EP1309603A1 - Acides nucleiques comprenant des regions du promoteur peg-3 du rat et leurs utilisations - Google Patents

Acides nucleiques comprenant des regions du promoteur peg-3 du rat et leurs utilisations

Info

Publication number
EP1309603A1
EP1309603A1 EP01954874A EP01954874A EP1309603A1 EP 1309603 A1 EP1309603 A1 EP 1309603A1 EP 01954874 A EP01954874 A EP 01954874A EP 01954874 A EP01954874 A EP 01954874A EP 1309603 A1 EP1309603 A1 EP 1309603A1
Authority
EP
European Patent Office
Prior art keywords
cell
gene
peg
cells
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01954874A
Other languages
German (de)
English (en)
Other versions
EP1309603A4 (fr
Inventor
Paul B. Fisher
Zao-Zhong Su
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Columbia University in the City of New York
Original Assignee
Columbia University in the City of New York
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US09/621,781 external-priority patent/US6737523B1/en
Application filed by Columbia University in the City of New York filed Critical Columbia University in the City of New York
Publication of EP1309603A1 publication Critical patent/EP1309603A1/fr
Publication of EP1309603A4 publication Critical patent/EP1309603A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B30/00—Methods of screening libraries
    • C40B30/04—Methods of screening libraries by measuring the ability to specifically bind a target molecule, e.g. antibody-antigen binding, receptor-ligand binding
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
    • G01N33/6845—Methods of identifying protein-protein interactions in protein mixtures

Definitions

  • This invention provides for an isolated nucleic acid comprising a PEG-3 promoter comprising the nucleotide sequence beginning with the guanosine (G) at position -270 and ending with the cytosine (C) at position +194 of SEQ ID NO: 1.
  • the invention also provides for a method for identifying an agent which modulates PEG-3 promoter activity in a cell which comprises : (a) contacting the cell with the agent wherein the cell comprises a nucleic acid comprising a PEG-3 promoter operatively linked to a reporter gene; (b) measuring the level of reporter gene expression in the cell; and (c) comparing the expression level measured in step (b) with the reporter gene expression level measured in an identical cell in the absence of the agent, wherein a lower expression level measured in the presence of the agent is indicative of an agent that inhibits PEG-3 promoter activity and wherein a higher expression level measured in the presence of the agent is indicative of an agent that enhances PEG-3 promoter activity, thereby identifying an agent which modulates PEG-3 promoter activity in the cell.
  • the invention provides for a method for treating cancer in a subject which comprises administering a nucleic acid comprising a PEG-3 promoter operatively linked to a gene-of-interest wherein the gene of interest is selectively expressed in cancerous cells in the subject and such expression regulates expression of PEG-3 resulting in growth suppression or death of the cancerous cells, thereby treating cancer in the subject.
  • FIGS 1A-1C Anchorage independent growth and PEG-3 mRNA and protein expression in normal, adenovirus-transformed and somatic cell hybrid rodent cells.
  • FIG. 1A Anchorage- independent growth assays were determined by plating 5 X 10 3 or 1 X 10 4 cells in 0.4% agar containing medium on top of a 0.8% agar medium containing base layer. After two weeks growth, colonies >0.1 mm were enumerated using an inverted microscope. The results are the average of 3 independent experiments using triplicate samples per experiment + SD.
  • FIG. IB PEG3 MRNA levels were determined by electrophoresing 15 ⁇ g of total cellular RNA in a 1.2% agarose gel . RNA was transferred to nylon membranes and hybridized with a 32 P-labeled PEG-3 cDNA probe, the blot was stripped and then rehybridized with a 32 P-labeled GAPDH probe.
  • FIG. 2 Sequence of the 2.0-kb PEG-3 promoter. (SEQ ID NO:l) This fragment was identified by 5' DNA walking as described in Materials and Methods. The location of PEA3 and API elements and the TATA boxes are indicated.
  • Figure 3 Determination of the transcription start site of the PEG-3 promoter.
  • a primer complementary to the 5' UTR region of PEG-3 mRNA was annealed with 4 ⁇ g of Poly A + RNAs from Ell-NMT or Ell cells and used as a template for the primer extension assay. The conditions used for reverse transcription were as described in Materials and Methods.
  • Figure 4 Full-length PEG-3 promoter-luciferase activity in normal, adenovirus transformed and somatic cell hybrid rodent cells. Different cell types were co-transfected with 5 ⁇ g of the FL PEG-Prom and 1 ⁇ g of a pSV- ⁇ -galactosidase plasmid and luciferase activity was determined as described in Materials and Methods 48 hr later. The results are standardized by ⁇ - galactosidase activity and represent the average of 3 independent experiments + SD. Results are expressed as fold activation in comparison with activity in Ell, which represents 1 fold activation.
  • FIGS. 5A-5B Mapping the regions of the PEG-3 promoter necessary for basal and elevated PEG-Prom expression in Ell and Ell-NMT cells.
  • FIG. 5A Schematic representation of deletion mutants of the PEG-Prom. Mutants were constructed as described in Materials and Methods.
  • FIG. 5B Fold activation of the FL-PEG-Prom (lane 1) and the various PEG- Prom deletion mutants (lanes 2 to 11) in Ell and Ell-NMT cells. Fold activation compares the FL-PEG-Prom and various deletion mutants of PEG-Prom versus the specific PEG-Prom deletion construct (deleted at position -40) which contains the TATA box and API element. This deletion construct is given the arbitrary value of one.
  • FIG. 6A-6B Mutation analysis of the PEA3 and API sites and the TATA box in the PEG-Prom.
  • FIG. 6A Schematic representation of the specific mutations in the PEG-Prom analyzed for activity in Ell and Ell-NMT cells. Point mutations were made using a site-specific mutagenesis as described in Materials and Methods.
  • FIG. 6B Fold activation of the various PEG-Prom mutants in Ell and Ell-NMT cells.
  • Fold activation compares the PEG-Prom mutant (deleted at position -118) and additional mutants containing point or deletion mutations effecting the PEA3 and API sites and/or the TATA box region versus the specific PEG-Prom deletion construct (deleted at position -40) which contains a wild- type TATA box and API element. This latter deletion construct is given the arbitrary value of one. Promoter- luciferase assays were performed as described in Materials and Methods .
  • FIG. 7A-7B Analysis of nuclear protein binding to API and PEA3 elements by EMSA.
  • FIG. 7A API and
  • FIG. 7B PEA3 nucleoprotein complexes in Ell and Ell-NMT cells were identified using EMSA.
  • Nuclear extracts were prepared from the two cell types and incubated with an API or PEA3 probe labeled with 32 P using ⁇ 32 P-ATP and T4 DNA kinase. The reaction mixture was electrophoreised in a 5% non-denatured polyacrylamide gel as described in Materials and Methods.
  • Arrow 1 indicates supershifted API (Fig. 7A) or PEA3 (Fig. 7B) DNA-protein-antibody complexes and arrow 2 indicates the API (Fig. 7A) or PEA3 (Fig.
  • Figure 8 Effect of ectopic expression of cJun (API) and PEA3 , alone and in combination, on FL-PEG-Prom activity in Ell cells.
  • PEG-3 progression elevated gene-3
  • RE cells rat embryonic cells
  • PEG-promoter PEG-Prom
  • kb kilobases
  • This invention provides for an isolated nucleic acid comprising a PEG-3 promoter comprising the nucleotide sequence beginning with the guanosine (G) at position -270 and ending with the cytosine (C) at position +194 of SEQ ID NO: 1.
  • the invention also provides for an isolated nucleic acid comprising a fragment of the nucleotide sequence of claim 1 which is at least 15 nucleotides in length.
  • the nucleic acid fragment comprises
  • a PEA3 protein binding sequence consisting of the nucleotide sequence beginning with the thymidine (T) at position -105 and ending with the thymidine (T) at position -100 of SEQ ID NO: 1,
  • TATA sequence consisting of the nucleotide sequence beginning with the thymidine (T) at position -29 and ending with the adenosine (A) at position -24 of SEQ ID NO : 1 , or
  • the nucleic acid comprises at least two of the nucleotide sequences (i) to (iii) listed above.
  • the nucleic acid comprises the three nucleotide sequences (i) to (iii) listed above.
  • the fragment has promoter activity.
  • the fragment is operably linked to a gene of interest.
  • the gene of interest is a reporter gene.
  • the reporter gene encodes beta- galactosidase, luciferase, chloramphenicol transferase or alkaline phosphatase .
  • the gene of interest is a tumor suppressor gene, a gene whose expression causes apoptosis of a cell, or a cytotoxic gene.
  • the invention provides for a vector comprising at least one of the nucleic acids described herein.
  • the invention also provides for a host cell comprising this vector.
  • the host cell is a tumor cell.
  • the tumor cell is a melanoma cell, a neuroblastoma cell, a cervical cancer cell, a breast cancer cell, a lung cancer cell, a prostate cancer cell, a colon cancer cell or a glioblastoma multiforme cell .
  • the invention also provides for a method for identifying an agent which modulates PEG-3 promoter activity in a cell which comprises : (a) contacting the cell with the agent wherein the cell comprises a nucleic acid comprising a PEG-3 promoter operatively linked to a reporter gene; (b) measuring the level of reporter gene expression in the cell; and (c) comparing the expression level measured in step (b) with the reporter gene expression level measured in an identical cell in the absence of the agent, wherein a lower expression level measured in the presence of the agent is indicative of an agent that inhibits PEG-3 promoter activity and wherein a higher expression level measured in the presence of the agent is indicative of an agent that enhances PEG-3 promoter activity, thereby identifying an agent which modulates PEG-3 promoter activity in the cell.
  • the cell is a melanoma cell, a neuroblastoma cell, a cervical cancer cell, a breast cancer cell, a lung cancer cell a prostate cancer cell, a colon cancer cell or a glioblastoma multiforme cell.
  • the agent comprises a molecule having a molecular weight of about 7 kilodaltons or less.
  • the agent is an antisense nucleic acid comprising a nucleotide sequence complementary to at least a portion of the sequence shown in SEQ ID NO: 1 and is at least 15 nucleotides in length.
  • the agent is a DNA molecule, a carbohydrate, a glycoprotein, a transcription factor protein or a double-stranded RNA molecule.
  • the agent is a synthetic nucleotide sequence, a peptidomimetic, or an organic molecule having a molecular weight from 0.1 kilodaltons to 10 kilodaltons.
  • the reporter gene encodes beta- galactosidase, luciferase, chloramphenicol transferase or alkaline phosphatase.
  • expression of PEG-3 promoter activity measured is equal to or greater than a 2.5 to 3.5 fold increase or decrease.
  • the invention provides for a method for treating cancer in a subject which comprises administering a nucleic acid comprising a PEG-3 promoter operatively linked to a gene-of- interest wherein the gene of interest is selectively expressed in cancerous cells in the subject and such expression regulates expression of PEG-3 resulting in growth suppression or death of the cancerous cells, thereby treating cancer in the subject.
  • the nucleic acid consists essentially of (i) a PEA3 protein binding sequence consisting of the nucleotide sequence beginning with the thymidine (T) at position -105 and ending with the thymidine (T) at position -100 of SEQ ID NO : 1, (ii) a TATA sequence consisting of the nucleotide sequence beginning with the thymidine (T) at position -29 and ending with the adenosine (A) at position -24 of SEQ ID NO: 1, and (iii) an API protein binding sequence consisting of the nucleotide sequence beginning with the thymidine (T) at position +6 and ending with the adenosine (A) at position +12 of the nucleotide sequence shown in SEQ ID NO: 1.
  • the nucleic acid has a sequence complementary to at least a portion of SEQ ID NO : 1 of at least 25 nucleotides in length.
  • the cancer is melanoma, neuroblastoma, astrocytoma, glioblastoma multiforme, cervical cancer, breast cancer, colon cancer, prostate cancer, osteoscarcoma or chrondosarcoma .
  • the administering is carried out via injection, oral administration, topical administration, adenovirus infection, liposome-mediated transfer, topical application to the cells of the subject, or microinj ection.
  • the subject is a mammal.
  • the mammal is a human.
  • the gene of interest is an gene whose expression causes apoptosis of a cell.
  • the gene comprises an Mda ⁇ 7 gene or a p53 gene.
  • the gene of interest is a tumor suppressor gene.
  • the suppressor gene is mda-7.
  • the gene of interest is a cytotoxic gene.
  • expression of the cytotoxic gene causes cell death.
  • the cytotoxic gene is selected from the group consisting of HSV-TK, p21, p27, and plO.
  • the invention provides for a host cell comprising the recombinant expression construct as described herein.
  • the host cell is stably transformed with the recombinant expression construct described herein.
  • the host cell is a tumor cell .
  • the host cell is a melanocyte.
  • the cell is an immortalized cell.
  • the tumor cell is a melanoma cell, a neuroblastoma cell, an astrocytoma cell, a glioblastomoa multifore cell, a cerival cancer cell, a breast cancer cell, a lung cancer cell or a prostate cancer cell.
  • the invention provides for a method for expressing foreign DNA in a host cell comprising: introducing into the host cell a gene transfer vector comprising a PEG-3 promoter nucleotide sequence operably linked to a foreign DNA encoding a desired polypeptide or RNA, wherein said foreign DNA is expressed.
  • the gene transfer vector encodes and expresses a reporter molecule.
  • the reporter molecule is selected from the group consisting of beta-galactosidase, luciferase and chloramphenicol acetyltransferase.
  • the "introducing" is carried out by a means selected from the group consisting of adenovirus infection, liposome-mediated transfer, topical application to the cell, and microinjection.
  • the cancer is melanoma, neuroblastoma, astrocytoma, glioblastoma multiforme, cervical cancer, breast cancer, colon cancer, prostate cancer, osteoscarcoma, or chrondosarcoma.
  • the cancer is a cancer of the central nervous system of the subject.
  • the administering is carried out via injection, oral administration, or topical administration.
  • the carrier is an aqueous carrier, a liposome, or a lipid carrier.
  • therapeutic gene means DNA encoding an amino acid sequence corresponding to a functional protein capable of exerting a therapeutic effect on cancer cells or having a regulatory effect on the expression of a gene which functions in cells.
  • nucleic acid molecule includes both DNA and RNA and, unless otherwise specified, includes both double- stranded and single-stranded nucleic acids. Also included are hybrids such as DNA-RNA hybrids. Reference to a nucleic acid sequence can also include modified bases as long as the modification does not significantly interfere either with binding of a ligand such as a protein by the nucleic acid or Watson-Crick base pairing.
  • enhancer element is a nucleotide sequence that increases the rate of transcription of the therapeutic genes or genes of interest but does not have promoter activity. An enhancer can be moved upstream, downstream, and to the other side of a promoter without significant loss of activity.
  • Two DNA or polypeptide sequences are "substantially homologous" when at least about 80% (preferably at least about 90%, and most preferably at least about 95%-99%) of the nucleotides or amino acids match over a defined length of the molecule.
  • substantially homologous also refers to sequences showing identity (100% identical sequence) to the specified DNA or polypeptide sequence.
  • DNA sequences that are substantially homologous can be identified in a Southern hybridization, experiment under, for example, stringent conditions, as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Sambrook et al . , supra; DNA Cloning, vols I & II, supra; Nucleic Acid Hybridization, supra .
  • a sequence "functionally equivalent" to a PEG-3 promoter sequence is one which functions in the same manner as the PEG-3 promoter sequence.
  • a promoter sequence “functionally equivalent” to the PEG-3 promoter described herein is one which is capable of directing transcription of a downstream coding sequence in substantially similar time- frames of expression and in substantially similar amounts and with substantially similar tissue specificity as the PEG-3 promoter sequence .
  • a DNA "coding sequence” or a "nucleotide sequence encoding" a particular protein is a DNA sequence which is transcribed and translated into a polypeptide in vivo or in vi tro when placed under the control of appropriate regulatory sequences.
  • the boundaries of the coding sequence are determined by a start codon at the 5'- (amino) terminus and a translation stop codon at the 3'-(carboxy) terminus.
  • a coding sequence can include, but is not limited to, procaryotic sequences, cDNA from eucaryotic mRNA, genomic DNA sequences from eucaryotic (e.g., mammalian) sources, viral RNA or DNA, and even synthetic nucleotide sequences.
  • a transcription termination sequence will usually be located 3' to the coding sequence.
  • control sequences refers collectively to promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, enhancers, and the like, untranslated regions, including 5 ' -UTRs (untranslated regions) and 3' -UTRs, which collectively provide for the transcription and translation of a coding sequence in a host cell .
  • operably linked refers to an arrangement of nucleotide sequence elements wherein the components so described are configured so as to perform their usual function.
  • control sequences operably linked to a coding sequence are capable of effecting the expression of the coding sequence.
  • the control sequences need not be contiguous with the coding sequence, so long as they function to direct the expression thereof.
  • intervening untranslated yet transcribed sequences can be present between a promoter sequence and the coding sequence and the promoter sequence can still be considered “operably linked" to the coding sequence .
  • a control sequence "directs the transcription" of a coding sequence in a cell when RNA polymerase will bind the promoter sequence and transcribe the coding sequence into mRNA, which is then translated into the polypeptide encoded by the coding sequence .
  • a cell has been "transformed” by exogenous DNA when such exogenous DNA has been introduced inside the cell membrane.
  • Exogenous DNA may or may not be integrated (covalently linked) into chromosomal DNA making up the genome of the cell. In procaryotes and yeasts, for example, the exogenous DNA may be maintained on an episomal element, such as a plasmid.
  • a stably transformed cell is generally one in which the exogenous DNA has become integrated into the chromosome so that it is inherited by daughter cells through chromosome replication, or one which includes stably maintained extrachromosomal plasmids. This stability is demonstrated by the ability of the eucaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the exogenous DNA.
  • a "heterologous" region of a DNA construct is an identifiable segment of DNA within or attached to another DNA molecule that is not found in association with the other molecule in nature.
  • a sequence encoding a protein other than a PEG-3 protein is considered a heterologous sequence when linked to a PEG-3 promoter.
  • Another example of a heterologous coding sequence is a construct where the coding sequence itself is not found in nature (e.g., synthetic sequences having codons different from the native gene) .
  • a chimeric sequence, comprising a heterologous gene linked to a PEG-3 promoter will be considered heterologous since such chimeric constructs are not normally found in nature. Allelic variation or naturally occurring mutational events do not give rise to a heterologous region of DNA, as used herein.
  • Vectors Especially preferred are virus based vectors.
  • retrovirus or adenovirus based vectors are preferred.
  • Such vectors contain all or a part of a viral genome, such as long term repeats ("LTRs"), promoters (e.g., CMV promoters, SV40 promoter, RSV promoter), enhancers, and so forth.
  • LTRs long term repeats
  • promoters e.g., CMV promoters, SV40 promoter, RSV promoter
  • enhancers e.g., enhancers, and so forth.
  • the host cell is a prokaryote
  • bacterial viruses, or phages are preferred.
  • Exemplary of such vectors are vectors based upon, e.g., lambda phage.
  • the vector may comprise elements of more than one virus .
  • the resulting vectors are transfected or transformed into a host cell, which may be eukaryotic or prokaryotic.
  • the gene transfer vector of the present invention may additionally comprise a gene encoding a marker or reporter molecule to more easily trace expression of the vector.
  • reporter molecule which can be employed in the present invention is not critical thereto.
  • reporter molecules which can be employed in the present invention are well-known in the art and include beta- galactosidase (Fowler et al , Proc. Natl. Acad. Sci., USA,
  • the gene transfer vector may contain more than one gene encoding the same or different foreign polypeptides or RNAs.
  • the gene transfer vector may be any construct which is able to replicate within a host cell and includes plasmids, DNA viruses, retroviruses, as well as isolated nucleotide molecules. Liposome-mediated transfer of the gene transfer vector may also be carried out in the present invention.
  • An example of such DNA viruses which can be employed in the present invention are adenoviruses .
  • Adenoviruses have attracted increasing attention as expression vectors, especially for human gene therapy
  • adenovirus serotypes which can be employed in the present invention are well-known in the art and include more than 40 different human adenoviruses, e.g., Adl2
  • Ad5 of subgroup C is the preferred adenovirus employed in the present invention. This is because Ad5 is a human adenovirus about which a great deal of biochemical and genetic information is known, and it has historically been used for most constructions employing adenovirus as a vector. Also, adenoviral vectors are commercially available, e.g., pCA3 (Microbix Biosystems Inc.) .
  • Derivative nucleic acid molecules would retain the functional property of the PEG-3 promoter, namely, the molecule having such substitutions will still permit the tissue specific expression of the gene of interest. Modification is permitted so long as the derivative molecules retain its increased potency compared to PEG-3 promoter alone and its tissue specificity.
  • therapeutic genes include suicide genes. These are genes sequences the expression of which produces a protein or agent that inhibits melanoma tumor cell growth or induces melanoma tumor cell death.
  • Suicide genes include genes encoding enzymes, oncogenes, tumor suppressor genes, genes encoding toxins, genes encoding cytokines, or a gene encoding oncostatin. The purpose of the therapeutic gene is to inhibit the growth of or kill skin cancer cells or produce cytokines or other cytotoxic agents which directly or indirectly inhibit the growth of or kill the cancer cell.
  • Suitable enzymes include thymidine kinase (TK) , xanthine- guanine phosphoribosyltransferase (GPT) gene from E. coli or E. coli cytosine deaminase (CD), or hypoxanthine phosphoribosyl transferase (HPRT) .
  • TK thymidine kinase
  • GPT xanthine- guanine phosphoribosyltransferase
  • CD E. coli cytosine deaminase
  • HPRT hypoxanthine phosphoribosyl transferase
  • Suitable oncogenes and tumor suppressor genes include neu, EGF, ras (including H, K, and N ras) , p53, Retinoblastoma tumor suppressor gene (Rb) , Wilm's Tumor Gene Product,
  • Phosphotyrosine Phosphatase Phosphotyrosine Phosphatase
  • Suitable toxins include Pseudomonas exotoxin A and S; diphtheria toxin (DT) ; E. coli LT toxins, Shiga toxin, Shiga-like toxins (SLT- 1, -2) , ricin, abrin, supporin, and gelonin.
  • Suitable cytokines include interferons, GM-CSF interleukins, tumor necrosis factor (TNF) (Wong G, et al . , Human GM-CSF: Molecular cloning of the complementary DNA and purification of the natural and recombinant proteins. Science 1985; 228:810); WO9323034 (1993); Horisberger M. A., et al . , Cloning and sequence analyses of cDNAs for interferon-beta and virus-induced human Mx proteins reveal that they contain putative guanine nucleotide-binding sites: functional study of the corresponding gene promoter.
  • TNF tumor necrosis factor
  • IL-4 down- regulates IL-2-, IL-3-, and GM-CSF-induced cytokine gene expression in peripheral blood monocytes.
  • Growth factors include Transforming Growth Factor- . alpha . (TGF-alpha) and beta (TGF-beta) , cytokine colony stimulating factors (Shimane M. , et al . , Molecular cloning and characterization of G-CSF induced gene cDNA. Biochemical and Biophysical Research Communications, Feb. 28, 1994, 199(1) :26-32; Kay A. B., et al . , Messenger RNA expression of the cytokine gene cluster, interleukin 3 (IL-3), IL-4, IL-5, and granulocyte/macrophage colony-stimulating factor, in allergen-induced late-phase cutaneous reactions in atopic subjects. Journal of Experimental Medicine, Mar.
  • Preferred vectors for use in the methods of the present invention are viral including adenoviruses, retroviral, vectors, adeno-associated viral (AAV) vectors.
  • viral including adenoviruses, retroviral, vectors, adeno-associated viral (AAV) vectors.
  • AAV adeno-associated viral
  • the viral vector selected should meet the following criteria: 1) the vector must be able to infect the tumor cells and thus viral vectors having an appropriate host range must be selected; 2) the transferred gene should be capable of persisting and being expressed in a cell for an extended period of time; and 3) the vector should be safe to the host and cause minimal cell transformation.
  • Retroviral vectors and adenoviruses offer an efficient, useful, and presently the best-characterized means of introducing and expressing foreign genes efficiently in mammalian cells. These vectors have very broad host and cell type ranges, express genes stably and efficiently. The safety of these vectors has been proved by many research groups. In fact many are in clinical trials .
  • Adenoviruses have several properties that make them attractive as cloning vehicles (Bachettis et al . : Transfer of gene for thymidine kinase-deficient human cells by purified herpes simplex viral DNA.
  • adenoviruses possess an intermediate sized genome that replicates in cellular nuclei; many serotypes are clinically innocuous; adenovirus genomes appear to be stable despite insertion of foreign genes; foreign genes appear to be maintained without loss or rearrangement; and adenoviruses can be used as high level transient expression vectors with an expression period up to 4 weeks to several months.
  • Extensive biochemical and genetic studies suggest that it is possible to substitute up to 7-7.5 kb of heterologous sequences for native adenovirus sequences generating viable, conditional, helper-independent vectors (Kaufman R. J. ; identification of the component necessary for adenovirus translational control and their utilization in cDNA expression vectors. PNAS USA, 1985 82:689).
  • AAV is a small human parvovirus with a single stranded DNA genome of approximately 5 kb. This virus can be propagated as an integrated provirus in several human cell types.
  • AAV vectors have several advantage for human gene therapy. For example, they are trophic for human cells but can also infect other mammalian cells; (2) no disease has been associated with AAV in humans or other animals; (3) integrated AAV genomes appear stable in their host cells; (4) there is no evidence that integration of AAV alters expression of host genes or promoters or promotes their rearrangement; (5) introduced genes can be rescued from the host cell by infection with a helper virus such as adenovirus.
  • helper virus such as adenovirus
  • HSV-1 vector system facilitates introduction of virtually any gene into non-mitotic cells (Geller et al . an efficient deletion mutant packaging system for a defective herpes simplex virus vectors: Potential applications to human gene therapy and neuronal physiology. PNAS USA, 1990 87:8950).
  • Bovine papilloma virus-based vector (Sarver N, et al . , Bovine papilloma virus DNA: A novel eukaryotic cloning vector.
  • Vaccinia and other poxvirus-based vectors provide a mammalian gene transfer system.
  • Vaccinia virus is a large double- stranded DNA virus of 120 kilodaltons (kd) genomic size (Panicali D, et al . , Construction of poxvirus as cloning vectors: Insertion of the thymidine kinase gene from herpes simplex virus into the DNA of infectious vaccine virus. Proc Natl Acad Sci USA 1982; 79:4927; Smith et al . infectious vaccinia virus recombinants that express hepatitis B virus surface antigens. Nature, 1983 302:490.)
  • Retroviruses are packages designed to insert viral genes into host cells (Guild B, et al . , Development of retrovirus vectors useful for expressing genes in cultured murine embryonic cells and hematopoietic cells in vivo. J Virol 1988; 62:795; Hock R. A., et al . , Retrovirus mediated transfer and expression of drug resistance genes in human hemopoietic progenitor cells. Nature 1986; 320:275).
  • the basic retrovirus consists of two identical strands of RNA packaged in a proviral protein. The core surrounded by a protective coat called the envelope, which is derived from the membrane of the previous host but modified with glycoproteins contributed by the virus .
  • Markers and amplifiers can also be employed in the subject expression systems.
  • markers are known which are useful in selecting for transformed cell lines and generally comprise a gene whose expression confers a selectable phenotype on transformed cells when the cells are grown in an appropriate selective medium.
  • markers for mammalian cell lines include, for example, the bacterial xanthine-guanine phosporibosyl transferase gene, which can be selected for in medium containing mycophenolic acid and xanthine (Mulligan et al. (1981) Proc. Natl. Acad. Sci.
  • aminoglycoside phosphotransferase gene (specifying a protein that inactivates the antibacterial action of neomycin/kanamycin derivatives) , which can be selected for using medium containing neomycin derivatives such as G418 which are normally toxic to mammalian cells (Colbere-Garapin et al . (1981) J. Mol. Biol. 150:1-14).
  • Useful markers for other eucaryotic expression systems, are well known to those of skill in the art.
  • Infection can be carried out in vitro or in vivo .
  • vi tro infection of cells is performed by adding the gene transfer vectors to the cell culture medium.
  • the solution containing the gene transfer vectors may be administered by a variety of modes, depending on the tissue which is to be infected. Examples of such modes of administration include injection of gene transfer vectors into the skin, topical application onto the skin, direct application to a surface of epithelium, or instillation into an organ (e.g., time release patch or capsule below the skin or into a tumor) .
  • Expression can be amplified by placing an amplifiable gene, such as the mouse dihydrofolate reductase (dhfr) gene adjacent to the coding sequence. Cells can then be selected for methotrexate resistance in dhfr-deficient cells. See, e.g. Urlaub et al . (1980) Proc. Natl. Acad. Sci. USA 77:4216- 4220; Rungold et al . (1981) J. Mol. and Appl . Genet. 1:165- 175.
  • dhfr mouse dihydrofolate reductase
  • the above-described system can be used to direct the expression of a wide variety of procaryotic, eucaryotic and viral proteins, including, for example, viral glycoproteins suitable for use as vaccine antigens, immunomodulators for regulation of the immune response, hormones, cytokines and growth factors, as well as proteins useful in the production of other biopharmaceuticals .
  • Mutants or analogs may be prepared by the deletion of a portion of the sequence encoding the protein, by insertion of a sequence, and/or by substitution of one or more nucleotides within the sequence.
  • Techniques for modifying nucleotide sequences, such as site-directed mutagenesis, are well known to those skilled in the art. See, e.g., Sambrook et al . , supra; DNA Cloning, Vols. I and II, supra; Nucleic Acid Hybridization, supra.
  • the coding sequence For purposes of the present invention, it is particularly desirable to further engineer the coding sequence to effect secretion of the polypeptide from the host organism. This enhances clone stability and prevents the toxic build up of proteins in the host cell so that expression can proceed more efficiently.
  • Homologous signal sequences can be used for this purpose with proteins normally found in association with a signal sequence.
  • heterologous leader sequences which provide for secretion of the protein can be added to the constructs.
  • processing sites will be included such that the leader fragment can be cleaved from the protein expressed therewith. (See, e.g., U.S. Pat. No. 4,336,246 for a discussion of how such cleavage sites can be introduced) .
  • the leader sequence fragment typically encodes a signal peptide comprised of hydrophobic amino acids.
  • a heterologous gene sequence i.e., a therapeutic gene
  • a heterologous gene sequence is inserted into the nucleic acid molecule of the invention.
  • Other embodiments of the isolated nucleic acid molecule of the invention include the addition of a single enhancer element or multiple enhancer elements which amplify the expression of the heterologous therapeutic gene without compromising tissue specificity.
  • the transformation procedure used depends upon the host to be transformed. Mammalian cells can conveniently be transformed using, for example, DEAE-dextran based procedures, calcium phosphate precipitation (Graham, F. L. and Van der Eb, A. J.
  • Bacterial cells will generally be transformed using calcium chloride, either alone or in combination with other divalent cations and DMSO
  • DNA can also be introduced into bacterial cells by electroporation.
  • Methods of introducing exogenous DNA into yeast hosts typically include either the transformation of spheroplasts or transformation of intact yeast cells treated with alkali cations .
  • the constructs can also be used in gene therapy or nucleic acid immunization, to direct the production of the desired gene product in vivo, by administering the expression constructs directly to a subject for the in vivo translation thereof. See, e.g. EPA Publication No. 336,523 (Dreano et al . , published Oct. 11, 1989) .
  • gene transfer can be accomplished by transfecting the subject's cells or tissues with the expression constructs ex vivo and reintroducing the transformed material into the host .
  • the constructs can be directly introduced into the host organism, i.e., by injection (see International Publication No. WO/90/11092; and Wolff et al . , (1990) Science 247:1465-1468).
  • Liposome-mediated gene transfer can also be accomplished using known methods. See, e.g., Hazinski et al . , (1991) Am. J. Respir. Cell Mol. Biol. 4:206-209; Brigham et al . (1989) Am. J. Med. Sci. 298:278-281; Canonico et al . (1991) Clin. Res. 39:219A; and Nabel et al . (1990) Science 249:1285-1288.
  • Targeting agents such as antibodies directed against surface antigens expressed on specific cell types, can be covalently conjugated to the liposomal surface so that the nucleic acid can be delivered to specific tissues and cells for local administration .
  • Retroviral-mediated gene transfer requires target cells which are undergoing cell division in order to achieve stable integration hence, cells are collected from a subject often by removing blood or bone marrow. It may be necessary to select for a particular subpopulation of the originally harvested cells for use in the infection protocol. Then, a retroviral vector containing the gene(s) of interest would be mixed into the culture medium. The vector binds to the surface of the subject's cells, enters the cells and inserts the gene of interest randomly into a chromosome . The gene of interest is now stably integrated and will remain in place and be passed to all of the daughter cells as the cells grow in number. The cells may be expanded in culture for a total of 9-10 days before reinfusion (Culver et al . , 1991) . As the length of time the target cells are left in culture increases, the possibility of contamination also increases, therefore a shorter protocol would be more beneficial .
  • This invention provides for the construction of retrovirus vectors containing the PEG-3 promoter or a functional equivalent thereof linked to a gene of interest for use in gene therapy or for diagnostic uses. The efficiency of transduction of these vectors can be tested in cell culture systems .
  • This invention involves targeting a gene-of-interest to the a cancer cell so that the protein encoded by the gene is expressed and directly or indirectly ameliorate the diseased state. Since the PEG-3 promoter is specifically active in a cancer cell which is undergoing cancer progression, it will act as a tissue specific promoter (specific for cancer cells) .
  • the transgene driven by a specific promoter in the vector expresses the protein encoded by the gene.
  • the use of the highly specific gene vector will allow selective expression of the specific genes in cancer cells.
  • the basic tasks in the present method of the invention are isolating the gene of interest, selecting the proper vector vehicle to deliver the gene of interest to the body, administering the vector having the gene of interest into the body, and achieving appropriate expression of the gene of interest.
  • the present invention provides packaging the cloned genes, i.e. the genes of interest, in such a way that they can be injected directly into the bloodstream or relevant organs of patients who need them.
  • the packaging will protect the foreign DNA from elimination by the immune system and direct it to appropriate tissues or cells.
  • the gene of interest is a tumor suppressor gene.
  • the tumor suppressor gene may be p21, RB (retinoblastoma) or p53.
  • RB retinoblastoma
  • p53 a tumor suppressor gene.
  • Recent U.S. Patent Nos. 6,025,127 and 5,912,236 are hereby incorporated by reference to more explicitly describe the state of the art as to tumor suppressor genes.
  • a selectable marker can be inserted that will allow easy identification of cells that have incorporated the modified retrovirus.
  • the critical focus on the process of gene therapy is that the new gene must be expressed in target cells at an appropriate level with a satisfactory duration of expression.
  • Site-specific DNA cleavage is performed by treating with the suitable restriction enzyme (or enzymes) under conditions which are generally understood in the art, and the particulars of which are specified by the manufacturer of these commercially available restriction enzymes (See, e.g. New England Biolabs Product Catalog) .
  • suitable restriction enzyme or enzymes
  • about 1 ⁇ g of plasmid or DNA sequences is cleaved by one unit of enzyme in about 20 ⁇ l of buffer solution.
  • an excess of restriction enzyme is used to insure complete digestion of the DNA substrate.
  • Restriction cleaved fragments may be blunt ended by treating with the large fragment of E. coli DNA polymerase I (Klenow) in the presence of the four deoxynucleotide triphosphates (dNTPs) using incubation times of about 15 to 25 min at 20. degree. C. to 25. degree. C. in 50 mM Tris (pH 7.6) 50 mM NaCl, 6 mM MgCl . sub .2 , 6 mM DTT and 5-10 .mu.M dNTPs.
  • the Klenow fragment fills in at 5' sticky ends but chews back protruding 3' single strands, even though the four dNTPs are present.
  • selective repair can be performed by supplying only one of the dNTPs, or with selected dNTPs, within the limitations dictated by the nature of the sticky ends.
  • the mixture is extracted with phenol/chloroform and ethanol precipitated.
  • Treatment under appropriate conditions with Si nuclease or Bal-31 results in hydrolysis of any single-stranded portion.
  • Ligations are performed in 10-50 ⁇ l volumes under the following standard conditions and temperatures using T4 DNA ligase. Ligation protocols are standard (D. Goeddel (ed.) Gene Expression Technology: Methods in Enzymology (1991) ) . In vector construction employing "vector fragments", the vector fragment is commonly treated with bacterial alkaline phosphatase (BAP) or calf intestinal alkaline phosphatase
  • BAP bacterial alkaline phosphatase
  • CIP CIP in order to remove the 5 ' phosphate and prevent religation of the vector.
  • religation can be prevented in vectors which have been double digested by additional restriction enzyme digestion of the unwanted fragments .
  • Suitable vectors include viral vector systems e.g. ADV, RV, and AAV (R. J. Kaufman "Vectors used for expression in mammalian cells” in Gene Expression Technology, edited by D. V. Goeddel (1991) .
  • Many methods for inserting functional DNA transgenes into cells are known in the art.
  • non-vector methods include nonviral physical transfection of DNA into cells; for example, microinj ection (DePamphilis et al . , BioTechnique 6:662-680 (1988)); liposomal mediated transfection (Feigner et al., Proc. Natl. Acad. Sci.
  • DNA into a target cell is to put it inside a membrane bound sac or vesicle such as a spheroplast or liposome, or by calcium phosphate precipitation (CaPO.sub.4) (Graham F. and Van der Eb, A., Virology 52:456 1973; Schaefer-Ridder M. , et al . , Liposomes as gene carriers: Efficient transduction of mouse L cells by thymidine kinase gene. Science 1982; 215:166; Stavridis J. C, et al . , Construction of transferrin-coated liposomes for in vivo transport of exogenous DNA to bone marrow erythroblasts in rabbits. Exp Cell Res 1986; 164:568-572).
  • CaPO.sub.4 calcium phosphate precipitation
  • a vesicle can be constructed in such a way that its membrane will fuse with the outer membrane of a target cell.
  • the vector of the invention in vesicles can home into the cancer cells .
  • the spheroplasts are maintained in high ionic strength buffer until they can be fused through the mammalian target cell using fusogens such as polyethylene glycol .
  • Liposomes are artificial phospholipid vesicles. Vesicles range in size from 0.2 to 4.0 micrometers and can entrap 10% to 40% of an aqueous buffer containing macromolecules . The liposomes protect the DNA from nucleases and facilitate its introduction into target cells. Transfection can also occur through electroporation.
  • the modified vectors are suspended in complete PBS at a selected density for injection.
  • any osmotically balanced solution which is physiologically compatible with the subject may be used to suspend and inject the modified vectors into the host.
  • the cell suspension is drawn up into the syringe and administered to anesthetized recipients. Multiple injections may be made using this procedure.
  • the viral suspension procedure thus permits administration of genetically modified vectors to any predetermined site in the skin, is relatively non-traumatic, allows multiple administrations simultaneously in several different sites or the same site using the same viral suspension. Multiple injections may consist of a mixture of therapeutic genes.
  • Transcription initiation is an early and critical event in gene expression. This depends on the promoter and enhancer sequences and is influenced by specific cellular factors that interact with these sequences.
  • the transcriptional unit of many prokaryotic genes consists of the promoter and in some cases enhancer or regulator elements (Banerji et al . , Cell 27:299 (1981); Corden et al . , Science 209:1406 (1980); and Breathnach and Chambon, Ann. Rev. Biochem. 50:349 (1981)).
  • LTR long terminal repeat
  • Moloney murine leukemia virus (MLV) and Rous sarcoma virus (RSV) LTRs contain promoter and enhancer sequences (Jolly et al . , Nucleic Acids Res. 11:1855 (1983); Capecchi et al . , In: Enhancer and eukaryotic gene expression, Gulzman and Shenk, eds., pp. 101-102, Cold Spring Harbor Laboratories, Cold Spring Harbor, N.Y.) .
  • Promoter and enhancer regions of a number of non-viral promoters have also been described (Schmidt et al . , Nature 314:285 (1985); Rossi and de Crombrugghe, Proc. Natl. Acad. Sci. USA 84:5590-5594 (1987)).
  • an enhancer sequence may be used to increase the level of therapeutic gene expression. Enhancers can increase the transcriptional activity not only of their native gene but also of some foreign genes (Armelor,
  • Therapeutic gene expression may also be increased for long term stable expression after injection using cytokines to modulate promoter activity.
  • modified vectors carrying a therapeutic gene are injected intracerebrally into a subject.
  • the most effective mode of administration and dosage regimen for the molecules of the present invention depends upon the exact location of the cancer being treated, the severity and course of the cancer, the subject's health and response to treatment and the judgment of the treating physician. Accordingly, the dosages of the molecules should be titrated to the individual subject.
  • the molecules may be delivered directly or indirectly via another cell, autologous cells are preferred, but heterologous cells are encompassed within the scope of the invention.
  • Adjustments in the dosage regimen may be made to optimize the tumor cell growth inhibiting and killing response, e.g., doses may be divided and administered on a daily basis or the dose reduced proportionally depending upon the situation (e.g., several divided dose may be administered daily or proportionally reduced depending on the specific therapeutic situation) .
  • One embodiment of the invention provides for methods for expressing a gene of interest which gene is not endogenously expressed in cancer cells which comprises a) constructing a nucleic acid which comprises the PEG-3 promoter operatively linked to the gene-of-interest ; b) introducing this nucleic acid into a cancer cell which cell expresses PEG-3, thereby causing the PEG-3 promoter to direct expression of the gene- of-interest in the cancer cell.
  • the gene- of-interest encodes a protein which is cytotoxic to the cancer cell, causes apoptosis of the cancer cell, slows the growth of the cancer cell, or causes the cancer cell to stop dividing.
  • the gene-of-interest can be any gene whose expression would cause a desired biochemical or physiological effect in the cancer cell, such as the decrease of growth or the decrease or inhibition of cancer phenotype progression.
  • nucleic acid constructs described above are used in such a method to treat cancer in a subject, so the nucleic acid can be administered to both cancerous and normal cells.
  • the PEG-3 promoter is only active in cancerous cells, there will be no expression of the gene-of-interest in normal cells, while there will be high expression of the gene-of-interest in the cancerous cells.
  • This nucleic acid construct thus allows one to target specifically expression of a gene-of-interest to specifically cancerous cells.
  • Liposomes could be used as a delivery agent to introduce the nucleic acid construct to the cells of the subject to be treated.
  • a delivery agent to introduce the nucleic acid construct to the cells of the subject to be treated.
  • ways to deliver such a nucleic acid construct which would be known to one of skill in the art (e.g. microinjection; topical application; use of a chemical vehicle; direct injection into the tumor; etc.) .
  • This invention is illustrated in the Experimental Details section which follows. These sections are set forth to aid in an understanding of the invention but are not intended to, and should not be construed to, limit in any way the invention as set forth in the claims which follow thereafter.
  • Example 1 Defining the regions within the promoter of progression elevated gene-3 responsible for differential expression during transformation progression
  • Cancer is a progressive disease in which a tumor cell temporally develops qualitatively new transformation related phenotypes or a further elaboration of existing transformation associated properties.
  • a rodent cell culture model system is being used to define the genes that associate with and control cancer progression.
  • Subtraction hybridization identified a novel gene that is functionally involved in the induction of transformation progression in mutant adenovirus type 5, H5tsl25, transformed rat embryo cells, referred to as progression elevated gene-3 (PEG-3) .
  • PEG-3 progression elevated gene-3
  • a 5 '-flanking promoter region of -2.1 kilobases, PEG- promoter has been isolated, cloned and characterized.
  • Example 2 Cooperation between AP-1 and PEA-3 sites within the progression elevated gene-3 (PEG-3) promoter regulate basal and differential expression of PEG-3 during progression of the oncogenic phenotype in transformed rat embryo cells
  • the carcinogenic process involves a series of sequential changes in the phenotype of a cell, resulting in new properties or a further elaboration of transformation- associated traits by the evolving tumor cell (Fisher, 1984; Bishop, 1991; Knudson, 1993; Vogelstein and Kinzler, 1993). Although extensively studied, the precise genetic mechanisms underlying tumor cell progression during the development of most human cancers remain unknown. Experimental evidence indicates that a number of diverse acting genetic elements can contribute to cancer development and transformation progression (Fisher, 1984; Bishop, 1991; Liotta et al . , 1991; Knudson, 1993; Levine, 1993; Hartwell and Kastan, 1994; Kang et al .
  • Important target genes involved in these processes include, oncogenes, tumor supressor genes and genes regulating genomic stability, cancer agressiveness and angiogenesis (Fisher, 1984; Bishop, 1991; Liotta et al . , 1991; Knudson, 1993; Levine, 1993; Hartwell and Kastan, 1994;
  • a useful model for defining the genetic and biochemical changes mediating tumor progression is the Ad5/early passage RE cell culture system (Fisher, 1984; Babiss et al . , 1985; Duigou et al . , 1989, 1990, 1991; Fisher et al, 1979a, b,c; Reddy et al . , 1993; Su et al . , 1994, 1997; Kang et al . , 1998a) . Transformation of secondary rat embryo (RE) cells by Ad5 is often a sequential process resulting in the acquisition of an further elaboration of specific phenotypes by the untransfor ed cell (Fisher et al .
  • Ad5-transformation model Progression in the Ad5-transformation model is characterized by the development of enhanced anchorage- independence and tumorigenic capacity (as formation in nude mice) (Fisher, 1984; Babiss et al . , 1985) .
  • the progression phenotype in Ad5-transformed RE cells can be induced by selection for growth in agar or tumor formation in nude mice (Fisher et al . , 1979 a,b,c; Babiss et al .
  • Progression induced spontaneously or after gene transfer is a stable cellular trait that remains undiminished in Ad5- transformed RE cells even after extensive passage (>100) in monolayer culture (Fisher, 1984; Babiss et al . , 1985; Reddy et al . , 1993) .
  • a single-treatment with the demethylating agent 5-azacytidine (AZA) results in a stable reversion in transformation progression in >95% of cellular clones (Fisher, 1984; Babiss et al . , 1985; Duigou et al . , 1989; Reddy et al . , 1993; Su et al . , 1994).
  • progression phenotype is also suppressed in somatic cell hybrids formed between normal or un-progressed transformed cells and progressed cells (Duigou et al . , 1990, 1991; Reddy et al . , 1993) .
  • progression may result from the activation of specific progression-promoting (progression elevated) genes or the selective inhibition of progression-suppression (progression suppressed) genes, or possibly a combination of both processes (Fisher, 1984; Babiss et al . , 1985; Su et al . , 1997; Kang et al . , 1998a).
  • CREF cells are immortal rat embryo cells that do not form colonies when grown in agar and are devoid of tumorigenic potential when inoculated subcutaneously into athymic nude mice (Fisher et al . , 1982; Duigou et al . , 1990).
  • somatic cell hybrids formed between Ell-NMT and CREF cells that display a fat morphology such as FI and F2 also fail to form tumors in nude mice (Duigou et al . , 1990) , although they grow with a low efficiency in agar similar to Ell cells ( Figure 1A) .
  • specific Ell-NMT x CREF somatic cell hybrids that display round morphology such as Rl and R2 grown with high efficiency in agar, even exceeding that of Ell-NMT ( Figure 1A) and they rapidly form tumors in nude mice (Duigou et al . ,
  • a genomic walking approach from the 5' region of the PEG-3 CDNA was used to identify a 2.0-kb rat genomic fragment that represents the 5' flanking region of the PEG-3 gene.
  • the sequence of the putative FL-PEG-Prom is shown in Fig. 2.
  • the transcription start site of the PEG-3 gene was mapped by primer extension with RNAs isolated from Ell and Ell-NMT cells (Fig. 3) .
  • Computer analysis with GCG software of the PEG-Prom indicates the presence of two TATA boxes located at positions -1071 and -24 upstream of the RNA cap site, respectively.
  • the sequence at -1071 is probably non-functional because of its large distance from the RNA cap-site.
  • PEA3 -binding sites AGGAAA and TTTCCT, are located at positions -1644 and -101.
  • the PEA3 site at position -101 is 76 nt upstream of the TATA box.
  • An API site is present at position +8. Additional potential DNA binding elements are also apparent in the PEG- Prom, including Spl, acute phase reaction element, NFKB1, E2F, E2A, GRE, TRE and CREB .
  • API and PEA3 si tes adjacent to the TATA box in the PEG-3 promoter are involved in basal and enhanced promoter activi ty in progressed and un-progressed H5tsl25 trans formed RE cells
  • a further deletion at position -270 minimally inhibited promoter activity in Ell-NMT cells (-19% reduction versus activity of the FL-PEG-Prom) without significantly altering activity of the PEG-Prom in Ell cells.
  • removal of the PEA3 site at -104 nt with retention of the TATA box at position - 24 and the API site at +8 bp resulted in a reduction in basal promoter activity in both Ell and Ell-NMT cells.
  • the activity of this mutant PEG-Prom was 15- and 4-fold lower, respectively, than the activity of the FL-PEG-Prom in Ell-NMT and Ell cells (Fig. 5) .
  • this promoter deletion eliminated the enhanced expression of the PEG-Prom in Ell-NMT versus Ell cells, indicating that the PEA3 site at -104 is a primary determinant of the enhanced activity of PEG-3 in progressed H5tsl25transformed RE cells.
  • Internal deletions at position -1167 to -536 and -1267 to -536 resulted in similar levels of luciferase activity in Ell-NMT and Ell cells as observed with the deletion mutant containing a deletion at position -270.
  • TATA sites resulted in equivalent promoter activity in Ell and Ell-NMT cells.
  • This observation emphasizes the importance of the API site at position +8 in the PEG promoter in regulating elevated PEG-3 transcriptional activity in Ell- NMT versus Ell cells.
  • An involvement of the PEA3 site at position -104 in defining PEG promoter activity was also demonstrated by analysis of a construct containing a mutated PEA3 site at -104 with wild-type TATA (at position -24) and API (at position +8) sites (Fig. 6) . In this mutant, the level of activity of the promoter was at a basal level and the activity was similar in Ell and Ell-NMT cells.
  • Promoter deletion analysis indicates that a region of the PEG-Prom containing -270/+194 of the PEG-3 gene is essential for PEG-3 transcriptional activity in Ell and Ell-NMT cells (Fig. 5 and 6) . Moreover, this region of the PEG-Prom is also responsible for the differential promoter activity of the PEG-Prom in Ell-NMT versus Ell cells. Sequence analysis indicates that this part of the PEG-Prom contains API (+8) , TATA (-24) and PEA3 (-104) elements (Fig. 2) . A mutation of the API site at +8, while retaining a wild-type TATA and PEA3 sequence, reduces the activity of the PEG-Prom deletion construct (-270/+194) in Ell-NMT to that of Ell cells (Fig.
  • API (+8) site is mutated singly or in combination with a mutated PEA3 (+8) site. In these contexts, altering the API
  • (+8) and PEA3 (104) sites effects both basal and enhanced PEG-Prom activity.
  • a mutation in the TATA region (-24) results in an extinction of promoter activity.
  • API transcription factors are immediate early response genes that regulate expression of a subset of target gene promoters containing defined sequence motifs (TPA-response elements, TRE) (Angel and Karin, 1991) .
  • the API complex comprises a heterodimer of a member of the Fos family and a member of the Jun family or homodlmers of members of the Jun family (Angel and Karin, 1991, Karin et al . , 1997).
  • API contributes to many important and diverse biological processes including cell proliferation, transformation, onocogenesis, differentiation and apoptosis (Angel and Karin, 1991; Karin et al . , 1997; Olive et al . , 1997; Kang et al . , 1998b).
  • the transcription factor PEA3 a member of the ets gene family is also a major contributor to cell transformation and oncogenesis (Brown and McKnight, 1992) .
  • PEA3 proteins interact with an -10 base pair DNA sequence in the promoters of target genes resulting in regulation of transcription
  • Putative candidate P ⁇ A3 target genes include proteinases required for degradation of the extracellular matrix, including the serine urokinase-type plasminogen activator (Nerlov et al . , 1992 ) and matrix metalloprotemases gelatinase B, interstitial collagenase, stromelysin-3 and matrilysin (Matrisian and Bowden, 1990; Matrisian, 1994; Higashino et al . , 1995), which represent important factors contributing to cancer metastasis (Liotta et al .
  • PEA3 and API elements are also present in the promoters of the stromelysin and collagenase genes (Gutman and Wasylyk, 1990; Sirum- Conolly and Brinckerhoff , 1991) and these elements provide targets for transcriptional activation by specific transforming oncogenes (Wasylyk et al . , 1989, 1993).
  • the increased API and PEA3 activity in Ell- NMT cells versus Ell can result in elevated PEG-Prom activity and thereby increased PEG-3 protein which can directly contribute to cancer aggressiveness, resulting in enhanced tumor growth in vivo in nude mice, in the progressed tumor cells.
  • the increased activity of API and PEA3 in Ell-NMT cells will also likely activate additional down-stream genes that can facilitate the cancer phenotype.
  • PEG-3 vascular endothelial growth factor
  • VEGF vascular endothelial growth factor
  • Stable elevated expression of PEG-3 results in increased VEGF RNA transcription, steady- state mRNA and secreted protein in Ell cells.
  • a VEGF-luciferase reporter construct displays enhanced activity in cells expressing PEG-3.
  • a functional role for PEG-3 in regulating VEGF expression is demonstrated further by inhibiting PEG-3 expression in Ell-NMT cells using a stable antisense PEG-3 expression vector which results in a decrease in VEGF mRNA and secreted protein.
  • Ell is a single cell clone of H5tsl25-transformed Sprague- Dawley secondary RE cells (Fisher et al . , 1978).
  • Ell-NMT is a subclone of Ell cells derived from a nude mouse tumor induced by the Ell cell line (Babiss et al . , 1985) .
  • R12 is a Ha-ras oncogene transformed Ell clone (Duigou et al . , 1989) .
  • Fl and F2 are suppressed somatic cell hybrids with a flat morphology that were formed between Ell-NMT and CREF cells (Duigou et al . , 1990) .
  • Rl and R2 are progressed somatic cell hybrids with a round morphology that were created by fusing Ell-NMT and CREF cells (Duigou et al . , 1990) .
  • CREF is a specific immortal non-transformed and non- tumorigenic clone of Fischer rat embryo fibroblast cells
  • PEA3 PEA3
  • PEG-3 actin proteins.
  • Five million cells were seeded into 100-mm plates and incubated for 24 h at 37°C.
  • the medium (DMEM-5) was removed, the cells were washed 3 X with cold PBS and then lysed in RIPC buffer (0.5 M NaCl, 0.5% NP40, 20 mM Tris-HCI, pH 8, 1 mM PMSF) .
  • the protein levels were determined using an ECL kit (Amersham) and the respective antibodies (Santa Cruz) .
  • Cell lysates were also analyzed using rabbit anti-PEG-3 polyclonal antibodies against C-terminal peptides.
  • the internal deletions were performed by digesting the FL-PEG-Prom with Ndel/Sacll, Ndel/BstEll, Stul/BstEll and BstXl, respectively. Mutations in the API-binding site, PEA3 -binding site, and TATA box were made using a site- specific mutagenesis method with the Altered Sites 11 In Vitro Mutagenesis System (Promega) . The PEG-Prom deletion mutants were cloned into the pGL3 -basic Luciferase Reporter Vector (Promega, ) .
  • the transfection mixture was removed after 14 hr and the cells were washed 3X with serum-free media and incubated at 37°C for an additional 48 hr in complete growth media.
  • Cells were harvested and lysed to make extracts (Gopalkrishnan et al . , 1999) utilized in ⁇ -gal and Luciferase reporter assays.
  • Luminometric determinations of Luciferase and Pgal activity was performed using commercial kits (Promega and Tropix, respectively) .
  • 10 ⁇ l of cell lysate were mixed with 40 ⁇ l of Luciferase Assay substrate (Promega) .
  • GGCAAAGGGATGCGGAGTCGCGCGGGTCTCGCATG 3 ' ( SEQ ID NO : 4 ) complementary to the 5 ' UTR sequence of the PEG- 3 cDNA was annealed to 4 ⁇ g of PolyA + RNAs from E- l l or Ell -NMT cells , which were used as template for primer extension with reverse transcriptase .
  • 20 pmol of dephosphorylated oligo- DNA was end-labeled with ⁇ - 32 P ATP (Amersham) and T4 polynucleotide kinase.
  • the labeled oligonucleotides (5 X 10 s cpm) were incubated with 4 ⁇ g of polyA+ RNA and the precipitate was resuspended in DEPC-treated H 2 0.
  • the reverse transcription reaction contained 200 u / ⁇ l of Superscript Reverse Transcriptase II (Gibco) , 50 mM of Tris-HCI (pH 8.3), 40 mM KCI, 6 mM MgC'21 1 mM DTT, 1 mM dNTP, and 0.1 mg / ml BSA.
  • the mixture was incubated at 42 °C for 1 hr followed by the addition of 1 ml of 0.5 M EDTA (pH 8) to stop the reaction. After DNase-free RNase treatment, the reaction mixture was loaded onto a 5% urea polyacrylamide sequencing gel in parallel with a DNA sequencing reaction using the same primer and template.
  • Electrophoretic mobili ty shift assays (EMSA)
  • Nuclear extracts were prepared from 2 to 5 X 10 8 cells as described by Dignam et al . (1983) .
  • the sequence of probes were as follows: wild-type API, 5 ' CGCAGATTGACTCAGTTCGC3 ' (SEQ ID NO: 5) / 5'GC GTCTAACTGAGTCAAGCG3 ' (SEQ ID NO: 6); mutant API, 5 ' CGCAGATAAACTACGTTCGC3 ' (SEQ ID NO: 7) / 5' GCGTCTATTTGATGCAAGCG3 ' (SEQ ID NO: 8); wild-type PEA3 , 5' GTGTTGTTTTCCTCTCTCCA3 ' (SEQ ID NO : 9 ) / 5' CACAACAA AGGAGAGAGGT3 ' (SEQ ID NO: 10); and mutant PEA3 ' ,
  • the reaction mixture consisted of 32 P-labeled deoxyoligonucleotides (> 5000 cpm), 2 ⁇ g of poly(dl-dc) and 10 ⁇ g of nuclear protein extract with 10 mM HEPES (pH 7.5), 50 mM KCI, 5 mM MgCI2, 0.5 mM EDTA, 1 mM DTT and 12.5% glycerol. After incubation for 30 min at RT, the reaction mixtures were electrophoresed on a 5% polyacrylamide gel with 0.5 X TBE (160V for 3 h) . The gel was dried and autoradiographed .
  • Nuclear extracts were also incubated with a 10- or 100-fold molar excess of cold competitor oligonucleotide or cJun (API) , PEA3 or actin antibody (1 or 5 ⁇ g) together with the 32 P-labeled probe.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Urology & Nephrology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Physics & Mathematics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Hematology (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Analytical Chemistry (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

L'invention concerne un acide nucléique isolé comprenant un promoteur PEG-3 possédant la séquence de nucléotides commençant par guanosine (G) dans la position -270 et finissant par cytosine (C) dans la position +194 de SEQ ID NO:1. Elle concerne également un procédé servant à identifier un agent modulant l'activité du promoteur PEG-3 dans une cellule. Elle concerne également un procédé servant à traiter le cancer chez un patient.
EP01954874A 2000-07-21 2001-07-20 Acides nucleiques comprenant des regions du promoteur peg-3 du rat et leurs utilisations Withdrawn EP1309603A4 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US621781 1984-06-18
US09/621,781 US6737523B1 (en) 1998-03-20 2000-07-21 Nucleic acids comprising regions of the rat PEG-3 promoter that display elevated expression in human cancer cells and uses thereof
PCT/US2001/023099 WO2002008242A1 (fr) 2000-07-21 2001-07-20 Acides nucleiques comprenant des regions du promoteur peg-3 du rat et leurs utilisations

Publications (2)

Publication Number Publication Date
EP1309603A1 true EP1309603A1 (fr) 2003-05-14
EP1309603A4 EP1309603A4 (fr) 2004-07-28

Family

ID=24491606

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01954874A Withdrawn EP1309603A4 (fr) 2000-07-21 2001-07-20 Acides nucleiques comprenant des regions du promoteur peg-3 du rat et leurs utilisations

Country Status (5)

Country Link
EP (1) EP1309603A4 (fr)
JP (1) JP2004520006A (fr)
AU (1) AU2001277094A1 (fr)
CA (1) CA2416676A1 (fr)
WO (1) WO2002008242A1 (fr)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2003224087B2 (en) 2002-04-18 2009-03-05 Opko Pharmaceuticals, Llc. Means and methods for the specific inhibition of genes in cells and tissue of the CNS and/or eye
US7148342B2 (en) 2002-07-24 2006-12-12 The Trustees Of The University Of Pennyslvania Compositions and methods for sirna inhibition of angiogenesis
US8053232B2 (en) 2004-01-23 2011-11-08 Virxsys Corporation Correction of alpha-1-antitrypsin genetic defects using spliceosome mediated RNA trans splicing
US7449565B2 (en) 2005-01-21 2008-11-11 The Trustees Of Columbia University In The City Of New York Chimeric tumor suppressor gene and protein
JP5832293B2 (ja) 2008-12-04 2015-12-16 オプコ ファーマシューティカルズ、エルエルシー 血管新生促進ｖｅｇｆイソ型を選択的に抑制する組成物および方法
WO2012058522A2 (fr) * 2010-10-28 2012-05-03 Virginia Commonwealth University Imagerie du cancer au moyen d'une thérapie : la théranostique

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999049898A1 (fr) * 1998-03-31 1999-10-07 The Trustees Of Columbia University In The City Of New York Gene-3 a progression elevee et ses utilisations

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6146877A (en) * 1997-03-21 2000-11-14 The Trustees Of Columbia University In The City Of New York Identification of the progression elevated gene-3 and uses thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999049898A1 (fr) * 1998-03-31 1999-10-07 The Trustees Of Columbia University In The City Of New York Gene-3 a progression elevee et ses utilisations

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL [Online] 9 April 2001 (2001-04-09) retrieved from EBI Database accession no. AF351130 XP002281485 *
MILAS MIRA ET AL: "Adenovirus-mediated p53 gene therapy inhibits human sarcoma tumorigenicity" CANCER GENE THERAPY, vol. 7, no. 3, March 2000 (2000-03), pages 422-429, XP002281484 ISSN: 0929-1903 *
See also references of WO0208242A1 *
SU ZAO-ZHONG ET AL: "Cooperation between AP1 and PEA3 sites within the progression elevated gene-3 (PEG-3) promoter regulate basal and differential expression of PEG-3 during progression of the oncogenic phenotype in transformed rat embryo cells" ONCOGENE, vol. 19, no. 30, 13 July 2000 (2000-07-13), pages 3411-3421, XP002281483 ISSN: 0950-9232 *

Also Published As

Publication number Publication date
CA2416676A1 (fr) 2002-01-31
EP1309603A4 (fr) 2004-07-28
JP2004520006A (ja) 2004-07-08
AU2001277094A1 (en) 2002-02-05
WO2002008242A1 (fr) 2002-01-31

Similar Documents

Publication Publication Date Title
US6737523B1 (en) Nucleic acids comprising regions of the rat PEG-3 promoter that display elevated expression in human cancer cells and uses thereof
US7067317B2 (en) Regulation of angiogenesis with zinc finger proteins
Wang et al. Inhibition of DNA topoisomerase IIα gene expression by the p53 tumor suppressor
AU715526B2 (en) Novel nucleic acid molecules comprising the prostate specific antigen (PSA) promoter and uses thereof
Chiou et al. p300 binding by E1A cosegregates with p53 induction but is dispensable for apoptosis
Stein et al. Repression of insulin gene expression by adenovirus type 5 Ela proteins
US20030021776A1 (en) Regulation of angiogenesis with zinc finger proteins
WO1996014875A9 (fr) Nouvelles molecules d'acide nucleique comportant un antigene prostatique specifique et leurs usages
CA2295199C (fr) Traitement des maladies vasculaires proliferatives a l'aide de p27 et de ses proteines hybrides
Schaffhausen et al. Lessons from polyoma middle T antigen on signaling and transformation: A DNA tumor virus contribution to the war on cancer
US20070259372A1 (en) Melanoma differentiation associated gene - 5 and promoter and uses thereof
Lipinski et al. Optimization of a synthetic β-catenin-dependent promoter for tumor-specific cancer gene therapy
EP1309603A1 (fr) Acides nucleiques comprenant des regions du promoteur peg-3 du rat et leurs utilisations
Goldsmith et al. transE1 Component Requirements for Maximal Replication of E1-Defective Recombinant Adenovirus
Logan et al. Altered shape and cell cycle characteristics of fibroblasts expressing the E2F1 transcription factor.
US6841362B1 (en) Melanoma differentiation associated gene-7 promoter and uses thereof
US6110702A (en) PSA positive regulating (PSAR) sequences and uses thereof
US6982148B2 (en) Progressive elevated gene-3 (PEG-3) induces aggressive cancer phenotype and regulates angiogenesis
Alvarez-Salas et al. YY-1 and c-Jun transcription factors participate in the repression of the human involucrin promoter
WO1997035993A9 (fr) Sequences de regulation positive de l'antigene prostatique specifique et utilisations de ces sequences
US6730662B1 (en) Adenovirus E4 proteins for inducing cell death
Crist EGR-1 prevents RB-hypophosphorylation and growth arrest by induction ofc-myc via a homopurine/homopyrimidine-rich element
Eaton Characterization of the CCAAT/enhancer binding protein-beta activator isoforms in normal mammary epithelial cells and breast cancer cells
WO2001016167A2 (fr) INTERACTION DE LA β-CATENINE, TCF-4, ET DE L'APC DANS LA PREVENTION DU CANCER

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20030213

AK Designated contracting states

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

A4 Supplementary search report drawn up and despatched

Effective date: 20040614

17Q First examination report despatched

Effective date: 20070813

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20090201