EP1296714A2 - Methods for enhancing antibody-induced cell lysis and treating cancer - Google Patents

Methods for enhancing antibody-induced cell lysis and treating cancer

Info

Publication number
EP1296714A2
EP1296714A2 EP01948684A EP01948684A EP1296714A2 EP 1296714 A2 EP1296714 A2 EP 1296714A2 EP 01948684 A EP01948684 A EP 01948684A EP 01948684 A EP01948684 A EP 01948684A EP 1296714 A2 EP1296714 A2 EP 1296714A2
Authority
EP
European Patent Office
Prior art keywords
nucleic acid
antibody
cancer
cell
lymphoma
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
EP01948684A
Other languages
German (de)
French (fr)
Other versions
EP1296714B1 (en
Inventor
George Weiner
Gunther Hartmann
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Iowa Research Foundation En Coley Ph, University of
Original Assignee
University of Iowa Research Foundation UIRF
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Iowa Research Foundation UIRF filed Critical University of Iowa Research Foundation UIRF
Priority to SI200130937T priority Critical patent/SI1296714T1/en
Publication of EP1296714A2 publication Critical patent/EP1296714A2/en
Application granted granted Critical
Publication of EP1296714B1 publication Critical patent/EP1296714B1/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2896Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against molecules with a "CD"-designation, not provided for elsewhere
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/39541Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against normal tissues, cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2878Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies

Definitions

  • the invention relates to the treatment and prevention of cancer using immunostimulatory nucleic acids and antibodies.
  • Cancer is a disease which involves the uncontrolled growth (i.e., division) of cells.
  • Some of the known mechanisms which contribute to the uncontrolled proliferation of cancer cells include growth factor independence, failure to detect genomic mutation, and inappropriate cell signaling. The ability of cancer cells to ignore normal growth controls may result in an increased rate of proliferation.
  • the causes of cancer have not been firmly established, there are some factors known to contribute, or at least predispose a subject, to cancer. Such factors include particular genetic mutations (e.g., BRCA gene mutation for breast cancer, APC for colon cancer), exposure to suspected cancer-causing agents, or carcinogens (e.g., asbestos, UN radiation) and familial disposition for particular cancers such as breast cancer.
  • Cancer is currently treated using a variety of modalities including surgery, radiation therapy and chemotherapy.
  • the choice of treatment modality will depend upon the type, location and dissemination of the cancer.
  • surgery and radiation therapy may be more appropriate in the case of solid well-defined tumor masses and less practical in the case of non-solid tumor cancers such as leukemia and lymphoma.
  • One of the advantages of surgery and radiation therapy is the ability to control to some extent the impact of the therapy, and thus to limit the toxicity to normal tissues in the body.
  • surgery and radiation therapy are often followed by chemotherapy to guard against any remaining or radio-resistant cancer cells.
  • Chemotherapy is also the most appropriate treatment for disseminated cancers such as leukemia and lymphoma as well as metastases.
  • CpG DNA unmethylated CG-dinucleotides within certain sequence contexts
  • CpG DNA activates a coordinated set of immune responses that include innate immunity (macrophages, dendritic cells, and natural killer cells), humoral immunity, and cellular immunity.
  • innate immunity macrophages, dendritic cells, and natural killer cells
  • humoral immunity and cellular immunity.
  • Krieg AM et al. Pharmacol Ther 84:113- 20 (1999); Krieg AM et al., Curr Top Microbiol Immunol 247:1-21 (2000); Wagner H, Adv Immunol 73:329-68 (1999).
  • CpG DNA is at least as effective as the gold standard complete Freund's adjuvant (CFA), but induces higher Thl activity and demonstrates less toxicity.
  • CFA complete Freund's adjuvant
  • the invention relates in some aspects to methods for treating and preventing cancer using immunostimulatory nucleic acids and antibodies.
  • the invention is a method for treating or preventing cancer.
  • the method involves administering to a subject having or at risk of developing cancer an effective amount to upregulate CD20 expression of a nucleic acid, and an anti-CD20 antibody.
  • the cancer in some embodiments, is B-cell lymphoma associated with low levels of CD20 expression.
  • the B-cell lymphoma in other embodiments is B-cell chronic lymphocytic leukemia (B-CLL) or a marginal zone lymphoma.
  • the CD20 antibody is C2B8 or Rituximab.
  • the invention in other aspects relates to a method for diagnosing lymphoma by isolating a B cell from a subject and identifying a change in cell surface markers when the B cell is contacted with an immunostimulatory nucleic acid, wherein the cell surface marker induced on the B cell is indicative of the type of lymphoma.
  • the subject has a type of lymphoma.
  • the subject is suspected of having a type of lymphoma.
  • the method may optionally include a method for treating cancer by administering to the subject an immunostimulatory nucleic acid and an antibody specific for the cell surface antigens induced on the B cell in order to treat the cancer.
  • the invention is a method for treating or preventing cancer by administering to a subject having or at risk of developing cancer an effective amount to induce expression of a surface antigen on a cancer cell surface, of a nucleic acid, and administering to the subject an antibody selected from the group consisting of an anti-CD22 antibody and an anti-CD 19 antibody.
  • a method for treating lymphoma includes the steps of isolating a B cell from a subject having lymphoma, identifying a surface antigen which is not expressed or which is expressed on the surface of the B cell in an amount lower than that of a control B cell, administering to the subject an antibody specific for the identified surface antigen and an immunostimulatory nucleic acid in order to treat the lymphoma, wherein the nucleic acid is administered in an effective amount to upregulate expression of the surface antigen on the lymphoma cell surface.
  • a method for treating a lymphoma resistant to antibody therapy includes administering to a subject having a lymphoma resistant to therapy with an antibody specific for a surface antigen, an antibody specific for the surface antigen to which the lymphoma is resistant and a nucleic acid in order to treat the lymphoma, wherein the nucleic acid is administered in an effective amount to upregulate expression of the surface antigen on the lymphoma cell surface.
  • the surface antigen may be any type of surface antigen which is capable of being expressed on the surface of a cancer cell and which is induced by stimulation with immunostimulatory nucleic acids.
  • the surface antigen is CD20, CD40, CD22, or CD19.
  • the lymphoma is B-CLL or marginal zone lymphoma.
  • the antibody is an anti-CD20 antibody, hi some embodiments the anti-CD20 antibody is C2B8. In another embodiment the anti-CD20 antibody is Rituximab. In some preferred embodiments the antibody is a human IgGl antibody. In some preferred embodiments the antibody is a murine IgG2a antibody. hi some embodiments the methods also include administering an anti-cancer therapy to the subject.
  • the invention also includes a method for treating cancer in a human by administering to a human an immunostimulatory nucleic acid and an antibody of IgGl isotype (an IgGl isotype antibody as used herein refers to a human or humanized IgGl unless otherwise specified), which binds to a cell surface antigen of a cancer cell and wherein the nucleic acid and the antibody are administered in an effective amount for killing the cancer cell.
  • the nucleic acid and the antibody are administered together.
  • the nucleic acid and the antibody may be administered separately.
  • the method includes the step of administering a cancer therapy.
  • a cancer therapy is meant to embrace a single medicament, a plurality of medicaments of a particular class and a plurality of medicaments of different classes, and includes but is not limited to chemotherapeutic agents, cancer vaccines, biological response modifiers, and hormone therapies.
  • a chemotherapeutic agent maybe selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, non-sugar containing chloroethylnitrosoureas, 5- fluorouracil, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, fragyline, Meglamine GLA, valrubicin, carmustaine and poliferposan, MMI270, BAY 12-9566, RAS famesyl transferase inhibitor, famesyl transferase inhibitor, MMP, MTA/LY231514, LY264618/Lometexol, Glamolec, CI-994, TNP-470, Hycamtin/Topotecan, PKC412, Valspodar/PSC833, Novantrone/Mitroxantrone, Metaret/Suramin, Batimastat, E7070, BCH- 4556, CS-682, 9
  • Mitoguazone methyl-GAG; methyl glyoxal bis-guanylhydrazone; MGBG
  • Pentostatin (2'deoxycoformycin
  • Semustine methyl-CCNU
  • Teniposide VM-26
  • Vindesine sulfate Vindesine sulfate.
  • the chemotherapeutic agent may be selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, valrubicin, Novantrone/Mitroxantrone, Evacet/liposomal doxorubicin, Yewtaxan Paclitaxel, Taxol/Paclitaxel, SPU-077/Cisplatin, HMR 1275/Flavopiridol, BMS-182751/oral platinum, Leustatin/Cladribine, Paxex/Paclitaxel, Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin, Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, Caetyx/liposomal doxorubicin
  • a cancer vaccine may be selected from the group consisting of EGF, Anti-idiotypic cancer vaccines, Gp75 antigen, GMK melanoma vaccine, MGV ganglioside conjugate vaccine, Her2/neu, Ovarex, M-Vax, O-Vax, L-Vax, STn-KHL theratope, BLP25 (MUC-1), liposomal idiotypic vaccine, Melacine, peptide antigen vaccines, toxin/antigen vaccines, MVA-based vaccine, PACIS, BCG vaccine, TA-HPV, TA-CLN, DISC-virus and hnmuCyst/TheraCys.
  • Biological response modifiers include interferon, and lymphokines such as IL-2.
  • Hormone replacement therapy includes tamoxifen alone or in combination with progesterone.
  • the cancer therapy is interferon- ⁇ (e.g., INTRON® A, Schering).
  • the cancer may be selected from the group consisting of basal cell carcinoma, bladder cancer, bone cancer, brain and central nervous system (CNS) cancer, breast cancer, cervical cancer, colon and rectum cancer, connective tissue cancer, esophageal cancer, eye cancer, kidney cancer, larynx cancer, leukemia, liver cancer, lung cancer, Hodgkin's lymphoma, non- Hodgkin's lymphoma, melanoma, myeloma, oral cavity cancer (e.g., lip, tongue, mouth, and pharynx), ovarian cancer, pancreatic cancer, prostate cancer, rhabdomyosarcoma, skin cancer, stomach cancer, testicular cancer, and uterine cancer.
  • CNS central nervous system
  • the cancer to be treated may be selected from the group consisting of bone cancer, brain and CNS cancer, connective tissue cancer, esophageal cancer, eye cancer, Hodgkin's lymphoma, larynx cancer, oral cavity cancer (e.g., lip, tongue, mouth, and pharynx), skin cancer, and testicular cancer.
  • the invention encompasses a kit.
  • the kit includes a package including at least two containers, the first container housing an immunostimulatory nucleic acid, the second container housing an antibody specific for a cell surface antigen, and instructions for screening a cell to determine whether the immunostimulatory nucleic acid upregulates expression of the cell surface antigen.
  • the antibody is selected from the group consisting of an anti-CD20 antibody, an anti-CD 19 antibody, and an anti-CD22 antibody.
  • the nucleic acids useful according to the invention are immunostimulatory nucleic acids and in some embodiments are immunostimulatory CpG nucleic acids having an unmethylated CpG motif, immunostimulatory T-rich nucleic acids, immunostimulatory poly-
  • G nucleic acids, bacterial DNA, yeast DNA, or eukaryotic DNA.
  • nucleic acid does not hybridize with genomic DNA or RNA under stringent conditions. In other embodiments the nucleic acid does hybridize with genomic DNA or RNA under stringent conditions.
  • the nucleic acid may have natural linkages or may include at least one modified backbone internucleotide linkage.
  • the modified backbone is a phosphate backbone modification.
  • the modified backbone is a peptide modified oligonucleotide backbone.
  • the nucleic acid may also include native bases or modified bases.
  • the nucleotide backbone may be chimeric, or the nucleotide backbone is entirely modified.
  • the immunostimulatory nucleic acid can have any length greater than 6 nucleotides, but in some embodiments is between 8 and 100 nucleotide residues in length. In other embodiments the nucleic acid comprises at least 20 nucleotides, at least 24 nucleotides, at least 27, nucleotides, or at least 30 nucleotides. The nucleic acid may be single-stranded or double-stranded. In some embodiments the nucleic acid is isolated and in other embodiments the nucleic acid may be a synthetic nucleic acid.
  • the CpG nucleic acid in one embodiment contains at least one unmethylated CpG dinucleotide having a sequence including at least the following formula: 5' X ⁇ X CGX X 3' wherein C is unmethylated, wherein Xi, X 2 , X , and X 4 are nucleotides.
  • the 5' X ⁇ X CGX 3 X 3' sequence of the CpG nucleic acid is a non-palindromic sequence, and in other embodiments it is a palindromic sequence.
  • X 1 X2 are nucleotides selected from the group consisting of:
  • X ⁇ X 2 are GpA or GpT and X 3 X 4 are
  • Xi or X 2 or both are purines and X 3 or X or both are pyrimidines or X ⁇ X 2 are GpA and X 3 or X-j or both are pyrimidines.
  • X 2 is a T and X 3 is a pyrimidine.
  • the CpG nucleic acid has a sequence selected from the group consisting of SEQ ID NOs: 19, 35-37, 39-42, 91, 92, 101, 108, 111, 135, 141, 151, 274, 277,
  • the T-rich immunostimulatory nucleic acid is a poly-T nucleic acid comprising 5' TTTT 3'.
  • the poly-T nucleic acid comprises 5' X ⁇ X 2 TTTTX 3 X 3' wherein Xi, X 2 , X 3 , and X are nucleotides.
  • X ⁇ X 2 is TT and/or X 3 X 4 is TT.
  • X ⁇ X 2 is selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC; and or X 3 X 4 is selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC.
  • the T-rich immunostimulatory nucleic acid may have only a single poly-T motif or it may have a plurality of poly-T nucleic acid motifs.
  • the T-rich immunostimulatory nucleic acid comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 T motifs. In other embodiments it comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 CpG motifs. In some embodiments the plurality of CpG motifs and poly-T motifs are interspersed.
  • At least one of the plurality of poly-T motifs comprises at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9 contiguous T nucleotide residues.
  • the plurality of poly-T motifs is at least 3 motifs and wherein at least 3 motifs each comprises at least 3 contiguous T nucleotide residues or the plurality of poly-T motifs is at least 4 motifs and wherein the at least 4 motifs each comprises at least 3 contiguous T nucleotide residues.
  • the T-rich immunostimulatory nucleic acid may include one or more CpG motifs, h other embodiments the T-rich immunostimulatory nucleic acid is free of one or more CpG dinucleotides. In other embodiments the T-rich immunostimulatory nucleic acid has poly A, poly-G, and/or poly C motifs. In other embodiments the T-rich immunostimulatory nucleic acid is free of two poly C sequences of at least 3 contiguous C nucleotide residues. Preferably the T- rich immunostimulatory nucleic acid is free of two poly A sequences of at least 3 contiguous A nucleotide residues.
  • the T-rich immunostimulatory nucleic acid comprises a nucleotide composition of greater than 25% C or greater than 25% A. In yet other embodiments the T-rich immunostimulatory nucleic acid is free of poly-C sequences, poly-G sequences or poly-A sequences. In some cases the T-rich immunostimulatory nucleic acid may be free of poly-T motifs, but rather, comprises a nucleotide composition of greater than 25% T. In other embodiments the T-rich immunostimulatory nucleic acid may have poly-T motifs and also comprise a nucleotide composition of greater than 25% T.
  • the T-rich immunostimulatory nucleic acid comprises a nucleotide composition of greater than 25 % T, greater than 30% T, greater than 40% T, greater than 50% T, greater than 60% T, greater than 80% T, or greater than 90% T nucleotide residues.
  • the poly-G nucleic acid comprises: 5' X ⁇ X 2 GGGX 3 3' wherein Xj, X 2 , X 3 , and X are nucleotides. In embodiments at least one of X and are a G or both of X and are a G. In other embodiments the poly-G nucleic acid comprises the following formula: 5' GGGNGGG 3' wherein N represents between 0 and 20 nucleotides. In yet other embodiments the poly-G nucleic acid comprises the following formula: 5' GGGNGGGNGGG 3' wherein N represents between 0 and 20 nucleotides.
  • the poly-G immunostimulatory nucleic acid may include one or more CpG motifs or T-rich motifs. In other embodiments the poly-G nucleic acid is free of one or more CpG dinucleotides or poly-T motifs.
  • FIG. 1 depicts data from flow cytometry which demonstrates the induction of a morphologic change in marginal zone lymphoma cells upon CpG oligonucleotide stimulation.
  • Malignant B cells from a patient with marginal zone lymphoma were stimulated with no oligonucleotide (A and D), control oligonucleotide (ODN 2017, SEQ ID NO: 168, B and E) or CpG oligonucleotide (ODN 2006, SEQ J_D NO: 729, C and F) and analyzed by flow cytometry.
  • A, B, and C illustrate forward scatter (FSC; x-axis) vs. side scatter (SSC; y-axis).
  • D, E and F illustrate CD 19 expression (x-axis) against FSC (y-axis).
  • Figure 2 depicts data from flow cytometry which demonstrates the change in expression of surface antigens on marginal zone lymphoma cells upon CpG oligodoexynucleotide (ODN) treatment.
  • ODN CpG oligodoexynucleotide
  • Figure 3 is a set of bar graphs depicting changes in expression of surface antigens on primary cells representing different B-cell malignancies and cells of a benign follicular hyperplasia upon treatment with, from left to right in each panel: negative control, no oligonucleotide, control oligonucleotide (ODN 2017, SEQ JD NO: 168), or CpG oligonucleotide (ODN 2006, SEQ ID NO: 729). Each panel represents one experiment.
  • Figure 4 is a set of graphs depicting the observation that the effect of CpG oligonucleotide on CD20 (top) and CD40 (bottom) is dependent on the baseline level of expression of CD20 and CD40.
  • FIG. 5 depicts data from flow cytometry which demonstrates the effect of CpG oligonucleotide-induced proliferation of malignant and normal B cells.
  • Peripheral blood mononuclear cells from patients with B-CLL (left) or marginal zone lymphoma with circulating malignant cells (right) were incubated with CpG oligonucleotide (bottom) or medium alone (top) and evaluated by two-color flow cytometry.
  • CFSE fluorescence (x-axis) and expression of CD5 (B-CLL) or CD 19 (marginal zone lymphoma) (y-axis) were evaluated.
  • Figure 6 is a graph depicting the survival of mice injected on Day 0 with tumor cells in response to CpG simulation in combmation with murine IgG2a and murine IgGl anti- tumor antibodies. Treatments are shown as filled squares, untreated controls; filled circles, murine IgGl ; filled triangles, murine IgGl plus CpG; filled diamonds, murine IgG2a; and open squares, murine IgG2a plus CpG.
  • the invention provides methods and products for the more effective treatment of cancer using a combination of immunostimulatory nucleic acids, antibodies, and optionally cancer therapies.
  • the invention is based, in part, on the surprising discovery that administration to a subject of immunostimulatory nucleic acids induces the expression of cell surface antigens including CD20, CD19, and CD22 on the surface of a cancer cell and that the induction of these antigens leads to enhanced antibody-dependent cellular cytotoxicity (ADCC). It was previously believed that CpG oligonucleotides enhanced ADCC by influencing the effector cell (e.g., by activating natural killer (NK) cells).
  • NK natural killer
  • the invention provides a method for treating or preventing cancer which involves the administration to a subject of a combination of an immunostimulatory nucleic acid and an antibody which specifically interacts with CD20, CD 19, and CD22 in an effective amount to prevent or treat the cancer.
  • Immunostimulatory nucleic acids but not control nucleic acids, increased the expression of co-stimulatory molecules (e.g., CD40, CD80, CD86, CD54) on malignant B cells without altering the phenotype of B cells derived from reactive follicular hyperplasia.
  • Immunostimulatory nucleic acids also enhanced expression of both class I and class II MHC in most samples.
  • CD20 expression was increased in response to immunostimulatory nucleic acids, most notably in B-CLL and marginal zone lymphoma.
  • the invention relates to methods for identifying an appropriate therapy for a lymphoma patient, and for treating the patient using that therapy.
  • the method can be accomplished by isolating a B cell from a lymphoma patient and comparing the surface antigens expressed on the malignant B cell with those expressed on normal B cells.
  • the antigens which are expressed in low levels or not at all on the malignant B cell can be identified.
  • the subject can then be treated using a combination of an immunostimulating nucleic acid and an antibody which specifically recognizes the antigen(s) which are expressed in low levels or not at all on the malignant B cell.
  • the invention is also useful for treating cancers which are resistant to monoclonal antibody therapy. It has been discovered according to the invention, that immunostimulatory nucleic acids can reverse the resistance of tumor cells and render tumor cells which were previously non-responsive or only weakly responsive, sensitive to therapy. In particular it has been discovered that immunostimulatory nucleic acids can cause a phenotypic change to a resistant tumor cell that renders it sensitive to monoclonal antibody therapy. For instance, the monoclonal anti-CD20 antibody Rituximab has been shown to be effective clinically in several trials and has recently been approved for the therapy of follicular B cell lymphoma.
  • the immunostimulatory nucleic acids of the invention are useful for treating this set of resistant tumors. Additionally, Rituximab has not been useful for the treatment of all types of B cell malignancies. Expression of CD20 is relatively low on B-CLL cells, which provides an explanation for why Rituximab is less effective for CLL than for some other B-cell malignancies. Grinaldi L et a ⁇ ., JClin Pathol 51:364-9 (1998). The immunostimulatory nucleic acids of the invention are also useful for treating these tumors.
  • the humanized monoclonal antibody 1D10 recognizes an HLA-DR variant antigen.
  • This antibody is currently being tested in a phase I clinical trial in patients with lymphoma.
  • the target antigen is only expressed by approximately 50% of B-cell lymphomas.
  • its expression was upregulated by immunostimulatory nucleic acids in all lymphoma samples tested. It was discovered according to the invention that immunostimulatory nucleic acids may enhance the efficacy of therapy with these and other antibodies by increasing expression of target antigen.
  • the invention includes methods for treating lymphoma by administering to a subject an immunostimulatory nucleic acid and antibodies specific for HLA-DR.
  • One useful antibody is the humanized monoclonal antibody ID 10. It is particularly useful for treating resistant tumors.
  • the invention also relates to the discovery of a specific subclass, or isotype, of antibody which when combined with immunostimulatory nucleic acids produces a synergistic immune response. Another subclass, or isotype, does not even provide an additive response when combined with immunostimulatory nucleic acids. It was discovered according to the invention that the combination of immunostimulatory nucleic acids and human antibodies of the IgGl isotype results in an increased (synergistic) survival rate.
  • immunostimulatory nucleic acids When immunostimulatory nucleic acids are combined with human antibodies of the IgG2 isotype, no increase in survival rate is observed over the use of the IgG2 antibody alone.
  • the IgG2 isotype (which correlates with the murine IgGl isotype) is believed to be recognized by the Fc receptor designated CD 16 that is expressed largely by NK cells.
  • Immunostimulatory nucleic acids are known to activate NK cells, and thus, it is su ⁇ rising that immunostimulatory nucleic acids do not enhance the therapeutic effect of human IgG2 or murine IgGl antibodies.
  • NK cells are believed to be involved in ADCC and are activated by immunostimulatory nucleic acids, it was surprising that antibodies of the human IgG2 (or murine IgGl) isotype do not produce a synergistic or even additive response when administered with immunostimulatory nucleic acids.
  • a cancer cell is a cell that divides and reproduces abnormally due to a loss of normal growth control. Cancer cells almost always arise from at least one genetic mutation. In some instances, it is possible to distinguish cancer cells from their normal counte ⁇ arts based on profiles of expressed genes and proteins, as well as to the level of their expression. Genes commonly affected in cancer cells include oncogenes, such as ras, neu/HER2/erbB, myb, myc and abl, as well as tumor suppressor genes such as p53, Rb, DCC, RET and WT. Cancer-related mutations in some of these genes leads to a decrease in their expression or a complete deletion. In others, mutations cause an increase in expression or the expression of an activated variant of the normal counterpart.
  • neoplasm is usually equated with neoplasm, which literally means “new growth” and is used interchangeably with “cancer.”
  • a "neoplastic disorder” is any disorder associated with cell proliferation, specifically with a neoplasm.
  • a “neoplasm” is an abnormal mass of tissue that persists and proliferates after withdrawal of the carcinogenic factor that initiated its appearance.
  • the method of the invention can be used to treat neoplastic disorders in humans, including but not limited to: sarcoma, carcinoma, fibroma, glioma, leukemia, lymphoma, melanoma, myeloma, neuroblastoma, retinoblastoma, and rhabdomyosarcoma, as well as each of the other tumors described herein.
  • sarcoma as used herein refers to an uncontrolled growth of cells which interferes with the normal functioning of the bodily organs and systems. Cancers which migrate from their original location and seed vital organs can eventually lead to the death of the subject through the functional deterioration of the affected organs.
  • Hemopoietic cancers such as leukemia, are able to out-compete the normal hemopoietic compartments in a subject, thereby leading to hemopoietic failure (in the form of anemia, thrombocytopenia and neutropenia), ultimately causing death.
  • a metastasis is a region of cancer cells, distinct from the primary tumor location, resulting from the dissemination of cancer cells from the primary tumor to other parts of the body.
  • the subject may be monitored for the presence of metastases. Metastases are most often detected through the sole or combined use of magnetic resonance imaging (MRI) scans, computed tomography (CT) scans, blood and platelet counts, liver function studies, chest X-rays and bone scans in addition to the monitoring of specific symptoms.
  • MRI magnetic resonance imaging
  • CT computed tomography
  • Cancers include, but are not limited to, basal cell carcinoma, biliary tract cancer; bladder cancer; bone cancer; brain and CNS cancer; breast cancer; cervical cancer; choriocarcinoma; colon and rectum cancer; connective tissue cancer; cancer of the digestive system; endometrial cancer; esophageal cancer; eye cancer; cancer of the head and neck; gastric cancer; infra-epithelial neoplasm; kidney cancer; larynx cancer; leukemia; liver cancer; lung cancer (e.g., small cell and non-small cell); lymphoma including Hodgkin's and non-Hodgkin's lymphoma; melanoma; myeloma; neuroblastoma; oral cavity cancer (e.g., lip, tongue, mouth, and pharynx); ovarian cancer; pancreatic cancer; prostate cancer; retinoblastoma; rhabdomyosarcoma; rectal cancer; renal cancer; cancer of the respiratory system;
  • the immunostimulatory nucleic acids and antibodies are useful for treating or preventing cancer in a subject.
  • a "subject” unless otherwise specified shall mean a human or vertebrate mammal including but not limited to a dog, cat, horse, cow, pig, sheep, goat, or primate, e.g., monkey.
  • the invention can be used to treat cancer and tumors in human and non human subjects.
  • Cancer is one of the leading causes of death in companion animals (i.e., cats and dogs). Cancer usually strikes older animals which, in the case of house pets, have become integrated into the family. Forty-five percent of dogs older than 10 years of age are likely to succumb to the disease. The most common treatment options include surgery, chemotherapy and radiation therapy.
  • treatment modalities which have been used with some success are laser therapy, cryotherapy, hyperthermia and immunotherapy.
  • the choice of treatment depends on the type of cancer and degree of dissemination. Unless the malignant growth is confined to a discrete area in the body, it is difficult to remove only malignant tissue without also affecting normal cells.
  • Malignant disorders commonly diagnosed in dogs and cats include but are not limited to lymphosarcoma, osteosarcoma, mammary tumors, mastocytoma, brain tumor, melanoma, adenosquamous carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchiolar adenocarcinoma, fibroma, myxochondroma, pulmonary sarcoma, neurosarcoma, osteoma, papilloma, retinoblastoma, Ewing's sarcoma, Wilnis' tumor, Burkitt's lymphoma, microglioma, neuroblastoma, osteoclastoma, oral neoplasia, fibrosarcoma, osteosarcoma and rhabdomyosarcoma.
  • neoplasias in dogs include genital squamous cell carcinoma, transmissable venereal tumor, testicular tumor, seminoma, Sertoli cell tumor, hemangiopericytoma, histiocytoma, chloroma (granulocytic sarcoma), corneal papilloma, corneal squamous cell carcinoma, hemangiosarcoma, pleural mesothelioma, basal cell tumor, thymoma, stomach tumor, adrenal gland carcinoma, oral papillomatosis, hemangioendothelioma and cystadenoma.
  • Additional malignancies diagnosed in cats include follicular lymphoma, intestinal lymphosarcoma, fibrosarcoma and pulmonary squamous cell carcinoma.
  • the ferret an ever-more popular house pet, is known to develop insulinoma, lymphoma, sarcoma, neuroma, pancreatic islet cell tumor, gastric MALT lymphoma and gastric adenocarcinoma.
  • Neoplasias affecting agricultural livestock include leukemia, hemangiopericytoma and bovine ocular neoplasia (in cattle); preputial fibrosarcoma, ulcerative squamous cell carcinoma, preputial carcinoma, connective tissue neoplasia and mastocytoma (in horses); hepatocellular carcinoma (in swine); lymphoma and pulmonary adenomatosis (in sheep); pulmonary sarcoma, lymphoma, Rous sarcoma, reticuloendotheliosis, fibrosarcoma, nephroblastoma, B-cell lymphoma and lymphoid leukosis (in avian species); retinoblastoma, hepatic neoplasia, lymphosarcoma (lymphoblastic lymphoma), plasmacytoid leukemia and swimbladder sarcoma (in fish), caseous lymphadenitis (C
  • a method for treating cancer involves administering the compositions of the invention to a subject having cancer.
  • a "subject having cancer” is a subject that has been diagnosed with a cancer.
  • the subject has a cancer type characterized by a solid mass tumor.
  • the solid tumor mass if present, may be a primary tumor mass.
  • a primary tumor mass refers to a growth of cancer cells in a tissue resulting from the transformation of a normal cell of that tissue. In most cases, the primary tumor mass is identified by the presence of a cyst, which can be found through visual inspection or palpation methods, or by irregularity in shape, texture or weight of the tissue.
  • the invention is aimed at administering the compositions of the invention to a subject at risk of developing cancer.
  • a subject at risk of developing a cancer is one who has a high probability of developing cancer. These subjects include, for instance, subjects having a genetic abnormality, the presence of which has been demonstrated to have a correlative relation to a higher likelihood of developing a cancer.
  • Subjects exposed to cancer-causing agents such as tobacco, asbestos, or other chemical toxins are also subjects at risk of developing cancers used herein.
  • an immunostimulatory nucleic acid, an antibody and optionally a cancer therapy on a regular basis, such as monthly, the cancer growth will be prevented from initiating.
  • This aspect of the invention is particularly advantageous when the subjects employed in certain trades which are exposed to cancer- causing agents on an ongoing basis. For example, many airborne, or inhaled, carcinogens such as tobacco smoke and asbestos have been associated with lung cancer.
  • a carcinogen is an agent capable of initiating development of malignant cancers. Exposure to carcinogens generally increases the risk of neoplasms in subjects, usually by affecting DNA directly. Carcinogens may take one of several forms such as chemical, electromagnetic radiation, or may be an inert solid body. Substances for which there is sufficient evidence to establish a causal relationship in cancer in humans are referred to as confirmed human carcinogens.
  • Aflatoxins include Alcoholic beverages, Aluminium production, 4- aminobiphenyl, Arsenic and arsenic compounds, Asbestos, Manufacture of auramine, Azathioprine, Benzene, Benzidine, Beryllium and beryllium compounds, Betel quid with tobacco, Bis(chloromethyl)ether and chloromethyl methyl ether (technical grade), Boot and shoe manufacture and repair (occupational exposure), 1,4 Butanediol dimethanesulphonate (Myleran), Cadmium and cadmium compounds, Chlorambucil, Chlornaphazine, l-(2- Chloroethyl)-3-(4-methylcyclohexyl)-l nitrosourea, Chloromethyl methyl ether (technical), Chromium compounds (hexavalent), Coal gasification, Coal tar pitches, Coal tars, Coke production, Cyclophosphamide,
  • Substances for which there is a lesser degree of evidence in humans but sufficient evidence in animal studies, or degrees of evidence considered unequivocal of mutagenicity in mammalian cells, are referred to as probable human carcinogens.
  • This category of substances includes: Acrylamide, Acrylonitrile, Adriamycin, Anabolic steroids, Azacitidine, Benzanthracene, Benzidine-based dyes (technical grade), Direct Black 38, Direct Blue 6, Direct Brown 95, Benzopyrenel,3-Butadiene, Captafol, Bischloroethyl nitrosourea (BCNU), 1 -(2-Chloroethyl)-3-cyclohexyl-l -nitrosourea (CCNU), Chloramphenicolpara-Chloro-ortho- toluidine and its strong acid salts, Chlorozotocin, Cisplatin, Creosotes, Dibenzanthracene, Diesel engine exhaust, Diethy
  • Substances for which there is sufficient evidence in animal tests are referred to as possible human carcinogens.
  • This category of substances includes: A-C(2-Amino-9H- pyrido[2,3-b]indole), Acetaldehyde, Acetamide, AF-2[2-(2-Furyl)-3-(5-nitro-2- furyl)acrylamide, para-Aminoazobenzene, ortho-Aminoazobenzene, 2-Amino-5-(5-nitro-2- furyl)-l,3,4-thiadiazole, Amitrole, ortho-Anisidine, Antimony trioxide, Aramite, Atrazine, Attapulgite, Azaserine, Benzo[b]fluoranthene, Benzo[j]fluoranthene, Benzo[k]fluoranthene, Benzyl violet, Bitumens (extracts of steam-refined and air-refined bitumens), Bleomycins, Bra
  • Diaminodiphenyl ether 2,4-Diaminotoluene, Dibenz[a,h]acridine, Dibenz[a,j]acridine, 7H- Dibenzo[c,g]carbazole, Dibenzo[a,e]pyrene, Dibenzo[a,h]pyrene, Dibenzo[a,i]pyrene, Dibenzo[a,l]pyrene, l,2-Dibromo-3-chloropropane, para-Dichlorobenzene, 3,3'- Dichlorobenzene, 3,3'-Dichloro-4,4'-diaminodiphenyl ether, 1,2-Dichloroethane, Dichloromethane, 1,3-Dichloropropene (technical grade), Dichlorvos, Diepoxybutane, Diesel fuel (marine), Di(2-ethylhexyl)phthalate, 1,2-Diethylhydrazine, Diglycidyl
  • Phenoxybenzamine hydrochloride Phenyl glycidyl ether, PhenytoinPhJJP (2 -Amino- 1- methyl-6-phenylimidazo[4,5-b]pyridine, Pickled vegetables, traditional Asian, Polybrominated biphenyls, Ponceau MXPonceau 3R, Potassium bromate, 1,3 -Propane sultone, Propylene oxide, Progestins, Medroxyprogesterone acetate, a-Propiolactone, Propylthiouracil, Rockwool, Saccharin, Safrole, Slagwool, Sodium ortho-phenylphenate,
  • Subjects at risk of developing cancer also include those who have a genetic predisposition to cancer.
  • genetic predisposition to cancer can be identified by studying the occurrence of cancer in family members.
  • Examples of genetic predisposition to common forms of cancer include, but are not limited to, mutation of BRCA1 and BRCA2 in familial breast cancer, mutation of APC in familial colony cancer (familial polyposis coli), mutation of MSH2 and MLH1 in hereditary nonpolyposis colon cancer (HNPCC), mutation of p53 in Li-Fraumeni syndrome, mutation of Rbl in retinoblastoma, mutation of RET in multiple endocrine neoplasia type 2 (MEN2), mutation of VHL in renal cancer and mutation of WT1 in Wilms' tumor.
  • Other cancers for which a familial predisposition has been identified include ovarian, prostate, melanoma and lung cancer.
  • cancer medicaments It has been estimated that almost half of all currently diagnosed cancers will be treated with some form of cancer medicament.
  • many forms of cancer including melanoma, colorectal, prostate, endometrial, cervical and bladder cancer, do not respond well to treatment with cancer medicaments.
  • cancer medicaments only about 5-10 percent of cancers can be cured using cancer medicaments alone. These include some forms of leukemias and lymphomas, testicular cancer, choriocarcinoma, Wilms' tumor, Ewing's sarcoma, neuroblastoma, small-cell lung cancer and ovarian cancer.
  • Treatment of still other cancers, including breast cancer requires a combination therapy of surgery or radiotherapy in conjunction with a cancer medicament.
  • the immunostimulatory nucleic acids are administered in combination with antibodies which specifically bind to cancer cell surface antigens.
  • antibodies include but are not limited to anti-CD20 antibodies, anti-CD40 antibodies, anti-CD 19 antibodies, anti-CD22 antibodies, anti-HLA-DR antibodies, anti-CD80 antibodies, anti-CD86 antibodies, anti-CD54 antibodies, and anti-CD69 antibodies. These antibodies are available from commercial sources or may be synthesized de novo.
  • anti-CD20 antibodies include but are not limited to those presented in Table 1 below.
  • Antibodies are well known to those of ordinary skill in the science of immunology.
  • the term “antibody” means not only intact antibody molecules but also fragments of antibody molecules retaining specific binding ability. Such fragments are also well known in the art and are regularly employed both in vitro and in vivo.
  • the term “antibody” means not only intact immunoglobulin molecules but also the well-known active fragments F(ab') , and Fab. F(ab') 2 , and Fab fragments which lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody. Wahl RL et al., JNucl Med 24:316-25 (1983).
  • Antibody fragments which are particularly useful according to the methods of the invention are those which are bispecific and constructed to enhance FcR binding, e.g., include an Fc portion. These include, but are not limited to Medarex antibodies (MDX-210, 220, 22, 447, and 260). Other non-Fc containing fragments which interact with the antigens induced on the cell surface are also useful. These are particularly useful in combination with immunotoxins and/or radioactivity. The fragments can be delivered separately from the immunotoxins or radioactivity or conjugated thereto (e.g., radiolabled antibodies or antibody fragments).
  • CDRs complementarity-determining regions
  • FRs framework regions
  • CDR1 through CDR3 complementarity-determining regions
  • a "humanized monoclonal antibody” as used herein is a human monoclonal antibody or functionally active fragment thereof having human constant regions and a binding CDR3 region from a mammal of a species other than a human.
  • Humanized monoclonal antibodies may be made by any method known in the art. Humanized monoclonal antibodies, for example, may be constructed by replacing the non-CDR regions of a non-human mammalian antibody with similar regions of human antibodies while retaining the epitopic specificity of the original antibody. For example, non-human CDRs and optionally some of the framework regions may be covalently joined to human FR and/or Fc/pFc' regions to produce a functional antibody.
  • European Patent Application 0239400 provides an exemplary teaching of the production and use of humanized monoclonal antibodies in which at least the CDR portion of a murine (or other non-human mammal) antibody is included in the humanized antibody. Briefly, the following methods are useful for constructing a humanized CDR monoclonal antibody including at least a portion of a mouse CDR.
  • a first replicable expression vector including a suitable promoter operably linked to a DNA sequence encoding at least a variable domain of an Ig heavy or light chain and the variable domain comprising framework regions from a human antibody and a CDR region of a murine antibody is prepared.
  • a second replicable expression vector which includes a suitable promoter operably linked to a DNA sequence encoding at least the variable domain of a complementary human Ig light or heavy chain respectively.
  • a cell line is then transformed with the vectors.
  • the cell line is an immortalized mammalian cell line of lymphoid origin, such as a myeloma, hybridoma, trioma, or quadroma cell line, or is a normal lymphoid cell which has been immortalized by transformation with a virus.
  • the transformed cell line is then cultured under conditions known to those of skill in the art to produce the humanized antibody.
  • several techniques are well known in the art for creating the particular antibody domains to be inserted into the replicable vector.
  • the DNA sequence encoding the domain may be prepared by oligonucleotide synthesis.
  • Another method involves the preparation of the DNA sequence encoding the variable CDR containing domain by oligonucleotide site- directed mutagenesis. Each of these methods is well known in the art. Therefore, those skilled in the art may construct humanized antibodies containing a murine CDR region without destroying the specificity of the antibody for its epitope.
  • Human monoclonal antibodies may be made by any of the methods known in the art, such as those disclosed in U.S. Patent No. 5,567,610, issued to Borrebaeck et al., U.S. Patent No. 5,565,354, issued to Ostberg, U.S. Patent No. 5,571,893, issued to Baker et al, Kozbor D et al., J Immunol 133:3001-5 (1984), Brodeur et al., Monoclonal Antibody Production
  • Such antibodies may also be prepared by immunizing transgenic animals that are capable of producing human antibodies (e.g., Jakobovits A et al., Proc Natl Acad Sci USA 90:2551-5 (1993); Jakobovits A et al., N ⁇ twre 362:255-8 (1993); Bruggermann et al., Year in Immunology 7:33 (1993); and U.S. Patent No. 5,569,825 issued to Lonberg).
  • Jakobovits A et al. Proc Natl Acad Sci USA 90:2551-5 (1993); Jakobovits A et al., N ⁇ twre 362:255-8 (1993); Bruggermann et al., Year in Immunology 7:33 (1993); and U.S. Patent No. 5,569,825 issued to Lonberg).
  • an antibody from which the pFc' region has been enzymatically cleaved, or which has been produced without the pFc' region designated an F(ab') 2 fragment
  • an antibody from which the Fc region has been enzymatically cleaved, or which has been produced without the Fc region designated an Fab fragment
  • Fab fragments consist of a covalently bound antibody light chain and a portion of the antibody heavy chain denoted Fd.
  • the Fd fragments are the major determinant of antibody specificity (a single Fd fragment may be associated with up to ten different light chains without altering antibody specificity) and Fd fragments retain epitope-binding ability in isolation.
  • antibodies useful according to the invention are antibodies of the IgGl isotype.
  • anti-IgGl isotype antibody as used herein refers to a human or humanized anti-IgGl unless otherwise specified.
  • IgGl isotype antibodies are well known in the art and include at least the antibodies listed in Table 2 below.
  • the nucleic acid and antibody are administered in combination with a cancer therapy.
  • a cancer therapy refers to an agent which prevents growth of a cancer cell by decreasing or slowing the rate of growth, by inhibiting growth altogether, or by killing or inducing apoptosis of the cancer cell.
  • treating cancer includes preventing the development of a cancer, reducing the symptoms of cancer, and/or inhibiting the growth of an established cancer.
  • the cancer therapy is administered to a subject at risk of developing a cancer for the pu ⁇ ose of reducing the risk of developing the cancer.
  • chemotherapeutic agents are classified as chemotherapeutic agents, cancer vaccines, hormone therapy, biological response modifiers, surgical procedures, and radiotherapy aimed at treating cancer.
  • the methods of the invention are intended to embrace the use of more than one cancer therapy along with the immunostimulatory nucleic acids and antibody.
  • the immunostimulatory nucleic acids may be administered with a both a chemotherapeutic agent and a radiotherapy.
  • Cancer therapies function in a variety of ways. Some cancer therapies work by targeting physiological mechanisms that are specific to tumor cells. Examples include the targeting of specific genes and their gene products (i.e., proteins primarily) which are mutated in cancers. Such genes include but are not limited to oncogenes (e.g., Ras, Her2, bcl-2), tumor suppressor genes (e.g., EGF, p53, Rb), and cell cycle targets (e.g., CDK4, p21, telomerase). Cancer therapies can alternately target signal transduction pathways and molecular mechanisms which are altered in cancer cells.
  • oncogenes e.g., Ras, Her2, bcl-2
  • tumor suppressor genes e.g., EGF, p53, Rb
  • cell cycle targets e.g., CDK4, p21, telomerase.
  • cancer therapies target cells other than cancer cells.
  • some medicaments prime the immune system to attack tumor cells (i.e., cancer vaccines).
  • Still other medicaments called angiogenesis inhibitors, function by attacking the blood supply of solid tumors. Since the most malignant cancers are able to metastasize (i.e., exit the primary tumor site and seed a distal tissue, thereby forming a secondary tumor), medicaments that impede this metastasis are also useful in the treatment of cancer.
  • Angiogenic mediators include basic FGF, VEGF, angiopoietins, angiostatin, endostatin, TNF- ⁇ , TNP-470, thrombospondin-1, platelet factor 4, CAI, and certain members of the integrin family of proteins.
  • a metalloproteinase inhibitor which inhibits the enzymes used by the cancer cells to exit the primary tumor site and extravasate into another tissue.
  • chemotherapeutic agents encompass both chemical and biological agents. These agents function to inhibit a cellular activity which the cancer cell is dependent upon for continued survival. Categories of chemotherapeutic agents include alkylating/alkaloid agents, antimetabolites, hormones or hormone analogs, and miscellaneous antineoplastic drugs. Most ifnot all of these agents are directly toxic to cancer cells and do not require immune stimulation. Chemotherapeutic agents which are currently in development or in use in a clinical setting are shown in Table 3 below.
  • Interferon- ⁇ e.g., INTRON® A, Schering.
  • nucleic acids may be double-stranded or single-stranded. Generally, double-stranded molecules may be more stable in vivo, while single-stranded molecules may have increased activity.
  • nucleic acid and oligonucleotide refer to multiple nucleotides (i.e., molecules comprising a sugar (e.g., ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g., cytosine (C), thymine (T) or uracil (U)) or a substituted purine (e.g., adenine (A) or guanine (G)) or a modified base.
  • a substituted pyrimidine e.g., cytosine (C), thymine (T) or uracil (U)
  • purine e.g., adenine (A) or guanine (
  • nucleic acid and oligonucleotide also encompass nucleic acids or oligonucleotides with a covalently modified base and/or sugar. For example, they include nucleic acids having backbone sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3' position and other than a phosphate group at the 5' position.
  • modified nucleic acids may include a 2'-O-alkylated ribose group.
  • modified nucleic acids may include sugars such as arabinose instead of ribose.
  • the nucleic acids may be heterogeneous in backbone composition thereby containing any possible combination of polymer units linked together such as peptide-nucleic acids (which have amino acid backbone with nucleic acid bases).
  • the nucleic acids are homogeneous in backbone composition.
  • Nucleic acids also can include base analogs such as C-5 propyne modified bases.
  • Purines and pyrimidines include but are not limited to adenine, cytosine, guanine, thymine, 5-methylcytosine, 2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine, hypoxanthine, and other naturally and non-naturally occurring nucleobases, substituted and unsubstituted aromatic moieties.
  • the nucleic acid is a linked polymer of bases or nucleotides. As used herein with respect to linked units of a nucleic acid, "linked" or “linkage” means two entities are bound to one another by any physicochemical means.
  • linkages Any linkage known to those of ordinary skill in the art, covalent or non-covalent, is embraced. Such linkages are well known to those of ordinary skill in the art. Natural linkages, which are those ordinarily found in nature connecting the individual units of a nucleic acid , are most common. The individual units of a nucleic acid may be linked, however, by synthetic or modified linkages.
  • nucleic acid is represented by a sequence of letters it will be understood that the nucleotides are in 5' ⁇ 3' order from left to right and that "A” denotes adenosine, “C” denotes cytosine, “G” denotes guanosine, “T” denotes thymidine, and “U” denotes uracil unless otherwise noted.
  • Nucleic acid molecules useful according to the invention can be obtained from natural nucleic acid sources (e.g., genomic nuclear or mitochondrial DNA or cDNA), or are synthetic (e.g., produced by oligonucleotide synthesis). Nucleic acids isolated from existing nucleic acid sources are referred to herein as native, natural, or isolated nucleic acids.
  • the nucleic acids useful according to the invention may be isolated from any source, including eukaryotic sources, prokaryotic sources, nuclear DNA, mitochondrial DNA, etc. Thus, the term nucleic acid encompasses both synthetic and isolated nucleic acids.
  • isolated refers to a nucleic acid which is substantially free of other nucleic acids, proteins, lipids, carbohydrates or other materials with which it is naturally associated.
  • the nucleic acids can be produced on a large scale in plasmids, (see Sambrook T et al., "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory Press, New York, 1989) and separated into smaller pieces or administered whole. After being administered to a subject the plasmid can be degraded into oligonucleotides.
  • One skilled in the art can purify viral, bacterial, eukaryotic, etc., nucleic acids using standard techniques, such as those employing restriction enzymes, exonucleases or endonucleases.
  • the nucleic acids can be synthesized de novo using any of a number of procedures well known in the art.
  • the b-cyanoethyl phosphoramidite method (Beaucage SL et al., Tetrahedron Lett 22:1859, 1981); nucleoside H-phosphonate method (Garegg et al., Tetrahedron Lett 27:4051-4, 1986; Froehler et al., Nucl Acid Res 14:5399-407, 1986; Garegg et al., Tetrahedron Lett 27:4055-8, 1986; Gaffhey et al., Tetrahedron Lett 29:2619-22, 1988).
  • These chemistries can be performed by a variety of automated oligonucleotide synthesizers available in the market.
  • the nucleic acids useful according to the invention are immunostimulatory nucleic acids.
  • An immunostimulatory nucleic acid is any nucleic acid, as described above, which is capable of modulating an immune response.
  • a nucleic acid which modulates an immune response is one which produces any form of immune stimulation, including, but not limited to, induction of cytokines, B-cell activation, T-cell activation, monocyte activation.
  • Immunostimulatory nucleic acids include, but are not limited to, CpG nucleic acids, methylated CpG nucleic acids, T-rich nucleic acids, poly-G nucleic acids, and nucleic acids having phosphate modified backbones, such as phosphorothioate backbones.
  • CpG nucleic acid or a “CpG immunostimulatory nucleic acid” as used herein is a nucleic acid containing at least one unmethylated CpG dinucleotide (cytosine-guanine dinucleotide sequence, i.e., "CpG DNA” or DNA containing a 5' cytosine followed by 3' guanosine and linked by a phosphate bond) and activates a component of the immune system.
  • the entire CpG nucleic acid can be unmethylated or portions may be unmethylated but at least the C of the 5' CG 3' must be unmethylated.
  • the invention provides a CpG nucleic acid represented by at least the formula:
  • Xi and X 2 are nucleotides and N is any nucleotide and Ni and N 2 are nucleic acid sequences composed of from about 0-25 N's each.
  • Xi is adenine, guanine, or thymine and X 2 is cytosine, adenine, or thymine.
  • Xi is cytosine and/or X 2 is guanine.
  • the CpG nucleic acid is represented by at least the formula: 5' N ⁇ X ⁇ X 2 CGX 3 X 4 N 2 3' wherein Xi, X 2 , X 3 , and X 4 are nucleotides.
  • X ⁇ X 2 are nucleotides selected from the group consisting of: GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA, TpT, and TpG; and X - are nucleotides selected from the group consisting of: TpT, CpT, ApT, TpG, ApG, CpG, TpC, ApC, CpC, TpA, ApA, and CpA; N is any nucleotide and Ni and N 2 are nucleic acid sequences composed of from about 0-25 N's each.
  • X ⁇ X 2 are GpA or GpT and X 3 X 4 are TpT.
  • Xi or X 2 or both are purines and X or X-j or both are pyrimidines or X ⁇ X are GpA and X 3 or X or both are pyrimidines.
  • Ni and N 2 of the nucleic acid do not contain a CCGG or CGCG quadmer or more than one CCG or CGG trimer. The effect of a CCGG or CGCG quadmer or more than one CCG or CGG trimer depends in part on the status of the nucleic acid backbone.
  • the nucleic acid has a phosphodiester backbone or a chimeric backbone the inclusion of these sequences in the nucleic acid will only have minimal if any affect on the biological activity of the nucleic acid. If the backbone is completely phosphorothioate or significantly phosphorothioate then the inclusion of these sequences may have more influence on the biological activity or the kinetics of the biological activity, but compounds containing these sequences are still useful.
  • the CpG nucleic acid has the sequence 5' TCN ⁇ TX ⁇ X 2 CGX X 4 3'.
  • T-rich nucleic acid or “T-rich immunostimulatory nucleic acid” is a nucleic acid which includes at least one poly-T sequence and/or which has a nucleotide composition of greater than 25% T nucleotide residues and which activates a component of the immune system.
  • a nucleic acid having a poly-T sequence includes at least four Ts in a row, such as 5' TTTT 3'.
  • the T-rich nucleic acid includes more than one poly-T sequence, hi preferred embodiments the T-rich nucleic acid may have 2, 3, 4, etc., poly-T sequences, such as oligonucleotide #2006 (5' TCGTCGTTTTGTCGTTTTGTCGTT 3', SEQ ID NO: 729).
  • oligonucleotide #2006 5' TCGTCGTTTTGTCGTTTTGTCGTT 3', SEQ ID NO: 729.
  • One of the most highly immunostimulatory T-rich oligonucleotides discovered according to the invention is a nucleic acid composed entirely of T nucleotide residues, e.g., oligonucleotide #2183 (5* ⁇ 3 ⁇ SE Q j ) N0: 841).
  • T-rich nucleic acids have a nucleotide composition of greater than 25% T nucleotide residues, but do not necessarily include a poly-T sequence.
  • the T nucleotide resides may be separated from one another by other types of nucleotide residues, i.e., G, C, and A.
  • the T-rich nucleic acids have a nucleotide composition of greater than 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 99%, T nucleotide residues and every integer % in between.
  • the T-rich nucleic acids have at least one poly-T sequence and a nucleotide composition of greater than 25% T nucleotide residues.
  • the T-rich nucleic acid is represented by at least the formula:
  • X ⁇ X is TT and or X 3 X 4 is TT.
  • X ⁇ X 2 are any one of the following nucleotides TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC; and X 3 X 4 are any one of the following nucleotides TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC.
  • the T-rich nucleic acid does not contain poly-C (CCCC), poly-A (AAAA), poly-G (GGGG), CpG motifs, or multiple GGs. In other embodiments the T-rich nucleic acid includes these motifs.
  • the T-rich nucleic acids include CpG dmucleotides and in other embodiments the T-rich nucleic acids are free of CpG dmucleotides. The CpG dmucleotides maybe methylated or unmethylated.
  • Poly-G containing nucleic acids are also immunostimulatory.
  • references including Pisetsky DS et al., Mol Biol Rep 18:217-21 (1993); Krieger M et al., Annu Rev Biochem 63:601-37 (1994); Macaya RF et al., Proc Natl Acad Sci USA 90:3745-9 (1993); Wyatt JR et al., Proc Natl Acad Sci USA 91:1356-60 (1994); Rando and Hogan, 1998, In: Applied Antisense Oligonucleotide Technology, eds. Krieg AM and Stein C, pp.
  • Poly G nucleic acids preferably are nucleic acids having the following formulas:
  • the poly-G nucleic acid is free of unmethylated CG dmucleotides, such as, for example, the nucleic acids listed in Table 4 below as SEQ ID NOs: 12-14, 23, 56, 100, 155, 163, 182, 227, 237, 246, 400, 407, 429, 430, 432, 435, 438, 439, 446, 450, 451, 480, 487, 493, 522, 661, 662, 671-673, 807, 808, 821, 823, and 834.
  • the poly-G nucleic acid includes at least one unmethylated CG dinucleotide, such as, for example, the nucleic acids listed in Table 4 below as SEQ ID NOs: 6, 7, 22, 26, 28-30, 87, 115, 141, 177, 191, 209, 254, 258, 267, 303, 317, 329, 335, 344, 345, 395, 414, 417, 418, 423-426, 428, 431, 433, 434, 436, 437, 440, 442-445, 447-449, 458, 460, 463, 467-469, 474, 515, 516, 594, 638-640, 663, 664, 727, 752, 776, 795, 799, 817, 818, 831, and 832.
  • SEQ ID NOs: 6, 7, 22, 26, 28-30 87, 115, 141, 177, 191, 209, 254, 258, 267, 303, 317, 329, 335,
  • Nucleic acids having modified backbones such as phosphorothioate backbones, also fall within the class of immunostimulatory nucleic acids.
  • U.S. Patents Nos. 5,723,335 and 5,663,153 issued to Hutcherson, et al. and related PCT publication WO95/26204 describe immune stimulation using phosphorothioate oligonucleotide analogues. These patents describe the ability of the phosphorothioate backbone to stimulate an immune response in a non-sequence specific manner.
  • the immunostimulatory nucleic acids may be any size but in some embodiments are in the range of between 6 and 100 or in some embodiments between 8 and 35 nucleotides in size, hnmunostimulatory nucleic acids can be produced on a large scale in plasmids. These may be administered in plasmid form or alternatively they can be degraded into oligonucleotides.
  • “Palindromic sequence” shall mean an inverted repeat (i.e., a sequence such as ABCDEE'D'C'B'A' in which A and A' are bases capable of forming the usual Watson-Crick base pairs and which includes at least 6 nucleotides in the palindrome. In vivo, such sequences may form double-stranded structures.
  • the nucleic acid contains a palindromic sequence.
  • a palindromic sequence used in this context refers to a palindrome in which the CpG is part of the palindrome, and optionally is the center of the palindrome. In another embodiment the nucleic acid is free of a palindrome.
  • a nucleic acid that is free of a palindrome does not have any regions of 6 nucleotides or greater in length which are palindromic.
  • a nucleic acid that is free of a palindrome can include a region of less than 6 nucleotides which are palindromic.
  • a "stabilized nucleic acid molecule” shall mean a nucleic acid molecule that is relatively resistant to in vivo degradation (e.g., via an exonuclease or endonuclease). Stabilization can be a function of length or secondary structure. Nucleic acids that are tens to hundreds of kbs long are relatively resistant to in vivo degradation. For shorter nucleic acids, secondary structure can stabilize and increase their effect.
  • an oligonucleotide For example, if the 3' end of an oligonucleotide has self-complementarity to an upstream region, so that it can fold back and form a sort of stem loop structure, then the oligonucleotide becomes stabilized and therefore exhibits more activity.
  • Some stabilized oligonucleotides of the instant invention have a modified backbone. It has been demonstrated that modification of the oligonucleotide backbone provides enhanced activity of the nucleic acids when administered in vivo. Nucleic acids, including at least two phosphorothioate linkages at the 5' end of the oligonucleotide and multiple phosphorothioate linkages at the 3' end, preferably 5, may provide maximal activity and protect the oligonucleotide from degradation by intracellular exo- and endo-nucleases.
  • modified oligonucleotides include phosphodiester modified oligonucleotide, combinations of phosphodiester and phosphorothioate oligonucleotide, methylphosphonate, methylphosphorothioate, phosphorodithioate, and combinations thereof.
  • phosphodiester modified oligonucleotide combinations of phosphodiester and phosphorothioate oligonucleotide, methylphosphonate, methylphosphorothioate, phosphorodithioate, and combinations thereof.
  • modified oligonucleotides may show more stimulatory activity due to enhanced nuclease resistance, increased cellular uptake, increased protein binding, and/or altered intracellular localization. Both phosphorothioate and phosphodiester nucleic acids are active in immune cells.
  • oligonucleotides include: nonionic DNA analogs, such as alkyl- and aryl-phosphates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Oligonucleotides which contain diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation.
  • nucleic acids are preferably relatively resistant to degradation (e.g., via endonucleases and exonucleases). Secondary structures, such as stem loops, can stabilize nucleic acids against degradation. Alternatively, nucleic acid stabilization can be accomplished via phosphate backbone modifications. One type of stabilized nucleic acid has at least a partial phosphorothioate modified backbone. Phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries. Aryl- and alkyl-phosphonates can be made, e.g., as described in U.S. Patent No.
  • 4,469,863; and alkylphosphotriesters in which the charged oxygen moiety is alkylated as described in U.S. Patent No. 5,023,243 and European Patent No. 092,574 can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described. Uhlmann E et al., Chem Rev 90:544-84 (1990); Goodchild J, Bioconjugate Chem 1:165-87 (1990).
  • the immunostimulatory nucleic acids having backbone modifications useful according to the invention in some embodiments are S- or R-chiral immunostimulatory nucleic acids.
  • S chiral immunostimulatory nucleic acid as used herein is an immunostimulatory nucleic acid wherein at least two nucleotides have a backbone modification forming a chiral center and wherein a plurality of the chiral centers have S chirality.
  • R chiral immunostimulatory nucleic acid as used herein is an immunostimulatory nucleic acid wherein at least two nucleotides have a backbone modification forming a chiral center and wherein a plurality of the chiral centers have R chirality.
  • the backbone modification may be any type of modification that forms a chiral center.
  • the modifications include but are not limited to phosphorothioate, methylphosphonate, methylphosphorothioate, phosphorodithioate, 2'-OMe and combinations thereof. In other embodiments they are non-chiral.
  • a non-chiral nucleic acid is any nucleic acid which does not have at least two chiral centers.
  • the chiral immunostimulatory nucleic acids must have at least two nucleotides within the nucleic acid that have a backbone modification. All or less than all of the nucleotides in the nucleic acid, however, may have a modified backbone. Of the nucleotides having a modified backbone (referred to as chiral centers), a plurality have a single chirality, S or R. A "plurality" as used herein refers to an amount greater than or equal to 75%. Thus, less than all of the chiral centers may have S or R chirality as long as a plurality of the chiral centers have S or R chirality.
  • At least 75%, 80%, 85%, 90%, 95%, or 100% of the chiral centers have S or R chirality.
  • at least 75%, 80%, 85%, 90%, 95%, or 100% of the nucleotides have backbone modifications.
  • the S- and R- chiral immunostimulatory nucleic acids may be prepared by any method known in the art for producing chirally pure oligonucleotides.
  • Stec et al. teach methods for producing stereopure phosphorothioate oligodeoxynucleotides using an oxathiaphospholane.
  • the vector as used herein may be an empty vector or a vector carrying a gene which can be expressed.
  • the vector In the case when the vector is carrying a gene the vector generally transports the gene to the target cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector.
  • the vector optionally includes gene expression sequences to enhance expression of the gene in target cells such as immune cells, but it is not required that the gene be expressed in the cell.
  • vectors include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources.
  • Viral vectors are one type of vector and include, but are not limited to, nucleic acid sequences from the following viruses: retrovirus, such as Moloney murine leukemia virus, Harvey murine sarcoma virus, murine mammary tumor virus, and Rous sarcoma virus; adenovirus, adeno-associated virus; SN40-type viruses; polyoma viruses; Epstein-Barr viruses; papiUoma viruses; herpes virus; vaccinia virus; polio virus; and R ⁇ A virus such as a retrovirus.
  • retrovirus such as Moloney murine leukemia virus, Harvey murine sarcoma virus, murine mammary tumor virus, and Rous sarcoma virus
  • adenovirus adeno-associated virus
  • SN40-type viruses polyoma viruses
  • Epstein-Barr viruses papiUoma viruses
  • herpes virus vaccinia virus
  • polio virus polio virus
  • Some viral vectors are based on non-cytopathic eukaryotic viruses in which non-essential genes have been replaced with a nucleic acid to be delivered.
  • ⁇ on-cytopathic viruses include retroviruses, the life cycle of which involves reverse transcription of genomic viral R ⁇ A into D ⁇ A.
  • Plasmid vectors have been extensively described in the art and are well-known to those of skill in the art. See e.g., Sambrook et al., "Molecular Cloning: A Laboratory Manual," Second Edition, Cold Spring Harbor Laboratory Press, 1989. h the last few years, plasmid vectors have been found to be particularly advantageous for delivering genes to cells in vivo because of their inability to replicate within and integrate into a host genome. Some plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid.
  • Plasmids include pBR322, pUC18, pUC19, pcDNA3.1, pSV40, and pBlueScript. Other plasmids are well-known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA.
  • plasmids empty or gene-carrying
  • Modified forms of bacteria such as Salmonella can be transfected with the plasmid and used as delivery vehicles.
  • the bacterial delivery vehicles can be administered to a host subject orally or by other administration means.
  • the bacteria deliver the plasmid to immune cells, e.g., dendritic cells, probably by passing through the gut barrier. High levels of immune protection have been established using this methodology.
  • Such methods of delivery are useful for the aspects of the invention utilizing systemic delivery of nucleic acid.
  • an immunostimulatory nucleic acid is intended to embrace the administration of one or more immunostimulatory nucleic acids which may or may not differ in terms of their profile, sequence, backbone modifications and biological effect.
  • CpG nucleic acids and T-rich nucleic acids may be administered to a single subject along with an antibody and optionally a cancer therapy.
  • a plurality of CpG nucleic acids which differ in nucleotide sequence may also be administered to a subject.
  • the nucleic acids are delivered in effective amounts.
  • the term "effective amount" of a immunostimulatory nucleic acid refers to the amount necessary or sufficient to realize a desired biologic effect.
  • an effective amount of an immunostimulatory nucleic acid could be that amount necessary to cause activation of the immune system.
  • an effective amount is that amount of an immunostimulatory nucleic acid and that amount of an antibody, which when combined or co-administered, results in the prevention or the treatment of the cancer.
  • a synergistic effect is observed.
  • a synergistic amount is that amount which produces an anti-cancer response that is greater than the sum of the individual effects of either the immunostimulatory nucleic acid and the antibody alone.
  • a synergistic combination of an immunostimulatory nucleic acid and an antibody provides a biological effect which is greater than the combined biological effect which could have been achieved using each of the components (i.e., the nucleic acid and the antibody) separately.
  • the biological effect may be the amelioration and or absolute elimination of symptoms resulting from the cancer.
  • the biological effect is the complete abrogation of the cancer, as evidenced for example, by the absence of a tumor or a biopsy or blood smear which is free of cancer cells.
  • the effective amount of immunostimulatory nucleic acid necessary to treat a cancer or in the reduction of the risk of developing a cancer may vary depending upon the sequence of the immunostimulatory nucleic acid, the backbone constituents of the nucleic acid, and the mode of delivery of the nucleic acid.
  • the effective amount for any particular application can also vary depending on such factors as the cancer being treated, the particular immunostimulatory nucleic acid being administered (e.g., the nature, number or location of immunostimulatory motifs in the nucleic acid), the size of the subject, or the severity of the disease or condition.
  • One of ordinary skill in the art can empirically determine the effective amount of a particular immunostimulatory nucleic acid and antibody combination without necessitating undue experimentation.
  • an effective prophylactic or therapeutic treatment regimen can be planned which does not cause substantial toxicity and yet is entirely effective to treat the particular subject.
  • Therapeutic doses of cancer therapies are well known in the field of medicine for the treatment of cancer. These dosages have been extensively described in references such as Remington's Pharmaceutical Sciences, 18th ed., 1990; as well as many other medical references relied upon by the medical profession as guidance for the treatment of cancer. Therapeutic dosages of immunostimulatory nucleic acids have also been described in the art and methods for identifying therapeutic dosages in subjects are described in more detail herein. Subject doses of the compounds described herein typically range from about 0.1 ⁇ g to
  • mucosal or local doses range from about 10 ⁇ g to 5 mg per administration, and most typically from about 100 ⁇ g to 1 mg, with 2 - 4 administrations being spaced hours, days or weeks apart.
  • immune stimulant doses range from 1 ⁇ g to 10 mg per administration, and most typically 10 ⁇ g to 1 mg, with daily or weekly administrations.
  • Subject doses of the compounds described herein for parenteral delivery, wherein the compounds are delivered without another therapeutic agent are typically 5 to 10,000 times higher than the effective mucosal dose or for immune stimulant applications, and more typically 10 to 1,000 times higher, and most typically 20 to 100 times higher.
  • parenteral doses for these purposes range from about 10 ⁇ g to 5 mg per administration, and most typically from about 100 ⁇ g to 1 mg, with 2 - 4 administrations being spaced hours, days or weeks apart. In some embodiments, however, parenteral doses for these purposes may be used in a range of 5 to 10,000 times higher than the typical doses described above.
  • the therapeutically effective amount can be initially determined from animal models, e.g., the animal models described herein.
  • a therapeutically effective dose can also be determined from human data for CpG nucleic acids which have been tested in humans (human clinical trials have been initiated and the results publicly disseminated) and for compounds which are known to exhibit similar pharmacological activities.
  • Higher doses may be required for parenteral administration, as described above.
  • the applied dose can be adjusted based on the relative bioavailability and potency of the administered compound. Adjusting the dose to achieve maximal efficacy based on the methods described above and other methods as are well-known in the art is well within the capabilities of the ordinarily skilled artisan.
  • compositions of the invention are administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients.
  • an effective amount of the nucleic acid can be administered to a subject by any mode that delivers the nucleic acid to a subject.
  • administering the pharmaceutical composition of the present invention may be accomplished by any means known to the skilled artisan. Some routes of administration include but are not limited to oral, intranasal, intratracheal, inhalation, ocular, vaginal, rectal, parenteral (e.g., intramuscular, intradermal, intravenous or subcutaneous injection) and direct injection.
  • the compounds i.e., nucleic acids and antibodies
  • pharmaceutically acceptable carriers well known in the art.
  • pharmaceutically-acceptable carrier means one or more compatible solid or liquid filler, dilutants or encapsulating substances which are suitable for administration to a human or other vertebrate animal.
  • carrier denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.
  • the components of the pharmaceutical compositions also are capable of being commingled with the compounds of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficiency.
  • Such carriers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject to be treated.
  • Pharmaceutical preparations for oral use can be obtained as solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PNP).
  • disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
  • the oral formulations may also be fo ⁇ nulated in saline or buffers for neutralizing internal acid conditions.
  • Dragee cores may be provided with suitable coatings.
  • suitable coatings For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrohdone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
  • compositions which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
  • the push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers, h soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added.
  • suitable liquids such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
  • stabilizers may be added.
  • Microspheres formulated for oral administration may also be used. Such microspheres have been well defined in the art. All formulations for oral administration should be in dosages suitable for such administration.
  • the compositions may take the form of tablets or lozenges formulated in conventional manner.
  • the compounds for use according to the present invention may be conveniently delivered in the form of an aerosol spray, from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of e.g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactos
  • the compounds when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
  • the compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • compositions for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
  • the active compounds may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
  • a suitable vehicle e.g., sterile pyrogen-free water
  • the compounds may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
  • the compounds may also be formulated as a depot preparation.
  • Such long acting formulations may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
  • compositions also may comprise suitable solid or gel phase carriers or excipients.
  • suitable solid or gel phase carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.
  • Suitable liquid or solid pharmaceutical preparation forms are, for example, aqueous or saline solutions for inhalation, microencapsulated, encochleated, coated onto microscopic gold particles, contained in liposomes, nebulized, aerosols, pellets for implantation into the skin, or dried onto a sharp object to be scratched into the skin.
  • the pharmaceutical compositions may also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above.
  • the pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of present methods for drug delivery, see Langer R, Science 249:1527-33 (1990), which is incorporated herein by reference.
  • the nucleic acids and/or antibodies may be administered per se (neat) or in the form of a pharmaceutically acceptable salt.
  • the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof.
  • Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and benzene sulphonic.
  • salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group.
  • Suitable buffering agents include: acetic acid and a salt (1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v).
  • Suitable preservatives include benzalkonium chloride (0.003-0.03% w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and thimerosal (0.004-0.02% w/v).
  • the nucleic acids or other therapeutics useful in the invention may be delivered in mixtures with additional antibodies. A mixture may consist of several antibodies in addition to the nucleic acid.
  • a variety of administration routes are available. The particular mode selected will depend, of course, upon the particular nucleic acids or antibodies selected, the particular condition being treated and the dosage required for therapeutic efficacy.
  • the methods of this invention may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of an immune response without causing clinically unacceptable adverse effects. Preferred modes of administration are discussed above.
  • compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. All methods include the step of bringing the compounds into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the compounds into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.
  • Liquid dose units are vials or ampoules. Solid dose units are tablets, capsules and suppositories.
  • Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the compounds, increasing convenience to the subject and the physician.
  • Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer base systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Patent No. 5,075,109.
  • Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono-, di-, and tri-glycerides; hydrogel release systems; sylastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like.
  • lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono-, di-, and tri-glycerides
  • hydrogel release systems such as lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono-, di-, and tri-glycerides
  • sylastic systems such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono-, di-, and tri-glycerides
  • peptide based systems such as fatty acids
  • wax coatings such as those described in U.S. Patent Nos.
  • the nucleic acid may be directly administered to the subject or may be administered in conjunction with a pharmaceutically acceptable carrier or a delivery vehicle.
  • the nucleic acid and optionally other therapeutic agents may be administered alone (e.g., in saline or buffer) or using any delivery vehicles known in the art.
  • One type of delivery vehicle is referred to herein as a nucleic acid delivery complex.
  • a "nucleic acid delivery complex” shall mean a nucleic acid molecule associated with (e.g., ionically or covalently bound to; or encapsulated within) a targeting means (e.g., a molecule that results in higher affinity binding to target cell (e.g., dendritic cell surfaces and/or increased cellular uptake by target cells).
  • nucleic acid delivery complexes include nucleic acids associated with: a sterol (e.g., cholesterol), a lipid (e.g., a cationic lipid, virosome or liposome), or a target cell specific binding agent (e.g., a ligand recognized by target cell specific receptor).
  • a sterol e.g., cholesterol
  • a lipid e.g., a cationic lipid, virosome or liposome
  • a target cell specific binding agent e.g., a ligand recognized by target cell specific receptor
  • Preferred complexes may be sufficiently stable in vivo to reduce significant uncoupling prior to internalization by the target cell. However, the complex may be cleavable under appropriate conditions within the cell so that the nucleic acid may be released in a functional form.
  • the nucleic acids may be delivered by non-invasive methods as described above.
  • Non-invasive delivery of compounds is desirable for treatment of children, elderly, animals, and even adults and also to avoid the risk of needle-stick injury.
  • Delivery vehicles for delivering compounds to mucosal surfaces have been described and include but are not limited to: Cochleates (Gould-Fogerite et al., 1994, 1996); Emulsomes (Vancott et al., 1998, Lowell et al., 1997); ISCOMs (Mowat et al., 1993, Carlsson et al., 1991, Hu et al., 1998, Morein et al., 1999); Liposomes (Childers et al., 1999, Michalek et al., 1989, 1992, de Haan 1995a, 1995b); Live bacterial vectors (e.g., Salmonella, Escherichia coli, Bacillus Calmette- Guerin, Shigella, Lactobacillus) (Hone et al., 1996, Pouwels et al., 1998
  • kits generally include a package with a plurality of containers housing active agents and instructions for carrying out the methods of the invention.
  • the active agents include but are not limited to immunostimulatory nucleic acids, antibodies such as antibodies specific for a cell surface antigen, and anti-cancer therapies.
  • a variety of cellular receptors and antigens are involved in growth, differentiation and apoptosis of B-cell malignancies.
  • Antibodies or ligands against a variety of antigens can cause growth inhibition or even apoptosis including CD20, surface immunoglobulins, MHC II, CD80, CD86 and CD40.
  • mononuclear cells were obtained from peripheral blood or pleural fluid as described. Hartmann G et al., J Pharmacol Exp Ther 285:920-8 (1998). Red blood cells were removed by resuspending the cells in 5 ml ACK lysis buffer according to standard procedures. Cells were frozen slowly and stored in liquid nitrogen.
  • Oligonucleotides Nuclease-resistant phosphorothioate-modified oligodeoxynucleotide (ODN) were purchased from Operon Technologies (Alameda, CA) and Hybridon Specialty Products (Milford, MA). Sequences were as follows: CpG ODN 2006: 5'-TCGTCGTTTTGTCGTTTTGTCGTT-3' (SEQ ID NO: 729), and control ODN 2017: 5'-CCCCCCCCCCCCCCCCCC-3' (SEQ J-D NO: 168). ODN was diluted in TE (10 mM Tris-HCl, 1 mM EDTA, pH 8) using pyrogen-free reagents. ODN was added at a final concentration of 5 ⁇ g/ml.
  • Monoclonal antibodies to CD40 (5C3), CD69 (FN50), CD80 (L307.4), CD86 (IT2.2), CD54 (HA58), MHC I (G46-2.6) and MHC II (TU39) as well as isotype controls (IgGl, MOPC-21 and IgG2a, G155-178) were purchased from PharMingen, San Diego, CA.
  • FITC-labeled polyclonal anti-human Ig was purchased from Southern Biotech, Birmingham, AL. 1D10, a monoclonal humanized antibody directed against a variant of HLA-DR was produced in our laboratory as described earlier. Link BK et al., Blood 81 :3343-9 (1993).
  • C2B8 a monoclonal humanized anti-CD20 antibody, was purchased from J-DEC Pharmaceuticals, San Diego, CA. 1D10 and C2B8 were labeled with FITC according to standard protocols. The analysis gate was set on viable cells identified according to FSC/SSC characteristics and Annexin V staining (> 97 % viable cells within analysis gate). Spectral overlap was corrected by appropriate compensation. Flow cytometric data from 1 x 10 4 cells per sample were acquired on a FACScan (Beckton Dickinson hnmunocytometry Systems, San Jose, CA). Data were analyzed using the computer program FlowJo (version 2.5.1, Tree Star, Inc., Stanford, CA).
  • CFSE staining CFSE 5- (and 6-) carboxyfluorescein diacetate succinimidyl ester, Molecular Probes, USA, is a fluorescein-derived intracellular fluorescent label which is divided equally between daughter cells upon cell division. Staining of cells with CFSE allows both quantification and immunophenotyping of proliferating cells in a mixed cell suspension. Interference between oligonucleotide degradation products and thymidine uptake (standard proliferation assay) is avoided by using this method. The technique has described in detail previously. Lyons AB et al., J Immunol Methods 171:131-7 (1994).
  • TUNEL assay A two-color DNA strand break labeling assay, based on a modification of the assay described by Li et al. (Li X et al., ExpCell Res 222:28-37 (1996)) was used to assess B-cell proliferation in response to CpG ODN. This assay involved terminal transferase-mediated dUTP nick end labeling (TUNEL) before and after induction of DNA strand breaks in BrdU-labeled cells. Briefly, cells were cultured for 3 days with and without ODN. They were then incubated for 16 hours in lO ⁇ M BrdU and placed onto slides by cytospin.
  • TUNEL terminal transferase-mediated dUTP nick end labeling
  • TUNEL staining steps included incubating slides in 50 ⁇ l of TdT mix (34 ⁇ l distilled water, lO ⁇ l of 5X TdT buffer, 5 ⁇ l of 25mM cobalt chloride, 12.5 units terminal transferase and 0.5nmol fluorochrome-conjugated-dUTP) (Boeliringer-Marrnheim) under a coverslip for one hour at 37°C in a humidified chamber.
  • the slides were then washed in 5 quick changes of distilled water followed by 3 changes of 2XSSC containing 30% formamide for 5 minutes each at room temperature.
  • TUNEL labeling step cells were counterstained for CD 19, and also stained with Wright solution for blood cell differentiation and mounted in Vectashield media containing DAPI counterstain (Vector Laboratories, Burlingame, CA). The morphology and staining of cells were assessed using both visible light and fluorescence microscopy. Apoptotic cells were identified by green fluorescence (FITC label), and proliferating cells by red fluorescence (TMR label). The percentage of apoptotic and proliferating cells was determined by counting at least 200 cells per sample by three observers blinded to whether cells were treated with ODN. Mean and standard error were determined for each sample based on these three readings.
  • Example 1 Immunostimulatory nucleic acids induce morphological and phenotypic changes in malignant B cells.
  • FIG. 1 depicts the morphologic changes of marginal zone lymphoma cells upon
  • CpG ODN stimulation Malignant B cells from a patient with marginal zone lymphoma were stimulated with 5 ⁇ g/ml of no ODN (A and D), control ODN (B and E) or CpG ODN (C and F) for 72 hours and analyzed by flow cytometry.
  • A, B, and C illustrate FSC (x-axis) vs. SSC (y-axis).
  • D, E and F illustrate CD 19 expression (x-axis) against FSC (y-axis), allowing for separation of B cells from other leukocyte subpopulations.
  • CpG ODN B cells shifted up and to the right, indicating an increase in granularity and size.
  • Figure 2 depicts the expression of surface antigens on marginal zone lymphoma cells upon CpG ODN treatment.
  • Flow cytometric analysis of surface antigen expression on malignant B cells from a patient with marginal zone lymphoma was performed 72 hours after stimulation with 5 ⁇ g/ml of either CpG ODN or non-CpG ODN.
  • CpG ODN median fluorescence intensity for all markers tested shifted to the right, indicating an increase in surface expression.
  • Thin curves indicate incubation with medium alone, dotted curves incubation with control ODN, and bold curves incubation with CpG ODN.
  • Figure 3 depicts the expression of surface antigens on primary cells representing different B-cell malignancies and cells of a benign follicular hyperplasia upon CpG ODN treatment.
  • Cells from lymph node biopsies, peripheral blood or pleural fluid from patients with different B-cell malignancies were incubated for 72 hours with either media alone, control ODN or CpG ODN. Each panel represents one experiment.
  • CD20 was expressed to varying degrees in all samples tested. As is well known, baseline CD20 expression was lower in the B-CLL samples when compared to the B-cell malignancies of other histologies. CpG-ODN 2006 but not the control ODN 2017 increased CD20 expression in both B-CLLs and both marginal zone lymphomas. No or only little upregulation was seen in the other lymphoma samples. Non-malignant CD19+ cells derived from the reactive follicular hyperplasia decreased CD20 expression in response to CpG (Fig. 3).
  • Table 5 Percentage Of CD 19+ Cells In Samples Tested.
  • Example 2 Immunostimulatory nucleic acids induce proliferation and apoptosis of malignant B cells.
  • CpG induces a strong proliferative response of primary human B cells. Hartmann G et al., J Immunol 164:944-53 (2000). Two techniques were used to assess whether CpG ODN is capable of inducing proliferation of B-CLL cells. For select samples, cells were stained with CFSE and incubated for four days. Proliferation of cells is indicated by a loss of CFSE stain with every cell division.
  • CD5 can be used to identify malignant B cells among CD19+ cells.
  • Figure 5 shows a comparison of CpG ODN induced proliferation of malignant and normal B cells.
  • Peripheral blood mononuclear cells from two patients, one with B-CLL and one with marginal zone lymphoma with circulating malignant cells were incubated for 72 hours with CpG ODN or medium alone and evaluated by two-color flow cytometry.
  • CFSE fluorescence (x-axis) and expression of CD5 (CLL) or CD 19 (marginal zone lymphoma) (y- axis) were evaluated.
  • CLL CpG ODN enhanced proliferation of both CD5+ and the CD5- cells.
  • the relative number of proliferating cells and the number of divisions is lower in the CD5- subset than in the CD5+ subset.
  • marginal zone lymphoma CpG ODN enhanced proliferation in the CD 19+ cell subset.
  • Table 7 Apoptosis And Proliferation As Determined By TUNEL.
  • Example 3 CpG ODN enhance the therapeutic effect of murine IgG2a (which relates to human IgGl) but not murine IgGl (which relates to human IgG2) anti-tumor antibody.
  • CpG ODN when combined with antibody of murine subtype IgG2a dramatically promotes survival in mice having tumors. Mice were injected i.p. with 5000 T3C cells on day 0. They were then given 100 ⁇ g anti-idiotype monoclonal antibody as either IgGl (MS5A10) or IgG2a (MSI 1G6) on days 5, 7, and 10. In this model, the target antigen is the idiotype expressed by the lymphoma cells.
  • the anti-tumor antibodies are also "anti-idiotype.” These antibodies (MS5A10 and MSI 1G6) are simultaneously both anti- tumor antibodies and anti-idiotype antibodies. Twenty micrograms of CpG ODN 1826 (5' TCCATGACGTTCCTGACGTT 3'; SEQ ID NO: 560) was given at the same time. Results are shown in Figure 6. Untreated controls had a median survival time (MST) of 17 days after inoculation with tumor. Mice treated with murine IgGl antibody plus CpG ODN had survival that was similar to those treated with murine IgGl antibody alone (MST 28 days and 27 days, respectively). In contrast, mice treated with murine IgG2a plus CpG ODN had survival that was significantly improved when compared to mice treated with murine IgG2a alone (MST 45 days and 37 days, respectively).
  • MST median survival time

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Genetics & Genomics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biophysics (AREA)
  • Public Health (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Oncology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Hematology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to methods and products for treating cancer. In particular the invention relates to combinations of nucleic acids and antibodies for the treatment and prevention of cancer. The invention also relates to diagnostic methods for screening cancer cells.

Description

METHODS FOR ENHANCING ANTIBODY-INDUCED CELL LYSIS AND
TREATING CANCER
PRIORITY This application claims the benefit of U.S. Provisional Application No. 60/213,346, filed June 22, 2000.
FIELD OF THE INVENTION The invention relates to the treatment and prevention of cancer using immunostimulatory nucleic acids and antibodies.
BACKGROUND OF THE INVENTION Cancer is the second leading cause of death, resulting in one out of every four deaths in the United States. In 1997, the estimated total number of new diagnoses for lung, breast, prostate, colorectal and ovarian cancer was approximately two million. Due to the ever increasing aging population in the United States, it is reasonable to expect that rates of cancer incidence will continue to grow.
Cancer is a disease which involves the uncontrolled growth (i.e., division) of cells. Some of the known mechanisms which contribute to the uncontrolled proliferation of cancer cells include growth factor independence, failure to detect genomic mutation, and inappropriate cell signaling. The ability of cancer cells to ignore normal growth controls may result in an increased rate of proliferation. Although the causes of cancer have not been firmly established, there are some factors known to contribute, or at least predispose a subject, to cancer. Such factors include particular genetic mutations (e.g., BRCA gene mutation for breast cancer, APC for colon cancer), exposure to suspected cancer-causing agents, or carcinogens (e.g., asbestos, UN radiation) and familial disposition for particular cancers such as breast cancer.
Cancer is currently treated using a variety of modalities including surgery, radiation therapy and chemotherapy. The choice of treatment modality will depend upon the type, location and dissemination of the cancer. For example, surgery and radiation therapy may be more appropriate in the case of solid well-defined tumor masses and less practical in the case of non-solid tumor cancers such as leukemia and lymphoma. One of the advantages of surgery and radiation therapy is the ability to control to some extent the impact of the therapy, and thus to limit the toxicity to normal tissues in the body. However, surgery and radiation therapy are often followed by chemotherapy to guard against any remaining or radio-resistant cancer cells. Chemotherapy is also the most appropriate treatment for disseminated cancers such as leukemia and lymphoma as well as metastases.
More recently, the use of CpG containing nucleic acids has been proposed for the treatment and prevention of cancer. We have found that unmethylated CG-dinucleotides within certain sequence contexts (CpG DNA) are recognized by the vertebrate immune system as foreign DNA (bacterial or viral). CpG DNA activates a coordinated set of immune responses that include innate immunity (macrophages, dendritic cells, and natural killer cells), humoral immunity, and cellular immunity. Krieg AM et al., Pharmacol Ther 84:113- 20 (1999); Krieg AM et al., Curr Top Microbiol Immunol 247:1-21 (2000); Wagner H, Adv Immunol 73:329-68 (1999). As a vaccine adjuvant, CpG DNA is at least as effective as the gold standard complete Freund's adjuvant (CFA), but induces higher Thl activity and demonstrates less toxicity. Chu RS et al., JExp Med 186:1623-31 (1997); Weiner GJ et al, Proc Natl Acad Sci USA 94:10833-7 (1997); Roman M et al., Nat Med 3:849-54 (1997); Lipford GB et al., Eur J Immunol 27:2340-4 (1997); Davis HL et al., J Immunol 160:870-6 (1998). Recently, we identified a human CpG motif which triggers proliferation and activation of primary human B cells. Hartmann G et al., J Immunol 164:944-53 (2000).
SUMMARY OF THE INVENTION
The invention relates in some aspects to methods for treating and preventing cancer using immunostimulatory nucleic acids and antibodies. Thus in one aspect the invention is a method for treating or preventing cancer. The method involves administering to a subject having or at risk of developing cancer an effective amount to upregulate CD20 expression of a nucleic acid, and an anti-CD20 antibody. The cancer, in some embodiments, is B-cell lymphoma associated with low levels of CD20 expression. The B-cell lymphoma in other embodiments is B-cell chronic lymphocytic leukemia (B-CLL) or a marginal zone lymphoma. In some embodiments the CD20 antibody is C2B8 or Rituximab. The invention in other aspects relates to a method for diagnosing lymphoma by isolating a B cell from a subject and identifying a change in cell surface markers when the B cell is contacted with an immunostimulatory nucleic acid, wherein the cell surface marker induced on the B cell is indicative of the type of lymphoma. In some embodiments the subject has a type of lymphoma. In some embodiments the subject is suspected of having a type of lymphoma. The method may optionally include a method for treating cancer by administering to the subject an immunostimulatory nucleic acid and an antibody specific for the cell surface antigens induced on the B cell in order to treat the cancer.
In another aspect the invention is a method for treating or preventing cancer by administering to a subject having or at risk of developing cancer an effective amount to induce expression of a surface antigen on a cancer cell surface, of a nucleic acid, and administering to the subject an antibody selected from the group consisting of an anti-CD22 antibody and an anti-CD 19 antibody.
According to another aspect of the invention, a method for treating lymphoma is provided. The method includes the steps of isolating a B cell from a subject having lymphoma, identifying a surface antigen which is not expressed or which is expressed on the surface of the B cell in an amount lower than that of a control B cell, administering to the subject an antibody specific for the identified surface antigen and an immunostimulatory nucleic acid in order to treat the lymphoma, wherein the nucleic acid is administered in an effective amount to upregulate expression of the surface antigen on the lymphoma cell surface.
A method for treating a lymphoma resistant to antibody therapy is provided according to another aspect of the invention. The method includes administering to a subject having a lymphoma resistant to therapy with an antibody specific for a surface antigen, an antibody specific for the surface antigen to which the lymphoma is resistant and a nucleic acid in order to treat the lymphoma, wherein the nucleic acid is administered in an effective amount to upregulate expression of the surface antigen on the lymphoma cell surface. The surface antigen may be any type of surface antigen which is capable of being expressed on the surface of a cancer cell and which is induced by stimulation with immunostimulatory nucleic acids. In some embodiments the surface antigen is CD20, CD40, CD22, or CD19. In other embodiments the lymphoma is B-CLL or marginal zone lymphoma. In some embodiments the antibody is an anti-CD20 antibody, hi some embodiments the anti-CD20 antibody is C2B8. In another embodiment the anti-CD20 antibody is Rituximab. In some preferred embodiments the antibody is a human IgGl antibody. In some preferred embodiments the antibody is a murine IgG2a antibody. hi some embodiments the methods also include administering an anti-cancer therapy to the subject. The invention also includes a method for treating cancer in a human by administering to a human an immunostimulatory nucleic acid and an antibody of IgGl isotype (an IgGl isotype antibody as used herein refers to a human or humanized IgGl unless otherwise specified), which binds to a cell surface antigen of a cancer cell and wherein the nucleic acid and the antibody are administered in an effective amount for killing the cancer cell. Optionally the nucleic acid and the antibody are administered together. Alternatively the nucleic acid and the antibody may be administered separately. some embodiments the method includes the step of administering a cancer therapy. As used herein the term "a cancer therapy" is meant to embrace a single medicament, a plurality of medicaments of a particular class and a plurality of medicaments of different classes, and includes but is not limited to chemotherapeutic agents, cancer vaccines, biological response modifiers, and hormone therapies.
A chemotherapeutic agent maybe selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, non-sugar containing chloroethylnitrosoureas, 5- fluorouracil, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, fragyline, Meglamine GLA, valrubicin, carmustaine and poliferposan, MMI270, BAY 12-9566, RAS famesyl transferase inhibitor, famesyl transferase inhibitor, MMP, MTA/LY231514, LY264618/Lometexol, Glamolec, CI-994, TNP-470, Hycamtin/Topotecan, PKC412, Valspodar/PSC833, Novantrone/Mitroxantrone, Metaret/Suramin, Batimastat, E7070, BCH- 4556, CS-682, 9-AC, AG3340, AG3433, Incel/VX-710, VX-853, ZD0101, ISI641, ODN 698, TA 2516/Marmistat, BB2516/Marmistat, CDP 845, D2163, PD183805, DX8951f, Lemonal DP 2202, FK 317, Picibanil/OK-432, AD 32/Nalrubicin, Metastron/strontium derivative, Temodal/Temozolomide, Evacet/liposomal doxorubicin, Yewtaxan/Paclitaxel, Taxol/Paclitaxel, Xeload/Capecitabine, Furtulon/Doxifluridine, Cyclopax/oral paclitaxel, Oral Taxoid, SPU-077/Cisplatin, HMR 1275/Flavopiridol, CP-358 (774)/EGFR, CP-609 (754)/RAS oncogene inhibitor, BMS- 182751 /oral platinum, UFT(Tegafur/Uracil), Ergamisol/Levamisole, Eniluracil/776C85/5FU enhancer, Campto/Levamisole, C-imptosar/Irinotecan, Tumodex/Ralitrexed, Leustatin/Cladribine, Paxex/Paclitaxel, Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin, Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, ZD1839, LU 79553/Bis-Naphtalimide, LU 103793 Dolastain, Caetyx/liposomal doxorubicin, Gemzar/Gemcitabine, ZD 0473/Anormed, YM 116, Iodine seeds, CDK4 and CDK2 inhibitors, PARP inhibitors, D4809/Dexifosamide, Ifes/Mesnex/Ifosamide, Vumon/Teniposide, Paraplatin Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, ZD 9331, Taxotere/Docetaxel, prodrug of guanine arabinoside, Taxane Analog, nitrosoureas, alkylating agents such as Melphalan, Cyclophosphamide, Aminoglutethimide, Asparaginase, Busulfan, Carboplatin, Chlorombucil, Cytarabine HC1, Dactinomycin, Daunorubicin HC1, Estramustine phosphate sodium, Etoposide (VP 16-213), Floxuridine, Fluorouracil (5-FU), Flutamide, Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Interferon Alfa-2b, Leuprolide acetate (LHRH-releasing factor analogue), Lomustine (CCNU), Mechlorethamine HC1 (nitrogen mustard), Mercaptopurine, Mesna, Mitotane (o,p'-DDD), Mitoxantrone HC1, Octreotide, Plicamycin, Procarbazine HC1, Streptozocin, Tamoxifen citrate, Thioguanine, Thiotepa, Vinblastine sulfate, Amsacrine (m- AMSA), Azacitidine, Erythropoietin, Hexamethylmelamine (HMM), Interleukin 2,
Mitoguazone (methyl-GAG; methyl glyoxal bis-guanylhydrazone; MGBG), Pentostatin (2'deoxycoformycin), Semustine (methyl-CCNU), Teniposide (VM-26) and Vindesine sulfate.
In some preferred embodiments the chemotherapeutic agent may be selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, valrubicin, Novantrone/Mitroxantrone, Evacet/liposomal doxorubicin, Yewtaxan Paclitaxel, Taxol/Paclitaxel, SPU-077/Cisplatin, HMR 1275/Flavopiridol, BMS-182751/oral platinum, Leustatin/Cladribine, Paxex/Paclitaxel, Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin, Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, Caetyx/liposomal doxorubicin, Gemzar/Gemcitabine, Ifes Mesnex/Ifosamide, Vumon/Teniposide, Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, Taxotere/Docetaxel, prodrug of guanine arabinoside, nitrosoureas, alkylating agents such as melphalan and cyclophosphamide, Asparaginase, Busulfan, Carboplatin, Chlorombucil, Cytarabine HC1, Daunorubicin HC1, Etoposide (VP 16-213), Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, interferon Alfa-2b, Lomustine (CCNU), Mechlorethamine HC1 (nitrogen mustard), Mercaptopurine, Mitoxantrone HO, Procarbazine HC1, Thioguanine, Thiotepa, Vinblastine sulfate, Azacitidine, Interleukin 2, Pentostatin (2'deoxycoformycin), Teniposide (VM-26), GM-CSF, and Vindesine sulfate.
A cancer vaccine may be selected from the group consisting of EGF, Anti-idiotypic cancer vaccines, Gp75 antigen, GMK melanoma vaccine, MGV ganglioside conjugate vaccine, Her2/neu, Ovarex, M-Vax, O-Vax, L-Vax, STn-KHL theratope, BLP25 (MUC-1), liposomal idiotypic vaccine, Melacine, peptide antigen vaccines, toxin/antigen vaccines, MVA-based vaccine, PACIS, BCG vaccine, TA-HPV, TA-CLN, DISC-virus and hnmuCyst/TheraCys. Biological response modifiers include interferon, and lymphokines such as IL-2. Hormone replacement therapy includes tamoxifen alone or in combination with progesterone. In a further embodiment, the cancer therapy is interferon-α (e.g., INTRON® A, Schering).
The cancer may be selected from the group consisting of basal cell carcinoma, bladder cancer, bone cancer, brain and central nervous system (CNS) cancer, breast cancer, cervical cancer, colon and rectum cancer, connective tissue cancer, esophageal cancer, eye cancer, kidney cancer, larynx cancer, leukemia, liver cancer, lung cancer, Hodgkin's lymphoma, non- Hodgkin's lymphoma, melanoma, myeloma, oral cavity cancer (e.g., lip, tongue, mouth, and pharynx), ovarian cancer, pancreatic cancer, prostate cancer, rhabdomyosarcoma, skin cancer, stomach cancer, testicular cancer, and uterine cancer. In preferred embodiments, the cancer to be treated may be selected from the group consisting of bone cancer, brain and CNS cancer, connective tissue cancer, esophageal cancer, eye cancer, Hodgkin's lymphoma, larynx cancer, oral cavity cancer (e.g., lip, tongue, mouth, and pharynx), skin cancer, and testicular cancer.
In another aspect the invention encompasses a kit. The kit includes a package including at least two containers, the first container housing an immunostimulatory nucleic acid, the second container housing an antibody specific for a cell surface antigen, and instructions for screening a cell to determine whether the immunostimulatory nucleic acid upregulates expression of the cell surface antigen. In one embodiment the antibody is selected from the group consisting of an anti-CD20 antibody, an anti-CD 19 antibody, and an anti-CD22 antibody. The nucleic acids useful according to the invention are immunostimulatory nucleic acids and in some embodiments are immunostimulatory CpG nucleic acids having an unmethylated CpG motif, immunostimulatory T-rich nucleic acids, immunostimulatory poly-
G nucleic acids, bacterial DNA, yeast DNA, or eukaryotic DNA.
In some embodiments the nucleic acid does not hybridize with genomic DNA or RNA under stringent conditions. In other embodiments the nucleic acid does hybridize with genomic DNA or RNA under stringent conditions.
The nucleic acid may have natural linkages or may include at least one modified backbone internucleotide linkage. In some embodiments the modified backbone is a phosphate backbone modification. In other embodiments the modified backbone is a peptide modified oligonucleotide backbone. The nucleic acid may also include native bases or modified bases. The nucleotide backbone may be chimeric, or the nucleotide backbone is entirely modified.
The immunostimulatory nucleic acid can have any length greater than 6 nucleotides, but in some embodiments is between 8 and 100 nucleotide residues in length. In other embodiments the nucleic acid comprises at least 20 nucleotides, at least 24 nucleotides, at least 27, nucleotides, or at least 30 nucleotides. The nucleic acid may be single-stranded or double-stranded. In some embodiments the nucleic acid is isolated and in other embodiments the nucleic acid may be a synthetic nucleic acid.
The CpG nucleic acid in one embodiment contains at least one unmethylated CpG dinucleotide having a sequence including at least the following formula: 5' XιX CGX X 3' wherein C is unmethylated, wherein Xi, X2, X , and X4 are nucleotides. In one embodiment the 5' XιX CGX3X 3' sequence of the CpG nucleic acid is a non-palindromic sequence, and in other embodiments it is a palindromic sequence.
In some embodiments X1X2 are nucleotides selected from the group consisting of:
GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA, TpT, and TpG; and X3X4 are nucleotides selected from the group consisting of: TpT, CpT, ApT, TpG, ApG, CpG, TpC,
ApC, CpC, TpA, ApA, and CpA. In other embodiments XιX2 are GpA or GpT and X3X4 are
TpT. In yet other embodiments Xi or X2 or both are purines and X3 or X or both are pyrimidines or XιX2 are GpA and X3 or X-j or both are pyrimidines. In one embodiment X2 is a T and X3 is a pyrimidine. In other embodiments the CpG nucleic acid has a sequence selected from the group consisting of SEQ ID NOs: 19, 35-37, 39-42, 91, 92, 101, 108, 111, 135, 141, 151, 274, 277,
280, 286, 319, 350, 363, 368, 375, 495-498, 517, 518, 524, 529, 545, 548, 549, 555, 557, 560-563, 566, 585, 590, 591, 595, 599, 603, 605, 611, 614-616, 650, 676, 679, 682, 684, 702, 703, 707-710, 717-720, 729-732, 752, 755, 770, and 801-803.
In some embodiments the T-rich immunostimulatory nucleic acid is a poly-T nucleic acid comprising 5' TTTT 3'. In yet other embodiments the poly-T nucleic acid comprises 5' XιX2TTTTX3X 3' wherein Xi, X2, X3, and X are nucleotides. In some embodiments XιX2 is TT and/or X3X4 is TT. In other embodiments XιX2 is selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC; and or X3X4 is selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC. The T-rich immunostimulatory nucleic acid may have only a single poly-T motif or it may have a plurality of poly-T nucleic acid motifs. In some embodiments the T-rich immunostimulatory nucleic acid comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 T motifs. In other embodiments it comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 CpG motifs. In some embodiments the plurality of CpG motifs and poly-T motifs are interspersed.
In yet other embodiments at least one of the plurality of poly-T motifs comprises at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9 contiguous T nucleotide residues. In other embodiments the plurality of poly-T motifs is at least 3 motifs and wherein at least 3 motifs each comprises at least 3 contiguous T nucleotide residues or the plurality of poly-T motifs is at least 4 motifs and wherein the at least 4 motifs each comprises at least 3 contiguous T nucleotide residues.
The T-rich immunostimulatory nucleic acid may include one or more CpG motifs, h other embodiments the T-rich immunostimulatory nucleic acid is free of one or more CpG dinucleotides. In other embodiments the T-rich immunostimulatory nucleic acid has poly A, poly-G, and/or poly C motifs. In other embodiments the T-rich immunostimulatory nucleic acid is free of two poly C sequences of at least 3 contiguous C nucleotide residues. Preferably the T- rich immunostimulatory nucleic acid is free of two poly A sequences of at least 3 contiguous A nucleotide residues. In other embodiments the T-rich immunostimulatory nucleic acid comprises a nucleotide composition of greater than 25% C or greater than 25% A. In yet other embodiments the T-rich immunostimulatory nucleic acid is free of poly-C sequences, poly-G sequences or poly-A sequences. In some cases the T-rich immunostimulatory nucleic acid may be free of poly-T motifs, but rather, comprises a nucleotide composition of greater than 25% T. In other embodiments the T-rich immunostimulatory nucleic acid may have poly-T motifs and also comprise a nucleotide composition of greater than 25% T. In some embodiments the T-rich immunostimulatory nucleic acid comprises a nucleotide composition of greater than 25 % T, greater than 30% T, greater than 40% T, greater than 50% T, greater than 60% T, greater than 80% T, or greater than 90% T nucleotide residues.
In some embodiments the poly-G nucleic acid comprises: 5' XιX2GGGX3 3' wherein Xj, X2, X3, and X are nucleotides. In embodiments at least one of X and are a G or both of X and are a G. In other embodiments the poly-G nucleic acid comprises the following formula: 5' GGGNGGG 3' wherein N represents between 0 and 20 nucleotides. In yet other embodiments the poly-G nucleic acid comprises the following formula: 5' GGGNGGGNGGG 3' wherein N represents between 0 and 20 nucleotides.
The poly-G immunostimulatory nucleic acid may include one or more CpG motifs or T-rich motifs. In other embodiments the poly-G nucleic acid is free of one or more CpG dinucleotides or poly-T motifs.
Each of the limitations of the invention can encompass various embodiments of the invention. It is, therefore, anticipated that each of the limitations of the invention involving any one element or combinations of elements can be included in each aspect of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 depicts data from flow cytometry which demonstrates the induction of a morphologic change in marginal zone lymphoma cells upon CpG oligonucleotide stimulation. Malignant B cells from a patient with marginal zone lymphoma were stimulated with no oligonucleotide (A and D), control oligonucleotide (ODN 2017, SEQ ID NO: 168, B and E) or CpG oligonucleotide (ODN 2006, SEQ J_D NO: 729, C and F) and analyzed by flow cytometry. A, B, and C illustrate forward scatter (FSC; x-axis) vs. side scatter (SSC; y-axis). D, E and F illustrate CD 19 expression (x-axis) against FSC (y-axis).
Figure 2 depicts data from flow cytometry which demonstrates the change in expression of surface antigens on marginal zone lymphoma cells upon CpG oligodoexynucleotide (ODN) treatment. Flow cytometric analysis of surface antigen expression on malignant B cells from a patient with marginal zone lymphoma was performed using either CpG or non-CpG oligonucleotide. Thin curves indicate incubation with medium alone, dotted curves indicate incubation with control oligonucleotide, and bold curves indicate incubation with CpG oligonucleotide.
Figure 3 is a set of bar graphs depicting changes in expression of surface antigens on primary cells representing different B-cell malignancies and cells of a benign follicular hyperplasia upon treatment with, from left to right in each panel: negative control, no oligonucleotide, control oligonucleotide (ODN 2017, SEQ JD NO: 168), or CpG oligonucleotide (ODN 2006, SEQ ID NO: 729). Each panel represents one experiment. Figure 4 is a set of graphs depicting the observation that the effect of CpG oligonucleotide on CD20 (top) and CD40 (bottom) is dependent on the baseline level of expression of CD20 and CD40. Cells from lymph node biopsies, peripheral blood or pleural fluid from patients with different B-cell malignancies were incubated with or without CpG oligonucleotide, and expression of CD20 and CD40 was measured by flow cytometry. Figure 5 depicts data from flow cytometry which demonstrates the effect of CpG oligonucleotide-induced proliferation of malignant and normal B cells. Peripheral blood mononuclear cells from patients with B-CLL (left) or marginal zone lymphoma with circulating malignant cells (right), were incubated with CpG oligonucleotide (bottom) or medium alone (top) and evaluated by two-color flow cytometry. CFSE fluorescence (x-axis) and expression of CD5 (B-CLL) or CD 19 (marginal zone lymphoma) (y-axis) were evaluated.
Figure 6 is a graph depicting the survival of mice injected on Day 0 with tumor cells in response to CpG simulation in combmation with murine IgG2a and murine IgGl anti- tumor antibodies. Treatments are shown as filled squares, untreated controls; filled circles, murine IgGl ; filled triangles, murine IgGl plus CpG; filled diamonds, murine IgG2a; and open squares, murine IgG2a plus CpG.
DETAILED DESCRIPTION Present cancer treatments are often ineffective as well as being associated with a high degree of patient morbidity. The invention provides methods and products for the more effective treatment of cancer using a combination of immunostimulatory nucleic acids, antibodies, and optionally cancer therapies. The invention is based, in part, on the surprising discovery that administration to a subject of immunostimulatory nucleic acids induces the expression of cell surface antigens including CD20, CD19, and CD22 on the surface of a cancer cell and that the induction of these antigens leads to enhanced antibody-dependent cellular cytotoxicity (ADCC). It was previously believed that CpG oligonucleotides enhanced ADCC by influencing the effector cell (e.g., by activating natural killer (NK) cells). Now it has been discovered according to the invention that immunostimulatory nucleic acids actually cause the induction of specific antigens CD20, CD 19, and CD22, each of which can be targeted by specific antibody therapies. The discovery that immunostimulatory nucleic acids are capable of upregulating expression of certain target antigens on the surface of cancer cells, supports the development of therapies using immunostimulatory nucleic acids in combination with specific antibodies which interact with these cell surface antigens. Thus, in one aspect, the invention provides a method for treating or preventing cancer which involves the administration to a subject of a combination of an immunostimulatory nucleic acid and an antibody which specifically interacts with CD20, CD 19, and CD22 in an effective amount to prevent or treat the cancer. Additionally, it was discovered that the increased expression of these and other cell surface antigens varies widely depending upon the histological state of the tumor cell studied. The effect of immunostimulatory nucleic acids on different types of primary malignant B cells and reactive follicular hyperplasia was extensively examined. All B-cell lymphoma cells tested increased in size and granularity, upregulated activation markers (CD80, CD86, CD40, CD54, CD69), and upregulated antigen presentation molecules (class I major histocompatibility complex (MHC I), class II major histocompatibilty complex (MHC II)) in response to immunostimulatory nucleic acids. A control poly-C oligodeoxynucleotide (ODN) showed only minor effects. The extent of phenotypic change induced by immunostimulatory nucleic acids differed from sample to sample. Immunostimulatory nucleic acids, but not control nucleic acids, increased the expression of co-stimulatory molecules (e.g., CD40, CD80, CD86, CD54) on malignant B cells without altering the phenotype of B cells derived from reactive follicular hyperplasia. Immunostimulatory nucleic acids also enhanced expression of both class I and class II MHC in most samples. CD20 expression was increased in response to immunostimulatory nucleic acids, most notably in B-CLL and marginal zone lymphoma. Furthermore, an inverse correlation was found between baseline expression of specific cell surface antigens and their expression after exposure to immunostimulatory nucleic acids. Thus the most significant increase in expression of these molecules was found in those samples that had the lowest (or no) baseline levels. These data indicate that immunostimulatory nucleic acids may reverse low expression of co-stimulatory molecules on malignant B cells that correspond to a low level of activation, while their effects on cells that are already in an activated state are less profound.
Thus, the invention relates to methods for identifying an appropriate therapy for a lymphoma patient, and for treating the patient using that therapy. The method can be accomplished by isolating a B cell from a lymphoma patient and comparing the surface antigens expressed on the malignant B cell with those expressed on normal B cells. The antigens which are expressed in low levels or not at all on the malignant B cell can be identified. The subject can then be treated using a combination of an immunostimulating nucleic acid and an antibody which specifically recognizes the antigen(s) which are expressed in low levels or not at all on the malignant B cell.
The invention is also useful for treating cancers which are resistant to monoclonal antibody therapy. It has been discovered according to the invention, that immunostimulatory nucleic acids can reverse the resistance of tumor cells and render tumor cells which were previously non-responsive or only weakly responsive, sensitive to therapy. In particular it has been discovered that immunostimulatory nucleic acids can cause a phenotypic change to a resistant tumor cell that renders it sensitive to monoclonal antibody therapy. For instance, the monoclonal anti-CD20 antibody Rituximab has been shown to be effective clinically in several trials and has recently been approved for the therapy of follicular B cell lymphoma. Maloney DG, Semin Oncol 26:74-8 (1999); Foran JM et al, JClin Oncol 18:317-24 (2000); Witzig TE et al., J Clin Oncol 17:3793-803 (1999); Davis TA et aL, JCIin Oncol 17:1851-7 (1999); Wiseman GA et al., Clin Cancer Res 5:3281s-3286s (1999); Grillo-Lopez AJ et al, Semin Oncol 26:66-73 (1999). There are reports that with lymphomas a small minority of tumors that re-emerge following Rituximab therapy can lack CD20 expression. Davis TA et al., Clin Cancer Res 5:611-5 (1999); Kinoshita T et al., J Clin Oncol 16:3916 (1998). The immunostimulatory nucleic acids of the invention are useful for treating this set of resistant tumors. Additionally, Rituximab has not been useful for the treatment of all types of B cell malignancies. Expression of CD20 is relatively low on B-CLL cells, which provides an explanation for why Rituximab is less effective for CLL than for some other B-cell malignancies. Grinaldi L et a\., JClin Pathol 51:364-9 (1998). The immunostimulatory nucleic acids of the invention are also useful for treating these tumors.
The humanized monoclonal antibody 1D10 recognizes an HLA-DR variant antigen. Link BK et al., Blood 81 :3343-9 (1993). This antibody is currently being tested in a phase I clinical trial in patients with lymphoma. One limitation to the use of this antibody is that the target antigen is only expressed by approximately 50% of B-cell lymphomas. Interestingly, its expression was upregulated by immunostimulatory nucleic acids in all lymphoma samples tested. It was discovered according to the invention that immunostimulatory nucleic acids may enhance the efficacy of therapy with these and other antibodies by increasing expression of target antigen. Thus in another aspect the invention includes methods for treating lymphoma by administering to a subject an immunostimulatory nucleic acid and antibodies specific for HLA-DR. One useful antibody is the humanized monoclonal antibody ID 10. It is particularly useful for treating resistant tumors. The invention also relates to the discovery of a specific subclass, or isotype, of antibody which when combined with immunostimulatory nucleic acids produces a synergistic immune response. Another subclass, or isotype, does not even provide an additive response when combined with immunostimulatory nucleic acids. It was discovered according to the invention that the combination of immunostimulatory nucleic acids and human antibodies of the IgGl isotype results in an increased (synergistic) survival rate. When immunostimulatory nucleic acids are combined with human antibodies of the IgG2 isotype, no increase in survival rate is observed over the use of the IgG2 antibody alone. The IgG2 isotype (which correlates with the murine IgGl isotype) is believed to be recognized by the Fc receptor designated CD 16 that is expressed largely by NK cells. Immunostimulatory nucleic acids are known to activate NK cells, and thus, it is suφrising that immunostimulatory nucleic acids do not enhance the therapeutic effect of human IgG2 or murine IgGl antibodies. Since NK cells are believed to be involved in ADCC and are activated by immunostimulatory nucleic acids, it was surprising that antibodies of the human IgG2 (or murine IgGl) isotype do not produce a synergistic or even additive response when administered with immunostimulatory nucleic acids.
A cancer cell is a cell that divides and reproduces abnormally due to a loss of normal growth control. Cancer cells almost always arise from at least one genetic mutation. In some instances, it is possible to distinguish cancer cells from their normal counteφarts based on profiles of expressed genes and proteins, as well as to the level of their expression. Genes commonly affected in cancer cells include oncogenes, such as ras, neu/HER2/erbB, myb, myc and abl, as well as tumor suppressor genes such as p53, Rb, DCC, RET and WT. Cancer-related mutations in some of these genes leads to a decrease in their expression or a complete deletion. In others, mutations cause an increase in expression or the expression of an activated variant of the normal counterpart.
The term "tumor" is usually equated with neoplasm, which literally means "new growth" and is used interchangeably with "cancer." A "neoplastic disorder" is any disorder associated with cell proliferation, specifically with a neoplasm. A "neoplasm" is an abnormal mass of tissue that persists and proliferates after withdrawal of the carcinogenic factor that initiated its appearance. There are two types of neoplasms, benign and malignant. Nearly all benign tumors are encapsulated and are noninvasive; in contrast, malignant tumors are almost never encapsulated but invade adjacent tissue by infiltrative destructive growth. This infiltrative growth can be followed by tumor cells implanting at sites discontinuous with the original tumor. The method of the invention can be used to treat neoplastic disorders in humans, including but not limited to: sarcoma, carcinoma, fibroma, glioma, leukemia, lymphoma, melanoma, myeloma, neuroblastoma, retinoblastoma, and rhabdomyosarcoma, as well as each of the other tumors described herein. "Cancer" as used herein refers to an uncontrolled growth of cells which interferes with the normal functioning of the bodily organs and systems. Cancers which migrate from their original location and seed vital organs can eventually lead to the death of the subject through the functional deterioration of the affected organs. Hemopoietic cancers, such as leukemia, are able to out-compete the normal hemopoietic compartments in a subject, thereby leading to hemopoietic failure (in the form of anemia, thrombocytopenia and neutropenia), ultimately causing death.
A metastasis is a region of cancer cells, distinct from the primary tumor location, resulting from the dissemination of cancer cells from the primary tumor to other parts of the body. At the time of diagnosis of the primary tumor mass, the subject may be monitored for the presence of metastases. Metastases are most often detected through the sole or combined use of magnetic resonance imaging (MRI) scans, computed tomography (CT) scans, blood and platelet counts, liver function studies, chest X-rays and bone scans in addition to the monitoring of specific symptoms.
Cancers include, but are not limited to, basal cell carcinoma, biliary tract cancer; bladder cancer; bone cancer; brain and CNS cancer; breast cancer; cervical cancer; choriocarcinoma; colon and rectum cancer; connective tissue cancer; cancer of the digestive system; endometrial cancer; esophageal cancer; eye cancer; cancer of the head and neck; gastric cancer; infra-epithelial neoplasm; kidney cancer; larynx cancer; leukemia; liver cancer; lung cancer (e.g., small cell and non-small cell); lymphoma including Hodgkin's and non-Hodgkin's lymphoma; melanoma; myeloma; neuroblastoma; oral cavity cancer (e.g., lip, tongue, mouth, and pharynx); ovarian cancer; pancreatic cancer; prostate cancer; retinoblastoma; rhabdomyosarcoma; rectal cancer; renal cancer; cancer of the respiratory system; sarcoma; skin cancer; stomach cancer; testicular cancer; thyroid cancer; uterine cancer; cancer of the urinary system, as well as other carcinomas and sarcomas.
The immunostimulatory nucleic acids and antibodies are useful for treating or preventing cancer in a subject. A "subject" unless otherwise specified shall mean a human or vertebrate mammal including but not limited to a dog, cat, horse, cow, pig, sheep, goat, or primate, e.g., monkey. Thus the invention can be used to treat cancer and tumors in human and non human subjects. Cancer is one of the leading causes of death in companion animals (i.e., cats and dogs). Cancer usually strikes older animals which, in the case of house pets, have become integrated into the family. Forty-five percent of dogs older than 10 years of age are likely to succumb to the disease. The most common treatment options include surgery, chemotherapy and radiation therapy. Other treatment modalities which have been used with some success are laser therapy, cryotherapy, hyperthermia and immunotherapy. The choice of treatment depends on the type of cancer and degree of dissemination. Unless the malignant growth is confined to a discrete area in the body, it is difficult to remove only malignant tissue without also affecting normal cells.
Malignant disorders commonly diagnosed in dogs and cats include but are not limited to lymphosarcoma, osteosarcoma, mammary tumors, mastocytoma, brain tumor, melanoma, adenosquamous carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchiolar adenocarcinoma, fibroma, myxochondroma, pulmonary sarcoma, neurosarcoma, osteoma, papilloma, retinoblastoma, Ewing's sarcoma, Wilnis' tumor, Burkitt's lymphoma, microglioma, neuroblastoma, osteoclastoma, oral neoplasia, fibrosarcoma, osteosarcoma and rhabdomyosarcoma. Other neoplasias in dogs include genital squamous cell carcinoma, transmissable venereal tumor, testicular tumor, seminoma, Sertoli cell tumor, hemangiopericytoma, histiocytoma, chloroma (granulocytic sarcoma), corneal papilloma, corneal squamous cell carcinoma, hemangiosarcoma, pleural mesothelioma, basal cell tumor, thymoma, stomach tumor, adrenal gland carcinoma, oral papillomatosis, hemangioendothelioma and cystadenoma. Additional malignancies diagnosed in cats include follicular lymphoma, intestinal lymphosarcoma, fibrosarcoma and pulmonary squamous cell carcinoma. The ferret, an ever-more popular house pet, is known to develop insulinoma, lymphoma, sarcoma, neuroma, pancreatic islet cell tumor, gastric MALT lymphoma and gastric adenocarcinoma.
Neoplasias affecting agricultural livestock include leukemia, hemangiopericytoma and bovine ocular neoplasia (in cattle); preputial fibrosarcoma, ulcerative squamous cell carcinoma, preputial carcinoma, connective tissue neoplasia and mastocytoma (in horses); hepatocellular carcinoma (in swine); lymphoma and pulmonary adenomatosis (in sheep); pulmonary sarcoma, lymphoma, Rous sarcoma, reticuloendotheliosis, fibrosarcoma, nephroblastoma, B-cell lymphoma and lymphoid leukosis (in avian species); retinoblastoma, hepatic neoplasia, lymphosarcoma (lymphoblastic lymphoma), plasmacytoid leukemia and swimbladder sarcoma (in fish), caseous lymphadenitis (CLA): chronic, infectious, contagious disease of sheep and goats caused by the bacterium Corynebacterium pseudotuberculosis, and contagious lung tumor of sheep caused by jaagsiekte.
In one aspect, a method for treating cancer is provided which involves administering the compositions of the invention to a subject having cancer. A "subject having cancer" is a subject that has been diagnosed with a cancer. In some embodiments, the subject has a cancer type characterized by a solid mass tumor. The solid tumor mass, if present, may be a primary tumor mass. A primary tumor mass refers to a growth of cancer cells in a tissue resulting from the transformation of a normal cell of that tissue. In most cases, the primary tumor mass is identified by the presence of a cyst, which can be found through visual inspection or palpation methods, or by irregularity in shape, texture or weight of the tissue. However, some primary tumors are not palpable and can be detected only through medical imaging techniques such as X-rays (e.g., mammography), or by needle aspirations. The use of these latter techniques is more common in early detection. Molecular and phenotypic analysis of cancer cells within a tissue will usually confirm if the cancer is endogenous to the tissue or if the lesion is due to metastasis from another site.
With respect to the prophylactic treatment methods, the invention is aimed at administering the compositions of the invention to a subject at risk of developing cancer. A subject at risk of developing a cancer is one who has a high probability of developing cancer. These subjects include, for instance, subjects having a genetic abnormality, the presence of which has been demonstrated to have a correlative relation to a higher likelihood of developing a cancer. Subjects exposed to cancer-causing agents such as tobacco, asbestos, or other chemical toxins are also subjects at risk of developing cancers used herein. When a subject at risk of developing a cancer is treated with an immunostimulatory nucleic acid, an antibody and optionally a cancer therapy, on a regular basis, such as monthly, the cancer growth will be prevented from initiating. This aspect of the invention is particularly advantageous when the subjects employed in certain trades which are exposed to cancer- causing agents on an ongoing basis. For example, many airborne, or inhaled, carcinogens such as tobacco smoke and asbestos have been associated with lung cancer.
A carcinogen is an agent capable of initiating development of malignant cancers. Exposure to carcinogens generally increases the risk of neoplasms in subjects, usually by affecting DNA directly. Carcinogens may take one of several forms such as chemical, electromagnetic radiation, or may be an inert solid body. Substances for which there is sufficient evidence to establish a causal relationship in cancer in humans are referred to as confirmed human carcinogens. Included in this category are the following substances: Aflatoxins, Alcoholic beverages, Aluminium production, 4- aminobiphenyl, Arsenic and arsenic compounds, Asbestos, Manufacture of auramine, Azathioprine, Benzene, Benzidine, Beryllium and beryllium compounds, Betel quid with tobacco, Bis(chloromethyl)ether and chloromethyl methyl ether (technical grade), Boot and shoe manufacture and repair (occupational exposure), 1,4 Butanediol dimethanesulphonate (Myleran), Cadmium and cadmium compounds, Chlorambucil, Chlornaphazine, l-(2- Chloroethyl)-3-(4-methylcyclohexyl)-l nitrosourea, Chloromethyl methyl ether (technical), Chromium compounds (hexavalent), Coal gasification, Coal tar pitches, Coal tars, Coke production, Cyclophosphamide, Cyclosporin, Erionite, Ethylene oxide, Furniture and cabinet making, Underground haematite mining with exposure to radon, Iron and steel founding, Isopropyl alcohol manufacture (strong acid process), Manufacture of magenta, Melphalan, 8- Methoxypsoralen (Methoxsalen) plus ultraviolet radiation, Mineral oils-untreated and mildly- treated oils, MOPP and other combined chemotherapy for cancer, Mustard gas (sulphur mustard), 2-Naphthylamine, Nickel and nickel compounds (essentially sulphate and sulphide), Nonsteroidal estrogens (not necessarily all in group) includes diethylstilbestrol, Estrogen replacement therapy, and Combined oral contraceptives and sequential oral contraceptives, Steroidal estrogens (not all in group), Painter (occupational exposure as a painter), Phenacetin (analgesic mixtures containing), Rubber industry, Salted fish (Chinese style), Solar radiation, Shale oils, Soots, Sulphuric acid (occupational exposures to strong- inorganic-acid mists of sulphuric acid), Talc containing asbestiform fibres, Thiotepa, Tobacco products (smokeless), Tobacco smoke, Treosulphan, and Vinyl chloride.
Substances for which there is a lesser degree of evidence in humans but sufficient evidence in animal studies, or degrees of evidence considered unequivocal of mutagenicity in mammalian cells, are referred to as probable human carcinogens. This category of substances includes: Acrylamide, Acrylonitrile, Adriamycin, Anabolic steroids, Azacitidine, Benzanthracene, Benzidine-based dyes (technical grade), Direct Black 38, Direct Blue 6, Direct Brown 95, Benzopyrenel,3-Butadiene, Captafol, Bischloroethyl nitrosourea (BCNU), 1 -(2-Chloroethyl)-3-cyclohexyl-l -nitrosourea (CCNU), Chloramphenicolpara-Chloro-ortho- toluidine and its strong acid salts, Chlorozotocin, Cisplatin, Creosotes, Dibenzanthracene, Diesel engine exhaust, Diethyl sulphate, Dimethylcarbamoyl chloride, Dimethyl sulphate, Epichlorohydrin, Ethylene dibromide, N-ethyl-N-nitrosourea, Formaldehyde, Glass manufacturing industry (occupational exposure), Art glass (glass containers and pressed ware), Hairdresser or barber (occupational exposure, probably dyes), Insecticide use (occupational), IQ (2-Amino-3-methylimidazo[4,5-fJquinoline), Mate drinking (hot), 5- Methoxypsoralen, 4,4'-Methylenebis(2-chloroaniline) (MOCA), N-Methyl-N-nitro-N- nitrosoguanidine (MNNG), N-Methyl-N-nitrosourea, Nitrogen mustard, N-
Nitrosodiethylamine, N-Nitrosodimethylamine, Petroleum refining (occupational refining exposures), Phenacetin, Polychlorinated biphenyls, Procarbazine hydrochloride, Silica (crystalline), Styrene-7,8-oxide, Tris(l-azaridinyl)phosphine sulphide (Thiotepa), Tris(2,3- dibromopropyl) phosphate, Ultraviolet radiation: A, B and C including sunlamps and sunbeds, and Vinyl bromide.
Substances for which there is sufficient evidence in animal tests are referred to as possible human carcinogens. This category of substances includes: A-C(2-Amino-9H- pyrido[2,3-b]indole), Acetaldehyde, Acetamide, AF-2[2-(2-Furyl)-3-(5-nitro-2- furyl)acrylamide, para-Aminoazobenzene, ortho-Aminoazobenzene, 2-Amino-5-(5-nitro-2- furyl)-l,3,4-thiadiazole, Amitrole, ortho-Anisidine, Antimony trioxide, Aramite, Atrazine, Attapulgite, Azaserine, Benzo[b]fluoranthene, Benzo[j]fluoranthene, Benzo[k]fluoranthene, Benzyl violet, Bitumens (extracts of steam-refined and air-refined bitumens), Bleomycins, Bracken ferns, Bromodichloromethane, Butylated hydroxyanisole (BHA), a-Butyrolactone, Caffeic acid, Carbon black extract, Carbon tetrachloride, Carrageenan (degraded), Ceramic fibres, Chloramphenicol, Chlordane, Chlordecone, Chlorendic acid, Chlorinated paraffins of average carbon-chain length C12 and average degree of chlorination approx 60%, alpha- Chlorinated toluenes (not necessarily all in group), Benzotrichloride, para-Chloroaniline, Chloroform, Chlorophenols, Pentachlorophenol, 2,4,6-Trichlorophenol, Chlorophenoxy herbicides (not necessarily all in group), 4-Chloro-ortho-phenylenediamine, Cl Acid Red 114, Cl Basic Red 9, Cl Direct Blue 15, Citrus Red No .2, Cobalt and cobalt compounds, Coffee (bladder), para-Cresidine, Cycasin, Dacarbazine, Dantron (1,8- dihydroxyanthraquinone), Daunomycin, DDT, N,N'-Diacetylbenzidine, 4,4'-
Diaminodiphenyl ether, 2,4-Diaminotoluene, Dibenz[a,h]acridine, Dibenz[a,j]acridine, 7H- Dibenzo[c,g]carbazole, Dibenzo[a,e]pyrene, Dibenzo[a,h]pyrene, Dibenzo[a,i]pyrene, Dibenzo[a,l]pyrene, l,2-Dibromo-3-chloropropane, para-Dichlorobenzene, 3,3'- Dichlorobenzene, 3,3'-Dichloro-4,4'-diaminodiphenyl ether, 1,2-Dichloroethane, Dichloromethane, 1,3-Dichloropropene (technical grade), Dichlorvos, Diepoxybutane, Diesel fuel (marine), Di(2-ethylhexyl)phthalate, 1,2-Diethylhydrazine, Diglycidyl resorcinol ether, Dihydrosafrole, Diisopropyl sulfate, 3,3'-Dimethoxybenzidine, para- Dimethylaminoazobenzene, trans-2-[(Dimethylamino)methylimino]-5-[2-(5-nitro-2- furyl[vinyl]-l,3,4-oxidiazole, 2,6-Dimethylaniline (2,6-Xylidene), 3,3'-Dimethylbenzidine (ortho-tolidine), Dimethylformamide, 1,1-Dimethylhydrazine, 1,2-Dimethylhydrazine, 1,6- Dinitropyrene, 1,8-Dinitropyrene, 1,4-Dioxane, Disperse Blue, 1 Ethyl acrylate, Ethylene thiourea, Ethyl methanesulphonate, 2-(2-Formylhydrazino)-4-(5-nitro-2-furyl)thiazole, Fuel oils (residual, heavy), Fusarium moniliforme (toxins derived from), Fumonisin Bl; Fumonisin B2; Fusarin C, Gasoline, Gasoline engine exhausts, Glasswool, Glu-P-1 (2- Amino-6-methyldipyrido[l,2-a:3'2'-d]imidazole), Glu-P-2(-Aminodipyrido[l,2-a:3'2'- d]imidazole), Glycidaldehyde, Griseofulvin, HC Blue No 1, Heptachlor, Hexachlorobenzene, Hexachlorocyclohexanes Technical grades alpha isomer gamma isomer (lindane), Hexamethylphosphoramide, Hydrazine, Indeno[l,2,3-cd]pyrene, Iron-dextran complex, Isoprene, Lasiocaφine, Lead and lead compounds (inorganic), Magenta (containing Cl Basic Red 9), Man-made mineral fibres (see glasswool, rockwool, slagwool, and ceramic fibres), MeA-a-C (2-Amino-3-methyl-9H-pyrido[2,3-b]indoϊe), MelQ (2-Amino-3,4- dimethylimidazo[4,5-f]-quinolone), MelQx (2-Amino-3,8-dimethylamidazo[4,5- fjquinoxaline), Methylmercury compounds (methylmercuric chloride), Melphalan, 2- Methylaziridine, Methylazoxymethanol and its acetate, 5-Methylchrysene, 4,4'- Methylenebis(2-methylaniline), 4,4'-Methylenedianiline, Methylmethanesulphonate, 2- methyl-1-nitroanthraquinone (uncertain purity), N-methyl-N-nitrosourethane, Methylthiouracil, Metronidazole, Mirex, Mitomycin, Monocrotaline 5-(Morpholinomethyl)- 3-[(5-nifrofurfurylidene)amino]-2-oxazolidinone, Nafenopin, Niridazole, 5- Nitroacenaphthene, 6-Nitrochrysene, Nitrofen (technical grade), 2-Nitrofluorenel-[(5- Nitrofurfurylidene)amino]-2-imidazolidinone, N-[4-(5-Nitro-2-furyl)-2-thiazolyl]acetamide, Nitrogen mustard, N-oxide, Nitrolotriacetic acid and its salts, 2-Nitropropanel-Nitropyrene, 4-Nitropyrene, N-Nitrosodi-n-butylamine, N-Nitrosodiethanolamine, N-Nitrosodi-n- propylamine, 3-(N-Nitrosomethylamino)propionitrile, 4-(N-Nitrosomethylamino)-l-(3- pyridyl)-l-butanone (NNK), N-Nitrosomethylethylamine, N-Nitrosomethylvinylamine, N- Nitrosomoφholine, N-Nitrosonornicotine, N-Nitrosopiperidene, N-Nitrosopyrrolidine, N- Nitrososarcosine, Ochratoxin A, Oil Orange, Panfuran S (containing dihydroxymethylfuratzine), Phenazopyridine hydrochloride, Phenobarbital,
Phenoxybenzamine hydrochloride, Phenyl glycidyl ether, PhenytoinPhJJP (2 -Amino- 1- methyl-6-phenylimidazo[4,5-b]pyridine, Pickled vegetables, traditional Asian, Polybrominated biphenyls, Ponceau MXPonceau 3R, Potassium bromate, 1,3 -Propane sultone, Propylene oxide, Progestins, Medroxyprogesterone acetate, a-Propiolactone, Propylthiouracil, Rockwool, Saccharin, Safrole, Slagwool, Sodium ortho-phenylphenate,
Sterigmatocystin, Streptozotocin, Styrene, Sulfallate, 2,3,7,8-Tetrachlorodibenzo-para-dioxin (TCDD), Tetrachloroethylene, Textile manufacturing (occupational exposures), Thiocetamide, 4,4'-Thiodianiline, Thiourea, Toluene, diisocyanatesortho-Toluidine, Toxaphene (polychlorinated camphenes), Trichlormethine (trimustine hydrochloride), Tφ-P- 1 (3-Amino-l,4-dimethyl-5-H-ρyrido[4,3-b]indole), Tφ-P-2 (3-Amino-l-methyl-5H- pyrido[4,3-b]indole), Trypan blue, Uracil mustard, Urethane, 4-Vinylcyclohexene, 4- Vinylcyclohexene diepoxide, Welding fumes, Wood industries and Caφentry and joinery. Subjects at risk of developing cancer also include those who have a genetic predisposition to cancer. In many cases, genetic predisposition to cancer can be identified by studying the occurrence of cancer in family members. Examples of genetic predisposition to common forms of cancer include, but are not limited to, mutation of BRCA1 and BRCA2 in familial breast cancer, mutation of APC in familial colony cancer (familial polyposis coli), mutation of MSH2 and MLH1 in hereditary nonpolyposis colon cancer (HNPCC), mutation of p53 in Li-Fraumeni syndrome, mutation of Rbl in retinoblastoma, mutation of RET in multiple endocrine neoplasia type 2 (MEN2), mutation of VHL in renal cancer and mutation of WT1 in Wilms' tumor. Other cancers for which a familial predisposition has been identified include ovarian, prostate, melanoma and lung cancer.
It has been estimated that almost half of all currently diagnosed cancers will be treated with some form of cancer medicament. However, many forms of cancer, including melanoma, colorectal, prostate, endometrial, cervical and bladder cancer, do not respond well to treatment with cancer medicaments. In fact, only about 5-10 percent of cancers can be cured using cancer medicaments alone. These include some forms of leukemias and lymphomas, testicular cancer, choriocarcinoma, Wilms' tumor, Ewing's sarcoma, neuroblastoma, small-cell lung cancer and ovarian cancer. Treatment of still other cancers, including breast cancer, requires a combination therapy of surgery or radiotherapy in conjunction with a cancer medicament. The immunostimulatory nucleic acids are administered in combination with antibodies which specifically bind to cancer cell surface antigens. These antibodies include but are not limited to anti-CD20 antibodies, anti-CD40 antibodies, anti-CD 19 antibodies, anti-CD22 antibodies, anti-HLA-DR antibodies, anti-CD80 antibodies, anti-CD86 antibodies, anti-CD54 antibodies, and anti-CD69 antibodies. These antibodies are available from commercial sources or may be synthesized de novo.
Commercially available anti-CD20 antibodies include but are not limited to those presented in Table 1 below.
Table 1. Commercially Available Anti-CD20 Antibodies.
Antibodies are well known to those of ordinary skill in the science of immunology. As used herein, the term "antibody" means not only intact antibody molecules but also fragments of antibody molecules retaining specific binding ability. Such fragments are also well known in the art and are regularly employed both in vitro and in vivo. In particular, as used herein, the term "antibody" means not only intact immunoglobulin molecules but also the well-known active fragments F(ab') , and Fab. F(ab')2, and Fab fragments which lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody. Wahl RL et al., JNucl Med 24:316-25 (1983). Antibody fragments which are particularly useful according to the methods of the invention are those which are bispecific and constructed to enhance FcR binding, e.g., include an Fc portion. These include, but are not limited to Medarex antibodies (MDX-210, 220, 22, 447, and 260). Other non-Fc containing fragments which interact with the antigens induced on the cell surface are also useful. These are particularly useful in combination with immunotoxins and/or radioactivity. The fragments can be delivered separately from the immunotoxins or radioactivity or conjugated thereto (e.g., radiolabled antibodies or antibody fragments).
Within the antigen-binding portion of an antibody, as is well-known in the art, there are complementarity-determining regions (CDRs), which directly interact with the epitope of the antigen, and framework regions (FRs), which maintain the tertiary structure of the paratope (see, in general, Clark, 1986; Roitt, 1991). hi both the heavy chain Fd fragment and the light chain of IgG immunoglobulins, there are four framework regions (FRl through FR4) separated respectively by three complementarity-determining regions (CDR1 through CDR3). The CDRs, and in particular the CDR3 regions, and more particularly the heavy chain CDR3, are largely responsible for antibody specificity. It is now well-established in the art that the non-CDR regions of a mammalian antibody may be replaced with similar regions of conspecific or heterospecific antibodies while retaining the epitopic specificity of the original antibody. This is most clearly manifested in the development and use of "humanized" antibodies in which non-human CDRs are covalently joined to human FR and/or Fc/pFc' regions to produce a functional antibody. Thus, for example, PCT International Publication Number WO 92/04381 teaches the production and use of humanized murine RSV antibodies in which at least a portion of the murine FR regions have been replaced by FR regions of human origin. Such antibodies, including fragments of intact antibodies with antigen-binding ability, are often referred to as "chimeric" antibodies. A "humanized monoclonal antibody" as used herein is a human monoclonal antibody or functionally active fragment thereof having human constant regions and a binding CDR3 region from a mammal of a species other than a human. Humanized monoclonal antibodies may be made by any method known in the art. Humanized monoclonal antibodies, for example, may be constructed by replacing the non-CDR regions of a non-human mammalian antibody with similar regions of human antibodies while retaining the epitopic specificity of the original antibody. For example, non-human CDRs and optionally some of the framework regions may be covalently joined to human FR and/or Fc/pFc' regions to produce a functional antibody. There are entities in the United States which will synthesize humanized antibodies from specific murine antibody regions commercially, such as Protein Design Labs (Mountain View California).
European Patent Application 0239400, the entire contents of which is hereby incoφorated by reference, provides an exemplary teaching of the production and use of humanized monoclonal antibodies in which at least the CDR portion of a murine (or other non-human mammal) antibody is included in the humanized antibody. Briefly, the following methods are useful for constructing a humanized CDR monoclonal antibody including at least a portion of a mouse CDR. A first replicable expression vector including a suitable promoter operably linked to a DNA sequence encoding at least a variable domain of an Ig heavy or light chain and the variable domain comprising framework regions from a human antibody and a CDR region of a murine antibody is prepared. Optionally a second replicable expression vector is prepared which includes a suitable promoter operably linked to a DNA sequence encoding at least the variable domain of a complementary human Ig light or heavy chain respectively. A cell line is then transformed with the vectors. Preferably the cell line is an immortalized mammalian cell line of lymphoid origin, such as a myeloma, hybridoma, trioma, or quadroma cell line, or is a normal lymphoid cell which has been immortalized by transformation with a virus. The transformed cell line is then cultured under conditions known to those of skill in the art to produce the humanized antibody. As set forth in European Patent Application 0239400 several techniques are well known in the art for creating the particular antibody domains to be inserted into the replicable vector. (Preferred vectors and recombinant techniques are discussed in greater detail below.) For example, the DNA sequence encoding the domain may be prepared by oligonucleotide synthesis. Alternatively a synthetic gene lacking the CDR regions in which four framework regions are fused together with suitable restriction sites at the junctions, such that double- stranded synthetic or restricted subcloned CDR cassettes with sticky ends could be ligated at the junctions of the framework regions. Another method involves the preparation of the DNA sequence encoding the variable CDR containing domain by oligonucleotide site- directed mutagenesis. Each of these methods is well known in the art. Therefore, those skilled in the art may construct humanized antibodies containing a murine CDR region without destroying the specificity of the antibody for its epitope.
Human monoclonal antibodies may be made by any of the methods known in the art, such as those disclosed in U.S. Patent No. 5,567,610, issued to Borrebaeck et al., U.S. Patent No. 5,565,354, issued to Ostberg, U.S. Patent No. 5,571,893, issued to Baker et al, Kozbor D et al., J Immunol 133:3001-5 (1984), Brodeur et al., Monoclonal Antibody Production
Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc, New York, 1987), and Boerner P et al., J Immunol 147:86-95 (1991). In addition to the conventional methods for preparing human monoclonal antibodies, such antibodies may also be prepared by immunizing transgenic animals that are capable of producing human antibodies (e.g., Jakobovits A et al., Proc Natl Acad Sci USA 90:2551-5 (1993); Jakobovits A et al., Nαtwre 362:255-8 (1993); Bruggermann et al., Year in Immunology 7:33 (1993); and U.S. Patent No. 5,569,825 issued to Lonberg).
Significantly, as is well-known in the art, only a small portion of an antibody molecule, the paratope, is involved in the binding of the antibody to its epitope (see, in general, Clark, W.R. (1986) The Experimental Foundations of Modern Immunology Wiley & Sons, Inc., New York; Roitt, I. (1991) Essential Immunology. 7th Ed., Blackwell Scientific Publications, Oxford). The pFc' and Fc regions, for example, are effectors of the complement cascade but are not involved in antigen binding. An antibody from which the pFc' region has been enzymatically cleaved, or which has been produced without the pFc' region, designated an F(ab')2 fragment, retains both of the antigen binding sites of an intact antibody. Similarly, an antibody from which the Fc region has been enzymatically cleaved, or which has been produced without the Fc region, designated an Fab fragment, retains one of the antigen binding sites of an intact antibody molecule. Proceeding further, Fab fragments consist of a covalently bound antibody light chain and a portion of the antibody heavy chain denoted Fd. The Fd fragments are the major determinant of antibody specificity (a single Fd fragment may be associated with up to ten different light chains without altering antibody specificity) and Fd fragments retain epitope-binding ability in isolation.
Other antibodies useful according to the invention are antibodies of the IgGl isotype. As mentioned above, anti-IgGl isotype antibody as used herein refers to a human or humanized anti-IgGl unless otherwise specified. IgGl isotype antibodies are well known in the art and include at least the antibodies listed in Table 2 below.
Table 2: Cancer Immunotherapies In Development Or On The Market.
In some embodiments the nucleic acid and antibody are administered in combination with a cancer therapy. As used herein, a "cancer therapy" refers to an agent which prevents growth of a cancer cell by decreasing or slowing the rate of growth, by inhibiting growth altogether, or by killing or inducing apoptosis of the cancer cell. Thus, as used herein,
"treating cancer" includes preventing the development of a cancer, reducing the symptoms of cancer, and/or inhibiting the growth of an established cancer. In other aspects, the cancer therapy is administered to a subject at risk of developing a cancer for the puφose of reducing the risk of developing the cancer. Various types of medicaments for the treatment of cancer are described herein. For the puφose of this specification, cancer therapies are classified as chemotherapeutic agents, cancer vaccines, hormone therapy, biological response modifiers, surgical procedures, and radiotherapy aimed at treating cancer. Additionally, the methods of the invention are intended to embrace the use of more than one cancer therapy along with the immunostimulatory nucleic acids and antibody. As an example, where appropriate, the immunostimulatory nucleic acids may be administered with a both a chemotherapeutic agent and a radiotherapy.
Cancer therapies function in a variety of ways. Some cancer therapies work by targeting physiological mechanisms that are specific to tumor cells. Examples include the targeting of specific genes and their gene products (i.e., proteins primarily) which are mutated in cancers. Such genes include but are not limited to oncogenes (e.g., Ras, Her2, bcl-2), tumor suppressor genes (e.g., EGF, p53, Rb), and cell cycle targets (e.g., CDK4, p21, telomerase). Cancer therapies can alternately target signal transduction pathways and molecular mechanisms which are altered in cancer cells.
Other cancer therapies target cells other than cancer cells. For example, some medicaments prime the immune system to attack tumor cells (i.e., cancer vaccines). Still other medicaments, called angiogenesis inhibitors, function by attacking the blood supply of solid tumors. Since the most malignant cancers are able to metastasize (i.e., exit the primary tumor site and seed a distal tissue, thereby forming a secondary tumor), medicaments that impede this metastasis are also useful in the treatment of cancer. Angiogenic mediators include basic FGF, VEGF, angiopoietins, angiostatin, endostatin, TNF-α, TNP-470, thrombospondin-1, platelet factor 4, CAI, and certain members of the integrin family of proteins. One category of this type of medicament is a metalloproteinase inhibitor, which inhibits the enzymes used by the cancer cells to exit the primary tumor site and extravasate into another tissue.
As used herein, chemotherapeutic agents encompass both chemical and biological agents. These agents function to inhibit a cellular activity which the cancer cell is dependent upon for continued survival. Categories of chemotherapeutic agents include alkylating/alkaloid agents, antimetabolites, hormones or hormone analogs, and miscellaneous antineoplastic drugs. Most ifnot all of these agents are directly toxic to cancer cells and do not require immune stimulation. Chemotherapeutic agents which are currently in development or in use in a clinical setting are shown in Table 3 below.
Table 3: Cancer Drugs In Development Or On The Market.
Another useful anti-cancer therapy is Interferon-α (e.g., INTRON® A, Schering).
The compounds useful according to the invention are nucleic acids. The nucleic acids may be double-stranded or single-stranded. Generally, double-stranded molecules may be more stable in vivo, while single-stranded molecules may have increased activity. The terms "nucleic acid" and "oligonucleotide" refer to multiple nucleotides (i.e., molecules comprising a sugar (e.g., ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g., cytosine (C), thymine (T) or uracil (U)) or a substituted purine (e.g., adenine (A) or guanine (G)) or a modified base. As used herein, the terms refer to ohgoribonucleotides as well as oligodeoxyribonucleotides. The terms shall also include polynucleosides (i.e., a polynucleotide minus the phosphate) and any other organic base-containing polymer. The terms "nucleic acid" and "oligonucleotide" also encompass nucleic acids or oligonucleotides with a covalently modified base and/or sugar. For example, they include nucleic acids having backbone sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3' position and other than a phosphate group at the 5' position. Thus modified nucleic acids may include a 2'-O-alkylated ribose group. In addition, modified nucleic acids may include sugars such as arabinose instead of ribose. Thus the nucleic acids may be heterogeneous in backbone composition thereby containing any possible combination of polymer units linked together such as peptide-nucleic acids (which have amino acid backbone with nucleic acid bases). In some embodiments the nucleic acids are homogeneous in backbone composition. Nucleic acids also can include base analogs such as C-5 propyne modified bases.
Wagner RW et al., Nature Biotechnol 14:840-4 (1996). Purines and pyrimidines include but are not limited to adenine, cytosine, guanine, thymine, 5-methylcytosine, 2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine, hypoxanthine, and other naturally and non-naturally occurring nucleobases, substituted and unsubstituted aromatic moieties. The nucleic acid is a linked polymer of bases or nucleotides. As used herein with respect to linked units of a nucleic acid, "linked" or "linkage" means two entities are bound to one another by any physicochemical means. Any linkage known to those of ordinary skill in the art, covalent or non-covalent, is embraced. Such linkages are well known to those of ordinary skill in the art. Natural linkages, which are those ordinarily found in nature connecting the individual units of a nucleic acid , are most common. The individual units of a nucleic acid may be linked, however, by synthetic or modified linkages.
Whenever a nucleic acid is represented by a sequence of letters it will be understood that the nucleotides are in 5' → 3' order from left to right and that "A" denotes adenosine, "C" denotes cytosine, "G" denotes guanosine, "T" denotes thymidine, and "U" denotes uracil unless otherwise noted.
Nucleic acid molecules useful according to the invention can be obtained from natural nucleic acid sources (e.g., genomic nuclear or mitochondrial DNA or cDNA), or are synthetic (e.g., produced by oligonucleotide synthesis). Nucleic acids isolated from existing nucleic acid sources are referred to herein as native, natural, or isolated nucleic acids. The nucleic acids useful according to the invention may be isolated from any source, including eukaryotic sources, prokaryotic sources, nuclear DNA, mitochondrial DNA, etc. Thus, the term nucleic acid encompasses both synthetic and isolated nucleic acids. The term "isolated" as used herein refers to a nucleic acid which is substantially free of other nucleic acids, proteins, lipids, carbohydrates or other materials with which it is naturally associated. The nucleic acids can be produced on a large scale in plasmids, (see Sambrook T et al., "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory Press, New York, 1989) and separated into smaller pieces or administered whole. After being administered to a subject the plasmid can be degraded into oligonucleotides. One skilled in the art can purify viral, bacterial, eukaryotic, etc., nucleic acids using standard techniques, such as those employing restriction enzymes, exonucleases or endonucleases.
For use in the instant invention, the nucleic acids can be synthesized de novo using any of a number of procedures well known in the art. For example, the b-cyanoethyl phosphoramidite method (Beaucage SL et al., Tetrahedron Lett 22:1859, 1981); nucleoside H-phosphonate method (Garegg et al., Tetrahedron Lett 27:4051-4, 1986; Froehler et al., Nucl Acid Res 14:5399-407, 1986; Garegg et al., Tetrahedron Lett 27:4055-8, 1986; Gaffhey et al., Tetrahedron Lett 29:2619-22, 1988). These chemistries can be performed by a variety of automated oligonucleotide synthesizers available in the market.
In some embodiments, the nucleic acids useful according to the invention are immunostimulatory nucleic acids. An immunostimulatory nucleic acid is any nucleic acid, as described above, which is capable of modulating an immune response. A nucleic acid which modulates an immune response is one which produces any form of immune stimulation, including, but not limited to, induction of cytokines, B-cell activation, T-cell activation, monocyte activation. Immunostimulatory nucleic acids include, but are not limited to, CpG nucleic acids, methylated CpG nucleic acids, T-rich nucleic acids, poly-G nucleic acids, and nucleic acids having phosphate modified backbones, such as phosphorothioate backbones.
A "CpG nucleic acid" or a "CpG immunostimulatory nucleic acid" as used herein is a nucleic acid containing at least one unmethylated CpG dinucleotide (cytosine-guanine dinucleotide sequence, i.e., "CpG DNA" or DNA containing a 5' cytosine followed by 3' guanosine and linked by a phosphate bond) and activates a component of the immune system. The entire CpG nucleic acid can be unmethylated or portions may be unmethylated but at least the C of the 5' CG 3' must be unmethylated. In one embodiment the invention provides a CpG nucleic acid represented by at least the formula:
5' NιXιCGX2N2 3' wherein Xi and X2 are nucleotides and N is any nucleotide and Ni and N2 are nucleic acid sequences composed of from about 0-25 N's each. In some embodiments Xi is adenine, guanine, or thymine and X2 is cytosine, adenine, or thymine. In other embodiments Xi is cytosine and/or X2 is guanine.
In other embodiments the CpG nucleic acid is represented by at least the formula: 5' NιXιX2CGX3X4N2 3' wherein Xi, X2, X3, and X4 are nucleotides. In some embodiments, XιX2 are nucleotides selected from the group consisting of: GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA, TpT, and TpG; and X - are nucleotides selected from the group consisting of: TpT, CpT, ApT, TpG, ApG, CpG, TpC, ApC, CpC, TpA, ApA, and CpA; N is any nucleotide and Ni and N2 are nucleic acid sequences composed of from about 0-25 N's each. In some embodiments, XιX2 are GpA or GpT and X3X4 are TpT. In other embodiments Xi or X2 or both are purines and X or X-j or both are pyrimidines or XιX are GpA and X3 or X or both are pyrimidines. In some embodiments Ni and N2 of the nucleic acid do not contain a CCGG or CGCG quadmer or more than one CCG or CGG trimer. The effect of a CCGG or CGCG quadmer or more than one CCG or CGG trimer depends in part on the status of the nucleic acid backbone. For instance, if the nucleic acid has a phosphodiester backbone or a chimeric backbone the inclusion of these sequences in the nucleic acid will only have minimal if any affect on the biological activity of the nucleic acid. If the backbone is completely phosphorothioate or significantly phosphorothioate then the inclusion of these sequences may have more influence on the biological activity or the kinetics of the biological activity, but compounds containing these sequences are still useful. In another embodiment the CpG nucleic acid has the sequence 5' TCNιTXιX2CGX X4 3'. A "T-rich nucleic acid" or "T-rich immunostimulatory nucleic acid" is a nucleic acid which includes at least one poly-T sequence and/or which has a nucleotide composition of greater than 25% T nucleotide residues and which activates a component of the immune system. A nucleic acid having a poly-T sequence includes at least four Ts in a row, such as 5' TTTT 3'. Preferably the T-rich nucleic acid includes more than one poly-T sequence, hi preferred embodiments the T-rich nucleic acid may have 2, 3, 4, etc., poly-T sequences, such as oligonucleotide #2006 (5' TCGTCGTTTTGTCGTTTTGTCGTT 3', SEQ ID NO: 729). One of the most highly immunostimulatory T-rich oligonucleotides discovered according to the invention is a nucleic acid composed entirely of T nucleotide residues, e.g., oligonucleotide #2183 (5* ττττττττττττττττττττττττ 3^ SEQ j ) N0: 841). Other T-rich nucleic acids have a nucleotide composition of greater than 25% T nucleotide residues, but do not necessarily include a poly-T sequence. In these T-rich nucleic acids the T nucleotide resides may be separated from one another by other types of nucleotide residues, i.e., G, C, and A. In some embodiments the T-rich nucleic acids have a nucleotide composition of greater than 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 99%, T nucleotide residues and every integer % in between. Preferably the T-rich nucleic acids have at least one poly-T sequence and a nucleotide composition of greater than 25% T nucleotide residues. In one embodiment the T-rich nucleic acid is represented by at least the formula:
5' XjX2TTTTX3X4 3' wherein Xi, X2, X , and are nucleotides. In one embodiment XιX is TT and or X3X4 is TT. h another embodiment XιX2 are any one of the following nucleotides TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC; and X3X4 are any one of the following nucleotides TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC.
In some embodiments it is preferred that the T-rich nucleic acid does not contain poly-C (CCCC), poly-A (AAAA), poly-G (GGGG), CpG motifs, or multiple GGs. In other embodiments the T-rich nucleic acid includes these motifs. Thus in some embodiments of the invention the T-rich nucleic acids include CpG dmucleotides and in other embodiments the T-rich nucleic acids are free of CpG dmucleotides. The CpG dmucleotides maybe methylated or unmethylated.
Poly-G containing nucleic acids are also immunostimulatory. A variety of references, including Pisetsky DS et al., Mol Biol Rep 18:217-21 (1993); Krieger M et al., Annu Rev Biochem 63:601-37 (1994); Macaya RF et al., Proc Natl Acad Sci USA 90:3745-9 (1993); Wyatt JR et al., Proc Natl Acad Sci USA 91:1356-60 (1994); Rando and Hogan, 1998, In: Applied Antisense Oligonucleotide Technology, eds. Krieg AM and Stein C, pp. 335-352; and Kimura Y et al., J Biochem (Tokyo) 116:991-4 (1994) also describe the immunostimulatory properties of poly-G nucleic acids. Poly G nucleic acids preferably are nucleic acids having the following formulas:
5' X1X2GGGX3X4 3' wherein X\, X2, X , and X4 are nucleotides. In preferred embodiments at least one of X3 and 4 are a G. In other embodiments both of X3 and X4 are a G. In yet other embodiments the preferred formula is 5' GGGNGGG 3', or 5' GGGNGGGNGGG 3' wherein N represents between 0 and 20 nucleotides. In other embodiments the poly-G nucleic acid is free of unmethylated CG dmucleotides, such as, for example, the nucleic acids listed in Table 4 below as SEQ ID NOs: 12-14, 23, 56, 100, 155, 163, 182, 227, 237, 246, 400, 407, 429, 430, 432, 435, 438, 439, 446, 450, 451, 480, 487, 493, 522, 661, 662, 671-673, 807, 808, 821, 823, and 834. hi other embodiments the poly-G nucleic acid includes at least one unmethylated CG dinucleotide, such as, for example, the nucleic acids listed in Table 4 below as SEQ ID NOs: 6, 7, 22, 26, 28-30, 87, 115, 141, 177, 191, 209, 254, 258, 267, 303, 317, 329, 335, 344, 345, 395, 414, 417, 418, 423-426, 428, 431, 433, 434, 436, 437, 440, 442-445, 447-449, 458, 460, 463, 467-469, 474, 515, 516, 594, 638-640, 663, 664, 727, 752, 776, 795, 799, 817, 818, 831, and 832.
Nucleic acids having modified backbones, such as phosphorothioate backbones, also fall within the class of immunostimulatory nucleic acids. U.S. Patents Nos. 5,723,335 and 5,663,153 issued to Hutcherson, et al. and related PCT publication WO95/26204 describe immune stimulation using phosphorothioate oligonucleotide analogues. These patents describe the ability of the phosphorothioate backbone to stimulate an immune response in a non-sequence specific manner.
The immunostimulatory nucleic acids may be any size but in some embodiments are in the range of between 6 and 100 or in some embodiments between 8 and 35 nucleotides in size, hnmunostimulatory nucleic acids can be produced on a large scale in plasmids. These may be administered in plasmid form or alternatively they can be degraded into oligonucleotides.
"Palindromic sequence" shall mean an inverted repeat (i.e., a sequence such as ABCDEE'D'C'B'A' in which A and A' are bases capable of forming the usual Watson-Crick base pairs and which includes at least 6 nucleotides in the palindrome. In vivo, such sequences may form double-stranded structures. In one embodiment the nucleic acid contains a palindromic sequence. In some embodiments when the nucleic acid is a CpG nucleic acid, a palindromic sequence used in this context refers to a palindrome in which the CpG is part of the palindrome, and optionally is the center of the palindrome. In another embodiment the nucleic acid is free of a palindrome. A nucleic acid that is free of a palindrome does not have any regions of 6 nucleotides or greater in length which are palindromic. A nucleic acid that is free of a palindrome can include a region of less than 6 nucleotides which are palindromic. A "stabilized nucleic acid molecule" shall mean a nucleic acid molecule that is relatively resistant to in vivo degradation (e.g., via an exonuclease or endonuclease). Stabilization can be a function of length or secondary structure. Nucleic acids that are tens to hundreds of kbs long are relatively resistant to in vivo degradation. For shorter nucleic acids, secondary structure can stabilize and increase their effect. For example, if the 3' end of an oligonucleotide has self-complementarity to an upstream region, so that it can fold back and form a sort of stem loop structure, then the oligonucleotide becomes stabilized and therefore exhibits more activity.
Some stabilized oligonucleotides of the instant invention have a modified backbone. It has been demonstrated that modification of the oligonucleotide backbone provides enhanced activity of the nucleic acids when administered in vivo. Nucleic acids, including at least two phosphorothioate linkages at the 5' end of the oligonucleotide and multiple phosphorothioate linkages at the 3' end, preferably 5, may provide maximal activity and protect the oligonucleotide from degradation by intracellular exo- and endo-nucleases. Other modified oligonucleotides include phosphodiester modified oligonucleotide, combinations of phosphodiester and phosphorothioate oligonucleotide, methylphosphonate, methylphosphorothioate, phosphorodithioate, and combinations thereof. Each of these combinations and their particular effects on immune cells is discussed in more detail in PCT Published Patent Application WO98/18810 claiming priority to U.S. Serial Nos. 08/738,652 (now issued as U.S. Patent No. 6,207,646 Bl) and 08/960,774 (now issued as U.S. Patent No. 6,239,116 Bl), filed on October 30, 1996 and October 30, 1997 respectively, the entire contents of which is hereby incorporated by reference. It is believed that these modified oligonucleotides may show more stimulatory activity due to enhanced nuclease resistance, increased cellular uptake, increased protein binding, and/or altered intracellular localization. Both phosphorothioate and phosphodiester nucleic acids are active in immune cells.
Other stabilized oligonucleotides include: nonionic DNA analogs, such as alkyl- and aryl-phosphates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Oligonucleotides which contain diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation.
For use in vivo, nucleic acids are preferably relatively resistant to degradation (e.g., via endonucleases and exonucleases). Secondary structures, such as stem loops, can stabilize nucleic acids against degradation. Alternatively, nucleic acid stabilization can be accomplished via phosphate backbone modifications. One type of stabilized nucleic acid has at least a partial phosphorothioate modified backbone. Phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries. Aryl- and alkyl-phosphonates can be made, e.g., as described in U.S. Patent No. 4,469,863; and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Patent No. 5,023,243 and European Patent No. 092,574) can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described. Uhlmann E et al., Chem Rev 90:544-84 (1990); Goodchild J, Bioconjugate Chem 1:165-87 (1990). The immunostimulatory nucleic acids having backbone modifications useful according to the invention in some embodiments are S- or R-chiral immunostimulatory nucleic acids. An "S chiral immunostimulatory nucleic acid" as used herein is an immunostimulatory nucleic acid wherein at least two nucleotides have a backbone modification forming a chiral center and wherein a plurality of the chiral centers have S chirality. An "R chiral immunostimulatory nucleic acid" as used herein is an immunostimulatory nucleic acid wherein at least two nucleotides have a backbone modification forming a chiral center and wherein a plurality of the chiral centers have R chirality. The backbone modification may be any type of modification that forms a chiral center. The modifications include but are not limited to phosphorothioate, methylphosphonate, methylphosphorothioate, phosphorodithioate, 2'-OMe and combinations thereof. In other embodiments they are non-chiral. A non-chiral nucleic acid is any nucleic acid which does not have at least two chiral centers.
The chiral immunostimulatory nucleic acids must have at least two nucleotides within the nucleic acid that have a backbone modification. All or less than all of the nucleotides in the nucleic acid, however, may have a modified backbone. Of the nucleotides having a modified backbone (referred to as chiral centers), a plurality have a single chirality, S or R. A "plurality" as used herein refers to an amount greater than or equal to 75%. Thus, less than all of the chiral centers may have S or R chirality as long as a plurality of the chiral centers have S or R chirality. In some embodiments at least 75%, 80%, 85%, 90%, 95%, or 100% of the chiral centers have S or R chirality. h other embodiments at least 75%, 80%, 85%, 90%, 95%, or 100% of the nucleotides have backbone modifications. The S- and R- chiral immunostimulatory nucleic acids may be prepared by any method known in the art for producing chirally pure oligonucleotides. Stec et al. teach methods for producing stereopure phosphorothioate oligodeoxynucleotides using an oxathiaphospholane. Stec WJ et al., J Am Chem Soc 117:12019 (1995). Other methods for making chirally pure oligonucleotides have been described by companies such as ISIS Pharmaceuticals. U.S. Patents which disclose methods for generating stereopure oligonucleotides include 5,212,295, 5,359,052, 5,506,212, 5,512,668, 5,521,302, 5,599,797, 5,837,856, 5,856,465, and 5,883,237, each of which is hereby incorporated by reference in its entirety. Other sources of nucleic acids useful according to the invention include standard viral and bacterial vectors, many of which are commercially available. In its broadest sense, a "vector" is any nucleic acid material which is ordinarily used to deliver and facilitate the transfer of nucleic acids to cells. The vector as used herein may be an empty vector or a vector carrying a gene which can be expressed. In the case when the vector is carrying a gene the vector generally transports the gene to the target cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In this case the vector optionally includes gene expression sequences to enhance expression of the gene in target cells such as immune cells, but it is not required that the gene be expressed in the cell. h general, vectors include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources. Viral vectors are one type of vector and include, but are not limited to, nucleic acid sequences from the following viruses: retrovirus, such as Moloney murine leukemia virus, Harvey murine sarcoma virus, murine mammary tumor virus, and Rous sarcoma virus; adenovirus, adeno-associated virus; SN40-type viruses; polyoma viruses; Epstein-Barr viruses; papiUoma viruses; herpes virus; vaccinia virus; polio virus; and RΝA virus such as a retrovirus. One can readily employ other vectors not named but known to the art. Some viral vectors are based on non-cytopathic eukaryotic viruses in which non-essential genes have been replaced with a nucleic acid to be delivered. Νon-cytopathic viruses include retroviruses, the life cycle of which involves reverse transcription of genomic viral RΝA into DΝA.
Standard protocols for producing empty vectors or vectors carrying genes (including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a packaging cell lined with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and/or infection of the target cells with viral particles) are provided in Kriegler M, "Gene Transfer and Expression, A Laboratory Manual," W.H. Freeman Co., New York (1990) and Murry EJ, Ed., "Methods in Molecular Biology," vol. 7, Humana Press, hie, Cliffton, New Jersey (1991).
Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well-known to those of skill in the art. See e.g., Sambrook et al., "Molecular Cloning: A Laboratory Manual," Second Edition, Cold Spring Harbor Laboratory Press, 1989. h the last few years, plasmid vectors have been found to be particularly advantageous for delivering genes to cells in vivo because of their inability to replicate within and integrate into a host genome. Some plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid. Some commonly used plasmids include pBR322, pUC18, pUC19, pcDNA3.1, pSV40, and pBlueScript. Other plasmids are well-known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA.
It has recently been discovered that plasmids (empty or gene-carrying) can be delivered to the immune system using bacteria. Modified forms of bacteria such as Salmonella can be transfected with the plasmid and used as delivery vehicles. The bacterial delivery vehicles can be administered to a host subject orally or by other administration means. The bacteria deliver the plasmid to immune cells, e.g., dendritic cells, probably by passing through the gut barrier. High levels of immune protection have been established using this methodology. Such methods of delivery are useful for the aspects of the invention utilizing systemic delivery of nucleic acid. As used herein, administration of an immunostimulatory nucleic acid is intended to embrace the administration of one or more immunostimulatory nucleic acids which may or may not differ in terms of their profile, sequence, backbone modifications and biological effect. As an example, CpG nucleic acids and T-rich nucleic acids may be administered to a single subject along with an antibody and optionally a cancer therapy. In another example, a plurality of CpG nucleic acids which differ in nucleotide sequence may also be administered to a subject. Some of the nucleic acids useful according to the invention and described herein are presented in Table 4 below.
Table 4: Exemplary Nucleic Acids.
In Table 4 with respect to sequences the letter symbols aside from a, c, t, and g are defined as follows: "b" indicates a biotin moiety attached to that end of the oligonucleotide when it is single and is listed on the 5' or 3' end of oligonucleotide; "d" represents a, g, or t; "f represents fluorescein isothiocyanate (FITC) moiety attached to the 5' or 3' end of oligonucleotide; "h" represents a, c, or t; "i" represents inosine; "n" represents any nucleotide; "z" represents 5-methylcytosine.
Also in Table 4 with respect to backbones the notations are defined as follows: "o" represents phosphodiester; "os" represents phosphorothioate and phosphodiester chimeric with phosphodiester on 5' end; "os2" represents phosphorodithioate and phosphodiester chimeric with phosphodiester on 5' end; "p-ethoxy" represents p-ethoxy backbone (see, e.g., U.S. Patent No. 6,015,886); "po" represents phosphodiester; "s" represents phosphorothioate; "s2" represents phosphorodithioate; "s2o" represents phosphorodithioate and phosphodiester chimeric with phosphodiester on 3' end; "so" represents phosphorothioate and phosphodiester chimeric with phosphodiester on 3' end; and "sos" represents chimeric phosphorothioate/phosphodiester with phosphorothioate at the 5' and 3' ends.
The nucleic acids are delivered in effective amounts. The term "effective amount" of a immunostimulatory nucleic acid refers to the amount necessary or sufficient to realize a desired biologic effect. For example, an effective amount of an immunostimulatory nucleic acid could be that amount necessary to cause activation of the immune system. According to some aspects of the invention, an effective amount is that amount of an immunostimulatory nucleic acid and that amount of an antibody, which when combined or co-administered, results in the prevention or the treatment of the cancer. In some embodiments a synergistic effect is observed. A synergistic amount is that amount which produces an anti-cancer response that is greater than the sum of the individual effects of either the immunostimulatory nucleic acid and the antibody alone. For example, a synergistic combination of an immunostimulatory nucleic acid and an antibody provides a biological effect which is greater than the combined biological effect which could have been achieved using each of the components (i.e., the nucleic acid and the antibody) separately. The biological effect may be the amelioration and or absolute elimination of symptoms resulting from the cancer. In another embodiment, the biological effect is the complete abrogation of the cancer, as evidenced for example, by the absence of a tumor or a biopsy or blood smear which is free of cancer cells. The effective amount of immunostimulatory nucleic acid necessary to treat a cancer or in the reduction of the risk of developing a cancer may vary depending upon the sequence of the immunostimulatory nucleic acid, the backbone constituents of the nucleic acid, and the mode of delivery of the nucleic acid. The effective amount for any particular application can also vary depending on such factors as the cancer being treated, the particular immunostimulatory nucleic acid being administered (e.g., the nature, number or location of immunostimulatory motifs in the nucleic acid), the size of the subject, or the severity of the disease or condition. One of ordinary skill in the art can empirically determine the effective amount of a particular immunostimulatory nucleic acid and antibody combination without necessitating undue experimentation. Combined with the teachings provided herein, by choosing among the various active compounds and weighing factors such as potency, relative bioavailability, patient body weight, severity of adverse side-effects and preferred mode of administration, an effective prophylactic or therapeutic treatment regimen can be planned which does not cause substantial toxicity and yet is entirely effective to treat the particular subject.
Therapeutic doses of cancer therapies are well known in the field of medicine for the treatment of cancer. These dosages have been extensively described in references such as Remington's Pharmaceutical Sciences, 18th ed., 1990; as well as many other medical references relied upon by the medical profession as guidance for the treatment of cancer. Therapeutic dosages of immunostimulatory nucleic acids have also been described in the art and methods for identifying therapeutic dosages in subjects are described in more detail herein. Subject doses of the compounds described herein typically range from about 0.1 μg to
10 mg per administration, which depending on the application could be given daily, weekly, or monthly and any other amount of time therebetween. More typically mucosal or local doses range from about 10 μg to 5 mg per administration, and most typically from about 100 μg to 1 mg, with 2 - 4 administrations being spaced hours, days or weeks apart. More typically, immune stimulant doses range from 1 μg to 10 mg per administration, and most typically 10 μg to 1 mg, with daily or weekly administrations. Subject doses of the compounds described herein for parenteral delivery, wherein the compounds are delivered without another therapeutic agent are typically 5 to 10,000 times higher than the effective mucosal dose or for immune stimulant applications, and more typically 10 to 1,000 times higher, and most typically 20 to 100 times higher. More typically parenteral doses for these purposes range from about 10 μg to 5 mg per administration, and most typically from about 100 μg to 1 mg, with 2 - 4 administrations being spaced hours, days or weeks apart. In some embodiments, however, parenteral doses for these purposes may be used in a range of 5 to 10,000 times higher than the typical doses described above. For any compound described herein the therapeutically effective amount can be initially determined from animal models, e.g., the animal models described herein. A therapeutically effective dose can also be determined from human data for CpG nucleic acids which have been tested in humans (human clinical trials have been initiated and the results publicly disseminated) and for compounds which are known to exhibit similar pharmacological activities. Higher doses may be required for parenteral administration, as described above. The applied dose can be adjusted based on the relative bioavailability and potency of the administered compound. Adjusting the dose to achieve maximal efficacy based on the methods described above and other methods as are well-known in the art is well within the capabilities of the ordinarily skilled artisan.
The formulations of the invention are administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients.
For use in therapy, an effective amount of the nucleic acid can be administered to a subject by any mode that delivers the nucleic acid to a subject. "Administering" the pharmaceutical composition of the present invention may be accomplished by any means known to the skilled artisan. Some routes of administration include but are not limited to oral, intranasal, intratracheal, inhalation, ocular, vaginal, rectal, parenteral (e.g., intramuscular, intradermal, intravenous or subcutaneous injection) and direct injection.
For oral administration, the compounds (i.e., nucleic acids and antibodies) can be delivered alone without any pharmaceutical carriers or formulated readily by combining the active compound(s) with pharmaceutically acceptable carriers well known in the art. The term "pharmaceutically-acceptable carrier" means one or more compatible solid or liquid filler, dilutants or encapsulating substances which are suitable for administration to a human or other vertebrate animal. The term "carrier" denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The components of the pharmaceutical compositions also are capable of being commingled with the compounds of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficiency.
Such carriers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject to be treated. Pharmaceutical preparations for oral use can be obtained as solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PNP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. Optionally the oral formulations may also be foπnulated in saline or buffers for neutralizing internal acid conditions.
Dragee cores may be provided with suitable coatings. For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrohdone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers, h soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. Microspheres formulated for oral administration may also be used. Such microspheres have been well defined in the art. All formulations for oral administration should be in dosages suitable for such administration.
For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner. For administration by inhalation, the compounds for use according to the present invention may be conveniently delivered in the form of an aerosol spray, from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
The compounds, when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
Alternatively, the active compounds may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
The compounds may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
In addition to the formulations described previously, the compounds may also be formulated as a depot preparation. Such long acting formulations may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
The pharmaceutical compositions also may comprise suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.
Suitable liquid or solid pharmaceutical preparation forms are, for example, aqueous or saline solutions for inhalation, microencapsulated, encochleated, coated onto microscopic gold particles, contained in liposomes, nebulized, aerosols, pellets for implantation into the skin, or dried onto a sharp object to be scratched into the skin. The pharmaceutical compositions may also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above. The pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of present methods for drug delivery, see Langer R, Science 249:1527-33 (1990), which is incorporated herein by reference.
The nucleic acids and/or antibodies may be administered per se (neat) or in the form of a pharmaceutically acceptable salt. When used in medicine the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof. Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group. Suitable buffering agents include: acetic acid and a salt (1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v). Suitable preservatives include benzalkonium chloride (0.003-0.03% w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and thimerosal (0.004-0.02% w/v). The nucleic acids or other therapeutics useful in the invention may be delivered in mixtures with additional antibodies. A mixture may consist of several antibodies in addition to the nucleic acid.
A variety of administration routes are available. The particular mode selected will depend, of course, upon the particular nucleic acids or antibodies selected, the particular condition being treated and the dosage required for therapeutic efficacy. The methods of this invention, generally speaking, may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of an immune response without causing clinically unacceptable adverse effects. Preferred modes of administration are discussed above.
The compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. All methods include the step of bringing the compounds into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the compounds into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product. Liquid dose units are vials or ampoules. Solid dose units are tablets, capsules and suppositories.
Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the compounds, increasing convenience to the subject and the physician. Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer base systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Patent No. 5,075,109. Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono-, di-, and tri-glycerides; hydrogel release systems; sylastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which an agent of the invention is contained in a form within a matrix such as those described in U.S. Patent Nos. 4,452,775, 4,675,189, and 5,736,152, and (b) diffiisional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Patent Nos. 3,854,480, 5,133,974 and 5,407,686. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.
The nucleic acid may be directly administered to the subject or may be administered in conjunction with a pharmaceutically acceptable carrier or a delivery vehicle. The nucleic acid and optionally other therapeutic agents may be administered alone (e.g., in saline or buffer) or using any delivery vehicles known in the art. One type of delivery vehicle is referred to herein as a nucleic acid delivery complex. A "nucleic acid delivery complex" shall mean a nucleic acid molecule associated with (e.g., ionically or covalently bound to; or encapsulated within) a targeting means (e.g., a molecule that results in higher affinity binding to target cell (e.g., dendritic cell surfaces and/or increased cellular uptake by target cells). Examples of nucleic acid delivery complexes include nucleic acids associated with: a sterol (e.g., cholesterol), a lipid (e.g., a cationic lipid, virosome or liposome), or a target cell specific binding agent (e.g., a ligand recognized by target cell specific receptor). Preferred complexes may be sufficiently stable in vivo to reduce significant uncoupling prior to internalization by the target cell. However, the complex may be cleavable under appropriate conditions within the cell so that the nucleic acid may be released in a functional form. The nucleic acids may be delivered by non-invasive methods as described above. Non-invasive delivery of compounds is desirable for treatment of children, elderly, animals, and even adults and also to avoid the risk of needle-stick injury. Delivery vehicles for delivering compounds to mucosal surfaces have been described and include but are not limited to: Cochleates (Gould-Fogerite et al., 1994, 1996); Emulsomes (Vancott et al., 1998, Lowell et al., 1997); ISCOMs (Mowat et al., 1993, Carlsson et al., 1991, Hu et al., 1998, Morein et al., 1999); Liposomes (Childers et al., 1999, Michalek et al., 1989, 1992, de Haan 1995a, 1995b); Live bacterial vectors (e.g., Salmonella, Escherichia coli, Bacillus Calmette- Guerin, Shigella, Lactobacillus) (Hone et al., 1996, Pouwels et al., 1998, Chatfield et al., 1993, Stover et al., 1991, Nugent et al., 1998); Live viral vectors (e.g., Vaccinia, adenovirus, Herpes Simplex) (Gallichan et al., 1993, 1995, Moss et al., 1996, Nugent et al., 1998, Flexner et al., 1988, Morrow et al., 1999); Microspheres (Gupta et al., 1998, Jones et al., 1996, Maloy et al., 1994, Moore et al., 1995, O'Hagan et al., 1994, Eldridge et al., 1989); nucleic acid vaccines (Fynan et al., 1993, Kuklin et al., 1997, Sasaki et al., 1998, Okada et al., 1997, Ishii et al., 1997); Polymers (e.g., carboxymethylcellulose, chitosan) (Hamajima et al., 1998, Jabbal-Gill et al., 1998); Polymer rings (Wyatt et al., 1998); Proteosomes (Vancott et al., 1998, Lowell et al., 1988, 1996, 1997); Sodium Fluoride (Hashi et al., 1998); Transgenic plants (Tacket et al., 1998, Mason et al., 1998, Haq et al., 1995); Virosomes (Gluck et al., 1992, Mengiardi et al., 1995, Cryz et al., 1998); Virus-like particles (Jiang et al., 1999, Leibl et al., 1998).
The invention also includes kits. The kits generally include a package with a plurality of containers housing active agents and instructions for carrying out the methods of the invention. The active agents include but are not limited to immunostimulatory nucleic acids, antibodies such as antibodies specific for a cell surface antigen, and anti-cancer therapies.
The following examples are provided to illustrate specific instances of the practice of the present invention and are not to be construed as limiting the present invention to these examples. As will be apparent to one of ordinary skill in the art, the present invention will find application in a variety of compositions and methods. Examples Introduction:
Extensive cross-talk exists between healthy B cells and T cells. There is evidence that malignant B cells also communicate with T cells. However, malignant cells appear to differ from their normal counterparts in a number of ways, including a decreased tendency to undergo apoptosis in response to normal signals, altered expression of a variety of surface markers, and altered ability to function as effective antigen presenting cells. Lagneaux L et al, Blood 91:2387-96 (1998); Gordon J et al., Leukemia 7 Suppl 2:S5-9 (1993); Gordon J et al., Adv Exp Med Biol 406:139-44 (1996); Chaperot L et al., Exp Hematol 27:479-88 (1999). Immunotherapeutic approaches have recently become part of our therapy of some subtypes of B-cell malignancy. Improved immunotherapy of B-cell malignancy will need to be designed based on the growing understanding of the cellular immunology of this disease. Schultze JL et al., J Mol Med 77:322-32 (1999).
A variety of cellular receptors and antigens are involved in growth, differentiation and apoptosis of B-cell malignancies. Antibodies or ligands against a variety of antigens can cause growth inhibition or even apoptosis including CD20, surface immunoglobulins, MHC II, CD80, CD86 and CD40. Maloney DG, Semin Oncol 26:74-8 (1999); McLaughlin P et al., Semin Oncol 26:79-87 (1999); Shan D et al., Blood 91 :1644-52 (1998); Coiffier B et al., Blood 92:1927-32 (1998); McLaughlin P et al., Oncology (Huntingt) 12:1763-70, 1775-7 (1998); Tutt AL et al., J Immunol 161:3176-85 (1998); Funakoshi S et al., Blood 83:2787-94 (1994); Mayumi M et al., J Allergy Clin Immunol 98:S238-47 (1996); Higaki Y et al., Immunol Cell Biol 72:205-14 (1994); Elsasser D et al., Blood 87:3803-12 (1996); Link BK et al., Blood 81 :3343-9 (1993); Link BK et al., Int J Cancer 77:251-6 (1998). The relative contribution of antibody dependent cellular cytotoxicity (ADCC) versus trans-membrane signaling mediated by anti-B cell antibodies remains unclear. In the present study, we examined how CpG-DNA impacts on the phenotype, apoptosis and proliferation of different types of B-cell malignancy including follicular B-cell lymphoma and B-CLL. Materials and Methods: Cell culture: Fresh lymph node samples were obtained from the operating suite and were minced with a scalpel under aseptic conditions. The resulting suspension was passed sequentially through a sterilized sieve-tissue grinder containing a nylon mesh screen, a 150 μm mesh screen and a 60 μm mesh screen. Alternatively, mononuclear cells were obtained from peripheral blood or pleural fluid as described. Hartmann G et al., J Pharmacol Exp Ther 285:920-8 (1998). Red blood cells were removed by resuspending the cells in 5 ml ACK lysis buffer according to standard procedures. Cells were frozen slowly and stored in liquid nitrogen. For analysis, cells were thawed and resuspended in 10 % (v/v) heat- inactivated (56°C, 1 h) FCS (HyClone, Logan, UT), 1.5 mM L-glutamine (all from Gibco BRL, Grand Island, NY) and incubated on a 96-well-plate (1 x 106 cells/ml) in the presence of ODN as indicated below. Not all assays were performed for all samples because of the limited number of cells available for some samples.
Oligonucleotides : Nuclease-resistant phosphorothioate-modified oligodeoxynucleotide (ODN) were purchased from Operon Technologies (Alameda, CA) and Hybridon Specialty Products (Milford, MA). Sequences were as follows: CpG ODN 2006: 5'-TCGTCGTTTTGTCGTTTTGTCGTT-3' (SEQ ID NO: 729), and control ODN 2017: 5'-CCCCCCCCCCCCCCCCCCCC-3' (SEQ J-D NO: 168). ODN was diluted in TE (10 mM Tris-HCl, 1 mM EDTA, pH 8) using pyrogen-free reagents. ODN was added at a final concentration of 5 μg/ml.
Flow cytometry: Cells were washed and resuspended in ice-cold PBS or Annexin V binding buffer (10 mM HEPES/NaOH, 140 mM NaCl, 2.5 mM CaCl2, pH 7.4). Murine or human serum was added (final concentration 1%) to block non-specific binding of antibodies. Surface antigen staining was performed as described. Hartmann G et al., J Pharmacol Exp Ther 285:920-8 (1998). In brief, 1 x 105 cells per sample were stained with CyChrome- labeled anti-CD 19 and FITC- or PE-labeled antibodies as indicated for 20 min on ice. They were then washed and analyzed by flow cytometry. Monoclonal antibodies to CD40 (5C3), CD69 (FN50), CD80 (L307.4), CD86 (IT2.2), CD54 (HA58), MHC I (G46-2.6) and MHC II (TU39) as well as isotype controls (IgGl, MOPC-21 and IgG2a, G155-178) were purchased from PharMingen, San Diego, CA. FITC-labeled polyclonal anti-human Ig was purchased from Southern Biotech, Birmingham, AL. 1D10, a monoclonal humanized antibody directed against a variant of HLA-DR was produced in our laboratory as described earlier. Link BK et al., Blood 81 :3343-9 (1993). C2B8, a monoclonal humanized anti-CD20 antibody, was purchased from J-DEC Pharmaceuticals, San Diego, CA. 1D10 and C2B8 were labeled with FITC according to standard protocols. The analysis gate was set on viable cells identified according to FSC/SSC characteristics and Annexin V staining (> 97 % viable cells within analysis gate). Spectral overlap was corrected by appropriate compensation. Flow cytometric data from 1 x 104 cells per sample were acquired on a FACScan (Beckton Dickinson hnmunocytometry Systems, San Jose, CA). Data were analyzed using the computer program FlowJo (version 2.5.1, Tree Star, Inc., Stanford, CA).
CFSE staining: CFSE 5- (and 6-) carboxyfluorescein diacetate succinimidyl ester, Molecular Probes, USA, is a fluorescein-derived intracellular fluorescent label which is divided equally between daughter cells upon cell division. Staining of cells with CFSE allows both quantification and immunophenotyping of proliferating cells in a mixed cell suspension. Interference between oligonucleotide degradation products and thymidine uptake (standard proliferation assay) is avoided by using this method. The technique has described in detail previously. Lyons AB et al., J Immunol Methods 171:131-7 (1994). Briefly, cells were washed twice in PBS, resuspended in PBS (1 x 107 cells/ml) containing CFSE at a final concentration of 1 μM, and incubated at 37°C for 10 minutes. Cells were washed three times with PBS.
TUNEL assay: A two-color DNA strand break labeling assay, based on a modification of the assay described by Li et al. (Li X et al., ExpCell Res 222:28-37 (1996)) was used to assess B-cell proliferation in response to CpG ODN. This assay involved terminal transferase-mediated dUTP nick end labeling (TUNEL) before and after induction of DNA strand breaks in BrdU-labeled cells. Briefly, cells were cultured for 3 days with and without ODN. They were then incubated for 16 hours in lOμM BrdU and placed onto slides by cytospin. Cells were then in 1% paraformaldehyde in PBS for 15 minutes followed by 20 minutes in 70% ethanol. DNA cleavage indicative of apoptosis cells was detected by labeling the 3'-DNA end of nicked strands with FITC-ddUTP (Boehringer-Mannheim). The use of dideoxy-dUTP prevented further elongation of the 3'-ends in subsequent steps. Slides were then placed face-down on a 2mm support at both ends on a UV transilluminator and exposed for 5 minutes. The new DNA strand breaks induced by photolysis at sites of BrdU incorporation (i.e., proliferating cells) were detected by a second TUNEL labeling using tetramethylrhodamine-dUTP (TMR-dUTP, Boehringer-Mannheim). Both TUNEL staining steps included incubating slides in 50μl of TdT mix (34μl distilled water, lOμl of 5X TdT buffer, 5μl of 25mM cobalt chloride, 12.5 units terminal transferase and 0.5nmol fluorochrome-conjugated-dUTP) (Boeliringer-Marrnheim) under a coverslip for one hour at 37°C in a humidified chamber. The slides were then washed in 5 quick changes of distilled water followed by 3 changes of 2XSSC containing 30% formamide for 5 minutes each at room temperature. After the second TUNEL labeling step, cells were counterstained for CD 19, and also stained with Wright solution for blood cell differentiation and mounted in Vectashield media containing DAPI counterstain (Vector Laboratories, Burlingame, CA). The morphology and staining of cells were assessed using both visible light and fluorescence microscopy. Apoptotic cells were identified by green fluorescence (FITC label), and proliferating cells by red fluorescence (TMR label). The percentage of apoptotic and proliferating cells was determined by counting at least 200 cells per sample by three observers blinded to whether cells were treated with ODN. Mean and standard error were determined for each sample based on these three readings.
Example 1 : Immunostimulatory nucleic acids induce morphological and phenotypic changes in malignant B cells.
Our prior studies demonstrated that activation of naive human B cells by CpG ODN results in increased cell size (FSC) and granularity (SSC). Hartmann G et al., J Immunol 164:944-53 (2000). We therefore first detennined whether such changes also occur in malignant B cells. Primary malignant B cells were obtained from lymph node biopsies, peripheral blood, or pleural fluid of patients with various types of B-cell malignancy. In addition, cells from the lymph node of a patient with benign reactive follicular hyperplasia were studied. Nine samples in total were evaluated (see Table 5). Cells were incubated for 72 hours in media containing CpG ODN 2006 (5 μg/ml) or control ODN 2017. FSC and SSC were examined with gating on CD19+ viable cells (Figure 1). Varying degrees of change in FSC and SSC were noted in response to CpG ODN 2006 when compared to control ODN 2017 or medium alone. Comparable changes were not found in the cells from the patient with benign reactive follicular hyperplasia. Figure 1 depicts the morphologic changes of marginal zone lymphoma cells upon
CpG ODN stimulation. Malignant B cells from a patient with marginal zone lymphoma were stimulated with 5 μg/ml of no ODN (A and D), control ODN (B and E) or CpG ODN (C and F) for 72 hours and analyzed by flow cytometry. A, B, and C illustrate FSC (x-axis) vs. SSC (y-axis). D, E and F illustrate CD 19 expression (x-axis) against FSC (y-axis), allowing for separation of B cells from other leukocyte subpopulations. Upon stimulation with CpG ODN, B cells shifted up and to the right, indicating an increase in granularity and size. No changes could be detected without stimulation or on stimulation with the non-CpG ODN. Expression of CD20, CD40, CD69, CD80, CD86, surface Ig, CD54, MHC I, MHC II, and an HLA-DR variant antigen (moAb ID 10) were examined on viable CD 19+ cells after incubation of cells with CpG ODN for 72 hours. Each of these markers was upregulated to varying extents in response to the CpG ODN 2006 compared to the control ODN 2017 (Fig. 2, Fig. 3).
Figure 2 depicts the expression of surface antigens on marginal zone lymphoma cells upon CpG ODN treatment. Flow cytometric analysis of surface antigen expression on malignant B cells from a patient with marginal zone lymphoma was performed 72 hours after stimulation with 5 μg/ml of either CpG ODN or non-CpG ODN. On stimulation with CpG ODN, median fluorescence intensity for all markers tested shifted to the right, indicating an increase in surface expression. Thin curves indicate incubation with medium alone, dotted curves incubation with control ODN, and bold curves incubation with CpG ODN.
Figure 3 depicts the expression of surface antigens on primary cells representing different B-cell malignancies and cells of a benign follicular hyperplasia upon CpG ODN treatment. Cells from lymph node biopsies, peripheral blood or pleural fluid from patients with different B-cell malignancies were incubated for 72 hours with either media alone, control ODN or CpG ODN. Each panel represents one experiment.
CD20 was expressed to varying degrees in all samples tested. As is well known, baseline CD20 expression was lower in the B-CLL samples when compared to the B-cell malignancies of other histologies. CpG-ODN 2006 but not the control ODN 2017 increased CD20 expression in both B-CLLs and both marginal zone lymphomas. No or only little upregulation was seen in the other lymphoma samples. Non-malignant CD19+ cells derived from the reactive follicular hyperplasia decreased CD20 expression in response to CpG (Fig. 3). This data demonstrated a reverse correlation between the baseline expression of CD20 and CD40, and expression of these markers after incubation with CpG ODN; thus the lower the baseline level of CD20 and CD40, the higher was the responsiveness to CpG ODN (r: - 0.6; -0.4) (Fig. 4). This correlation was less clear for the other markers. CD19+ cells derived from the reactive follicular hyperplasia showed high baseline expression of activation markers which was not further upregulated by CpG. Figure 4 shows the CpG ODN effect on CD20 and CD40 is dependent on the baseline level of expression. Cells from lymph node biopsies, peripheral blood or pleural fluid from patients with different B-cell malignancies (see Table 5) were incubated with or without CpG ODN for 72 hours. Expression of CD20 and CD40 was measured by flow cytometry. Baseline expression of CD20 and CD40 with medium alone was compared to the expression of CD20 and CD40 in the presence of CpG ODN. The coefficients of correlation are indicated.
Table 5: Percentage Of CD 19+ Cells In Samples Tested.
Example 2: Immunostimulatory nucleic acids induce proliferation and apoptosis of malignant B cells. CpG induces a strong proliferative response of primary human B cells. Hartmann G et al., J Immunol 164:944-53 (2000). Two techniques were used to assess whether CpG ODN is capable of inducing proliferation of B-CLL cells. For select samples, cells were stained with CFSE and incubated for four days. Proliferation of cells is indicated by a loss of CFSE stain with every cell division. In B-CLL, CD5 can be used to identify malignant B cells among CD19+ cells. Proliferation of malignant B cells (CD5+ and CD19+) was lower than proliferation of normal B cells (CD5- and CD19+) (Fig. 5). For the marginal zone lymphoma, CpG ODN 2006 induced proliferation of the CD19+ cell population (Fig. 5).
Figure 5 shows a comparison of CpG ODN induced proliferation of malignant and normal B cells. Peripheral blood mononuclear cells from two patients, one with B-CLL and one with marginal zone lymphoma with circulating malignant cells, were incubated for 72 hours with CpG ODN or medium alone and evaluated by two-color flow cytometry. CFSE fluorescence (x-axis) and expression of CD5 (CLL) or CD 19 (marginal zone lymphoma) (y- axis) were evaluated. In CLL, CpG ODN enhanced proliferation of both CD5+ and the CD5- cells. However the relative number of proliferating cells and the number of divisions is lower in the CD5- subset than in the CD5+ subset. In marginal zone lymphoma CpG ODN enhanced proliferation in the CD 19+ cell subset.
No consistent pattern was apparent related to determining whether CpG ODN altered the percent of dead cells as determined by morphological criteria (see Table 6).
Table 6: Percent Apoptotic Cells Based On Morphologic Criteria.
A TUNEL assay was utilized to assess the effect of CpG ODN on both proliferation and apoptosis. The results are shown in Table 7.
Table 7: Apoptosis And Proliferation As Determined By TUNEL.
Example 3: CpG ODN enhance the therapeutic effect of murine IgG2a (which relates to human IgGl) but not murine IgGl (which relates to human IgG2) anti-tumor antibody. CpG ODN when combined with antibody of murine subtype IgG2a dramatically promotes survival in mice having tumors. Mice were injected i.p. with 5000 T3C cells on day 0. They were then given 100 μg anti-idiotype monoclonal antibody as either IgGl (MS5A10) or IgG2a (MSI 1G6) on days 5, 7, and 10. In this model, the target antigen is the idiotype expressed by the lymphoma cells. Therefore, the anti-tumor antibodies are also "anti-idiotype." These antibodies (MS5A10 and MSI 1G6) are simultaneously both anti- tumor antibodies and anti-idiotype antibodies. Twenty micrograms of CpG ODN 1826 (5' TCCATGACGTTCCTGACGTT 3'; SEQ ID NO: 560) was given at the same time. Results are shown in Figure 6. Untreated controls had a median survival time (MST) of 17 days after inoculation with tumor. Mice treated with murine IgGl antibody plus CpG ODN had survival that was similar to those treated with murine IgGl antibody alone (MST 28 days and 27 days, respectively). In contrast, mice treated with murine IgG2a plus CpG ODN had survival that was significantly improved when compared to mice treated with murine IgG2a alone (MST 45 days and 37 days, respectively).
The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. The present invention is not to be limited in scope by examples provided, since the examples are intended as a single illustration of one aspect of the invention and other functionally equivalent embodiments are within the scope of the invention. Various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims. The advantages and objects of the invention are not necessarily encompassed by each embodiment of the invention.
All references, patents and patent publications that are recited in this application are incorporated in their entirety herein by reference. We claim:

Claims

1. A method for treating or preventing cancer, comprising: administering to a subject having or at risk of developing cancer an effective amount to upregulate CD20 expression of a nucleic acid, and an anti-CD20 antibody.
2. The method of claim 1, wherein the nucleic acid is an immunostimulatory CpG nucleic acid having an unmethylated CpG motif.
3. The method of claim 1 , wherein the nucleic acid is an immunostimulatory T-rich nucleic acid.
4. The method of claim 1 , wherein the nucleic acid is an immunostimulatory poly-G nucleic acid.
5. The method of claim 1 , wherein the nucleic acid is bacterial DNA.
6. The method of claim 1 , wherein the nucleic acid is eukaryotic DNA.
7. The method of claim 1, wherein the cancer is B-cell lymphoma associated with low levels of CD20 expression.
8. The method of claim 7, wherein the B-cell lymphoma is B-cell chronic lymphocytic leukemia (B-CLL).
9. The method of claim 7, wherein the B-cell lymphoma is a marginal zone lymphoma.
10. The method of claim 1, wherein the anti-CD20 antibody is C2B8.
11. The method of claim 1 , wherein the anti-CD20 antibody is Rituximab.
12. The method of claim 1 , wherein the nucleic acid does not hybridize with genomic DNA or RNA under stringent conditions.
13. The method of claim 1 , wherein the nucleic acid has a modified backbone.
14. The method of claim 13, wherein the modified backbone is a phosphate backbone modification.
15. The method of claim 13, wherein the modified backbone is a peptide modified oligonucleotide backbone.
16. The method of claim 1, wherein the nucleic acid is an immunostimulatory nucleic acid.
17. The method of claim 1 , wherein the nucleic acid is 8 to 40 nucleotides in length.
18. The method of claim 1, wherein the nucleic acid is isolated.
19. The method of claim 1, wherein the nucleic acid is a synthetic nucleic acid.
20. The method of claim 1, wherein the nucleic acid and the anti-CD20 antibody are administered together.
21. The method of claim 1 , wherein the nucleic acid and the anti-CD20 antibody are administered separately.
22. A method for diagnosing lymphoma, comprising: isolating a B cell from a subject having or suspected of having a type of lymphoma and identifying a change in a cell surface marker when the B cell is contacted with an immunostimulatory nucleic acid, wherein the cell surface marker induced on the B cell is indicative of the type of lymphoma.
23. The method of claim 22, further comprising a method for treating cancer by administering to the subject an immunostimulatory nucleic acid and an antibody specific for the cell surface marker induced on the B cell in order to treat the cancer.
24. A method for treating or preventing cancer, comprising: administering to a subject having or at risk of developing cancer an effective amount to induce expression of a surface antigen on a cancer cell surface, of a nucleic acid, and administering to the subject an antibody selected from the group consisting of an anti- CD22 antibody and an anti-CD 19 antibody.
25. The method of claim 24, wherein the nucleic acid is an immunostimulatory CpG nucleic acid having an unmethylated CpG motif.
26. The method of claim 24, wherein the nucleic acid is an immunostimulatory T-rich nucleic acid.
27. The method of claim 24, wherein the nucleic acid is an immunostimulatory poly-G nucleic acid.
28. The method of claim 24, wherein the nucleic acid is bacterial DNA.
29. The method of claim 24, wherein the nucleic acid is eukaryotic DNA.
30. The method of claim 24, wherein the anti-CD22 antibody is a human IgGl antibody.
31. The method of claim 24, wherein the anti-CD22 antibody is a murine IgG2a antibody.
32. The method of claim 24, wherein the anti-CD 19 antibody is a human IgGl antibody.
33. The method of claim 24, wherein the anti-CD19 antibody is a murine IgG2a antibody.
34. A method for treating lymphoma, comprising: isolating a B cell from a subject having lymphoma, identifying a surface antigen which is not expressed or which is expressed on the surface of the B cell in an amount lower than that of a control B cell, administering to the subject an antibody specific for the identified surface antigen and an immunostimulatory nucleic acid in order to treat the cancer, wherein the immunostimulatory nucleic acid is administered in an effective amount to upregulate expression of the surface antigen on the cancer cell surface.
35. The method of claim 34, wherein the surface antigen is CD20.
36. The method of claim 34, wherein the surface antigen is CD40.
37. The method of claim 34, wherein surface antigen is CD22.
38. The method of claim 34, wherein surface antigen is CD19.
39. The method of claim 34, wherein the lymphoma is B-CLL.
40. The method of claim 34, wherein the lymphoma is marginal zone lymphoma.
41. The method of claim 34, wherein the antibody is a human IgGl antibody.
42. The method of claim 34, wherein the antibody is a murine IgG2a antibody.
43. A method for treating a lymphoma resistant to antibody therapy, comprising: administering to a subject having a lymphoma resistant to therapy with an antibody specific for a surface antigen, an antibody specific for the surface antigen to which the lymphoma is resistant and a nucleic acid in order to treat the lymphoma, wherein the nucleic acid is administered in an effective amount to upregulate expression of the surface antigen on the lymphoma cell surface.
44. The method of claim 43, wherein the surface antigen is CD20.
45. The method of claim 44, wherein the antibody is Rituximab.
46. The method of claim 43, wherein the surface antigen is CD40.
47. The method of claim 43, wherein the surface antigen is CD22.
48. The method of claim 43 , wherein the surface antigen is CD 19.
49. The method of claim 43, wherein the antibody is a human IgGl antibody.
50. The method of claim 43, wherein the antibody is a murine IgG2a antibody.
51. The method of claim 43, further comprising administering an anti-cancer therapy.
52. The method of claim 51 , wherein the anti-cancer therapy is selected from the group consisting of a chemotherapeutic agent or a cancer vaccine.
53. The method of claim 52, wherein the chemotherapeutic agent is selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, valrubicin, Novantrone/Mitroxantrone, Evacet/liposomal doxorubicin, Yewtaxan/Paclitaxel, Taxol/Paclitaxel, Furtulon/Doxifluridine, Cyclopax/oral paclitaxel, SPU-077/Cisplatin, HMR 1275/Flavoρiridol, BMS-182751/oral platinum, Leustatin/Cladribine, Paxex/Paclitaxel, Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin, Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, Caetyx/liposomal doxorubicin, Gemzar/Gemcitabine, Ifes/Mesnex/Ifosamide, Vumon Teniposide, Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, Taxotere/Docetaxel, prodrug of guanine arabinoside, nitrosoureas, Asparaginase, Busulfan, Carboplatin, Chlorombucil, Cytarabine HC1, Daunorubicin HC1, Etoposide (VP 16-213), Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Interferon Alfa-2b, Lomustine (CCNU), Mechlorethamine HC1 (nitrogen mustard), Mercaptopurine, Mesna, Mitoxantrone HC1, Procarbazine HC1, Thioguanine, Thiotepa, Vinblastine sulfate, Azacitidine, Interleukin 2, Pentostatin (2'deoxycoformycin), Teniposide (VM-26), GM-CSF, and Vindesine sulfate.
54. The method of claim 52, wherein the chemotherapeutic agent is selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, valrubicin, Novantrone/Mitroxantrone, Evacet/liposomal doxorubicin, Yewtaxan/Paclitaxel, Taxol/Paclitaxel, SPU-077/Cisplatin, HMR 1275/Flavopiridol, BMS-182751/oral platinum, Leustatin Cladribine, Paxex/Paclitaxel, Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin, Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, Caetyx/liposomal doxorubicin, Gemzar/Gemcitabine, Ifes/Mesnex/Ifosamide, Vumon/Teniposide, Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, Taxotere/Docetaxel, prodrug of guanine arabinoside, nitrosoureas, alkylating agents such as melphalan and cyclophosphamide, Asparaginase, Busulfan, Carboplatin, Chlorombucil, Cytarabine HC1, Daunorubicin HC1, Etoposide (VP 16-213), Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Interferon Alfa-2b, Lomustine (CCNU), Mechlorethamine HC1 (nitrogen mustard), Mercaptopurine, Mitoxantrone HC1, Procarbazine HO, Thioguanine, Thiotepa, Vinblastine sulfate, Azacitidine, Interleukin 2, Pentostatin (2'deoxycoformycin), Teniposide (VM-26), GM-CSF, and Vindesine sulfate.
55. The method of claim 52, wherein the cancer vaccine is selected from the group consisting of EGF, Anti-idiotypic cancer vaccines, Gp75 antigen, GMK melanoma vaccine, MGV ganglioside conjugate vaccine, Her2/neu, Ovarex, M-Vax, O-Vax, L-Vax, STn-KHL theratope, BLP25 (MUC-1), liposomal idiotypic vaccine, Melacine, peptide antigen vaccines, toxin/antigen vaccines, MVA-based vaccine, PACIS, BCG vaccine, TA-HPV, TA-CTN, DISC-virus and ImmuCyst/TheraCys.
56. A method for treating cancer in a human, comprising: administering to a human an immunostimulatory nucleic acid and an antibody of IgGl isotype, which binds to a cell surface antigen of a cancer cell and wherein the nucleic acid and the antibody are administered in an effective amount for killing the cancer cell.
57. The method of claim 56, wherein the nucleic acid is an immunostimulatory CpG nucleic acid having an umnethylated CpG motif.
58. The method of claim 56, wherein the nucleic acid is an immunostimulatory T-rich nucleic acid.
59. The method of claim 56, wherein the nucleic acid is an immunostimulatory poly-G nucleic acid.
60. The method of claim 56, wherein the nucleic acid is bacterial DNA.
61. The method of claim 56, wherein the nucleic acid is eukaryotic DNA.
62. The method of claim 56, wherein the nucleic acid has a modified backbone.
63. The method of claim 62, wherein the modified backbone is a phosphate backbone modification.
64. The method of claim 62, wherein the modified backbone is a peptide modified oligonucleotide backbone.
65. The method of claim 56, wherein the nucleic acid is an immunostimulatory nucleic acid.
66. The method of claim 56, wherein the nucleic acid is 8 to 40 nucleotides in length.
67. The method of claim 56, wherein the nucleic acid is isolated.
68. The method of claim 56, wherein the nucleic acid is a synthetic nucleic acid.
69. The method of claim 56, wherem the nucleic acid and the antibody are administered together.
70. The method of claim 56, wherein the nucleic acid and the antibody are administered separately.
71. The method of claim 56, further comprising administering an anti-cancer therapy.
72. The method of claim 71, wherein the anti-cancer therapy is selected from the group consisting of a chemotherapeutic agent and a cancer vaccine.
73. The method of claim 72, wherein the chemotherapeutic agent is selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, non-sugar containing chloroethylnitrosoureas, 5 -fluorouracil, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, fragyline, Meglamine GLA, valrubicin, carmustaine and poliferposan, MMI270, BAY 12-9566, RAS famesyl transferase inhibitor, famesyl transferase inhibitor, MMP, MTA/LY231514, LY264618/Lometexol, Glamolec, CI-994, TNP-470, Hycamtin/Topotecan, PKC412, Nalspodar/PSC833, Νovantrone/Mitroxantrone, Metaret/Suramin, Batimastat, E7070, BCH-4556, CS-682, 9-AC, AG3340, AG3433, Incel/VX-710, NX-853, ZD0101, ISI641, ODΝ 698, TA 2516/Marmistat, BB2516/Marmistat, CDP 845, D2163, PD183805, DX8951f, Lemonal DP 2202, FK 317, Picibanil/OK-432, AD 32/Nalrubicin, Metasfron/strontium derivative, Temodal/Temozolomide, Evacet/liposomal doxorubicin, Yewtaxan/Paclitaxel, Taxol/Paclitaxel, Xeload/Capecitabine, Furtulon/Doxifluridine, Cyclopax/oral paclitaxel, Oral Taxoid, SPU-077/Cisplatin, HMR 1275/Flavopiridol, CP-358 (774VEGFR, CP-609 (754)/RAS oncogene inhibitor, BMS-182751/oral platinum, UFT(Tegafur/Uracil), Ergamisol/Levamisole, Eniluracil/776C85/5FU enhancer, Campto/Levamisole, Camptosar/Jrinotecan, Tumodex/Ralitrexed, Leustatin/Cladribine, Paxex/Paclitaxel, Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin, Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, ZD1839, LU 79553/Bis- Νaphtalimide, LU 103793/Dolastain, Caetyx/liposomal doxorubicin, Gemzar/Gemcitabine, ZD 0473/Anormed, YM 116, Iodine seeds, CDK4 and CDK2 inhibitors, PARP inhibitors, D4809/Dexifosamide, Ifes/Mesnex/Ifosamide, Numon/Teniposide, Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, ZD 9331, Taxotere/Docetaxel, prodrug of guanine arabinoside, Taxane Analog, nitrosoureas, alkylating agents such as melphalan and cyclophosphamide, Aminoglutethimide, Asparaginase, Busulfan, Carboplatin, Chlorombucil, Cytarabine HCl, Dactinomycin, Daunorubicin HCl, Estramustine phosphate sodium, Etoposide (VP 16-213), Floxuridine, Fluorouracil (5-FU), Flutamide, Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Interferon Alfa-2b, Leuprolide acetate (LHRH-releasing factor analogue), Lomustine (CCNU), Mechlorethamine HCl (nitrogen mustard), Mercaptopurine, Mesna, Mitotane (o,p'-DDD), Mitoxantrone HCl, Octreotide, Plicamycin, Procarbazine HCl, Streptozocin, Tamoxifen citrate, Thioguanine, Thiotepa, Vinblastine sulfate, Amsacrine (m-AMSA), Azacitidine, Erythropoietin, Hexamethylmelamine (HMM), Interleukin 2, Mitoguazone (methyl-GAG; methyl glyoxal bis-guanylhydrazone; MGBG), Pentostatin (2'deoxycoformycin), Semustine (methyl- CCNU), Teniposide (VM-26), GM-CSF, and Vindesine sulfate.
74. The method of claim 72, wherein the chemotherapeutic agent is selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, valrubicin, Novantrone/Mitroxantrone, Evacet/liposomal doxorubicin, Yewtaxan/Paclitaxel, Taxol/Paclitaxel, SPU-077/Cisplatin, HMR 1275/Flavopiridol, BMS-182751/oral platinum, Leustatin/Cladribine, Paxex/Paclitaxel, Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin, Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, Caetyx/liposomal doxorubicin, Gemzar/Gemcitabine, Ifes/Mesnex/Ifosamide, Vumon/Teniposide, Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, Taxotere/Docetaxel, prodrug of guanine arabinoside, nitrosoureas, alkylating agents such as melphalan and cyclophosphamide, Asparaginase, Busulfan, Carboplatin, Chlorombucil, Cytarabine HCl, Daunorubicin HCl, Etoposide (VP 16-213), Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Interferon Alfa-2b, Lomustine (CCNU), Mechlorethamine HCl (nitrogen mustard), Mercaptopurine, Mitoxantrone HCl, Procarbazine HCl, Thioguanine, Thiotepa, Vinblastine sulfate, Azacitidine, Interleukin 2, Pentostatin (2'deoxycoformycin), Teniposide (VM-26), GM-CSF, and Vindesine sulfate.
75. The method of claim 72, wherein the cancer vaccine is selected from the group consisting of EGF, Anti-idiotypic cancer vaccines, Gp75 antigen, GMK melanoma vaccine, MGV ganglioside conjugate vaccine, Her2/neu, Ovarex, M-Vax, O-Vax, L-Vax, STn-KHL theratope, BLP25 (MUC-1), liposomal idiotypic vaccine, Melacine, peptide antigen vaccines, toxin/antigen vaccines, MVA-based vaccine, PACIS, BCG vaccine, TA-HPV, TA-CIN, DISC-virus and ImmuCyst/TheraCys.
76. A kit, comprising: a package including at least two containers, the first container housing an immunostimulatory nucleic acid, the second container housing an antibody specific for a cell surface antigen, and instructions for screening a cell to determine whether the immunostimulatory nucleic acid upregulates expression of the cell surface antigen.
77. The kit of claim 76, wherein the antibody is selected from the group consisting of an anti-CD20 antibody, an anti-CD 19 antibody, and an anti-CD22 antibody.
EP01948684A 2000-06-22 2001-06-22 Combination of CpG and antibodies directed against CD19,CD20, CD22 or CD40 for the treatment or prevention of cancer. Expired - Lifetime EP1296714B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
SI200130937T SI1296714T1 (en) 2000-06-22 2001-06-22 Combination of CpG and antibodies directed against CD19,CD20, CD22 or CD40 for the treatment or prevention of cancer.

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US21334600P 2000-06-22 2000-06-22
US213346P 2000-06-22
PCT/US2001/020154 WO2001097843A2 (en) 2000-06-22 2001-06-22 Methods for enhancing antibody-induced cell lysis and treating cancer

Publications (2)

Publication Number Publication Date
EP1296714A2 true EP1296714A2 (en) 2003-04-02
EP1296714B1 EP1296714B1 (en) 2009-08-26

Family

ID=22794755

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01948684A Expired - Lifetime EP1296714B1 (en) 2000-06-22 2001-06-22 Combination of CpG and antibodies directed against CD19,CD20, CD22 or CD40 for the treatment or prevention of cancer.

Country Status (12)

Country Link
US (1) US7534772B2 (en)
EP (1) EP1296714B1 (en)
JP (1) JP2003535907A (en)
AT (1) ATE440618T1 (en)
AU (5) AU2001270134B2 (en)
CA (1) CA2410371C (en)
DE (1) DE60139689D1 (en)
DK (1) DK1296714T3 (en)
ES (1) ES2332444T3 (en)
PT (1) PT1296714E (en)
SI (1) SI1296714T1 (en)
WO (1) WO2001097843A2 (en)

Families Citing this family (210)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6727230B1 (en) * 1994-03-25 2004-04-27 Coley Pharmaceutical Group, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US20030026782A1 (en) * 1995-02-07 2003-02-06 Arthur M. Krieg Immunomodulatory oligonucleotides
US6239116B1 (en) * 1994-07-15 2001-05-29 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7935675B1 (en) * 1994-07-15 2011-05-03 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6429199B1 (en) * 1994-07-15 2002-08-06 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
US6207646B1 (en) * 1994-07-15 2001-03-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
CA2244946C (en) * 1996-01-30 2010-04-13 The Regents Of The University Of California Gene expression vectors which generate an antigen specific immune response and methods of using the same
EP0855184A1 (en) 1997-01-23 1998-07-29 Grayson B. Dr. Lipford Pharmaceutical composition comprising a polynucleotide and an antigen especially for vaccination
US6406705B1 (en) * 1997-03-10 2002-06-18 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US6274591B1 (en) * 1997-11-03 2001-08-14 Joseph F. Foss Use of methylnaltrexone and related compounds
US20030158220A1 (en) * 1997-11-03 2003-08-21 Foss Joseph F. Use of methylnaltrexone and related compounds to treat chronic opioid use side effects
AU760549B2 (en) * 1998-04-03 2003-05-15 University Of Iowa Research Foundation, The Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
JP2002514397A (en) * 1998-05-14 2002-05-21 コーリー ファーマシューティカル ゲーエムベーハー Methods for hematopoietic regulation using CpG oligonucleotides
SI1077722T1 (en) 1998-05-22 2007-02-28 Ottawa Health Research Inst Methods and products for inducing mucosal immunity
WO2001060397A1 (en) * 2000-02-16 2001-08-23 Genentech, Inc. Uses of agonists and antagonists to modulate activity of tnf-related molecules
US6693086B1 (en) * 1998-06-25 2004-02-17 National Jewish Medical And Research Center Systemic immune activation method using nucleic acid-lipid complexes
US20030022854A1 (en) 1998-06-25 2003-01-30 Dow Steven W. Vaccines using nucleic acid-lipid complexes
ES2572834T3 (en) 1999-02-17 2016-06-02 Csl Limited Immunogenic complexes and related methods
EP1176966B1 (en) * 1999-04-12 2013-04-03 THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES Oligodeoxynucleotide and its use to induce an immune response
US6977245B2 (en) 1999-04-12 2005-12-20 The United States Of America As Represented By The Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
WO2000067796A1 (en) 1999-05-07 2000-11-16 Genentech, Inc. Treatment of autoimmune diseases with antagonists which bind to b cell surface markers
KR20020027490A (en) * 1999-07-12 2002-04-13 제넨테크, 인크. Blocking Immune Response to a Foreign Antigen Using an Antagonist Which Binds to CD20
NZ517929A (en) * 1999-09-25 2004-02-27 Univ Iowa Res Found Immunostimulatory nucleic acids
US6949520B1 (en) * 1999-09-27 2005-09-27 Coley Pharmaceutical Group, Inc. Methods related to immunostimulatory nucleic acid-induced interferon
AU2001227889A1 (en) 2000-01-14 2001-07-24 The United States of America, represented by The Secretary, Department of Health & Human Services Oligodeoxynucleotide and its use to induce an immune response
US20010044416A1 (en) * 2000-01-20 2001-11-22 Mccluskie Michael J. Immunostimulatory nucleic acids for inducing a Th2 immune response
US7585847B2 (en) * 2000-02-03 2009-09-08 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20040131628A1 (en) * 2000-03-08 2004-07-08 Bratzler Robert L. Nucleic acids for the treatment of disorders associated with microorganisms
US7030219B2 (en) 2000-04-28 2006-04-18 Johns Hopkins University B7-DC, Dendritic cell co-stimulatory molecules
IL153218A0 (en) 2000-06-02 2003-07-06 Univ Texas Ethylenedicysteine (ec) -drug conjugates
WO2001093902A2 (en) * 2000-06-07 2001-12-13 Biosynexus Incorporated Immunostimulatory rna/dna hybrid molecules
KR100917101B1 (en) * 2000-08-04 2009-09-15 도요 보세키 가부시키가이샤 Flexible metal laminate and production method thereof
JP2005500806A (en) * 2000-09-15 2005-01-13 コーリー ファーマシューティカル ゲーエムベーハー Process for high-throughput screening of immune agonist / immunoantagonists based on CpG
JP2004508420A (en) * 2000-09-18 2004-03-18 アイデック ファーマスーティカルズ コーポレイション Combination therapy for treating autoimmune diseases using B cell depleting antibody / immunomodulatory antibody combination
TWI283575B (en) * 2000-10-31 2007-07-11 Eisai Co Ltd Medicinal compositions for concomitant use as anticancer agent
ES2307568T3 (en) * 2000-12-08 2008-12-01 Coley Pharmaceutical Gmbh CPG TYPE NUCLEIC ACIDS AND SAME USE METHODS.
US20030133939A1 (en) 2001-01-17 2003-07-17 Genecraft, Inc. Binding domain-immunoglobulin fusion proteins
US7829084B2 (en) * 2001-01-17 2010-11-09 Trubion Pharmaceuticals, Inc. Binding constructs and methods for use thereof
US7754208B2 (en) 2001-01-17 2010-07-13 Trubion Pharmaceuticals, Inc. Binding domain-immunoglobulin fusion proteins
US7666674B2 (en) 2001-07-27 2010-02-23 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of sterically stabilized cationic liposomes to efficiently deliver CPG oligonucleotides in vivo
BR0211614A (en) * 2001-08-03 2006-10-31 Genentech Inc tacis and br3 polypeptide and their uses
CA2456193A1 (en) * 2001-08-03 2003-03-27 Medarex, Inc. Compositions comprising immunostimulatory oligonucleotides and uses thereof to enhance fc receptor-mediated immunotherapies
WO2003020884A2 (en) * 2001-08-14 2003-03-13 The Government Of The United States Of America As Represented By The Secretary Of Health And Human Services Method for rapid generation of mature dendritic cells
ATE411054T1 (en) * 2001-08-17 2008-10-15 Coley Pharm Gmbh COMBINATION MOTIF-IMMUNO-STIMULATING OLIGONUCLEOTIDES WITH IMPROVED EFFECT
JP2005501917A (en) * 2001-09-07 2005-01-20 ザ トラスティーズ オブ ボストン ユニバーシティ Methods and compositions for treating immune complex related diseases
CN1633598A (en) * 2001-10-05 2005-06-29 科勒制药股份公司 Toll-like receptor 3 signaling agonists and antagonists
US20030139364A1 (en) * 2001-10-12 2003-07-24 University Of Iowa Research Foundation Methods and products for enhancing immune responses using imidazoquinoline compounds
WO2003054161A2 (en) 2001-12-20 2003-07-03 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services USE OF CpG OLIGODEOXYNUCLEOTIDES TO INDUCE ANGIOGENESIS
US8466116B2 (en) 2001-12-20 2013-06-18 The Unites States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of CpG oligodeoxynucleotides to induce epithelial cell growth
WO2003066649A1 (en) 2002-02-04 2003-08-14 Biomira Inc. Immunostimulatory, covalently lipidated oligonucleotides
US8088388B2 (en) * 2002-02-14 2012-01-03 United Biomedical, Inc. Stabilized synthetic immunogen delivery system
EP3006043B1 (en) * 2002-04-04 2019-05-29 Zoetis Belgium S.A. Immunostimulatory g,u-containing oligoribonucleotides
US7968569B2 (en) * 2002-05-17 2011-06-28 Celgene Corporation Methods for treatment of multiple myeloma using 3-(4-amino-1-oxo-1,3-dihydro-isoindol-2-yl)-piperidine-2,6-dione
US20040009949A1 (en) * 2002-06-05 2004-01-15 Coley Pharmaceutical Group, Inc. Method for treating autoimmune or inflammatory diseases with combinations of inhibitory oligonucleotides and small molecule antagonists of immunostimulatory CpG nucleic acids
WO2004003545A1 (en) * 2002-07-01 2004-01-08 Tufts University Methods and compositions for inhibition of multi-drug resistance by hyaluronan oligomers
US20040053880A1 (en) * 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7807803B2 (en) 2002-07-03 2010-10-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7605138B2 (en) * 2002-07-03 2009-10-20 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7569553B2 (en) * 2002-07-03 2009-08-04 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7576066B2 (en) 2002-07-03 2009-08-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
WO2004011611A2 (en) * 2002-07-25 2004-02-05 Genentech, Inc. Taci antibodies and uses thereof
SG166673A1 (en) * 2002-08-19 2010-12-29 Coley Pharm Group Inc Immunostimulatory nucleic acids
AR040996A1 (en) * 2002-08-19 2005-04-27 Coley Pharm Group Inc IMMUNE STIMULATING NUCLEIC ACIDS
FR2844455B1 (en) * 2002-09-13 2007-12-14 Lab Francais Du Fractionnement TREATMENT OF PATHOLOGIES EXCLUDING IMMUNE RESPONSE BY OPTIMIZED ANTIBODIES
US8263091B2 (en) * 2002-09-18 2012-09-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating and preventing infections in immunocompromised subjects with immunostimulatory CpG oligonucleotides
BRPI0315295C1 (en) 2002-10-17 2021-05-25 Genmab As isolated human monoclonal antibody, prokaryotic host cell, pharmaceutical composition, bispecific molecule, uses of an antibody, in vitro methods of detecting the presence of cd20 antigen or a cell expressing cd20 in a sample, kit, and expression vector
CN1753687A (en) * 2002-10-29 2006-03-29 科勒制药集团股份有限公司 Application of CPG oligonucleotide in the treatment of hepatitis C virus infection
CA2502015A1 (en) 2002-12-11 2004-06-24 Coley Pharmaceutical Group, Inc. 5' cpg nucleic acids and methods of use
TWI335821B (en) * 2002-12-16 2011-01-11 Genentech Inc Immunoglobulin variants and uses thereof
KR20050109958A (en) * 2003-03-04 2005-11-22 가부시키가이샤 소세이 Gm-95-containing antitumor effect potentiator, combined antitumor preparation and antitumor agent
AU2004226605A1 (en) * 2003-04-02 2004-10-14 Coley Pharmaceutical Group, Ltd. Immunostimulatory nucleic acid oil-in-water formulations for topical application
EP1638607A1 (en) * 2003-04-08 2006-03-29 Progenics Pharmaceuticals, Inc. Combination therapy for constipation comprising a laxative and a peripheral opioid antagonist
MXPA05010819A (en) * 2003-04-08 2006-03-30 Progenics Pharm Inc The use of peripheral opiois antagonists, especially methylnaltrexone to treat irritable bowel syndrome.
CA2811272C (en) * 2003-04-08 2016-12-20 Progenics Pharmaceuticals, Inc. Pharmaceutical formulations containing methylnaltrexone
EP1613350B1 (en) * 2003-04-09 2009-03-18 Genentech, Inc. Therapy of autoimmune disease in a patient with an inadequate response to a tnf-alpha inhibitor
MXPA05012421A (en) * 2003-05-16 2006-02-22 Hybridon Inc Synergistic treatment of cancer using immunomers in conjunction with chemotherapeutic agents.
US20050163775A1 (en) * 2003-06-05 2005-07-28 Genentech, Inc. Combination therapy for B cell disorders
JP2007526220A (en) 2003-06-05 2007-09-13 ジェネンテック・インコーポレーテッド Combination therapy for B cell disease
MXPA05013922A (en) * 2003-06-20 2006-02-24 Coley Pharm Group Inc Small molecule toll-like receptor (tlr) antagonists.
US20050013812A1 (en) * 2003-07-14 2005-01-20 Dow Steven W. Vaccines using pattern recognition receptor-ligand:lipid complexes
US20050032130A1 (en) * 2003-07-29 2005-02-10 Genentech, Inc. Neutralizing antibody assay and uses therefor
MXPA06002134A (en) * 2003-08-29 2006-05-31 Genentech Inc Anti-cd20 therapy of ocular disorders.
AU2004275876B2 (en) * 2003-09-25 2011-03-31 Coley Pharmaceutical Gmbh Nucleic acid-lipophilic conjugates
CA2542099A1 (en) * 2003-10-11 2005-04-21 Inex Pharmaceuticals Corporation Methods and compositions for enhancing innate immunity and antibody dependent cellular cytotoxicity
EP1678303A2 (en) * 2003-10-30 2006-07-12 Coley Pharmaceutical GmbH C-class oligonucleotide analogs with enhanced immunostimulatory potency
US20050239733A1 (en) * 2003-10-31 2005-10-27 Coley Pharmaceutical Gmbh Sequence requirements for inhibitory oligonucleotides
US20050100983A1 (en) * 2003-11-06 2005-05-12 Coley Pharmaceutical Gmbh Cell-free methods for identifying compounds that affect toll-like receptor 9 (TLR9) signaling
US9050378B2 (en) 2003-12-10 2015-06-09 Board Of Regents, The University Of Texas System N2S2 chelate-targeting ligand conjugates
WO2005059133A2 (en) * 2003-12-19 2005-06-30 Antisense Pharma Gmbh Combination therapy associating a tgf-breta antagonist with a chemiotherapeutic agent
KR20060107555A (en) * 2003-12-19 2006-10-13 제넨테크, 인크. Detection of CD20 in Transplant Rejection
CN1917901A (en) * 2003-12-19 2007-02-21 健泰科生物技术公司 Detection of cd20 in therapy of autoimmune diseases
JP2007526253A (en) * 2004-02-19 2007-09-13 コーリー ファーマシューティカル グループ,インコーポレイテッド Immunostimulatory viral RNA oligonucleotide
TWI235440B (en) * 2004-03-31 2005-07-01 Advanced Semiconductor Eng Method for making leadless semiconductor package
JP2007531746A (en) * 2004-04-02 2007-11-08 コーリー ファーマシューティカル グループ,インコーポレイテッド Immunostimulatory nucleic acid for inducing an IL-10 response
CA2563432A1 (en) * 2004-04-16 2005-12-01 Genentech, Inc. Method for augmenting b cell depletion
US7850962B2 (en) 2004-04-20 2010-12-14 Genmab A/S Human monoclonal antibodies against CD20
ZA200608982B (en) * 2004-05-05 2008-06-25 Genentech Inc Preventing autoimmune disease by using an anti-CD20 antibody
US7531628B2 (en) * 2004-05-28 2009-05-12 Idexx Laboratories, Inc. Canine CD20 compositions
MXPA06014067A (en) * 2004-06-04 2007-02-15 Genentech Inc Method for treating lupus.
AU2005249566B2 (en) * 2004-06-04 2010-11-11 Genentech, Inc. Method for treating multiple sclerosis
US20060287263A1 (en) * 2004-07-18 2006-12-21 Csl Limited Methods and compositions for inducing antigen-specific immune responses
BRPI0513100A (en) * 2004-07-22 2007-10-23 Genentech Inc methods of treating sjígren's syndrome and manufactured articles
BRPI0516297A (en) * 2004-10-05 2008-09-02 Genentech Inc Vasculitis treatment methods and articles of manufacture
MY159370A (en) * 2004-10-20 2016-12-30 Coley Pharm Group Inc Semi-soft-class immunostimulatory oligonucleotides
CA2586913A1 (en) * 2004-11-09 2006-05-18 University Of Southern California Targeted innate immunity
TW200637574A (en) * 2005-01-13 2006-11-01 Genentech Inc Treatment method
EP1845989A1 (en) * 2005-01-20 2007-10-24 Progenics Pharmaceuticals, Inc. Use of methylnaltrexone and related compounds to treat post-operative gastrointestinal dysfunction
DOP2006000029A (en) * 2005-02-07 2006-08-15 Genentech Inc ANTIBODY VARIANTS AND USES THEREOF. (VARIATIONS OF AN ANTIBODY AND USES OF THE SAME)
US8444973B2 (en) 2005-02-15 2013-05-21 Duke University Anti-CD19 antibodies and uses in B cell disorders
HUE025945T2 (en) * 2005-02-15 2016-07-28 Univ Duke Anti-cd19 antibodies and uses in oncology
US20080009455A9 (en) * 2005-02-24 2008-01-10 Coley Pharmaceutical Group, Inc. Immunostimulatory oligonucleotides
TW200714289A (en) * 2005-02-28 2007-04-16 Genentech Inc Treatment of bone disorders
SI1859793T1 (en) * 2005-02-28 2011-08-31 Eisai R&D Man Co Ltd Novel combinational use of a sulfonamide compound in the treatment of cancer
ES2714198T3 (en) * 2005-03-07 2019-05-27 Univ Chicago Use of opioid antagonists to attenuate the proliferation and migration of endothelial cells
US8524731B2 (en) * 2005-03-07 2013-09-03 The University Of Chicago Use of opioid antagonists to attenuate endothelial cell proliferation and migration
US9662325B2 (en) 2005-03-07 2017-05-30 The University Of Chicago Use of opioid antagonists to attenuate endothelial cell proliferation and migration
US8518962B2 (en) 2005-03-07 2013-08-27 The University Of Chicago Use of opioid antagonists
JP2008535859A (en) * 2005-04-08 2008-09-04 コーリー ファーマシューティカル グループ,インコーポレイテッド Methods for treating asthma exacerbated by infection
AR053579A1 (en) * 2005-04-15 2007-05-09 Genentech Inc TREATMENT OF INTESTINAL INFLAMMATORY DISEASE (IBD)
AU2006241149A1 (en) * 2005-04-26 2006-11-02 Coley Pharmaceutical Gmbh Modified oligoribonucleotide analogs with enhanced immunostimulatory activity
EP1885755A4 (en) * 2005-05-05 2009-07-29 Univ Duke TREATMENTS OF AUTOIMMUNE DISEASES BY ANTI-CD19 ANTIBODIES
CN1865275B (en) 2005-05-17 2011-06-15 长春华普生物技术有限公司 Artificial single-chain deoxynucleotide having therapeutic effect to human B cell tumour
ZA200709956B (en) * 2005-05-20 2009-02-25 Genentech Inc Pretreatment of a biological sample from an autoimmune disease subject
AR057035A1 (en) 2005-05-25 2007-11-14 Progenics Pharm Inc SYNTHESIS OF (R) -N-METHYLNTREXONE, PHARMACEUTICAL COMPOSITIONS AND USES
AR057325A1 (en) 2005-05-25 2007-11-28 Progenics Pharm Inc SYNTHESIS OF (S) -N-METHYLNTREXONE, PHARMACEUTICAL COMPOSITIONS AND USES
US20080194611A1 (en) * 2005-06-03 2008-08-14 Alverdy John C Modulation of Cell Barrier Dysfunction
ATE439135T1 (en) 2005-07-01 2009-08-15 Index Pharmaceuticals Ab MODULATION OF RESPONSE TO STEROIDS
AU2006266503B2 (en) 2005-07-01 2011-12-08 Index Pharmaceuticals Ab Immunostimulatory method
KR20080030656A (en) * 2005-07-07 2008-04-04 콜레이 파마시티컬 그룹, 인코포레이티드 Combination therapy of anti-CTLA-4 antibody and CVII-motif-containing oligodeoxynucleotide for the treatment of cancer
RU2423381C2 (en) * 2005-07-25 2011-07-10 Трабьон Фармасьютикалз, Инк. Decreasing b-cell count with using cd37-specific and cd20-specific binding molecules
RU2421242C2 (en) 2005-07-25 2011-06-20 Трабьон Фармасьютикалз, Инк. Application of single dose of cd20-specific binding molecules
US20080279850A1 (en) * 2005-07-25 2008-11-13 Trubion Pharmaceuticals, Inc. B-Cell Reduction Using CD37-Specific and CD20-Specific Binding Molecules
US20090214578A1 (en) * 2005-09-16 2009-08-27 Coley Pharmaceutical Gmbh Immunostimulatory Single-Stranded Ribonucleic Acid with Phosphodiester Backbone
CN101321868A (en) * 2005-09-16 2008-12-10 科利制药公司 Modulation of the immunostimulatory properties of short interfering ribonucleic acids (siRNAs) by nucleotide modifications
AU2006306805A1 (en) 2005-10-28 2007-05-03 Index Pharmaceuticals Ab Composition and method for the prevention, treatment and/or alleviation of an inflammatory disease
GB0523041D0 (en) * 2005-11-11 2005-12-21 Cyclacel Ltd Combination
MY149159A (en) 2005-11-15 2013-07-31 Hoffmann La Roche Method for treating joint damage
ES2618543T3 (en) * 2005-11-23 2017-06-21 Genentech, Inc. Methods and compositions related to B lymphocyte assays
JP4538522B2 (en) * 2005-11-25 2010-09-08 コーリー ファーマシューティカル ゲーエムベーハー Immunostimulatory oligoribonucleotides
DK2405002T3 (en) * 2006-02-15 2015-01-05 Adiutide Pharmaceuticals Gmbh Compositions and methods for oligonukleotidformuleringer
NZ573646A (en) * 2006-06-12 2012-04-27 Wyeth Llc Single-chain multivalent binding proteins with effector function
US20080031887A1 (en) * 2006-06-30 2008-02-07 Joseph Lustgarten Conjugates for inducing targeted immune responses and methods of making and using same
DE102006035618A1 (en) * 2006-07-31 2008-02-07 Curevac Gmbh Nucleic acid of the formula (I): GlXmGn, in particular as immunostimulating adjuvant
EP2046954A2 (en) * 2006-07-31 2009-04-15 Curevac GmbH NUCLEIC ACID OF FORMULA (I): GIXmGn, OR (II): CIXmCn, IN PARTICULAR AS AN IMMUNE-STIMULATING AGENT/ADJUVANT
TWI489984B (en) 2006-08-04 2015-07-01 Wyeth Corp Formulations for parenteral delivery of compounds and uses thereof
PL2383297T3 (en) 2006-08-14 2013-06-28 Xencor Inc Optimized antibodies that target CD19
TW200817048A (en) * 2006-09-08 2008-04-16 Wyeth Corp Dry powder compound formulations and uses thereof
PT2078080E (en) 2006-09-27 2015-09-18 Coley Pharm Gmbh Cpg oligonucleotide analogs containing hydrophobic t analogs with enhanced immunostimulatory activity
US10925977B2 (en) 2006-10-05 2021-02-23 Ceil>Point, LLC Efficient synthesis of chelators for nuclear imaging and radiotherapy: compositions and applications
US20090142362A1 (en) * 2006-11-06 2009-06-04 Avant Immunotherapeutics, Inc. Peptide-based vaccine compositions to endogenous cholesteryl ester transfer protein (CETP)
GB0625283D0 (en) 2006-12-19 2007-01-24 Cyclacel Ltd Combination
PL2137191T3 (en) * 2007-03-29 2016-12-30 Peripheral opioid receptor antagonists and uses thereof
JP2010522756A (en) * 2007-03-29 2010-07-08 プロジェニックス ファーマシューティカルズ,インコーポレーテッド Crystal form and its use
EP2565195B1 (en) * 2007-03-29 2015-05-06 Wyeth LLC Peripheral opioid receptor and antagonists and uses thereof
JP2010525046A (en) * 2007-04-27 2010-07-22 アストラゼネカ アクチボラグ Methods for the treatment of hematological tumors
ES2581480T3 (en) * 2007-05-04 2016-09-06 Index Pharmaceuticals Ab Tumor growth inhibitor compounds and methods of use thereof
KR102055873B1 (en) 2007-07-09 2019-12-13 제넨테크, 인크. Prevention of disulfide bond reduction during recombinant production of polypeptides
WO2009030254A1 (en) 2007-09-04 2009-03-12 Curevac Gmbh Complexes of rna and cationic peptides for transfection and for immunostimulation
JP2010538762A (en) * 2007-09-13 2010-12-16 モレキュラ インサイト ファーマシューティカルズ インコーポレイテッド Infusion and transfer systems for use with radioactive materials
HUE030134T2 (en) 2007-10-16 2017-04-28 Zymogenetics Inc Combination of transmembrane activator and calcium modulator and cyclophilin ligand interactor (TACI) and anti-CD20 agents for treatment of autoimmune disease
EP2077281A1 (en) 2008-01-02 2009-07-08 Bergen Teknologioverforing AS Anti-CD20 antibodies or fragments thereof for the treatment of chronic fatigue syndrome
DK2176408T5 (en) 2008-01-31 2015-12-14 Curevac Gmbh Nucleic acids comprising FORMULA (NuGiXmGnNv) a AND DERIVATIVES AS IMMUNE STIMULATING AGENTS / ADJUVANTS.
AU2008349873B2 (en) 2008-02-06 2014-02-13 Progenics Pharmaceuticals, Inc. Preparation and use of (R),(R)-2,2'-bis-methylnaltrexone
CA2719134C (en) 2008-03-21 2015-06-30 The University Of Chicago Treatment with opioid antagonists and mtor inhibitors
RU2531754C2 (en) 2008-04-11 2014-10-27 ЭМЕРДЖЕНТ ПРОДАКТ ДИВЕЛОПМЕНТ СИЭТЛ,ЭлЭлСи,US Immunotherapeutic agent combined with cd37, and its combination with bifunctional chemotherapeutic agent
US9669057B2 (en) 2008-04-25 2017-06-06 Duke University Regulatory B cells and their uses
AU2009259136B2 (en) 2008-06-09 2014-09-25 Cyclacel Limited Combinations of sapacitabine or CNDAC with DNA methyltransferase inhibitors such as decitabine and procaine
CA2728276A1 (en) * 2008-06-18 2009-12-23 Index Pharmaceuticals Ab Combination therapies against cancer
TWI351288B (en) * 2008-07-04 2011-11-01 Univ Nat Pingtung Sci & Tech Cpg dna adjuvant in avian vaccines
AU2009288730B2 (en) * 2008-08-25 2013-06-20 Amplimmune, Inc. Compositions of PD-1 antagonists and methods of use
AR073295A1 (en) 2008-09-16 2010-10-28 Genentech Inc METHODS TO TREAT PROGRESSIVE MULTIPLE SCLEROSIS. MANUFACTURING ARTICLE.
CA2676881C (en) 2008-09-30 2017-04-25 Wyeth Peripheral opioid receptor antagonists and uses thereof
WO2010037408A1 (en) 2008-09-30 2010-04-08 Curevac Gmbh Composition comprising a complexed (m)rna and a naked mrna for providing or enhancing an immunostimulatory response in a mammal and uses thereof
US20110280934A1 (en) * 2008-11-04 2011-11-17 Asa Karlsson Increased Expression of Specific Antigens
WO2010075249A2 (en) 2008-12-22 2010-07-01 Genentech, Inc. A method for treating rheumatoid arthritis with b-cell antagonists
CN103800906B (en) 2009-03-25 2017-09-22 德克萨斯大学系统董事会 For stimulating mammal to the composition of the congenital immunity resistance of pathogen
WO2010132622A2 (en) * 2009-05-14 2010-11-18 The Regents Of The University Of California Anticd20-cpg conjugates and methods of treating b cell malignancies
HRP20200768T4 (en) 2009-08-11 2025-03-28 F. Hoffmann - La Roche Ag PRODUCTION OF PROTEIN IN CELL GROWTH MEDIA WITHOUT GLUTAMINE
US20110053829A1 (en) 2009-09-03 2011-03-03 Curevac Gmbh Disulfide-linked polyethyleneglycol/peptide conjugates for the transfection of nucleic acids
KR20130009760A (en) 2010-02-10 2013-01-23 이뮤노젠 아이엔씨 Cd20 antibodies and uses thereof
US20130224237A1 (en) * 2010-07-20 2013-08-29 University Of Miami Inhibition of nonsense mediated decay pathways
KR101761388B1 (en) 2010-07-30 2017-07-25 큐어백 아게 Complexation of nucleic acids with disulfide-crosslinked cationic components for transfection and immunostimulation
EP2600878A4 (en) 2010-08-04 2014-06-11 Univ Duke REGULATORY B LYMPHOCYTES AND USES THEREOF
WO2012064671A1 (en) * 2010-11-08 2012-05-18 The Ohio State University Research Foundation Compositions and methods for increasing drug efficacy in cancer
WO2012088272A1 (en) * 2010-12-21 2012-06-28 Duke University Methods and compositions combining immunotherapy with monocyte activation
JP5930146B2 (en) * 2011-03-28 2016-06-08 国立研究開発法人物質・材料研究機構 Immunostimulatory oligonucleotide and therapeutic agent comprising said immunostimulatory oligonucleotide
PL2696878T3 (en) 2011-04-14 2020-01-31 Cyclacel Limited Dosage regimen for sapacitabine and decitabine in combination for treating acute myeloid leukemia
US20130157261A1 (en) * 2011-06-01 2013-06-20 The Methodist Hospital Research Institute Compositions and Methods for Quantitative Histology, Calibration of Images in Fluorescence Microscopy, and ddTUNEL Analyses
WO2013113326A1 (en) 2012-01-31 2013-08-08 Curevac Gmbh Pharmaceutical composition comprising a polymeric carrier cargo complex and at least one protein or peptide antigen
US10017739B2 (en) 2012-09-06 2018-07-10 Duke University Methods of expanding and assessing B cells and using expanded B cells to treat disease
BR112016003361A2 (en) 2013-08-21 2017-11-21 Curevac Ag respiratory syncytial virus vaccine (rsv)
US10436680B2 (en) 2013-10-15 2019-10-08 Kianoosh Peyvan Capture, disruption, and extraction apparatus and method
AU2015209277B2 (en) * 2014-01-22 2020-09-03 The Board Of Trustees Of The Leland Stanford Junior University Methods and compositions for antibody and antibody-loaded dendritic cell mediated therapy
US10369216B2 (en) 2014-04-01 2019-08-06 Curevac Ag Polymeric carrier cargo complex for use as an immunostimulating agent or as an adjuvant
WO2016044839A2 (en) 2014-09-19 2016-03-24 The Board Of Regents Of The University Of Texas System Compositions and methods for treating viral infections through stimulated innate immunity in combination with antiviral compounds
HUE057952T2 (en) 2015-06-24 2022-06-28 Hoffmann La Roche Anti-transferrin receptor antibodies with customized affinity
WO2017053469A2 (en) 2015-09-21 2017-03-30 Aptevo Research And Development Llc Cd3 binding polypeptides
AR106189A1 (en) 2015-10-02 2017-12-20 Hoffmann La Roche BIESPECTIFIC ANTIBODIES AGAINST HUMAN A-b AND THE HUMAN TRANSFERRINE RECEIVER AND METHODS OF USE
TWI873952B (en) 2015-10-02 2025-02-21 瑞士商赫孚孟拉羅股份公司 Bispecific anti-human cd20/human transferrin receptor antibodies and methods of use
AU2016341208A1 (en) * 2015-10-20 2018-05-10 Sorrento Therapeutics, Inc. Intracellular delivery compounds
US20190185852A1 (en) * 2016-05-05 2019-06-20 M. Mahmood Hussain Therapeutically modulating apob and apoai
CN109843327B (en) 2016-07-07 2022-05-13 小利兰·斯坦福大学托管委员会 Antibody adjuvant conjugates
WO2018112407A1 (en) 2016-12-15 2018-06-21 Duke University Antibodies and methods for depleting regulatory b10 cells and use in combination with immune checkpoint inhibitors
MX2019012295A (en) 2017-04-14 2020-02-07 Tollnine Inc Immunomodulating polynucleotides, antibody conjugates thereof, and methods of their use.
MY206158A (en) 2017-05-24 2024-12-02 Novartis Ag Antibody-cytokine engrafted proteins and methods of use in the treatment of cancer
WO2020190725A1 (en) 2019-03-15 2020-09-24 Bolt Biotherapeutics, Inc. Immunoconjugates targeting her2
CN111826764B (en) * 2020-07-28 2021-10-15 吴忠德悦纺织科技有限公司 A kind of preparation method of modified multi-component composite yarn
KR20230166090A (en) * 2021-04-06 2023-12-06 테네오바이오, 인코포레이티드 Anti-CD19 antibody and CAR-T construct
CN114216985A (en) * 2021-12-22 2022-03-22 珠海润都制药股份有限公司 Method for testing diisopropyl sulfate in isosorbide
CN118162136A (en) * 2023-11-15 2024-06-11 陕西师范大学 SiO2@Cu2GaBO5@TiO2 microsphere heterojunction photocatalytic material and photocatalytic hydrogen production and formaldehyde application

Family Cites Families (121)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3854480A (en) 1969-04-01 1974-12-17 Alza Corp Drug-delivery system
US3906092A (en) 1971-11-26 1975-09-16 Merck & Co Inc Stimulation of antibody response
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4675189A (en) 1980-11-18 1987-06-23 Syntex (U.S.A.) Inc. Microencapsulation of water soluble active polypeptides
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
DE3280400D1 (en) 1981-10-23 1992-06-04 Molecular Biosystems Inc OLIGONUCLEOTIDES MEDICINE AND THEIR PRODUCTION METHOD.
US4452775A (en) 1982-12-03 1984-06-05 Syntex (U.S.A.) Inc. Cholesterol matrix delivery system for sustained release of macromolecules
FR2596144B1 (en) 1986-03-24 1988-05-27 Jouet Etienne SPIRAL HEAT EXCHANGER AND MANUFACTURING METHOD THEREOF
US5567610A (en) 1986-09-04 1996-10-22 Bioinvent International Ab Method of producing human monoclonal antibodies and kit therefor
US5565354A (en) 1986-09-05 1996-10-15 Sandoz Ltd. Production of human monoclonal antibodies specific for hepatitis B surface antigen
US5075109A (en) 1986-10-24 1991-12-24 Southern Research Institute Method of potentiating an immune response
ES2020603B3 (en) 1987-07-23 1991-08-16 Uop (A New York General Partnership) TREATMENT OF A TEMPERATURE SENSITIVE HYDROCARBONACEOUS EFFLUENT CONTAINING A NON-DISTILLABLE COMPONENT
US6214804B1 (en) 1989-03-21 2001-04-10 Vical Incorporated Induction of a protective immune response in a mammal by injecting a DNA sequence
US5133974A (en) 1989-05-05 1992-07-28 Kv Pharmaceutical Company Extended release pharmaceutical formulations
US5786189A (en) 1989-11-29 1998-07-28 Smithkline Beecham Biologicals (S.A.) Vaccine
US5506212A (en) 1990-01-11 1996-04-09 Isis Pharmaceuticals, Inc. Oligonucleotides with substantially chirally pure phosphorothioate linkages
US5212295A (en) 1990-01-11 1993-05-18 Isis Pharmaceuticals Monomers for preparation of oligonucleotides having chiral phosphorus linkages
US5248670A (en) 1990-02-26 1993-09-28 Isis Pharmaceuticals, Inc. Antisense oligonucleotides for inhibiting herpesviruses
US5514577A (en) 1990-02-26 1996-05-07 Isis Pharmaceuticals, Inc. Oligonucleotide therapies for modulating the effects of herpes viruses
EP0468520A3 (en) 1990-07-27 1992-07-01 Mitsui Toatsu Chemicals, Inc. Immunostimulatory remedies containing palindromic dna sequences
ES2104717T3 (en) 1990-08-16 1997-10-16 Isis Pharmaceuticals Inc OLIGONUCLEOTIDES TO MODULATE THE EFFECTS OF CYTOMEGALOVIRUS INFECTIONS.
ATE158021T1 (en) 1990-08-29 1997-09-15 Genpharm Int PRODUCTION AND USE OF NON-HUMAN TRANSGENT ANIMALS FOR THE PRODUCTION OF HETEROLOGUE ANTIBODIES
GB9019812D0 (en) 1990-09-11 1990-10-24 Scotgen Ltd Novel antibodies for treatment and prevention of infection in animals and man
US5208146A (en) * 1990-11-05 1993-05-04 The Regents Of The University Of California Murine monoclonal anti-idiotype antibodies
US5512668A (en) 1991-03-06 1996-04-30 Polish Academy Of Sciences Solid phase oligonucleotide synthesis using phospholane intermediates
CA2106386A1 (en) 1991-04-18 1992-10-19 Barbara C. F. Chu Oligodeoxynucleotides and oligonucleotides useful as decoys for proteins which selectively bind to defined dna sequences
JPH06507911A (en) 1991-05-31 1994-09-08 ジンタ・インコーポレイテッド Composition and delivery system for transdermal administration of neutral oligomers
US5359052A (en) 1991-08-05 1994-10-25 Polish Academy Of Sciences Chalcophospholanes useful in the synthesis of oligonucleoside phosphorothioates, phosphorodithioates and related selenates
US5599797A (en) 1991-10-15 1997-02-04 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5407686A (en) 1991-11-27 1995-04-18 Sidmak Laboratories, Inc. Sustained release composition for oral administration of active ingredient
US5585479A (en) 1992-07-24 1996-12-17 The United States Of America As Represented By The Secretary Of The Navy Antisense oligonucleotides directed against human ELAM-I RNA
US6015886A (en) 1993-05-24 2000-01-18 Chemgenes Corporation Oligonucleotide phosphate esters
US5679647A (en) 1993-08-26 1997-10-21 The Regents Of The University Of California Methods and devices for immunizing a host against tumor-associated antigens through administration of naked polynucleotides which encode tumor-associated antigenic peptides
US5849719A (en) 1993-08-26 1998-12-15 The Regents Of The University Of California Method for treating allergic lung disease
EP0714308A4 (en) 1993-08-26 1998-07-29 Univ California METHOD, COMPOSITIONS AND DEVICES FOR THE DELIVERY OF NAKED POLYNUCLEOTIDES THAT ENCODE BIOLOGICALLY ACTIVE PEPTIDES
NZ276968A (en) 1993-11-16 1998-04-27 Genta Inc Synthetic oligomers enriched for phosphonate internucleosidyl linkages of preselected chirality and their preparation
US6727230B1 (en) * 1994-03-25 2004-04-27 Coley Pharmaceutical Group, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
WO1995026204A1 (en) 1994-03-25 1995-10-05 Isis Pharmaceuticals, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US5534615A (en) 1994-04-25 1996-07-09 Genentech, Inc. Cardiac hypertrophy factor and uses therefor
US20030050263A1 (en) * 1994-07-15 2003-03-13 The University Of Iowa Research Foundation Methods and products for treating HIV infection
US6239116B1 (en) * 1994-07-15 2001-05-29 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7935675B1 (en) * 1994-07-15 2011-05-03 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6429199B1 (en) * 1994-07-15 2002-08-06 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
EP1167379A3 (en) 1994-07-15 2004-09-08 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US6207646B1 (en) * 1994-07-15 2001-03-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20030026782A1 (en) 1995-02-07 2003-02-06 Arthur M. Krieg Immunomodulatory oligonucleotides
WO1996002560A1 (en) 1994-07-18 1996-02-01 University Of North Carolina At Chapel Hill Oligonucleoside compounds and methods for inhibiting tumor growth, invasion and metastasis
ATE271128T1 (en) 1995-05-11 2004-07-15 Applied Research Systems INHIBITORS OF IL-6 ACTIVITY
US5736152A (en) 1995-10-27 1998-04-07 Atrix Laboratories, Inc. Non-polymeric sustained release delivery system
US5969135A (en) * 1995-11-02 1999-10-19 Icn Pharmaceuticals, Inc. Oligonucleotide analogs with an amino acid or a modified amino alcohol residue
US5780448A (en) 1995-11-07 1998-07-14 Ottawa Civic Hospital Loeb Research DNA-based vaccination of fish
CA2244946C (en) 1996-01-30 2010-04-13 The Regents Of The University Of California Gene expression vectors which generate an antigen specific immune response and methods of using the same
US5856465A (en) 1996-05-24 1999-01-05 Polska Akademia Nauk Centrum Badan Molekularnych I Makromolekularnych Compositions and methods for the synthesis of chirally pure organophosphorus nucleoside derivatives
ATE292980T1 (en) 1996-10-11 2005-04-15 Univ California IMMUNO-STIMULATING OLIGONUCLEOTIDE CONJUGATES
EP0855184A1 (en) 1997-01-23 1998-07-29 Grayson B. Dr. Lipford Pharmaceutical composition comprising a polynucleotide and an antigen especially for vaccination
WO1998037919A1 (en) 1997-02-28 1998-09-03 University Of Iowa Research Foundation USE OF NUCLEIC ACIDS CONTAINING UNMETHYLATED CpG DINUCLEOTIDE IN THE TREATMENT OF LPS-ASSOCIATED DISORDERS
DK1005368T3 (en) * 1997-03-10 2010-01-04 Ottawa Hospital Res Inst Use of nucleic acids containing non-methylated CpG dinucleotide in combination with alum as adjuvants
US6406705B1 (en) 1997-03-10 2002-06-18 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US6306393B1 (en) * 1997-03-24 2001-10-23 Immunomedics, Inc. Immunotherapy of B-cell malignancies using anti-CD22 antibodies
US6183744B1 (en) * 1997-03-24 2001-02-06 Immunomedics, Inc. Immunotherapy of B-cell malignancies using anti-CD22 antibodies
EP1003531B1 (en) 1997-05-20 2007-08-22 Ottawa Health Research Institute Processes for preparing nucleic acid constructs
EP1003850B1 (en) 1997-06-06 2009-05-27 The Regents of the University of California Inhibitors of dna immunostimulatory sequence activity
WO1999001154A1 (en) 1997-07-03 1999-01-14 University Of Iowa Research Foundation Method for inhibiting immunostimulatory dna associated responses
AU760549B2 (en) 1998-04-03 2003-05-15 University Of Iowa Research Foundation, The Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
CA2328602A1 (en) 1998-05-06 1999-11-11 University Of Iowa Research Foundation Methods for the prevention and treatment of parasitic infections and related diseases using cpg oligonucleotides
JP2002514397A (en) 1998-05-14 2002-05-21 コーリー ファーマシューティカル ゲーエムベーハー Methods for hematopoietic regulation using CpG oligonucleotides
SI1077722T1 (en) 1998-05-22 2007-02-28 Ottawa Health Research Inst Methods and products for inducing mucosal immunity
JP2002521489A (en) 1998-07-27 2002-07-16 ユニバーシティ オブ アイオワ リサーチ ファウンデーション Stereoisomers of CpG oligonucleotides and related methods
PT1974747E (en) * 1998-08-11 2012-09-05 Biogen Idec Inc Combination therapies for b-cell lymphomas comprising administration of anti-cd20 antibody
WO2000014217A2 (en) 1998-09-03 2000-03-16 Coley Pharmaceutical Gmbh G-motif oligonucleotides and uses thereof
ES2543819T3 (en) * 1998-11-09 2015-08-24 Biogen Inc. Treatment of hematologic malignancies associated with circulating tumor cells using chimeric antibody directed against CD20
EP1177439B1 (en) 1999-04-29 2004-09-08 Coley Pharmaceutical GmbH Screening for immunostimulatory dna functional modifiers
US6946129B1 (en) 1999-06-08 2005-09-20 Seattle Genetics, Inc. Recombinant anti-CD40 antibody and uses thereof
JP2003519417A (en) * 1999-06-23 2003-06-17 データム・インコーポレイテツド System and method for providing a trusted third party clock and a trusted local clock
NZ517929A (en) 1999-09-25 2004-02-27 Univ Iowa Res Found Immunostimulatory nucleic acids
US6949520B1 (en) 1999-09-27 2005-09-27 Coley Pharmaceutical Group, Inc. Methods related to immunostimulatory nucleic acid-induced interferon
US20010044416A1 (en) 2000-01-20 2001-11-22 Mccluskie Michael J. Immunostimulatory nucleic acids for inducing a Th2 immune response
US7585847B2 (en) * 2000-02-03 2009-09-08 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20020156033A1 (en) * 2000-03-03 2002-10-24 Bratzler Robert L. Immunostimulatory nucleic acids and cancer medicament combination therapy for the treatment of cancer
US20040131628A1 (en) * 2000-03-08 2004-07-08 Bratzler Robert L. Nucleic acids for the treatment of disorders associated with microorganisms
US20020091097A1 (en) * 2000-09-07 2002-07-11 Bratzler Robert L. Nucleic acids for the prevention and treatment of sexually transmitted diseases
JP2005500806A (en) * 2000-09-15 2005-01-13 コーリー ファーマシューティカル ゲーエムベーハー Process for high-throughput screening of immune agonist / immunoantagonists based on CpG
ES2307568T3 (en) * 2000-12-08 2008-12-01 Coley Pharmaceutical Gmbh CPG TYPE NUCLEIC ACIDS AND SAME USE METHODS.
WO2002053141A2 (en) * 2000-12-14 2002-07-11 Coley Pharmaceutical Group, Inc. Inhibition of angiogenesis by nucleic acids
US20030050268A1 (en) * 2001-03-29 2003-03-13 Krieg Arthur M. Immunostimulatory nucleic acid for treatment of non-allergic inflammatory diseases
US20030148316A1 (en) * 2001-08-01 2003-08-07 Lipford Grayson B. Methods and compositions relating to plasmacytoid dendritic cells
ATE411054T1 (en) * 2001-08-17 2008-10-15 Coley Pharm Gmbh COMBINATION MOTIF-IMMUNO-STIMULATING OLIGONUCLEOTIDES WITH IMPROVED EFFECT
CN1633598A (en) * 2001-10-05 2005-06-29 科勒制药股份公司 Toll-like receptor 3 signaling agonists and antagonists
US20030139364A1 (en) * 2001-10-12 2003-07-24 University Of Iowa Research Foundation Methods and products for enhancing immune responses using imidazoquinoline compounds
EP3006043B1 (en) * 2002-04-04 2019-05-29 Zoetis Belgium S.A. Immunostimulatory g,u-containing oligoribonucleotides
US20040009949A1 (en) * 2002-06-05 2004-01-15 Coley Pharmaceutical Group, Inc. Method for treating autoimmune or inflammatory diseases with combinations of inhibitory oligonucleotides and small molecule antagonists of immunostimulatory CpG nucleic acids
US20040053880A1 (en) * 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7605138B2 (en) * 2002-07-03 2009-10-20 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7576066B2 (en) * 2002-07-03 2009-08-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7807803B2 (en) * 2002-07-03 2010-10-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7569553B2 (en) * 2002-07-03 2009-08-04 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
WO2004007743A2 (en) 2002-07-17 2004-01-22 Coley Pharmaceutical Gmbh Use of cpg nucleic acids in prion-disease
AR040996A1 (en) * 2002-08-19 2005-04-27 Coley Pharm Group Inc IMMUNE STIMULATING NUCLEIC ACIDS
AU2003278845A1 (en) 2002-09-19 2004-04-08 Coley Pharmaceutical Gmbh Toll-like receptor 9 (tlr9) from various mammalian species
CN1753687A (en) * 2002-10-29 2006-03-29 科勒制药集团股份有限公司 Application of CPG oligonucleotide in the treatment of hepatitis C virus infection
CA2502015A1 (en) * 2002-12-11 2004-06-24 Coley Pharmaceutical Group, Inc. 5' cpg nucleic acids and methods of use
AU2004226605A1 (en) 2003-04-02 2004-10-14 Coley Pharmaceutical Group, Ltd. Immunostimulatory nucleic acid oil-in-water formulations for topical application
EP1631687A2 (en) 2003-04-22 2006-03-08 Coley Pharmaceutical GmbH Methods and products for identification and assessment of tlr ligands
MXPA05013922A (en) 2003-06-20 2006-02-24 Coley Pharm Group Inc Small molecule toll-like receptor (tlr) antagonists.
AU2004275876B2 (en) * 2003-09-25 2011-03-31 Coley Pharmaceutical Gmbh Nucleic acid-lipophilic conjugates
US20050215501A1 (en) * 2003-10-24 2005-09-29 Coley Pharmaceutical Group, Inc. Methods and products for enhancing epitope spreading
EP1678303A2 (en) 2003-10-30 2006-07-12 Coley Pharmaceutical GmbH C-class oligonucleotide analogs with enhanced immunostimulatory potency
US20050239733A1 (en) * 2003-10-31 2005-10-27 Coley Pharmaceutical Gmbh Sequence requirements for inhibitory oligonucleotides
US20050100983A1 (en) * 2003-11-06 2005-05-12 Coley Pharmaceutical Gmbh Cell-free methods for identifying compounds that affect toll-like receptor 9 (TLR9) signaling
JP2007526253A (en) 2004-02-19 2007-09-13 コーリー ファーマシューティカル グループ,インコーポレイテッド Immunostimulatory viral RNA oligonucleotide
JP2007531746A (en) * 2004-04-02 2007-11-08 コーリー ファーマシューティカル グループ,インコーポレイテッド Immunostimulatory nucleic acid for inducing an IL-10 response
US20080113929A1 (en) 2004-06-08 2008-05-15 Coley Pharmaceutical Gmbh Abasic Oligonucleotide as Carrier Platform for Antigen and Immunostimulatory Agonist and Antagonist
EP1776105A2 (en) * 2004-07-18 2007-04-25 Coley Pharmaceutical Group, Ltd Methods and compositions for inducing innate immune responses
US20060287263A1 (en) 2004-07-18 2006-12-21 Csl Limited Methods and compositions for inducing antigen-specific immune responses
MY159370A (en) * 2004-10-20 2016-12-30 Coley Pharm Group Inc Semi-soft-class immunostimulatory oligonucleotides
US20080009455A9 (en) * 2005-02-24 2008-01-10 Coley Pharmaceutical Group, Inc. Immunostimulatory oligonucleotides
JP2008535859A (en) 2005-04-08 2008-09-04 コーリー ファーマシューティカル グループ,インコーポレイテッド Methods for treating asthma exacerbated by infection
AU2006241149A1 (en) 2005-04-26 2006-11-02 Coley Pharmaceutical Gmbh Modified oligoribonucleotide analogs with enhanced immunostimulatory activity
CN101321868A (en) 2005-09-16 2008-12-10 科利制药公司 Modulation of the immunostimulatory properties of short interfering ribonucleic acids (siRNAs) by nucleotide modifications
WO2007038720A2 (en) 2005-09-27 2007-04-05 Coley Pharmaceutical Gmbh Modulation of tlr-mediated immune responses using adaptor oligonucleotides
JP4538522B2 (en) * 2005-11-25 2010-09-08 コーリー ファーマシューティカル ゲーエムベーハー Immunostimulatory oligoribonucleotides

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0197843A2 *

Also Published As

Publication number Publication date
WO2001097843A3 (en) 2003-01-23
PT1296714E (en) 2009-10-15
ATE440618T1 (en) 2009-09-15
CA2410371A1 (en) 2001-12-27
US20030026801A1 (en) 2003-02-06
AU7013401A (en) 2002-01-02
AU2006216542B2 (en) 2009-04-30
CA2410371C (en) 2015-11-17
AU2009203061C1 (en) 2012-06-28
JP2003535907A (en) 2003-12-02
AU2001270134B2 (en) 2006-06-15
AU2009212978A1 (en) 2009-10-01
SI1296714T1 (en) 2010-01-29
DK1296714T3 (en) 2009-12-07
EP1296714B1 (en) 2009-08-26
ES2332444T3 (en) 2010-02-05
AU2006216542A1 (en) 2006-10-12
DE60139689D1 (en) 2009-10-08
AU2009203061B2 (en) 2012-02-23
WO2001097843A2 (en) 2001-12-27
AU2009203061A1 (en) 2009-08-20
US7534772B2 (en) 2009-05-19

Similar Documents

Publication Publication Date Title
AU2009203061C1 (en) Methods for enhancing antibody-induced cell lysis and treating cancer
AU2001270134A1 (en) Methods for enhancing antibody-induced cell lysis and treating cancer
US20200101102A1 (en) Treatment of cancer using tlr9 agonist with checkpoint inhibitors
JP7236483B2 (en) Combination of PD-1 antagonists and CpG-C type oligonucleotides for the treatment of cancer
US20060211639A1 (en) Immunostimulatory nucleic acids and cancer medicament combination therapy for the treatment of cancer
WO2018192505A1 (en) Immunomodulatory polynucleotides and uses thereof
US20250255898A1 (en) Compositions and methods for tumor immunotherapy
JP2009500412A (en) Combination therapy of anti-CTLA-4 antibody and CPG motif-containing synthetic oligodeoxynucleotide for the treatment of cancer
US20110293565A1 (en) Novel synthetic agonists of tlr9
JP2022515188A (en) Compositions and Methods for Cancer Treatment
US12558351B2 (en) Compositions and methods for enhancing cancer immune checkpoint therapy
US20230203504A1 (en) Immunomodulatory polynucleotides and uses thereof

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20030122

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

RIN1 Information on inventor provided before grant (corrected)

Inventor name: WEINER, GEORGE

Inventor name: HARTMANN, GUNTHER

17Q First examination report despatched

Effective date: 20040712

17Q First examination report despatched

Effective date: 20040712

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

RTI1 Title (correction)

Free format text: COMBINATION OF CPG AND ANTIBODIES DIRECTED AGAINST CD19,CD20, CD22 OR CD40 FOR THE TREATMENT OR PREVENTION OF CANCER.

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

RIN1 Information on inventor provided before grant (corrected)

Inventor name: WEINER, GEORGE

Inventor name: HARTMANN, GUNTHER

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: UNIVERSITY OF IOWA RESEARCH FOUNDATION

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: EP

RAP2 Party data changed (patent owner data changed or rights of a patent transferred)

Owner name: UNIVERSITY OF IOWA RESEARCH FOUNDATION

Owner name: COLEY PHARMACEUTICAL GMBH

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

REF Corresponds to:

Ref document number: 60139689

Country of ref document: DE

Date of ref document: 20091008

Kind code of ref document: P

REG Reference to a national code

Ref country code: PT

Ref legal event code: SC4A

Free format text: AVAILABILITY OF NATIONAL TRANSLATION

Effective date: 20091007

REG Reference to a national code

Ref country code: GR

Ref legal event code: EP

Ref document number: 20090402338

Country of ref document: GR

REG Reference to a national code

Ref country code: CH

Ref legal event code: NV

Representative=s name: E. BLUM & CO. AG PATENT- UND MARKENANWAELTE VSP

NLT2 Nl: modifications (of names), taken from the european patent patent bulletin

Owner name: UNIVERSITY OF IOWA RESEARCH FOUNDATION EN COLEY PH

Effective date: 20090930

REG Reference to a national code

Ref country code: DK

Ref legal event code: T3

REG Reference to a national code

Ref country code: SE

Ref legal event code: TRGR

LTIE Lt: invalidation of european patent or patent extension

Effective date: 20090826

REG Reference to a national code

Ref country code: ES

Ref legal event code: FG2A

Ref document number: 2332444

Country of ref document: ES

Kind code of ref document: T3

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: CY

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090826

PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

26N No opposition filed

Effective date: 20100527

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MC

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20100630

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 16

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 17

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 18

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: DK

Payment date: 20200629

Year of fee payment: 20

Ref country code: LU

Payment date: 20200629

Year of fee payment: 20

Ref country code: FI

Payment date: 20200629

Year of fee payment: 20

Ref country code: PT

Payment date: 20200608

Year of fee payment: 20

Ref country code: FR

Payment date: 20200625

Year of fee payment: 20

Ref country code: IE

Payment date: 20200629

Year of fee payment: 20

Ref country code: TR

Payment date: 20200605

Year of fee payment: 20

Ref country code: DE

Payment date: 20200629

Year of fee payment: 20

Ref country code: GR

Payment date: 20200629

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: IT

Payment date: 20200619

Year of fee payment: 20

Ref country code: BE

Payment date: 20200629

Year of fee payment: 20

Ref country code: NL

Payment date: 20200626

Year of fee payment: 20

Ref country code: SE

Payment date: 20200629

Year of fee payment: 20

Ref country code: GB

Payment date: 20200629

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: AT

Payment date: 20200603

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: ES

Payment date: 20200701

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: CH

Payment date: 20200702

Year of fee payment: 20

REG Reference to a national code

Ref country code: DE

Ref legal event code: R071

Ref document number: 60139689

Country of ref document: DE

REG Reference to a national code

Ref country code: NL

Ref legal event code: MK

Effective date: 20210621

REG Reference to a national code

Ref country code: DK

Ref legal event code: EUP

Expiry date: 20210622

REG Reference to a national code

Ref country code: CH

Ref legal event code: PL

REG Reference to a national code

Ref country code: FI

Ref legal event code: MAE

REG Reference to a national code

Ref country code: GB

Ref legal event code: PE20

Expiry date: 20210621

REG Reference to a national code

Ref country code: BE

Ref legal event code: MK

Effective date: 20210622

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: PT

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20210630

REG Reference to a national code

Ref country code: SE

Ref legal event code: EUG

REG Reference to a national code

Ref country code: IE

Ref legal event code: MK9A

REG Reference to a national code

Ref country code: AT

Ref legal event code: MK07

Ref document number: 440618

Country of ref document: AT

Kind code of ref document: T

Effective date: 20210622

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GB

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20210621

REG Reference to a national code

Ref country code: ES

Ref legal event code: FD2A

Effective date: 20211026

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IE

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20210622

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: ES

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20210623