm244-U2, pMyc-Am244-U 1 or pMyc-Am244-U2. The infected calli were washed for a period of thirty minutes and then dried on a sterile filter paper. The dried calli were then transferred to a selection medium (callus induction medium containing Hygromycin (50 g/ml)) for a period of 6 weeks. The calli were sub-cultured every fifteen days. The selected calli were then transferred to the regeneration medium (MS inorganic, MS vitamins, benzyl aminopurine (BAP (1.5mg/L)), kinetin (0.Smg/L) and NAA (0.5mg/L)). The regenerants were transferred to the rooting medium (MS
inorganic and MS vitamins without hormones). The plantlets were subsequently transferred to the hardening medium for a span of two weeks and finally transferred to the soil in pots to raise the next generation of seeds. The tillers of the rice plants were bagged before the onset of flowering in order to promote self-pollination. The seeds from the selfed plants were collected and again sown for the next generation.
The second generation rice palnts were analyzed for the presence of the Am244 DNA
as shown in SEQ ID NO: 1 or 2. The transgenic rice plants were screened for the localization of the polypeptide as shown in SEQ ID NO: 3.

These plants were tested for the presence of the Am244 DNA and also for copy number of the inserted gene. Further the plants were screened for tolerance to abiotic stress.
The details are given in Example 10.

Examplc 9 Microscopy and Imaging Leaf peels mounted in water were prepared from GUS
positive tobacco and rice plants transformed with pGFP-Ala-Am244-C1 or pGFP-Ala-Am244-U1 respectively and examined under the Nikon Optiphot-2 phase contrast microscope fitted with an Episcopic fluorescence attachment (100W IIg,lamp). Fluorescence imaging of guard cells was carried out using the Nikon B2A filter set (excitation 450-490, Dichroic mirror 510, Barrier filter 520) and the Fluor 40X dry objective. Photographs were taken with a 35mm FX-35DX camera using the Microflex HfX-DX attachment for automatic exposure adjustments on a Kodalc ASA 400 film.

Guard cell imaging of pGFP-Ala-Am244-C 1 and pGFP-Ala-Am244-C 1 transforined tobacco and rice plants respectively showed localization of the green fluorescence at the periphery of the guard cells and close to the cell wall, suggesting plasma membrane localization of Am244. Chlorophyll aufio-fluorescence was used to locate the chloroplasts under the same imaging conditions. Bright field images and fluorescence images of the tobacco guard cell are enclosed in FIG 4.

Example 10 Expression Analysis of transgcnic plant Whole-plant Salt stress Treatments:

The salt tolerance conferred by over-expressing Am244 gene in tobacco and rice transgenics was analyzed by performing whole plant salt stress treatinents.
Phenotypic growth retardation study was also performed between control and transgenic plants., Three control and transgenic plants were grown initially in 1/2 MS for 1 week.
Later, they were transferred to '/2 MS medium supplemented with 150 mM and 200 mM
NaCl.
It was observed that in 150 mM NaCl, transgenic plants showed better rooting when compared to control plants. At 200 mM NaCI, both control and transgenic plants did not root. It was also found that the transgenic plants suffered less damage in 150 mM
and 200 mM NaCl stress. Phenotypic growth retardation was not evident in control and in both tobacco and rice transgenic plants grown in pots and irrigated with 150 mM
NaCl solution for 1'/z week.

Similarly experiments were conducted for analyzing the transgenic plants for other stresses.

ABA stress: A stress of 1 ,M ABA was given to control and transgenie plants (rice and tobacco) for same time intervals. It was observed that in 1~tM ABA, transgenic plants showed better rooting when compared to control plants which confirmed overexpression of Am244 DNA in rice and tobacco.

KC1 stress: Control and transgenic were supplemented with 500mM KCI. It was observed that in 500 mM KCI, transgenic plants showed better rooting when compared to control plants which conlirmed overexpression of Am244 DNA in rice and tobacco.

Mamlitol stress: Control and transgenic were supplemented with 800mM KCI. It was observed that in 800 mM Mannitol, transgenic plants showed better rooting when compared to control plants which confirmed overexpression of Am244 DNA in rice and tobacco.

References 1. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Bio1215:403-410 2. Boon PI, Allaway WG (1982) Assessment of leaf-washing techniques for measuring salt secretion in Avicennia marina (Forsk.) Vierh. Aust J Plant Physiol 9:725-734 3. Capel J, Jarillo JA, Salinas J, Mnrtinez-Zapa.ter JM (1997) Two homologous low-temperature-inducible genes from Arabidopsis encode highly hydrophobic proteins. Plant Physiol. 115: 569-76 4. Chauhan S, Forsthoefel N, Ran Y, Quigley F, Nelson DE, Bohnert HJ
(2000) Na+/myo-inositol symporters and Na+/H+-antiporter in Meseinvryantheinuni crystallinuin. Plant J 24:511-522 5. Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidiniuin thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156-159 6. Curtis MD, Grossniklaus U (2003) A gateway cloning vector set for high-throughput functional'analysis of genes in planta. Plant Physiol. 133: 462-9 7. Cushman JC, Bohnert I-IJ (2000) Genomic approaches to plant stress tolerance. Curr Opin Plant Bio13:117-124 8. Cutler SR, Elirharclt DW, Griffitts JS, Somerville CR (2000) Random GFP::cDNA fiisions enable visualization of subcellular structures in cells of Arabidopsis at a high frequency. Proc Natl Acad Sci U S A. 97: 3718-23 9. Fclicicllo I, Chinali G (1993) A modified alkaline lysis method for the preparation of highly purified plasmid DNA from Escherichia coli. Anal Biochem 212:394-401 10. Goddard NJ, Dunn MA, Zhang L, White AJ, Jack PL, Hughes MA (1993) Moleeular analysis and spatial expression pattern of a low-teinperature-specific barley gene, b1t101. Plant Mol Biol. 23: 871-9 11. Gulicic PJ, Sl-en W, An H(1994) BSI3, a stress-induced gene from Lophopyruin elongatuin. Plant Physiol. 104:799-800 12. I-Iajciukie.vvicz P Svab Z, Maliga, P (1994) The small versatile pPZP
family of :4gf=obcrcter=iurn binary vectors for plant transformation. Plant Mol Biol 25:989-994.
13. Higgins D, Thompson J, Gibson T, Thompson JD, Higgins DG, Gibson TJ
(1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment tluough sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.

14. Holsters M D, de Waele A, Depicker E, Messens M, Van Montagu, J Schell (1978) Transfection and transformation of A. tuinefa.cien,r. Mol. Gen. Genet.
163:181-187 15. Ilorsch RB, Fry JE, Hoffmann NL, Lichholtz D, Rogers S G, Fraley RT
(1985) A simple and general method for transferring genes into plants. Science 227:1229-1231.
16. Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS ftisions: Beta-glucuronidase as a sensitive and versatile gene fusion marker in. higher plants.
EAIBC).I6:3901-3907.
17. Munns R, Husain S, Rivelli AR, James RA, Condon AG, Lindsay MP, Lagudah ES, Schachtman DP, Hare RA (2002) Avenues for increasing salt tolerance of crops, and the role of physiologically based selection traits.
Plant Soi1247:93-105 18. Nalcai K, Horton P (1999) PSORT: a program for detecting sorting signals in proteins and prcdicting their subcellular localization. Trends Biochem Sci.
24:
34-6.
19. Parani M (1999) Isolation of salt tolerance genes from mangroves:
characterization of betaine aldehyde dehydrogenase (BADII) gene from Avicennia marina and its expression in tobacco transgenic system. PhD tliesis, Anna University, India 20. Rao AN (1987) Mangrove ecosystems of Asia and the Pacific. In: Umali RM, Zamora PM, Gotera RR, Jara RS, Cainacllo AS (eds) Mangroves of Asia and the Pacific: status and management. UNDP-UNBSCO Technical Report, pp 1-21. Ricliarcls EJ (1987) Preparation of genomic DNA from plant tissue. In:
Current Protocols in Molecular Biology, (eds. F. Ausubel et al) Jolu1 Wiley and Sons, New York, pp. 2.3 .1-2.3.3 .
22. Sambroolc, J, Fritsch EF, and Maniatis T Molecular Cloning, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
23. Shimony C, Fahn A, Reinliold L (1973) Ultrastructure and ion gradients in the salt glands of Avicennia marina (Forsk.) Vierh. New Phyto172:27-36 24. Tusnady GE and Simon I(1998) Principles Governing Amino Acid Composition of Integral Membrane Proteins: Applications to Topology Prediction." J. Mol. Biol. 283: 489-506.
25. Van West P, Kamoun S, van't Klooster JW, Govers F (1999) Ricl, a Phytophthora infestans gene with homology to stress-induced genes. Curr Genet. 3 6: 3 10-5 26. Wang W, Malcolm 13A. Two-Stage Polymerase Chain Reaction Protocol Allowing Introduction of Multiple Mutations, Deletions, and insertions using QuilcChangeTM Site-directed mutagenesis. In: In vitro Mutagenesis Protocols.
2d ed. Series: Methods in Molecular Biology v. 182. Edited by J. Braman, Htiuilana Press Inc. Totowa NJ
27. Yale J, Bohnert HJ (2001) Transcript expressiori in Saccharomyces cerevisiae at high salinity. J Biol Chem. 276: 15996-6007 28. Zhu JK (2002) Salt and drought stress signal transduction in plants. Annu Rev Plant Biol 53:247-273 Sequence Listing.ST25 SEQUENCE LISTING
<110> MS swaminathan Research Foundation Parida, Ajay Kumar venkatraman, Gayatri <120> Abiotic stress tolerant gene from Avicennia marina encoding a protein involved in salt tolerance <130> PCT0044 <150> 1261/CHE/2005 <151> 2005-09-09 <160> 12 <170> Patentln version 3.3 <210> 1 <211> 600 <212> DNA
<213> Artificial sequence <220>
<223> synthetic sequence <400> 1 ggtagagaaa agagagataa tcttgattct gtttaattta ttttgtcttg gtaaaatcaa 60 acaagggaag gcaaaaatgg ctgaagggac agcaacttgt atcgatattg ttgtggcaat 120 tcttctgcct ccacttggtg tcttcctcaa gtatggctgc aagggtgaat tctggatttg 180 tctgctactg accatccttg gttatattcc tggaattatc tatgctgttt gggccatcac 240 cagggactga tatgttttcc ttgagaaggt atcctattcg attgtcaggt gaagatgcaa 300 agggccataa agattgcagc tttctttagc acacagacag tgctgatttg ctggtgttag 360 gctgcaagtc cctttctctt ccacttttgc ttgtaccccc ttttccaatg tctcagatca 420 ctacttgatt tgatttgatt tgattttatc ttgtcttatt ttgtatttaa tgtgtgatta 480 aagtgattta tcttagagtg taagtcttgg tttggcccca ctgtatatgc ccctttagta 540 atgtaagtat ggtaaccgtg aggtactact tactctattt aaaaaaaaaa aaaaaaaaaa 600 <210> 2 <211> 174 <212> DNA
<213> Artificial sequence <220>
<223> synthetic sequence <400> 2 atggctgaag ggacagcaac ttgtatcgat attgttgtgg caattcttct gcctccactt 60 ggtgtcttcc tcaagtatgg ctgcaagggt gaattctgga tttgtctgct actgaccatc 120 cttggttata ttcctggaat tatctatgct gtttgggcca tcaccaggga ctga 174 Sequence Listing.sT25 <210> 3 <211> 57 <212> PRT
<213> Avicennia marina <400> 3 Met Ala Glu Gly Thr Ala Thr Cys Ile Asp Ile Val Val Ala Ile Leu Leu Pro Pro Leu Gly Val Phe Leu Lys Tyr Gly Cys Lys Gly Glu Phe Trp Ile Cys Leu Leu Leu Thr ile Leu Gly Tyr Ile Pro Gly ile Ile Tyr Ala Val Trp Ala Ile Thr Arg Asp <210> 4 <211> 42 <212> DNA
<213> Artificial sequence <220>
<223> Synthetic sequence <400> 4 gctgccgcag ctgcagccgc tatggctgaa gggacagcaa ct 42 <210> 5 <211> 54 <212> DNA
<213> Artificial sequence <220>
<223> Synthetic sequence <400> 5 agcggctgca gctgcggcag ctgcggctgc tttgtatagt tcatccatgc catg 54 <210> 6 <211> 35 <212> DNA
<213> Artificial sequence <220>
<223> Synthetic sequence <400> 6 ctagtctaga atgagtaaag gagaagaact tttca 35 <210> 7 <211> 36 <212> DNA

<213> Artificial Sequence Sequence Listing.ST25 <220>
<223> synthetic sequence <400> 7 ccgctcgagt tatttgtata gttcatccat gccatg 36 <210> 8 <211> 28 <212> DNA
<213> Artificial sequence <220>
<223> synthetic Sequence <400> 8 cgcggatcct cagtccctgg tgatggcc 28 <210> 9 <211> 64 <212> DNA
<213> Artificial sequence <220>
<223> Synthetic sequence <400> 9 gaacaaaagt tgatttctga agaagatctg atggctgaag ggacagcaac ttgtatcgat 60 attg 64 <210> 10 <211> 65 <212> DNA
<213> Artificial Sequence <220>
<223> synthetic sequence <400> 10 cagatcttct tcagaaatca acttttgttc catttttgcc ttcccttgtt tgattttacc 60 aagac 65 <210> 11 <211> 22 <212> DNA
<213> Artificial sequence <220>
<223> Synthetic Sequence <400> 11 agcggataac atttcacaca gg 22 <210> 12 <211> 21 Sequence Listing.ST25 <212> DNA
<213> Artificial Sequence <220>
<z23> Synthetic Sequence <400> 12 gatacaagtt gctgtccctt g 21

Claims (28)

1. An isolated nucleic acid molecule for enhanced tolerance to abiotic stress in plant having a nucleotide sequence with at least 90% homology to the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2, wherein said sequence codes for a polypeptide having amino acid sequence as shown in SEQ
ID NO: 3.

2. The isolated nucleic acid molecule of claim 1, wherein said nucleic acid molecule comprises a nucleotide sequence as set forth in SEQ ID NO: 1 and SEQ ID NO: 2.

3. A polypeptide having an amino acid sequence as set forth in SEQ ID NO: 3, wherein said polypeptide is encoded by the nucleic acid as claimed in claim 1.

4. The isolated nucleic acid molecule for enhanced tolerance to abiotic stress in a plant as claimed in claim 1, wherein said abiotic stress is selected from a group consisting of drought stress, salt stress and dehydration stress.

5. An expression cassette for enhanced tolerance to abiotic stress in plant, wherein said expression cassette comprises the nucleic acid molecule as claimed in claim 1 or claim 2 operably linked to a plant expressible regulatory sequence.

6. The expression cassette of claim 5, wherein the regulatory sequence is selected form a group consisting of CaMV 35S, NOS, OCS, AdhI, AdhII and Ubi-1.

7. A DNA construct comprising the expression cassette of claim 5.

8. The DNA construct as claimed in claim 7, wherein said construct further comprises another expression cassette comprising a selectable marker gene operably linked to the regulatory sequence as claimed in claim 6.

9. The DNA construct as claimed in claim 8, wherein the selectable marker gene is selected from a group consisting of nptII, hptII, pat and bar.

10. The DNA construct as claimed in claim 7 or claim 8, further comprises another expression cassette comprising a scorable marker gene operably linked to the regulatory sequence as claimed in claim 6.

11. The DNA construct as claimed in claim 10, wherein the scorable marker gene is selected from a group consisting of GUS, GFP, LUC and CAT.

12. A recombinant vector comprising the DNA construct of any one of the claim 11.

13. The recombinant vector as claimed in claim 12, wherein said vector is a plant transformation vector.

14. A recombinant host cell comprising the recombinant vector of claim 12.

15. The recombinant host cell as claimed in claim 14, wherein the host cell is a prokaryotic or eukaryotic cell.

16. The recombinant host cell of claim 15, wherein the prokaryotic cell is either E.
coli or Agrobacterium.

17. The recombinant host cell as claimed in claim 15, wherein the eukaryotic cell is a plant cell.

18. An abiotic stress tolerant transgenic plant or plant cell or plant tissue comprising the nucleic acid molecule of claim 1, wherein the expression of the said nucleic acid molecule results in the enhanced tolerance to abiotic stress in said plant, plant cell and plant tissue.

19. The progeny derived from the transgenic plant as claimed in claim 18.

20. Transgenic seeds produced from the transgenic plant as claimed in claim 18, wherein said seed comprises the nucleic acid molecule of claim 1.

21. A method of producing a abiotic stress tolerant transgenic plant, said method comprising introducing at least one nucleic acid molecule of claim 1 in plant genome by using transformation method, thereby producing abiotic stress tolerant transgenic plant.

22. The method of claim 21, wherein said transformation method is selected from a group consisting of Agrobacterium mediated transformation, particle bombardment, vacuum-infiltration, in planta transformation and chemical method.

23. The method of claim 22, wherein the Agrobacterium mediated transformation comprising :

a) obtaining suitable explants from a plant, b) constructing the recombinant vector of claim 12, c) mobilizing said vector in Agrobacterium cell to produce recombinant Agrobacterium cell, d) co-cultivating said explants with said recombinant Agrobacterium cell to produce transformed plant cells, e) culturing said transformed plant cells to produce abiotic stress-tolerant transgenic plant.

24. The method of claim 21 or 23, wherein said plant is a monocotyledonous or a dicotyledonous plant.

25. The method of claim 24, wherein the monocotyledonous plant is selected from a group consisting of rice, maize, wheat, barley and sorghum.

26. The method of claim 25, wherein said monocotyledonous plant is rice plant.

27. The method of claim 24, wherein the dicotyledonous plant is selected from a group consisting of tobacco, tomato, pea, soybean, Brassica, chickpea and pigeon pea.

28. The method of claim 23, wherein said explants are selected from a group consisting of cotyledons, hypocotyls, leaves, anthers, callus, cotyledonary nodes, stems and roots.