EP1301473A2 - Labeled peptides, proteins and antibodies and processes and intermediates useful for their preparation - Google Patents
Labeled peptides, proteins and antibodies and processes and intermediates useful for their preparationInfo
- Publication number
- EP1301473A2 EP1301473A2 EP01954689A EP01954689A EP1301473A2 EP 1301473 A2 EP1301473 A2 EP 1301473A2 EP 01954689 A EP01954689 A EP 01954689A EP 01954689 A EP01954689 A EP 01954689A EP 1301473 A2 EP1301473 A2 EP 1301473A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- peptide
- protein
- polypeptide
- biosensor
- functional molecule
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
- C07D409/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings
- C07D409/06—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
- C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
- C07D209/04—Indoles; Hydrogenated indoles
- C07D209/10—Indoles; Hydrogenated indoles with substituted hydrocarbon radicals attached to carbon atoms of the hetero ring
- C07D209/12—Radicals substituted by oxygen atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
- C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
- C07D209/04—Indoles; Hydrogenated indoles
- C07D209/10—Indoles; Hydrogenated indoles with substituted hydrocarbon radicals attached to carbon atoms of the hetero ring
- C07D209/18—Radicals substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
- C07D417/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings
- C07D417/06—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
- C07K1/107—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by chemical modification of precursor peptides
- C07K1/1072—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by chemical modification of precursor peptides by covalent attachment of residues or functional groups
- C07K1/1077—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by chemical modification of precursor peptides by covalent attachment of residues or functional groups by covalent attachment of residues other than amino acids or peptide residues, e.g. sugars, polyols, fatty acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
- C07K1/13—Labelling of peptides
-
- C—CHEMISTRY; METALLURGY
- C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
- C09B—ORGANIC DYES OR CLOSELY-RELATED COMPOUNDS FOR PRODUCING DYES, e.g. PIGMENTS; MORDANTS; LAKES
- C09B23/00—Methine or polymethine dyes, e.g. cyanine dyes
- C09B23/10—The polymethine chain containing an even number of >CH- groups
- C09B23/105—The polymethine chain containing an even number of >CH- groups two >CH- groups
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/55—Design of synthesis routes, e.g. reducing the use of auxiliary or protecting groups
Definitions
- Modified peptides and proteins are valuable biophysical tools for studying biological processes, both in vitro and in vivo. They are also useful in assays to identify new drugs and therapeutic agents.
- quantitative live cell imaging using fluorescent proteins and peptides is revolutionizing the study of cell biology.
- An exciting recent development within this field has been the construction of peptide and protein biosensors exhibiting altered fluorescence properties in response to changes in their environment, oligomeric state, conformation upon ligand binding, structure, or direct ligand binding.
- Appropriately labeled fluorescent biomolecules allow spatial and temporal detection of biochemical reactions inside living cells. See for example Giuliano, K.A., et al., Annu. Rev. Biophys. Biomol Struct.
- green fluorescence protein is a fluorescent protein that has been fused to other proteins using molecular biology techniques and has been used to visualize intracellular proteins (see, e.g., Katz et al., BioTechniques 25: 298-304 (1998)).
- GFP does not have the diverse capabilities of smaller, synthetic molecules, some of which provide a variety of fluorescence wavelengths, or are capable of reporting on protein conformation, or can photo-crosslink or act as ⁇ ME or EPR probes. Accordingly, new fluorescent molecules with more diverse properties and new attachment methods are needed.
- the present invention provides a highly efficient method for the site- specific attachment of biophysical probes or other molecules to unprotected peptides following chemical synthesis.
- the methodology utilizes amino acids having one or more protected aminooxy groups, which can be incorporated during solid-phase peptide synthesis or which can be combined with recombinant peptides through post expression steps. It has been discovered that the protected aminooxy group can be unmasked following peptide synthesis, and reacted with an electrophilic reagent to provide a modified (e.g. a labeled) peptide.
- the aminooxy group reacts selectively with electrophiles (e.g. an activated carboxylic ester such as an N-hydroxy-succinimide ester) in the presence of other nucleophilic groups including cysteine, lysine and amino groups.
- electrophiles e.g. an activated carboxylic ester such as an N-hydroxy-succinimide ester
- selective peptide modification can be accomplished after synthesis using commercially available and/or chemically sensitive molecules (e.g. probes).
- the methodology is compatible with the synthesis of C ⁇ -thioester containing peptides and amide-forming ligations, required steps for the synthesis of proteins by either total chemical synthesis or expressed protein ligation.
- An aminooxy containing amino acid can be introduced into different sites by parallel peptide synthesis to generate a polypeptide analogue family with each member possessing a single specifically-labeled site.
- the parallel synthesis enables the development of optimized biosensors or other modified polypeptides through combinatorial screening of different attachment sites for maximal response and minimal perturbation of desired biological activity.
- the invention provides a synthetic intermediate (i.e. a synthon) useful for preparing modified peptides, which is a compound of formula (I):
- R 1 is hydrogen or an amino protecting group
- R 2 is hydrogen or a carboxy protecting group
- R is an organic radical comprising one or more aminooxy groups.
- Peptides including one or more aminooxy groups are also useful synthetic intermediates that can be modified to provide related peptides having altered biological, chemical, or physical properties, such as, for example, a peptide linked to a fluorescent label. Accordingly, the invention also provides a peptide having one or more (e.g. 1, 2, 3, or 4) aminooxy groups; provided the peptide is not glutathione. The invention also provides a peptide having one or more (e.g. 1, 2, 3, or 4) secondary aminooxy groups.
- the invention generally provides intermediates and methods that allow for site-specific modification of peptides after synthesis.
- functional molecules can be selectively linked to a peptide to provide a peptide conjugate having altered biological, chemical, or physical properties.
- functional molecules e.g. biophysical probes, peptides, polynucleotides, and therapeutic agents
- R 6 is a peptide, polypeptide or antibody
- X is a direct bond or a linking group
- R 7 is hydrogen, (CrC ⁇ alkyl, an amino protecting group, or a radical comprising one or more aminooxy groups;
- Y is a direct bond or a linking group;
- a functional molecule can be any label, dye, pharmaceutical, toxin,
- the functional molecule is a biophysical probe, such as a fluorescent group that can be used for FRET studies or other studies involving fluorescent signals, such as excimer pair formation.
- the invention also provides a method for preparing a peptide conjugate comprising a peptide and a functional molecule, comprising reacting a peptide having one or more aminooxy groups with a corresponding functional molecule having an electrophilic moiety, to provide the peptide conjugate.
- the present invention further provides environment-sensing dyes that can be readily conjugated to proteins and other molecules without the problems of aggregation, fluorescence quenching and the like.
- the present dyes strongly fluoresce and can fluoresce in an environmentally-sensitive manner suitable for use in living cells. Unlike cyanine dyes, the environmental sensitivity of these dyes can be used to form biosensors that can report many aspects of protein behavior, or the behavior of other molecules. Protein behaviors including conformational change, phosphorylation state, ligand interaction, protein-protein binding and various post-translational modifications affect the distribution of charged and hydrophobic residues can be reported by the present dyes by changes in their fluorescence.
- the present invention overcomes the disadvantages of the available environmentally-sensitive fluorescent dyes.
- the present fluorescent probes exhibit high fluorescence levels before and after conjugation to other molecules, including peptides, proteins and antibodies, and changes in fluorescence suitable for many purposes, including in vivo and in vitro assays of protein behavior.
- the present invention provides new fluorescent dyes that can be used in any manner chosen by one of skill in the art.
- the dyes can be linked to any useful molecule known to one of skill in the art using any available procedure.
- the fluorescent dyes are linked to peptides, polypeptides or antibodies using the methods provided herein. These dyes have the following structure (IN).
- each m is separately an integer ranging from 1-3;
- n is an integer ranging from 0 to 5;
- each R is alkyl, branched alkyl or heterocyclic ring derivatized with charged groups to enhance water solubility and enhance photostability;
- R 9 and R are chains carrying charged groups to enhance water solubility (i.e. sulfonate, amide, ether) and/or chains bearing reactive groups for conjugation to other molecules.
- the reactive group is a functional group that is chemically reactive (or that can be made chemically reactive) with functional groups typically found in biological materials, or functional groups that can be readily converted to chemically reactive derivatives using methods well known in the art.
- the charged and reactive groups are carboxylic acid (COOH), or derivatives of a carboxylic acid.
- An appropriate derivative of a carboxylic acid includes an alkali or alkaline earth metal salt of carboxylic acid.
- the charged and reactive groups are reactive derivatives of a carboxylic acid (-COORx), where the reactive group Rx is one that activates the carbonyl group of -COORx toward nucleophilic displacement.
- Rx is any group that activates the carbonyl towards nucleophilic displacement without being incorporated into the final displacement product.
- COORx ester of phenol or naphtol that is further substituted by at least one strong electron withdrawing group, or carboxylic acid activated by carbodiimide, or acyl chloride, or succinimidyl or sulfosuccinimidyl ester.
- Additional charged and reactive groups include, among others, sulfonyl halides, sulfonyl azides, alcohols, thiols, semicarbazides, hydrazines or hydroxylamines.
- the invention still further provides a method of identifying an optimal position for placement of a functional molecule on a peptide having a peptide backbone and a known activity, which includes making a series of peptide conjugates, each peptide conjugate having the same amino acid sequence and the same functional molecule, wherein the functional molecule is linked at a different location along the backbone of every peptide conjugate in the series, and observing which functional molecule location does not substantially interfere with the known activity of the peptide.
- the invention also provides a method of identifying an optimal position for placement of a functional molecule in a protein having a known activity and an identified peptide segment for attachment of the functional molecule, which includes making a series of peptide conjugates, each peptide conjugate having the amino acid sequence of the identified peptide segment and the same functional molecule, wherein the functional molecule is linked at a different location along the backbone of every peptide conjugate in the series; replacing the identified peptide segment in each protein of a series of said proteins with a peptide conjugate selected from the series of peptide conjugates to create a series of protein conjugates each having the functional molecule at a different location; and observing which functional molecule location does not substantially interfere with the known activity of the protein.
- the invention further provides a method of identifying an optimal position for placement of an environmentally-sensitive functional molecule on a peptide biosensor having a backbone, which includes making a series of peptide conjugates, each peptide conjugate having the same amino acid sequence and the same functional molecule, wherein the functional molecule is at a different location along the backbone of every peptide conjugate in the series, and observing which functional molecule location provides the strongest signal change in response to an environmental change in the peptide conjugate.
- the signal change can be any observable change in a signal, for example, the change can be a change in fluorescence emission intensity, fluorescence duration or fluorescence emission wavelength.
- the environmental change in the peptide biosensor can be, for example, an interaction with a target molecule.
- the invention still further provides a method of identifying an optimal position for placement of an environmentally-sensitive functional molecule in a protein having a known activity and an identified peptide segment for attachment of the functional molecule, which includes making a series of peptide conjugates, each peptide conjugate having the amino acid sequence of the identified peptide segment and the same environmentally-sensitive functional molecule, wherein the environmentally-sensitive functional molecule is linked at a different location along the backbone of every peptide conjugate in the series; replacing the identified peptide segment in each protein of a series of said proteins with a peptide conjugate selected from the series of peptide conjugates to create a series of protein conjugates, each having the environmentally- sensitive functional molecule at a different location; and observing which functional molecule location provides the strongest signal change in response to an environmental change in the protein conjugate.
- the invention also provides a method for detecting GTP activation of a Rho GTPase protein, which includes contacting a polypeptide biosensor with a test substance, wherein said polypeptide biosensor comprises a polypeptide capable of binding a GTP-activated Rho GTPase protein, and wherein said polypeptide is operatively linked to an environmentally sensitive fluorescent ' dye; and observing fluorescence emissions from the polypeptide biosensor at a wavelength emitted by said fluorescent acceptor dye; wherein the environmentally sensitive fluorescent dye will emit light of a different intensity or a different wavelength when the polypeptide biosensor is bound to the GTP- activated Rho GTPase protein than when the polypeptide biosensor is not bound.
- the invention further provides a method of detecting the location of a cellular protein within a living cell that includes providing the living cell with a biosensor capable of binding to a tag on the cellular target protein; and detecting the location of a functional molecule on the biosensor within the living cell.
- the tag on the cellular target protein can be a peptide segment that has been fused to the cellular protein.
- the tag is a peptide which includes SEQ LD NO: 16 and that can bind to a biosensor having a peptide segment with SEQ ID NO: 15.
- the biosensor can include a peptide-conjugate of the invention. Any of the functional molecules, pharmaceuticals, toxins, labels, dyes or compounds can also be present on the biosensor.
- any cellular protein can be detected using this method, for example, calmodulin, Rho GTPase, rac, cdc42, mitogen-activated protein kinase, Erkl, Erk2, Erk3, Erk4, IgE receptor (F c ⁇ RI), actin, ⁇ -actinin, myosin, or a major histocompatibility protein.
- the methods provided herein can detect and identify the cellular location of proteins and cellular proteins that have never been successful labeled and observed in vivo.
- FIG. 1 illustrates a general strategy for site-specific labeling of polypeptides.
- the protected aminooxy group is incorporated during solid-phase peptide synthesis (synthesis on a thioester-linker resin is shown); cleavage from the resin generates a peptide possessing unprotected sidechains, an aminooxy group and a C-terminal thioester; and ligation and subsequent site-specific labeling produces the full-length peptide with a functional molecule attached at the aminooxy nitrogen.
- FIG. 2 illustrates the synthesis of PA-test and SA-test peptides.
- FIG. 3 shows HPLC analysis of purified SA-test peptide (top) and crude reaction products from optimized labeling conditions (bottom).
- FIG. 4 illustrates the synthesis of a protected intermediate (4) of the invention.
- FIG. 5 illustrates one method for using biosensors according to the present invention.
- Rh Rhin-activated kinase
- PBD p21- Activated kinase
- a Racl-Green Fluorescent Protein fusion protein shown as a square named "RAC” attached to a circle named "GFP" was made and a cell line expressing this fusion protein was generated. Cells expressing RAC-GFP were injected with PBD labeled with Alexa-546 dye ("Dye").
- the PBD biosensor binds selectively to GTP-RAC-GFP, but not to GDP-RAC-GFP.
- the Alexa on the labeled fragment undergoes fluorescence resonance energy transfer (FRET) as the Alexa and GFP fluorophores are brought close together.
- FRET fluorescence resonance energy transfer
- This FRET can be measured within a living cell or in vitro to map the distribution, localization and level of Rac-GTP activation.
- FRET produces a fluorescence signal which is distinct from a GFP fluorescence signal because energy is transferred from the excited GFP fluorophore to the nearby Alexa dye (J.R. Lakowicz, Principles of Fluorescence Spectroscopy (Plenum Press, New York, 1983), pp.305-341)).
- GFP excitation and emission are used for overall Rac distribution, while GFP excitation and Alexa emission are used for FRET.
- FIG. 6 illustrates one method of using an environmentally sensitive fluorescent dye in the present methods so that changes in naturally existing proteins can be detected and observed in vivo or in vitro.
- FIG 6a depicts FRET between the Racl-Green Fluorescent Protein (GFP -Racl) fusion and the p21-activated kinase biosensor (PBD) labeled with Alexa-546 dye as shown in Figure 5.
- Inactive Racl is depicted as a larger gray circle with Green Fluorescent Protein (smaller circle) attached.
- GTP Green Fluorescent Protein
- Racl undergoes a structural change depicted as a gray circle changing to a half-rounded gray rectangle.
- Unbound PBD is depicted as a black L-shape with an attached Alexa-546 dye (open circle).
- PBD cannot bind and the Alexa-546 cannot undergo FRET.
- FIG. 6b illustrates how an environmentally sensitive fluorescent dye eliminates the need to create a fusion protein like the GFP-Racl protein depicted in Figure 6a.
- a natural, unmodified protein is depicted as a gray oval.
- the protein changes conformation upon activation by GTP, depicted as the transition to a half-rounded gray rectangle.
- a polypeptide-biosensor that binds only to the activated state (black L- shape), with an attached environmentally sensitive dye (open circle), can bind.
- the environmentally sensitive dye will emit light of a different wavelength, duration or intensity (filled circle) than before binding. Use of this type of environmentally sensitive dye is further illustrated in the Figures to follow.
- FIG. 7 illustrates what conditions will optimally provide FRET between GFP-Rac and Alexa-PBD in vitro.
- Figure 7 A shows fluorescence emission from solutions containing a fixed level of GFP-Rac bound to GTP ⁇ S at different concentrations of Alexa-PBD (PBD labeled with Alexa-546). Light at 480 nm was selectively used for GFP excitation, and direct (non-FRET) excitation of Alexa was subtracted from these spectra. In the absence of Alexa-PBD, the emission from GFP (peak at 508 nm) is maximal and no Alexa emission (peak at 568 nm) is seen.
- FIG. 8 illustrates how GFP-Rac expression levels and levels of intracellular Alexa-PBD (as observed by fluorescence) correlate with changes in normal cell behavior produced by these proteins.
- Figure 8A shows what levels of GFP-Rac expression, as measured by log GFP intensity per cell area, were correlated with ruffling.
- FIG. 9 illustrates the dynamics of Rac activation during growth factor stimulation of quiescent cells.
- Figure 9A provides photomicrographs showing Rac localization (GFP-Rac) and Rac activation (FRET) before stimulation of quiescent Swiss 3T3 fibroblasts.
- Figure 9B provides photomicrographs of the same Swiss 3T3 fibroblasts three minutes after addition of serum. Warmer or lighter colors correspond to higher intensity values.
- the cells showed accumulation of Rac at and around the nucleus before stimulation (GFP-Rac image). Most of the nuclear GFP-Rac was associated with the nuclear envelope. Serum or PDGF addition generated multiple moving ruffles that showed FRET, while no FRET was seen at the nucleus before or after stimulation. Of thirty- five cells stimulated with either serum or PDGF, thirty-one began ruffling within 15 minutes. FRET was seen in the ruffles of all but one of the ruffling cells.
- the ruffle in Figure 9B is shown in close-up in Figure 9C, visualized using FRET.
- PBD localization in the same region is visualized using Alexa fluorescence in Figure 9D, with scaling optimized for detection of the ruffle. Without prior knowledge of the ruffle's location, this localization would have been difficult to discern.
- the high background due to unbound PBD cannot be eliminated in Figure 9D and binding to other target proteins is not eliminated as it is in the highly specific FRET signal.
- intensities range between 300- 1100.
- the image of FRET before serum addition was scaled to demonstrate the low levels of FRET, with values ranging between 0 and 15.
- the ruffle contains the highest values of 40 to 65. Nuclear FRET was not seen in any of the cells examined.
- FIG. 10 illustrates Rac activation in motile Swiss 3T3 fibroblast cells.
- This figure shows two examples of where a Rac 1 activation gradient is formed, in confluent monolayer cells and in "wound healing" cells.
- High Racl activation occurred at the leading edge of motility, particularly in wound healing cells.
- high levels of Rac-GTP were frequently seen in the juxtanuclear region of the cell (Fig. 10A).
- the strong correlation of this gradient with the direction of movement indicates that activated Rac is spatially organized in polarized cells to help guide or propagate movement.
- Comparison of the GFP (Fig. 10 A) and FRET (Fig. 10B) images shows that the distribution of activated Rac does not parallel that of Rac 1 itself.
- FRET intensities are 0-18 (top image) and 0-32 (bottom image). In the GFP images (Fig. 10A), intensities range between 98-700 (top image) and 100-1100 (bottom image).
- FIG. 11 provides the structure of one of the present fluorescent dyes and the spectrum of fluorescence emission for that dye in water, methanol and butanol. As illustrated, the fluorescent emission of this dye increases with increasing solvent hydrophobicity. This figure illustrates the environmental- sensitivity of this dye.
- FIG. 12 provides the structure of another fluorescent dye of the present invention and shows its spectrum in aqueous solution, compared to similar dyes lacking the groups designed to prevent aggregation.
- the peak to the right is the unconjugated, highly fluorescent form of the dye, while that to the left is the weakly fluorescent form.
- the curve furthest to the right is the dye containing groups to prevent aggregation. As illustrated, the chosen groups help prevent aggregation of the dye.
- FIG. 13 provides one method for synthesizing a dye of the present invention. Conversion of compound 1 to an amine 2 followed by protection of the amine provides compound 3, which can be alkylated to give compound 4. Reaction of compound 4 with compound 9 provides compound 5, which can be deprotected to provide amine 6.
- CBD Wiscott-Aldrich syndrome protein
- FIG. 15 provides the intensity of fluorescence at various wavelengths observed when fluorescently labeled CBD binds to cdc42.
- cdc42 When cdc42 is activated with GTP ⁇ S, highly intense fluorescence is observed (line labeled "GTP ⁇ S"), compared to when no cdc42 is present (line labeled "no cdc42”), or when cdc42 is not activated (line labeled "GDP").
- FIG. 16 shows how the present methods can be used for in vitro assays on crude cellular lysates.
- the fluorescently labeled CBD was added to a neutrophil lysate.
- CBD Upon binding to activated cdc42, CBD will emit fluorescence of greater intensity.
- time zero fMLP which stimulates neutrophils to activate cdc42, was added to the cellular lysate and the amount of fluorescence generated by the lysate (•) was measured as a function of time.
- the maximal amount of fluorescence that could be obtained from the lysate was estimated by adding saturating levels of GTP ⁇ S (T), which would activate most or all of the cdc42 in the cellular lysate. In this manner the levels of cdc42 in a cellular population can be quantified.
- FIG. 17 provides photomicrographs of live cells injected with fluorescently labeled CBD.
- the lighter colors indicate where the activated cdc42 is present within the cells.
- the merocyanin dye (“mero") is an environmentally sensitive dye that will fluoresce at higher intensity upon binding of the CBD-mero conjugate to activated cdc42.
- the intensity of fluorescence emitted by a non-environmentally sensitive fluorophore (Alexa) linked to CBD was determined relative to the intensity of fluorescence emitted by the CBD-mero fluorophore. The ratio of the two permitted background fluorescence intensity to be subtracted so that the fluorescence from activated cdc-42 could be localized with greater precision.
- FIG. 18 illustrates the affinity of the labeled leucine zipper peptide biosensor for the leucine peptide tag as determined by equilibrium fluorescence titration, which monitored the changes in anisotropy (o) and fluorescence intensity (•) as the amount of tag binding peptide was increased.
- the labeled biosensor showed a drop in quantum yield and a more than 230% increase in rhodamine anisotropy, indicating considerable reduction in rotation of the dye.
- FIG. 19 provides photomicrographs of the same cell with visualization of ⁇ -actinin by fluorescently labeled GFP- ⁇ -actinin and a rhodamine peptide biosensor of the invention.
- Cos-7 cells were transfected with an ⁇ -actinin construct with GFP fused to the N-terminus and the tag peptide on the C- terminus.
- the tag peptide and the rhodamine-peptide biosensor bound as illustrated in Figure 18.
- the rhodamine-peptide biosensor was injected into these cells and ⁇ -actinin localization was visualized using GFP or rhodamine fluorescence.
- Figures 19a and 19c show GFP images and Figures 19b and 19d show rhodamine images taken of the same cells.
- the similar fluorescence distribution in the GFP image ( Figurel9a) and rhodamine image ( Figurel9b) demonstrate labeling of ⁇ -actinin with a high degree of specificity.
- FIG. 20 provides photomicrographs of a different cell than is shown in
- FIG. 21 is a representative example from control experiments in which cells were transfected with the GFP construct described in Figure 18, but not injected with rhodamine peptide.
- Figure 21a shows GFP fluorescence and Figure 21b shows rhodamine fluorescence, taken under exposure conditions and with fluorescence levels similar to those in Figures 19 and 20.
- FIG. 22 provides photomicrographs illustrating fluorescent labeling of an endoplasmic reticulum membrane protein in vivo.
- a subunit of the Fc receptor (F c ⁇ RI ⁇ ) a protein which spans the endoplasmic reticulum membrane, was tagged with .
- Cells were cotransfected with an MHC-GFP fusion protein as an endoplasmic reticulum marker, and Fc receptor fused to the peptide tag. The cells were then injected with the rhodamine-labeled peptide and imaged in both rhodamine and GFP channels.
- Figure 22a shows the GFP fluorescence of the MHC marker
- Figure 22c shows the rhodamine fluorescence of the tagged
- F c ⁇ RI ⁇ receptor The images from Figures 22a and c are merged in Figure22b.
- FIG. 23 shows the fluorescence of the ERK2-dye construct under different conditions.
- ERK2 was activated with MEK for 0-60 min, as indicated in the figure.
- Mg and ATP were added, ERK2 was phosphorylated; no such phosphorylation was observed when no Mg, ATP or MEK was present.
- the data shown here demonstrate that MEK can interact with the labeled protein.
- FIG. 24 shows the fluorescence intensity as a function of wavelength for ERK2 when ERK2 is phosphorylated and unphosphorylated. Approximately 1.6- fold increase in emission was observed, when the Erk2 was phosphorylated.
- FIG. 25 shows the fluorescence of ERK2, in the presence and absence of MEK, as a function of time of incubation with MEK. No substantial Erk2 fluorescence was observed when MEK was not present. This result demonstrated the suitability of the present methods for detecting activation of ERK2 in live cells.
- Alkylene, alkenylene, alkynylene, etc. denote both straight and branched groups; but reference to an individual radical such as “propylene” embraces only the straight chain radical; a branched chain isomer such as "isopropylene” being specifically referred to.
- Aryl denotes a phenyl radical or an ortho-fused bicyclic carbocyclic radical having about nine to ten ring atoms in which at leasj one ring is aromatic.
- amino acid includes the residues of the natural amino acids (e.g. Ala, Arg, Asn, Asp, Cys, Glu, Gin, Gly, His, Hyl, Hyp, He, Leu, Lys, Met, Phe, Pro, Ser, Thr, Tip, Tyr, and Nal) in D or L form, as well as unnatural amino acids (e.g.
- the term also includes natural and unnatural amino acids bearing a conventional amino protecting group (e.g.
- acetyl or benzyloxycarbonyl as well as natural and unnatural amino acids protected at the carboxy terminus (e.g. as a ( -C ⁇ alkyl, phenyl or benzyl ester or amide).
- suitable amino and carboxy protecting groups are known to those skilled in the art (See for example, T.W. Greene, Protecting Groups In Organic Synthesis; Wiley: New York, 1981, and references cited therein).
- peptide includes any sequence of 2 or more amino acids.
- the sequence may be linear or cyclic.
- a cyclic peptide can be prepared or may result from the formation of disulfide bridges between two cysteine residues in a sequence.
- the term includes proteins, enzymes, antibodies, oligopeptides, and polypeptides.
- Peptide sequences specifically recited herein are written with the amino terminus on the left and the carboxy terminus on the right.
- An "aminooxy group” is a group having the following formula
- a “secondary aminooxy group” is an aminooxy group where one of the open valences on the nitrogen is filled by a radical other than a hydrogen.
- the term "functional molecule” includes any compound that can be linked to a peptide to provide a peptide conjugate having useful properties. Such conjugates may be useful for studying the structure or function of the peptide, or a polypeptide, antibody, antigen or other protein. Such conjugates can also be used for therapeutic treatments and diagnoses. Functional molecules linked to peptides by the present methods can be used in any assay, procedure or tracing protocol known to one of skill in the art. The functional molecules may also be used with biosensors as contemplated below.
- Peptide-conjugates with such functional molecules may be useful for drug screening, as pharmacological tools, as research tools, or as therapeutic agents.
- the term functional molecule includes labels, dyes, ESR probes, reporting groups, biophysical probes, peptides, polynucleotides, therapeutic agents, pharmaceuticals, toxins, cross-linking groups (chemical or photochemical), a compound that modifies the biological activity of the peptide, or a caged molecule (e.g. a reporting molecule or a biologically active agent that is masked and that can be unmasked by photoactivation or chemical means).
- biophysical probe includes any group that can be detected in vitro or in vivo, such as, for example, a fluorescent group, a phosphorescent group, a nucleic acid indicator, an ESR probe, another reporting group, a moiety, or a dye that is sensitive to pH change, ligand binding, or other environmental aspects.
- amino acids and peptides that include one or more aminooxy groups are useful intermediates for preparing peptide conjugates.
- the aminooxy group(s) can typically be positioned at any suitable position on the amino acid or peptide.
- the aminooxy group(s) can conveniently be incorporated into the side chain of the amino acid or into one or more side chains of the peptide.
- a radical comprising one or more aminooxy groups includes any organic group that can be attached to the amino acid or peptide that includes one or more aminooxy groups.
- the term includes a carbon chain having two to ten carbon atoms; which is optionally partially unsaturated (i.e.
- cross-linking group refers to any functionality that can form a bond with another functionality, such as photoaffmity label or a chemical crosslinking agent.
- damaged molecule includes a molecule or reporter group that is masked such that it can be activated (i.e. unmasked) at a given time or location of choice, for example using light or a chemical agent.
- (C 1 -C 6 )alkylene can be methylene, ethylene, propylene, isopropylene, butylene, iso-butylene, sec-butylene, pentylene, or hexylene;
- (C 3 ⁇ C 8 )cycloalkyl can be cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, or cyclooctyl;
- (C 2 -C 6 )alkenylene can be vinylene, allylene, 1- propenylene, 2-propenylene, 1-butenylene, 2-butenylene, 3-butenylene, 1,- pentenylene, 2-pentenylene, 3-pentenylene, 4-pentenylene, 1 -hexenylene, 2- hexenylene, 3-hexenylene, 4-hexenylene, or 5-hexenylene;
- R ,3 is hydrogen, (C 1 -C 6 )alkyl, an amino protecting group, or a radical comprising one or more aminooxy groups;
- R 4 is hydrogen, or an amino protecting group;
- R 5 is hydrogen, or ( -C ⁇ alkyl.
- a specific value for R 1 is hydrogen or benzyloxycarbonyl.
- a specific value for R 2 is hydrogen.
- a specific value for R 3 is methyl.
- a specific value for R 4 is hydrogen, 2-chlorobenzyloxycarbonyl, or benzyloxycarbonyl.
- a specific value for R 5 is hydrogen.
- a specific value for R 6 is an antibody.
- a specific value for R 6 is a peptide or polypeptide or antibody that includes about 2 to about 1000 amino acids.
- a more specific value for R 6 is a peptide that includes about 5 to about 500 amino acids.
- An even more specific value for R 6 is a peptide that includes about 10 to about 100 amino acids.
- X is a linking group that is about 5 angstroms to about 100 angstroms in length. More specifically, X is a linking group of about 5 angstroms to about 25 angstroms in length.
- each of R a and R is methylene (- CH 2 -).
- a preferred value for R 6 is KKKEKERPEISLPSDFEHTIHNGF DACTGEFTGMPEQWARLLQT (SEQ ID ⁇ O: 1) or an antibody.
- a specific value for R 7 is hydrogen.
- Another specific value for R 7 is (C 1 -C 6 )alkyl.
- a preferred value for R 7 is methyl.
- Y is a linking group that is about 5 angstroms to about 100 angstroms in length. More specifically, Y is a linking group of about 5 angstroms to about 25 angstroms in length.
- a specific value for Y is ( -C ⁇ alkylene.
- a preferred value for Y is methylene (-CH 2 -).
- Fluorescent Dyes Any fluorescent dye known to one of skill in the art is contemplated by the present invention as a functional molecule.
- a fluorescent dye can be excited to fluoresce by exposure to a certain wavelength of light.
- the dye is preferably environmentally sensitive.
- environmentally sensitive means that the signal from the functional molecule changes when the peptide, polypeptide or antibody interacts with, or becomes exposed to, a different environment.
- the environmentally sensitive functional molecule is a fluorescent dye, the fluorescence from that fluorescent dye will change as the environment changes.
- an environmentally sensitive fluorescent dye attached to a peptide, polypeptide or antibody will fluoresce differently upon target binding by the peptide, polypeptide or antibody to which the dye is attached.
- Any dye which emits fluorescence and whose fluorescence changes when the pH or the hydrophilicity/hydrophobicity of the environment changes is an environmentally sensitive dye contemplated by the present invention.
- Preferred fluorescent groups include molecules that are capable of absorbing radiation at one wavelength and emitting radiation at a longer wavelength, such as, for example, Alexa-532, Hydroxycoumarin, Aminocoumarin, Methoxycoumarin, Coumarin, Cascade Blue, Lucifer Yellow, P-Phycoerythrin, R-Phycoerythrin, (PE), PE-Cy5 conjugates, PE-Cy7 conjugates, Red 613, Fluorescein, BODIPY-FL, BODIPY TR, BODIPY TMR, Cy3, TRITC, X-Rhodamine, Lissamine Rhodamine B, PerCP, Texas Red, Cy5, Cy7, Allophycocyanin (APC), TruRed, APC-Cy7 conjugates, Oregon Green, Tetramethylrhodamine, Dansyl, Dansyl aziridine, Indo-1, Fura-2, FM 1-43, DilC18(3), Carboxy-SNARF-1, NBD, Indo-1, Fluo-3, DCFH,
- Coumarin fluorescent dyes include, for example, amino methylcoumarin, 7-diethylamino-3-(4'-(l-maleimidyl)phenyl)- 4-methylcoumarin (CPM) and N-(2-(l-maleimidyl)ethyl)7- diethylaminocoumarin-3-carboxamide (MDCC).
- Preferred fluorescent probes are sensitive to the polarity of the local environment and are available to those of skill in the art.
- useful functional molecules include those that display fluorescence resonance energy transfer (FRET). Many such donor-acceptor pairs are known, and include fluorescein to rhodamine, coumarin to fluorescein or rhodamine, etc. Still another class of useful label pairs include fluorophore- quencher pairs in which the second group is a quencher, which decreases the fluorescence intensity of the fluorescent group. Some known quenchers include acrylamide groups, heavy atoms such as iodide and bromate, nitroxide spin labels such as TEMPO, etc. These can be adapted for use as environmentally sensitive functional molecules of biosensors.
- FRET fluorescence resonance energy transfer
- Exemplary fluorescent proteins which can be used to label the present peptides, polypeptides and antibodies include green fluorescent protein (GFP), cyan fluorescent protein (CFP), red fluorescent protein (RFP), yellow fluorescent protein (YFF), enhanced GFP (EGFF), enhanced YFP (EYFP), and the like.
- GFP green fluorescent protein
- CFP cyan fluorescent protein
- RFP red fluorescent protein
- YFF yellow fluorescent protein
- EGFF enhanced GFP
- EYFP enhanced YFP
- the present invention also provides novel fluorescent dyes that retain high fluorescence emission after conjugation to other molecules and avoid problems of aggregation and insolubility. These dyes are particularly preferred for many of the imaging methods and conjugates contemplated but need not be restricted to use in the methods and conjugates contemplated herein.
- each R 13 is alkyl, branched alkyl or heterocyclic ring derivatized with charged groups to enhance water solubility and enhance photostability;
- R 9 and R 10 are chains carrying charged groups to enhance water solubility (i.e. sulfonate, amide, ether) and/or chains bearing reactive groups for conjugation to other molecules.
- the reactive group is a functional group that is chemically reactive (or that can be made chemically reactive) with functional groups typically found in biological materials, or functional groups that can be readily converted to chemically reactive derivatives using methods well known in the art.
- the charged and reactive groups are carboxylic acid (COOH), or derivatives of a carboxylic acid.
- An appropriate derivative of a carboxylic acid includes an alkali or alkaline earth metal salt of carboxylic acid.
- the charged and reactive groups are reactive derivatives of a carboxylic acid (-COORx), where the reactive group Rx is one that activates the carbonyl group of -COORx toward nucleophilic displacement.
- Rx is any group that activates the carbonyl towards nucleophilic displacement without being incorporated into the final displacement product.
- COORx ester of phenol or naphtol that is further substituted by at least one strong electron withdrawing group, or carboxylic acid activated by carbodiimide, or acyl chloride, or succinimidyl or sulfosuccinimidyl ester.
- Additional charged and reactive groups include, among others, sulfonyl halides, sulfonyl azides, alcohols, thiols, semicarbazides, hydrazines or hydroxy lamines.
- any net positive or negative charges possessed by the dye are balanced by a biologically compatible counterion or counterions.
- a substance that is biologically compatible is not toxic as used, and does not have a substantially deleterious effect on biomolecules.
- useful counterions for dyes having a net negative charge include, but are not limited to, alkali metal ions alkaline earth metal ions, transition metal ions, ammonium and substituted ammonium ions.
- useful counterions for dyes having a net positive charge include, but are not limited to chloride, bromide, iodide, sulfate, phosphate, perchlorate, nitrate, tetrafluoroborate.
- R 9 and R 10 chains for conjugation are alkyl, of unlimited length, preferably with 1-6 carbons, and can include other moieties such as ether, amide, or sulfonate to improve water solubility.
- the groups can be substituted on the end or in the middle of the alkyl chain.
- the fluorescent dye of the present invention has the following structure (Nl):
- the fluorescent dye of the present invention has the following structure (Nil):
- the fluorescent dye of the present invention has the following structure (Nfll):
- the fluorescent dyes of the present invention can exist in somewhat different polarization states. This property can modulate the solubility and the emission wavelength of the dye.
- the fluorescent dye depicted below can be charged or non-charged.
- the fluorescent dyes of the present invention can absorb and emit light at a variety of wavelengths, depending on the arrangement and variety of substituents employed.
- substituents of the present invention one of skill in the art can readily ascertain which combination of substituents will yield a fluorescent dye with a desired absorption and emission spectrum.
- the degree of conjugation of the dye, and in particular, the length of the alkylene chain connecting the two rings, can predictably influence the absorption and emission wavelength of the dye.
- Smaller incremental changes in the emission wavelength can be made by adding a conjugated group to one of the rings in the dye.
- the absorption and emission wavelengths can be altered to range from about 300 nm to about 800 nm.
- the absorption and emission wavelengths of the present dyes range from about 450 nm to higher wavelengths. Any variety of methods can be used to make the present dyes.
- Preferred nucleic acid indicators include intercalating agents and oligonucleotide strands, such as, for example, YOYO-1, Propidium Iodide, Hoechst 33342, DAPI, Hoerchst 33258, SYTOX Blue, Chromomycin A3, Mithramycin, SYTOX Green, SYTX Orange, Ethidium Bromide, 7-AAD, Acridine Orange, TOTO-1, TO-PRO-1, Thiazole Orange, Propidium Iodide, TOTO-3, TO-PRO-3, LDS 751.
- intercalating agents and oligonucleotide strands such as, for example, YOYO-1, Propidium Iodide, Hoechst 33342, DAPI, Hoerchst 33258, SYTOX Blue, Chromomycin A3, Mithramycin, SYTOX Green, SYTX Orange, Ethidium Bromide, 7-AAD, Acridine
- the synthetic intermediates (i.e. synthons) of the invention that include one or more aminooxy groups can be incorporated into peptides using a variety of techniques that are known in the art.
- the synthons can be incorporated into a peptide using solid-phase peptide synthesis, solution-phase peptide synthesis, native chemical ligation, intein-mediated protein ligation, and chemical ligation.
- Peptides may be prepared using solid-phase peptide synthesis (SPPS).
- SPPS solid-phase peptide synthesis
- protected amino acids in organic solvents can be added one at a time to a resin-bound peptide chain, resulting in the assembly of a target peptide having a specific sequence in fully-protected, resin-bound form.
- the product peptide can then be released by deprotection and cleavage from the resin support (Wade, L.G., JR., Organic Chemistry 4th Ed. (1999)).
- amino acids containing an aminooxy functional group can be incorporated into peptides using SPPS. Use of this methodology allows an amino acid containing an aminooxy functional group to be positioned at a desired location within a synthesized peptide chain.
- Amino acids containing an aminooxy group can also be incorporated into a peptide using solution-phase peptide synthesis (Wade, L.G., JR. Organic Chemistry 4th Ed. (1999)).
- Solution-phase peptide synthesis involves protecting the amino-terminus of a peptide chain followed by activation of the carboxyl- terminus allowing the addition of an amino acid or a peptide chain to the carboxy-terminus (Wade, L.G., JR. Organic Chemistry 4th Ed. (1999)).
- Native chemical ligation is a procedure that can be used to join two peptides or polypeptides together thereby producing a single peptide or polypeptide having a native backbone structure.
- Native chemical ligation is typically carried out by mixing a first peptide with a carboxy-terminal ⁇ - thioester and a second polypeptide with an amino-terminal cysteine (Dawson, P.E., et al, (1994), Science 266:776-779; Cotton, G.J., et al, (1999), J. Am. Chem. Soc. 121 :1100-1101).
- the thioester of the first peptide undergoes nucleophilic attack by the side chain of the cysteine residue at the amino terminus of the second peptide.
- the initial thioester ligation product then undergoes a rapid intramolecular reaction because of the favorable geometric arrangement of the alpha-amino group of the second peptide. This yields a product with a native peptide bond at the ligation site.
- a polypeptide beginning with cysteine can be chemically synthesized or generated by intein vectors, proteolysis, or cellular processing of the initiating methionine. This method allows mixing and matching of chemically synthesized polypeptide segments.
- the synthons of the invention are particularly useful in combination with native chemical ligation, because native chemical ligation allows a synthetic peptide having a specifically positioned amino acid (e.g. a synthon of the invention) to be selectively ligated to other peptides or into a larger polypeptide, antibody or protein.
- a synthetic peptide having a specifically positioned amino acid e.g. a synthon of the invention
- the ability to specifically incorporate aminooxy modified amino acids into a peptide chain allows useful moieties to be linked at any position within a peptide, polypeptide, antibody or protein.
- Another advantage of native chemical ligation is that it allows incorporation of peptides into a polypeptide that are unable to be added by ribosomal biosynthesis.
- Intein-mediated protein ligation may also be used to selectively place amino acids containing aminooxy functional groups into peptides.
- Inteins are intervening sequences that are excised from precursor proteins by a self-catalytic mechanism and thereby expose reactive ends of a peptide.
- Intein vectors have been developed that not only allow single-step purification of proteins, but also yield polypeptides with reactive ends necessary for intein-mediated protein ligation (IPL) (also called expressed protein ligation)(EPL) (Perler, F.R. and Adam, E., (2000) Curr. Opin. Biotechnol. ll(4):377-83; and Evans, T.C., et al., (1998) Protein Sci 7:2256-2264).
- IPL intein-mediated protein ligation
- EPL expressed protein ligation
- This method allows a peptide having a selectively placed amino acid containing an aminooxy functional group to be readily ligated to any peptide with reactive ends generated by intein excision.
- Two peptides or polypeptides may also be linked through use of chemical ligation. Chemical ligation occurs when two peptide segments are each linked to functional groups that react with each other to form a covalent bond producing a non-peptide bond at the ligation site (Wilken, J. and Kent, S.B.H., (1998) Curr. Opin. Biotechnol. 9:412-426).
- This method can be used to ligate a peptide having a specifically positioned aminooxy functional group to another peptide or polypeptide to produce a desired polypeptide that may be later linked to a detectable group.
- the structure of the linking group is not crucial, provided it does not interfere with the use of the resulting labeled peptide.
- Preferred linking groups include linkers that separate the aminooxy nitrogen and the detectable group by about 5 angstroms to about 100 angstroms. Other preferred linking groups separate the aminooxy nitrogen and the detectable group by about 5 angstroms to about 25 angstroms.
- Such a linkage can be formed from suitably functionalised starting materials using synthetic procedures that are known in the art.
- the aminooxy group can be attached to a peptide through a direct bond (e.g. a carbon-oxygen bond) between the aminooxy oxygen and a side chain of the peptide, or the aminooxy group can be attached to the peptide through a linking group.
- the structure of the linking group is not crucial, provided it does not interfere with the use of the resulting labeled peptide.
- Preferred linking groups include linking groups that separate the aminooxy oxygen and the side chain of the peptide by about 5 angstroms to about 100 angstroms. Other preferred linking groups separate the aminooxy oxygen and the side chain of the peptide by about 5 angstroms to about 25 angstroms.
- a specific Unking group (e.g. X or Y) can be a divalent (C ⁇ -C 6 )alkylene, (C -C 6 )alkenylene, or (C 2 -C 6 )alkynylene chain, or a divalent (C 3 -C 8 )cycloalkyl, or aryl ring.
- Biosensors Using the methods of the present invention with the synthons and peptides provided herein, antibodies, antigens and other polypeptides can be labeled with or attached to functional molecules. Such labeled or conjugated antibodies and polypeptides have particular utility as biosensors.
- a "biosensor” is a peptide, antigen, polypeptide or antibody with an attached functional molecule.
- the functional molecule is a label or dye, however, as used herein, a biosensor can have any functional molecule attached thereto.
- the functional molecule can be a label, dye, biophysical probe, peptide, polynucleotide, therapeutic agent, pharmaceutical, toxin, cross-linking group (chemical or photochemical), a compound that modifies the biological activity of the peptide, or a caged molecule (e.g. a reporting molecule or a biologically active agent that is masked and that can be unmasked by photoactivation or chemical means).
- a caged molecule e.g. a reporting molecule or a biologically active agent that is masked and that can be unmasked by photoactivation or chemical means.
- the functional molecule is dye or label.
- a dye or label can be an environmentally-sensitive fluorescent dye such that fluorescence is emitted by the dye can change when the protein biosensor becomes exposed to a different environment. Such a change in environment can occur, for example, when the biosensor binds to, or associates with, a target protein or cellular structure. The change in fluorescence can be used to quantify or otherwise monitor the amount of binding or interaction between the biosensor and the target site.
- the Examples provided herein further illustrate how such a biosensor can be used.
- the present invention provides methods for identifying an optimal position for the functional molecule on the peptide, polypeptide or antibody which involve generating a series of peptides, each peptide have the same amino acid sequence and functional molecule.
- the functional molecule is positioned at a different location along the backbone of each peptide in the series. To determine which location is best, the strength of the signal from the various peptides is observed under different conditions and the optimal location provides optimal functioning by the functional molecule and the peptide, polypeptide or antibody. For example, when the functional molecule provides a signal, a stronger signal is preferred so long as the function and the chemical and physical properties of the peptide, protein or antibody are not impaired. When an environmentally sensitive functional molecule is chosen, a maximal change in signal is preferred as the environment is changed.
- the environmentally sensitive functional molecule when attached to detect an interaction of the peptide with a target, a maximal change in signal is preferred when the peptide binds or interacts with its target, unless of the location of the functional molecule affects the binding affinity, binding selectivity or another desirable attribute of the peptide.
- an optimal location for a functional molecule in an antibody or polypeptide which can bind to a target a series of peptides are first synthesized, each with the functional molecule at a different position.
- the peptides can be incorporated into the polypeptide or antibody using the methods described herein to generate a series of biosensors, each with a functional molecule at a somewhat different position.
- the interaction of the different polypeptide or antibody biosensors with target is observed.
- an optimal position for the functional molecule on such a biosensor is that position which permits stable and selective binding to target with a maximal signal change upon binding.
- the strength of binding between the biosensor and target should be sufficient to permit observation of bound biosensor. If the biosensor is only transiently bound, little or no localized signal from the probe may be observed; instead, only diffuse signal from biosensor in solution may be observed. Similarly, if the biosensor is bound non-selectively, non-localized signal may be detected from many sites. Obviously, a strongly localized signal that clearly correlates with biosensor binding to target is preferred. A readily detectable change in signal strength or quality as the biosensor and target interact is also preferred.
- Procedures known to one of skill in the art can be used to detect a signal provided by the functional molecule and to correlate a change in signal by an environmentally sensitive functional molecule.
- Signals contemplated by the present invention include fluorescent emissions, radioactive emissions, enzymatic production of a colored product, and the like.
- One of skill in the art can readily detect these signals using a fluorescence microscope, a scintillation counter, a light or radioactively sensitive photoemulsion, a light microscope, a spectrophotometer or other means.
- the signal can change in lifetime, strength, color or other quality to signal interaction of the functional molecule with the environment.
- the signal change can be a color, wavelength, intensity or lifetime of fluorescence emitted by the dye.
- the change need only be detectable, for example, a change in wavelength of fluorescence of about 50 nm to about 300 nm can be readily detected. However, a change in wavelength of greater than about 10 nm is preferred. More preferably the change in wavelength is greater than 20 nm. In one embodiment the change in wavelength can vary from about 30 nm to about 200 nm.
- a peptide as opposed to a polypeptide or antibody, with an attached functional molecule may be a biosensor, for example, when the binding affinity and selectivity of the peptide is representative of the larger protein of which it is normally a part.
- the labeled peptide can be ligated into a polypeptide to form the protein or antibody of which it is normally a part using the methods described herein.
- the peptide is incorporated onto one of the termini of a protein, for example, through procedures described in Curr. Op. Biotechnology 9:412 (1998) or Ann. Rev. Biochem. 57:957-89 (1988).
- the peptide can be incorporated into the middle of a protein, for example, by using the procedures described in PNAS 95:6705 (1998).
- a "target” is any molecule, structure or complex that a peptide, polypeptide or antibody linked to a functional molecule by the present methods can interact with.
- Targets contemplated by the present invention include antigens, antibodies, proteins, enzymes, membrane proteins, endoplasmic reticulum proteins, structural proteins, major histocompatibility proteins, DNA binding proteins, receptors, ligands, cofactors, nucleic acids, kinases, GTPases, ATPases, proteins involved in motility and the like.
- Targets may undergo structural changes and other types of changes, for example, phosphorylation, de-phosphorylation, conformational changes, ligand binding, co-factor binding, activation, post-translational modification, carbohydrate or sugar attacliment, membrane interactions and the like.
- Specific targets include calmodulin, Rho GTPases, rac, cdc42, mitogen-activated protein kinase (MAP kinase), Erkl, Erk2, Erk3, Erk4, IgE receptor (F c RI) actin, ⁇ -actinin, myosin, and maj or histocompatibility proteins.
- Targets can have "tag" sequences that permit binding of a biosensor or labeled polypeptide to the target.
- a "tag” is any binding site for a biosensor.
- a tag is a peptide or polypeptide segment that is recognized by the biosensor and to which the biosensor will bind with sufficient binding affinity to permit detection and/or visualization of the target. Any protein binding domain or ligand binding site of a receptor can be used.
- a tag can be, for example, an antigenic epitope to which an antibody can bind, a part of a leucine-zipper to which another part of a leucine zipper can bind, a domain of a homeotic protein that mediates binding to a DNA site, receptor- ligand binding site.
- the dimerizing domain from yeast GCN4 protein can also be used to form a tag-biosensor dimer.
- the GCN4 dimerizing domain is a single a-helix which pairs with its partner to form a parallel coiled-coil (O'Shea, Rutkowski, Stafford and Kim, Science, 245, 646, (1989)).
- the X-ray crystal structure of the GCN4 coiled-coil has been determined (O'Shea, Klemm, Kim and Alber, Science, 254, 539, (1991)), and factors affecting stability and oligomerization state of native and mutant GCN4 coiled-coil peptides have been determined (Harbury, Zhang, Kim and Alber, Science, 262, 1401, (1993); O'Neil, Hoess and DeGrado, Science, 249, 774, (1990)).
- Tag-biosensor dimer can be formed from the binding domain from the Arc repressor of bacteriophage P22 (Schildbach, J F, Milla M E, Jeffrey PD, Raumann BE, Sauer RT (1995). Biochemistry 34: 13914-19).
- Arc repressor is a dimeric polypepfide of 53 amino acids.
- a tag-biosensor dimmer can also be fo ⁇ ned from the C-terminal tetramerizing domain from the tumor suppressor p53. The structure of this domain has been determined from the crystal Jeffrey, Gorina and Pavletich, Science, 267, 1498, (1995)) and in solution (Clore et al., Nature Struct. Biol., 2, 321, (1995)).
- the Mnt repressor of bacteriophage P22 (Waldburger, C. D. and R. T. Sauer (1995). Biochemistry
- the Mht repressor polypeptide and streptavidin-avidin can be used to form tag-biosensor dimers.
- Streptavidin Argonavidin (Argarana, C, Kuntz, I.D., Birken, S, Axel, R. and Cantor, C. R. (1986) Nucleic Acids Res. 14:1871)
- avidin Green, N. M. (1975) Adv. Protein Chem. 29:85
- Biotin ligase BLS
- BLS Biotin ligase
- BLS polypeptide sequences have been described for various proteins: for example, the C-terminal 87 residues of the biotin carboxy carrier protein of Escherichia coli acetyl-CoA carboxylase (Chapman-Smith, A., D. L. Turner, et al. (1994). Biochem J. 302: 881-7).
- the C-terminal 67 residues of carboxyl- terminal fragments of human propionyl-CoA carboxylase alpha subunit may be used (Leon-Del-Rio, A. and R. A. Gravel (1994) J. Biol. Chem.
- tag sequences can be present naturally or can be added to the target by methods available to one of skill in the art.
- Different targets within a single cell can have different tags to which different biosensors can bind. This permits visualization of two or more targets within the same cell so that the interaction and dynamic interplay between targets can be observed in relation to other cellular structures.
- biosensors can also be designed to undergo fluorescence resonance energy transfer (FRET) when they become juxtaposed at an appropriate distance.
- FRET fluorescence resonance energy transfer
- a target can be engineered to have two different tags so that two different biosensors can bind to the same target.
- Tag sequences can be added to a target protein, for example, by protein ligation procedures described herein or by standard molecular biology techniques where a peptide or polypeptide is fused to another peptide or polypeptide. See, e.g., Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Plainview, NY.).
- the target can be an antigen.
- an antigen or a peptide epitope can serve as a biosensor for an antibody target.
- the present invention contemplates use or detection of any antigen or antibody known to one of skill in the art as a target.
- a molecule In general, a molecule must have sufficient complexity and sufficient molecular weight in order to act as an antigen. In order to have sufficient complexity, the antigen must have at least one epitope.
- epitope As used in this invention, the term “epitope” is meant to include any determinant capable of specific interaction with the monoclonal antibodies of the invention. Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics.
- the antigen In order to have a sufficient molecular weight, the antigen generally must have a molecular weight that is greater than 2,000 daltons. Formerly, it was thought that the lower molecular weight limit to confer antigenicity was about 5,000 daltons. However, antigenicity has recently been demonstrated with molecules having molecular weights as low as 2,000 daltons. Molecular weights of 3,000 daltons and more appear to be more realistic as a lower limit for immunogenicity, and approximately 6,000 daltons or more is preferred. In preparing antigens to produce antibodies for attachment to functional molecule, it is desirable to use antigens with a high degree of purity. Accordingly, it is desirable to use a purification process permitting isolation of the antigen from antigenically distinct materials.
- Antigenically distinct materials are undesired large molecules that may compete with the target antigen for antibody production thereby minimizing production of the desired antibodies or inducing cross-reactive antibodies of low specificity or affinity.
- the practice of the invention can accordingly include a number of purification steps using available techniques. Purification can, for example, be effected by size exclusion chromatography, ion exchange chromatography, dialysis, cold organic solvent extraction, gel electrophoresis and/or fractional crystallization means which are available to one of skill in the art.
- an antigen used for antibody preparation is at least about 90% pure and more preferably at least about 99% pure.
- the present invention contemplates linkage of any available antibody to functional molecules.
- Such antibodies can be polyclonal or monoclonal antibodies.
- antibody as used in this invention is meant to include intact antibody molecules as well as fragments thereof, such as, for example, Fab and F(ab') 2 , which are capable of binding to the antigen or its epitopic determinant.
- Polyclonal antibodies can be raised by administration of an antigen of the invention to vertebrate animals, especially mammals such as goats, rabbits, rats or mice using known immunization procedures. Usually a buffered solution of the antigen accompanied by Freund's adjuvant is injected subcutaneously at multiple sites. A number of such administrations at intervals of days or weeks is usually necessary.
- the carrier material can be a natural or synthetic substance, provided that it is an antigen or a partial antigen.
- the carrier material can be a protein, a glycoprotein, a nucleoprotein, a polypeptide, a polysaccharide, a lipopolysaccharide, or a polyamino acid.
- a preferred class of natural carrier materials is the proteins. Proteins can be expected to have a molecular weight in excess of 5,000 daltons, commonly in the range of from 34,000 to 5,000,000 daltons. Specific examples of such natural proteins are hen ovalbumin (OA), bovine serum albumin (BSA), keyhole limpet hemocyanin (KLH), horse gammaglobulin (HGG), and thyroglobin.
- OA ovalbumin
- BSA bovine serum albumin
- KLH keyhole limpet hemocyanin
- HOG horse gammaglobulin
- thyroglobin thyroglobin
- synthetic carrier is the polyamino acid, polylysine.
- the synthetic antigen comprises a partially antigenic carrier conjugated with a hapten
- the natural carrier has some solubility in water or aqueous alcohol.
- the carriers are nontoxic to the animals to be used for generating antibodies.
- the carrier can be coupled to antigens by any available means, included the procedures provided herein.
- a carrier moiety has a plurality of hapten or antigen moieties coupled to it, for example, about 15 to 30 for a protein of 100,000 daltons. While steric hindrance and reduced structural complexity may reduce the number of haptens or antigens attached to the carrier, the maximum number is preferred. For example, up to about 25 to about 50 hapten moieties can be coupled to BSA carriers.
- monoclonal antibodies as biosensors of this invention is preferred because monoclonal antibodies are homogeneous and can be continuously produced in large quantities.
- Monoclonal antibodies are prepared by recovering lymph node or spleen cells from immunized animals and immortalizing the cells in conventional fashion, e.g., by fusion with myeloma cells or by Epstein-Barr virus transformation. Clones expressing the desired antibody are identified by screening cell line media for reactivity with the antigen used to immunize the animals.
- One of skill in the art can use readily available methods to make monoclonal antibodies, for example, by using the hybridoma technique described originally by Koehler and Milstein, Eur. J.
- the hybrid cell lines can be maintained in vitro in cell culture media.
- the cell lines producing the antibodies by these procedures can be selected and/or maintained in a medium containing hypoxanthine-aminopterin thymidine (HAT).
- HAT hypoxanthine-aminopterin thymidine
- hybrid cells lines can be stored and preserved in any number of conventional ways, including freezing and storage under liquid nitrogen. Frozen cell lines can be revived and cultured indefinitely with resumed synthesis and secretion of monoclonal antibody.
- the secreted antibody is recovered from tissue culture supernatant or ascites fluid by conventional methods such as immune precipitation, ion exchange chromatography, affinity chromatography such as protein A/protein G column chromatography, or the like.
- the antibodies described herein are also recovered from hybridoma cell cultures by conventional methods such as precipitation with 50% ammonium sulfate. If desired, the purified antibodies can then be sterile filtered before use.
- monoclonal antibody refers to any antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to polyclonal antibody preparations, which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they are synthesized by the hybridoma culture, uncontaminated by other immunoglobulins.
- the monoclonal antibodies herein also include hybrid and recombinant antibodies produced by splicing a variable (including hypervariable) domain of an anti-adduct antibody with a constant domain (e.g. "humanized” antibodies), or a light chain with a heavy chain, or a chain from one species with a chain from another species, or fusions with heterologous proteins, regardless of species of origin or immunoglobulin class or subclass designation, as well as antibody fragments (e.g., Fab, F(ab') 2 and Fv), so long as they exhibit the desired biological activity. See e.g. Cabilly et al. U.S. Pat. No. 4,816,567; Mage and Lamoyi, "Monoclonal Antibody Production Technique and Applications", pp. 79-97 (Marcel Dekker, Inc., New York, 1987).
- a variable domain of an anti-adduct antibody with a constant domain e.g. "humanized” antibodies
- the modifier "monoclonal” indicates the character of the antibody as being obtained from a substantially homogenous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
- the monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method described by Koehler and Milstein, supra, or may be made by recombinant DNA methods (Cabilly, et al. supra).
- the biosensor antibodies or the present invention are used for diagnostic or imaging purposes in vivo, within a mammalian subject. While the in vivo use of a monoclonal antibody from a foreign donor species in a different host recipient species is usually uncomplicated, an adverse immunological response by the host to antigenic determinants present on the donor antibody can sometimes arise. In some instances, this adverse response can be so severe as to curtail the in vivo use of the donor antibody in the host. Further, the adverse host response may serve to hinder the intercellular adhesion- suppressing efficacy of the donor antibody. Methods to avoid such adverse reactions are available.
- humanized antibodies or chimeric antibodies can be used.
- Chimeric antibodies are antibodies in which the various domains of the antibodies' heavy and light chains are coded for by DNA from more than one species.
- a chimeric antibody will comprise the variable domains of the heavy (N ⁇ ) and light V L ) chains derived from the donor species producing the antibody of desired antigenic specificity, and the constant domains of the heavy (C H ) and light (C L ) chains derived from the host recipient species.
- a chimeric antibody for in vivo clinical use in humans which comprises mouse N H and light N domains coded for by D ⁇ A isolated from ATCC HB X, and C H and CL domains coded for with D ⁇ A isolated from a human leukocyte.
- the present invention further provides a composition comprising an antibody with a functional molecule attached by the methods of the present invention and a suitable carrier. Further, the present invention also provides a therapeutic composition comprising an effective amount of the antibody- functional molecule conjugate produced by the present methods and a pharmaceutically acceptable carrier.
- the term "pharmaceutically acceptable carrier” encompasses any of the standard pharmaceutically accepted carriers, such as phosphate buffered saline solution, water, emulsions such as an oil/water emulsion or a triglyceride emulsion, various types of wetting agents, tablets, coated tablets and capsules.
- a pharmaceutically acceptable carrier such as phosphate buffered saline solution, water, emulsions such as an oil/water emulsion or a triglyceride emulsion, various types of wetting agents, tablets, coated tablets and capsules.
- An example of an acceptable triglyceride emulsion useful in intravenous and intraperitoneal administration of the compounds is the triglyceride emulsion commercially known as Intralipid RTM.
- Biosensors of the invention can be used in vitro or vivo. Biosensors can be used with any type of test sample, such as cultured cells, tissue samples, cell suspensions, cell lysates, partially purified isolates of a potential target and purified isolates of a potential target.
- a sample that includes cells can be in any form convenient for observation of the target, for example, cells plated on a culture dish, cells on a microscope slide, suspensions of cells, tissues in physiological or culture media or tissues on a microscope slide
- the biosensor is contacted with a sample that may contain a target of interest under conditions and for a time sufficient to permit interaction or binding of the biosensor to the target of interest.
- the biosensor can be contacted with sample that is in solution by simply mixing the biosensor into the solution.
- the biosensor can be injected into the cell or tissue.
- placing the needle into the region just adjacent to the nucleus produced a good combination of efficient injection and cell health.
- the cell or tissue can be transfected or transformed with a nucleic acid capable of expressing the biosensor.
- One of skill in the art can use readily available procedures for injecting and transfecting cells with such biosensors.
- Conditions sufficient to permit interaction of the biosensor with target are generally conditions that permit protein-protein interactions.
- a temperature sufficient to permit protein-protein interactions is a temperature that maintains and encourages secondary and tertiary polypeptide structure formation.
- the temperature can be about 4°C to about 40°C, and preferably a temperature of about 4°C to about 37°C.
- the temperature is preferably a temperature which maintains cellular function, for example, a temperature of about 20°C to about 38°C.
- a time sufficient for interaction of the biosensor with a target can be determined by one of skill in the art. Such a time can be, for example, about 1 minute to about 2 hours, preferably about 3 minutes to about one hour. In one experiment, visualization of biosensor-target interaction was successfully performed after cells were given about 5-10 minutes to recover after injection.
- a test peptide containing both a secondary aminooxy group and nucleophilic amino acids that were most likely to interfere with selective labeling at the aminooxy nitrogen (lysine, cysteine, and the amino-terminus) was prepared.
- NH 2 -AKAARAAAAK*AARACA-CO 2 H SEQ ID NO: 2
- SA-test peptide was synthesized by incorporation and deprotection of N-(2-Cl-benzyloxycarbonyl)-N- methylaminooxy acetic acid ( Figure 4, 3) during solid phase peptide synthesis.
- the reactivity of the protected secondary aminooxy group was sufficiently attenuated to remain unreactive during Boc solid-phase peptide synthesis on thioester-linker resins.
- the 2-C1-Z protection for the N-methylaminooxy amino acid was efficiently removed by standard HF cleavage procedures.
- TMR-OSu succinimide ester of tetramethyhhodamine
- SA-test peptide was reacted under higher pH conditions (pH 9.0) to label all reactive sites.
- SA-test peptide contained 3 nucleophilic labeling sites which would be irreversibly labeled: aminooxy, lysine, and N-terminal amine.
- Dye labeling at high pH generated a mixture of peptides labeled at all possible combinations of sites with 1, 2 or 3 dyes.
- Example 2 The secondary aminooxy group is compatible with C ⁇ -thioesters and amide-forming ligation.
- Preparation of proteins by total chemical synthesis often requires the ligation of large polypeptides prepared by solid-phase peptide synthesis on thioester-linker resins.
- the most generally applicable methods available for ligations are native chemical ligation and expressed protein ligation. These processes utilize the same basic chemistry to join two peptides, one with an N- terminal cysteine and the other with a C-terminal thioester, through a regiospecific and site-specific reaction to generate a larger polypeptide.
- the application of aminooxy-labeling chemistry to the synthesis of large polypeptides and proteins requires compatibility with these solid-phase peptide synthesis and ligation chemistries.
- SAOD This amino acid, referred to as SAOD, was incorporated into the peptide sequence LY-(S AOD) -AG-MPAL thioester by synthesis on TAMPAL thioester-linker resin, as described below in the Methods.
- MPAL is the C- terminal mercaptopropionyl-leucine group generated by cleavage of a peptide from TAMPAL resin, see Hojo, H., et al., Bull. Chem. Soc. Jpn. 1993, 66:2700- 2706; and Hackeng, T.M. et al., Proc. Natl. Acad. Sci. USA. In press)
- CEYRTORNRLFVDKLDNTAQNPRNGAA-IiHHHHH SEQ ID ⁇ O: 6
- LY- (SAOD)-AG-MPAL thioester proceeded to completion in 5 hours with minimal side reactions.
- there was less than 1% LY-(SAOD)- AG-MPAL self condensation product indicating that the aminooxy group and thioester do not appreciably react with one another under the ligation conditions.
- the histidines could potentially have been affecting yield and selectivity by catalyzing nucleophilic attack on the succinimide ester of the reactive dye.
- Inclusion of guanidine hydrochloride in the reaction solvent increased the yield to approximately 50%, indicating that folding or poor solubility of the peptide was a factor in preventing access of the reactive dye to the aminooxy group.
- Selectivity was also improved, presumably because of the availability of the reactive secondary aminooxy group.
- Single-site labeling at the aminooxy group was proven by mass spectral analysis of trypsin and ⁇ -chymotrypsin digests of the labeled polypeptide product.
- Example 3 Specificity of labeling in protein domains containing aminooxy amino acids.
- the GTPase binding domain of p21 activated kinase (45 aa, 4 lys, 1 cys) with a secondary aminooxy amino acid incorporated at the amino- terminus (SAOD-PBD) was prepared.
- SAOD-PBD secondary aminooxy amino acid incorporated at the amino- terminus
- SAOD-PBD was readily labeled with Alexa-532 N-hydroxy-succinimide ester by titration addition of dye at pH 4.7 over 72 hours.
- the labeling efficiency was commensurate with that reported for the longest model peptide (-50% yield by HPLC quantitation) and there was no indication of multiple labeling.
- isolation of labeled SAOD-PBD by RP-HPLC proved difficult. Separation to baseline resolution was not achieved, but small quantities of unlabelled PBD in the labeled product do not preclude the use of the labeled material in biosensor applications. Previous reports indicate that separation of labeled product from starting polypeptide is highly dependent on the specific peptide and the attached dye.
- MALDI-TOF matrix assisted laser desorption ionization time-of- flight
- Boc-L-amino acids were purchased from ⁇ ovabiochem (La Jolla, CA) or Bachem Bioscience, Inc. (King of Prussia, PA).
- [[4-(Hydroxymethyl)phenylj- acetamidojmethyl (-OCH -Pam) Resin was purchased from PE Biosystems (Foster City, CA) and methylbenzhydrylamine (MBHA) resin was purchased from Peninsula Laboratories, Inc. (San Carlos, CA).
- Solvents were Synthesis grade or better and were purchased from Fisher Scientific (Tustin, CA).
- Trifluoroacetic acid (TFA) and anhydrous hydrogen fluoride were purchased from Halocarbon (New Jersey) and Matheson Gas (Rancho Cucamonga, CA).
- Dyes were obtained from Molecular Probes (Eugene, OR). All other reagents were analytical grade or better and were purchased from Aldrich (Milwaukee, WI), Lancaster (Windham, NH), Peptides International (Louisville, KY) or Richelieu Biotechnologies (Montreal, Canada).
- Coupling was monitored by quantitative ninhydrin assay after 15 minute coupling cycles. After chain assembly, standard deprotection and cleavage from the resin support was carried out by treatment at 0 °C for 1 hour with anhydrous HF containing either 10% p-cresol or anisole as scavenger. Purification was performed using RP-HPLC.
- NXBoc group of the linked leucine was removed with neat TFA, then S-Trt- ⁇ -mercaptopropionic acid (1.5 grams, 4.3 mmol), activated in the same manner as Boc-Leu-OH, was added to the deprotected Leu-MBHA resin and allowed to couple until complete reaction.
- S-Trt- ⁇ -mercaptopropionyl-Leu-MBHA resin was washed extensively with DMF, then DCM/MeOH (1/1), and finally dried in vacuo to yield 3.39 grams of thioester resin. Substitution calculated by weight gain yielded 0.549 mmol/gram.
- TAMPAL Resin S-trityl protection was removed by two 5 minute treatments with 95% TFA/5% triisopropylsilane. The deprotected resin was extensively with DMF before coupling the first amino acid, activated using optimized in situ neutralization protocols.
- N-(2-Cl-benzyloxycarbonyl)-N-Methylhydroxylamine (1) (Jencks, W.P., Carriuolo, J. J. Am. Chem. Soc. I960, 82:675; Jencks, W.P. J. Am. Chem. Soc. 1958, 80:4581, 4585).
- N-methylhydroxylamine hydrochloride (0.95g, 11.37mmol) was dissolved in 3ml of water with rapid stirring. The pH of this solution was adjusted to 6-7 by dropwise addition of a saturated solution of sodium bicarbonate.
- N-(2-Chlorobenzyloxycarbonyl)-N-Methylaminooxy Acetic Acid (3) (2.5g, 9.2mmol) was activated with N-hydroxysuccinimide (2.11g, 2equiv.) and DIC (1.440ml, 1.Oequiv.) in 20ml DCM. This reaction was rapidly stirred at room temperature for 2 hours prior to the addition of N -Boc- ⁇ , ⁇ - diaminopropionic acid (2.3g, 1.2equiv.) and DIEA (3.20ml, 2equiv.). After 4 hours, the DCM solvent was removed in vacuo, and 50ml ethyl acetate was added.
- SA-test peptide The SA- test peptide, NH 2 -AKAARAAAAK* AARACA-CO 2 H, was synthesized with Lys 10 side chain Fmoc protection as described previously (Canne, L.E., et al., J. Am. Chem. Soc. 1995, 117:2998-3007).
- LY-(SAOD)-AG-MPAL-Thioester was synthesized using optimized in situ neutralization protocols for Boc chemistry on TAMPAL resin. Coupling of the N ⁇ -Boc-(SA)Dapa-OH amino acid was accomplished by reacting the in situ activated N- hydroxysuccinimide ester to the deprotected amino-terminal nitrogen of alanine (Canne, L.E., et al., J. Am. Chem. Soc. 1995, 117:2998-3007).
- the analytical sample of the dyes was purified by HPLC on a Vydac C- 18 column (no. 218TP152022, 22*250 mm, 15-20 ⁇ m, 3mL/min) using acetonitrile-water gradient elution.
- Example 6 Imaging the Spatio-temporal Dynamics of Rac Activation in vivo with FLAIR
- FLAIR Fluorescent Activation Indicator for Rho GTPases
- PBD fluorescent Activation Indicator for Rho GTPases
- the FRET signal marks subcellular locations where Rac is activated. This can be quantified to follow the changing levels and locations of Rac activation or to trace the kinetics of total Rac activation on an individual cell basis.
- the labeling of PBD with Alexa, and mammalian expression vectors for expression of Rac-GFP is by any procedure, for example, as described in this application.
- This example provides protocols for production of pure PBD, protocols for generating cell images suitable for quantitative analysis of rac activation, and procedures and caveats for generating two types of data: images showing the spatial distribution of Rac activation within cells, and curves showing the kinetics of Rac activation in single cells.
- PBD PBD Expression and Purification.
- PBD was expressed in the form of C-terminal 6His fusion from the prokaryotic expression vector pET23 (Novagen). It was determined experimentally that the highest levels of expression are observed when a vector containing plain T7 promoter (not T7/ ⁇ c) is used in combination with a BL21(DE3) strain (not the more stringent BL21(DE3)pLysS) of E. coli. This system allows for "leaky” protein expression (Novagen). While the 6His tag can be cleaved from the purified protein with thrombin, it is not necessary, as the tag does not have any significant effect on probe functionality.
- Competent BL21(DE3) cells (Stratagene) are transformed with pET23- PBD using standard procedures. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press 1989) After transformation, cells were plated on an LB plate containing carbenicilhn. Cells do not degrade carbenicilhn as quickly as ampicillin, so a higher percentage of cells retain the vector at the culture density appropriate for induction (Novagen). Five ml of LB media with 100 ⁇ g/ml carbenicillin were inoculated with a single colony of cells, and grown in the shaker at 37°C for 6-8 hours (until dense).
- JPTG is added to a final concentration of 0.4-0.5 mM, and the cultures are allowed to grow for another 4-5 hours at 30-32°C (shaker). The cells are collected by centrifugation (8,000 G, 4 min), and stored as a pellet at -20 °C until use. Approximately 2.5-3 g of cells is usually obtained from each liter of culture. Purification of PBD-6His is performed essentially as described in the Talon affinity resin manual (Clontech).
- the cells (3-5 g) are thawed in 20-30 ml of the Lysis buffer (30 mM Tris HCI, pH 7.8, 250 mM NaCl, 10% glycerol, 5 mM MgCl 2 , 2 mM ⁇ -ME, 1 mM PMSF), homogenized with a spatula and sonicated (4 pulses, 10-15 sec each).
- T4 lysozyme and DNAse are added in catalytic amounts (approximately 100 micrograms/ml lysozyme and 500 U DNAse) to help the lysis, and the suspension is incubated on ice with periodic mixing for 30 min.
- the cells are then centrifuged at 12,500 rpm for 30 min, and the supernatant containing PBD is carefully transferred into a 50 mL Falcon tube.
- Talon resin (1.5-2 ml) (Clontech) is washed twice with 10 volumes of the lysis buffer in a 15 ml Falcon tube, centrifuging in the swinging bucket centrifuge at low speed in between to separate the resin.
- the cell lysate is added to the 1.5 ml of washed Talon resin in a 50 mL falcon tube, and inverted or agitated gently (i.e. with an orbit shaker) for 20-30 mm at r.t.
- the resin is then separated by centrifugation in a swinging bucket centrifuge.
- the supernatant containing the unbound fraction is removed and saved for SDS-PAGE analysis.
- the resin is then transferred into a new 15 mL Falcon tube and washed twice (10-15 min each, r.t., orbit shaker) with 12 mL of the lysis buffer, without PMSF and ⁇ ME.
- the third wash is performed with lysis buffer + 10 mM imidazole (add 1 M stock in water, kept at -20°C).
- the resin is resuspended in 2-3 mL of lysis buffer with 10 mM imidazole, and pipetted into a column (0.5 cm in diameter). The resin is allowed to sediment by gravity flow until the fluid above the resin bed is almost gone, and then another 3-5 mL of Lysis buffer with 10 mM imidazole is added to wash the column.
- the elution is performed using Lysis buffer with 60 mM imidazole, and ca. 500 ⁇ L fractions are collected.
- PBD usually elutes in fractions 5-13 (total volume about 3-4 mL).
- An aliquot of each fraction is run on a 12% SDS-PAGE and the fractions containing the pure PBD are combined and dialyzed against 1 L of 25 mM NaP buffer (pH 7.3).
- a dialysis bag (SpectraPor 7), or dialysis cassette (Pierce) with a molecular weight cutoff value of 3,500 kDa can be used.
- the bag is wiped with a KimWipe and buried in Aquacide powder (Ca ⁇ biochem) for 15-45 min at 4°C, depending on the volume of the sample in the bag. This concentration process should be monitored carefully as complete drying may occur if the bag is left in the Aquacide for too long. The powder is scraped gently from the bag every 10-15 min to facilitate water absorption.
- the Aquacide is cleaned from the bag, and the sample is carefully removed. The sample is briefly centrifuged (14,000 rpm, 2 min) to separate it from the precipitated material, and transferred into a new dialysis bag or cassette.
- the concentration of PBD is measured by taking a small aliquot (5-10 ⁇ L) and diluting into 50 mM TrisHCl (pH 7.5-8.0) or other appropriate buffer.
- the extinction coefficient of PBD at 280 nm is 8,250 (estimated from the primary sequence). On average, 1.5- 2 mg of PBD is obtained per liter of cell culture.
- Other methods of concentrating PBD were found to be less effective. For instance, centrifugal concentrators require prolonged centrifugations, and result in nonspecific adsorption of the small PBD protein to the membrane. It is essential to perform dialysis after concentration with Aquacide. This prevents the ionic strength of the resultant protein prep from becoming too high before labeling. Low ionic strength conditions are preferable to avoid excessive precipitation of the protein during attachment of the hydrophobic dye.
- GFP-Rac and Alexa-PBD Loading GFP-Rac and Alexa-PBD in cells.
- Cells were first transfected with GFP-Rac through nuclear microinjection.
- the EGFP variant (Clontech) was used that produced significantly brighter cells than wild type GFP (Heim et al., 6 Current Biology 178 (1996)).
- PBD-Alexa glass pipettes with 1.0 mm outer diameter and 0.50 mm inner diameter (Sutter) were pulled using a micropipette puller (Sutter Model P-87) to make microinjection needles with tips of approximately 0.5 ⁇ m diameter.
- Rh-GEP c- DNA is injected into Swiss 3T3 fibroblasts at 200 ng/ ⁇ L, using a constant needle pressure of approximately 100 hPa. DNA can be centrifuged prior to injection (20,000 G for 15 minutes) to prevent clogging the needle.
- Cells expressing GFP-Rac were microinjected with Alexa-PBD using a microscope with optics and illumination capable of revealing the GFP fluorescence (detection sensitivity is typically improved by using higher NA objectives and brighter light sources, such as a 100W Hg arc lamp). Thus, only GFP-expressing cells need to be injected.
- DPBS Dulbecco's Phosphate Buffer Solution
- Alexa-PBD was centrifuged at 20,000 G for 1 hour prior to injection, and then injected into the cytoplasm of cells expressing the GEP-Rac. Lowering the needle into the region just adjacent to the nucleus seems to produce the best combination of efficient injection and cell health. After the injection, cells are placed back into the 37°C incubator for 5-10 minutes to recover. Alexa-PBD could potentially act as an inhibitor of Rac activity, so controls were carried out showing that, for our imaging system, up to 1000 IU of Alexa-PBD do not inhibit induction of ruffling.
- Imaging Rac activation Imaging experiments were performed using a
- Images are taken using 3x3 binning with exposure times of 0.1 sec, 0.1 sec, and 0.5 sec for GFP, Alexa and FRET respectively.
- l x l binning is used with exposure times of 1 sec, 1 sec and up to 5 sec for GFP, Alexa and FRET respectively.
- These settings depend on the sensitivity of the imaging system used, and the desired trade off between sensitivity and spatial or temporal resolution. Settings should always be chosen not exceed the dynamic range of the camera (Berland et al., in Sluder et al. (eds.)Nideo Microscopy at 33 (Academic Press 1998). Motion artifacts should also be considered during imaging experiments.
- features of the cell may move appreciably during the time between acquisition of the FRET and GFP images. This results in artifacts when the image is corrected for bleedthrough, as described in more detail below. Such artifacts can be prevented by reducing the time between exposures, or by using two cameras simultaneously.
- Image Processing Image analysis is performed to follow the kinetics of total Rac activity within individual cells, displayed as curves of activation over time, or to generate images that show the subcellular location of rac activation.
- the proper application of conections is needed essential for quantitative imaging.
- Common image processing operations can be used for this purpose (Berland et al., in Sluder et al., Video Microscopy at 33 (Academic Press 1998). Procedures for such image processing operations will depend on the software package used. The correction factors should be rigorously applied when using the FLAIR system, as FRET signals will be low relative to other sources of fluorescence in the sample. The FRET signal must purposefully be kept low, as minimum quantities of fluorescent molecules should be used to prevent perturbation of cell behavior. Hence, FLATR procedures must be more carefully controlled than procedures generally used with fluorescent probes.
- Background subtraction There are two methods commonly used for background subtraction. If the only intention is to follow the changing spatial distribution of the FRET signal over time, and if the background (in the absence of cells) remains uniform across the field of view throughout the experiment, then it is sufficient to determine the background intensity in several regions of the image outside the cell. The average value of these intensities is then subtracted from each pixel in the image. This method can also be sufficient for following qualitative changes in the subcellular location of activation, but it must be used with caution. Subtle variations in background intensity across the cell could be large relative to the changes observed in FRET, producing artifacts.
- the total fluorescence intensity is determined for both the GFP and FRET images from cells containing only GFP-Rac.
- a GFP bleedthrough factor is computed for each cell by dividing the intensity through the FRET filters by that through the GFP filters (the 'bleedthrough factor' for GFP: FRET intensity/GFP intensity). This value is plotted against cell intensity for numerous cells, and a line is fit to this data to produce an accurate value of the bleedthrough factor. It is important to use background-subtracted images.
- the process is repeated for Alexa-PBD. When the actual experiment is performed, an Alexa-PBD, GFP-Rac, and FRET image are obtained.
- the Alexa-PBD and GFP-Rac images are multiplied by the appropriate bleedthrough factor and subtracted from the FRET image. This is an extremely important step that must be applied carefully to prevent artifacts that appear to be regions of high FRET, especially as the magnitude of the FRET signal approaches that of the bleedthrough. It is important not to use GFP-Rac or Alexa-PBD images that exceed the dynamic range of the camera ('overexposure') as they will not fully eliminate bleedthrough. Motion artifacts can also produce errors derived from bleedthrough corrections.
- cytoskeletal control and signaling crosstalk depend upon the localization of Rho family GTPase activation, and may depend as well on the level and duration of activation. Signaling control by the precise dynamics of GTPase activation has been suggested by indirect experiments, but has been very difficult to quantify or study using previous methods.
- the FLAIR system reported here can reveal Rac activation dynamics in vivo and can accurately report the changing activation levels within a cell.
- Rh is a member of the Ras superfamily of small GTPase proteins (A. Hall, Science 279, 509-14 (1998). It plays a critical role in diverse signaling pathways, including control of cell morphology, actin dynamics, transcriptional activation, apoptosis signaling, and other more specialized functions (L. Kj oiler, A. Hall, Exp. Cell Res. 253 166-79 (1999). The broad range of events controlled by this GTPase requires subtle regulation of interactions with multiple downstream targets. Accumulating evidence suggests that the effects of Rac are in part controlled by regulating the subcellular localization of its activation through GTP binding. For example, Rac is known to induce localized actin rearrangements to generate polarized morphological changes (CD. Nobes, A.
- GTP exchange factors which regulate nucleotide exchange on Rho GTPases contain a variety of localization domains and may modulate downstream signaling from Rac (Zhou et al, J. Biol. Chem. 273(27), 16782-16786 (1998).
- This protein biosensor is labeled with an acceptor dye capable of undergoing FRET with GFP. Since the biosensor is derived from a specific GTP-Rac target protein, it binds to GFP-Rac 1 only when the Racl is in its activated, GTP-bound form, and produces a localized FRET signal revealing the level and location of Rac activation. When cells expressing GFP-Rac were injected with the biosensor, we were able to simultaneously map the changing location of GFP-Rac 1 and the subpopulation of GFP-Rac 1 molecules in the activated, GTP-bound state. FRET is proportional to the amount of GTP binding, enabling quantitation of changing activation levels.
- biosensor binding to the GFP-tagged protein will generate FRET.
- This approach has the potential to examine many protein states, including posttranslational modifications, conformation, and ligand binding.
- the biosensor was made by fluorescently labeling a domain from p21 activated kinase I (PAK1) known to bind selectively to GTP-Rac .
- PAK1 p21 activated kinase I
- PBD fragment of human PAK1, residues 65-150, with a single cysteine added in the penultimate N-terminal position
- GFP-Rac 1 fusion and wild type Racl were also expressed as 6His constructs and purified using a similar procedure. Purified protein was dialyzed against 50 mM sodium phosphate (pH 7.8), and labeled with 7 equivalents Alexa 546 maleimide (Molecular Probes) at 25 degrees for 2 hours. The conjugate was purified from unincorporated dye by G25 size exclusion chromatography followed by dialysis.
- the dye:protein ratio was between 0.8 and 1.3, as determined from absorbance of the conjugate at 558 nm (Alexa 546 extinction coefficient 104,000 M ⁇ cm "1 ) and 280nm (PBD, extinction coefficient 8,250 M ⁇ cm "1 plus Alexa absorbance, determined as 12 % of the absorbance at 546). Protein concentration was also independently determined using a Coomassie Plus protein assay (Pierce) and SDS-PAGE calibration with known concentrations of bovine serum albumin.
- the p21 binding domain (PBD, aa 65-150) has been used successfully to precipitate GTP-Rac 1 from cell lysates (V. Benard, B.P. Bohl, G.M. Bokoch, J. Biol. Chem. 274, 13198-204(1999).
- PBD p21 binding domain
- the optimum site for attachment of an acceptor dye was determined by analyzing FRET between purified GFP -Racl and PBD labeled with various dyes in different positions.
- PBD contained no native cysteines, so the site of labeling could be controlled through introduction of a single cysteine, followed by labeling with cysteine-selective iodoacetamide dyes.
- the best candidate was found to be a PBD with cysteine appended to the N-terminus, labeled with commercially available Alexa 546 dye.
- FLATR fluorescent activation indicator for Rho proteins
- nucleotide equilibration buffer 50 mM Tris HC1 (pH 7.6), 50 mM NaCl, 5 mM MgCl 2 , 10 mM EDTA, and 1 mM DTT.
- Equal volumes of Alexa-PBD in the same buffer were added to the GFP-Racl solution and fluorescence emission spectra (500-600 nm) were acquired at room temperature and 480 nm excitation. Spectra were corrected for dilution upon Alexa-PBD addition.
- Alexa-PBD concentrations were either varied as shown, or maintained at 1 micromolar when saturating Alexa-PBD was required.
- the spectra shown were corrected for direct excitation of the Alexa fluorophore by acquiring spectra of Alexa-PBD alone at equivalent concentrations, and subtracting these from spectra shown in Figure 7.
- panel A inset only points actually used in the curve fitting are shown. Higher, saturating concentrations of AlexaPBD were not used because errors from subtraction of direct Alexa excitation became larger. Binding of Alexa-PBD to GFP-Rac resulted in a change in fluorescence intensity of both donor (GFP) and acceptor (Alexa) emission.
- Cells expressing the GFP-Rac were then microinjected with 100 micromolar Alexa-PBD, mounted in a heated chamber on a Zeiss axiovert 100TV microscope and maintained in Dulbecco's phosphate buffered saline (DPBS) (GTBCO) to reduce background fluorescence. Cells were then stimulated by replacing the media with DPBS containing 10% FCS or 50 ng/mL PDGF. Images were obtained every 30 seconds using a Photometries PXL cooled CCD camera with lxl or 3x3 binning, and a Zeiss 40x 1.3 NA oil immersion objective.
- DPBS Dulbecco's phosphate buffered saline
- Fluorescence filters from Chroma were as follows: GFP: HQ480/40, HQ535/50, Q505LP; FRET: D480/30, HQ610/75, 505LP; Alexa:HQ 545/30, HQ 610/75, Q565LP.
- Cells were illuminated using a 100W Hg arc lamp. Exposure times for 3x3 binning were: GFP- 0.1 seconds, Alexa-PBD - 0.1 seconds, FRET -0.5 seconds. For lxl binning, GFP - 1 second, Alexa-PBD - 1 second, FRET - 5 seconds.
- Thresholding was based on the GFP image since it had the largest signal to noise ratio, providing the clearest distinction between the cell and background.
- the FRET and Alexa-PBD images were multiplied by the binary image, assuring that exactly the same pixels were analyzed in all three images.
- Emission appearing in the FRET image from direct excitation of Alexa and GFP was removed by subtracting a fraction of the GEP- Rac and Alexa-PBD images from the FRET image. This fraction depended on the filter set and exposure conditions used. It was determined, as described in detail elsewhere (CE. Chamberlain, V. Kraynov, K.M.
- Rhod activation is restricted to the site of actin polymerization, independent of the overall distribution of the protein.
- Rac activation was tightly correlated with moving ruffles, indicating that structures specifically associated with the ruffle were either binding and concentrating activated Rac or that growth-factor induced Rac activation was specifically localized to ruffles.
- the function of the Rac found at the nuclear envelope remains uncertain. It may be activated for regulation of transcription at times later than those tested here, or may be activated for an unknown role by other stimuli. When activation was concentrated in a small area such as a ruffle, spatially resolved FRET could detect significant activation changes too small to appreciably alter the overall levels of cellular Rac activity.
- Rhin has been shown to be essential for the directed movement of cells during chemotaxis, and for extension of the front end of cells during motility (C.Y. Chung et al, Proc. Natl. Acad. Sci. U.S.A. 97(10), 5225-5230 (2000).
- FLATR FLATR to ask if Rac activation in polarized, motile cells occurred in particular subcellular localizations to regulate localized actin behaviors.
- a 'wound' was scraped in a monolayer of confluent Swiss 3T3 fibroblasts, causing cells to become polarized and move into the open space.
- Swiss 3T3 fibroblasts were induced to undergo polarized movement as previously described (R.
- the cells were cultured in Dulbecco's modified Eagle's medium (GTBCO) supplemented with 10%> fetal calf serum at 37°C Cells were trypsinized and then plated on glass coverslips. They were grown to a confluent monolayer and maintained for an additional 3-4 days. Cells were then wounded by creating a straight laceration with a sterile razor blade. Cells along the edge of the wound were microinjected with 200 micrograms/ml GFP-Rac c-DNA.
- GTBCO Dulbecco's modified Eagle's medium
- the gradient was much broader than the narrow area at the leading edge where actin polymerization occurs (Y.L. Wang et al, J. Cell Biol 101, 597-602 (1985; J.A. Theriot and T.J. Mitchison, Nature 352, 126-131 (1991).
- Other activities required for motility, such as depolymerization of fiber networks to recycle monomers and delivery of molecules to the leading edge (O.D. Weiner et al., Nat. Cell. Biol. 1, 75-81 (1999) occur throughout the region where Rac is activated. Perhaps Rac is acting over a broader cell area to activate multiple downstream effectors, each producing different effects in more restricted locations.
- FLAIR can reveal how different stimuli interact to affect Rac through the complex circuitry of an intact cell.
- the ability of the biosensor to quantify the level and kinetics of activation should also prove very useful, as accumulating evidence indicates that Rac and related proteins do not function as simple binary switches. Different levels and kinetics of activation produce profoundly different results (T. Joneson, Mol. Cell. Biol. 19(9) 5892-901(1999).
- FLATR together with other biosensors of different wavelengths it should be possible to examine the balance between Rac, Ras, and other protein activation levels undergoing rapid changes in real time. With increasing access to FRET imaging equipment, the technique we describe provides a relatively straightforward way to greatly extend the utility of readily accessible GFP fusion proteins.
- Example 8 Activation biosensors for cdc42 and Erk2.
- cdc42 is a member of the Rho family of small GTPases involved in signal transduction in eukaryotic cells. Cdc42 becomes “activated” by releasing GDP and binding GTP. Such GTPases interact with a host of downstream effectors, ultimately resulting in one or the other cellular response via a variety of phosphorylation cascades.
- CBD cdc42 binding domain
- WASP Wiscott- Aldrich Syndrome Protein
- this fluorescent CBD biosensor Upon binding to the cdc42, this fluorescent CBD biosensor is able to increase its fluorescence intensity by up to 3.5-fold, providing a convenient measure of endogenous cdc42 activation in living cells or for in vitro applications (concept outlined in figure 6b).
- MAP kinase Mitogen-activated protein kinase
- MAP kinase Mitogen-activated protein kinase
- ERK Extracellular Signal-Regulated Kinase
- MEK Mitogen-Activated Protein Kinase Kinase
- DNA encoding the Cdc42-binding fragment of human WASP containing the CRTB motif and surrounding amino acids was amplified by PCR from ATCC clone # 99534.
- This peptide fragment has the following amino acid sequence (SEQ TD NO:13 ).
- the DNA fragment encoding SEQ TD NO: 13 was subcloned into ⁇ ET23a (Novagen) as a C-terminal 6His fusion.
- Site-specific cysteine mutants were constructed by QuikChange (Stratagene) mutagenesis using synthetic oligos and the presence of mutations was confirmed by DNA sequencing.
- Cell pellet was resuspended in cold lysis buffer (25 mM Tris-HCl, pH 7.9, 150 mM NaCl, 5 mM MgCl 2 , 5% glycerol, 1 mM PMSF, 2 mM ⁇ - mercaptoethanol), and briefly sonicated on ice. Lysozyme and DNase were added to the suspension to a final concentration of 0.1 mg/ml and 100 U/ml, respectively, and solution was incubated with occasional stirring at 4°C for 30 min. Lysate was centrifuged (12,000 g, 30 min), and the clarified supernatant was incubated with 1 ml of Talon resin (Clontech) at 25°C for 30 min.
- cold lysis buffer 25 mM Tris-HCl, pH 7.9, 150 mM NaCl, 5 mM MgCl 2 , 5% glycerol, 1 mM PMSF, 2 mM ⁇ - mercaptoethanol
- the resin containing bound CBD was separated from the lysate by brief low-speed centrifugation and washed twice with 15 ml of lysis buffer. Finally, the resin was washed with the lysis buffer, supplemented with 10 mM imidazole, and poured into a column. Elution was performed with 5 ml of the lysis buffer, containing 60 mM imidazole. Fractions containing bulk of CBD (as evidenced by SDS gel) were combined and dialyzed against 1 L of dialysis buffer (25 mM Na 2 HPO 4 (pH 7.5), 10 mM NaCl) for 5 hours at 4 C.
- dialysis buffer 25 mM Na 2 HPO 4 (pH 7.5), 10 mM NaCl
- CBD-conjugates were made with the dye shown in Figure 11, and are referred to as mero-CBD (for merocyanines dye conjugated to CBD).
- cdc42 500 nM was pre-incubated with varying concentrations of GTP ⁇ S (1 to 500 nM).
- Racl and RhoA GTPases were pre-equilibrated with GTP ⁇ S in the same manner.
- the three CBD residues were mutated to cysteines, easily amenable to covalent modification with the thiol-reactive derivatives of the solvatochromic dyes.
- Recombinant mutant CBD proteins were overexpressed in bacteria, purified and site-specifically modified with several of solvatochromic dyes. Only the conjugates with the dye shown in Figure 11 are described here.
- the mero-CBD-F271C conjugate exhibited the largest (ca 3.5 -fold) fluorescence change in response to binding of activated cdc42 (see Figure 15).
- the functionality and specificity of mero-CBD was characterized by measuring fluorescence in the presence of saturating amounts of cdc42-GDP or cdc42-GTP ⁇ S. Approximately 3.5-fold increase in both excitation and emission maxima was observed, when the probe was bound to cdc42-GTP ⁇ S, but not cdc42-GDP. Negligible increase ( ⁇ 5%) was also observed in the presence of activated Racl. No effect on the mero-CBD fluorescence was observed when RhoA-GTP ⁇ S was present.
- FIG. 17 demonstrates use of the biosensor in living cells. To eliminate potential artifacts due to varying cell thickness, uneven illumination, etc., the biosensor was loaded into the cell together with CBD labeled with nonresponsive Alexa546 fluorophore. The ratio of the mero-CBD image to the CBD-Alexa image provided a quantitative measure of the extent of GTPase activation. The lighter, warmer colors show areas of higher cdc42 activation.
- Proteins within living cells were fluorescently labeled in situ, without isolation or reintroduction of the protein.
- a short peptide tag derived from the leucine zipper of GCN4 transcription factor was fused to a cellular protein and this fusion protein was expressed in live cells.
- a second peptide from GCN4, which binds with high affinity to the peptide fused onto the cellular protein, was covalently labeled with rhodamine and also introduced into live cells, where it specifically and selectively labeled the tagged protein. Attachment of rhodamine at the chosen site provided good peptide-peptide binding affinity (5 nM Kd).
- TMR tetramethylrhodamine
- the sequence YGRKKRRNRRRP (SEQ TD NO: 17) was appended to the N- terminus of the rhodamine-containing peptide, as this sequence was being tested in a parallel study of cell import.
- the labeled peptide at a concentration of 12.52 nM was incubated with a stock solution of unlabeled peptide in 0. lx PBS. Titrations were performed at magic angle setting with the excitation wavelength set to 553 nm and the emission wavelength to 580 nm.
- the spectra were corrected for Raman scattering from the PBS solution, for dilution, and checked for interactions of the label with the ligand by a parallel titration with label peptide using 5-carboxytetramethyhhodamine in PBS in the reference cuvette.
- ten anisotropy measurements were taken, and the total intensity and anisotropy were calculated according to standard equations with the G-Factor consistency deteirnined at each titration point. The average of the anisotropy was used for data analysis. Standard deviations were ⁇ 1%.
- the humanized DNA sequence for the peptide tag was amplified from pCDNA-Nova2-EGFP- cdc42 (T17N) to incorporate a BsrGI restriction site on the 5' end and a Notl restriction site on the 3' end. These blunt end PCR products produced by pfu polymerase were ligated into pEGFP-Nl - ⁇ -actinin. After BsrGI and Notl restriction enzymes were used the construct was gel purified (Qiagen Qiaquick Gel Extraction Kit) and ligated with T4 ligase (Gibco, Life Technologies) into the pEGFP-Nl- ⁇ actininl vector downstream of EGFP. The pEGFP-Nl- ⁇ - actininl-Nova2 sequence was verified through sequencing performed by The Scripps Research Institute core facility.
- Each amplification used the 5' primer: 5'- GACTGGATCCGAGTCCATGAAGAAGATGGCTCCTGCC (SEQ TD NO:20) together with the 3' primers described below, using human Fc ⁇ RI ⁇ -chain plasmid as template and Pfu polymerase (Stratagene, San Diego, CA) with 25-30 cycles of 94° C for 1 min; 65° C for 1 min; and 72° C for 2 min, followed by one cycle of 72° C for 10 min.
- the following downstream PCR primers were used to generate PCR products 1-4, respectively.
- the GFP protein was fused to the ER-resident major histocompatability complex I glycoprotein D b (MHC).
- MHC major histocompatability complex I glycoprotein D b
- the cD ⁇ A encoding the human HLA B27 was generated by PCR amplification using the following oligonucleotide primers: 5'-GGGGATCCTCTCAGACGCCG-3' (SEQ ID O:25) and 5'- CATGCCATGGCTCCGGATCCACCAGCTGTGAGAGACAC-3' (SEQ TD NO:26) to produce BamHI and Ncol ends.
- This product was ligated with the GFP coding sequence that had been previously excised from the pSGFP vector as a Ncol-Notl fragment. This ligation product was then cloned the into the BamHI-Notl sites of the vector pcDNA3 to produce the desired MHC-GFP fusion protein construct.
- Cos-7 cells were cultured and transfected with FuGENE6 (Roche Molecular Biochemicals) according to the manufacturer's protocol.
- Cells expressing EGFP- ⁇ -actinin were microinjected with 20- ⁇ M Rhodamine-labeled peptide in water. After injection, cells were washed with Dulbecco's phosphate buffered saline (DPBS) (Life Technologies) with 10% FBS, then mounted in a heated chamber on a Zeiss Axiovert lOOTN microscope and maintained in DPBS with 10% Fetal Bovine Serum (FBS) to reduce background fluorescence.
- DPBS Dulbecco's phosphate buffered saline
- FBS Fetal Bovine Serum
- Images were obtained using a Photometries PXL cooled CCD camera with lxl binning, and a Zeiss Fluar 40 x 1.3 ⁇ A oil immersion objective. Fluorescence filters from Chroma were as follows: GFP: HQ480/40, HQ535/50, Q505LP; Rhodamine: HQ545/30, HQ610/75, Q565LP. Images were background subtracted and contrast stretched using Inovision ISEE software, then formatted for display using Adobe Photoshop software.
- GFP-fusion protein was compared to that of the peptide labeled with rhodamine.
- An ⁇ -actinin construct with GFP fused to the N-terminus and the tag peptide on the C-terminus was expressed in Cos-7 cells. These cells were loaded with rhodamine peptide through microinjection. The concentration of the rhodamine- labeled peptide was optimized at 20 ⁇ M to minimize background fluorescence while clearly labeling the tagged peptide. We had determined previously that a uniform fluorescence background is not a serious obstacle using other fluorescently labeled proteins, including rhodamine actin in cytoskeletal fibers, which produces a physiologically normal background of unpolymerized protein.
- Figures 19a and 19c show GFP images and Figures 19b and 19d show rhodamine images taken of the same cells.
- the fluorescence from a different cell is shown in Figure 20.
- the peptide tag gave remarkably detailed images of ⁇ -actinin distribution, which was difficult to distinguish from those obtained using GFP.
- Controls in which only the rhodamine-peptide or the ⁇ -actinin GFP were present in the cell proved that the colocalization of the rhodamine and GFP signals was not due simply to imperfect selectivity of the fluorescence filters used to separate rhodamine and GFP signals. (See Figure 21.)
- These controls also demonstrated that binding to other leucine zipper proteins or undesired sites was not a problem, although a slight affinity of rhodamine for the nuclear envelope could be seen.
- Figure 22 shows that the ER-localized F c ⁇ RI ⁇ -chain was clearly visualized using the rhodamine-tagged peptide.
- the distribution of the two proteins was not identical, with the Fc receptor showing some concentrations in the perinuclear region. Controls using each fluorescent species alone in cells showed that results were not due to bleedthrough of emission from one fluorophore into the image of the other, and that localizations were not the result of nonspecific binding (data not shown).
- this approach provides access to many proteins which were previously very difficult to label with synthetic fluorophores for live cell experiments. Unlike other methods requiring relatively difficult synthesis of reagents or bulky antibody tags, this procedure can be accomplished using routine cloning and peptide synthesis procedures.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Peptides Or Proteins (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
Description
Claims
Applications Claiming Priority (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US21811300P | 2000-07-13 | 2000-07-13 | |
| US218113P | 2000-07-13 | ||
| WOPCT/US00/26821 | 2000-09-29 | ||
| PCT/US2000/026821 WO2002028890A1 (en) | 2000-09-29 | 2000-09-29 | Labeled peptides, and processes and intermediates useful for their preparation |
| US27930201P | 2001-03-28 | 2001-03-28 | |
| US279302P | 2001-03-28 | ||
| US839577 | 2001-04-20 | ||
| US09/839,577 US6951947B2 (en) | 2000-07-13 | 2001-04-20 | Labeled peptides, proteins and antibodies and processes and intermediates useful for their preparation |
| PCT/US2001/022194 WO2002008245A2 (en) | 2000-07-13 | 2001-07-13 | Labeled peptides, proteins and antibodies and processes and intermediates useful for their preparation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP1301473A2 true EP1301473A2 (en) | 2003-04-16 |
Family
ID=56290166
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP01954689A Withdrawn EP1301473A2 (en) | 2000-07-13 | 2001-07-13 | Labeled peptides, proteins and antibodies and processes and intermediates useful for their preparation |
Country Status (4)
| Country | Link |
|---|---|
| EP (1) | EP1301473A2 (en) |
| AU (1) | AU2001276916A1 (en) |
| CA (1) | CA2415960A1 (en) |
| WO (1) | WO2002008245A2 (en) |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7176037B2 (en) | 2000-07-13 | 2007-02-13 | The Scripps Research Institute | Labeled peptides, proteins and antibodies and processes and intermediates useful for their preparation |
| US6951947B2 (en) | 2000-07-13 | 2005-10-04 | The Scripps Research Institute | Labeled peptides, proteins and antibodies and processes and intermediates useful for their preparation |
| US7432298B2 (en) | 2003-05-09 | 2008-10-07 | Applied Biosystems Inc. | Fluorescent polymeric materials containing lipid soluble rhodamine dyes |
| WO2004101709A1 (en) | 2003-05-09 | 2004-11-25 | Applera Corporation | Phenyl xanthene dyes |
| JP2007529718A (en) * | 2004-03-12 | 2007-10-25 | ザ スクリップス リサーチ インスティチュート | Fluorescent signal emitting live cell biosensor molecules and dyes for the detection and quantification of protein activity |
| US7582634B2 (en) | 2005-02-18 | 2009-09-01 | Wyeth | 7-substituted imidazo[4,5-c]pyridine antagonists of gonadotropin releasing hormone receptor |
| US7534796B2 (en) | 2005-02-18 | 2009-05-19 | Wyeth | Imidazo[4,5-b]pyridine antagonists of gonadotropin releasing hormone receptor |
| US7538113B2 (en) | 2005-02-18 | 2009-05-26 | Wyeth | 4-substituted imidazo[4,5-c]pyridine antagonists of gonadotropin releasing hormone receptor |
| US7531542B2 (en) | 2005-05-18 | 2009-05-12 | Wyeth | Benzooxazole and benzothiazole antagonists of gonadotropin releasing hormone receptor |
| US7582636B2 (en) | 2005-05-26 | 2009-09-01 | Wyeth | Piperazinylimidazopyridine and piperazinyltriazolopyridine antagonists of Gonadotropin Releasing Hormone receptor |
| US7763418B2 (en) * | 2005-07-05 | 2010-07-27 | Cytoskeleton, Inc. | Detection of Rho proteins |
| KR101834574B1 (en) | 2009-01-29 | 2018-03-05 | 커먼웰쓰 사이언티픽 앤드 인더스트리얼 리서치 오가니제이션 | Measuring g protein coupled receptor activation |
| CN116004221B (en) * | 2022-12-15 | 2023-12-19 | 湖南卓润生物科技有限公司 | New application of cyclic peptide, acridine labeled complex, preparation method and detection kit |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1996040662A2 (en) * | 1995-06-07 | 1996-12-19 | Cellpro, Incorporated | Aminooxy-containing linker compounds and their application in conjugates |
-
2001
- 2001-07-13 WO PCT/US2001/022194 patent/WO2002008245A2/en not_active Ceased
- 2001-07-13 AU AU2001276916A patent/AU2001276916A1/en not_active Abandoned
- 2001-07-13 CA CA002415960A patent/CA2415960A1/en not_active Abandoned
- 2001-07-13 EP EP01954689A patent/EP1301473A2/en not_active Withdrawn
Non-Patent Citations (1)
| Title |
|---|
| See references of WO0208245A3 * |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2001276916A1 (en) | 2002-02-05 |
| WO2002008245A2 (en) | 2002-01-31 |
| WO2002008245A3 (en) | 2003-01-30 |
| CA2415960A1 (en) | 2002-01-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7662644B2 (en) | Labeled peptides, proteins and antibodies and processes and intermediates useful for their preparation | |
| US6951947B2 (en) | Labeled peptides, proteins and antibodies and processes and intermediates useful for their preparation | |
| US6875594B2 (en) | Methods of ligating expressed proteins | |
| US7172877B2 (en) | Methods and compositions for peptide and protein labeling | |
| Sahoo | Fluorescent labeling techniques in biomolecules: a flashback | |
| US20050233389A1 (en) | Methods and compositions for peptide and protein labeling | |
| WO2002008245A2 (en) | Labeled peptides, proteins and antibodies and processes and intermediates useful for their preparation | |
| US7449558B2 (en) | Site-specific labelling of proteins | |
| US8871456B2 (en) | Probe incorporation mediated by enzymes | |
| US7595198B2 (en) | Photocleavable isotope-coded affinity tags | |
| JP2010500580A (en) | Dual-substrate fluorescent probes that bind to protein kinases | |
| US8445291B2 (en) | Method for detecting target substance, and tag, DNA, vector, probe and detection kit for use therewith | |
| Lapeyre et al. | Aryldithioethyloxycarbonyl (Ardec): a new family of amine protecting groups removable under mild reducing conditions and their applications to peptide synthesis | |
| Krishnan et al. | Site‐specific fluorescent labeling of poly‐histidine sequences using a metal‐chelating cysteine | |
| WO2015107071A1 (en) | Genetically encoded spin label | |
| US7351797B1 (en) | Labeled peptides, and processes and intermediates useful for their preparation | |
| US20130143251A1 (en) | Expeditious synthesis of ubiquitinated peptide conjugates | |
| WO2002029407A2 (en) | Dye-labelled peptide and its diagnostic use | |
| US20040265921A1 (en) | Intein-mediated attachment of ligands to proteins for immobilization onto a support | |
| US10591485B2 (en) | Peptide tags for fluorescent labelling of proteins | |
| JP7716729B2 (en) | Golgi apparatus-localized compounds and uses thereof | |
| Chen et al. | Chemoselective modification of proteins | |
| JP2005534739A (en) | Site-specific labeling of proteins using a cyanine dye reporter | |
| DE20023789U1 (en) | Novel synthetic intermediate compounds useful for preparing modified peptides and peptide conjugates which are useful in biosensors for detecting the location of cellular proteins in living cells | |
| IL300815A (en) | Proteins or peptides that have been modified for directed covalent binding |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20030206 |
|
| AK | Designated contracting states |
Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK RO SI |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: C09B 23/10 20060101ALI20060706BHEP Ipc: G01N 33/38 20060101ALI20060706BHEP Ipc: C12Q 1/44 20060101ALI20060706BHEP Ipc: C12N 15/12 20060101ALI20060706BHEP Ipc: C12N 9/12 20060101ALI20060706BHEP Ipc: C07K 14/00 20060101ALI20060706BHEP Ipc: C07K 14/435 20060101ALI20060706BHEP Ipc: C07K 19/00 20060101ALI20060706BHEP Ipc: C07K 1/107 20060101ALI20060706BHEP Ipc: C07C 271/22 20060101AFI20030224BHEP |
|
| RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: CHAMBERLAIN, CHESTER Inventor name: BURTON, DENNIS, R. Inventor name: BARK, STEVEN, J. Inventor name: KRAYNOV, VADIM Inventor name: MUTHYALA, RAJEEV Inventor name: TOUTCHKINE, ALEXEI Inventor name: HAHN, KLAUS, M. |
|
| 17Q | First examination report despatched |
Effective date: 20081104 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20110201 |