EP1311541A1 - IMMUNOGENIC PROTEINS DERIVED FROM DOMESTIC MITE ALLERGEN, BLOMIA TROPICALIS (Bt5) - Google Patents
IMMUNOGENIC PROTEINS DERIVED FROM DOMESTIC MITE ALLERGEN, BLOMIA TROPICALIS (Bt5)Info
- Publication number
- EP1311541A1 EP1311541A1 EP00969092A EP00969092A EP1311541A1 EP 1311541 A1 EP1311541 A1 EP 1311541A1 EP 00969092 A EP00969092 A EP 00969092A EP 00969092 A EP00969092 A EP 00969092A EP 1311541 A1 EP1311541 A1 EP 1311541A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- sequence
- polymoφhic
- protein
- derivative
- homologue
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43513—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae
- C07K14/43531—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae from mites
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
Definitions
- the present invention relates generally to novel protein molecules and to derivatives, homologs, analogues, chemical equivalents and mimetics thereof capable of inducing, upregulating or otherwise facilitating the induction of an immune response to a mite and, more particularly, a mite from the family Glycyphagidae. These mites include house dust mites and storage mites.
- the present invention also contemplates genetic sequences encoding said protein molecules and derivatives, homologs, analogues, chemical equivalents and mimetics thereof.
- the present invention further provides genetic vaccines and other compositions comprising nucleic acid molecules.
- the novel protein molecules and genetic sequences of the present invention relate to polymorphic variants of known mite allergens.
- the said polymorphic variants alone or in combination with known allergens provide the possibility for developing more comprehensive tests for potential allergic responses.
- the molecules of the present invention are, therefore, useful, inter alia, in a range of therapeutic, prophylactic and diagnostic applications.
- Bt classified under the family Glycyphagidae (1), is a main component of the house dust in the tropical and subtropical regions. It is well-documented that this mite is an important triggering factor for allergic asthma and rhinitis in the tropics (2,3,4,6,7,8). To date, cDNA clones coding for three allergens have been characterised from this mite. These are Bt5
- Btl2 shows a 432 bp reading frame with a 340 bp 5' non-translated region and a 116p 3' non- translated region with a poly A tail, encoding a putative signal peptide of 20 residues and a 124-residue mature protein of approximately 14.2 kD.
- the frequency of IgE binding of sera from patients with asthma to Btl2 was approximately 50%) (16).
- the nucleotide sequence of Btl3 is 934-bp in length with a 390-bp reading frame coding a 130-amino acid protein of 14.8 kD in molecular weight (17).
- Btl3 has a cytosolic fatty acid-binding protein(FABP) signature at 5-22 amino acid residues. It shows 42.3% identity with the Sml4-FABP of Schistosoma mansoni and 36% identity with FABPs from rat, mouse, bovine and human.
- the frequency of IgE binding of allergic sera to Btl3 was 11% and normally weak.
- Bt5 a member of group 5 allergens
- such clinical reagents may consist of each protein variant alone or may include a range of different mixtures of protein variants and may extend to a mixture of one or more protein variants in combination with the published Bt5 sequence. Since different variants may yield different responses in different patients in clinical practice, the availaility of the polymorphic variants of the present invention provides the clinician with the wherewithall to test for and identify a far wider range of allergic responses and thereby develop more appropriate, patient-targetted therapies.
- Treatments for allergic responses to members of all species encompassed by the families Pyroglyphidae and Glycyphagidae may be facilitated by the use of the polymorphic variants of the present invention, by virtue of the potential for cross-reactivity between species.
- Nucleotide and amino acid sequences are referred to by a sequence identifier, i.e. ⁇ 400>1, ⁇ 400>2, etc.
- One aspect of the present invention provides an isolated nucleic acid molecule or derivative thereof comprising a nucleotide sequence encoding or complementary to a sequence encoding a polymorphic variant of Bt5 wherein said Bt5 comprises an amino acid sequence as set forth in ⁇ 400>2.
- nucleic acid molecule comprising a sequence of nucleotides or complementary sequence of nucleotides encoding a polymorphic variant of Bt5 wherein said variant comprises an amino acid sequence selected from ⁇ 400>14 to ⁇ 400>18 or ⁇ 400>33 to ⁇ 400>36 or an amino acid sequence having at least about 70% similarity to any or all of ⁇ 400>14 to ⁇ 400>18 or ⁇ 400>33 to ⁇ 400>36 provided said amino acid sequence is not ⁇ 400>2.
- nucleic acid molecule comprising a sequence of nucleotides or complementary sequence of nucleotides which encodes a polymorphic Bt5 allergen from Bt, wherein said nucleotide sequences are selected
- nucleotide sequence having at least about 70% similarity to the sequence in (i) or (ii); (iv) a nucleotide sequencee capable of hybridizing to a complementary form of the sequences in (i) or (ii) under low stringency conditions,
- nucleotide sequence is not ⁇ 400>1.
- Yet another aspect of the present invention is directed to an isolated protein selected from the list consisting of:-
- a protein encoded by a nucleic acid molecule capable of hybridizing to the nucleotide sequence as set forth in ⁇ 400>3 to ⁇ 400>13 or ⁇ 400>20 to ⁇ 400>32 or a derivative or homologue thereof under low stringency conditions and which encodes an amino acid sequence substantially as set forth in ⁇ 400>14 to ⁇ 400>18 or ⁇ 400>33 to ⁇ 400>36 or a derivative or homologue or mimetic thereof or an aniino acid sequence having at least about 55% similarity to at least 10 contiguous amino acids in ⁇ 400>14 to ⁇ 400>18 or ⁇ 400>33 to ⁇ 400>36;
- the allergen does not contain the amino acid sequence set forth in ⁇ 400>2 and is not encoded by the nucleotide sequence set forth in ⁇ 400>1.
- Still another aspect of the present invention extends to fragments of the polymorphic Bt5 allergen comprising a linear or conformational epitope.
- Another aspect of the present invention provides a method of preventing, reducing or otherwise ameliorating a Bt5 hypersensitivity condition in a subject said method comprising administering to said subject an effective amount of a polymorphic variant of Bt5 or a derivative, homologue, analogue, mimetic or chemical equivalent thereof alone or in combination with Bt5 for a time and under conditions sufficient to desensitize said individual.
- Yet another aspect of the present invention relates to a method of modulating, in a subject, an immune response directed to Bt5 said method comprising administering to said subject an effective amount of a polymorphic variant of Bt5 or a derivative, homologue, analogue, chemical equivalent or mimetic thereof alone or in combmation with Bt5 for a time and under conditions sufficient to up-regulate, down-regulate or otherwise modulate said immune response.
- compositions for use in modulating an immune response comprising a polymorphic variant of Bt5 alone or in combination with Bt5 and one or more pharmaceutically acceptable carriers and/or diluents.
- Yet another aspect of the present invention is directed to antibodies to a polymorphic variant of Bt5 or a derivative, homologue, analogue, mimetic or chemical equivalent thereof.
- Yet another aspect of the present invention contemplates a method for detecting an antibody directed to all or part of a polymorphic variant of Bt5in a biological sample from a subject said method comprising contacting said biological sample with said polymorphic variant or a derivative, homologue, analogue, chemical equivalent or mimetic thereof for a time and under conditions sufficient for an antibody-protein complex to form, and then detecting said complex.
- Figure 1 is a diagrammatic representation showing the culture apparatus for the mites.
- Figure 2 shows the nucleotide sequences of polymorphic Bt5 genomic DNA obtained by PCR amplification from the environmental polymorphic Bt mites. Intron sequences are indicated in lower cases. Sequences underlined are the start and stop codons. Sequences 1 to 5 and 6 tol 1 representing polymorphic Bt5 gene sequences obtained from Colombian and Singapore Bt mites, respectively. Reference to polymorphic Bt5 sequence refers to the published cDNA sequence reported by Arruda et al. (12). Number on the right indicates the nucleotide position of the DNA sequence.
- Figure 3 shows the amino acid sequences deduced from the genomic sequences of the polymorphic Bt5 variants as shown in Figure 2. Number on the top indicates the position of the amino acid residue.
- FIG 4 is a photographic representation of SDS-PAGE analysis of purified three Bt5 isoforms as glutathion-S-transferase (GST) fusion proteins produced in E. coli.
- Lane 1 GST- Bt5 fusion protein (the sequence of this cDNA is identical to the published sequence (Arruda et al. (12)); lane 2, isoform 1; lane 3, isoform 2.
- the cDNA encoding the three different isoforms of Bt5 were isolated from the cDNA library constructed using the Singapore mites cultured as described in Examples 1 and 2.
- In vitro IgE tests by ELISA indicated that all these isoforms were capable of binding human IgE. (refer Figures llb-d). The frequency of IgE reactivity was high; 18 out of 20 mite sensitive sera showed IgE binding to these isoforms (see Example 15).
- Figure 5 is a photographic representation of Coomassie blue stained SDS-PAGE of purified recombinant Bt5 from yeast culture medium. Recombinant Bt5 was subjected to two-step chromatographic purification: first hydrophobic interaction chromatography on Butyl Sepharose FF and second anion exchange chromatography on Q Sepharose FF (refer Example 8). The purified recombinant Bt5 migrated at 15kD position.
- Figure 6 is a diagrammatic representation of in vitro IgE reactivity test of recombinant Bt5 (rBt 5) produced in yeast with sera from mite allergic patients by ELISA assay.
- Purified recombinant Bt5 from yeast medium was coated on 96 well plates and incubated with 1:5 dilution of patient serum (refer Example 8).
- the IgE reactivity was indicated by OD405 nm reading.
- the dotted line indicates the average plus two times the standard deviation of the OD reading from 8 non-atopic subjects.
- 103 sera reacted positively with the rBt 5 allergen.
- Figure 7 shows the sequence of the overlapping synthetic peptides and the peptide variants.
- the peptides were designed to be 16-amino acid residues in length, overlapping by 13 amino acid residues.
- Peptides 35-67 are polymorphic Bt5 peptides designed on the basis of sequence published by Arudda et al. (12).
- Peptides 80-111 are the peptide variants of polymorphic Bt5 designed on the basis of our unpublished sequence data. These peptide variants contain naturally occurring mutations of polymorphic Bt5 proteins.
- Figure 8 shows the nucleotide sequences of polymorphic Bt5 cDNA variants (1-13). Number on the right indicates the nucleotide position. Sequences underlined are the start, stop codons and polyadenylated sites. Polymorphic Bt5 is the sequence published by Arruda et al. (12).
- Figure 9 shows the comparison of the deduced amino acid sequences for the polymorphic Bt5 cDNA variants. Number on the right indicates the position of the amino acid residue.
- Figure 11a is a diagrammatic representation showing polymorphic Bt5-derived recombinant peptides.
- the numerals on the right hand side indicate amino acid residue positions.
- the overlapping cDNA fragments were generated by PCR using panel primers and these fragments were expressed as GST-fusion protein in E. coli.
- Figures llb-d are diagrammatic representations showing human IgE eptiope mapping.
- the full-length (FL), defined by residue 1-117, the peptide defined by residue 1-80, the peptide defined by residue 41-117 and the peptide defined by 70-117 all showed some degree of IgE reactivity with a subset of patients.
- Figure lib shows a representative result of each subset. Some patients showed IgE reactivity to the full-length (FL) peptide and to the peptide defined by residue 41-117 and this peptide represents the dominant IgE epitope for these patients.
- Figure 1 lc is another representative result from such patients. Yet another subset of patients showed poor IgE reactivity to the full-length peptide, but most of their IgE reactivity targeted at peptide 41-117.
- Figure 1 Id is another representative result from such patients.
- Table 2 summarizes the characteristics of the polymorphic residues found in Bt5 genes.
- Table 3 is a summary of amino acid and nucleotide sequence identifiers.
- Phi hydrophilic and Pho: hydrophobic
- the present invention is predicated in part on the identification and cloning of a genomic nucleotide sequence encoding polymorphic variants of Bt5 as well as the identification of various polymorphic variants of the published Bt5 cDNA sequence.
- the availability of these novel sequences permits the preparation of corresponding polymorphic Bt5 proteins and their derivatives, homologues, analogues, chemical equivalents and fragments comprising epitopic regions.
- Such molecules are capable of inducing or facilitating the induction of an immune response to the domestic dust or storage mite, Bt, and are useful in the development of therapeutic and diagnostic agents.
- one aspect of the present invention provides an isolated nucleic acid molecule or derivative thereof comprising a nucleotide sequence encoding or complementary to a sequence encoding a polymorphic variant of Bt5 wherein said Bt5 comprises an amino acid sequence as set forth in ⁇ 400>2.
- a polymorphic variant of Bt5 means a polymorphic variant of a Bt5 protein or corresponding nucleotide sequence identified in accordance with the present invention.
- the amino acid sequence set forth in ⁇ 400>2 corresponds to the Bt5 deduced from the cDNA sequence reported by Arruda et al. (12).
- the inventors have identified polymorphic variants of the amino acid sequence set forth in ⁇ 400>2. The availability of such variants enables a more complete set of agents for use in diagnosis and therapy.
- nucleic acid molecule comprising a sequence of nucleotides or complementary sequence of nucleotides a polymorphic variant of Bt5 wherein said variant comprises an amino acid sequence selected from ⁇ 400>14 to ⁇ 400>18 or ⁇ 400>33 to ⁇ 400>36 or an amino acid sequence having at least about 70% similarity to any or all of ⁇ 400>14 to ⁇ 400>18 or ⁇ 400>33 to ⁇ 400>36 provided said amino acid sequence is not ⁇ 400>2.
- the present invention is directed to a nucleic acid molecule comprising a sequence of nucleotides selected from ⁇ 400>3 to ⁇ 400>13 or ⁇ 400>20 to ⁇ 400>32 or a nucleotide sequence having at least 70% similarity to any one of more of ⁇ 400>3 to ⁇ 400>13 or ⁇ 400>20 to ⁇ 400>32 or a nucleotide sequence capable of hybridizing to the complement of any one or more of ⁇ 400>3 to ⁇ 400>13 or ⁇ 400>20 to ⁇ 400>32 under low stringency conditions provided said nucleotide sequence is not identical to ⁇ 400>1.
- the nucleotide sequence set forth in ⁇ 400>1 corresponds to the nucleotide sequence published by Arruda et al. (12).
- nucleic acid molecule comprising a sequence of nucleotides or complementary sequence of nucleotides which encodes a polymorphic Bt5 allergen from Bt, wherein said nucleotide sequences are selected from:-
- nucleotide sequence is not ⁇ 400>1.
- the immune response may be a humoral and/or a cellular immune response, hi a preferred embodiment, the immune response comprises a humoral response component and, most particularly, an IgE response.
- Reference to a "sensitized" individual should be understood as a reference to an individual who has been previously exposed to an allergen and upon subsequent exposure to the same allergen mounts an immune response which utilizes memory B and/or T cells.
- An individual who is "susceptible" to the sensitization is reference to an individual who, upon exposure to the allergen for the first time, will mount a primary immune response to the allergen.
- the allergen may comprise one or more epitopic regions to which a humoral immune response is directed. It may also, or alternatively, comprise one or more peptide regions to which a T cell response is directed upon processing and presentation of the protein by an antigen presenting cell.
- the allergen defined herein will not necessarily induce an immune response in all individuals who are exposed to it. It should also be understood that even within a group of individuals who are responsive to the allergen, these individuals may be responsive only to a certain range of dosages of the allergen, hi this regard, the principles of low and high dose tolerance are relevant wherein introduction of an immunogen, such as an allergen, at very high or very low doses sometimes induces tolerance.
- similarity includes exact identity between compared sequences at the nucleotide or amino acid level. Where there is non-identity at the nucleotide level, "similarity” includes differences between sequences which result in different amino acids that are nevertheless related to each other at the structural, functional, biochemical and/or conformational levels. Where there is non-identity at the amino acid level, “similarity” includes amino acids that are nevertheless related to each other at the structural, functional, biochemical and/or conformational levels. In a particularly preferred embodiment, nucleotide and sequence comparisons are made at the level of identity rather than similarity.
- references to describe sequence relationships between two or more polynucleotides or polypeptides include “reference sequence”, “comparison window”, “sequence similarity”, “sequence identity”, “percentage of sequence similarity”, “percentage of sequence identity”, “substantially similar” and “substantial identity”.
- a “reference sequence” is at least 12 but frequently 15 to 18 and often at least 25 or above, such as 30 monomer units, inclusive of nucleotides and amino acid residues, in length. Because two polynucleotides may each comprise (1) a sequence (i.e.
- sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity.
- a “comparison window” refers to a conceptual segment of typically 12 contiguous residues that is compared to a reference sequence.
- the comparison window may comprise additions or deletions (i.e. gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
- Optimal alignment of sequences for aligning a comparison window may be conducted by computerised implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, WI, USA) or by inspection and the best alignment (i.e. resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected.
- GAP Garnier et al.
- BESTFIT Pearson FASTA
- FASTA Altschul et al.
- TFASTA Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, WI, USA
- the best alignment i.e. resulting in the highest percentage homology over the comparison window
- sequence similarity and “sequence identity” as used herein refers to the extent that sequences are identical or functionally or structurally similar on a nucleotide-by-nucleotide basis or an amino acid-by-amino acid basis over a window of comparison.
- a “percentage of sequence identity” is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g. A, T, C, G, I) or the identical amino acid residue (e.g.
- sequence identity will be understood to mean the "match percentage” calculated by the DNASIS computer program (Version 2.5 for windows; available from Hitachi Software engineering Co., Ltd., South San Francisco, California, USA) using standard defaults as used in the reference manual accompanying the software. Similar comments apply in relation to sequence similarity.
- Reference herein to a low stringency includes and encompasses from at least about 0 to at least about 15% v/v formamide and from at least about 1 M to at least about 2 M salt for hybridization, and at least about 1 M to at least about 2 M salt for washing conditions.
- low stringency is at from about 25-30°C to about 42°C. The temperature may be altered and higher temperatures used to replace formamide and/or to give alternative stringency conditions.
- Alternative stringency conditions may be applied where necessary, such as medium stringency, which includes and encompasses from at least about 16% v/v to at least about 30% v/v formamide and from at least about 0.5 M to at least about 0.9 M salt for hybridization, and at least about 0.5 M to at least about 0.9 M salt for washing conditions, or high stringency, which includes and encompasses from at least about 31% v/v to at least about 50% v/v formamide and from at least about 0.01 M to at least about 0.15 M salt for hybridization, and at least about 0.01 M to at least about 0.15 M salt for washing conditions.
- T m of a duplex DNA decreases by 1°C with every increase of 1% in the number of mismatch base pairs (Bonner and Laskey (24)).
- Formamide is optional in these hybridization conditions.
- particularly preferred levels of stringency are defined as follows: low stringency is 6 x SSC buffer, 0.1% w/v SDS at 25-42°C; a moderate stringency is 2 x SSC buffer, 0.1% w/v SDS at a temperature in the range 20°C to 65°C; high stringency is 0.1 x SSC buffer, 0.1 % w/v SDS at a temperature of at least 65°C.
- the polymorphic Bt5 protein variatns are proposed to be reactive with human IgE present in the serum of patients who are allergic to house dust or storage mites. It is thereby thought that the polymorphic Bt5 variants comprise at least one epitopic region to which a humoral immune response is directed in individuals who are sensitized to, or susceptible to sensitization to mites.
- the nucleic acid molecule encoding a polymorphic Bt5 variant is preferably a sequence of deoxyribonucleic acids such as a cDNA sequence or a genomic sequence.
- a genomic sequence may also comprise exons and introns.
- a genomic sequence may also include a promoter region or other regulatory regions.
- polymorphic variant of Bt5 and polymorphic variant o ⁇ Bt5 should be understood as a reference to all forms of polymorphic variants of Bt5 and Bt5, respectively, including, for example, any peptide and cDNA isoforms which arise from alternative splicing of polymorphic Bt5 mRNA or mutants or polymorphic variants of polymorphic Bt5 or polymorphic Bt5.
- reference herein to polymorphic Bt5 and polymorphic Bt5 includes reference to derivatives, homologs, analogues, chemical equivalents and mimetics thereof.
- the protein and/or gene is preferably from Bt.
- the protein and/or gene may also be isolated from other species of mite such as other mites from the family Glycyphagidae or other familes such as Pyroglyphidae.
- the protein and/or gene may also be isolated from any non- mite species such as other members of the order Acari.
- the protein and/or gene may also be isolated from any mite or non-mite species other than those comprising the order Acari.
- Derivatives include fragments, parts, portions, mutants, and mimetics from natural, synthetic or recombinant sources including fusion proteins. Parts or fragments include, for example, epitopic regions of polymorphic variants of Bt5. Derivatives maybe derived from insertion, deletion or substitution of amino acids. Amino acid insertional derivatives include amino and/or carboxylic terminal fusions as well as intrasequence insertions of single or multiple amino acids. Insertional amino acid sequence variants are those in which one or more amino acid residues are introduced into a predetermined site in the protein although random insertion is also possible with suitable screening of the resulting product. Deletional variants are characterized by the removal of one or more amino acids from the sequence.
- substitutional amino acid variants are those in which at least one residue in the sequence has been removed and a different residue inserted in its place.
- An example of substitutional amino acid variants are conservative amino acid substitutions.
- Conservative amino acid substitutions typically include substitutions within the following groups: glycine and alanine; valine, isoleucine and leucine; aspartic acid and glutamic acid; asparagine and glutamine; serine and threonine; lysine and arginine; and phenylalanine and tyrosine. Additions to amino acid sequences including fusions with other peptides, polypeptides or proteins.
- Homologs of the protein contemplated herein include, but are not limited to, proteins derived from different species.
- polymorphic Bt5 or polymorphic Bt5 should be understood as molecules exhibiting any one or more of the functional activities of polymorphic Bt5 or polymorphic Bt5 and may be derived from any source such as being chemically synthesized or identified via screening processes such as natural product screening.
- the derivatives of polymorphic variants of Bt5 include fragments having particular epitopes of parts of an entire polymorphic variant of a Bt5 protein fused to peptides, polypeptides or other proteinaceous or non-pro teinaceous molecules.
- Analogues of polymorphic variants of Bt5 contemplated herein include, but are not limited to, modification to side chains, incorporating of unnatural amino acids and/or their derivatives during peptide, polypeptide or protein synthesis and the use of crosslinkers and other methods which impose conformational constraints on the proteinaceous molecules or their analogues.
- nucleic acid sequences may similarly be derived from single or multiple nucleotide substitutions, deletions and/or additions including fusion with other nucleic acid molecules.
- the derivatives of the nucleic acid molecules of the present invention include oligonucleotides, PCR primers, antisense molecules, molecules suitable for use in co- suppression and fusion of nucleic acid molecules.
- Derivatives of nucleic acid sequences also include degenerate variants.
- side chain modifications contemplated by the present invention include modifications of amino groups such as by reductive alkylation by reaction with an aldehyde followed by reduction with NaBBU; amidination with methylacetimidate; acylation with acetic anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2, 4, 6-trinitrobenzene sulphonic acid (TNBS); acylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride; and pyridoxylation of lysine with pyridoxal-5- phosphate followed by reduction with NaBH .
- modifications of amino groups such as by reductive alkylation by reaction with an aldehyde followed by reduction with NaBBU; amidination with methylacetimidate; acylation with acetic anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2, 4, 6-trinitrobenzene sulphonic acid (TNBS); acy
- the guanidine group of arginine residues may be modified by the formation of heterocyclic condensation products with reagents such as 2,3-butanedione, phenylglyoxal and glyoxal.
- the carboxyl group may be modified by carbodiimide activation via O-acylisourea formation followed by subsequent derivitization, for example, to a corresponding amide.
- Sulphydryl groups may be modified by methods such as carboxymethylation with iodoacetic acid or iodoacetamide; performic acid oxidation to cysteic acid; formation of a mixed disulphides with other thiol compounds; reaction with maleimide, maleic anhydride or other substituted maleimide; formation of mercurial derivatives using 4-chloromercuribenzoate, 4- chloromercuriphenylsulphonic acid, phenylmercury chloride, 2-chloromercuri-4-nitrophenol and other mercurials; carbamoylation with cyanate at alkaline pH.
- Tryptophan residues may be modified by, for example, oxidation with N-bromosuccinimide or alkylation of the indole ring with 2-hydroxy-5-nitrobenzyl bromide or sulphenyl halides.
- Tyrosine residues on the other hand, may be altered by nitration with tetranitromethane to form a 3-nitrotyrosine derivative.
- Modification of the imidazole ring of a histidine residue may be accomplished by alkylation with iodoacetic acid derivatives or N-carboethoxylation with diethylpyrocarbonate.
- Examples of incorporating unnatural amino acids and derivatives during protein synthesis include, but are not limited to, use of norleucine, 4-arnino butyric acid, 4-amino-3-hydroxy-5- phenylpentanoic acid, 6-aminohexanoic acid, t-butylglycine, norvaline, phenylglycine, ornithine, sarcosine, 4-amino-3-hydroxy-6-methylheptanoic acid, 2-thienyl alanine and/or D- isomers of amino acids.
- a list of unnatural amino acid contemplated herein is shown in International Patent Application No. PCT/AU97/00668 [International Patent Publication No. WO 97/15663].
- the nucleic acid molecule of the present invention is preferably in isolated form or ligated to a vector, such as an expression vector.
- isolated is meant a nucleic acid molecule having undergone at least one purification step and this is conveniently defined, for example, by a composition comprising at least about 10% subject nucleic acid molecule, preferably at least about 20%, more preferably at least about 30%, still more preferably at least about 40-50%, even still more preferably at least about 60-70%, yet even still more preferably 80-90%) or greater of subject nucleic acid molecule relative to other components as determined by molecular weight, encoding activity, nucleotide sequence, base composition or other convenient means.
- the nucleic acid molecule of the present invention may also be considered, in a preferred embodiment, to be biologically pure.
- protein should be understood to encompass peptides, polypeptides and proteins.
- the protein may be glycosylated or unglycosylated and/or may contain a range of other molecules fused, linked, bound or otherwise associated to the protein such as amino acids, lipids, carbohydrates or other peptides, polypeptides or proteins.
- Reference hereinafter to a "protein” includes a protein comprising a sequence of amino acids as well as a protein associated with other molecules such as amino acids, lipids, carbohydrates or other peptides, polypeptides or proteins.
- a derivative of a nucleic acid molecule of the present invention also includes a nucleic acid molecule capable of hybridizing to a nucleotide sequence as set forth in ⁇ 400>3 to ⁇ 400>13 or ⁇ 400>20 to ⁇ 400>32 under low stringency conditions.
- low stringency is at 42°C.
- the nucleic acid molecule may be ligated to an expression vector capable of expression in a prokaryotic cell (e.g. E.coli) or a eukaryotic cell (e.g. yeast cells, fungal cells, insect cells, mammalian cells or plant cells).
- the nucleic acid molecule may be ligated or fused or otherwise associated with a nucleic acid molecule encoding another entity such as, for example, a signal peptide. It may also comprise additional nucleotide sequence information fused, linked or otherwise associated with it either at the 3' or 5' terminal portions or at both the 3' and 5' terminal portions.
- the nucleic acid molecule may also be part of a vector, such as an expression vector. The latter embodiment facilitates production of recombinant forms of Bt5 which forms are encompassed by the present invention.
- the present invention extends to the expression product of the nucleic acid molecules as hereinbefore defined.
- the expression product is a Bt5 variant having an amino acid sequence set forth in ⁇ 400>14 to ⁇ 400>18 or ⁇ 400>33 to ⁇ 400>36 or is a derivative, homologue, analogue, chemical equivalent or mimetic thereof as defined above or is a derivative, homologue or mimetic having an amino acid sequence of at least about 55%> similarity to at least 10 contiguous amino acids in the amino acid sequence as set forth in ⁇ 400>3 or a derivative or homologue or mimetic thereof provided said amino acid sequence is not ⁇ 400>2.
- Another aspect of the present invention is directed to an isolated protein selected from the list consisting of:-
- a protein encoded by a nucleic acid molecule capable of hybridizing to the nucleotide sequence as set forth in ⁇ 400>3 to ⁇ 400>13 or ⁇ 400>20 to ⁇ 400>32 or a derivative or homologue thereof under low stringency conditions and which encodes an amino acid sequence substantially as set forth in ⁇ 400>14 to ⁇ 400>18 or ⁇ 400>33 to ⁇ 400>36 or a derivative or homologue or mimetic thereof or an amino acid sequence having at least about 55% similarity to at least 10 contiguous amino acids in ⁇ 400>14 to ⁇ 400>18 or ⁇ 400>33 to ⁇ 400>36;
- the allergen does not contain the amino acid sequence set forth in ⁇ 400>2 and is not encoded by the nucleotide sequence set forth in ⁇ 400>1.
- the polymo ⁇ hic Bt5 variants of the present invention may be in multimeric form meaning that two or more molecules are associated together. Where the same polymo ⁇ hic Bt5 molecules are associated together, the complex is a homomultimer. An example of a homomultimer is a homod mer. Where at least one polymo ⁇ hic Bt5 variants is associated with at least one non- polymo ⁇ hic Bt5 molecule, the complex is a heteromultimer such as a heterodimer.
- the heteromultimer may include, for example, another molecule in an amount capable of inducing tolerance to an allergen.
- the ability to produce recombinant polymo ⁇ hic Bt5 variants permits the large scale production of polymo ⁇ hic variants of Bt5 for commercial use.
- the variants may need to be produced as part of a large peptide, polypeptide or protein which may be used as is, or may first need to be processed in order to remove the extraneous proteinaceous sequences.
- processing includes digestion with proteases, peptidases and amidases or a range of chemical, electrochemical, sonic or mechanical disruption techniques.
- Polymo ⁇ hic variants of Bt5 according to the present invention are conveniently synthesized based on molecules isolated from Bt. Isolation of the Bt molecules may be accomplished by any suitable means such as by chromotographic separation, for example using CM-cellulose ion exchange chromotography followed by Sephadex (e.g. G-50 column) filtration. Many other techniques are available including HPLC, PAGE amongst others.
- the Bt5 molecule can be partially sequenced and/or fragments produced directly as a source of a polymo ⁇ hic variant of Bt5 or as a template for amino acid synthesis.
- Polymo ⁇ hic variants of Bt5 may be synthesized by solid phase synthesis using F-moc chemistry.
- Polymo ⁇ hic variants of Bt5 and fragments thereof may also be synthesized by alternative chemistries including, but not limited to, t-Boc chemistry or by classical methods of liquid phase peptide synthesis.
- polymo ⁇ hic variants of Bt5 are mite-derived protein allergens which comprise at least one epitopic region to which an individual sensitized to mites, or an individual who is susceptible to sensitization to mites, may mount an immune response, such as a humoral IgE response.
- the identification of novel mite allergens permits the generation of a range of molecules, such as therapeutic and prophylactic molecules, for the treatment of conditions such as mite-induced allergies.
- the identification of polymo ⁇ hic variants of Bt5 also facilitates the generation of molecules for use as diagnostic agents.
- the present invention further extends to fragments of the polymo ⁇ hic Bt5 allergens comprising a linear or conformational epitope. Preferred fragments are set forth in Figure 2.
- the present invention further provides a method of preventing, reducing or otherwise ameliorating a Bt5-hypersensitivity condition in a subject said method comprising administering to said subject an effective amount of a polymo ⁇ hic variant of Bt5 or a derivative, homologue, analogue, mimetic or chemical equivalent thereof alone or in combination with Bt5 for a time and under conditions sufficient to desensitize said individual.
- the individual who is treated in accordance with the method of the present invention may be human or animal in need of therapeutic or prophylactic treatment and includes an individual who has become sensitized, or who is predisposed to becoming sensitized, to at least part of the Bt5 molecule or a variant thereof such as an epitopic region of a polymo ⁇ hic variant of Bt5.
- the polymo ⁇ hic Bt5 molecule, or part thereof, to which an individual becomes sensitized may comprise part of any antigen such as, but not limited to, the dust or storage mite or a non-mite species.
- references to "subject” should be understood as a reference to all animals including primates (e.g. humans, monkeys), livestock animals (e.g. sheep, cows, horses, donkeys, goats, pigs ), laboratory tests animals (e.g. rats, guinea pigs, rabbits, hamsters), companion animals (e.g. dogs, cats), captive wild animals (e.g. emus, kangaroos, deer, foxes) avies (e.g. chickens, ducks, bantoms, pheasants, emus, ostriches), reptiles (e.g. lizards, snakes, frogs) and fish (e.g. trout, salmon).
- primates e.g. humans, monkeys
- livestock animals e.g. sheep, cows, horses, donkeys, goats, pigs
- laboratory tests animals e.g. rats, guinea pigs, rabbits, hamster
- Bt5-hypersensitivity condition should be understood as a reference to any of type I, ⁇ , HI or IV hypersensitivity conditions directed to all or part of Bt5 or a Bt5 variant. More particularly, the Bt5 hypersensitivity condition is a type I hypersensitivity condition. Examples of type I hypersensitivity conditions which may be treated in accordance with the method of the present invention include, but are not limited to immediate hypersensitivity, systemic anaphylaxis, allergic rhinitis (hayfever) or asthma (for example bronchial asthma).
- the preferred method is to reduce or prevent the induction of an immune response to an antigen comprising all or part of Bt5 or a Bt5 variant
- the antigen is a bacterium or parasite which comprises all or part of a polymo ⁇ hic Bt5 region
- another aspect of the present invention relates to a method of modulating, in a subject, an immune response directed to Bt5, said method comprising administering to said subject an effective amount of a polymo ⁇ hic variant of Bt5 or a derivative, homologue, analogue, chemical equivalent or mimetic thereof alone or in combination with Bt5 for a time and under conditions sufficient to up-regulate, down-regulate or otherwise modulate said immune response.
- references to an "effective amount” should be understood as a reference to an amount of a polymo ⁇ hic variant of Bt5 or derivative, homologue, analogue, chemical equivalent or mimetic thereof necessary to at least partly achieve the desired outcome.
- an antigen comprising a Bt5 portion, or a polymo ⁇ hic variant thereof
- very low or very high concentrations of a Bt5 vairant may be administered alone or in combination with Bt5 to induce low or high dose tolerance, respectively.
- doses of Bt5 and/or a variant thereof which do not induce tolerance maybe administered.
- the present invention further extends to the use of a polymo ⁇ liic variant of Bt5 in the manufacture of a medicament for modulating an immune response.
- Yet another aspect of the present invention provides an agent useful for modulating an immune response, said agent comprising a polymo ⁇ hic variant of Bt5 alone or hi combination with Bt5.
- said modulation is down-regulation of the immune response.
- more than one type of protein or peptide may be administered.
- the Bt5 variant may be co- administered with other known tolerance inducing compounds or molecules.
- the Bt5 variant maybe administered with an adjuvant.
- co- administered is meant simultaneous administration in the same formulation or in two different formulations via the same or different routes or sequential administration by the same or different routes.
- sequential administration is meant a time difference of from seconds, minutes, hours or days between the administration of the two or more types of molecules.
- the polymo ⁇ hic variant of Bt5, alone or in combination with Bt5, and other compound or molecule may be administered in any order.
- Routes of administration include but are not limited to intravenously, intraperitoneal, subcutaneously, intracranial, intradermal, intramuscular, intraocular, intrathecal, intracerebrally, intranasally, infusion, orally, rectally, via iv drip, patch and implant. Intravenous routes are particularly preferred. Administration may also be via aerosol or inhalation.
- compositions for use in modulating an immune response comprising a polymo ⁇ hic variant of Bt5 alone or in combination with Bt5 and one or more pharmaceutically acceptable carriers and/or diluents.
- the composition may also comprise two different types of molecules such as a polymo ⁇ hic variant of Bt5 alone or in combination with Bt5 and another compound or molecule with which it is co-administered.
- compositions suitable for injectable use include sterile aqueous solutions (where water soluble) and sterile powders for the extemporaneous preparation of sterile injectable solutions. They must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
- the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), suitable mixtures thereof and vegetable oils.
- the preventions of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thirmerosal and the like, h many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride.
- Prolonged abso ⁇ tion of the injectable compositions can be brought about by the use in the compositions of agents delaying abso ⁇ tion, for example, aluminum monostearate and gelatin.
- Sterile injectable solutions are prepared by inco ⁇ orating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by, for example, filter sterilization or sterilization by other appropriate means. Dispersions are also contemplated and these may be prepared by inco ⁇ orating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
- a preferred method of preparation includes vacuum drying and the freeze-drying technique which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution.
- the active ingredients When the active ingredients are suitably protected, they may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in hard or soft shell gelatin capsule, or it may be compressed into tablets.
- the active compound may be inco ⁇ orated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.
- Such compositions and preparations should contain at least 1% by weight of active compound.
- the percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 5 to about 80% of the weight of the unit.
- the amount of active compound in such therapeutically useful compositions in such that a suitable dosage will be obtained.
- Preferred compositions or preparations according to the present invention are prepared so that an oral dosage unit form contains between about 0.1 ng and 2000 mg of active compound.
- the tablets, troches, pills, capsules and the like may also contain the components as listed hereafter.
- a binder such as gum, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such a sucrose, lactose or saccharin may be added or a flavouring agent such as peppermint, oil of wintergreen, or cherry flavouring.
- the dosage unit form When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit.
- tablets, pills, or capsules may be coated with shellac, sugar or both.
- a syrup or elixir may contain the active compound, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavouring such as cherry or orange flavour. Any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-oxic in the amounts employed.
- the active compound(s) may be inco ⁇ orated into sustained-release preparations and formulations.
- the present invention also extends to forms suitable for topical application such as creams, lotions and gels.
- Pharmaceutically acceptable carriers and/or diluents include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and abso ⁇ tion delaying agents and the like.
- the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, use thereof in the therapeutic compositions is contemplated. Supplementary active ingredients can also be inco ⁇ orated into the compositions. It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage.
- Dosage unit form refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
- the specification for the novel dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active material and the particular therapeutic effect to be achieved and (b) the limitations inherent in the art of compounding such an active material.
- Effective amounts of protein contemplated by the present invention will vary depending on the severity of the pain and the health and age of the recipient. In general terms, effective amounts may vary from 0.01 ng/kg body weight to about 100 mg kg body weight. Alternative amounts include for about 0.1 ng/kg body weight about 100 mg/kg body weight or from 1.0 ng/kg body weight to about 80 mg/kg body weight.
- the pharmaceutical composition may also comprise genetic molecules such as a vector capable of transfecting target cells where the vector carries a nucleic acid molecule capable of expressing a polymo ⁇ hic variant of Bt5 or derivative, homologue or mimetic thereof.
- composition comprises an isolated nucleic acid molecule comprising a nucleotide sequence encoding or complementary to a sequence encoding a protein allergen from a mite or a derivative, homologue or mimetic or said protein allergen.
- the nucleotide sequence encodes the amino acid sequence substantially as set forth in ⁇ 400>14 to ⁇ 400>18 or ⁇ 400>33 to ⁇ 400>36 or a derivative, homologue or mimetic thereof or having at least about 55% or greater similarity to at least 10 contiguous amino acids in ⁇ 400>14 to ⁇ 400>18 or ⁇ 400>33 to ⁇ 400>36.
- the nucleotide sequence comprises the nucleotide sequence of ⁇ 400>3 to ⁇ 400>13 or ⁇ 400>20 to ⁇ 400>32, or a derivative, homologue or mimetic thereof, or capable of hybridizing to ⁇ 400>3 to ⁇ 400>13 or ⁇ 400>20 to ⁇ 400>32 under low stringency conditions.
- allergen gene transfer immunization is by the intramuscular injection of a plasmid DNA encoding a house dust or storage mite allergen (15).
- Still another aspect of the present invention is directed to antibodies to a polymo ⁇ hic variant of Bt5 or a derivative, homologue, analogue, mimetic or chemical equivalent thereof.
- antibodies of the present invention are particularly useful as therapeutic or diagnostic agents.
- specific antibodies can be used to screen for polymo ⁇ hic variants of Bt5 in immunoassays or used as antagonists to inhibit activity of Bt5 or a polymo ⁇ hic variant thereof under certain circumstances such as where temporary hypersensitivity inhibition only is required.
- Techniques for such immunoassays are well known in the art and include, for example, sandwich assays and ELISA. Knowledge of levels of Bt5 or a polymo ⁇ hic variant thereof may be important for monitoring certain therapeutic protocols.
- Antibodies to the polymo ⁇ hic variant of Bt5 (or its derivatives, homologues, analogues or mimetics) of the present invention may be monoclonal or polyclonal. Alternatively, fragments of antibodies maybe used such as Fab fragments. Furthermore, the present invention extends to recombinant and synthetic antibodies and to antibody hybrids. A "synthetic antibody" is considered herein to include fragments and hybrids of antibodies.
- specific antibodies can be used to screen for the polymo ⁇ hic variant of Bt5.
- the latter would be important, for example, as a means for screening for levels of a polymo ⁇ hic variant of Bt5 in a biological fluid or purifying a polymo ⁇ hic variant of Bt5 made by recombinant means from culture supernatant fluid.
- An antibody as contemplated herein includes any antibody specific to any region of a polymo ⁇ hic variant of Bt5.
- Both polyclonal and monoclonal antibodies are obtainable by immunization with a polymo ⁇ hic variant of Bt5 and either type is utilizable for immunoassays.
- the methods of obtaining both types of sera are well known in the art.
- Polyclonal sera are less preferred but are relatively easily prepared by injection of a suitable laboratory animal with an effective amount of a polymo ⁇ hic variant of Bt5 or antigenic parts thereof, collecting serum from the animal and isolating specific sera by any of the known immunoadsorbent techniques.
- antibodies produced by this method are utilizable in virtually any type of immunoassay, they are generally less favoured because of the potential heterogeneity of the product.
- the use of monoclonal antibodies in an immunoassay is particularly preferred because of the ability to produce them in large quantities and the homogeneity of the product.
- the preparation of hybridoma cell lines for monoclonal antibody production derived by fusing an immortal cell line and lymphocytes sensitized against the immunogenic preparation can be done by techniques which are well known to those who are skilled in the art.
- Yet another aspect of the present invention is directed to methods of diagnosing individuals who have become sensitized to antigens which comprise all or part of Bt5 or a polymo ⁇ hic variant of Bt5.
- another aspect of the present invention contemplates a method for detecting an antibody directed to all or part of a polymo ⁇ hic variant of Bt5 in a biological sample from a subject, said method comprising contacting said biological sample with said polymo ⁇ hic Bt5 variant or a derivative, homologue, analogue, chemical equivalent or mimetic thereof for a time and under conditions sufficient for an antibody-protein complex to form, and then detecting said complex.
- Detection of the presence of a polymo ⁇ hic variant of Bt5 may be accomplished in a number of ways such as by Western blotting and ELISA procedures.
- a wide range of immunoassay techniques are available as can be seen by reference to U.S. Patent Nos. 4,016,043, 4, 424,279 and 4,018,653. These, of course, include both single-site and two-site or "sandwich" assays of the non- competitive types, as well as in the traditional competitive binding assays.
- These assays also include direct binding of a labelled antibody to a target, such as a polymo ⁇ hic variant of Bt5.
- Sandwich assays are among the most useful and commonly used assays and are favoured for use in the present invention to detect a polymo ⁇ hic variant of Bt5 or antibody to a polymo ⁇ hic variant of Bt5.
- an unlabelled antibody of a polymo ⁇ hic variant of Bt5 is immobilized on a solid substrate and the sample to be tested brought into contact with the bound molecule.
- a second antibody specific to the complex molecules labelled with a reporter molecule capable of producing a detectable signal is then added and incubated, allowing time sufficient for the formation of another complex of antibody-antigen-labelled antibody. Any unreacted material is washed away, and the presence of the antigen or antibody is determined by observation of a signal produced by the reporter molecule. The results may either be qualitative, by simple observation of the visible signal, or maybe quantitated by comparing with a control sample containing known amounts of hapten.
- the sample is one which might contain an antibody to a polymo ⁇ hic variant of Bt5 including cell extract, culture supernatant tissue biopsy, serum, saliva, mucosal secretions, lymph, tissue fluid and respiratory fluid.
- the sample is, therefore, generally a biological sample comprising biological fluid but also extends to fermentation fluid and supernatant fluid such as from a cell culture.
- the sample may also be a sample thought to comprise the Bt5 variant molecule, such as a sample of dust thought to comprise dust or storage mites.
- a first antibody having specificity for the protein or antigenic parts thereof is either covalently or passively bound to a solid surface.
- the solid surface is typically glass or a polymer, the most commonly used polymers being cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene.
- the solid supports may be in the form of tubes, beads, discs of microplates, or any other surface suitable for conducting an immunoassay.
- the binding processes are well-known in the art and generally consist of cross-linking covalently binding or physically adsorbing, the polymer-antibody complex is washed in preparation for the test sample.
- an aliquot of the sample to be tested is then added to the solid phase complex and incubated for a period of time sufficient (e.g. 2-40 minutes or overnight if more convenient) and under suitable conditions (e.g. from room temperature to about 37°C) to allow binding of any subunit present in the antibody.
- the antibody subunit solid phase is washed and dried and incubated with a second antibody specific for a portion of the hapten.
- the second antibody is linked to a reporter molecule which is used to indicate the binding of the second antibody to the hapten.
- An alternative method involves immobilizing the target molecules (such as a polymo ⁇ hic variant of Bt5) and then exposing the immobilized target to a sample which is to be tested for the presence of antibody to the Bt5 variant.
- a second labelled reporter antibody specific to the first antibody is exposed to the target-first antibody complex to form a target-first antibody- second antibody tertiary complex. The complex is detected by the signal emitted by the reporter molecule.
- reporter molecule as used in the present specification, is meant a molecule which, by its chemical nature, provides an analytically identifiable signal which allows the detection of antigen-bound antibody. Detection may be either qualitative or quantitative.
- the most commonly used reporter molecules in this type of assay are either enzymes, fluorophores or radionucliide containing molecules (i.e. radioisotopes) and chemiluminescent molecules.
- an enzyme immunoassay an enzyme is conjugated to the second antibody, generally by means of glutaraldehyde or periodate. As will be readily recognized, however, a wide variety of different conjugation techniques exist, which are readily available to the skilled artisan.
- Commonly used enzymes include horseradish peroxidase, luciferase glucose oxidase, beta-galactosidase and alkaline phosphatase, amongst others.
- the substrates to be used with the specific enzymes are generally chosen for the production, upon hydrolysis by the corresponding enzyme, of a detectable colour change. Examples of suitable enzymes include alkaline phosphatase and peroxidase. It is also possible to employ fluorogenic substrates which yield a fluorescent product rather than the chromogenic substrates noted above. In all cases, the enzyme-labelled antibody is added to the first antibody-peptide complex, allowed to bind, and then the excess reagent is washed away.
- a solution containing the appropriate substrate is then added to the complex of antibody-antigen-antibody.
- the substrate will react with the enzyme linked to the second antibody, giving a qualitative visual signal, which may be further quantitated, usually spectrophotometrically, to give an indication of the amount of hapten which was present in the sample.
- Reporter molecule also extends to use of cell agglutination or inhibition of agglutination such as red blood cells on latex beads, and the like.
- fluorescent compounds such as fluorescein and rhodamine
- fluorescent compounds may be chemically coupled to antibodies without altering their binding capacity.
- the fluorochrome-labelled antibody When activated by illumination with light of a particular wavelength, the fluorochrome-labelled antibody adsorbs the light energy, inducing a state to excitability in the molecule, followed by emission of the light at a characteristic colour visually detectable with a light microscope.
- the fluorescent labelled antibody is allowed to bind to the first antibody-hapten complex.
- the fluorescence observed indicates the presence of the hapten of interest, hnmunofluorescene and EIA techniques are both very well established in the art and are particularly preferred for the present method.
- other reporter molecules such as radioisotope, chemiluminescent or bioluminescent molecules, may also be employed.
- Bt dust or storage mites were grown in the laboratory and the starter cultures were prepared by collecting mites from the house dust samples in Singapore. Bt were identified according to Bronswijk (18) and isolated under a stereomicroscope from the dust samples, which were used for setting-up a starter culture. Fine powdered tetiamin fish feed was used as a culture medium for culturing Bt. The tetiamin flakes were heated at 60°C for 3 hours before being grounded to kill pre-existing mites and insects. It was then sieved through a 125 ⁇ m. sieve before use.
- a thin layer of ⁇ 125 ⁇ m particles were introduced into Erlenmeyer flasks together with a few flakes that served as shelters and breeding ground for mites.
- a starter culture from a small bottle was inoculated into a one-litre Erlenmeyer flask which was then covered by two layers of paper towels to allow ventilation, and sealed with masking tape around the opening of the flask to prevent contamination from the other mites and insects.
- Those cultures were grown under natural environmental conditions with a mean annual temperature of 30°C and a mean RH of 80%.
- Mites that remained in the funnel were then swept into the tube with a tiny soft brush after the gauze was removed (Figure 1).
- the purified mites were stored at -80°C until use. Mites and the powered medium particles that were finer than 125 ⁇ m collected in a receiving pan placed at the bottom of the sieves were used for further subculturing.
- the phage particles were transfened to a Hybond-N+ nylon membrane (Amersham Pharmacia Biotech, England). The membranes were then subjected to denaturation, neutralization, and crosslinking process according to manufacturer protocol. The membranes were prehybridized for 1 hour before being hybridized with the labeled probes in a roller bottle at 42°C, overnight. After hybridization and post-hybridization washes, the membranes were equilibrated with washing buffer for 1 minute. The membranes were blocked in blocking solution for an hour before incubating with Anti-Digoxigenin- Alkaline Phosphate (Boehringer Mannheim, Germany) for 30 minutes. Washing was performed with washing buffer before signal detection.
- the phagemid was excised in vivo with the help of an ExAssist helper phage according to a protocol described in the instruction manual of Uni-Zap XR Library (Stratagene, La Jolla, CA). Sequences of the inserts were determined by automated DNA sequencing using ABI PRISM dRhodamine terminator cycle sequencing ready reaction kit (Perkin Elmer, CA).
- Genomic DNA sequence for Bt5 was cloned by direct PCR amplification from storage mite, Bt obtained from Singapore and Colombia. Briefly, numerous mites were suspended in IX PCR reaction buffer (10 mM KCL10 mM (NH4)2SO4, 20 mM Tris-Cl (pH 8.75), 2 mM MgSO 4 , 0.1% v/v Triton X-100, 100 ⁇ g/ml BSA) and boiled at 100°C for 10 minutes. The sample was cooled on ice for 10 minutes.
- the PCR reaction was carried out in 1 X PCR buffer containing 100 mM of dNTP, 20 pmoles of each sense and antisense primers and 2.5 units of pfu in a final volume of 100 ⁇ l.
- the sense primer and the antisense primer are 5'CCCGGATCCACAATGAAGTTCGCCATCGTTCTT3' ⁇ 400>35 (primer) and 5'GCTCTAGATTATTGGTTTGAATATC3' ⁇ 400>36 (primer), respectively.
- the recombinant Bt5 allergens have been purified using recombinant E coli as a fusion with glutathione-S-transferase (GST).
- GST glutathione-S-transferase
- the proteins were purified by affinity chromatography using glutathione agarose beads.
- the purified proteins were then cleaved by thrombin digestion.
- the cleaved proteins were separated from the GST fusion partner by another round of affinity chromatography using the glutathione agarose beads and then analysed on SDS-PAGE gel. Proteins were filter-sterilized before use (refer Figure 4).
- Lyophilized Bt mites were homogenized in the presence of liquid nitrogen.
- the homogenized mite proteins were extracted in PBS buffer for 48 hours at 4°C.
- the extracts were analyzed on SDS-PAGE gel and then filter sterilized before use.
- the pPICz ⁇ A vector provided the ⁇ -mating factor signal for secretion and the zeocin gene for selection of recombinant clones in both E. coli and P. paotoris.
- Both the the pPICz ⁇ A and pPICz ⁇ A-Bt5 plasmids were linearized with Pme I and transformed into P. pastoris strain KM71 by lithium chloride method as described in the Pichia expression manual (version E) (hivitrogen Co ⁇ .).
- the zeocin resistant colonies were furtl er selected for screening of protein expression.
- BMGY medium 1.34% yeast nitrogen base with ammonium sulphate, 0.1 M potassium phosphate, pH 6.0, 0.4 mg/l biotin, and 1% v/v glycerol
- Cells were harvested and gently resuspended in 500 ml of BMMY medium containing 0.5% methanol. The cells were cultured for another 2 days to induce the production of Bt5 and methanol was replenished to 0.5% final concentration every 24 hours.
- the extracellular medium containing the recombinant Bt5 was dialyzed against phosphate buffered saline (PBS) and concentrated with Centriplus-10 ultrafiltration (Amicon).
- PBS phosphate buffere
- the yeast cells were separated from the medium containing the rBt5 by centrifugation at 1500 g for 5 minutes.
- Sodium chloride crystal was added the culture medium to a final concentration of 4 M.
- the supernatant was applied to Butyl Sepharose 4 Fast Flow column (Pharmacia Biotech) equilibrated with 10 mM Mes pH6 .0, 4 M NaCl and eluted with 10 mM Mes pH 6.0.
- the rBt5 -containing fractions were dialyzed against 10 mM Tris pH 7.5 and loaded into a Q Sepharose Fast Flow column (Pharmacia Biotech) equilibrated with the same buffer.
- ELISA plates (96 well) (Costar) were coated with 50 ⁇ l of either rBt5 in 0.1 M NaHCO 3 , pH 8.2 at 4°C overnight. After washing, plates were blocked with 1% w/v bovine serum albumin in PBS containing 0.05% Tween-20 (PBS-Tween) at room temperature for 2 hours. The Dp mite positive human sera, non-atopic sera, and cord blood sera, all from National Taiwan University, were diluted 1:5 in blocking solution. Fifty ⁇ l of the diluted human sera were incubated at 4°C overnight. Plates were washed and incubated with biotin-conjugated monoclonal mouse anti-human IgE (B3102E8) for 1 hour.
- ExtiAvidin-alkaline phosphatase (Sigma), diluted 1 :2000 in blocking buffer, was incubated for 1 hour at room temperature. Signal was developed by addition of 50 ⁇ l p- Nitrophenylphosphate substrate. Abso ⁇ tion was measured at 405 nm (refer Figure 6).
- the zeocin resistant clones of Pichia pastoris KM71 strain transformed with pPICz ⁇ -Bt5 were selected for protein analysis.
- the recombinant Bt5 was produced as a secretory protein approximately 15 kD in size eight hours after methanol induction. The protein production continued to increase up to 96 hours, however, the yield and purity of the protein was optimum at 48 hours post-induction. SDS-PAGE analysis showed that greater than 90% of the proteins secreted by the recombinant yeast was a rBt5.
- the advantage of expressing Bt5 as secreted protein is that Pichia pastoris secretes very low levels of native proteins. The yield of the rBt5 produced was estimated as greater than 10 mg/litre.
- T-cells cultures were first set up using Bt crude extracts, the second round of antigen stimulation was performed with recombinant polymo ⁇ hic Bt5 allergens.
- Antigen-specific T- cell lines were established. Two cell lines were used for epitope mapping, using a panel of synthetic peptides.
- T-cell lines specific for Bt5 were generated from PBMC often allergic individuals. These cell lines were tested against the synthetic peptides by T-cell proliferation that was measured by thymidine uptake assay.
- T-cell epitope mapping was performed using a panel of polymo ⁇ hic Bt5 synthetic peptides (Figure7). As shown in Figure 10, the T-cell epitopes recognized by allergic subjects are largely located in regions where polymo ⁇ hic residues are found. A substitution of one or two amino acid residues resulted in sigmficant difference in T-cell response. The results suggest that these polymo ⁇ hic residues are potentially important for the design and development of effective immunotherapeutic reagents for the treatment of mite allergy.
- T-cells (1 x IO 5 ) were cultured with or without irradiated antigen presenting cells (5 x 10 5 ) in a final volume of 0.2 ml in complete RPMI in the presence of varying concentration of protein antigens. Tridium thymidine ([ 3 H]TdR) was added at 48 hours, 72 hours or 96 hours for 18 hours. Cultures were harvested and thymidine inco ⁇ oration was analyzed by liquid scintillation.
- the inventors have shown that a small degree of sequence polymo ⁇ hism in mite allergens exerts a significant impact on the host immune system, including both the humoral and cellular immune responses.
- Bt5 is the main indoor allergen causing asthma in tropical and subtropical countries, it was important to examine whether there was residue polymorphism in Bt5 gene(s).
- the inventors have cloned the genomic sequences of polymo ⁇ hic Bt5 gene(s). By aligning the coding and intron sequences, a total number of 11 Bt5 gene variants have been identified (Figure 2).
- Sequences 1 to 5 and 6 to 10 represent polymo ⁇ hic variants of Bt5 gene sequences obtained from Colombian and Singapore Bt mites, respectively. Like Der p 2, there is only one intron present in Bt5 (19). However, the intron of Bt5 is shorter and its location is further downstream of the first codon, ATG, than in the Der p 2 gene (19). The size of the intron ranges between 54 and 56 bp with stretches of nucleotides composed of either A or T base. Among the 11 Bt5 variants, nucleotide polymo ⁇ hisms are mainly found within the first half of the coding sequence (Table 2). Some of the nucleotide changes resulted in amino acid residue changes (Table 3 and Figure 3).
- the residue changes resulted in the conversion of a negatively charged residue to a neutral residue (residue 2), a positively-charged amino acid to a negatively-charged residue (residue 4), a neutral residue to a negatively-charged residue (residue 12); a neutral residue to a neutral residue (residues 17, 23 and 33), or a neutral residue to a positively-charged residue (residues 34 and 11).
- alterations included the conversion of a hydrophobic residue to a different hydrophobic residue (residue 34), an acidic residue to an aliphatic residue (residue 2), a basic residue to an acidic residue (residue 12), an aliphatic residue to an aromatic residue (residue 17), an amide residue to an aliphatic residue (residue 23), and an aliphatic residue to basic residue (residues 34 and 117).
- the first cDNA sequence for Bt5 was published by Arruda et al. (12). Subsequently, a partial sequence of Bt5 was reported by Carabolla et al. (13).
- the inventors independently isolated Bt5 cDNA clones from a cDNA library constructed using total RNA extracted from local Bt mites. As shown in Figures 8 and 9, the instant polymo ⁇ hic Bt5 cDNA sequences differ from the published sequences in two important aspects. First, the cDNA clones revealed a number of polymo ⁇ hic residues that were not previously reported. Secondly, the cDNA clones have extended 5'- and 3'- untranslated regions and there is a high degree of sequence diversity shown by the various cDNA variants in these untranslated regions ( Figure 8). EXAMPLE 14 IgE mapping
- Figures 1 lb-d The results of IgE mapping of recombinant polymo ⁇ hic Bt5 -derived recombinant peptides, Figure 1 la, are shown in Figures 1 lb-d.
- Figure 1 lb shows a representative result of each subset. Some patients showed IgE reactivity to the full-length (FL) peptide and to the peptide defined by residue 41-117 and this peptide represents the dominant IgE epitope for these patients.
- Figure 1 lc is another representative result from such patients. Yet another subset of patients showed poor IgE reactivity to the full-length peptide, but most of their IgE reactivity targeted at peptide 41-117.
- Figure 1 Id is another
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Insects & Arthropods (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Tropical Medicine & Parasitology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Immunology (AREA)
- Pharmacology & Pharmacy (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Animal Behavior & Ethology (AREA)
- Engineering & Computer Science (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pulmonology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
Claims
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AUPQ884500 | 2000-07-18 | ||
| AUPQ8845A AUPQ884500A0 (en) | 2000-07-18 | 2000-07-18 | Novel therapeutic molecules and uses therefor - III |
| PCT/AU2000/001228 WO2002006323A1 (en) | 2000-07-18 | 2000-10-10 | IMMUNOGENIC PROTEINS DERIVED FROM DOMESTIC MITE ALLERGEN, BLOMIA TROPICALIS (Bt5) |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP1311541A1 true EP1311541A1 (en) | 2003-05-21 |
| EP1311541A4 EP1311541A4 (en) | 2005-08-03 |
Family
ID=3822908
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP00969092A Withdrawn EP1311541A4 (en) | 2000-07-18 | 2000-10-10 | IMMUNOGENIC PROTEINS DERIVED FROM DOMESTIC MITE ALLERGEN, BLOMIA TROPICALIS (Bt5) |
Country Status (3)
| Country | Link |
|---|---|
| EP (1) | EP1311541A4 (en) |
| AU (1) | AUPQ884500A0 (en) |
| WO (1) | WO2002006323A1 (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9160811B2 (en) | 2004-08-10 | 2015-10-13 | Nokia Technologies Oy | Client provisioning with enhanced linking |
| US20090130130A1 (en) * | 2005-06-10 | 2009-05-21 | National University Of Singapore | Mutant allergen(s) |
| JP2009534029A (en) * | 2006-04-20 | 2009-09-24 | ナショナル ユニバーシティ オブ シンガポール | Recombinant lactobacilli and uses thereof |
| WO2008143594A1 (en) * | 2007-05-17 | 2008-11-27 | National University Of Singapore | Hypoallergenic polypeptides |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2317724A1 (en) * | 1998-01-09 | 1999-07-15 | Circassia Limited | Methods and compositions for desensitisation |
-
2000
- 2000-07-18 AU AUPQ8845A patent/AUPQ884500A0/en not_active Abandoned
- 2000-10-10 WO PCT/AU2000/001228 patent/WO2002006323A1/en not_active Ceased
- 2000-10-10 EP EP00969092A patent/EP1311541A4/en not_active Withdrawn
Also Published As
| Publication number | Publication date |
|---|---|
| AUPQ884500A0 (en) | 2000-08-10 |
| WO2002006323A1 (en) | 2002-01-24 |
| EP1311541A4 (en) | 2005-08-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP2009005709A (en) | Production method of t cell epitope of major allergen from dermatophagoides (house dust mite) | |
| JP2007151555A (en) | Allergen proteins and peptides from house dust mites and uses therefor | |
| US5710126A (en) | T cell epitopes of ryegrass pollen allergen | |
| KR100263393B1 (en) | Ryegrass Pollen Allergen | |
| US10293042B2 (en) | Immunogenic protein Pas n 1 from Bahia grass pollen | |
| JP2002191379A (en) | Asp1 | |
| KR100465382B1 (en) | Antigenic protein originating in malassezia | |
| US20030096779A1 (en) | Novel dermatophagoides proteins and uses thereof | |
| US6180771B1 (en) | Nucleic acids encoding a house dust mite allergen, Der p III, and uses therefor | |
| WO2002006323A1 (en) | IMMUNOGENIC PROTEINS DERIVED FROM DOMESTIC MITE ALLERGEN, BLOMIA TROPICALIS (Bt5) | |
| JPWO1997021817A1 (en) | Antigenic proteins from Malassezia | |
| KR101019865B1 (en) | Recombinant allergens with reduced IgE binding but not reduced T-cell antigenicity | |
| US7112333B1 (en) | T cell epitopes of ryegrass pollen allergen | |
| WO2001030817A1 (en) | Immunogenic proteins from the domestic mite, blomia tropicalis | |
| CA2437484A1 (en) | Ragweed allergens | |
| AU783254B2 (en) | Immunogenic proteins from the domestic mite, blomia tropicalis | |
| WO2003016529A1 (en) | Novel blomia tropicalis antigens and uses therefor | |
| JPH09501043A (en) | T cell epitopes of major allergens derived from DERMATOPHAGOIDES | |
| KR100733887B1 (en) | Isolated Nucleic Acids Encoding DerpIII Protein Allergens | |
| JP3983246B2 (en) | Antigenic protein from Malassezia | |
| WO2002030968A1 (en) | Novel mite allergens and uses therefor | |
| JP2004529605A (en) | Dermatophagoides nucleic acid molecules, proteins and uses thereof | |
| JP4044605B2 (en) | Antigenic protein from Malassezia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20030218 |
|
| AK | Designated contracting states |
Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK RO SI |
|
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: LEE, BEE WAH Owner name: CHEONG, NGE Owner name: CHUA, KAW YAN |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20050621 |
|
| 17Q | First examination report despatched |
Effective date: 20060809 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20061220 |