EP1307476A1 - Nucleotide sequences which code for the mete gene - Google Patents

Nucleotide sequences which code for the mete gene

Info

Publication number
EP1307476A1
EP1307476A1 EP01967191A EP01967191A EP1307476A1 EP 1307476 A1 EP1307476 A1 EP 1307476A1 EP 01967191 A EP01967191 A EP 01967191A EP 01967191 A EP01967191 A EP 01967191A EP 1307476 A1 EP1307476 A1 EP 1307476A1
Authority
EP
European Patent Office
Prior art keywords
gene
codes
polynucleotide
methionine
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
EP01967191A
Other languages
German (de)
French (fr)
Inventor
Brigitte Bathe
Bettina Möckel
Walter Pfefferle
Klaus Huthmacher
Christian RÜCKERT
Jörn Kalinowski
Alfred Pühler
Michael Binder
Dieter Greissinger
Georg Thierbach
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Evonik Operations GmbH
Original Assignee
Degussa GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE10109689A external-priority patent/DE10109689A1/en
Application filed by Degussa GmbH filed Critical Degussa GmbH
Publication of EP1307476A1 publication Critical patent/EP1307476A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1003Transferases (2.) transferring one-carbon groups (2.1)
    • C12N9/1007Methyltransferases (general) (2.1.1.)
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23KFODDER
    • A23K20/00Accessory food factors for animal feeding-stuffs
    • A23K20/10Organic substances
    • A23K20/142Amino acids; Derivatives thereof
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/34Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • C12P13/12Methionine; Cysteine; Cystine

Definitions

  • amino acids such as e.g. L- methionine
  • the inventors had the object of providing new measures for improved fermentative preparation of amino acids, in particular L-methionine .
  • the invention provides an isolated polynucleotide from coryneform bacteria, comprising a polynucleotide sequence which codes for the metE gene, chosen from the group consisting of
  • polynucleotide which is identical to the extent of at least 70% to a polynucleotide which codes for a polypeptide which comprises the amino acid sequence of SEQ ID No. 2,
  • polynucleotide which codes for a polypeptide which comprises an amino acid sequence which is identical to the extent of at least 70% to the amino acid sequence of SEQ ID No. 2,
  • polynucleotide which is complementary to the polynucleotides of a) or b) , and d) polynucleotide comprising at least 15 successive nucleotides of the polynucleotide sequence of a) , b) or c),
  • polypeptide preferably having the activity of homocysteine methyltransferase I.
  • the invention also provides the above-mentioned polynucleotide, this preferably being a DNA which is capable of replication, comprising:
  • the invention also provides
  • polynucleotide which codes for a polypeptide which comprises the amino acid sequence as shown in SEQ ID No. 2;
  • a vector containing the polynucleotide according to the invention in particular a shuttle vector or plasmid vector, and
  • the invention also provides polynucleotides which substantially comprise a polynucleotide sequence, which are obtainable by screening by means of hybridization of a corresponding gene library, which comprises the complete gene with the polynucleotide sequence corresponding to SEQ ID No. 1, with a probe which comprises the sequence of the polynucleotide mentioned, according to SEQ ID No. 1 or a fragment thereof, and isolation of the DNA sequence mentioned.
  • Polynucleotides which comprise the sequences according to the invention are suitable as hybridization probes for RNA, cDNA and DNA, in order to isolate, in the full length, nucleic acids or polynucleotides or genes which code for homocysteine methyltransferase I or to isolate those nucleic acids or polynucleotides or genes which have a high similarity of sequence with that of the homocysteine methyltransferase I gene.
  • Polynucleotides which comprise the sequences according to the invention are furthermore suitable as primers with the aid of which DNA of genes which code for homocysteine methyltransferase I can be prepared by the polymerase chain reaction (PCR) .
  • PCR polymerase chain reaction
  • Such oligonucleotides which serve as probes or primers comprise at least 30, preferably at least 20, very particularly preferably at least 15 successive nucleotides. Oligonucleotides which have a length of at least 40 or 50 nucleotides are also suitable. Oligonucleotides with a length of at least 100, 150, 200, 250 or 300 nucleotides are optionally also suitable.
  • Polynucleotide in general relates to polyribonucleotides and polydeoxyribonucleotides, it being possible for these to be non-modified RNA or DNA or modified RNA or DNA.
  • Polypeptides are understood as meaning peptides or proteins which comprise two or more amino acids bonded via peptide bonds.
  • polypeptides according to the invention include a polypeptide according to SEQ ID No. 2, in particular those with the biological activity of homocysteine methyltransferase I, and also those which are at least 70%, preferably at least 80% and in particular which are at least 90% to 95% identical to the polypeptide according to SEQ ID No. 2 and have the activity mentioned.
  • the invention moreover provides a process for the fermentative preparation of amino acids, in particular L- methionine, using coryneform bacteria which in particular already produce amino acids, and in which the nucleotide sequences which code for the metE gene are enhanced, in particular over-expressed.
  • enhancement in this connection describes the increase in the intracellular activity of one or more enzymes (proteins) in a microorganism which are coded by the corresponding DNA, for example by increasing the number of copies of the gene or genes, using a potent promoter or using a gene or allele which codes for a corresponding enzyme (protein) having a high activity, and optionally combining these measures.
  • the activity or concentration of the corresponding protein is in general increased by at least 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400% or 500%, up to a maximum of 1000% or 2000%, based on the starting microorganism.
  • the microorganisms which the present invention provides can prepare L-amino acids, in particular L-methionine, from glucose, sucrose, lactose, fructose, maltose, molasses, starch, cellulose or from glycerol and ethanol. They can be representatives of coryneform bacteria, in particular of the genus Corynebacterium. Of the genus Corynebacterium, there may be mentioned in particular the species Corynebacterium glutamicum, which is known among experts for its ability to produce L-amino acids.
  • Suitable strains of the genus Corynebacterium in particular of the species Corynebacterium glutamicum (C. glutamicum) , are in particular the known wild-type strains
  • L-amino acid-producing mutants or strains prepared therefrom such as, for example, the L-methionine-producing strain
  • the new metE gene from C. glutamicum which codes for the enzyme homocysteine methyltransferase I (EC 2.1.1.14) has been isolated.
  • E. coli Escherichia coli
  • the setting up of gene libraries is described in generally known textbooks and handbooks. The textbook by innacker: Gene und Klone, Amsterdam Einbowung in die Gentechnologie (Verlag Chemie, Weinheim, Germany, 1990) , or the handbook by Sambrook et al.: Molecular Cloning, A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1989) may be mentioned as an example.
  • a well-known gene library is that of the E. coli K-12 strain W3110 set up in ⁇ vectors by Kohara et al. (Cell 50, 495 -508 (1987)).
  • strain DH5 ⁇ mcr which has been described by Grant et al. (Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649).
  • the long DNA fragments cloned with the aid of cosmids can in turn be subcloned in the usual vectors suitable for sequencing and then sequenced, as is described e.g. by Sanger et al. (Proceedings of the National Academy of Sciences of the United States of America, 74:5463-5467, 1977).
  • TJ rt ⁇ 3 O ⁇ - tr rt tr ⁇ ⁇ — D tr TJ ⁇ 3 CO .
  • TJ ⁇ l cx CD 3 ft) O ⁇ li ⁇ cu ⁇ - ⁇ ii — 0) o tc 3 ⁇ li ⁇ 3 ⁇ > ⁇ ⁇ 0 OJ ⁇ CO 3 ⁇ 3 rt rt cx CO o rt rt • •>.
  • amino acids in particular L-methionine
  • amino acids in particular L- methionine
  • amino acids in particular L-methionine
  • metE gene for one or more genes chosen from the group consisting of
  • the term "attenuation" in this connection describes the reduction or elimination of the intracellular activity of one or more enzymes (proteins) in a microorganism which are coded by the corresponding DNA, for example by using a weak promoter or using a gene or allele which codes for a corresponding enzyme with a low activity or inactivates the corresponding gene or enzyme (protein) , and optionally combining these measures.
  • the activity or concentration of the corresponding protein is in general reduced to 0 to 50%, 0 to 25%, 0 to 10% or 0 to 5% of the activity or concentration of the wild-type protein.
  • metE gene it may furthermore be advantageous, for the production of amino acids, in particular L-methionine, to eliminate undesirable side reactions, (Nakayama: “Breeding of Amino Acid Producing Micro-organisms", in: Overproduction of Microbial Products, Krumphanzl, Sikyta, Vanek (eds.), Academic Press, London, UK, 1982) .
  • amino acids in particular L-methionine
  • microorganisms prepared according to the invention can be cultured continuously or discontinuously in the batch process (batch culture) or in the fed batch (feed process) or repeated fed batch process (repetitive feed process) for the purpose of production of amino acids, in particular L- methionine.
  • batch culture batch culture
  • feed process fed batch
  • repetitive feed process repeated fed batch process
  • the culture medium to be used must meet the requirements of the particular strains in a suitable manner. Descriptions of culture media for various microorganisms are contained in the handbook “Manual of Methods for General Bacteriology” of the American Society for Bacteriology (Washington D.C., USA, 1981).
  • Sugars and carbohydrates such as e.g. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats, such as e.g. soya oil, sunflower oil, groundnut oil and coconut fat, fatty acids, such as e.g. palmitic acid, stearic acid and linoleic acid, alcohols, such as e.g. glycerol and ethanol, and organic acids, such as e.g. acetic acid, can be used as the source of carbon. These substance can be used individually or as a mixture.
  • oils and fats such as e.g. soya oil, sunflower oil, groundnut oil and coconut fat
  • fatty acids such as e.g. palmitic acid, stearic acid and linoleic acid
  • alcohols such as e.g. glycerol and ethanol
  • organic acids such as e.g. acetic acid
  • Organic nitrogen-containing compounds such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soya bean flour and urea
  • inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, can be used as the source of nitrogen.
  • the sources of nitrogen can be used individually or as a mixture.
  • Organic and inorganic sulfur-containing compounds such as, for example, sulfides, sulfites, sulfates and thiosulfates, can be used as a source of sulfur, in particular for the preparation of methionine.
  • the fermentation broth prepared in this manner is then further processed.
  • all or some of the biomass can be removed from the fermentation broth by separation methods, such as e.g. centrifugation, filtration, decanting or a combination thereof, or it can be left completely in this.
  • This broth is then thickened or concentrated by known methods, such as e.g. with the aid of a rotary evaporator, thin film evaporator, falling film evaporator, by reverse osmosis, or by nanofiltration.
  • This concentrated fermentation broth can then be worked up by methods of freeze drying, spray drying, spray granulation or by other processes to give a preferably free-flowing, finely divided powder.
  • This free-flowing, finely divided powder can then in turn by converted by suitable compacting or granulating processes into a coarse-grained, readily free-flowing, storable and largely dust-free product.
  • suitable compacting or granulating processes into a coarse-grained, readily free-flowing, storable and largely dust-free product.
  • organic or inorganic auxiliary substances or carriers such as starch, gelatin, cellulose derivatives or similar substances, such as are conventionally used as binders, gelling agents or thickeners in foodstuffs or feedstuffs processing, or further substances, such as, for example, silicas, silicates or stearates.
  • Free-flowing is understood as meaning powders which flow unimpeded out of the vessel with the opening of 5 mm (millimeters) of a series of glass outflow vessels with outflow openings of various sizes (Klein, Seifen, ⁇ le, Fette, Wachse 94, 12 (1968)).
  • finely divided means a powder with a predominant content (> 50 %) with a particle size of 20 to 200 ⁇ m diameter.
  • coarse-grained means products with a predominant content (> 50 %) with a particle size of 200 to 2000 ⁇ m diameter.
  • dust-free means that the product contains only small contents ( ⁇ 5 %) with particle sizes of less than 20 ⁇ m diameter.
  • the particle size determination can be carried out with methods of laser diffraction spectrometry. The corresponding methods are described in the textbook on “Teilchengr ⁇ entown in der Laborpraxis” by R. H. M ⁇ ller and R. Schuhmann, Academicliche Verlagsgesellschaft Stuttgart (1996) or in the textbook “Introduction to Particle Technology” by M. Rhodes, Verlag Wiley & Sons (1998) .
  • “Storable” in the context of this invention means a product which can be stored for up to 120 days, preferably up to 52 weeks, particularly preferably 60 months, without a substantial loss ( ⁇ 5%) of methionine occurring.
  • the product can be absorbed on to an organic or inorganic carrier substance which is known and conventional in feedstuffs processing, such as, for example, silicas, silicates, grits, brans, meals, starches, sugars or others, and/or mixed and stabilized with conventional thickeners or binders.
  • feedstuffs processing such as, for example, silicas, silicates, grits, brans, meals, starches, sugars or others, and/or mixed and stabilized with conventional thickeners or binders.
  • the product can be brought into a state in which it is stable to digestion by animal stomachs, in particular the stomach of ruminants, by coating processes ("coating") using film-forming agents, such as, for example, metal carbonates, silicas, silicates, alginates, stearates, starches, gums and cellulose ethers, as described in DE-C-4100920.
  • film-forming agents such as, for example, metal carbonates, silicas, silicates, alginates, stearates, starches, gums and cellulose ethers, as described in DE-C-4100920.
  • the animal feedstuffs additive according to the invention comprises at least the predominant proportion of the further substances, in particular organic substances, which are formed or added and are present in solution in the fermentation broth, where these have not been separated off by suitable processes.
  • the biomass can be separated off to the extent of up to 70%, preferably up to 80%, preferably up to 90%, preferably up to 95%, and particularly preferably up to 100%.
  • up to 20% of the biomass preferably up to 15%, preferably up to 10%, preferably up to 5%, particularly preferably no biomass is separated off.
  • organic substances include organic by-products which are optionally produced, in addition to the L-methionine, and optionally discharged by the microorganisms employed in the fermentation.
  • L-amino acids chosen from the group consisting of L-lysine, L-valine, L-threonine, L- alanine or L-tryptophan.
  • vitamins chosen from the group consisting of vitamin Bl (thiamine) , vitamin B2 (riboflavin) , vitamin B5 (pantothenic acid), vitamin B6 (pyridoxine) , vitamin B12 (cyanocobalamin) , nicotinic acid/nicotinamide and vitamin E (tocopherol) .
  • organic substances including L-methionine and/or D-methionine and/or the racemic mixture D,L-methionine, can also be added, depending on requirements, as a concentrate or pure substance in solid or liquid form during a suitable process step.
  • organic substances mentioned can be added individually or as mixtures to the resulting or concentrated fermentation broth, or also during the drying or granulation process. It is likewise possible to add an organic substance or a mixture of several organic substances to the fermentation broth and a further organic substance or a further mixture of several organic substances during a later process step, for example granulation.
  • the product described above is suitable as a feedstuffs additive, i.e. feed additive, for animal nutrition.
  • the L-methionine content of the animal feedstuffs additive is conventionally 1 wt.% to 80 wt.%, preferably 2 wt.% to 80 wt.%, particularly preferably 4 wt.% to 80 wt.%, and very particularly preferably 8 wt.% to 80 wt.%, based on the dry weight of the animal feedstuffs additive.
  • the water content of the feedstuffs additive is conventionally up to 5 wt.%, preferably up to 4 wt.%, and particularly preferably less than 2 wt.%.
  • the invention accordingly also provides a process for the preparation of an L-methionine-containing animal feedstuffs additive from fermentation broths, which comprises the steps
  • auxiliary substances chosen from the group consisting of silicas, silicates, stearates, grits and bran to the substances obtained according to a) to d) for stabilization and to increase the storability; or
  • L-methionine can be carried out by ion exchange chromatography with subsequent ninhydrin derivation, as described by Spackman et al. (Analytical Chemistry, 30, (1958), 1190).
  • the process according to the invention is used for the fermentative preparation of amino acids, in particular L- methionine.
  • DSMZ German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany
  • the cosmid DNA was then cleaved with the restriction enzyme BamHI (Amersham Pharmacia, Freiburg, Germany, Product Description BamHI, Code no. 27-0868-04) .
  • the cosmid DNA treated in this manner was mixed with the treated ATCC13032 DNA and the batch was treated with T4 DNA ligase (Amersham Pharmacia, Freiburg, Germany, Product Description T4-DNA- Ligase, Code no.27-0870-04) .
  • the ligation mixture was then packed in phages with the aid of Gigapack II XL Packing Extract (Stratagene, La Jolla, USA, Product Description Gigapack II XL Packing Extract, Code no. 200217) .
  • chromosomal DNA was isolated by the method of Eikmanns et al. (Microbiology 140: 1817 -1828 (1994) ) .
  • metA gene library Accession Number AF052652
  • metE SEQ ID No. 1
  • PCR polymerase chain reaction
  • metA-EVP5 metA-EVP5
  • metA-EVP3 metA-EVP3
  • metE-EVP5 metE-EVP5 :
  • the primers shown were synthesized by MWG-Biotech AG (Ebersberg, Germany) and the PCR reaction was carried out by the standard PCR method of Innis et al. (PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) with Pwo-Polymerase from Roche Diagnostics GmbH (Mannheim, Germany) . With the aid of the polymerase chain reaction, the primers allow amplification of a DNA fragment 1161 bp in size, which carries the metA gene, and a DNA fragment 2286 bp in size, which carries the metE gene.
  • the primer metA-EVP5 contains the sequence for the cleavage site of the restriction endonuclease EcoRI, the primer metA-EVP3 the cleavage site of the restriction endonuclease BamHI, the primer metE-EVP5 the cleavage site of the restriction endonuclease Bglll and the primer metE- EVP3 the cleavage site of the restriction endonuclease Sail, which are marked by underlining in the nucleotide sequence shown above.
  • the metA fragment 1161 bp in size was cleaved with the restriction endonucleases EcoRI and BamHI, and the metE fragment 2286 bp in size was cleaved with the restriction . endonucleases Bglll and Sail.
  • the two batches were separated by gel electrophoresis and the fragments metA (approx. 1150 bp) and metE (approx. 2270 bp) were then isolated from the agarose gel with the QiaExII Gel Extraction Kit (Product No. 20021, Qiagen, Hilden, Germany) .
  • the E. coli - C. glutamicum shuttle expression vector pZ8-l (EP 0 375 889) was used as the base vector for the expression.
  • DNA of the plasmid pZ8-l was cleaved completely with the restriction enzymes EcoRI and BamHI and then dephosphorylated with shrimp alkaline phosphatase (Roche Diagnostics GmbH, Mannheim, Germany, Product Description SAP, Product No. 1758250) .
  • the metA fragment approx. 1150 bp in size isolated from the agarose gel in example 3.1 and cleaved with the restriction endonucleases BamHI and EcoRI was mixed with the vector pZ8-l prepared in this way and the batch was treated with T4 DNA ligase (Amersham Pharmacia, Freiburg, Germany, Product Description T4-DNA-Ligase, Code no.27-0870-04) .
  • the ligation batch was transformed in the E. coli strain DH5 ⁇ mcr (Hanahan, In: DNA cloning. A Practical Approach. Vol. I. IRL-Press, Oxford, Washington DC, USA). Selection li ⁇ - tc ! ⁇ ⁇ xi OJ ⁇ > rt o ⁇ D H IT" •XJ ⁇ -3 X ⁇ ⁇ 1-3 o . , rt ⁇ 3 CO ii ⁇ - tc ! ⁇ ) ) 0 ) ⁇ > rt o
  • the vectors pCREmetA and pCREmetAE obtained in example 3.2 and 3.3 were electroporated in the strain C. glutamicum ATCC13032 using the electroporation method described by Liebl et al. (FEMS Microbiology Letters, 53:299-303 (1989) ) .
  • Selection of the plasmid-carrying cells took place on LBHIS agar comprising 18.5 g/1 brain-heart infusion broth, 0.5 M sorbitol, 5 g/1 Bacto-tryptone, 2.5 g/1 Bacto- yeast extract, 5 g/1 NaCl and 18 g/1 Bacto-agar, which had been supplemented with 25 mg/1 kana ycin. Incubation was carried out for 2 days at 33°C.
  • Plasmid DNA was isolated from in each case one transformant by conventional methods (Peters-Wendisch et al., 1998, Microbiology 144, 915-927) and checked by restriction cleavage. The resulting strains were called ATCC13032/pCREmetA and ATCC13032/ ⁇ CREmetAE.
  • the C. glutamicum strains ATCCl3032/pCREmetA and ATCC13032/pCREmetAE obtained in example 3 were cultured in a nutrient medium suitable for the production of methionine and the methionine content in the culture supernatant was determined.
  • the strains were first incubated on an agar plate with the corresponding antibiotic (brain-heart agar with kanamycin (50 mg/1) ) for ' 24 hours at 33°C. Starting from this agar plate culture, in each case a preculture was seeded (10 ml medium in a 100 ml conical flask) . The complete medium Cglll was used as the medium for the precultures.
  • Kanamycin 25 mg/1 was added to this.
  • the preculture was incubated for 16 hours at 33°C at 240 rpm on a shaking machine.
  • a main culture was seeded from these precultures such that the initial OD (660 nm) of the main cultures was 0.1.
  • Medium MM was used for the main cultures.
  • MOPS morpholinopropanesulfonic acid
  • the CSL, MOPS and the salt solution were brought to pH 7 with aqueous ammonia and autoclaved.
  • the sterile substrate and vitamin solutions were then added, as well as the CaC0 3 autoclaved in the dry state.
  • Culturing is carried out in a 10 ml volume in 100 ml conical flasks with baffles. Kanamycin (25 mg/1) was added. Culturing was carried out at 33°C and 80% atmospheric humidity.
  • the OD was determined at a measurement wavelength of 660 nm with a Biomek 1000 (Beckmann Instruments GmbH, Kunststoff) .
  • the amount of methionine formed was determined with an amino acid analyzer from Eppendorf- BioTronik (Hamburg, Germany) by ion exchange chromatography and post-column derivation with ninhydrin detection.
  • chromosomal DNA was isolated by the method of Eikmanns et al. (Microbiology 140: 1817 -1828 (1994)). Starting from the nucleotide sequence of the methionine biosynthesis gene metY (DE: 10043334.0) of C. glutamicum ATCC13032, the following oligonucleotides were chosen for the polymerase chain reaction (PCR) (see SEQ ID No. 7 and SEQ ID No. 8) :
  • metY-EVP5 metY-EVP5 :
  • metY-EVP3 metY-EVP3 :
  • the primers shown were synthesized by MWG-Biotech AG (Ebersberg, Germany) and the PCR reaction was carried out by the standard PCR method of Innis et al . ( PCR Protocols , A Guide to Methods and Applications, 1990, Academic Press) with Pwo-Polymerase from Roche Diagnostics GmbH (Mannheim, Germany) . With the aid of the polymerase chain reaction, the primers allow amplification of a DNA fragment 1341 bp in size, which carries the metY gene.
  • the primer metY-EVP5 contains the sequence for the cleavage site of the restriction endonuclease Sail and the primer metY-EVP3 the cleavage site of the restriction endonuclease Nsil, which are marked by underlining in the nucleotide sequence shown above.
  • the metY fragment 1341 bp in size was cleaved with the restriction endonucleases Sail and Nsil.
  • the batch was separated by gel electrophoresis and the fragment metY (approx. 1330 bp) was then isolated from the agarose gel with the QiaExII Gel Extraction Kit (Product No. 20021, Qiagen, Hilden, Germany) .
  • the plasmid pCREmetA described in example 3.2 was cleaved completely with the restriction enzymes Sail and Pstl and then dephosphorylated with shrimp alkaline phosphatase (Roche Diagnostics GmbH, Mannheim, Germany, Product Description SAP, Product No. 1758250) .
  • the metY fragment approx. 1330 bp in size isolated from the agarose gel in example 5.1 and cleaved with the restriction endonucleases Sail and Nsil was mixed with the vector pCREmetA prepared in this way and the batch was treated with T4 DNA ligase (Amersham Pharmacia, Freiburg, Germany, Product Description T4-DNA-Ligase, Code no.27-0870-04) .
  • the ligation batch was transformed in the E. coli strain DH5 ⁇ mcr (Hanahan, In: DNA cloning. A Practical Approach. Vol. I. IRL-Press, Oxford, Washington DC, USA). Selection of plasmid-carrying cells was made by plating out the transformation batch on LB agar (Lennox, 1955, Virology, cx Hi li ⁇ - tc •x.
  • DSMZ German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany
  • the vector pCREmetAY obtained in example 5.3 was electroporated in the strain C. glutamicum ATCC13032 using the electroporation method described by Liebl et al. (FEMS Microbiology Letters, 53:299-303 (1989)). Selection of plasmid-carrying cells took place on LBHIS agar comprising 18.5 g/1 brain-heart infusion broth, 0.5 M sorbitol, 5 g/1 Bacto-tryptone, 2.5 g/1 Bacto-yeast extract, 5 g/1 NaCl and 18 g/1 Bacto-agar, which had been supplemented with 25 mg/1 kanamycin. Incubation was carried out for 2 days at 33°C.
  • Plasmid DNA was isolated from a transformant by conventional methods (Peters-Wendisch et al., 1998, Microbiology 144, 915-927) and checked by restriction cleavage. The resulting strain was called ATCC13032pCREmetAEY.
  • strain C. glutamicum ATCC13032/pCREmetAEY constructed by the process described in example 4 was cultured in a nutrient medium suitable for the production of methionine and the methionine content in the culture supernatant was determined.
  • the strain was first incubated on an agar plate with the corresponding antibiotic (brain-heart agar with kanamycin (25 mg/1)) for 24 hours at 33°C.
  • a preculture was seeded (10 ml medium in a 100 ml conical flask) .
  • the medium MM-1 was used as the medium for the preculture.
  • MOPS morpholinopropanesulfonic acid
  • Vitamin B12 (sterile-filtered) 0.02 mg/1
  • the CSL, MOPS and the salt solution were brought to pH 7 with aqueous ammonia and autoclaved.
  • the sterile substrate and vitamin solutions were then added, as well as the CaC0 3 autoclaved in the dry state. Kanamycin (25 mg/1) was added to this.
  • the preculture was incubated for 16 hours at 33°C at
  • the medium MM-2 which has the following composition, was used for the main culture:
  • Vitamin B12 (sterile-filtered) 0.02 mg/1
  • OD optical density
  • the biomass was first separated off from a fermentation broth comprising L-methionine prepared by the process of example 6 and comprising about 39 mg/1 L-methionine.
  • a fermentation broth comprising L-methionine prepared by the process of example 6 and comprising about 39 mg/1 L-methionine.
  • 0.5 1 of the above-mentioned fermentation broth was centrifuged with a laboratory centrifuge of the Biofuge- Stratos type from Heraeus (Dusseldorf, Germany) for 20 minutes at 4,000 rpm and the supernatant from the centrifugation was then purified further by cross-flow ultrafiltration with an MRC polymer membrane of 30kD in an ultrafiltrations unit from ICT GmbH (Bad Homburg, Germany) .
  • the biomass was first separated off from a fermentation broth comprising L-methionine prepared by the process as described under example 6 and comprising about 39.0 mg/1 L- methionine.
  • the fermenter contents of the above- mentioned fermentation broth were centrifuged and subjected to ultrafiltration as described in example 7.
  • a portion of the suspension improved in this way was then lyophilized in a freeze-dryer of the type LYOVAC GT 2 from Leybold (Cologne, Germany) .
  • the product comprising L- methionine prepared in this manner had a content of 70 wt.% L-methionine and was free-flowing.
  • the remaining portion of the suspension improved in this way was treated by means of spray drying in a laboratory spray dryer of the B ⁇ chi-190 type from Buchi-Labortechnik GmbH (Constance, Germany) at an intake temperature of 170°C, a starting temperature of 105°C, a pressure difference of -40 mbar and an air flow rate of 600 NL/h.
  • the product comprising L-methionine prepared in this manner had a content of 70 wt.% L-methionine and was free-flowing.
  • the remaining portion of the biomass-containing broth was treated by means of spray drying in a laboratory spray dryer of the B ⁇ chi-190 type from Biichi-Labortechnik GmbH (Constance, Germany) at an intake temperature of 170°C, a starting temperature of 105°C, a pressure difference of - 40 mbar and an air flow rate of 600 NL/h.
  • the product comprising L-methionine prepared in this way had a content of 65 wt.% L-methionine and was free-flowing.
  • Km Resistance gene for kanamycin
  • metE metE gene of C. glutamicum
  • metY metY gene of C. glutamicum
  • metA metA gene of C. glutamicum
  • rrnB-TlT2 Terminator T1T2 of the rrnB gene of E. coli

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Polymers & Plastics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Food Science & Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Husbandry (AREA)
  • Biomedical Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention relates to an isolated polynucleotide comprising a polynucleotide sequence chosen from the group consisting of: a) polynucleotide which is identical to the extent of at least 70 % to a polynucleotide which codes for a polypeptide which comprises the amino acid sequence of SEQ ID No. 2; b) polynucleotide which codes for a polypeptide which comprises an amino acid sequence which is identical to the extent of at least 70 % to the amino acid sequence of SEQ ID No. 2; c) polynucleotide which is complementary to the polynucleotides of a) or b); and d) polynucleotide comprising at least 15 successive nucleotides of the polynucleotide sequence of a), b) or c); and processes for the fermentative preparation of L-amino acids using coryneform bacteria in which at least the metE gene coding for homocysteine methyltransferase (EC 2.1.1.14) is present in enhanced form, and the use of the polynucleotide sequences as hybridization probes.

Description

0> CO tr 0) 3 CU 3 ø S 3 Ω rt Ω 3 CO H ft H- n Hi H 3 Hi tr tr1 TI Φ 3 Hi tr m ^ o 3 φ Ω φ 3 F- ω Φ H- " tr O 3 rt Φ tr 3 o H rt 3 O 3 1 hi 3 φ Φ 0J 3" μ-
H- H TJ φ rt r Ω Φ rt Ω H Φ 3 rt H- H Φ TJ H O rt O 3 t? μ- tr rt H Ω Φ Φ
Hi H rt tr H- H tr H O Ω H H fυ O 3 μ- l-i Q. u 3 0 Cu tr 3 rt H
O Φ 3 O o O 3 TJ Φ H- H r+ TJ H 3 co μ- CO 3 H- H 3 H- φ Φ μ- Q.
X 0 I-*1 H Φ O rt O 0) H 3 Φ H- Φ H rt Φ CO rt rt 3 Ω 0 3 ti 3 a o H- o 3 1 rt K O cn H ft O rt 3 3 Φ a> σ rt μ- 3 3 O > Φ 3 rt μ- <. o ø
H 3 H- O 3 u ιQ ιQ o H rt ιQ rt TJ 3 0) H 3 o Hi Φ H μ- 01 0> Φ Hi O
H- rt H Φ tr 0) H- O CU iQ 3 ø) O 0J Ω Ω U o 3 Hi CU rt • 3 rt 3 H
CU ti H- H rt o 3 3 H. 3 l-i Ω rt 3 PJ H Φ rt μ- s: • CO μ- Ω φ μ- € rt ft (D
H φ Ω Φ r I-** H- TJ H- DJ rt H- φ 3 Hi 0) φ 3 3 Ω μ- <i tr μ- tr O
CD 3 P- H- co ι-S 3 co TJ O Φ ft H O μ- μ- Φ μ- 0 φ rt ft) Ω O rt 3 O 0 3 * Hi 3 l-i H- s; μ- rt 3 3 CO 3 Ω 3 μ-
0) 3 Ω H- 3 Φ ω <! rt < O DJ CO 3 O 0 3 o ff φ CO TJ tr
0 CD H- α.
3 H- CO • Φ CU F- H ^ 3 φ 3 l-i 3 Hi CU 3 μ- H T 3 ID
X r Φ 3 * ιQ rt 3 d Ό 3 w rt CO Cu μ- 3 Φ Ω H <! o ff "* ^ Φ O rt Φ CO O H CO TJ ft TJ ιQ Ω rt 3 3 ιQ TJ o O φ (0 rt O « CO rt tr 3 Φ f-s σ H- 0 P> H μ- h-1 o Cu H Cu <! 3 (D
I-. X co CΛ 3 H φ Φ •< 3 a *< rt O CO 3 l-i 3 - TJ tr H Φ μ- rt
O P- φ 1 Φ Ω CU CO Hi rt U3 ff H- Ω rt •< μ- μ- u cu CU μ-
TJ 3 rt r+ ff H- o F- • 1 O O Φ Ω DJ 3 3 CU 3 H Ω rt Hi Φ O a Φ tr (D φ H tr 3 0 co Φ Hi rt øj Hi 3 CO o 3 Φ o 3 rt rt μ- o CO 3 a
H- 3 H- H- o> O rt •^ O tr CO CO 3 μ- Hi rt μ- Φ O l-S a
Ω O Hi O CO TJ H- H Φ O 3 Φ to Ω O CU tr Ω H 3 3 (D μ» 1 3 ■s 3 CO 3 X Φ CO rt 3 H Ω <i φ 3 H- rt 3 ω
Hi 1 3 3 H- Φ " rt φ rt Φ Hi Hi B> CU 3 3 μ- φ H 0) O tr Ω o CU φ O 3 • H- I—* H !x! Φ O U3 CO 3 α H TJ CU Hi Φ I-1 < l-i 3 rt H Φ vQ Ω T Φ H- CD H H Φ 3 H rt tr CO < tr H μ- φ tJ*
H- tr O 3* 1-1 Ω 3 3 3 3 H 3 H D U cu 3 Cu 3 o H-
3 3 H- 3 O rt ω TJ Φ Φ Φ T Φ Ω CU T3 ι-i t"1 3 Φ rt 0
(1) 0 O Φ 3 rt J TJ H- H- M 3 X CO t Ω rt 1-1 0) 3 1 s: μ- rt μ- CJ* rt Ω 3 rt O t H Φ o Ω Φ rt £U O o σ CU Φ φ H CU 3 tr 3 H ) H- ff H φ Φ H 3 u 3 H <! Φ 3 ι- rt Ω φ μ- o Φ 0 σ Ω 3 H rt o rt TJ CO Φ μ- CO μ- TJ μ- φ rt Ω ιQ 0 o H Φ H Φ 3 H H- CU 0 H- H- l-1 rt 3 3 3 Φ OJ l-i Ω 3 tr 3" CU Φ CO μ- o tr 3 φ Φ Φ 3 rt O O φ tr Ω φ iQ *« φ 3 ft μ- Ω 3 Φ (D
H- T o Ω rt CO CO TJ 3 3 ^ φ t 3 O TJ H μ- O rt μ- Φ Λ rt φ 3 3 H- tr H- 3 ^ rt 3 Hi μ- 0) 0) Ω 3 tr
H- co O 3 rt Φ rt . Ω Cu CO 3 3 f-i OJ α 3 H>
(D ti φ o 3 t μ- φ CO CU φ 0 co rt rt Ω Φ o rt Hi 3 i O tr O CO rt φ μ- - 3 3 3 h
CU t •< 3 Qi rt T Ω H Φ 3 ^ rt Φ ff T3 < C0 φ 3 . Ω o 3 H- co H- ti rt Cu H t TJ o i Φ 0) "» Φ μ- φ rt l-h Φ o rt 3 3 rt 3" 3 O fu rt CO o Hi rt μ- H tr μ- μ- rt 3 CU CO ΪJ*
1 3 φ 1 Φ Φ rt T3 3 tr 0 CO O ft DJ l-i rt - 3 3 0) M (D l-i Ω P- H- rt CO Φ U3 Φ ιQ H- H tr ?T μ- l-i TJ T Hi
CD (D ts 3 D) O Φ CO H Φ PJ rt Φ Φ ιQ Ω Hi cu 3 CD . ιQ CU H l-i iQ 3
H φ Φ 3 Φ rt s: H P- Φ 3 H 3 Φ 3 CO Φ l-i O O (D
3 tr 1 *•» 0> M H- o O i T Φ μ-1 H μ- rt 3 3 rt Ω 3
O I-* Φ Φ ti 3 U H rt SD 0) 3 3 i CO Φ μ- Φ
DJ !X to O Ω CO 1- 3 O O rt l-i φ 0) φ Ω CO Ω s rt 1 ιQ rt μ- O TJ Ω 3 μ- 3 O O iQ
O H u 3 H- O 3 Hi r--* Φ μ- rt ω μ-1 H (D
H H- 3 Φ O Hi <Q Φ CO 3 CU μ- μ- CU Hi << 0
* Ω 3 rt ^ CO TJ rt 3 3 H O ti <D
3 rt 3 tr H μ- H Φ O 1 0) 1 T φ Ω O o rt tr1 H!
1 H Φ CU < 3 tr 1 rt O π Φ rt 3 Φ φ tr H
importance and produce amino acids, such as e.g. L- methionine, are obtained in this manner.
Methods of the reco binant DNA technique have also been employed for some years for improving the strain of Corynebacterium strains which produce L-amino acid, by amplifying individual amino acid biosynthesis genes and investigating the effect on the amino acid production.
Object of the Invention
The inventors had the object of providing new measures for improved fermentative preparation of amino acids, in particular L-methionine .
Summary of the Invention
When L-methionine or methionine are mentioned in the following, the salts, such as e.g. methionine hydrochloride or methionine sulfate are also meant by this.
The invention provides an isolated polynucleotide from coryneform bacteria, comprising a polynucleotide sequence which codes for the metE gene, chosen from the group consisting of
a) polynucleotide which is identical to the extent of at least 70% to a polynucleotide which codes for a polypeptide which comprises the amino acid sequence of SEQ ID No. 2,
b) polynucleotide which codes for a polypeptide which comprises an amino acid sequence which is identical to the extent of at least 70% to the amino acid sequence of SEQ ID No. 2,
c) polynucleotide which is complementary to the polynucleotides of a) or b) , and d) polynucleotide comprising at least 15 successive nucleotides of the polynucleotide sequence of a) , b) or c),
the polypeptide preferably having the activity of homocysteine methyltransferase I.
The invention also provides the above-mentioned polynucleotide, this preferably being a DNA which is capable of replication, comprising:
(i) the nucleotide sequence shown in SEQ ID No. 1, or
(ii) at least one sequence which corresponds' to sequence (i) within the range of the degeneration of the genetic code, or
(iii) at least one sequence which hybridizes with the sequence complementary to sequence (i) or (ii) , and optionally
(iv) sense mutations of neutral function in (i) .
The invention also provides
a polynucleotide comprising the nucleotide sequence as shown in SEQ ID No. 1;
a polynucleotide which codes for a polypeptide which comprises the amino acid sequence as shown in SEQ ID No. 2;
a vector containing the polynucleotide according to the invention, in particular a shuttle vector or plasmid vector, and
and coryneform bacteria serving as the host cell, which contain the vector or in which the etE gene is enhanced. The invention also provides polynucleotides which substantially comprise a polynucleotide sequence, which are obtainable by screening by means of hybridization of a corresponding gene library, which comprises the complete gene with the polynucleotide sequence corresponding to SEQ ID No. 1, with a probe which comprises the sequence of the polynucleotide mentioned, according to SEQ ID No. 1 or a fragment thereof, and isolation of the DNA sequence mentioned.
Detailed Description of the Invention
Polynucleotides which comprise the sequences according to the invention are suitable as hybridization probes for RNA, cDNA and DNA, in order to isolate, in the full length, nucleic acids or polynucleotides or genes which code for homocysteine methyltransferase I or to isolate those nucleic acids or polynucleotides or genes which have a high similarity of sequence with that of the homocysteine methyltransferase I gene.
Polynucleotides which comprise the sequences according to the invention are furthermore suitable as primers with the aid of which DNA of genes which code for homocysteine methyltransferase I can be prepared by the polymerase chain reaction (PCR) .
Such oligonucleotides which serve as probes or primers comprise at least 30, preferably at least 20, very particularly preferably at least 15 successive nucleotides. Oligonucleotides which have a length of at least 40 or 50 nucleotides are also suitable. Oligonucleotides with a length of at least 100, 150, 200, 250 or 300 nucleotides are optionally also suitable.
"Isolated" means separated out of its natural environment. "Polynucleotide" in general relates to polyribonucleotides and polydeoxyribonucleotides, it being possible for these to be non-modified RNA or DNA or modified RNA or DNA.
"Polypeptides" are understood as meaning peptides or proteins which comprise two or more amino acids bonded via peptide bonds.
The polypeptides according to the invention include a polypeptide according to SEQ ID No. 2, in particular those with the biological activity of homocysteine methyltransferase I, and also those which are at least 70%, preferably at least 80% and in particular which are at least 90% to 95% identical to the polypeptide according to SEQ ID No. 2 and have the activity mentioned.
The invention moreover provides a process for the fermentative preparation of amino acids, in particular L- methionine, using coryneform bacteria which in particular already produce amino acids, and in which the nucleotide sequences which code for the metE gene are enhanced, in particular over-expressed.
The term "enhancement" in this connection describes the increase in the intracellular activity of one or more enzymes (proteins) in a microorganism which are coded by the corresponding DNA, for example by increasing the number of copies of the gene or genes, using a potent promoter or using a gene or allele which codes for a corresponding enzyme (protein) having a high activity, and optionally combining these measures.
By enhancement measures, in particular over-expression, the activity or concentration of the corresponding protein is in general increased by at least 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400% or 500%, up to a maximum of 1000% or 2000%, based on the starting microorganism. The microorganisms which the present invention provides can prepare L-amino acids, in particular L-methionine, from glucose, sucrose, lactose, fructose, maltose, molasses, starch, cellulose or from glycerol and ethanol. They can be representatives of coryneform bacteria, in particular of the genus Corynebacterium. Of the genus Corynebacterium, there may be mentioned in particular the species Corynebacterium glutamicum, which is known among experts for its ability to produce L-amino acids.
Suitable strains of the genus Corynebacterium, in particular of the species Corynebacterium glutamicum (C. glutamicum) , are in particular the known wild-type strains
Corynebacterium glutamicum ATCC13032 Corynebacterium acetoglutamicum ATCC15806 Corynebacterium acetoacidophilum ATCC13870 Corynebacterium thermoaminogenes FERM BP-1539 Corynebacterium elassecola ATCC17965 Brevibacterium flavu ATCC14067 Brevibacterium lactofermentum ATCC13869 and Brevibacterium divaricatum ATCC14020
or L-amino acid-producing mutants or strains prepared therefrom, such as, for example, the L-methionine-producing strain
Corynebacterium glutamicum ATCC21608.
The new metE gene from C. glutamicum which codes for the enzyme homocysteine methyltransferase I (EC 2.1.1.14) has been isolated.
To isolate the metE gene or also other genes of C. glutamicum, a gene library of this microorganism is first set up in Escherichia coli (E. coli) . The setting up of gene libraries is described in generally known textbooks and handbooks. The textbook by innacker: Gene und Klone, Eine Einfuhrung in die Gentechnologie (Verlag Chemie, Weinheim, Germany, 1990) , or the handbook by Sambrook et al.: Molecular Cloning, A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1989) may be mentioned as an example. A well-known gene library is that of the E. coli K-12 strain W3110 set up in λ vectors by Kohara et al. (Cell 50, 495 -508 (1987)). Bathe et al. (Molecular and General Genetics, 252:255-265, 1996) describe a gene library of C. glutamicum ATCC13032, which was set up with the aid of the cosmid vector SuperCos I (Wahl et al., 1987, Proceedings of the National Academy of Sciences USA, 84:2160-2164) in the E. coli K-12 strain NM554 (Raleigh et al., 1988, Nucleic Acids Research 16:1563-1575).
Bormann et al. (Molecular Microbiology 6(3), 317-326) (1992)) in turn describe a gene library of C. glutamicum ATCC13032 using the cosmid pHC79 (Hohn and Collins, Gene 11, 291-298 (1980)). To prepare a gene library of C. glutamicum in E. coli it is also possible to use plasmids such as pBR322 (Bolivar, Life Sciences, 25, 807-818 (1979)) or pϋC9 (Vieira et al., 1982, Gene, 19:259-268). Suitable hosts are, in particular, those E. coli strains which are restriction- and recombination-defective. An example of these is the strain DH5αmcr, which has been described by Grant et al. (Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649). The long DNA fragments cloned with the aid of cosmids can in turn be subcloned in the usual vectors suitable for sequencing and then sequenced, as is described e.g. by Sanger et al. (Proceedings of the National Academy of Sciences of the United States of America, 74:5463-5467, 1977).
The resulting DNA sequences can then be investigated with known algorithms or sequence analysis programs, such as e.g. that of Staden (Nucleic Acids Research 14, 217- 232(1986)), that of Marck (Nucleic Acids Research 16, 1829- 1836 (1988)) or the GCG program of Butler (Methods of Biochemical Analysis 39, 74-97 (1998)). 3 o Hi TJ μ- 3 Ω Ω 3 σ> ω -J ro tr Ω rV 3 o Φ Ω tr rt x O 3 O rt 3 ι-3
3 H o 3 O 3 O O o • • -J cu 3 ft) 3 H O 3 Hi X o tr Φ O Φ Φ φ Φ tr Φ ff
Ω μ- O μ- <1 . 3 H ) .. Ω 3 3 o O H Ω 3 σ Φ ιQ rt CO H Xi φ rt Φ ιQ 3 Φ rt CO ti Φ ω t rt rt Ω 3 s: rt 3 rt cu tr CO l-i φ μ- t? Ω μ- 3 M
Φ o !" 3 ff rt Φ Ω r-o o ω Φ t rt o 3 Φ O tr CO 0) rt μ- μ- 3 3 l-i <i Φ TJ 3
O 3 CO Φ rt Φ μ- CO 3 1 -0 H φ μ- rt μ- rt Φ T 3 μ- x 3 φ iQ ιQ μ- φ 3 H ιQ Φ rt 3 M H μ- o rt TJ M 1 r- 1 μ- O rt 3 H CU iQ rt μ- <! H Φ tr x Ω φ Φ μ- Ω D 0) 0 H O 3 0 ft) μ- to 0 φ 3 CD tr H 3 H Φ 3 N Φ OJ D 3 Φ Φ ω 3
CX I-1 CO 3 CU Φ 3 H u> π H X 3 0) Φ 0 ft CO Φ Φ 3 Ω a Φ Hi φ Φ D
Φ Φ H Φ T 3 3 x N> h-1 0 TJ rt σ rt μ- OJ H μ- 3 rt > l-i O 3 a ω o α ft) Φ rt μ- tr cπ ^~. ιQ Φ tr O • Φ Ω rt s: μ- TJ CU o Hi rt OJ
• > rt Ω TI l-i 3 μ- μ1 ^~. H φ rt Ω Φ CO μ- 0 o ω H tr 3 3 μ- a tr μ- rt £ O ιQ o . — . > μ- rt H Cu tr • rt rV CU 3 O rt 3 Hi Φ O O rt μ- CX CO cx O cu 3 CO OJ Hi H μ» ω φ 3 OJ O 3 Ω Ω Hi tr • uQ CX <j rt tr 3 φ
Φ • μ- OJ 3 o < > O rt 3 ft) o μ- tr rt 3 3 Φ tr Φ <i •n
CO 3 H 0 rt 0) ιQ 00 — μ- Hi μ- iQ l-i OJ s α ft O H tr Φ Ω • φ φ tr 3 μ- Hi tr 3 •< ∞ •— ' 3 . OJ Φ Φ 3 OJ tr H 3 Φ 3 rt O 3 μ- Φ rt H •< o Φ 3 — — rt H CO Hi Hi CO Φ ιO Ω ι-3 T o rt Ω 3
•- ft) φ CO a Φ — On Φ H M O 3 ft) O rt ιQ Φ μ- ff l-i l-i μ- tr Ω
TJ H ft) M > μ- t J_? μ- μ-» H 3 < O Hi 3 3 Ii φ μ- H 3" Φ CO co Φ φ H o φ μ- Φ Ω D KD 3 3 CU 3 μ- 1 Hi 3 O- o . 3 α Φ 3 CO Φ 3
Ω rt S ω <S Hi μ- 3 3 CU O μ- 3 CU 3 ιQ iQ < Φ •5 CO H φ CO cu O
OJ cu μ- H φ Φ ι-i 3 X tc Cπ l-i 3 rt Φ 3 ιQ H . φ s CO rt 3* ff Φ 3 T tr CO Hi μ- o α Λ 3 O o o CO -~J μ- 3 TJ ff 3 Φ 3 3 o OJ μ- μ- o CO rt O ft) μ- Ω 3 CO 3 rt 3 μ- Ω u cu ft) ft) Φ rt 3 Φ rt Φ rt . 3 Ω Ω s: 3 3 CO CΛ o
• o φ a Φ μ- OJ 3 tr tr ^^ ^ rt μ- H rt X Cu * μ- Φ tr 3 μ- o M •
3 ,-» •n o 3 O O Ω 0 μ- μ» μ- H a CU Cu TJ 3 Ω o μ> Ω rt a μ- tr lO tr CO m 3 • Ω 3 w μ- ?r 3 μ- O H I-1 Φ μ- ff 3 ■ O l-i μ- μ- > 3 φ ιQ u rt o Φ Φ . O x 3 μ- 1 00 3 3 O cu l-i Ω 0) • O OJ Φ 3 3 iQ φ M H"
<! μ- 5 3 μ** CO o j H 3 Hi Ω rt 3 H Φ CO ιQ CO 3 σ 3 φ rt Ω H CO £ Φ o — ω μ- x 3 ff CQ ft) iQ o ^ 3 O φ TJ li¬
3 Φ ft) ■S D Φ 3 rt rt — Φ 3 Ω ^^ 3 CU Ω Φ o T CU μ-* M OJ iQ H Hi a eu
0) Φ 3 CO i-i tr X! tr • 3 CU o Ω 3 ft) μ- 3 CU σ i rt D 3 3 O o o 3
3 CO Φ μ- a 3 rt CU 1 rt 3 H rt iQ CO x O CO H a Φ μ- Φ ft 3 • μ-
H rt μ- s: Ω o Φ Φ H Φ μ- CO ff μ- Φ Hi Φ ft > H) μt 3 3 Φ 3 Ω
Φ 3 tr CU ff • 3 X rt 3 0) μ- Φ O O _; μ- l-i CO ft) ti σ o Ω μ- . μ» 3
3 O iQ μ- Ω rt CO CO <! 3 μ- CO 3 ιQ <! CO I-- O Φ 3 • 3 vQ Hi Ω Ω tr N> tt> tr ^-» OJ o CO Φ rt 3 Φ ^ 0) O φ ω 3 a OJ rt TJ tr 0 «< O 0 r H OJ Ω 3 Φ 3 TJ rt Hi Λ 0 0 Ω σ tr 3 μ- s: tr rt H 3 tr OJ 0 μ- tϋ rt 0 h H rt O ti Ω μ- 3 O • μ- OJ tr ω tr ff μ- cu CO H hi • ;v o φ 3 O 3 rt ff φ O H- <! O Φ CU C cx CO φ μ- o Φ 3 H rt μ- Φ 3* ω ^ ^-, iQ Φ rt rt μ- Φ rt 3 Φ M 3 lO [S3 rt OJ Ω
Hi Φ Φ μ- μ- j •X) CU rt Φ 0) 3 μ- 3 Φ Φ Ω Ω • CO 3J Hi DJ ff μ- H rt μ- 0) Ω o Φ l-i 3 X tr 3 co 0) 3 μ- ft) Φ O H φ Φ 3 3 Ω
0) 3 CO TJ 3 N I-1 tr Hi Ω o cu rt μ- CO Ω rt 3 Hi
Φ O tr rt 3 H CO 3 D Q tj μ- o Ω rt <1 ι-i Φ Φ M Hi rt 0) CO o μ- D O 3 3 rt 3 3 o
Φ •s φ 3 0 ι-i iQ 3 Φ rt • Ω μ- 0 3 μ- rt H 3 * rt a Φ Φ tr o CO -> 3 t TJ rt •€ Φ Φ o μ- OJ N Hi ι-i < μ- o a ff μ- O 3 rt φ rt Φ
Φ rt μ- cu μ- u O 3 3 u ^ — , 3 Φ rt μ- O u CU o μ- rt • Ω tr l-i ft) μ- CO
Cu μ- Ω ι-i O rt 3 Φ o I-" CU ff rt 3 H OJ . Ω 3 Φ o 3 Ω rt
CO O tr φ Hi * I-1 rt iQ O • O tr rt Φ ft) Ω tr Hi rt •< CO Φ Φ μ- CX o μ- 3
• 3 cx rt μ- • Ω 3 φ tr T l-i 3 3 μ- μ» 3 O CO l-i ex Φ o
Ii rt CO Ω μ- ^^ H Φ l-i 3 o μ- x rt σ Hi φ 3 ii 1 φ σ tr M μ- CO φ α 3 Hi o O Hi s: 3 0) rt π O CO -< Φ O 3 3 Φ ft) o rt H tr Φ ti O rt tr rt
3 3 CU Ω 3 3 Φ Φ rt μ- φ Hi rt ff φ O ff
Ω H rt H ft) 3 Φ Φ 3 μ- ff Ω O 3* φ φ Hi Φ tr ft tr D α CO O x 3 Φ tr ti OJ Φ 3 Φ Hi
^-. μ- H Ω OJ Φ 0) <! 0 TJ J H Hi TJ μ- rt hi Ω 3 OJ OJ H > o O rt CU H o Ω tc rt 3" H μ- 3 3 3 Ω X J3 OJ H H a μ- Φ o 3 tr ff Φ O 0 Hi Ω ft ?r X H tr μ- 3 Hi ra ff 3
U3 rt CO tr TJ T li Φ > rV li CO μ- Φ XI hi tiμ- &) Hi μ- φ co H tr φ tr CO
00 Φ rt rt μ- hi μ- - J < Φ 3 CO rt Ω 3 H ft) ro tr ex o J rt O 3 hi H rt h H 3 Φ φ μ- μ- Φ Φ s: φ μ- ff ff CO I-* Φ Ω h CO cu Φ hi o φ o hi •< OJ μ- tr μ- li
— 3 hi < CO Hi 3 3 3 **1 μ- 3 tr Φ rt 0) CO ff CO 3 cx 3 X Hi 3 O 3 X cu 3
- — ft) Ω Φ φ CO μ- X! Φ rt 3 CO li-1 cu li rt TJ μ- o μ- 3 TJ Ω li" μ- 3 μ- Ω μ- rt x μ- φ μ- hi Φ eu Φ CO hi 3 μ- 0 Φ < μ- tr co Ω φ rt rt ra N CX N rt μ- μ- TJ 0 cx 3 Ω 3 rt rt ft) Φ Ω 0 3 <l Φ 3 Φ Ω α h-1 hi tr μ- 3 OJ σ OJ μ- μ- cu 0 H tr 3 3 0 X! tr μ- μ- rt 3 rt 3 CX φ H Φ tr i Φ rt Φ o Cu μ> rt 0 rt o
3 •^ 3 O < μ- 3 Φ 3 <! O φ μ- 3 μ- 1 TJ 3 φ O 3 rt (Ω μ- o μ- 3
CO Ω o 3 1 CO rt hi TJ Φ 3 H li 3 CU Φ CU li rt TJ CO μ- I ) o rV o CO
Q μ- Φ Ω Hi Φ rt tr 3 li μ- •≤ Ω 0) Φ X! 3 X H Hi μ1 μ- μ- o Ω ω 3 3
3 3 μ- cx tr rt li H φ o o l→ 3 OJ 0 H X! TJ rt 0 < >£> cx 3 μ- h-h 3 3 Hi
Φ 3 3 ft) tiff 3 li <! 1 Ω hi μ- XI o li μ- 3 Φ 00 φ li^ O GO j o O li S li 3 er Φ o Ω cx Φ Φ 3 li • TJ X! o Φ <! Φ Ω 3 li •fc-. ra 3 li ft) ft) Hi tr ft) H
H ft) rt Φ X, φ H ci¬ Φ ^ φ Φ o Φ 3 3 ω 3
. CX (-> to H φ Ω 3 hi φ 3
Φ H tr μ- Ω te XI rt CU d hi 3 Φ ii CO M OJ li ft) liCX o μ- hi rt μ- 3 XI tr Ω li rt tr ff CO < CU Φ o CO 1 μ- ø rt X) OJ 3 CU ft) 3 ra 3 α tr cx
O μ- co XI φ ii 0 Ω cu tr H- Φ rt ii φ O hi 3* -> 3 rt μ> CO TJ hi μ- H ra ra
3 3 o TJ OJ ex Φ O μ- Φ Ω Ω 3 CU cx tr μ- Φ μ» μ- 3 GO en 3
Φ Ω ft φ 3 μ- 3 cu 3 3 rt 3 OJ rt CU T tr1 rt tc Φ eu μ- o o Hi rt li- Φ o tr CO o Φ rt Φ Φ μ- tr ex 3 tr 3 li O 1 φ μ- CO Ω Hi μ- tr* φ O o μ- li3 Φ CO CO Φ μ- 3 J 3 φ 3 3 φ Φ Hi 3 Ω μ- 3 μ- tr μ- o μ- tr 3 Hi
CU rt μ- O μ- O N CO Φ Ω TJ σ tr CO φ O cx co μ- cu Ω XJ ra hi CO 3 <
H ft) Φ Ω 3 3 i-t 3 3 φ μ- CO Φ li Φ CO rt rt H Φ a .. 3 μ- cu - tr μ- liΩ- μ-
. μ-* K o φ o tr H TJ IX σ rt μ- μ- ff tr μ- Φ 3 rt μ» 3 ra 3
• rt 3 X! • li Φ O Φ φ li TJ - H 3 tr μ- o Φ μ- 3 σ s: > rt μ- ^-^ X! 3 σ XJ
^-» TJ 3 H Hi CO O li φ Φ 3 o 3 3 o Φ Φ rt ff hi o l-1 ra ro
^-» Ω o Φ Ω OJ cx Φ CU liCO Ω 3 3 Hi hi O Φ φ 3 5 rt li σ D φ GO ft) CO CO OJ tr rt Ω rt 3 CO TJ 3 ft) o li Φ μ- O X! 3 ii OJ O CD rt a
3 μ- 3 μ- rt rt 3 Φ tr rt o Ω CO hi rt 3 Φ rt rt 3 hi *< OJ tr Ω O cu s ra tr >
Φ 0 rt μ- Φ Φ μ- rt μ- O 0 Φ Φ ft) tr M φ 3 OJ Ω cu rt Hi — μ- OJ hi ra
\ tr μ- o hi tr TJ < TJ μ- o 3 Hi cx CO φ ^ ω 3 rt 3 μ- • 3 CO CO μ> ι-3 Φ o 3 3 φ H Φ μ- ii o 3 o σ φ XI tr Φ CX μ- ex o α •Ji. 3 ra φ ω Φ 3 CU φ 3 rt 0 3 rt rt μ- cx ti Φ μ- ft) li Ω tr 3 a h-1 ^-~. tr Ώ x XI
03 Ω Hi o rt μ- CO N • μ- • μ- Φ tr M 3 •* 0 3 3 Ω 3 α CU o > • • H ra 3 T 3
-*. tr o o OJ μ- 3 φ 0 3 H φ X cx 3 Φ li¬ 0) i μ- o ^^ 3 μ- μ- ra Φ
3 3 Hi 3 <! rt 3 μ- 3 H3 CO TJ μ- o & • OJ ra 3 OJ rV n CO N> li3 α hi 3 ω o 3 Φ Φ rt φ CO X! tr rt CO li 3 li Φ 3 H tr > o φ cπ ra ra rt Ω
Cπ μ-- ex ft Hi μ* XI φ ff rt Φ X! H μ- cu TJ σ w X! ( i hi en ^ ra
1 o tr 3 << hi μ- TJ cu ft Φ μ- li CO rt μ- eu 3 TJ 3 1 3 Hi ω α-> XI tr Φ ii OJ 3 li l-1 tr φ rt 3 CO CO tr o 3 h-1 li Φ ) CU & o μ-
- rt rt O O Φ X Ω Ω μ- μ- Φ Hi TJ TJ Ω o Q Ω 3 n rt tc hi 3 σ
3 tr OJ Φ TJ rt o T O μ- rt O rt li li tJD ra ft) CU CU Ω o μ- li¬
_— , JI rt φ Φ 3 CX μ- Φ μ- li 3 co 3 3 φ TJ Ω O O *» a Ω μ- 3 Φ — - 0 . — . •^ ra μ» --. tr cx hi ft) μ- μ- μ- Φ ii hi hi o < 0. . — Pi tr rt O • 3 s μ- hi 3
<£> φ μ- 3 O 0) CO 3 3 Hi CO O cu 0) Ω 3 o TJ Φ 3 . .. tr CU CU h-> ra
«x> 1 ft> o <J 3 3 • Ω Φ CO Φ cx I-1 0) TJ 3 μ- D. Ω . — . Φ S μ-1 3 liCU OJ
*-. ω φ H Φ ex μ- hi μ- cx CO CO o φ Φ O M μ- 3 ra 3
P cu Φ li ex ι-3 Φ o o O μ- X5 CO rt rt CO 3 τs to Hi rt . 3* H μ- CO
— 1 TJ 3 1 CO tr ft) Hi 3 Hi rt Φ Φ ii Φ 0) OJ Φ t-i o tr O Φ eu μ> φ ex tr Φ CO μ- 3 liΦ H o 3 3 3 3 μ- ** o a*--. H Φ •s φ rt μ- o Φ ft 0) Hi 3 μ- rt n 3 rt hi 3 Hi
O. ft rt μ- XI ex tr CD 3 Φ 3 ft) Φ 3 H hi ex tr 3 μ- tr rt Φ φ 0) OJ CO 3 ft li 0 3 φ φ ft) 3 Φ tr 3 tr μ** Ω O CX tr 3 ω tr μ-
Φ 3 μ< rt Hi φ cu 1
φ Ω n 0 ,_, 0) 3 OJ rt •D CO μ- ^-, ft) TJ Φ -~. M <! hi ra rt DO rt to O X) μ- 3 i o TJ μ> μ- CD 3 tr μ- ft) f-o O CO h-1 rt M 3 Φ Φ TJ o < Φ ra Ω cu 3 CO ft) μ- ft) ra IX) . φ TJ o OJ 3 d*-. Φ ft) μ- <! Ω TJ μ- P$ μ- tr li¬ 3
3 μ- CO li X) cx M CO CO φ ti φ CO ft) μ- ι-r ω rt rt 3 X ra M Ω
TJ 3 o it-. ÷~. μ- Φ
— 3 ,—» X • 3 μ-* 0" H O μ- o ff OJ tr CD OJ 3 μ- * h-1 μ- 3 H, μ- 3 μ» o X! μ- • ft) o ii Ω 3 Φ o Ω li rt X" μ- φ cx — TJ Cu μ- x x OJ <X) μ- • cx -^ 3 3 to CU cu 0 tr N 3 • tr TJ CO Ω μ- 3 <X) cx CO 3 3 li¬ H μ- o T ra φ co OJ 0)
3 H Hi H OJ rt < 3 O 1 rt O O φ ra 3 Hi CD μ- hi TJ 3
TJ rt Φ 3 O μ- tr rt tr Φ Φ — D tr TJ Φ 3 CO . TJ <l cx CD 3 ft) O Ω li Φ cu μ- Ω ii — 0) o tc 3 Φ li¬ 3 μ> Φ Φ 0 OJ Ω CO 3 α 3 rt rt cx CO o rt rt • •>. <j CO s Φ li¬ eu Ω μ- OJ 3 !X Hi ra 3 μ- ex
"-a o O tr cx 3 tr o μ- φ μ* tr 3 O rt OJ li- CX Hi ra co rt li μ- 3 OJ tr Φ H o C0 Cπ μ- eu 3 μ- 3 } μ- li¬ s o O TJ 3 Φ tr CO li tr h-1 o \-> S ft) Ω μ- o TJ φ CU X) Ω o μ> μ- X μj CX Φ cu Φ CU U3 -j . μ- CO O cx 3 μ- 3 !- 3: OJ eu li
3 ff 3 μ- 3 μ- X rt CO •* .. -^ Ω li O φ Φ • tr rt μ- μ-
,—» μ- Φ Ω W μ- cx tr φ σ> H Φ • • rt μ- μ- 3
CO O Ω rt OJ 3 cx 3 μ- O CU cx TJ υ_> o o • 3 OJ μ- ^-, φ o ft) μ- • tr ff rt <1 Φ rt O Ω μ» DO 1 φ tr xι ra O CD Hi Ω > hi 3 XI
3 0 μ- μ- CO Φ Hi tr • o tr1 -j 3 μ- • Hi 3 o CD TJ o ft) o X! Ω 0- o H Ω X! , — . "* 3 μ- j-» Φ o O μ- O li TJ . ^ o ra
3 M cu 3 o h{ H X 0) M T li rt < ft) H GO 3 ^-,
3 3 3 μ- 0) tr li CO •n TJ O ^-^ μ» o N 3 0) Φ Φ 3 μ- μ- ife ra DO
Φ rt rt o 3 tr rt μ- Φ 1 M o li μ- o XI h-1 tr hi 3 CX ra o -J μ- li¬ 0) ii tr hi ra Φ μ- Ω S Q IX) to tr μ-* 1 tr α N I J μ> o
3 Φ Φ 3 cx o tr Hi CO ■J-* TJ vo • • . . 0) ra Φ CU 3 1^ o ^ eu μ- TJ ft) li¬ 3 3 Cπ O μ- IX) 3 Ω X 3 o cu Φ 00 t ι-3 μ- Ω μ- Ω 3 eu rt li 3 . — . — - CO 1 Φ li¬ TJ TJ Ω M 3 Ω en ra
• 3 μ- o TJ H Hi μ- tr rt μ» μ- — 1 IX) 3 ra H Φ ra cx tr 1X5 Ω
*» 3 Ω 3 μ-* O 3 Φ tr cπ Ω ω • IX) 00 r hi 0) ra 3 Ω 3 <X) tr eu TJ μ- s hi rt φ 00 h 1 OJ 00 <X) Φ μ- ω CD ra 3 w o O 3 ω rt I-* Hi μ- o TJ hi o o hi --- H OJ 3 CO 3 I-1 3 -> μ- 1 o μ- TJ ra φ μ- Ω Φ hi 3 00 tr rt φ -—. • μ- ra rt ft) <! o 3 IX) H o o rt Ω H i rt o o IX) μ- ff en φ cx cx li μ- XI 00 O
\ CO μ- Φ cu o CU tr Ω li h-1 o •^ ra tr <X) 4"-. li¬ a CO rt H a iQ ι-3 CO 3 rt tr 3 φ Φ φ ** — " μ- ι4-> hi OJ IX) • • 3 •s tr σ o O . — . ra μ- XI μ- μ- TJ CO *. o 00 CO μ- eu 3 CU μ- ra μ- 3 •X) μ>
Ω tr 0) Φ o o M Ω CO CO X! I ) T φ — Cπ μ- ra hi rt o 3 •^ •XI IX) en tr H 3 3 μ- Φ tr 3 Ω -< H ex — tfc. • li Φ tr 3 H Φ OJ IX)
3 Φ tr Φ o H o μ- CU h-1 ft) IX) ** O ra o 3 00 li¬ μ-* o o o X3. o Hi rt 3 t→ cn CO o o 1 3 rt rt rt X! li¬ ιt-> ra — j-> μ-* CO μ- Hi tr 3 OJ Φ σ 3 3 hi cπ CO tr tr t? ft) 1 3 — ) o Φ rt CD o ιQ tr tr rt — * μ- Cπ TJ o ra μ- 00 li¬ *- 00
X* Ω rt en CO φ φ rt •^ cx rt T •4--. TJ f CO XI ^] 1 rt . — . Ω tr o to o 3 Φ Φ 3" tc — - 3 φ cu Φ
3 li o <! ra CO μ- o μ- 3 s te-. μ- .t--. o rt H φ Φ 3 φ μ- ^_, ^ 3 O μ»
^ li o μ- ra ft) CD CD H Φ r-o ra s: S ex Φ Ω μ1 en o ω TJ 3 ff μ> 3 hi Φ Ω Ω 1 TJ α 3 tr li IX) o M μ- Φ o IV) co Ω φ cx en T rt ti μ- t? μ- o ft) o ^X) h-> 3
-j OJ Ω ex 3 en Ω ft) σι 2 0 i OJ T Ω Hi Ω σ i μ»
CO H OJ 1 I tr 3 ft) μ- O H T ^-^ M 3 H tr Ω μ- 00 O IX)
J-» Φ H μ- rt μ» φ H 3 K) CO rt CO cx OJ O o "^ <X) TJ 00
1 μ-* 3 3* ω μ- tr CO h-> •*. μ- o μ> CO OJ li μj U) ra 00
-j >< H PO cx Φ o rt h-1 Ω 3 3 hi cx o μ- ^ OJ — D Hi OJ DO tr < > CO 3 μ- φ μ- <Q 3 3 •w μ» o m Φ Φ 1 3 Φ CX 3 < H- li • fi- Ω 3 XI 3 tr
(1983)), pKlδmob or pK19mob (Schafer et al., Gene 145, 69- 73 (1994)), pGEM-T (Promega corporation, Madison, WI, USA), pCR2.1-TOPO (Shuman (1994). Journal of Biological Chemistry 269:32678-84; US-A 5, 487, 993) , pCR®Blunt (Invitrogen, Groningen, Holland; Bernard et al., Journal of Molecular Biology, 234: 534-541 (1993)), pEMl (Schrumpf et al, 1991, Journal of Bacteriology 173:4510-4516) or pBGS8 (Spratt et al.,1986, Gene 41: 337-342). The plasmid vector which contains the gene to be amplified is then transferred into the desired strain of C. glutamicum by conjugation or transformation. The method of conjugation is described, for example, by Schafer et al. (Applied and Environmental Microbiology 60, 756-759 (1994)). Methods for transformation are described, for example, by Thierbach et al. (Applied Microbiology and Biotechnology 29, 356-362 (1988)), Dunican and Shivnan (Bio/Technology 7, 1067-1070 (1989)) and Tauch et al. (FEMS Microbiological Letters 123, 343-347 (1994)). After homologous recombination by means of a "cross over" event, the resulting strain contains at least two copies of the gene in question.
In addition, it may be advantageous for the production of amino acids, in particular L-methionine, to enhance one or more enzymes of the particular biosynthesis pathway, of glycolysis, of anaplerosis, of the citric acid cycle or of amino acid export, in addition to the metE gene.
Thus for the preparation of amino acids, in particular L- methionine, one or more genes chosen from the group consisting of
• the gap gene which codes for glyceraldehyde 3-phosphate dehydrogenase (Eikmanns (1992), Journal of Bacteriology 174:6076-6086) ,
• the tpi gene which codes for triose phosphate isomerase
(Eikmanns (1992), Journal of Bacteriology 174:6076-6086), • the pgk gene which codes for 3-phosphoglycerate kinase (Eikmanns (1992), Journal of Bacteriology 174:6076-6086),
• the pyc gene which codes for pyruvate carboxylase (Eikmanns (1992), Journal of Bacteriology 174:6076-6086),
• the lysC gene which codes for a feed-back resistant aspartate kinase (Accession No.P26512; EP-B-0387527; EP- A-0699759) ,
• the etA gene which codes for homoserine 0- acetyltransferase (ACCESSION Number AF052652),
• the metB gene which codes for cystathionine gamma- synthase (ACCESSION Number AF126953) ,
• the aecD gene which codes for cystathionine gamma-lyase
(ACCESSION Number M89931)
• the glyA gene which codes for serine hydroxymethyltransferase (JP-A-08107788) ,
• the metY gene which codes for O-acetylhomoserine sulfhydrylase (DSM 13556)
can be enhanced, in particular over-expressed.
It may furthermore be advantageous for the production of amino acids, in particular L-methionine, in addition to the enhancement of the metE gene, for one or more genes chosen from the group consisting of
• the thrB gene which codes for homoserine kinase (ACCESSION Number P08210) ,
• the ilvA gene which codes for threonine dehydratase (ACCESSION Number Q04513) ,
• the thrC gene which codes for threonine synthase
(ACCESSION Number P23669) , • the ddh gene which codes for meso-diaminopimelate D- dehydrogenase (ACCESSION Number Y00151) ,
• the pck gene which codes for phosphoenol pyruvate carboxykinase (DE 199 50 409.1; DSM 13047),
• the pgi gene which codes for glucose 6-phosphate isomerase (US 09/396,478; DSM 12969),
• the poxB gene which codes for pyruvate oxidase (DE: 1995 1975.7; DSM 13114)
to be attenuated, in particular for the expression thereof to be reduced.
The term "attenuation" in this connection describes the reduction or elimination of the intracellular activity of one or more enzymes (proteins) in a microorganism which are coded by the corresponding DNA, for example by using a weak promoter or using a gene or allele which codes for a corresponding enzyme with a low activity or inactivates the corresponding gene or enzyme (protein) , and optionally combining these measures.
By attenuation measures, the activity or concentration of the corresponding protein is in general reduced to 0 to 50%, 0 to 25%, 0 to 10% or 0 to 5% of the activity or concentration of the wild-type protein.
In addition to over-expression of the metE gene it may furthermore be advantageous, for the production of amino acids, in particular L-methionine, to eliminate undesirable side reactions, (Nakayama: "Breeding of Amino Acid Producing Micro-organisms", in: Overproduction of Microbial Products, Krumphanzl, Sikyta, Vanek (eds.), Academic Press, London, UK, 1982) .
The microorganisms prepared according to the invention can be cultured continuously or discontinuously in the batch process (batch culture) or in the fed batch (feed process) or repeated fed batch process (repetitive feed process) for the purpose of production of amino acids, in particular L- methionine. A summary of known culture methods is described in the textbook by Chmiel (Bioprozesstechnik 1. Einfϋhrung in die Bioverfahrenstechnik (Gustav Fischer Verlag, Stuttgart, 1991) ) or in the textbook by Storhas (Bioreaktoren und periphere Einrichtungen (Vieweg Verlag, Braunschweig/Wiesbaden, 1994) ) .
The culture medium to be used must meet the requirements of the particular strains in a suitable manner. Descriptions of culture media for various microorganisms are contained in the handbook "Manual of Methods for General Bacteriology" of the American Society for Bacteriology (Washington D.C., USA, 1981).
Sugars and carbohydrates, such as e.g. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats, such as e.g. soya oil, sunflower oil, groundnut oil and coconut fat, fatty acids, such as e.g. palmitic acid, stearic acid and linoleic acid, alcohols, such as e.g. glycerol and ethanol, and organic acids, such as e.g. acetic acid, can be used as the source of carbon. These substance can be used individually or as a mixture.
Organic nitrogen-containing compounds, such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soya bean flour and urea, or inorganic compounds, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, can be used as the source of nitrogen. The sources of nitrogen can be used individually or as a mixture.
Organic and inorganic sulfur-containing compounds, such as, for example, sulfides, sulfites, sulfates and thiosulfates, can be used as a source of sulfur, in particular for the preparation of methionine. TJ Hi μ- O μ- ft) rt Ω ι-3 μ> TJ •4-> Ω 0) O CO 0) CO tr μ- CO tr 00 ex rt 3 CO Φ CO X 3 ι-3 Ω cx ■ J ra ra CD <1 μ- CX o o tr o hi O 3 hi X li- 3 3 Φ 3 3 3 eu 3 ff φ 3 3 3 tr ra ff O μ- tr li H ra 3 <! 3 ra O μ* Φ - CU rt tr rt Ω CX CO H Φ cx μ- TJ σ μ- li¬ ra 3 TJ o μ- 3 rt ti μ- ft) r-o li¬ ff cx O rt Xl tr μ- CO Φ μ- ft) tr h μ- μ- μ- rt l-1 CO Ω ft) li¬ o CO o ra o rt 3 cπ ft) Hi o 3 3 μ- Φ μ- tr li¬ 3 Hi o Ω 3 Ω 3 0) o li¬ ff !- Ω eu ri- TJ
CX 3 ft) Φ li¬ μ- Φ 3 Ω H 3 3 μ- ft) TJ O CO 0) X XI 3 3 tr < eu CO 3 μ- eu tr rt O rt α ft) X 3 H hi rt o Φ rt μ- o 3 I-* ft) 3 D μ- Ω h-1 μ- φ 3 cu H 3 CO o cu ft) vQ rt μ- 3 CD 3 H O rt rt Ω o 3 μ- cx o rt rt Φ cx Ω H rt μ- CO H rt μ- TJ Φ • 3 φ tr μ- μ- O hi ^ μ- Φ ^ CD rt TJ Φ 3 ff 3 j Φ φ CO 3 3 μ- μ- μ- ra hi o o\° Xl 3 rt OJ rt CD α Ω CO φ • 0) tr ^ TJ Φ tr TJ μ- CO 3 H X! 3 Ω
0 ft) 0 3 li¬ 0 O 3 3 O 0 CD α tr 0 O Φ Φ ϋ 3 3 Ω ra 3
3 rt CD Ω CO OJ t-1 ft) ti 3 Ω X Hi tr CD H CD ft) 3 Ω Φ ra tr CO OJ tr rt φ 3 1 rt h-1 Hi μ- CO φ 0) rt 3 ra TJ 3 3 3 μ- CO Ω cυ CO Ω 3 OJ tr Ω
3 ra x μ- cx 3 μ- cn 0 3 3 x X! T Ω 0 Ω tr cx H 3 li- 3 α 3 ra cu ra H μ- ra O 3 Hi ra o o H XJ. OJ Φ I-1 CU μ- tr 3 o o O rt CU hi ex Ω CO CD cx rt cx cx Ω o H Ω rt 3 3 μ- μ- 3 ft) 3 3 Ω cu hi 3 3 rt hi CO μ- tr CO μ- CD li μ- o o\° Φ rt O tr tr φ μ- 3 1 O iQ O 0) 3 μ- μ- hi tr rt O rt ft) φ 3 o
3 3 tr 3 μ- tr o cx co rt Ω 3 tr 3 CD 3 Ω 0J CO Φ φ μ- hi μ- eu li • 3 Ω X! TJ
3 Ω 0 DJ Φ rt o hi 3 O O μ- Φ Cu rt ra 3 3 CD o CO 0J Φ o ra Hi rt ft) 3 o li Ω IV) 3 cx H φ hi cu o Ω μ- Hi XI 3 X! 3 3 3 li- μ- 3 Hi μ- μ- rt CO H O o rt li- CO 0) CO 0 • Ω H tr 3 O Ω OJ Hi • 3 CU co rt rt f—* Φ 3 3 tr t 3 0 tr CU • Φ X! rt μ- li CO OJ rt 3 O CO σ TJ CO li ff Φ li ra ω μ- rt o Φ μ- ex h-1 • O cx ft) eu 0J 3 3 3 O μ- H 3 rt φ tr CO
H OJ CD ft) 3 IT1 co μ- 3 H Φ Φ rt X) CO σ 3 OJ o μ- ra rt CO Φ 1 o 3 rt Ω μ- O cx Ω ff Hi Ω O 3 CO o CD 3 rt O X3 X! Hl 3 CO 3 cx μ- CX li¬ 3 3 3 tr li- 3 o 3 3 rt Φ CU O H Φ CD 3 Hi rt o tr H 3 3 CD TJ 3
3 o ø lira CO li¬ CU Φ μ- ιQ 3 rt μ- li¬ 3 o o μ- CU li Φ 0) O Φ H φ tr
Ω 3 li ft) eu rt 3 ft) li CX |J"-. rt cu O <1 CX ft rt CO 3 cx rt ft) 3 Φ Ω X CO rt cx eu ra ft) rt rt tr ft) μ- Xl cπ 3 J μ- Φ Φ -< li 3 CO μ- 0) Ω O øj μ- rt μ- tr li¬ μ- cx o rt μ- μ- I-1 3 φ 3 0 hi 0J 3 rt < O H 3 σ CO Φ <! tr cx tr 3 ra ft) ra tr
Hi μ- rt o o μ- φ rt 3 O Φ CD li¬ tr ft) Φ J I—* Hi ft) 3 l-1 μ- CO Φ o CO • 3 ii CO rt O tr 3 3 cx rt ^ • eu φ Ω H Ω 3 φ 3 ti <! 3 o ex o 3 3 Φ μ- μ- μ- 3 μ- rt O μ- rt li 3 tr ιQ 3 Φ eu "3 CD o rt li li rt μ- 3 tr μ- co μ> 0) 3 μ- 3 3 μ- TJ ff μ- o 3 μ- φ σ 1 3 μ- 3 hi tr o
IV μ- O Φ CD φ cu 3 3 tr X φ o 3 Φ Ω 3 0) Φ 3 ra 3 cx 3 μ" CD φ rt X! μ-1 Hi 3 • 3 3 0) CX Φ rt CU P-. 3 φ TJ μ- li 3 rt φ ft) Hi tr ra o μ- CX Ω ra rt CD 3 Φ μ- 3 o TJ OJ cυ o 3 tr μ- OJ 3 < h-1 ØJ Ω CO ra 3
N rt o H tr 3 3 T rt li ii 3 rt H t Ω ^ X Φ cu 0 cx rt μ- H li0 O rt OJ tr 3 rt cυ μ- OJ Cu H Φ Φ O 3 CO < μ- μ- hi rt 3 cx μ- rt ra 3 3 Ω TJ o σ φ tr ex CD μ- X Φ 3 CO tr 3 O J O 0 α • Ω ra ra 0 eu TJ ti 0 tr μ- 3 3 μ- cx μ- μ- Hi TJ μ- rt Ω Hi H Hi -« ti Φ tr cx cx 3 3 o li Ω li o ω ro Hi rt Ω co li X ^ 3 Φ φ Ω O tr ** φ μ- ra H μ- Φ hi CO φ rt OJ 3 hi li CD Hi Ω rt Ω CU Ω rt 3 CO co ra TJ ιQ CD hi μ- Φ Hi ii 3 0) OJ 3 Ω 3 cu O O tr ft) Ω T o CU o CO CO μ- ra O CD
N ff
3 3 3 cx 3 s: ^ φ tr rt Ω O OJ CD OJ I-1 Φ 3 μ- o li 3 CO ra li Hi TJ 0) h-1 ιQ φ ii ra 0) o 3 tr 3 μ- 3 cx li- rt 3 3 o CD o li¬
OJ 3 TJ μ- rt μ- μ- Ω Hi H α 3 Φ Φ Ω tr CU Ω tr tr tr Ω rt 3 cu TJ 3 ra ex hi li¬ 0) 3 * iQ 3 tr Φ cu μ- li¬ CO 3 Φ Ω CO ft) ra ra CD CU μ- (- tr CX
3 ft) H Φ tr Φ rt fO O rt ft) X! o li¬ I-1 O O 3 li¬ 3 eu CO li¬ μ-
H CU o o μ- rt rt H rt T cx ff cπ O μ- μ- 0 ra ft Φ 3 μ- eu Ω ft) μ" 0 en CO 3 li μ- 3 μ- μ- 3 OJ Φ 0 Hi φ O 3 μ- li 'ø 3 TJ 3 tr cx 3 3 tr h-1 TJ XJ
3 o Ω CO o o li X O • 3 rt CO li TJ o Φ rt xi Hi o tr
Xl 3 3 3 hi rt μ- ex rt Xl CO rt f) "• 3 φ ex -> Ω t Φ I-* 3 ra rt Φ H CU Hi o CO tr • I-* XI ra μ- rt Φ rt ff • ff σ o 3 Hi CD rt cx 3 o li¬ H o ra ft) Cu -J Ω tr CO o Φ Φ (- Ω cx φ ti • s: ra 3 cx
3" ι-3 li hi 0) • 3 μ- μ- OJ Φ OJ φ C0 cx rt ra rt *» CD μ- μ- tr 1 h-1 Cπ μ- 3 li μ- 3 ex o tr • 3
CO cu co 0) Φ li μ- 3 rt o H cx 3 1
The fermentation broth prepared in this manner, in particular containing L-methionine, is then further processed. Depending on requirements, all or some of the biomass can be removed from the fermentation broth by separation methods, such as e.g. centrifugation, filtration, decanting or a combination thereof, or it can be left completely in this. This broth is then thickened or concentrated by known methods, such as e.g. with the aid of a rotary evaporator, thin film evaporator, falling film evaporator, by reverse osmosis, or by nanofiltration. This concentrated fermentation broth can then be worked up by methods of freeze drying, spray drying, spray granulation or by other processes to give a preferably free-flowing, finely divided powder.
This free-flowing, finely divided powder can then in turn by converted by suitable compacting or granulating processes into a coarse-grained, readily free-flowing, storable and largely dust-free product. In the granulation or compacting it is advantageous to employ conventional organic or inorganic auxiliary substances or carriers, such as starch, gelatin, cellulose derivatives or similar substances, such as are conventionally used as binders, gelling agents or thickeners in foodstuffs or feedstuffs processing, or further substances, such as, for example, silicas, silicates or stearates.
"Free-flowing" is understood as meaning powders which flow unimpeded out of the vessel with the opening of 5 mm (millimeters) of a series of glass outflow vessels with outflow openings of various sizes (Klein, Seifen, όle, Fette, Wachse 94, 12 (1968)).
As described here, "finely divided" means a powder with a predominant content (> 50 %) with a particle size of 20 to 200 μm diameter. "Coarse-grained" means products with a predominant content (> 50 %) with a particle size of 200 to 2000 μm diameter. In this context, "dust-free" means that the product contains only small contents (< 5 %) with particle sizes of less than 20 μm diameter. The particle size determination can be carried out with methods of laser diffraction spectrometry. The corresponding methods are described in the textbook on "Teilchengrδβenmessung in der Laborpraxis" by R. H. Mϋller and R. Schuhmann, Wissenschaftliche Verlagsgesellschaft Stuttgart (1996) or in the textbook "Introduction to Particle Technology" by M. Rhodes, Verlag Wiley & Sons (1998) .
"Storable" in the context of this invention means a product which can be stored for up to 120 days, preferably up to 52 weeks, particularly preferably 60 months, without a substantial loss (< 5%) of methionine occurring.
Alternatively, however, the product can be absorbed on to an organic or inorganic carrier substance which is known and conventional in feedstuffs processing, such as, for example, silicas, silicates, grits, brans, meals, starches, sugars or others, and/or mixed and stabilized with conventional thickeners or binders. Use examples and processes in this context are described in the literature (Die Mϋhle + Mischfuttertechnik 132 (1995) 49, page 817) .
Finally, the product can be brought into a state in which it is stable to digestion by animal stomachs, in particular the stomach of ruminants, by coating processes ("coating") using film-forming agents, such as, for example, metal carbonates, silicas, silicates, alginates, stearates, starches, gums and cellulose ethers, as described in DE-C-4100920.
If the biomass is separated off during the process, further inorganic solids, for example added during the fermentation, are in general removed. In addition, the animal feedstuffs additive according to the invention comprises at least the predominant proportion of the further substances, in particular organic substances, which are formed or added and are present in solution in the fermentation broth, where these have not been separated off by suitable processes.
In one aspect of the invention, the biomass can be separated off to the extent of up to 70%, preferably up to 80%, preferably up to 90%, preferably up to 95%, and particularly preferably up to 100%. In another aspect of the invention, up to 20% of the biomass, preferably up to 15%, preferably up to 10%, preferably up to 5%, particularly preferably no biomass is separated off.
These organic substances include organic by-products which are optionally produced, in addition to the L-methionine, and optionally discharged by the microorganisms employed in the fermentation. These include L-amino acids chosen from the group consisting of L-lysine, L-valine, L-threonine, L- alanine or L-tryptophan. They include vitamins chosen from the group consisting of vitamin Bl (thiamine) , vitamin B2 (riboflavin) , vitamin B5 (pantothenic acid), vitamin B6 (pyridoxine) , vitamin B12 (cyanocobalamin) , nicotinic acid/nicotinamide and vitamin E (tocopherol) . They include furthermore organic acids which carry one to three carboxyl groups, such as, for example, acetic acid, lactic acid, citric acid, malic acid or fumaric acid. Finally, they also include sugars, such as, for example, trehalose. These compounds are optionally desired if they improve the nutritional value of the product.
These organic substances, including L-methionine and/or D-methionine and/or the racemic mixture D,L-methionine, can also be added, depending on requirements, as a concentrate or pure substance in solid or liquid form during a suitable process step. These organic substances mentioned can be added individually or as mixtures to the resulting or concentrated fermentation broth, or also during the drying or granulation process. It is likewise possible to add an organic substance or a mixture of several organic substances to the fermentation broth and a further organic substance or a further mixture of several organic substances during a later process step, for example granulation.
The product described above is suitable as a feedstuffs additive, i.e. feed additive, for animal nutrition.
The L-methionine content of the animal feedstuffs additive is conventionally 1 wt.% to 80 wt.%, preferably 2 wt.% to 80 wt.%, particularly preferably 4 wt.% to 80 wt.%, and very particularly preferably 8 wt.% to 80 wt.%, based on the dry weight of the animal feedstuffs additive. Contents of 1 wt.% to 60 wt.%, 2 wt.% to 60 wt.%, 4 wt.% to 60 wt.%, 6 wt.% to 60 wt.%, 1 wt.% to 40 wt.%, 2 wt.% to 40 wt.% or 4 wt.% to 40 wt.% are likewise possible. The water content of the feedstuffs additive is conventionally up to 5 wt.%, preferably up to 4 wt.%, and particularly preferably less than 2 wt.%.
The invention accordingly also provides a process for the preparation of an L-methionine-containing animal feedstuffs additive from fermentation broths, which comprises the steps
a) culture and fermentation of an L-methionine-producing microorganism in a fermentation medium;
b) removal of water from the L-methionine-containing fermentation broth (concentration) ;
c) removal of an amount of 0 to 100 wt.% of the biomass formed during the fermentation; and
d) drying of the fermentation broth obtained according to a) and/or b) to obtain the animal feedstuffs additive in the desired powder or granule form. If desired, one or more of the following steps can furthermore be carried out in the process according to the invention:
e) addition of one or more organic substances, including L-methionine and/or D-methionine and/or the racemic mixture D, L-methionine, to the products obtained according to a) , b) and/or c) ;
f) addition of auxiliary substances chosen from the group consisting of silicas, silicates, stearates, grits and bran to the substances obtained according to a) to d) for stabilization and to increase the storability; or
g) conversion of the substances obtained according to a) to e) into a form stable to the animal stomach, in particular rumen, by coating with film-forming agents.
The analysis of L-methionine can be carried out by ion exchange chromatography with subsequent ninhydrin derivation, as described by Spackman et al. (Analytical Chemistry, 30, (1958), 1190).
The process according to the invention is used for the fermentative preparation of amino acids, in particular L- methionine.
The following microorganisms were deposited as a pure culture on 14th June 2001 at the Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ = German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany) in accordance with the Budapest Treaty:
• Escherichia coli DH5αmcr/pCREmetAE as DSM 14352,
• Escherichia coli DH5αmcr/pCREmetAEY as DSM 14353.
The present invention is explained in more detail in the following with the aid of embodiment examples. Example 1
Preparation of a genomic cosmid gene library from Corynebacterium glutamicum ATCC 13032
Chromosomal DNA from Corynebacterium glutamicum ATCC-13032 was isolated as described by Tauch et al. (1995, Plasmid 33:168-179) and partly cleaved with the restriction enzyme Sau3AI (Amersham Pharmacia, Freiburg, Germany, Product Description Sau3AI, Code no. 27-0913-02) . The DNA fragments were dephosphorylated with shrimp alkaline phosphatase (Roche Diagnostics GmbH, Mannheim, Germany, Product Description SAP, Code no. 1758250) . The DNA of the cosmid vector SuperCosl (Wahl et al. (1987) Proceedings of the National Academy of Sciences USA 84:2160-2164), obtained from Stratagene (La Jolla, USA, Product Description SuperCosl Cosmid Vector Kit, Code no. 251301) was cleaved with the restriction enzyme Xbal (Amersham Pharmacia, Freiburg, Germany, Product Description Xbal, Code no. 27- 0948-02) and likewise dephosphorylated with shrimp alkaline phosphatase.
The cosmid DNA was then cleaved with the restriction enzyme BamHI (Amersham Pharmacia, Freiburg, Germany, Product Description BamHI, Code no. 27-0868-04) . The cosmid DNA treated in this manner was mixed with the treated ATCC13032 DNA and the batch was treated with T4 DNA ligase (Amersham Pharmacia, Freiburg, Germany, Product Description T4-DNA- Ligase, Code no.27-0870-04) . The ligation mixture was then packed in phages with the aid of Gigapack II XL Packing Extract (Stratagene, La Jolla, USA, Product Description Gigapack II XL Packing Extract, Code no. 200217) .
For infection of the E. coli strain NM554 (Raleigh et al. 1988, Nucleic Acid Research 16:1563-1575) the cells were taken up in 10 mM MgS04 and mixed with an aliquot of the phage suspension. The infection and titering of the cosmid library were carried out as described by Sambrook et al. μ> ra DO tr t→ ØJ Hi Ω N H H t lO rt CO hO TJ Hi D CO μ- tc rt 3 H td μ- tc --,
H CO μ- μ- ra ØJ CO H H 3" μ- Φ 3 ff μ- μ- tr Φ hi ff H φ 0) 3 μ- ff tr CD X Φ 3 <X) 0) ι->
O CO ra o μ- tr OJ O eu Φ ti <1 φ h-1 eu Φ TJ O o OJ CO 3 CO H ra ra O ft) H Ω cπ H IX)
Ω • • Ω li¬ 3 o cx XI ex li 0) o μ- cx cu CD X! Ω O rt cx h-1 3 Φ 3 cπ σ 00 ra ω rt ra X! li ra 3 3 3 < rt D φ X CO H 3 TJ 3 hi H ra o Ω 0J TJ σ •^ o IX) ra li Ω OJ CD ra Ω CU Φ 00 hi a 3 H μ- ft) Ω ff ra μ- H 3 3 μ- o rt μ* CO CU li "" cx ω O tr μ- ft Ω 3 rt Ω cx 0) o > H N rt rt 0) 3 TJ Ω ** 0) CD μ- φ ro rt < — μ- 1 TJ 3 o H li¬ μ- Ω XJ Φ μ- li- rt rt . — . rt TJ 3 o μ- μ- ->. 3
3 O Ω ti μ- en a ø) • rV Φ o o Q o ϋ CU co μ- μ- Ω ti μ- 3 ro ra O H O
XI — - hi n 3 tr O ^ μ- Xl 3 Hi φ φ hi 3 ra CO o 3 O Φ ro cx Ω 3 O rt h-1
CO cu li tr ra μ- * rt ti ti H OJ CO ra X 3 ra 3 ti TJ ft) li¬ h-1 tr Φ μ- li¬ ra cu s ex 3 "3 tr 0 ,-, rt 3 3 tr Ω Φ hi CO 3 D 3 ra O 0 ra Ω
0 3 ra μ- rt OJ ro hi 3 Ω tr ft) t ιQ < li .—, hi CO CD ø) CO 2 α cx <l XI 3
Hi rt cx cr CD 3 tr rt Φ rt 3 H φ 3 X Φ μ- to ra ØJ tr OJ 3 TJ > • Φ Ω H o 3 cx 3 < tr 1 μ- tr CX O rt ιQ T3 o 3 0) 3 - μ- CO H ^ Φ ft) rt ^~. H 0) ra o tr ra 3 CO li O φ rt Ω α CO 3 cx •— - 3 o Φ 3 h-1 hi tr rt 1-3 X! o μ- CO 00 3 n μ- φ • OJ Hi μ- tr ra > Hi l μ- μ1 H-* φ tr OJ ""» <! ** 0J CO en hi H H 3 JQ Ω O ra TJ H X) TJ μ- 2 3 X! CO Ω
Φ 3 ra H ra 00 X! ra o X! 3 rt μ- φ 3 tr ^ tr OJ 3 μ- ft) Φ 3" μ» μj a Ω Ω li o O" l 1 ^ CO 3 Φ Φ μ- Cπ μ-1 α o ØJ H 3 3 3 rt tr o
0) is tr ra 3 o ii 3 o rt μ- 3 3 O O Φ CO μ- CO ti rt eu μ- Ω o Φ 3 rt . li μ- M o ra Ω ti 3 «* Ω 3 o Ω > ft> TJ H 3 H Ω TJ μ- μ- ftJ *^— - μ- μ- μ- ra 3 X! cx o 3 - — Φ μ- XI μ- rt X! tr O cu Ω li 3 3 rt 3 3 o Ω li- ø) tr rV Ω . H Ω 3 3 pi rt ti *» 3 o O. Ω o ra CX X! s: XI X!
3 O 3 rt O μ- 3 rt Pi tr Xl μ- O O o H 3 μ- Ω li T μ- CO μ-
0) μ- CU T ra 3 H CU μ- μ- Φ rt TJ T. CD *-< Ω øj ex <1 O -J rt TJ μ- μ- s: H rt l tr 3 o rt <i t tr H rt μ- rt ra ft) Pi μ- Hi ff μ>
. μ- μ- Φ -< 3 a φ ^ — , o o O μ- cu cu 3 μ- cx Ω 0J
> ω rt 3 0) < Φ Ω •X) o li α Ω lia f <1 Ω rt 3 rt μ- rt
Ω rt 1-3 tr iQ H ro μ- Φ ffj rt rt ti O Φ 3 CO ra o li ra φ cu tr o Φ 0J
0) ti IX) 3* • Ω μ- O 3 hi tr O O CD Ω cx • CD ex . — . μ- ra H o cx tr cx CU IX) μ- ι-3 tc rt X! li N o Φ H tr μ- rt Ω μ- X •X) Φ o ra μ- it-. CD d-. 0J ,—* o ØJ o ^ cx hi 3 TJ ω 3 X ro tr X μ- ti Ω 3 Ω 3 o H
3 3 •* H μ» li rt ex 3 3 TJ Ω -« a tr μ- -J 3 μ- <-t O o Φ O X. 3 0)
H -1 tr <X) μ- 3 φ Ω eu N rt X o tc rt 1 li rt tr O. H fi- ^^ rt rt
O •^ μ- μ- o 00 TJ o Ω ft 3 Φ Φ rt • •^ tr o J tr 3 O t rj1 μ*" O o tc Cd } X) hi IX) N 3 rt 00 cx H a li tr IX) ^ rt Ω 3 μ- O H
Hi Cπ S OJ eυ *. ra OJ a CD O O Φ ra I-1 S CO μ-> rt tr rt •<! ιQ 3 OJ 3 •
P w rt CD "* ti o α 3 0 1 • -J OJ tr ω Ω tr ra φ 0J 3
CO 3 μ- ra S o Hi ra tc • μ-> μ- Ω π 3 hi 1 ra ra a ■S 3 3 TJ t"1 2
Ω Ω S o rt o 1 CD H •X) ^ Ni co o CX) 3 μ- o H 3 o ØJ Φ rt μ- DO ft) μ- H μ- 3 ^ tr μ» rt Ω pi li O o CO ro 3* 3 ro 3 H ft) • CD Ω 3 ra Ω X) ro CD tr hi . — ^ to o o O H 3 cπ ra TJ — OJ ra 3 μ- μ- OJ 3
3 ,— H 3 3* Ω X Φ μ- t? cπ cx σ K) OJ μ- o μ- • 3 CO 3 ro μ- 3 H J ft)
Ω Ω O μ- ø) σ 3 OJ TJ 3 o 3 liμ- ft — 3 ø) rt Hi cn & ft) h-1 ra hi tr X H a μ-1 CD Ω rt Φ o Ω eu φ • t-1 HI H 0) H-1 O μ- μ- hi •»
CO 0J μ- rt 3 > OJ o μ- H 1 ft μ- x Hi f tr μ- Ω o H < 3
3 O 3 0) H o CD o CO o 3 H > Ω eu Φ >χ) Ω rt en ft) μ- . — . Ω σ rt I-* li Ω 3 OJ 3 3 ff h-1 α Φ μ- X cu Hi ra li rt 3 ^ licx tr- O
• -• Φ μ- μ- H μ- eu — ra cx ø) μ- Ώ lili μ- σ O μ- H ra 0 > φ μ-*
00 t→ 0J X I-1 ti cx DO
• 3 CD X! rt 3 ra 3 3 a o CD cx ft) Hi 3 ex μ> ra X rt o μ- OJ X Ω Hi Φ tr ra li £U φ :&- 3 3 hi μ- 1-" rt 3
> vx> rt cu 3 3 ra 3 OJ ti ii 3 3 3 Ω 0) s: ra O co
IX) rt CD li μ- ex tc CD μ- o rt rt rt ra CD J μ- Ω H X T o ra ra 3 TJ 3 tr CO 3 ra rt μ- li
H rt X! o rt Φ N 3 tr 0 μ-
CO tr 3 μ- μ- ^
* 3 3 ra rt O 3 φ XI
3 > 3 ra CO
HI Hi j to s: ι-3 T μ» rt m Ω CO > a ft 3 GO ex cu -J *υ cx tc Ω 3 < 00 tr hi 3 tr Φ μ- tr N a-. tr tr Φ Φ h-1 * tr CD μ- to H ►t-. H μ- μ- OJ tr μ- -J
Φ ft) 0) Φ CO rt Φ ra • • φ Φ H XI t Φ Φ o tr . .. O cx H ra H • •
3 μ- φ ff ti to 3 3 ■i--. cx CO o Cπ Ω ro cx H o ■J-.
3 CD hi ØJ Ω o μ- CO li ø) Φ • Ω CO • cx ^^ -> Φ o ro μ- TJ μj en
Φ CD Φ hi rt 0 μ> -j li¬ OJ 3 3 μ> H Φ CD OJ μ> en Φ X 3 ra μ- o Oi. rt O μ- CO Ω tr 3 1 ft) X -< Ω Λ ι-3 li¬ 3 1X5 ω ex cu ιQ H td Hi CO 3 tr φ TJ cx ro cx >— Φ H 3 ff ra μ- IX) 1 μ- CD < 1 μ- 3 ra co φ CO H PJ ft) Φ ro 3 3 o cπ 3 Ω Ω O 3 •fc. J ro o rt X rt li μ» 3 φ o 3 3 CO ^ j-. XI tr ro 3 μ- en φ to Hi μ- μ- 2 Φ μ- J Hi rt μ- Ω CO Hi en CD ØJ li rt cx j-.
3 ω 3 ^ H li <! TJ 3 H tr ex μ- ro . — . Φ a -j μ- 3 IX) φ cπ rt X! • • •X) 1 0) <! li Φ O ra 3 TJ •X) hi 3 "— - O 3 eu s: TJ μ- — tr to eu rt Φ o 3 3 \ ιQ eu hi 3 Ω Hi 3 μ- hi IX)
Ω tr ra 3 μ- TJ CO μ- ii X! Ω DO hi o μ- H s: rt rt ra o 0)
O 0J 3 -j ti CO <! CD H Φ •X) OJ μ- ti cu cx 3 CD μ- rt ro — tr TJ — 3 cx CO 3 Ω 1 O μ- ra μ- ft) td hi co Φ rt 3 0J μ- rt tr hi • 0J CX
Φ ra 3 I—* to XI CD CO o 3 cx μ- ø) 0) μ- Ω rt Ω tr Φ 3 00 hi X
CO Ω CD O hi rt 3 CU CD Ω Ω o rt O μ- m μ- eu μ- TJ
TJ μ-* O μ- CU φ X TJ li- TJ ii H rt 3 H 3 a 3 3* o rt rt l-1
Hi 0J φ rt — 3 cx φ <X) ft) CU TJ 3 < μ- a Ω o cu ft) Φ ti μ- tr ft) o μ- o μ- • H -j Ω I-1 tr μ- O tr o O μ- ex rt rt o o li¬
H H rt cx Ω Φ 1 r O μ- Φ cυ 3 . μ- μ- μ- CO σ 3 cπ ra
CO μ- ra CO O o eu tr φ 3 Ω CO Hi o o Φ o o cx
ØJ cx li- ex OJ • J rt cx μ- X IX! •J μ- μ- 3 3 JQ rt o φ CO CU μ- CO Φ ø) Ω CX Φ ro o Φ to Ω 0) 3 Hi 3 o
TJ ■ Φ cx 3 CO ι-3 μ- DO Φ ra hi O ra eu 3 Φ IX) xi 3
H " CD X! φ X! φ ff _. — , 3 μ- hi 3 Φ o co CO rt CD 3 en rt \ rt o μ- φ 3 3 3 φ μ- φ o 3 ro J-- Φ ra μ- > rt Ω o tr liΩ X! Φ .*' H o* <X) CX D 0) Ω Ω μ- J-» XJ 0) o Ω tr μ- o ra O ra tr 3 3 φ H μ- 00 < 3 CD OJ φ ^ 3 H 3 ØJ o 3 N 3
H- Φ Ω μ> iQ Φ 3 en X CD s H li Ω φ Ω CO cx XI ti ra
3 X 3 Φ IX) μ- α cx "* φ rt H rt s 3 tr ra l ra o tr1 ft) Ω 00 0 μ- H Φ ,-, μ- ti φ Ω OJ 3 O X ii Ω Ω DO o CO Φ μ- en 3 rt a Φ 3 s: to ra o μ- μ- Ω Hi eu O o μ-
Hi CD -» O μ- 3 ω μ- IX) cx TJ li¬ 3 Ω CD 3 OJ
Ω CO eu cx Ω rt rt • • tr ra XI 00 O o co 3 -* . X!
-J cu t CD a 3 OJ 3 tr ^-^ 31 μ-* O o li .. H Hi øj Ω Ω μ- 0)
Ji. μ* o tr 3 0) 0) Φ φ S! — 3 H CO Pi μ» cx 3 ØJ rt 3 li cπ M X o Ω h-* Ω t-> μ- 3 φ rt rt Φ liμ- o μ- CO X! H ØJ
Φ Φ X μ- O Ω μ- ff _. — . CO eu rt en 3 Ω ro H a 3 .
OJ ex cx 3 Φ ω 3 CO TJ rt Φ X) μ- μ- cx 3 -0 X! μ- ti μ- o rt tr"
3 μ- μ- rt φ > ti Φ H 3 CD rt -— ra ra CD μ- rt OJ μ- Ω Cfl μ- Λ a o H 3 o Hi • rt 3 ro cx Ω 3
3 tr 3 3 3 3 μ- Ω CD CX 0) cu H O Ω li¬ V£> μ< 3 o Φ X 3 Φ cx Φ li¬ 00 3 3 Ω o •-3 ra o o o O o CO Ω 0) O 3 CO CD ft) H Ω 3 ex Φ 3 tr N CD eu 3 o 3 X ft) 3 TJ td μ- CO 3 Ω ω CX rt to H ra μ- μ- rt ro Φ *
Ω φ φ to cx CO Φ to φ rt X) o CU H li- 3 no
3 CO TJ Co α • o CD μ- Φ cx li a rt 3 0) M 3 ^ tr o I-- cx Cd μ. H Ω CO μ- O μ- eu 3 to Φ CO -~. *. S IX)
CD H α Φ O o φ 3 co . Ό μ- ?o H • μ> eu cπ
• XJ Φ TJ 3 Hi ft) CO 3 tr TJ 3 > <X) rt D CO Cπ φ ft) a eu rt H μ- o ω TJ ø) -j tr μ-
3 cx o ti μ- rt Ω 3 CA) li μ- s: μ- 3 ** -j φ 0J ra μ- • Φ ιQ tr tr Xl -J ra co 0J μ- 3 X!
3 cx φ -J CO CO ra ra J μ> μ- o cx Φ 3 co Hi rt
Example 3
Preparation of the strains C. glutamicum ATCC13032/pCREmetA and ATCC13032/pCREmetAE
3.1 Amplification of the genes metA and metE
From the strain ATCC13032, chromosomal DNA was isolated by the method of Eikmanns et al. (Microbiology 140: 1817 -1828 (1994) ) . Starting from the nucleotide sequences of the methionine biosynthesis genes metA (gene library Accession Number AF052652) and metE (SEQ ID No. 1) of C. glutamicum ATCC13032, the following oligonucleotides were chosen for the polymerase chain reaction (PCR) (see SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 6):
metA-EVP5 :
5'- AGAACGAATTCAAAGGAGGACAACCATGCCCACCCTCGCGC -3'
metA-EVP3 :
5'- GTCGTGGATCCCCTATTAGATGTAGAACTCG -3'
metE-EVP5 :
5 ' -GGCTCAAAGATCTAAAGGAGGACAACCATGACTTCCAACTTTTCTTC -3 '
metE-EVP3:
5'- GGTTCCTGTCGACGGTACCATTTAGATAGTTGCTCCGATT -3'
The primers shown were synthesized by MWG-Biotech AG (Ebersberg, Germany) and the PCR reaction was carried out by the standard PCR method of Innis et al. (PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) with Pwo-Polymerase from Roche Diagnostics GmbH (Mannheim, Germany) . With the aid of the polymerase chain reaction, the primers allow amplification of a DNA fragment 1161 bp in size, which carries the metA gene, and a DNA fragment 2286 bp in size, which carries the metE gene.
Furthermore, the primer metA-EVP5 contains the sequence for the cleavage site of the restriction endonuclease EcoRI, the primer metA-EVP3 the cleavage site of the restriction endonuclease BamHI, the primer metE-EVP5 the cleavage site of the restriction endonuclease Bglll and the primer metE- EVP3 the cleavage site of the restriction endonuclease Sail, which are marked by underlining in the nucleotide sequence shown above.
The metA fragment 1161 bp in size was cleaved with the restriction endonucleases EcoRI and BamHI, and the metE fragment 2286 bp in size was cleaved with the restriction . endonucleases Bglll and Sail. The two batches were separated by gel electrophoresis and the fragments metA (approx. 1150 bp) and metE (approx. 2270 bp) were then isolated from the agarose gel with the QiaExII Gel Extraction Kit (Product No. 20021, Qiagen, Hilden, Germany) .
3.2 Cloning of metA in the vector pZ8-l
The E. coli - C. glutamicum shuttle expression vector pZ8-l (EP 0 375 889) was used as the base vector for the expression.
DNA of the plasmid pZ8-l was cleaved completely with the restriction enzymes EcoRI and BamHI and then dephosphorylated with shrimp alkaline phosphatase (Roche Diagnostics GmbH, Mannheim, Germany, Product Description SAP, Product No. 1758250) .
The metA fragment approx. 1150 bp in size isolated from the agarose gel in example 3.1 and cleaved with the restriction endonucleases BamHI and EcoRI was mixed with the vector pZ8-l prepared in this way and the batch was treated with T4 DNA ligase (Amersham Pharmacia, Freiburg, Germany, Product Description T4-DNA-Ligase, Code no.27-0870-04) .
The ligation batch was transformed in the E. coli strain DH5αmcr (Hanahan, In: DNA cloning. A Practical Approach. Vol. I. IRL-Press, Oxford, Washington DC, USA). Selection li μ- tc !θ xi OJ μ> rt o < D H IT" •XJ ι-3 X Ω φ 1-3 o . , rt Ω 3 CO ii μ- tc !θ ) ) 0) μ> rt o
Φ 3 μ- μ- μ- rt • • ti Hi o t * μ- 3" tr ft) μ-1 X tr φ Pi ff O tr . Φ 3 μ- μ- h-1 rt • • H Hi
CO CD μ- 0) ØJ μ> ft) h-* cπ Φ X! OJ Φ CO φ OJ φ CO O Φ 3 Φ O CO ω μ- øJ 0J μ1 0)
3 rt cx TJ CD ω IX) 3 TJ • P 0) hi ft) 3 Ω Ω 3 TJ 3 rt X TJ CO CO IX) 3 J μ- l ro H 3 o CO I-* 3 h-1 CO 3 tr 3 <! TJ 3 hi ff h-1 TJ (- H ro li 3 -J o CD μ-1 rt 3 3 Φ μ- o - — Hi ft) hH Ω μ- ro 0J cu μ- φ t-1 ro μ- Φ Φ μ-1 rt 3 3 Φ μ- o — Hi eu μ- Ω TJ cx Ω o CO • hi |Q Ω rt X α φ rt TJ Φ rt cu Ω μ- Ω T α Ω O CD
3 rt s; ii 3 0J μ- Ω φ td rt D TJ Φ CO I-* 3 rt ** • li 3 ιQ μ- Ω co D μ- 3 μ- H ,—. rt Ω ø) tr X ω μ- μ- tr H 3 o ιQ μ- Ω CO σ μ- 3 μ-
O Φ Ό a li rt ft) cx t tc μ- O ^ μ- . Hi o eu o - μ- 3 o Φ TJ 2 hi rt cu cx
TJ 3 H μ- Φ 3* rt 1 tr1 CU o cx X • rt μ» ti 3 XI CO μ- TJ 3 ti μ- Φ - rt 1 μ- CD 3 3 Ω μ- Ω 1 3 3 Φ •n CU μ- tr ft) 3 TJ X 3 l-1 CD 3 3 Ω μ- Ω ø) £U X O Cπ o CU Xl OJ H CD rt σ X! ω o tr μ- TJ X! 0) eu X O Cπ o Cυ ω ftJ 3 2 ØJ O 3 ti ii tr tr 3 Φ tr rt 3 CO o rt Ω CO OJ 3 2 eu 3 O 3 H
3 3 μ- CO hi φ cu ft) O μ- rt tr ro xi rt li tr Pi O 3 3 μ- 3 tr CO 3 rt σ H rt φ 3 3 μ- 2. μ- CD Q H μ- cx 3 • Cd Hi μ- CX 3 μ- 3 tr cx μ- μ- 3 X! cu μ- CO ^ Ω to 3 Φ tr φ li¬ Ω rt 3 μ- μ- 3 J ft) μ-
Ω μ- TJ CO ft) \ rt 3 ^ ff H cυ Φ H CU •Xl CO 0) tr φ 3 Ω μ- TJ C0 0) \ rt 3
X tr 3 ti o 3 h-1 Ω ιQ H 1 X! rt φ 3 ft) ti rr Φ rt CD X tr 3 H o 3 Ω X!
0) Φ φ μ- rt tr O 3 X o Φ < CD CO TJ o Ω Φ rt OJ φ φ M rt 3*
CO Ω 0) TJ eυ r Ω X • • ft) 00 cx Φ rt TJ ex ii td CO Ω OJ TJ 0) rV Ω r-r Ω rt μ- 0) 0 Φ Hi CO -J Ω Ω ti o li 3 Q1 φ rV Ω rt μ- ft) o Φ
Ω φ Ω pi φ 3 3 3 μ- o α o φ X ft μ- Hi 0 Ω tc X CD Φ μ- Ω φ Ω Φ 3 3 3 ft) cx 0 μ- ex X OJ H H a rt 1 li μ- o Ω X ft » μ- rt CO 3 ø) cx O μ- α Q. ft) I-1
H rt μ- 3 tr1 CO cx li o 3 rt li ft rt • rt H Ω I—* H rt μ- 3 IT- CD
M tr cx Hi <1 - GO ^ OJ α-> 0) 3* μ- ff a 2 tr μ- li rt tr CX Hi <! DO φ 01 . — . li μ- Ω s: Ω 3 3 TJ o Φ to o ft) Ω μ- tr φ OJ . » hi μ- Ω X cx 3 <τ) o cx μ- ft) 0J S! CO • • H Ω 3 t . 3 CO rt σ ro 3 o o cx μ- eu ft) h Ω ti 3 3 3 X! ω OJ O Hi ^ ■*-. to TJ 3 tr μ- Φ li Ω hi 3 3 3 XJ CO
TJ Φ Φ O ft) • ft) CO 3 O td Φ O o μ- tr H O cx <1 TJ φ Φ o ø) OJ
Ω CO ft) μ-* H 3 tr μ- H l D 3 3 μ- φ μ- 3 ro Ω CD Ω- 0) " li 3 J rt X 3 eu μ- 3 3 H a φ P- ^ tr cπ μ- 3 μ- Ω to rt X 3 ft) td H μ- Ω ti¬ Ω . — . cx 3 X! φ O rt o 3 TJ 00 3 TJ φ 3 ft td H μ- Ω rt Ω ,— , cx
3 μ- rt rt ll I-1 Hi tr1 φ iQ . cx > 3 Φ ro 3 o 3 μ- rt rt li μ- Hi tr* Φ
Φ Ω tr cυ O rt Φ rt 3 h-1 3 H μ- cπ 0) N Φ H φ Ω tr ø) o li¬ ra rt rt 2 3 3 Φ 3 tr o > μ- Ω μ- TJ Ω cυ 3 o Ω l-1 ι<j X rt rt 2 3 3 ra 3 tr μ- rt O CO Φ ti 3 3 3 rt XJ H CO - — Φ rV !=j CU TJ > μ- rt O CO Φ H 3 t?d O tr Hi CO O X) ØJ Φ Φ Φ CD • ti ft) Φ 3 Ω o tr • Hi CD o
3 ro o μ- X TJ D ii rt D CO TJ ØJ μ- 3 H CD TJ t 3 Φ o μ- X TJ to X 3 ** H Ω 0) tr Φ ro OJ CO Ω N ft) μ- H Cd t ti X 3 •* h-1
H Ω 3 3 Φ Ω 0) Ω ro CD H Φ tr CD 3 3 00 Φ 3 Ω 3 -J 3 Φ Ω eυ rt μ- eu μ> ft) hi 3 I-1 rt rt Ω . . Φ CO cu Φ 0) φ OJ I-1 OJ H 3 > rt ro 3 o 3 Φ tr IX) μ- α μ- td hi X μ- o 3 ω rt ro 3 o 3 Φ tr IX) μ- μ- OJ 3 en rt 0) cπ 3 CO Ω • μ- 3 DO 3 tr TJ tc • 0) 3 en rt OJ cπ 3
CD <J Hi CD rt cπ XI ft) TJ ro μ- J rt n tr H to <! Hi CO ft cπ X3 ft) ø) X Φ μ- I-- Ω rt ii 3 H H 0) t 0 0J OJ X Φ μ- *<« ω X) Ω lO μ- I-* 0 o • O μ- CO H Φ μ- o CO ft) X X! Ω lO μ- μ-* o o tr ro rt μ- rt Φ 3 3 > μ- o tr rt H OJ 3 cx TJ 3 0) ro rt μ- rt ra 3 < 3 o • 3 cυ tr Ω μ- rt CO TJ μ- 3 cυ ff Ω ro 3 tr CX CD • 3 ø) tr Ω μ- rt
■£ H J rh O li φ T 3 μ- 0J ft cx Ω OJ ii J li¬ o ti
3 Hi Φ Φ rt Φ <! o rt I-* li co H CD 3 μ- rt li¬ CO Ω HI Φ Φ rt ra 3 o rt tr H 3 tr CX Φ ff φ
** O rt CX o μ- ft) ØJ μ- ff ti 3 ff ex ra h-1 tr μ- ro — φ • hi o Φ Ω ft) H I s: 3 3 CD t-1 ro φ ^ φ H o ro
3 CO 3 X! rt Ω OJ OJ CO φ H 0J CO 3 J μ- μ- tr μ- 0J ft) <! μ- X! 0 3 h-1 3 ØJ ro X! tr 3 1 H cx 3 cx tr rt rt
figure 1. The strain E. coli DH5αmcr/pCREmetAE was deposited as a pure culture on 14th June 2001 at the Deutsche Sammlung fϋr Mikroorganismen und Zellkulturen (DSMZ = German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany) in accordance with the Budapest Treaty as DSM 14352.
3.4 Preparation of the strains C. glutamicum
ATCC23032/pCREmetA and ATCC13032/pCREmetAE
The vectors pCREmetA and pCREmetAE obtained in example 3.2 and 3.3 were electroporated in the strain C. glutamicum ATCC13032 using the electroporation method described by Liebl et al. (FEMS Microbiology Letters, 53:299-303 (1989) ) . Selection of the plasmid-carrying cells took place on LBHIS agar comprising 18.5 g/1 brain-heart infusion broth, 0.5 M sorbitol, 5 g/1 Bacto-tryptone, 2.5 g/1 Bacto- yeast extract, 5 g/1 NaCl and 18 g/1 Bacto-agar, which had been supplemented with 25 mg/1 kana ycin. Incubation was carried out for 2 days at 33°C.
Plasmid DNA was isolated from in each case one transformant by conventional methods (Peters-Wendisch et al., 1998, Microbiology 144, 915-927) and checked by restriction cleavage. The resulting strains were called ATCC13032/pCREmetA and ATCC13032/ρCREmetAE.
Example 4
Preparation of L-methionine. with the strain C. glutamicum ATCC13032/pCREmetAE
The C. glutamicum strains ATCCl3032/pCREmetA and ATCC13032/pCREmetAE obtained in example 3 were cultured in a nutrient medium suitable for the production of methionine and the methionine content in the culture supernatant was determined. For this, the strains were first incubated on an agar plate with the corresponding antibiotic (brain-heart agar with kanamycin (50 mg/1) ) for '24 hours at 33°C. Starting from this agar plate culture, in each case a preculture was seeded (10 ml medium in a 100 ml conical flask) . The complete medium Cglll was used as the medium for the precultures.
Medium Cg III
NaCl 2.5 g/1
Bacto-Peptone 10 g/1
Bacto-Yeast extract 10 g/1
Glucose (autoclaved separately) 2% (w/v)
The pH was brought to pH 7.4
Kanamycin (25 mg/1) was added to this. The preculture was incubated for 16 hours at 33°C at 240 rpm on a shaking machine. In each case a main culture was seeded from these precultures such that the initial OD (660 nm) of the main cultures was 0.1. Medium MM was used for the main cultures.
Medium MM
CSL (corn steep liquor) 5 g/1
MOPS (morpholinopropanesulfonic acid) 20 g/1
Glucose (autoclaved separately) 50 g/1
(NH4)2S04 25 g/1
KH2P04 0.1 g/1
MgS04 * 7 H20 1.0 g/1
CaCl2 * 2 H20 10 mg/1
FeS04 * 7 H20 10 mg/1
MnS04 * H20 5.0mg/l
Biotin (sterile-filtered) 0.3 mg/1
Thiamine * HC1 (sterile-filtered) 0.2 mg/1
CaC03 25 g/1
The CSL, MOPS and the salt solution were brought to pH 7 with aqueous ammonia and autoclaved. The sterile substrate and vitamin solutions were then added, as well as the CaC03 autoclaved in the dry state.
Culturing is carried out in a 10 ml volume in 100 ml conical flasks with baffles. Kanamycin (25 mg/1) was added. Culturing was carried out at 33°C and 80% atmospheric humidity.
After 72 hours, the OD was determined at a measurement wavelength of 660 nm with a Biomek 1000 (Beckmann Instruments GmbH, Munich) . The amount of methionine formed was determined with an amino acid analyzer from Eppendorf- BioTronik (Hamburg, Germany) by ion exchange chromatography and post-column derivation with ninhydrin detection.
The result of the experiment is shown in Table 1.
Table 1
Example 5
Preparation of the strain C. glutamicum ATCC13032/pCREmetAEY
5.1 Amplification of the metY gene
From the strain ATCC13032, chromosomal DNA was isolated by the method of Eikmanns et al. (Microbiology 140: 1817 -1828 (1994)). Starting from the nucleotide sequence of the methionine biosynthesis gene metY (DE: 10043334.0) of C. glutamicum ATCC13032, the following oligonucleotides were chosen for the polymerase chain reaction (PCR) (see SEQ ID No. 7 and SEQ ID No. 8) :
metY-EVP5 :
5 ' - CTAATAAGTCGACAAAGGAGGACAACCATGCC7ΛAAGTACGAC -3 '
metY-EVP3 :
5 ' - GAGTCTAATGCATGCTAGATTGCAGCAAAGCCG -3 '
The primers shown were synthesized by MWG-Biotech AG (Ebersberg, Germany) and the PCR reaction was carried out by the standard PCR method of Innis et al . ( PCR Protocols , A Guide to Methods and Applications, 1990, Academic Press) with Pwo-Polymerase from Roche Diagnostics GmbH (Mannheim, Germany) . With the aid of the polymerase chain reaction, the primers allow amplification of a DNA fragment 1341 bp in size, which carries the metY gene.
Furthermore, the primer metY-EVP5 contains the sequence for the cleavage site of the restriction endonuclease Sail and the primer metY-EVP3 the cleavage site of the restriction endonuclease Nsil, which are marked by underlining in the nucleotide sequence shown above.
The metY fragment 1341 bp in size was cleaved with the restriction endonucleases Sail and Nsil. The batch was separated by gel electrophoresis and the fragment metY (approx. 1330 bp) was then isolated from the agarose gel with the QiaExII Gel Extraction Kit (Product No. 20021, Qiagen, Hilden, Germany) .
5.2 Cloning of metA and metY in the vector pZ8-l
The plasmid pCREmetA described in example 3.2 was cleaved completely with the restriction enzymes Sail and Pstl and then dephosphorylated with shrimp alkaline phosphatase (Roche Diagnostics GmbH, Mannheim, Germany, Product Description SAP, Product No. 1758250) .
The metY fragment approx. 1330 bp in size isolated from the agarose gel in example 5.1 and cleaved with the restriction endonucleases Sail and Nsil was mixed with the vector pCREmetA prepared in this way and the batch was treated with T4 DNA ligase (Amersham Pharmacia, Freiburg, Germany, Product Description T4-DNA-Ligase, Code no.27-0870-04) .
The ligation batch was transformed in the E. coli strain DH5αmcr (Hanahan, In: DNA cloning. A Practical Approach. Vol. I. IRL-Press, Oxford, Washington DC, USA). Selection of plasmid-carrying cells was made by plating out the transformation batch on LB agar (Lennox, 1955, Virology, cx Hi li μ- tc •x. ø) μ> rt o < σ H tr- no ι-3 ≤ Ω Φ Hi σ ,— » rt Ω h3 Cπ H μ- t no 0J μ- φ μ- Φ 3 μ- μ- H" rt • • i Hi o t tr μ- tr tr ØJ H X tr Φ to tr o tr • Φ 3 μ- μ- μ- rt
TJ X! CO co DJ 0) μ> ft) H cπ ra ιQ cυ Φ CO Φ CU ra CO o φ 3 ro CO CO CO μ- eυ cu μ* o 3 3 rt cx TJ CO ω IX) 3 TJ . P 0) hi CU 3 Ω Ω 3 TJ 3 rt CX TJ CO O IX)
CO li ti ra H 3 o CO 3 H ω 3 tr 3 < TJ 3 li tr μ> TJ I--* H Φ H 3 o μ- ro rt 3 3 ra μ- o — -• Hi OJ M Ω μ- Φ OJ eu μ- Φ h-- ra μ- Φ α ro μ- rt 3 3 Φ μ- -— * rt μ- Ω TJ CX Ω o CO . hi X! Ω rt X ex φ li- J Φ liø) Ω μ- Ω TJ x Ω φ to 3 rt ^ s: ti 3 OJ μ- Ω Φ Cd t-t σ TJ ra CO μ- 3 rt X cx X! μ- Ω CO o μ- 3 μ- H .-^ rt Ω cu tr CX Ξ O H- μ- tr H 3 0 XJ μ- Ω co D μ-
O ra TJ 2 li rt ft) cx po tc μ- O ^ μ- • Hi O eu o <: μ- 3 o Φ T 2 H rt
0) ι-3 TJ 3 li μ- Φ tr rt 1 tr- 0) O Ω- X X rt h-1 hi 3 ιQ CD cx μ- TJ 3 H μ- > Φ tr
CO ff h-* CO 3 3 Ω μ- Ω 1 3 3 Φ * cυ μ- tr 0) 3 TJ s: 3 μ- CO 3 3 Ω ro 0J cu S 0 cπ o cυ ø) li CO rt tr l CO o tr μ- TJ X! ft) CU X O Cπ cu CD cυ 3 2 ø) 3 o 3 ti H tr σ 3 φ tr rt 3 > CO o rt Ω CO 0) 3 2 OJ o
CO 3 3 s μ- CO ø- hi ra cu OJ O μ- ti¬ ff φ no rt li tr to o 3 3 -< μ- CO o*
TJ rt μ- CX 3 μ- 3 σ CD 3 rt « tr ll rt φ 3 3 μ- -< td Hi μ- CX — - 3 μ- 3
3 li cx μ- μ- 3 X! eu μ- CD > Ω I 3 Φ tr ro li- Ω μ- rt 3 cx μ- μ- 3 X!
H eu Ω μ- TJ CD cυ \ rt 3 -» tr -J u ft) Φ li ft) >χj CO eu tr ra 3 Ω μ- TJ co ø) \
Φ μ- X tr 3 hi o 3 H Ω XI H 1 X! li¬ Φ 3 CU hi ti¬ ra rt φ X tr 3 hi o 3 l-1
3 ø) Φ ra rt tr o 3 X o ra < CO O TJ O Ω ro > li- ft) Φ Φ H rt
Ω co Ω ØJ TJ ØJ r Ω X ft) 00 cx Φ H TJ x 3 CX hi K Cd CO Ω OJ TJ 0J f-r
3 td rV Ω rt μ- OJ 0 ra Hi CO -J Ω 0 μ- O H 3 O" ro r-T Ω liμ- ft)
H • Ω ra Ω « φ 3 3 3 H 0 D o Φ X rt Ω Hi O Ω tc s: CO cx μ- Ω ra Ω Pi ra 3 3 rt ft) cx o μ- α x ft) H H a rt 1 H μ- 0 rt X rt μ- rt CD 3 0) ex o μ- cx cx cu
3 Ω μ-* H rt μ- 3 tr* CO H o 3 rt H μ- rt • rt H CO μ- H rt μ- 3
H O H σ ex Hi <! CO 0J Ji. ft) ff o ff 2 2 tr μ- Ω rt μ- tr Hi <J
Φ μ-* Φ 0) . — . hi μ- Ω s: Ω 3 — 3 TJ 3 Φ to O OJ Ω hi tr φ •< 0) . — . li μ- Ω μ- cx 3 >x) O cx μ- ft) eu s: μ* CO . < h Ω ro • 3 CD ft μ- φ α 3 no o cx μ-
O H Ω li 3 3 3 X! CD cu o Hi to φ TJ 3 tr μ- tr H Ω hi 3 3 3
3 D TJ ra Φ o 0) • OJ CO 3 O Cd 3 O o μ-> ff H o ra < TJ ra Φ o ft) tc Ω CO cx OJ μ- H 3 tr μ- hi no α 3 (X H -o Φ μ- 3 ex φ Ω CD cx ØJ μ- μ- cπ 50 rt X 3 ØJ μ- 3 3 hi 2 φ O d ^ tr cπ μ- 3 Ω t rt X 3 d--. S C H μ- Ω rt Ω > ^-^ cx 3 XI ra O rt 3 3 TJ CD 3 TJ ro μ- rt d H μ- Ω ft Ω Hi rt 3 3 μ- rt ft H h-* Hi tr1 ra J cx cx 3 ro to 3 3 O 3 μ- rt rt ti μ-* li¬ tr Ω φ Ω tr OJ o li¬ ra rt 3 « Ω H μ- cπ ØJ N H Φ Ω tr ft) o ra ti rt ft a 3 3 ra 3 tr O μ- Ω μ- (- CU 3 o Ω H t<J φ rt rt a 3 3 H -l μ- rt o CO Φ ti 3 • 3 3 rt J TJ Φ co — Φ ?r 3 X TJ > μ- rt O CO Φ
3 TJ Cd o ff • Hi CD O no eu ti ft) ra CO H øj CD cu Ω K. o tr • Hi CO μ-
3 Ω 3 Φ O μ- X TJ D hi rt σ CO Φ CO μ- 3 H CD 3 to • 3 Φ 0 3 ro o • t H X 3 H Ω ØJ tr Φ ra TJ Φ Ω N eu μ- TJ Cd to hi X Ω
Cd Ω 3 -J 3 φ Ω cu Ω ra CD ft) CO tr Φ 3 3 00 I—* 3 Ω 3 -J 3 φ 3 ro 3 H μ-1 0) μ- ft) H 3 μ» rt rt Ω ^-^ hi cu Φ ft) φ φ ØJ μ> cυ ti tr o ro ft φ 3 o 3 Φ σ IX) μ- α μ- Cd hi _? Φ GO μ- o 3 rt CD 3 o 3 φ ft) o ti¬ ft) 3 en rt cυ cπ 3 CO Ω • μ- cx X! 3 tr T tc cπ ft) 3 en rt rt μ» ts' μ- <l Hi •* CD rt cπ ιQ > CU TJ ra h-1 li¬ no tr H • <! Hi CD μ-
Cd ω ft) OJ X Φ μ- h^ Ω rt H μ- H ii eu hi 0 to eu 0) ≤ Φ 0 eυ ιQ Ω lO μ- H 0 0 • 0 μ- ω 3 H ro μ- 0 CO Cυ XJ Ω lO μ- H 3 rt CO CD rt μ- rt ra 3 < 3 > H o tr 0) 3 CX TJ 3 X ra rt μ- rt φ
X tr • 3 cu tr Ω μ- rt CO T H- 3 0) rt ft) Ω Φ 3 tr cx OJ • 3 tr Ω o rt ØJ o H X! li¬ o H ra TJ 3 tr 3 rt x Ω eυ CO ti X! li¬ < ff CO X H3 ra ra rt ra < o rt μ- H CD ι-3 μ- cx μ- rt li¬ CO 1-3 CD φ rt ra φ
Φ ti tr li 3 ^ cx ra μ-* tr ra O ft •fc ω O H- ft) OJ Ω tr H 3 3" cx hi ra - •^ Φ • ti 0 ra Ω OJ H 1 CO 3 3 CO I-" μ-* ra Φ • 3 μ- CO 3 X! rt Ω 0) a D s: 0) ro H φ ω μ-
3 μ- μ- tr μ- sυ I-1 ft) OJ X!
XI O 3 H 3 ØJ tr tr 3 1 X 3 Φ rt rt cx cx
Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ = German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany) in accordance with the Budapest Treaty as DSM 14353.
5.4 Preparation of the strain C. glutamicum ATCC13032/pCREmetAEY
The vector pCREmetAY obtained in example 5.3 was electroporated in the strain C. glutamicum ATCC13032 using the electroporation method described by Liebl et al. (FEMS Microbiology Letters, 53:299-303 (1989)). Selection of plasmid-carrying cells took place on LBHIS agar comprising 18.5 g/1 brain-heart infusion broth, 0.5 M sorbitol, 5 g/1 Bacto-tryptone, 2.5 g/1 Bacto-yeast extract, 5 g/1 NaCl and 18 g/1 Bacto-agar, which had been supplemented with 25 mg/1 kanamycin. Incubation was carried out for 2 days at 33°C.
Plasmid DNA. was isolated from a transformant by conventional methods (Peters-Wendisch et al., 1998, Microbiology 144, 915-927) and checked by restriction cleavage. The resulting strain was called ATCC13032pCREmetAEY.
Example 6
Fermentative preparation of L-methionine with the strain ATCC13032/pCREmetAEY
The strain C. glutamicum ATCC13032/pCREmetAEY constructed by the process described in example 4 was cultured in a nutrient medium suitable for the production of methionine and the methionine content in the culture supernatant was determined.
For this, the strain was first incubated on an agar plate with the corresponding antibiotic (brain-heart agar with kanamycin (25 mg/1)) for 24 hours at 33°C. Starting from this agar plate culture, a preculture was seeded (10 ml medium in a 100 ml conical flask) . The medium MM-1 was used as the medium for the preculture.
Medium MM-1
CSL (corn steep liquor) 5 g/1
MOPS (morpholinopropanesulfonic acid) 20 g/1
Glucose (autoclaved separately) 50g/l
Salts
(NH4)2S04 25 g/1
KH2P04 0.1 g/1
MgS04 * 7 H20 1.0 g/1
CaCl2 * 2 H20 10 mg/1
FeS04 * 7 H20 10 mg/1
MnS04 * H20 5. Omg/1
Biotin (sterile-filtered) 0.01 mg/1
Vitamin B12 (sterile-filtered) 0.02 mg/1
Thiamine * HC1 (sterile-filtered) 0.2 mg/1
CaC03 25 g/1
The CSL, MOPS and the salt solution were brought to pH 7 with aqueous ammonia and autoclaved. The sterile substrate and vitamin solutions were then added, as well as the CaC03 autoclaved in the dry state. Kanamycin (25 mg/1) was added to this.
The preculture was incubated for 16 hours at 33°C at
240 rpm on a shaking machine and then used as the inoculum for the main culture in the fermenter. To establish an optical density (at 660 nm) of 1.0 as the starting value for the main culture in the fermenter, the corresponding amount of culture broth was transferred from the preculture.
The medium MM-2, which has the following composition, was used for the main culture:
Medium MM-2
CSL (corn steep liquor) 5 g/1
Glucose (autoclaved separately) 50g/l
Salts:
(NH4)2S04 25 g/1
KH2P04 0.1 g/1
MgS04 * 7 H20 1.0 g/1
CaCl2 * 2 H20 10 mg/1
FeS0 * 7 H20 10 mg/1
MnS04 * H20 5.0mg/l
Biotin (sterile-filtered) 0.01 mg/1
Vitamin B12 (sterile-filtered) 0.02 mg/1
Thiamine * HC1 (sterile-filtered) 0.2 mg/1
Antifoam (Structol) 0.5 g/1
All the components of the medium were initially introduced directly into the fermenter, dissolved in water and then sterilized by means of heat (121°C, 20 minutes) . Only the glucose was prepared in a stock solution of 50 wt.% and sterilized separately (also 121°C, 20 minutes) . Biotin or thiamine were sterile-filtered and added under aseptic conditions directly before the start of fermentation. Culturing was carried out by the batch process in a bioreactor with a working volume of 0.5 L (Multifermenter SIXFORS from Infors GmbH, Bodmingen, Switzerland) . After addition of the inoculum, the starting volume in the fermenter was 0.4 L in total. Further culturing was carried out under constant aeration (0.1 vvm ("volume per volume per minute") and stirring at 33°C and a pH of 7.0. Correction or adjustment of the pH was carried out with a 5% NHOH solution. The set value for the concentration of dissolved oxygen in the fermentation medium was regulated at 40% and adjusted via the stirrer speed at a constant rate of aeration.
After 48 hours the process was ended and the optical density (OD) of the culture suspension was determined with an LP2W photometer from Dr. Lange (Berlin, Germany) at a measurement wavelength of 660 nm. The concentration of L- methionine formed was determined with an amino acid analyzer from Eppendorf-BioTronik (Hamburg, Germany) by ion exchange chromatography and post-column derivation with ninhydrin detection.
An optical density in the final sample of 31.7 and a concentration of L-methionine of 39.0 mg per liter could be determined by the methods described above as the result.
Example 7
Preparation of biomass-free broth containing L-methionine
The biomass was first separated off from a fermentation broth comprising L-methionine prepared by the process of example 6 and comprising about 39 mg/1 L-methionine. For this, 0.5 1 of the above-mentioned fermentation broth was centrifuged with a laboratory centrifuge of the Biofuge- Stratos type from Heraeus (Dusseldorf, Germany) for 20 minutes at 4,000 rpm and the supernatant from the centrifugation was then purified further by cross-flow ultrafiltration with an MRC polymer membrane of 30kD in an ultrafiltrations unit from ICT GmbH (Bad Homburg, Germany) .
Example 8
Preparation of a biomass-free product comprising L- methionine from a fermentation broth
The biomass was first separated off from a fermentation broth comprising L-methionine prepared by the process as described under example 6 and comprising about 39.0 mg/1 L- methionine. For this, the fermenter contents of the above- mentioned fermentation broth were centrifuged and subjected to ultrafiltration as described in example 7.
23.7 g pure L-methionine (>99%; MERCK, Darmstadt, Germany) were then added batchwise to 300 g of the biomass-free filtrate, while stirring, in order to establish the desired content of L-methionine in the product. The suspension comprising L-methionine treated in this way was then mixed with 150 g water, with further stirring, to improve the working-up properties.
A portion of the suspension improved in this way was then lyophilized in a freeze-dryer of the type LYOVAC GT 2 from Leybold (Cologne, Germany) . The product comprising L- methionine prepared in this manner had a content of 70 wt.% L-methionine and was free-flowing.
The remaining portion of the suspension improved in this way was treated by means of spray drying in a laboratory spray dryer of the Bϋchi-190 type from Buchi-Labortechnik GmbH (Constance, Germany) at an intake temperature of 170°C, a starting temperature of 105°C, a pressure difference of -40 mbar and an air flow rate of 600 NL/h. The product comprising L-methionine prepared in this manner had a content of 70 wt.% L-methionine and was free-flowing. Example 9
Preparation of a biomass-containing product comprising L- methionine from a fermentation broth
From a fermentation broth comprising L-methionine prepared by the process of example 6 and comprising about 39 mg/1 L- methionine, 23.7 g pure L-methionine (>99%; MERCK, Darmstadt, Germany) was first added batchwise, while stirring, in order to establish the desired content of L- methionine in the product. The fermentation broth treated in this way was then mixed with 150 g water, with further stirring, to improve the working-up properties.
A portion of this biomass-containing broth was then lyophilized in a freeze-dryer of the type LYOVAC GT 2 from Leybold (Cologne, Germany) . The product comprising L- methionine prepared in this way had a content of 65 wt.% L- methionine and was free-flowing.
The remaining portion of the biomass-containing broth was treated by means of spray drying in a laboratory spray dryer of the Bϋchi-190 type from Biichi-Labortechnik GmbH (Constance, Germany) at an intake temperature of 170°C, a starting temperature of 105°C, a pressure difference of - 40 mbar and an air flow rate of 600 NL/h. The product comprising L-methionine prepared in this way had a content of 65 wt.% L-methionine and was free-flowing.
Brief Description of the Figures :
• Figure 1 : Plasmid pCREmetAE
• Figure 2 : pCREmetAEY
The abbreviations used in the figures have the following meaning:
Km: Resistance gene for kanamycin
metE: metE gene of C. glutamicum
metY: metY gene of C. glutamicum
metA: metA gene of C. glutamicum
Ptac: tac promoter
rrnB-TlT2: Terminator T1T2 of the rrnB gene of E. coli
rep:. Plasmid-coded replication origin for C. glutamicum (of pHM1519)
BamHI : Cleavage site of the restriction enzyme BamHI
EcoRI: Cleavage site of the restriction enzyme EcoRI
Sail: Cleavage site of the restriction enzyme Sail

Claims

What is claimed is :
1. An isolated polynucleotide from coryneform bacteria, comprising a polynucleotide sequence chosen from the group consisting of
a) polynucleotide which is identical to the extent of at least 70% to a polynucleotide which codes for a polypeptide which comprises the amino acid sequence of SEQ ID No. 2,
b) polynucleotide which codes for a polypeptide which comprises an amino acid sequence which is identical to the extent of at least 70% to' the amino acid sequence of SEQ ID No. 2,
c) polynucleotide which is complementary to the polynucleotides of a) or b) , and
d) polynucleotide comprising at least 15 successive nucleotides of the polynucleotide sequence of a) , b) or c) .
2. A polynucleotide as claimed in claim 1, wherein the polynucleotide is a preferably recombinant DNA which is capable of replication in coryneform bacteria.
3. A polynucleotide as claimed in claim 1, wherein the polynucleotide is an RNA.
4. A polynucleotide as claimed in claim 2, comprising the nucleic acid sequence as shown in SEQ ID No. 1.
5. A DNA as claimed in claim 2 which is capable of replication, comprising
(i) the nucleotide sequence shown in SEQ ID No. 1, or
(ii) at least one sequence which corresponds to sequence (i) within the range of the degeneration of the genetic code, or (iii) at least one sequence which hybridizes with the sequence complementary to sequence (i) or (ii) , and optionally
(iv) sense mutations of neutral function in (i) .
6. A polynucleotide sequence as claimed in claim 2, which codes for a polypeptide which comprises the amino acid sequence in SEQ ID No. 2.
7. A coryneform bacterium in which the metE gene is enhanced, in particular over-expressed.
8. A coryneform bacterium serving as the host cell, which contains a vector which carries a polynucleotide as claimed in claim 1.
9. Escherichia coli strain DHαmcr/pCREmetAE as DSM 14352 deposited at the Deutsche Sammlung fur Mikroorganismen und Zellkulturen [German Collection of Microorganisms and Cell Cultures], Braunschweig, Germany.
10. Escherichia coli strain DHαmcr/pCREmetAEY as DSM 14353 deposited at the Deutsche Sammlung fur Mikroorganismen und Zellkulturen [German Collection of Microorganisms and Cell Cultures], Braunschweig, Germany.
11. A process for the fermentative preparation of L-amino acids, in particular L-methionine, which comprises carrying out the following steps:
a) fermentation of the coryneform bacteria which produce the desired L-amino acid and in which at least the metE gene or nucleotide sequences which code for it are enhanced, in particular over- expressed;
b) concentration of the L-amino acid in the medium or in the cells of the bacteria, and c) isolation of the L-amino acid.
12. A process as claimed in claim 11, wherein bacteria in which further genes of the biosynthesis pathway of the desired L-amino acid are additionally enhanced are employed.
13. A process as claimed in claim 11, wherein bacteria in which the metabolic pathways which reduce the formation of the desired L-amino acid are at least partly eliminated are employed.
14. A process as claimed in claim 11, wherein a strain transformed with a plasmid vector is employed, and the plasmid vector carries the nucleotide sequence which codes for the metE gene.
15. A process as claimed in claim 11, wherein the expression of the polynucleotide (s) which code(s) for
• the metE gene is enhanced, in particular over- expressed.
16. A process as claimed in claim 11, wherein the catalytic properties of the polypeptide (enzyme protein) for which the polynucleotide metE codes are increased.
17. A process as claimed in claim 11, wherein for the preparation of L-amino acids, in particular L- methionine, coryneform microorganisms in which at the same time one or more of the genes chosen from the group consisting of
17.1 the lysC gene which codes for a feed back resistant aspartate kinase,
17.2 the gap gene which codes for glycerolaldehyde 3-phosphate dehydrogenase,
1 .3 the pgk gene which codes for 3-phosphoglycerate kinase,
17.4 the pyc gene which codes for pyruvate carboxylase,
17.5 the tpi gene which codes for triose phosphate isomerase
17.6 the metA gene which codes for homoserine 0- acetyltransferase
17.7 the metB gene which codes for cystathionine gamma-synthase
17.8 the aecD gene which codes for cystathionine gamma-lyase
17.9 the glyA gene which codes for serine hydroxymethyltransferase
17.10 the metY gene which codes for 0- acetylhomoserine sulfhydrylase
is or are enhanced or over-expressed are fermented.
18. A process as claimed in claim 11, wherein for the preparation of L-amino acids, in particular L- methionine, coryneform microorganisms in which at the same time one or more of the genes chosen from the group consisting of
18.1 the thrB gene which codes for homoserine kinase
18.2 the ilvA gene which codes for threonine dehydratase
18.3 the thrC gene which codes for threonine synthase
18.4 the ddh gene which codes for meso- diaminopimelate D-dehydrogenase
18.5 the pck gene which codes for phosphoenol pyruvate carboxykinase
18.6 the pgi gene which codes for glucose 6- phosphate isomerase
18.7 the poxB gene which codes for pyruvate oxidase
is or are attenuated are fermented.
19. A process as claimed in one or more of claims 11 to 18, wherein microorganisms of the species Corynebacterium glutamicum are employed.
20. A process as claimed in claim 19, wherein the Corynebacterium glutamicum strain ATCC13032/pCREmetAE is employed.
21. A process as claimed in claim 19, wherein the Corynebacterium glutamicum strain ATCCl3032/pCREmetAEY is employed.
22. A process for the preparation of an L-methionine- containing animal feedstuffs additive from fermentation broths, which comprises the steps
a) culture and fermentation of an L-methionine- producing microorganism in a fermentation medium;
b) removal of water from the L-methionine-containing fermentation broth (concentration) ;
c) removal of an amount of 0 to 100 wt.% of the biomass formed during the fermentation; and
d) drying of the fermentation broth obtained according to b) and/or c) to obtain the animal feedstuffs additive in the desired powder or granule form.
23. A process as claimed in claim 22, wherein microorganisms in which further genes of the biosynthesis pathway of L-methionine are additionally enhanced are employed.
24. A process as claimed in claim 22, wherein microorganisms in which the metabolic pathways which reduce the formation of L-methionine are at least partly eliminated are employed.
25. A process as claimed in claim 22, wherein the expression of the polynucleotides which code for the metE gene is enhanced, in particular over-expressed.
26. A process as claimed in one or more of claims 22 to 25, wherein microorganisms of the species Corynebacterium glutamicum are employed.
27. A process as claimed in claim 26, wherein the Corynebacterium glutamicum strain ATCCl3032/pCREmetAE is employed.
28. A process as claimed in claim 26, wherein the Corynebacterium glutamicum strain ATCCl3032/pCREmetAEY is employed.
29. A process as claimed in claim 22, wherein one or more of the following steps is or are additionally carried out:
e) addition of one or more organic substances, including L-methionine and/or D-methionine and/or the racemic mixture D, L-methionine, to the products obtained according to b) , c) and/or d) ;
f) addition of auxiliary substances chosen from the group consisting of silicas, silicates, stearates, grits and bran to the substances obtained according to b) to e) for stabilization and to increase the storability; or g) conversion of the substances obtained according to b) to f) into a form stable to the animal stomach, in particular rumen, by coating with film-forming agents.
30. A process as claimed in claim 29, wherein a portion of the biomass is removed.
31. A process as claimed in claim 30, wherein up to 100% of the biomass is removed.
32. A process as claimed in claim 29, wherein the water content is up to 5 wt . % .
33. A process as claimed in claim 32, wherein the water content is less than 2 wt.%.
34. A process as claimed in claim 29, 30, 31, 32 or 33, wherein the film-forming agents are metal carbonates, silicas, silicates, alginates, stearates, starches, gums or cellulose ethers.
35. An animal feedstuffs additive prepared as claimed in claims 22 to 34.
36. An animal feedstuffs additive as claimed in claim 35, which comprises 1 wt.% to 80 wt.% L-methionine, D- methionine, D, L-methionine or a mixture thereof, based on the dry weight of the animal feedstuffs additive.
37. A process for discovering RNA, cDNA and DNA in order to isolate nucleic acids, or polynucleotides or genes which code for homocysteine methyltransferase I or have a high similarity with the sequence of the homocysteine methyltransferase I gene, which comprises employing the polynucleotide sequences as claimed in claims 1, 2, 3 or 4 as hybridization probes.
EP01967191A 2000-08-02 2001-07-17 Nucleotide sequences which code for the mete gene Ceased EP1307476A1 (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
DE10038023 2000-08-02
DE10038023 2000-08-02
DE10109689A DE10109689A1 (en) 2000-08-02 2001-02-28 New nucleotide sequences coding for the metE gene
DE10109689 2001-02-28
PCT/EP2001/008219 WO2002010208A1 (en) 2000-08-02 2001-07-17 Nucleotide sequences which code for the mete gene

Publications (1)

Publication Number Publication Date
EP1307476A1 true EP1307476A1 (en) 2003-05-07

Family

ID=26006608

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01967191A Ceased EP1307476A1 (en) 2000-08-02 2001-07-17 Nucleotide sequences which code for the mete gene

Country Status (3)

Country Link
EP (1) EP1307476A1 (en)
AU (1) AU2001287630A1 (en)
WO (1) WO2002010208A1 (en)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE10109685A1 (en) * 2000-09-09 2002-04-11 Degussa New nucleotide sequences coding for the sahH gene
KR100651220B1 (en) 2004-06-29 2006-11-29 씨제이 주식회사 L-methionine producing strain and L-methionine production method using the strain
FR2879075B1 (en) 2004-12-15 2007-01-19 Adisseo France Sas Soc Par Act PROCESS FOR PREPARING EXTRUSION-ACTIVE HYDROPHILIC ACTIVE INGREDIENT PELLETS
FR2879074B1 (en) * 2004-12-15 2007-08-03 Adisseo France Sas Soc Par Act PELLETS OF ACTIVE HYDROPHILIC PRINCIPLE
WO2020067487A1 (en) * 2018-09-28 2020-04-02 Ajinomoto Co., Inc. Method for producing l-methionine using a bacterium

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE3908201A1 (en) * 1989-03-14 1990-09-27 Degussa METHOD FOR THE FERMENTATIVE MANUFACTURE OF L-LYSINE
KR920008381B1 (en) * 1990-12-31 1992-09-26 제일제당 주식회사 Lysine production method by recombinant Corynebacterium glutamicum
JPH07503855A (en) * 1992-02-20 1995-04-27 ジェネンコア インターナショナル インコーポレーテッド Methionine biosynthesis using a sulfur reducing source
DE19644567A1 (en) * 1996-10-26 1998-04-30 Forschungszentrum Juelich Gmbh Microbial production of substances from the aromatic metabolism / II
MXPA01013123A (en) * 1999-06-25 2002-06-21 Basf Ag Corynebacterium glutamicum.
JP4623825B2 (en) * 1999-12-16 2011-02-02 協和発酵バイオ株式会社 Novel polynucleotide

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0210208A1 *

Also Published As

Publication number Publication date
AU2001287630A1 (en) 2002-02-13
WO2002010208A1 (en) 2002-02-07

Similar Documents

Publication Publication Date Title
EP1390504B1 (en) Nucleotide sequences which code for the metd gene
EP1307475A1 (en) Nucleotide sequences which code for the meth gene
EP2085482B1 (en) Nucleotide sequences which code for the metY gene
EP1320593B1 (en) Process for the preparation of L-lysine using CYSD, CYSN, CYSK, CYSE AND/or CYSH OF C. GLUTAMICUM
US6942996B2 (en) Isolated polynucleotide from Corynebacterium encoding a homocysteine methyltransferase
US20020049305A1 (en) Nucleotide sequences which code for the metF gene
US6822085B2 (en) Nucleotide sequences which code for the cysD, cysN, cysK, cysE and cysH genes
US6812016B2 (en) Nucleotide sequences which code for the metY gene
US6759224B2 (en) Nucleotide sequences which code for the sahH gene
US6958228B2 (en) Nucleotide sequence which code for the metH gene
US6815196B2 (en) Nucleotide sequences encoding o-succinylhomoserine sulfhydrylase
EP1307476A1 (en) Nucleotide sequences which code for the mete gene
EP1307477A2 (en) Nucleotide sequences which code for the metf gene
WO2002022668A1 (en) Nucleotide sequences which code for the roda gene
WO2002026755A2 (en) Nucleotide sequences which code for the ppgk gene
EP1315820B1 (en) Nucleotide sequences which code for s-adenosyl homocysteinase (sahh)
WO2002024880A1 (en) Nucleotide sequences which code for the ndka gene
EP1507008A2 (en) Nucleotide sequences which code for the sahH gene
DE10109689A1 (en) New nucleotide sequences coding for the metE gene
DE10109687A1 (en) New nucleotide sequences coding for the metH gene
EP1313757A2 (en) Nucleotide sequences which code for the metr and metz genes

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20030103

AK Designated contracting states

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

RIN1 Information on inventor provided before grant (corrected)

Inventor name: THIERBACH, GEORG

Inventor name: GREISSINGER, DIETER

Inventor name: BINDER, MICHAEL

Inventor name: PUEHLER, ALFRED

Inventor name: KALINOWSKI, JOERN

Inventor name: RUECKERT, CHRISTIAN

Inventor name: HUTHMACHER, KLAUS

Inventor name: PFEFFERLE, WALTER

Inventor name: MOECKEL, BETTINA

Inventor name: BATHE, BRIGITTE

17Q First examination report despatched

Effective date: 20040319

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: DEGUSSA GMBH

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: EVONIK DEGUSSA GMBH

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED

18R Application refused

Effective date: 20070927