EP1242619A2 - Assay for detection of human cftr allele variants using specific diagnostic primers - Google Patents

Assay for detection of human cftr allele variants using specific diagnostic primers

Info

Publication number
EP1242619A2
EP1242619A2 EP00960854A EP00960854A EP1242619A2 EP 1242619 A2 EP1242619 A2 EP 1242619A2 EP 00960854 A EP00960854 A EP 00960854A EP 00960854 A EP00960854 A EP 00960854A EP 1242619 A2 EP1242619 A2 EP 1242619A2
Authority
EP
European Patent Office
Prior art keywords
primer
mutant primer
mutant
diagnostic
variant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00960854A
Other languages
German (de)
French (fr)
Inventor
Andrew Iain Bayliffe
Eelco Docter
Stephen James Kelly
Nancy Hastings Robertson
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
AstraZeneca AB
Original Assignee
AstraZeneca AB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by AstraZeneca AB filed Critical AstraZeneca AB
Publication of EP1242619A2 publication Critical patent/EP1242619A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/172Haplotypes

Definitions

  • This invention relates to a diagnostic method for the simultaneous detection of the variable length polythymidine (polyT) tract alleles in the CFTR gene that are associated with the phenotypic modulation of selected CFTR mutations (Friedman KJ. et al. Hum Mutat. 10: 108-115 (1997)).
  • polyT variable length polythymidine
  • the invention also relates to a diagnostic method further comprising the simultaneous detection of one or more of the DF508 (Kerem B. et al. Science 245: 1073-1080 (1989)), 621+1G>T (Rozen R. et al. Am. J. Med. Genet. 42: 360-364 (1992)), G542X, 3659delC, A455E, DI507 (Kerem B. et al. Proc. Nat.Acad. Sci. 87: 8447-8451 (1990)), 3849+10kbOT (Highsmith WE. et al. New Eng. J. Med. 331 : 974-980 (1994)), N1303K (Osbome L. et al. Am. J.
  • the invention also relates to a diagnostic method further comprising the simultaneous detection of one or more of the G85E (Chalkley G. et al. J. Med. Genet. 28: 875-877 (1991)), 405+lG>A (Dork T. et al. Hum Mol Genet. 2: 1965-1966 1993)), S549R (Kerem B. et al. Proc. Nat.Acad. Sci. 87: 8447-8451 (1990)), (or, depending on which of the two mutations produce this phenotype is tested for, Sangiuolo. et al. Genomics 9: 788-789 (1991)), W1089X (Shoshani T. et al. Hum. Molec. Genet.
  • Cystic fibrosis transmembrane conductance regulator functions as a chloride channel and controls the regulation of other transport pathways.
  • the CFTR gene maps to chromosome 7q (Riordan J R. et al. Science 245: 1066-1073 (1989)).
  • Cystic fibrosis is an autosomal recessive disorder mainly among Caucasians with a frequency of approximately 1/2 500 (Welsh MJ. et al. in Scriver et al. (eds): The Metabolic Basis of Inherited Disease, Vol 3: 7th ed. McGraw-Hill; New York, pp3799-3876 (1995)).
  • CF CF
  • Treatment is directed at improving nutrition through the use of replacement pancreatic enzymes and vitamins, as well as a high-energy, high-protein and liberal-fat diet.
  • enteral supplementation by nightly nasogastric, gastrostomy or jejunostomy infusion of high-energy diets has been used.
  • Pulmonary treatment includes antibiotic therapy, either maintained continuously or reserved for exacerbations, and chest physiotherapy consisting of postural drainage, percussion, vibration and assisted coughing.
  • Mutations of the CFTR gene are believed to produce an abnormal protein as a component of the chloride channel gate at the cell surface and are classified according to their phenotypic manifestations.
  • Class I are nonsense mutations, resulting in the introduction of a stop codon, and in no synthesis of CFTR e.g. G542X, R553X, W1282X.
  • Class II mutations cause a block in CFTR assembly in the endoplasmic reticulum or affect transport to the cell membrane, these include ⁇ F508, A455E, and P574H.
  • Class HI and IV mutations give rise to defective chloride channel activity or regulation e.g. Rl 17H, which alters amino acid residues in the first CFTR transmembrane domain.
  • Class V mutations result in modulations in CFTR synthesis.
  • CF CF involving class I and II CFTR mutations (most commonly ⁇ F508 homozygotes)
  • chronic pulmonary disease is observed at variable levels with chronic pancreatitis.
  • PS-CF sinopulmonary problems with pancreas sufficiency
  • CBAVD congenital bilateral absence of vas deferens
  • Mutations associated with PS-CF include R334W and R117H; the latter mutation accounts for approximately 0.8% of mutant alleles in Caucasian CF patients (Tsui LC. Trends Genet. 57: 392-398 (1992)).
  • the T5 allele results in the most inefficient use of this splice acceptor site (Teng, H. et al. Hum. Mol. Genet. 6: 85-90 (1997)) and so CFTR transcripts from a T5 allele will lack exon 9 sequence.
  • Individuals homozygous for the 5T allele were found to generate 90% CFTR mRNA with exon9 skipped (exon9 ⁇ ). While 7T homozygotes generated ⁇ 25% exon9 " transcripts, and 9T ⁇ 15% (Lissens W. et al. Hum. Reprod. 11 : Supp4 55-77 (1996)).
  • CFTR gene with the Rl 17H mutation harbors a T5 allele
  • the mutant gene will be responsible for CF.
  • An Rl 17H mutant CFTR gene that harbors a T7 allele can either result in CF or CBAVD (Kiesewetter S. et al. Nature Genet. 5: 274-278, (1993)).
  • polyT splice site variants may therefore explain the clinical heterogeneity observed in some mild cases of CF. It is also possible that the CF clinical phenotypes associated with mutations other than ⁇ F508 result from both the mutation in the CFTR gene and the sequence at exon9 splice site acceptor site. Most CFTR mutations occur on a particular polyT background, most commonly the
  • ⁇ F508 is in linkage disequilibrium with the 9T allele and the mild CF mutation Rl 17H is always found on a 5T or 7T background.
  • the mutation Rl 17H has been shown to owe its phenotypic heterogeneity (PS CF or CBAVD) to the presence of the 5T or 7T polyT alleles (Friedman KJ. et al. Hum Mutat. 10: 108-115 (1997)).
  • Compound heterozygotes having the genotype ⁇ F508/R117H may present as PS-CF, CBAVD or be asymptomatic.
  • Diagnostic techniques for phenotypic manifestations of CF include measuring sweat chloride. Elevated sweat chloride concentrations (greater than 60 mmol/1) are almost exclusively observed in patients with CF. However, it is difficult to obtain sufficient sweat from newborns, even after stimulating localised sweating by administering pilocarpine into the skin it is often impossible to collect sufficient sweat for accurate analysis. Sweat chloride concentrations can be measured, for example, by using the Lazar ISM- 146 Micro Chloride electrode. Measurement of elevated immunoreactive trypsinogen (IRT) in a dried blood spot is another screening method for CF. False positives and false negatives are known to occur, with false negatives occurring more frequently in neonates with meconium ileus. The positive predictive value of the test is only 1-7% (Ryley HC. J. Clin. Pathol. 41 : 726-729 (1988),
  • the "BM meconium test” identifies infants with high albumin content in the stool resulting from pancreatic insufficiency but it has very low sensitivity (Naylor EW. Semin. Perinatol. 9: 232-249 (1985)).
  • Friedman requires the use of each allele-specific primer in a separate reaction.
  • ARMS Mutation System
  • a diagnostic method for the detection of the 5T, 7T and 9T alleles in intron 8 of the human CFTR gene comprises contacting a test sample of nucleic acid from an individual with a multiplex of diagnostic primers comprising (i) 5T variant primer 5'(N)nAAAGAC3', (ii) 7T variant primer 5'(N*)n*(N)nAAAAGC3' and (iii) 9T variant primer
  • N represents additional nucleotides which base pair with the corresponding genomic sequence in the respective allele and n is an integer between 10 and 30 and N* represents additional non-homologous nucleotides which do not base pair with the corresponding genomic sequence in the respective allele and n* is an integer between 5 and 60, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that a diagnostic primer is extended only when the corresponding allelic variant is present in the sample; and detecting the presence or absence of the allelic variant by reference to the presence or absence of a diagnostic primer extension product.
  • N* may be any other molecule that serves to reduce the electrophoretic mobility of an extension product such as 3'hexaethylene glycol (HEG) or a combination of such molecules and additional non-homologous nucleotides.
  • HOG 3'hexaethylene glycol
  • the diagnostic primers for use in the methods of the invention conveniently comprise one or more of
  • nucleotide sequence as defined by (N)n in the diagnostic primer is normally selected to be 100%) complementary to the corresponding genomic sequence.
  • one or more mismatched bases may be included, for example at the 5' terminus of the primer.
  • up to two, three, four or five mismatched base pairs may be included in the nucleotide sequence defined by (N)n. It will also be understood that any mismatched bases must not significantly impair the discriminatory properties of the diagnostic primer.
  • n is for example 10, up to 15, up to 20, up to 25, or up to 30.
  • Preferred diagnostic primers include
  • 5T variant primer 5'TAATTCCCCAAATCCCTGTTAAAGAC3'
  • 7T variant primer 5'(N*)n*TAATTCCCCAAATCCCTGTTAAAAAAGC3'
  • 9T variant primer 5'(N*)n*TAATTCCCCAAATCCCTGTTAAAAAAAATC3' wherein N* and n* are as defined above.
  • Preferred diagnostic 7T and 9T primers are: 7T variant primer
  • a diagnostic primer of the invention with a further amplification primer in one or more cycles of PCR amplification.
  • a convenient example of this aspect is set out in our European patent number EP-B1-0332435. Any convenient amplification primer may be useed provided that the resulting amplification products are of a suitable size for separation and analysis.
  • the further amplification primer is conveniently the polyT common primer
  • GTACATAAAACAAGCATCTATTGAAAATATCTGAC is used in combination with the intron 8 5T, 7T and 9T allele-specific primers.
  • a diagnostic method for the detection of the 5T, 7T and 9T alleles in intron 8 of the human CFTR gene comprises contacting a test sample of nucleic acid from an individual with a multiplex of diagnostic primers comprising (i) 5T variant primer 5'(N)nAAAGAC3', (ii) 7T variant primer 5'(N*)n*(N)nAAAAGC3' and (iii) 9T variant primer
  • N represents additional nucleotides which base pair with the corresponding genomic sequence in the respective allele and n is an integer between 10 and 30 and N* represents additional non-homologous nucleotides which do not base pair with the corresponding genomic sequence in the respective allele and n* is an integer between 5 and 60, and a common amplification primer in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, and subjecting the mixture to PCR amplification such that a diagnostic primer is extended only when the corresponding allelic variant is present in the sample; and detecting the presence or absence of the allelic variant by reference to the presence or absence of a corresponding PCR amplification product.
  • primer set 1 The above aspects of the invention are referred to as primer set 1 and conveniently illustrated by reference to Table 1 and the disclosure of a specific primer mixl. References to primer “mixes” and “sets” are not intended to be limiting and the terms are used throughout the text interchangeably.
  • N* is one from a group of labels that can be conjugated to primers whereby an individual label is associated specifically to one allele- specific primer and n* may be 0 or an integer greater than 1.
  • An example of labels according to this definition of N* is a group of molecules such as fluorophores for example, (Brown T. and Brown DJS. in Newton CR. (ed): PCR - Essential Data: 1 st ed. Wiley; Chichester, pp57- 71 (1995)).
  • the primers may be manufactured using any convenient method of synthesis. Examples of such methods may be found in standard textbooks, for example "Protocols For Oligonucleotides And Analogues: Synthesis And Properties;” Methods In Molecular Biology Series; Volume 20; Ed. Sudhir Agrawal, Humana ISBN: 0-89603-247-7; 1993; 1 st Edition.
  • any of the above diagnostic methods may, if appropriate, also be configured so that extension of the diagnostic primer indicates the absence of the respective CFTR gene polyT allele.
  • the polyT methods of this invention may be used with any known CFTR testing procedure.
  • Two or more of the above diagnostic primers are conveniently used as a multiplex and more conveniently with a suitable amplificiation primer. Preferably several or all of the above primer sequences are used in a single multiplex reaction.
  • Convenient primers include: W1282X mutant primer 5'(N)nGCAACAGTCA3', 1717-lOA mutant primer 5'(N)nTTGGTAATTA3 ⁇ G542X mutant primer 5'(N)nATAGTTCTCT3', N1303K mutant primer 5'(N)nGGGATCCATC3', DF508 mutant primer 5'(N)nAAACACCATT3' and
  • Preferred diagnostic primers include W1282X mutant primer 5'TCTTGGGATTCAATAACTTTGCAACAGTCA3', 1717-1G>A mutant primer 5'TCTCGAATTTTCTATTTTTGGTAATTA3', G542X mutant primer 5 ⁇ GTTTGCAGAGAAAGACAATATAGTTCTCT3', N1303K mutant primer 5 GATCACTCCACTGTTCATAGGGATCCATC3', DF508 mutant primer 5'GTATCTATATTCATCATAGGAAACACCATT3', and 3849+ 1 Okb OT mutant primer 5 ' GAAC ATTTCCTTTC AGGGTGTCTT ACGC A3 ' .
  • primer set 2 A The above aspects of the invention are referred to as primer set 2 A and illustrated by reference to Table 3 and the specific primer mix 2A.
  • Primer mix 2A is conveniently used in combination with primer mix 1 as set out in Table 1.
  • Two or more of the above diagnostic primers are conveniently used as a multiplex and more conveniently with a suitable amplificiation primer.
  • Preferably several or all of the above primer sequences are used in a single multiplex reaction.
  • Convenient diagnostic primers include: DF508 non-mutant primer 5'(N)nAAACACCACA3', Rl 17H mutant primer 5'(N)nGCGATAGACT3', 621+1G>T mutant primer 5'(N)nGAAGTATTGA3', R334W mutant primer 5 '(N)nATCATCCTGT3 ', Rl 162X mutant primer 5'(N)nTCTGTGAGTT3 ⁇ R553X mutant primer 5'(N)nTTCTTGCTGA3' and
  • Preferred diagnostic primers include:
  • Rl 17H mutant primer5'AGCCTATGCCTAGATAAATCGCGATAGACT3' 621+lOT mutant primer 5'TGCCATGGGGCCTGTGCAAGGAAGTATTGA3', R334W mutant primer 5'CCTATGCACTAATCAAAGGAATCATCCTGT3', Rl 162X mutant primer 5'TATTTTTATTTCAGATGCGATCTGTGAGTT3', R553X mutant primer 5 TATTCACCTTGCTAAAGAAATTCTTGCTGA3', G551D mutant primer 5'GCTAAAGAAATTCTTGCTCGTTGTT3'.
  • primer set 2B The above aspects of the invention are referred to as primer set 2B and are conveniently illustrated by reference to Table 3 and the specific primer mix 2B.
  • Primer mix 2B is conveniently used in combination with mixl as set out in Table 1.
  • We have also devised novel diagnostic primer sequences for the A455E, 2183AA>G, 3659delC, DI507, 1078delT, R347P, S1251N and E60X mutations of the human CFTR gene using ARMS allele specific amplification. Therefore the polyT multiplex of the present invention is conveniently accompanied by the use in a separate ARMS reaction of one or more of :
  • N and n are as previously defined, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that a diagnostic primer is extended only when the corresponding allelic variant is present in the sample; and detecting the presence or absence of the allelic variant by reference to the presence or absence of a diagnostic primer extension product.
  • Two or more of the above diagnostic primers are conveniently used as a multiplex and more conveniently with a suitable amplificiation primer.
  • Preferably several or all of the above primer sequences are used in a single multiplex reaction.
  • the diagnostic primer conveniently comprises one or more of A455E mutant primer 5'(N)nAGTTGTTGTA3', 1078delT mutant primer 5'(N)nAGGGTTCCTG3', R347P mutant primer 5'(N)nTTGTTCTACC3', DI507 mutant primer 5'(N)nGAAAATAACT3', 3659delC mutant primer 5'(N)nTAAACCTAGA3', 2183AA>G mutant primer 5'(N)nAAAAGATAGC3', S 125 IN mutant primer 5 ' (N)nCAGGGAAGC A3 ' and
  • Preferred diagnostic primers include A455E mutant primer 5 TCAAGATAGAAAGAGGACAGTTGTTGTA3', 1078delT mutant primer 5'CCTTCTTCTTCTCAGGGTTCCTG3',
  • primer set 2C R347P mutant primer 5'CACCATCTCATTCTGCATTGTTCTACC3', DI507 mutant primer 5'GCCTGGCACCATTAAAGAAAATAACT3', 3659delC mutant primer 5 ⁇ TGCCAACAGAAGGTAAACCTAGA3', 2183AA>G mutant primer 5'CAAACTCTCCAGTCTGTTTAAAAGATAGC3', S1251N mutant primer 5'GGAAGAACTGGATCAGGGAAGCA3' and E60X mutant primer 5'TTAGGATTTTTCTTTGAAGCCAGTTA3'.
  • primer set 2C primer set 2C and conveniently illustrated by reference to Table 4 and the specific primer mix 2C.
  • Primer mix 2C is conveniently used in combination with mixl as set out in Table 1.
  • diagnostic primers are conveniently used as a multiplex and more conveniently with a suitable amplificiation primer. Preferably several or all of the above primer sequences are used in a single multiplex reaction.
  • the diagnostic primer conveniently comprises one or more of
  • N, n, are as defined above and n is an integer between 6 and 26.
  • Preferred diagnostic primers include: G85E mutant primer
  • primer set 3 GATTTATGTTCT ATGGAATCTTTTT AT ATTTAGTGA3 '
  • DI 152H mutant primer 5 ⁇ AAGATGATAAGACTTACCAAGCTATCCACTTG3' The above aspects of the present invention are referred to as primer set 3 and conveniently illustrated by reference to Table 5 and the specific mix 3.
  • Mix 3 may for example be used in combination with mixl as set out in Table 1.
  • the primers may be manufactured using any convenient method of synthesis. Examples of such methods may be found in standard textbooks, for example "Protocols For Oligonucleotides And Analogues: Synthesis And Properties " Methods In Molecular Biology Series; Volume 20; Ed. Sudhir Agrawal, Humana ISBN: 0-89603-247-7; 1993; 1 st Edition. It will be appreciated that any of the above diagnostic methods may, if appropriate, also be configured so that extension of the diagnostic primer indicates the absence of the respective CFTR gene mutation or polyT allele.
  • the test sample of nucleic acid is preferably a blood sample but may also conveniently be a sample of any body fluid, or tissue obtained from an individual. The individual is any convenient mammal, preferably a human being.
  • test sample may equally be a nucleic acid sequence corresponding to the sequence in the test sample. That is to say that all or a part of the region in the sample nucleic acid may firstly be amplified using any convenient technique such as PCR before use in the method of the invention.
  • Any convenient enzyme for polymerisation may be used provided that it does not affect the ability of the DNA polymerase to discriminate between normal and mutant template sequences to any significant extent.
  • convenient enzymes include thermostable enzymes which have no significant 3 '-5' exonuclease activity, for example Taq DNA polymerase, particularly "Ampli Taq Gold”TM DNA polymerase (PE Applied Biosystems), Stoffel fragment, or other appropriately N-terminal deleted modifications of Taq or Tth (Thermus thermophilus) DNA polymerases.
  • the diagnostic methods of the invention can be used in combination to enable the presence or absence of mutations or polyT alleles of the CFTR gene to be detected simultaneously (i.e. the method comprises several multiplex tests).
  • Primer Mix 1 can be used in isolation or in combination with any other cystic fibrosis diagnostic tests. Because the multiplex polyT test using the mix 1 primer mix adds value to the information derived from other cystic fibrosis diagnostic tests it is convenient to use the mix 1 primer mix in combination with the mix 2A primer mix. Similarly, it is convenient to use the mix 1 primer mix in combination with the mix 2B primer mix. Similarly, it is convenient to use the mix 1 primer mix in combination with the mix 2C primer mix.
  • the tests may provide genotype information for the 1717-1G>A, G542X, W1282X, N1303K, 3849+1 OkbOT, 621+lOT, R553X, G551D, R117H, R1162X, R334W, A455E, 2183AA>G, 3659delC, 1078delT, DI507, R347P, S 125 IN, E60X, G85E, 405+lOA, S549R, W1089X, and DI 152H CFTR gene mutations by the inclusion of primers specific for the normal CFTR gene sequences that correspond to the respective mutated CFTR gene sequences associated with these mutations.
  • each multiplex test may have any of the primers described above in combination the prefe ⁇ ed diagnostic primer multiplexes are the mix 1 comprising primers for the 5T, 7T and 9T alleles.
  • Mix 2A comprising primers for the 1717-1G>A, G542X, W1282X, N1303K, DF508 and 3849+lOkbOT mutations;
  • mix 2B comprising primers for the 621+lOT, R553X, G551D, Rl 17H, Rl 162X and R334W mutations and the normal CFTR gene sequence corresponding to the DF508 mutation;
  • mix 2C comprising primers for the A455E, 2183AA>G, 3659delC, 1078delT, DI507, R347P, S1251N and E60X mutations;
  • mix 3 comprising primers for the G85E, 405+lOA, S549R, W1089X, and DI 152H mutations.
  • the further amplification primer is either a 1717-1G>A common, G542X common, W1282X common, N1303K common, DF508 common or 3849+lOkbOT common primer.
  • the 1717-lOA common primer TAATCTCTACCAAATCTGGATACTATACC is conveniently used in combination with the 1717-1G>A mutant primer
  • the G542X common primer TAATCTCTACCAAATCTGGATACTATACC is conveniently used in combination with the G542X mutant primer
  • the W1282X common primer GAATTCCCAAACTTTTAGAGACATC is conveniently used in combination with the W1282X mutant primer
  • CTTGATGGTAAGTACATGGGTTTTTCTTAT is conveniently used in combination with the N1303K mutant primer
  • the DF508 common primer CCAGACTTCACTTCTAATTATGATTATGGG is conveniently used in combination with the DF508 mutant primer
  • TTGTGGATCAAATTTCAGTTGACTTGTCATC is conveniently used in combination with the 3849+1 OkbOT mutant primer.
  • any convenient control primer may be used.
  • the amplification products from the Mix 1 primer mix serve as internal controls and so an additional amplification control is not required.
  • the further amplification primer is either a 1717-1G>A common, G542X common, W1282X common, N1303K common, DF508 common or 3849+lOkbOT common primer.
  • the DF508 common primer GACTTCACTTCTAATGATGATTATGGGAGA is conveniently used in combination with the DF508 normal primer
  • the 621+1G>T common primer GTTTCACATAGTGTATGACCCTCTATATACACTCATT is conveniently used in combination with the 621+1G>T mutant primer
  • the R553X common primer ATCTAAAATTGGAGCAATGTTGTTTTTGACC is conveniently used in combination with the R553X mutant primer
  • the G551D common primer ATCTAAAATTGGAGCAATGTTGTTTTTGACC is conveniently used in combination with the G551D mutant primer
  • GTTTCACATAGTGTATGACCCTCTATATACACTCATT is conveniently used in combination with the Rl 17H mutant primer
  • the Rl 162X common primer TTTTGCTGTGAGATCTTTGACAGTCATTT is conveniently used in combination with the Rl 162X mutant primer
  • TTTGTTTATTGCTCCAAGAGAGTCATACCA is conveniently used in combination with the R334W mutant primer. Any convenient control primer may be used.
  • the further amplification primer is either a 621+1G>T common, R553X common, G551D common, Rl 17H common, Rl 162X common, R334W common or A455E common primer.
  • the A455E common primer is either a 621+1G>T common, R553X common, G551D common, Rl 17H common, Rl 162X common, R334W common or A455E common primer.
  • GACTGACTGACTGACTGACTGAAATGGAGACTTTTTGTTTATGTGGTTACTAA is conveniently used in combination with the A455E mutant primer
  • the 2183AA>G common primer GTATGATAGAGATTATATGCAATAAAACATTAACA is conveniently used in combination with the 2183 AA>G mutant primer
  • TGTGTCTAATATTGATTCTACTGTACAATAATAA is conveniently used in combination with the 3659delC mutant primer
  • the 1078delT common primer ATTTTTCCAAACTTCATTAGAACTGATCTATTGAC is conveniently used in combination with the 1078delT mutant primer
  • the DI507 common primer CACAGTAGCTTACCCATAGAGGAAACA is conveniently used in combination with the DI507 mutant primer
  • ATTTTTCCAAACTTCATTAGAACTGATCTATTGAC is conveniently used in combination with the R347P mutant primer
  • the S 125 IN common primer GCTCACCTGTGGTATCACTCCAA is conveniently used in combination with the S 125 IN mutant primer
  • AATCAAACTATGTTAAGGGAAATAGGACAACTAA is conveniently used in combination with the E60X mutant primer. Any convenient control primer may be used.
  • the further amplification primer is either a G85E common, 405+1 G>A common, S549R common, W1089X common, DI 152H common primer.
  • the G85E and the 405+lOA common primer CGATTCGATTCAGTTTTCTGTGGTTTCTTAGTGTTTGGA is conveniently used in combination with the G85E mutant primer and/or the 405+lG>A mutant primer
  • the S549R common primer GTAATTTTTTTACATGAATGACATTTACAGCAA is conveniently used in combination with the S549R mutant primer
  • GGAAATTATTTGTTTAACAATAAAACAATGGAA is conveniently used in combination with the W1089X mutant primer and the DI 152H common primer CCAACAACACCTCCAATACCAGTAAC is conveniently used in combination with the D 1152H mutant primer.
  • control primers from unrelated regions of the genome, namely, part of the human apolipoprotein B gene and part of the ornithine decarboxylase gene.
  • a variety of methods may be used to detect the presence or absence of diagnostic primer extension products and/or amplification products. These will be apparent to the person skilled in the art of nucleic acid detection procedures. Preferred methods avoid the need for radiolabelled reagents. Particular detection methods include size separation of amplification products, for example as described in our patents numbers EP 0 332 435 & US 5595890, "ALEX" product detection (Haque K. et al. Diag. Mol. Pathol. &: 248-252 (1998)), the detection of amplification incorporated "Sunrise” probes (Nazarenko LA. et al. Nucl. Acids Res.
  • patent number EP 0 731 177 "taqman” product detection for example as described in patent numbers US-A- 5487972 & US-A-5210015; and "Molecular Beacons” product detection outlined in patent number WO-95/13399.
  • primer mixes of the invention may be conveniently packaged with instructions for use in the method of the invention and appropriate packaging and sold as a kit.
  • Convenient primer mixes include intron 8 polyT allele-specific primers and CFTR mutation- specific primers, equivalent normal-specific primers; all as hereinbefore disclosed.
  • the kits will conveniently include one or more of the following: appropriate nucleotide triphosphates, for example one or more of dATP, dCTP, dGTP, and dTTP, a suitable polymerase as previously described, and a convenient buffer solution.
  • Table 1 shows a specific primer mix 1
  • Table 2 shows a specific primer mix 2A
  • Table 3 shows a specific primer mix 2B
  • Table 4 shows a specific primer mix 2C
  • Table 5 shows a specific primer mix 3
  • Figure 1 shows the relative location of the PCR product bands on an agarose electrophoresis gel corresponding to (PolyT)
  • Fisure 2 shows the relative location of the PCR product bands on an agarose electrophoresis gel corresponding to a CFTR DF508 heterozygote, DF508 homozygote, DF508/ DI507 compound heterozygote, G542X heterozygote, G551D heterozygote, 1078delT heterozygote.
  • Figure 3 shows the relative location of the PCR product bands on an agarose electrophoresis gel corresponding to a (Middle Eastern Panel)
  • Figure 4 shows diagramatically the relative sizes in base pairs and the relative location of the PCR product bands on an agarose electrophoresis gel corresponding to the CFTR intron 8 5T, 7T and 9T alleles.
  • Figure 5 shows diagramatically the size in base pairs and the relative location of the
  • Example 1.1 Materials Provided in a diagnostic kit containing 50tests (polyT)
  • Example 2.1 Materials Provided in a diagnostic kit containing 50 tests (CF20)
  • Example 3.1 Materials Provided in a diagnostic kit containing 50tests (Middle Eastern) 1. 50 Vial 3 (colour coded) containing primers (DI 152H, W1089X, G85E,
  • 1 vial normal DNA control contains human DNA unaffected by the mutations detected by the kit, in buffer. 6. Instructions for use.
  • the samples may be stored at room temperature overnight or at 2-8 °C for up to 7 days before analysis by gel electrophoresis.
  • the samples may be stored at room temperature overnight or at 2-8 °C for up to 7 days before analysis by gel electrophoresis.
  • a 50 Base-Pair Ladder (Amersham Pharmacia Biotech) at 1.5 ⁇ g/15 ⁇ L was prepared in the loading dye (80 ⁇ L distilled water / lO ⁇ L loading dye / lO ⁇ L 50 Base-Pair Ladder). 15 ⁇ L of this dilution was run adjacent to samples as a molecular weight marker.
  • Electrophoresis was carried out at 5 to 6 V/cm between electrodes until the dye front had migrated 5 cm from the loading wells towards the anode (1.5 to 2 hours).
  • the negative control should show no bands in the tracks within the area co ⁇ esponding to the upper and lower control bands.
  • a diagnostic band should not be interpreted if a similar band is also seen in the negative control for that PCR run as this is indicative of contamination with genomic DNA.
  • An individual has two copies of the CFTR gene. Where these copies have the same sequence for any given site, an individual is described as being homozygous for this site. Where the copies differ in sequence at a given site, an individual is described as being heterozygous for this site.
  • the bands should be of similar intensity to the 250bp band in the 50bp ladder, loaded at 1.5mg/15ml (Amersham Pharmacia Biotech).
  • heteroduplexes may occasionally be formed from the PCR products and may therefore be visible in some test sample tracks. The position of these heteroduplexes is indicated in figure
  • a 7T/7T individual may have a heteroduplex band larger than the 7T allele but not as large as the 9T allele.
  • a 5T/7T individual may have a heteroduplex that runs in a similar position to the 9T allele. Therefore if all three diagnostic bands are visible the individual's genotype is 5T/7T.
  • the heteroduplex if present, is generally weaker than the corresponding 5T and 7T diagnostic products.
  • a 5T/9T individual occasionally has a heteroduplex which run larger than the 9T allele.
  • a diagnostic 2183AA>G band may indicate that the
  • 2184insG mutation is present. 4.
  • the mix formulation for mix 1 is presented below (Table 1).
  • the 25 ⁇ l total reaction volume also includes lx ARMS, lOOmM dNTP, 1.5U AmpliTaq Gold, lx CRS.
  • the mix formulation for the 2A mix is presented below (Table 2).
  • the 25 ⁇ l total reaction volume also includes lx ARMS, lOOmM dNTP, 1.5U AmpliTaq Gold, lx CRS
  • the mix formulation for the 2B mix is presented below (Table 3).
  • the 25 ⁇ l total reaction volume also includes lx ARMS, lOOmM dNTP, 1.5U AmpliTaq Gold, lx CRS.
  • the mix formulation for the 2C mix is presented below (Table 4).
  • the 25 ⁇ l total reaction volume also includes lx ARMS, lOOmM dNTP, 1.5U AmpliTaq Gold, lx CRS.
  • the mix formulation for mix 3 is presented below (Table 5).
  • the 25 ⁇ l total reaction volume also includes lx ARMS, lOOmM dNTP, 1.5U AmpliTaq Gold, lx CRS.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A diagnostic method for the detection of the 5T, 7T and 9T alleles in intron (8) of the human CFTR gene which method comprises contacting a test sample of nucleic acid from an individual with a multiplex of diagnostic primers comprising (i) 5T variant primer 5'(N)nAAAGAC3', (ii) 7T variant primer 5'(N*)n*(N)nAAAAGC3' and (iii) 9T variant primer 5'(N*)n*(N)nAAAATC3', wherein N represents additional nucleotides which base pair with the corresponding genomic sequence in the respective allele and n is an integer between 10 and 30 and N* represents additional non-homologous nucleotides which do not base pair with the corresponding genomic sequence in the respective allele and n* is an integer between 5 and 60, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that a diagnostic primer is extended only when the corresponding allelic variant is present in the sample; and detecting the presence or absence of the allelic variant by reference to the presence or absence of a diagnostic primer extension product.

Description

ASSAY
This invention relates to a diagnostic method for the simultaneous detection of the variable length polythymidine (polyT) tract alleles in the CFTR gene that are associated with the phenotypic modulation of selected CFTR mutations (Friedman KJ. et al. Hum Mutat. 10: 108-115 (1997)).
The invention also relates to a diagnostic method further comprising the simultaneous detection of one or more of the DF508 (Kerem B. et al. Science 245: 1073-1080 (1989)), 621+1G>T (Rozen R. et al. Am. J. Med. Genet. 42: 360-364 (1992)), G542X, 3659delC, A455E, DI507 (Kerem B. et al. Proc. Nat.Acad. Sci. 87: 8447-8451 (1990)), 3849+10kbOT (Highsmith WE. et al. New Eng. J. Med. 331 : 974-980 (1994)), N1303K (Osbome L. et al. Am. J. Hum. Genet. 48: 608-612 (1991)), 1717-1G>A (Kerem B. et al. Proc. Nat. Acad. Sci. 87: 8447-8451 (1990), Guillermit H. et al. Hum. Genet. 85: 450-453 (1990)), 1078delT (Claustres M. et al. Genomics 13: 907-908 (1992)), W1282X (Vidaud M et al. Hum. Genet. 85: 446-449 (1990)), R347P, R117H (Dean M. et al. Cell 61: 863-870 (1990)), G551D,
R553X (Cutting GR. et al. New Eng. J. Med. 323: 1685-1689 (1990)), S1251N (Gasparini P. et al. Hum. Mutat. 2: 389-394 (1993)), Rl 162X, R334W (Gasparini P. et al. Genomics 10: 193-200 (1991)), 2183AA>G, (Bozon D. et al. Hum. Mutat. 3: 330-332 (1994)), and the E60X (Will K. et al. Hum. Mutat. 5: 210-20 (1995)) mutations in the human cystic fibrosis conductance regulator (CFTR) gene that are prevalent in populations of European descent using the amplification refractory mutation system, (ARMS).
The invention also relates to a diagnostic method further comprising the simultaneous detection of one or more of the G85E (Chalkley G. et al. J. Med. Genet. 28: 875-877 (1991)), 405+lG>A (Dork T. et al. Hum Mol Genet. 2: 1965-1966 1993)), S549R (Kerem B. et al. Proc. Nat.Acad. Sci. 87: 8447-8451 (1990)), (or, depending on which of the two mutations produce this phenotype is tested for, Sangiuolo. et al. Genomics 9: 788-789 (1991)), W1089X (Shoshani T. et al. Hum. Molec. Genet. 3: 657-658 (1994)), DI 152H (Feldmann D. et al. Clin. Chem. 41 : 1675 (1995)) mutations in the human CFTR gene that are prevalent in populations of Middle Eastern descent using ARMS. The invention also relates to mutation specific and allele specific primers for use in the method, to diagnostic kits containing these primers and to techniques for detecting primer specific amplification products. Cystic fibrosis transmembrane conductance regulator (CFTR) functions as a chloride channel and controls the regulation of other transport pathways. The CFTR gene maps to chromosome 7q (Riordan J R. et al. Science 245: 1066-1073 (1989)). Mutations in the CFTR gene cause cystic fibrosis (CF) formerly known as cystic fibrosis of the pancreas. Cystic fibrosis is an autosomal recessive disorder mainly among Caucasians with a frequency of approximately 1/2 500 (Welsh MJ. et al. in Scriver et al. (eds): The Metabolic Basis of Inherited Disease, Vol 3: 7th ed. McGraw-Hill; New York, pp3799-3876 (1995)). Cystic fibrosis disrupts exocrine function of the pancreas, intestinal glands (meconium ileus), biliary tree (biliary cirrhosis), bronchial glands (chronic bronchopulmonary infection with emphysema), and sweat glands (high sweat electrolyte with depletion in a hot environment). Infertility occurs in both males and females. Many of the clinical and pathological findings are thought to be attributable to a generalised defect in mucus secretion due to an abnormality in the chloride channel.
The treatment of CF is complex, costly and time-consuming. Most children with CF in the developed world are followed in CF clinics which are typically multidisciplinary, involving physicians, nurses, social workers, nutritionists and physiotherapists. Treatment is directed at improving nutrition through the use of replacement pancreatic enzymes and vitamins, as well as a high-energy, high-protein and liberal-fat diet. For those not responding to this approach, enteral supplementation by nightly nasogastric, gastrostomy or jejunostomy infusion of high-energy diets has been used. Pulmonary treatment includes antibiotic therapy, either maintained continuously or reserved for exacerbations, and chest physiotherapy consisting of postural drainage, percussion, vibration and assisted coughing.
Approximately 70% of the mutations in CF patients correspond to a specific deletion of 3 basepairs, which results in the loss of a phenylalanine residue at amino acid position 508 of the CFTR protein (Kerem B. et al. Am. J. Hum. Genet. 44: 827-834 (1989)).
Mutations of the CFTR gene are believed to produce an abnormal protein as a component of the chloride channel gate at the cell surface and are classified according to their phenotypic manifestations. Class I are nonsense mutations, resulting in the introduction of a stop codon, and in no synthesis of CFTR e.g. G542X, R553X, W1282X. Class II mutations cause a block in CFTR assembly in the endoplasmic reticulum or affect transport to the cell membrane, these include ΔF508, A455E, and P574H. Class HI and IV mutations give rise to defective chloride channel activity or regulation e.g. Rl 17H, which alters amino acid residues in the first CFTR transmembrane domain. Class V mutations result in modulations in CFTR synthesis. In cases of CF involving class I and II CFTR mutations (most commonly ΔF508 homozygotes) chronic pulmonary disease is observed at variable levels with chronic pancreatitis. However, some CF patients present with "mild" symptoms ranging from sinopulmonary problems with pancreas sufficiency (PS-CF), to congenital bilateral absence of vas deferens (CBAVD). Mutations associated with PS-CF include R334W and R117H; the latter mutation accounts for approximately 0.8% of mutant alleles in Caucasian CF patients (Tsui LC. Trends Genet. 57: 392-398 (1992)).
There is a highly conserved polyT at the end of intron 8 of the CFTR gene. This polyT tract plays an important role in aiding splice branch site recognition, and identifying and using the splice acceptor site (Smith CW. et al. Nature. 342: 243-247 (1989)). There are three allelic variants depending on the number of thymidines (5, 7, or 9) with allele frequencies in the general population of 5%, 85%, 10%, and respectively (Chu C-S. et al. EMBO J. 10: 1355- 1363 (1991)). The number of thymidines determines the efficiency by which the intron 8 splice acceptor site is used. The efficiency decreases when a shorter stretch of thymidine residues is found. The T5 allele results in the most inefficient use of this splice acceptor site (Teng, H. et al. Hum. Mol. Genet. 6: 85-90 (1997)) and so CFTR transcripts from a T5 allele will lack exon 9 sequence. Individuals homozygous for the 5T allele were found to generate 90% CFTR mRNA with exon9 skipped (exon9~). While 7T homozygotes generated <25% exon9" transcripts, and 9T <15% (Lissens W. et al. Hum. Reprod. 11 : Supp4 55-77 (1996)). There is an association between phenotype and the particular polyT allelic background for some CF mutations, for example, if a CFTR gene with the Rl 17H mutation harbors a T5 allele, the mutant gene will be responsible for CF. An Rl 17H mutant CFTR gene that harbors a T7 allele can either result in CF or CBAVD (Kiesewetter S. et al. Nature Genet. 5: 274-278, (1993)).
The existence of polyT splice site variants may therefore explain the clinical heterogeneity observed in some mild cases of CF. It is also possible that the CF clinical phenotypes associated with mutations other than ΔF508 result from both the mutation in the CFTR gene and the sequence at exon9 splice site acceptor site. Most CFTR mutations occur on a particular polyT background, most commonly the
9T allele; ΔF508 is in linkage disequilibrium with the 9T allele and the mild CF mutation Rl 17H is always found on a 5T or 7T background. The mutation Rl 17H has been shown to owe its phenotypic heterogeneity (PS CF or CBAVD) to the presence of the 5T or 7T polyT alleles (Friedman KJ. et al. Hum Mutat. 10: 108-115 (1997)). Compound heterozygotes having the genotype ΔF508/R117H may present as PS-CF, CBAVD or be asymptomatic. Since the mutation ΔF508 is in linkage disequilibrium with the 9T allele, it has been demonstrated that the Rl 17H phenotype contrasts with respect to its associated polyT haplotype (Rl 17H-5T or Rl 17-7T). The incidence of 5T alleles is also associated with other clinical phenotypes, for example, disseminated bronchiectasis (Pignatti PF. et al. Am. J. Hum. Genet. 58: 889-892 (1996)). Hence the human CFTR gene intron 8 5T, 7T and 9T allele discriminatory test described and disclosed here is a test that is particularly useful when used in combination with any other cystic fibrosis diagnostic test.
Several cohort studies of screened and unscreened subjects have suggested that people identified with CF in the presymptomatic phase do better than those in whom a diagnosis is made because of symptoms. For example, one study (Dankert-Roelse JE. et al. J. Pediatr. 114: 362-367 (1989)) showed that, 88% of screened children but only 60% of unscreened children were still alive at age 11 years.
Diagnostic techniques for phenotypic manifestations of CF include measuring sweat chloride. Elevated sweat chloride concentrations (greater than 60 mmol/1) are almost exclusively observed in patients with CF. However, it is difficult to obtain sufficient sweat from newborns, even after stimulating localised sweating by administering pilocarpine into the skin it is often impossible to collect sufficient sweat for accurate analysis. Sweat chloride concentrations can be measured, for example, by using the Lazar ISM- 146 Micro Chloride electrode. Measurement of elevated immunoreactive trypsinogen (IRT) in a dried blood spot is another screening method for CF. False positives and false negatives are known to occur, with false negatives occurring more frequently in neonates with meconium ileus. The positive predictive value of the test is only 1-7% (Ryley HC. J. Clin. Pathol. 41 : 726-729 (1988),
Edminson PD. et al. Scand. J. Gastroenterol. Suppl. 143: 13-18 (1988)). A false positive rate of 93-99%o could and likely does generate considerable anxiety, which may be long-lasting (Ryley HC. J. Clin. Pathol. 41: 726-729 (1988)). Furthermore, elevations of IRT decline after the first few months of life, so while exact timing of specimen collection in the neonatal period is not critical, the collection of a second screening specimen to follow-up an initial abnormal screen should occur no earlier than 21 days, to avoid an increased number of false positives, and no later than 60 days, to reduce the risk of false negatives. Some newborn screening programs rely on other tests. The "BM meconium test" identifies infants with high albumin content in the stool resulting from pancreatic insufficiency but it has very low sensitivity (Naylor EW. Semin. Perinatol. 9: 232-249 (1985)).
Friedman et al. describe an allele-specific amplification polyT assay (Friedman KJ. et al. Hum. Mutat. 10: 108-115 (1997)) designed to screen individuals for CFTR intron 8 5T,
7T, 9T alleles and heterozygotic polyT allelic combinations. However, the assay described by
Friedman requires the use of each allele-specific primer in a separate reaction.
In our European Patent No. 0 332 435 Bl we disclose the Amplification Refractory
Mutation System (ARMS). This simple and elegant method permits the detection of point mutations via allele-specific amplification of target sequences. In EP-0 332 435 we disclose and claim the application of ARMS to a variety of inherited and/or acquired genetic disorders.
Multiplex allele-specific amplification assays have been described for the simultaneous analysis of several CF causing mutations (for example, see Ferrie RM. et al. Am. J. Hum. Genet. 51 : 251-262 (1992) and Robertson NH. et al. Eur. Respir. J. 12: 477-482
(1998)) as disclosed in our European Patent No. 0 928 832. The combination of different primers for the simultaneous detection of two or more point mutations is termed
"multiplexing". However, the design of robust and accurate allele-specific multiplex tests is not straightforward. A person skilled in the art would still need to contend with inter- and intra- primer reactions when several alleles are amplified simultaneously in one reaction; there may be further interactions between amplification products for one allele with the primers for another allele. Furthermore, there will be inequalities between the efficiencies amplification products from different alleles.
We now provide allele-specific primers for the 5T, 7T and 9T alleles in intron 8 of the CFTR gene that are designed for use in combination in a multiplex assay and function by bringing about an allele-specific size differential between CFTR intron 8 5T, 7T and 9T derived amplification products.
Therefore according to a first aspect of the invention we now provide a diagnostic method for the detection of the 5T, 7T and 9T alleles in intron 8 of the human CFTR gene which method comprises contacting a test sample of nucleic acid from an individual with a multiplex of diagnostic primers comprising (i) 5T variant primer 5'(N)nAAAGAC3', (ii) 7T variant primer 5'(N*)n*(N)nAAAAGC3' and (iii) 9T variant primer
5'(N*)n*(N)nAAAATC3', wherein N represents additional nucleotides which base pair with the corresponding genomic sequence in the respective allele and n is an integer between 10 and 30 and N* represents additional non-homologous nucleotides which do not base pair with the corresponding genomic sequence in the respective allele and n* is an integer between 5 and 60, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that a diagnostic primer is extended only when the corresponding allelic variant is present in the sample; and detecting the presence or absence of the allelic variant by reference to the presence or absence of a diagnostic primer extension product.
It will be appreciated that N* may be any other molecule that serves to reduce the electrophoretic mobility of an extension product such as 3'hexaethylene glycol (HEG) or a combination of such molecules and additional non-homologous nucleotides.
The diagnostic primers for use in the methods of the invention conveniently comprise one or more of
5T variant primer 5'(N)nTGTTAAAGAC3',
7T variant primer 5'(N*)n*(N)nTTAAAAAAGC3' and 9T variant primer 5 '(N*)n*(N)nAAAAAAAATC3 ' wherein N, n, N* and n* are as defined above and n is an integer between 6 and 26.
It will be understood that the nucleotide sequence as defined by (N)n in the diagnostic primer is normally selected to be 100%) complementary to the corresponding genomic sequence. However, as required, one or more mismatched bases may be included, for example at the 5' terminus of the primer. For example up to two, three, four or five mismatched base pairs may be included in the nucleotide sequence defined by (N)n. It will also be understood that any mismatched bases must not significantly impair the discriminatory properties of the diagnostic primer.
The integer n is for example 10, up to 15, up to 20, up to 25, or up to 30. Preferred diagnostic primers include
5T variant primer 5'TAATTCCCCAAATCCCTGTTAAAGAC3', 7T variant primer 5'(N*)n*TAATTCCCCAAATCCCTGTTAAAAAAGC3' and 9T variant primer 5'(N*)n*TAATTCCCCAAATCCCTGTTAAAAAAAATC3' wherein N* and n* are as defined above. Preferred diagnostic 7T and 9T primers are: 7T variant primer
5 'GTTAATCATTCAGCTACTACGCACCTAATTCCCCAAATCCCTGTTAAAAAAGC3 ' and 9T variant primer 5'GACTGTACGATACTCATTTATATGAAGTCAGCTACTTACCTATAGAACGCTTGC TAGTTTAATTCCCC AAATCCCTGTTAAAAAAAATC3 ' .
The above primers have been shown to detect their respective alleles reliably and robustly. Each of the primers disclosed above represents a further and independent aspect of the invention.
In many situations, it will be convenient to use a diagnostic primer of the invention with a further amplification primer in one or more cycles of PCR amplification. A convenient example of this aspect is set out in our European patent number EP-B1-0332435. Any convenient amplification primer may be useed provided that the resulting amplification products are of a suitable size for separation and analysis. The further amplification primer is conveniently the polyT common primer
GTACATAAAACAAGCATCTATTGAAAATATCTGAC and this is used in combination with the intron 8 5T, 7T and 9T allele-specific primers.
Therefore according to a further aspect of the invention we provide a diagnostic method for the detection of the 5T, 7T and 9T alleles in intron 8 of the human CFTR gene which method comprises contacting a test sample of nucleic acid from an individual with a multiplex of diagnostic primers comprising (i) 5T variant primer 5'(N)nAAAGAC3', (ii) 7T variant primer 5'(N*)n*(N)nAAAAGC3' and (iii) 9T variant primer
5'(N*)n*(N)nAAAATC3', wherein N represents additional nucleotides which base pair with the corresponding genomic sequence in the respective allele and n is an integer between 10 and 30 and N* represents additional non-homologous nucleotides which do not base pair with the corresponding genomic sequence in the respective allele and n* is an integer between 5 and 60, and a common amplification primer in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, and subjecting the mixture to PCR amplification such that a diagnostic primer is extended only when the corresponding allelic variant is present in the sample; and detecting the presence or absence of the allelic variant by reference to the presence or absence of a corresponding PCR amplification product.
The above aspects of the invention are referred to as primer set 1 and conveniently illustrated by reference to Table 1 and the disclosure of a specific primer mixl. References to primer "mixes" and "sets" are not intended to be limiting and the terms are used throughout the text interchangeably.
It will also be appreciated that we do not want to be limited solely to discrimination between the human CFTR gene intron 8 5T, 7T and 9T alleles by allele associated PCR product sizes; hence a further definition of N* is one from a group of labels that can be conjugated to primers whereby an individual label is associated specifically to one allele- specific primer and n* may be 0 or an integer greater than 1. An example of labels according to this definition of N* is a group of molecules such as fluorophores for example, (Brown T. and Brown DJS. in Newton CR. (ed): PCR - Essential Data: 1 st ed. Wiley; Chichester, pp57- 71 (1995)).
The primers may be manufactured using any convenient method of synthesis. Examples of such methods may be found in standard textbooks, for example "Protocols For Oligonucleotides And Analogues: Synthesis And Properties;" Methods In Molecular Biology Series; Volume 20; Ed. Sudhir Agrawal, Humana ISBN: 0-89603-247-7; 1993; 1st Edition.
It will be appreciated that any of the above diagnostic methods may, if appropriate, also be configured so that extension of the diagnostic primer indicates the absence of the respective CFTR gene polyT allele.
As outlined earlier above, the polyT methods of this invention may be used with any known CFTR testing procedure.
In addition we have now devised novel diagnostic primer sequences for the detection of the W1282X, 1717-lOA, G542X, N1303K, DF508 and 3849+lOkbOT mutations of the human CFTR gene using ARMS allele specific amplification. Therefore the polyT multiplex of the present invention is conveniently accompanied by the use in a separate ARMS reaction of one or more of :
DF508 mutant primer 5'(N)nACCATT3',
3849+10kb C>T mutant primer 5'(N)nTACGCA3',
N1303K mutant primer 5'(N)nTCCATC3',
1717-lOA mutant primer 5'(N)nTAATTA3', W1282X mutant primer 5'(N)nCAGTCA3\ and
G542X mutant primer 5'(N)nTTCTCT3' wherein N and n are as previously defined, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that a diagnostic primer is extended only when the corresponding allelic variant is present in the sample; and detecting the presence or absence of the allelic variant by reference to the presence or absence of a diagnostic primer extension product.
Two or more of the above diagnostic primers are conveniently used as a multiplex and more conveniently with a suitable amplificiation primer. Preferably several or all of the above primer sequences are used in a single multiplex reaction. Convenient primers include: W1282X mutant primer 5'(N)nGCAACAGTCA3', 1717-lOA mutant primer 5'(N)nTTGGTAATTA3\ G542X mutant primer 5'(N)nATAGTTCTCT3', N1303K mutant primer 5'(N)nGGGATCCATC3', DF508 mutant primer 5'(N)nAAACACCATT3' and
3849+1 Okb OT mutant primer 5'(N)nGTCTTACGCA3' wherein N, n, are as defined above and n is an integer between 6 and 26.
Preferred diagnostic primers include W1282X mutant primer 5'TCTTGGGATTCAATAACTTTGCAACAGTCA3', 1717-1G>A mutant primer 5'TCTCGAATTTTCTATTTTTGGTAATTA3', G542X mutant primer 5ΑGTTTGCAGAGAAAGACAATATAGTTCTCT3', N1303K mutant primer 5 GATCACTCCACTGTTCATAGGGATCCATC3', DF508 mutant primer 5'GTATCTATATTCATCATAGGAAACACCATT3', and 3849+ 1 Okb OT mutant primer 5 ' GAAC ATTTCCTTTC AGGGTGTCTT ACGC A3 ' .
The above aspects of the invention are referred to as primer set 2 A and illustrated by reference to Table 3 and the specific primer mix 2A. Primer mix 2A is conveniently used in combination with primer mix 1 as set out in Table 1.
We have also devised novel diagnostic primer sequences for detection by ARMS allele specific amplification of the DF508 normal allele, and the 621+1G>T, Rl 17H, R334W, G551D, R553X, and Rl 162X mutations of the human CFTR gene. Therefore the polyT multiplex of the present invention is conveniently accompanied by the use in a separate ARMS reaction of one or more of :
DF508 non-mutant primer 5'(N)nACCACA3\ W1282X mutant primer 5'(N)nCAGTCA3',
1717-1 mutant primer 5'(N)nTAATTA3',
G542X mutant primer 5'(N)nTTCTCT3',
N1303K mutant primer 5'(N)nTCCATC3\
DF508 non-mutant primer 5'(N)nACCACA3', DF508 mutant primer 5 '(N)nACCATT3 ' and
3849+1 Okb OT mutant primer 5'(N)nTACGCA3' wherein N and n are as previously defined, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that a diagnostic primer is extended only when the corresponding allelic variant is present in the sample; and detecting the presence or absence of the allelic variant by reference to the presence or absence of a diagnostic primer extension product.
Two or more of the above diagnostic primers are conveniently used as a multiplex and more conveniently with a suitable amplificiation primer. Preferably several or all of the above primer sequences are used in a single multiplex reaction.
Convenient diagnostic primers include: DF508 non-mutant primer 5'(N)nAAACACCACA3', Rl 17H mutant primer 5'(N)nGCGATAGACT3', 621+1G>T mutant primer 5'(N)nGAAGTATTGA3', R334W mutant primer 5 '(N)nATCATCCTGT3 ', Rl 162X mutant primer 5'(N)nTCTGTGAGTT3\ R553X mutant primer 5'(N)nTTCTTGCTGA3' and
G551D mutant primer 5'(N)nGCTCGTTGTT3' wherein N, n, are as defined above and n is an integer between 6 and 26. Preferred diagnostic primers include:
Rl 17H mutant primer5'AGCCTATGCCTAGATAAATCGCGATAGACT3', 621+lOT mutant primer 5'TGCCATGGGGCCTGTGCAAGGAAGTATTGA3', R334W mutant primer 5'CCTATGCACTAATCAAAGGAATCATCCTGT3', Rl 162X mutant primer 5'TATTTTTATTTCAGATGCGATCTGTGAGTT3', R553X mutant primer 5 TATTCACCTTGCTAAAGAAATTCTTGCTGA3', G551D mutant primer 5'GCTAAAGAAATTCTTGCTCGTTGTT3'.
The above aspects of the invention are referred to as primer set 2B and are conviently illustrated by reference to Table 3 and the specific primer mix 2B. Primer mix 2B is conveniently used in combination with mixl as set out in Table 1.We have also devised novel diagnostic primer sequences for the A455E, 2183AA>G, 3659delC, DI507, 1078delT, R347P, S1251N and E60X mutations of the human CFTR gene using ARMS allele specific amplification. Therefore the polyT multiplex of the present invention is conveniently accompanied by the use in a separate ARMS reaction of one or more of :
A455E mutant primer 5'(N)nGTTGTA3', 2183 AA>G mutant primer 5 ' (N)nGATAGC3 ' ,
3659delC mutant primer 5'(N)nCCTAGA3',
DI507 mutant primer 5'(N)nATAACT3', 1078delT mutant primer 5'(N)nTTCCTG3', R347P mutant primer 5'(N)nTCTACC3', S1251N mutant primer 5'(N)nGAAGCA3' and E60X mutant primer 5'(N)nCAGTTA3' wherein N and n are as previously defined, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that a diagnostic primer is extended only when the corresponding allelic variant is present in the sample; and detecting the presence or absence of the allelic variant by reference to the presence or absence of a diagnostic primer extension product. Two or more of the above diagnostic primers are conveniently used as a multiplex and more conveniently with a suitable amplificiation primer. Preferably several or all of the above primer sequences are used in a single multiplex reaction.
The diagnostic primer conveniently comprises one or more of A455E mutant primer 5'(N)nAGTTGTTGTA3', 1078delT mutant primer 5'(N)nAGGGTTCCTG3', R347P mutant primer 5'(N)nTTGTTCTACC3', DI507 mutant primer 5'(N)nGAAAATAACT3', 3659delC mutant primer 5'(N)nTAAACCTAGA3', 2183AA>G mutant primer 5'(N)nAAAAGATAGC3', S 125 IN mutant primer 5 ' (N)nCAGGGAAGC A3 ' and
E60X mutant primer 5'(N)nAAGCCAGTTA3' wherein N, n, are as defined above and n is an integer between 6 and 26.
Preferred diagnostic primers include A455E mutant primer 5 TCAAGATAGAAAGAGGACAGTTGTTGTA3', 1078delT mutant primer 5'CCTTCTTCTTCTCAGGGTTCCTG3',
R347P mutant primer 5'CACCATCTCATTCTGCATTGTTCTACC3', DI507 mutant primer 5'GCCTGGCACCATTAAAGAAAATAACT3', 3659delC mutant primer 5ΑTGCCAACAGAAGGTAAACCTAGA3', 2183AA>G mutant primer 5'CAAACTCTCCAGTCTGTTTAAAAGATAGC3', S1251N mutant primer 5'GGAAGAACTGGATCAGGGAAGCA3' and E60X mutant primer 5'TTAGGATTTTTCTTTGAAGCCAGTTA3'. The above aspects of the invention are referred to as primer set 2C and conveniently illustrated by reference to Table 4 and the specific primer mix 2C. Primer mix 2C is conveniently used in combination with mixl as set out in Table 1.
We have also devised novel diagnostic primer sequences for the detection of the G85E, 405+lG>A, S549R, W1089X and DI 152H mutations of the human CFTR gene using ARMS allele specific amplification. Therefore the polyT multiplex of the present invention is conveniently accompanied by the use in a separate ARMS reaction of one or more of :
G85E mutant primer 5'(N)nCTACGA3',
405+1 G>A mutant primer 5'(N)nTAGTGA3', S549R mutant primer 5'(N)nCTGACG3',
W1089X mutant primer 5'(N)nCAAATA3' and
DI 152H mutant primer 5'(N)nCACTTG3' wherein N and n are as previously defined, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that a diagnostic primer is extended only when the corresponding allelic variant is present in the sample; and detecting the presence or absence of the allelic variant by reference to the presence or absence of a diagnostic primer extension product.
Two or more of the above diagnostic primers are conveniently used as a multiplex and more conveniently with a suitable amplificiation primer. Preferably several or all of the above primer sequences are used in a single multiplex reaction. The diagnostic primer conveniently comprises one or more of
G85E mutant primer 5'(N)nTGTTCTACGA3', 405+lG>A mutant primer 5'(N)nTATTTAGTGA3', S549R mutant primer 5'(N)nCACACTGACG3', W1089X mutant primer 5'(N)nCTGCCAAATA3', DI 152H mutant primer 5'(N)nTATCCACTTG3 ' wherein N, n, are as defined above and n is an integer between 6 and 26.
Preferred diagnostic primers include: G85E mutant primer
5 'TAGCC ATTGATGACGGAGCGATGTTTTTTCTGGAGATTTATGTTCTACGA3 ' 405+1 G>A mutant primer
5 ' GATTTATGTTCT ATGGAATCTTTTT AT ATTTAGTGA3 ' , S549R mutant primer 5 GGAGAAGGTGGAATCACACTGACG3', W1089X mutant primer 5ΑAGCTCTGAATTTACATACTGCCAAATA3' and DI 152H mutant primer 5ΑAAGATGATAAGACTTACCAAGCTATCCACTTG3' The above aspects of the present invention are referred to as primer set 3 and conveniently illustrated by reference to Table 5 and the specific mix 3. Mix 3 may for example be used in combination with mixl as set out in Table 1.
The above primers in mixes 2A, 2B, 2C and 3 have been shown to detect their respective alleles reliably and robustly.
The primers may be manufactured using any convenient method of synthesis. Examples of such methods may be found in standard textbooks, for example "Protocols For Oligonucleotides And Analogues: Synthesis And Properties " Methods In Molecular Biology Series; Volume 20; Ed. Sudhir Agrawal, Humana ISBN: 0-89603-247-7; 1993; 1st Edition. It will be appreciated that any of the above diagnostic methods may, if appropriate, also be configured so that extension of the diagnostic primer indicates the absence of the respective CFTR gene mutation or polyT allele. The test sample of nucleic acid is preferably a blood sample but may also conveniently be a sample of any body fluid, or tissue obtained from an individual. The individual is any convenient mammal, preferably a human being. It will be appreciated that the test sample may equally be a nucleic acid sequence corresponding to the sequence in the test sample. That is to say that all or a part of the region in the sample nucleic acid may firstly be amplified using any convenient technique such as PCR before use in the method of the invention.
Any convenient enzyme for polymerisation may be used provided that it does not affect the ability of the DNA polymerase to discriminate between normal and mutant template sequences to any significant extent. Examples of convenient enzymes include thermostable enzymes which have no significant 3 '-5' exonuclease activity, for example Taq DNA polymerase, particularly "Ampli Taq Gold"™ DNA polymerase (PE Applied Biosystems), Stoffel fragment, or other appropriately N-terminal deleted modifications of Taq or Tth (Thermus thermophilus) DNA polymerases.
Significiantly the diagnostic methods of the invention can be used in combination to enable the presence or absence of mutations or polyT alleles of the CFTR gene to be detected simultaneously (i.e. the method comprises several multiplex tests). Primer Mix 1 can be used in isolation or in combination with any other cystic fibrosis diagnostic tests. Because the multiplex polyT test using the mix 1 primer mix adds value to the information derived from other cystic fibrosis diagnostic tests it is convenient to use the mix 1 primer mix in combination with the mix 2A primer mix. Similarly, it is convenient to use the mix 1 primer mix in combination with the mix 2B primer mix. Similarly, it is convenient to use the mix 1 primer mix in combination with the mix 2C primer mix. Similarly, it is convenient to use the mix 1 primer mix in combination with the mix 3 primer mix. Similarly, it is convenient to use the mix 1 primer mix in combination with any two of the mix 2A, 2B, 2C or 3 primer mixes. Similarly, it is convenient to use the mix 1 primer mix in combination with any three of the mix 2A, 2B, 2C or 3 primer mixes. Similarly, it is convenient to use the mix 1 primer mix in combination with all of the mix 2 A, 2B, 2C or 3 primer mixes. The above test combinations give genotype information by distinguishing between individuals who are heterozygous and homozygous for either of the CFTR polyT alleles and the more common DF508 CFTR gene mutation. If desired, the tests may provide genotype information for the 1717-1G>A, G542X, W1282X, N1303K, 3849+1 OkbOT, 621+lOT, R553X, G551D, R117H, R1162X, R334W, A455E, 2183AA>G, 3659delC, 1078delT, DI507, R347P, S 125 IN, E60X, G85E, 405+lOA, S549R, W1089X, and DI 152H CFTR gene mutations by the inclusion of primers specific for the normal CFTR gene sequences that correspond to the respective mutated CFTR gene sequences associated with these mutations. Whilst each multiplex test may have any of the primers described above in combination the prefeπed diagnostic primer multiplexes are the mix 1 comprising primers for the 5T, 7T and 9T alleles. Mix 2A comprising primers for the 1717-1G>A, G542X, W1282X, N1303K, DF508 and 3849+lOkbOT mutations; mix 2B comprising primers for the 621+lOT, R553X, G551D, Rl 17H, Rl 162X and R334W mutations and the normal CFTR gene sequence corresponding to the DF508 mutation; mix 2C comprising primers for the A455E, 2183AA>G, 3659delC, 1078delT, DI507, R347P, S1251N and E60X mutations; mix 3 comprising primers for the G85E, 405+lOA, S549R, W1089X, and DI 152H mutations.
We have developed a validated test using primer mix 2A for the 1717-1G>A, G542X, W1282X, N1303K, DF508 and 3849+1 OkbOT mutations and have applied these in a thorough investigation of the incidence of the mutations in 100 individuals.
In many situations, it will be convenient to use a diagnostic primer of the invention with a further amplification primer in one or more cycles of PCR amplification. A convenient example of this aspect is set out in our European patent number EP-B1-0332435. In the present application, the further amplification primer is either a 1717-1G>A common, G542X common, W1282X common, N1303K common, DF508 common or 3849+lOkbOT common primer. The 1717-lOA common primer TAATCTCTACCAAATCTGGATACTATACC is conveniently used in combination with the 1717-1G>A mutant primer, the G542X common primer TAATCTCTACCAAATCTGGATACTATACC is conveniently used in combination with the G542X mutant primer, the W1282X common primer GAATTCCCAAACTTTTAGAGACATC is conveniently used in combination with the W1282X mutant primer, the, N1303K common primer
CTTGATGGTAAGTACATGGGTTTTTCTTAT is conveniently used in combination with the N1303K mutant primer, the DF508 common primer CCAGACTTCACTTCTAATTATGATTATGGG is conveniently used in combination with the DF508 mutant primer, the 3849+1 OkbOT common primer
TTGTGGATCAAATTTCAGTTGACTTGTCATC is conveniently used in combination with the 3849+1 OkbOT mutant primer.
Any convenient control primer may be used. However, the amplification products from the Mix 1 primer mix serve as internal controls and so an additional amplification control is not required.
We have developed a validated test using primer mix 2B for the 621+1G>T, R553X, G551D, Rl 17H, Rl 162X and R334W mutations and the normal DF508 allele and have applied these in a thorough investigation of the incidence of the mutations in 100 individuals. In many situations, it will be convenient to use a diagnostic primer of the invention with a further amplification primer in one or more cycles of PCR amplification. A convenient example of this aspect is set out in our European patent number EP-B1-0332435. In the present application, the further amplification primer is either a 1717-1G>A common, G542X common, W1282X common, N1303K common, DF508 common or 3849+lOkbOT common primer. The DF508 common primer GACTTCACTTCTAATGATGATTATGGGAGA is conveniently used in combination with the DF508 normal primer, the 621+1G>T common primer GTTTCACATAGTGTATGACCCTCTATATACACTCATT is conveniently used in combination with the 621+1G>T mutant primer, the R553X common primer ATCTAAAATTGGAGCAATGTTGTTTTTGACC is conveniently used in combination with the R553X mutant primer, the G551D common primer ATCTAAAATTGGAGCAATGTTGTTTTTGACC is conveniently used in combination with the G551D mutant primer, the Rl 17H common primer
GTTTCACATAGTGTATGACCCTCTATATACACTCATT is conveniently used in combination with the Rl 17H mutant primer, the Rl 162X common primer TTTTGCTGTGAGATCTTTGACAGTCATTT is conveniently used in combination with the Rl 162X mutant primer, the R334W common primer
TTTGTTTATTGCTCCAAGAGAGTCATACCA is conveniently used in combination with the R334W mutant primer. Any convenient control primer may be used. We have selected control primers from unrelated regions of the genome, namely, part of the human apolipoprotein B gene and part of the ornithine decarboxylase gene.
We have developed a validated test using primer mix 2C for the A455E, 2183AA>G, 3659delC, 1078delT, DI507, R347P, S1251N and E60X mutations and have applied these in a thorough investigation of the incidence of the mutations in 100 individuals.
In many situations, it will be convenient to use a diagnostic primer of the invention with a further amplification primer in one or more cycles of PCR amplification. A convenient example of this aspect is set out in our European patent number EP-B1-0332435. In the present application, the further amplification primer is either a 621+1G>T common, R553X common, G551D common, Rl 17H common, Rl 162X common, R334W common or A455E common primer. The A455E common primer
GACTGACTGACTGACTGAAATGGAGACTTTTTGTTTATGTGGTTACTAA is conveniently used in combination with the A455E mutant primer, the 2183AA>G common primer GTATGATAGAGATTATATGCAATAAAACATTAACA is conveniently used in combination with the 2183 AA>G mutant primer, the 3659delC common primer
TGTGTCTAATATTGATTCTACTGTACAATAATAA is conveniently used in combination with the 3659delC mutant primer, the 1078delT common primer ATTTTTCCAAACTTCATTAGAACTGATCTATTGAC is conveniently used in combination with the 1078delT mutant primer, the DI507 common primer CACAGTAGCTTACCCATAGAGGAAACA is conveniently used in combination with the DI507 mutant primer, the R347P common primer
ATTTTTCCAAACTTCATTAGAACTGATCTATTGAC is conveniently used in combination with the R347P mutant primer, the S 125 IN common primer GCTCACCTGTGGTATCACTCCAA is conveniently used in combination with the S 125 IN mutant primer, the E60X common primer
AATCAAACTATGTTAAGGGAAATAGGACAACTAA is conveniently used in combination with the E60X mutant primer. Any convenient control primer may be used. We have selected control primers from unrelated regions of the genome, namely, part of the human apolipoprotein B gene and part of the ornithine decarboxylase gene.
We have developed a validated test using primer mix 3 for the G85E, 405+1 G>A, S549R, W1089X, and DI 152H mutations and have applied these in a thorough investigation of the incidence of the mutations in a number of individuals.
In many situations, it will be convenient to use a diagnostic primer of the invention with a further amplification primer in one or more cycles of PCR amplification. A convenient example of this aspect is set out in our European patent number EP-B1-0332435. In the present application, the further amplification primer is either a G85E common, 405+1 G>A common, S549R common, W1089X common, DI 152H common primer. The G85E and the 405+lOA common primer CGATTCGATTCAGTTTTCTGTGGTTTCTTAGTGTTTGGA is conveniently used in combination with the G85E mutant primer and/or the 405+lG>A mutant primer, the S549R common primer GTAATTTTTTTACATGAATGACATTTACAGCAA is conveniently used in combination with the S549R mutant primer, the W1089X common primer
GGAAATTATTTGTTTAACAATAAAACAATGGAA is conveniently used in combination with the W1089X mutant primer and the DI 152H common primer CCAACAACACCTCCAATACCAGTAAC is conveniently used in combination with the D 1152H mutant primer.
Any convenient control primer may be used. We have selected control primers from unrelated regions of the genome, namely, part of the human apolipoprotein B gene and part of the ornithine decarboxylase gene.
It will be appreciated that by combining intron 8 polyT allele-specific primers and their respective common primer and/or different mutant or normal primers and their respective common primers, or by using combinations of the 1 and 2 A and/or 2B and/or 2C and/or 3 primer sets or mixes for a given DNA sample, further useful diagnostic tests are provided which permit the simultaneous detection of alternative polyT alleles and/or several mutations in the CFTR gene. Each of these combinations will also include the addition of the appropriate control primers as set out in Tables 1 to 5 below. The combination of different primers for the simultaneous detection of two or more point mutations is termed "multiplexing"(see EP-B 1-0332435). A variety of methods may be used to detect the presence or absence of diagnostic primer extension products and/or amplification products. These will be apparent to the person skilled in the art of nucleic acid detection procedures. Preferred methods avoid the need for radiolabelled reagents. Particular detection methods include size separation of amplification products, for example as described in our patents numbers EP 0 332 435 & US 5595890, "ALEX" product detection (Haque K. et al. Diag. Mol. Pathol. &: 248-252 (1998)), the detection of amplification incorporated "Sunrise" probes (Nazarenko LA. et al. Nucl. Acids Res. 25: 2516-2521 (1997)), the detection of amplification incorporated "Scorpions" primers (Whitcombe D. et al. Nature Biotechnol. 17: 804-807 (1999)), the detection of fluorescence polarisation signal combined with dual labelled ARMS primers (Gibson NJ. et al. Clin. Chem. 43: 1336-1341 (1997)) patent number EP 0 382 433, the detection of intercalating dyes into ARMS products (Brownie J. et al. Nucl. Acids Res. 25: 3235-3241 (1997)) patent number EP 0 731 177, "taqman" product detection for example as described in patent numbers US-A- 5487972 & US-A-5210015; and "Molecular Beacons" product detection outlined in patent number WO-95/13399.
One or more of the primer mixes of the invention may be conveniently packaged with instructions for use in the method of the invention and appropriate packaging and sold as a kit. Convenient primer mixes include intron 8 polyT allele-specific primers and CFTR mutation- specific primers, equivalent normal-specific primers; all as hereinbefore disclosed. The kits will conveniently include one or more of the following: appropriate nucleotide triphosphates, for example one or more of dATP, dCTP, dGTP, and dTTP, a suitable polymerase as previously described, and a convenient buffer solution.
The invention will now be illustrated but not limited by reference to the following Examples, Tables and Figures in which:
Table 1 shows a specific primer mix 1 Table 2 shows a specific primer mix 2A Table 3 shows a specific primer mix 2B Table 4 shows a specific primer mix 2C Table 5 shows a specific primer mix 3
Figure 1 shows the relative location of the PCR product bands on an agarose electrophoresis gel corresponding to (PolyT) Fisure 2 shows the relative location of the PCR product bands on an agarose electrophoresis gel corresponding to a CFTR DF508 heterozygote, DF508 homozygote, DF508/ DI507 compound heterozygote, G542X heterozygote, G551D heterozygote, 1078delT heterozygote. (i.e figure from brochure) Figure 3 shows the relative location of the PCR product bands on an agarose electrophoresis gel corresponding to a (Middle Eastern Panel)
Figure 4 shows diagramatically the relative sizes in base pairs and the relative location of the PCR product bands on an agarose electrophoresis gel corresponding to the CFTR intron 8 5T, 7T and 9T alleles. Figure 5 shows diagramatically the size in base pairs and the relative location of the
PCR product bands on an agarose electrophoresis gel corresponding to the CFTR 1717-1G>A, G542X, W1282X, N1303K, DF508, 3849+lOkbOT, 621+1G>T, R553X, G551D, R117H, R1162X, R334W, A455E, 2183AA>G, 3659deIC, 1078deIT, DI507, R347P, S1251N, E6OX mutant alleles and the non-DF508 allele. Figure 6 shows diagramatically the size in base pairs and the relative location of the
PCR product bands on an agarose electrophoresis gel corresponding to the CFTR DI 152H, W1089X, G85E, 405+lOA, S549R mutant alleles.
Examples
Example 1.1 Materials Provided in a diagnostic kit containing 50tests (polyT)
1. 50 Vial 1 (colour coded) containing primers (5T, 7T, 9T), and deoxynucleotide triphosphates in buffer.
2. 1 vial dilution buffer.
3. 1 vial AmpliTaq Gold.
4. 1 vial loading dye.
5. 1 vial DNA control, contains human DNA in buffer. 6. Instructions for use.
Example 2.1 Materials Provided in a diagnostic kit containing 50 tests (CF20)
1. 50 Vial 2 A (colour coded) containing primers (mutant 1717-1G>A, G542X, W1282X, N1303K, DF508 and 3849+lOkbOT), control primers and deoxynucleotide triphosphates in buffer.
2. 50 Vial 2B (colour coded) containing primers (mutant 621+1G>T, R553X, G551D, Rl 17H, Rl 162X, R334W, normal DF508), control primers and deoxynucleotide triphosphates in buffer.
3. 50 Vial 2C (colour coded) containing primers (mutant A455E, 2183AA>G, 3659deIC, 1078deIT, DI507, R347P, S 125 IN, E6OX), control primers and deoxynucleotide triphosphates in buffer.
4. 1 vial dilution buffer.
5. 1 vial AmpliTaq Gold.
6. 1 vial loading dye. 7. 1 vial normal DNA control, contains human DNA unaffected by the mutations detected by the kit, in buffer. 8. Instructions for use.
Example 3.1 Materials Provided in a diagnostic kit containing 50tests (Middle Eastern) 1. 50 Vial 3 (colour coded) containing primers (DI 152H, W1089X, G85E,
405+lG>A, S549R ), control primers and deoxynucleotide triphosphates in buffer 2. 1 vial dilution buffer. 3. 1 vial AmpliTaq Gold.
4. 1 vial loading dye.
5. 1 vial normal DNA control, contains human DNA unaffected by the mutations detected by the kit, in buffer. 6. Instructions for use.
Example 4.1 Instructions for CF20 PCR amplification procedure
1. Program the thermal cycler for an activation program which holds the vials at 94 °C for 20 minutes and an amplification program of 0.5 minutes at 94 °C (denaturation), 2 minutes at 58 °C (annealing) and 1 minute at 72 °C (extension) for 35 cycles. Followed by a 20 minute 72 °C extension stage..
2. Label one vial A, one vial B and one vial C for each sample and control.
3. Micro fuge vials A, B and C until all liquid is at the bottom of each vial.
4. Prepare sufficient dilution of the AmpliTaq Gold for the number of samples and controls to be tested. For 10 samples or controls pipette 68 μL sterile deionized water, 20 μL dilution buffer, 100 μL loading dye and 12 μL AmpliTaq Gold into a micro fuge tube and mix gently.
5. Carefully open the vial lid and pipette 5 μL of the enzyme dilution into the A, B and C vials using separate tips and re-cap. 6. Pipette 5 μL of test or Normal DNA Control sample to each of a vial A, B and
C vials using separate tips. Add one drop of Sigma light white mineral oil to cover the aqueous phase if using a thermal cycler without a heated lid. Re-cap firmly.
7. For the negative control add 5 μL sterile water to a vial of each of A, B and C. Add one drop of Sigma light white mineral oil to cover the aqueous phase if using a thermal cycler without a heated lid. Re-cap firmly.
8. Microfuge vials A, B and C until all liquid is at the bottom of each vial.
9. Place all tubes firmly in the thermal cycler block. Initiate the 94 °C activation program. On completion of the activation program, run the amplification program.
10. On completion of the final extension stage , the samples may be stored at room temperature overnight or at 2-8 °C for up to 7 days before analysis by gel electrophoresis.
Instructions for CF Poly-T and CF-MEP PCR amplification procedure 1. Program the thermal cycler for an activation program which holds the vials at 94 °C for 20 minutes and an amplification program of 0.5 minutes at 94 °C (denaturation), 2 minutes at 58 °C (annealing) and 1 minute at 72 °C (extension) for 35 cycles. Followed by a 20 minute 72 °C extension stage.. 2. Label a vial for each sample and control.
3. Microfuge vials until all liquid is at the bottom of each vial.
4. Prepare sufficient dilution of the AmpliTaq Gold for the number of samples and controls to be tested. For 10 samples or controls pipette 68 μL sterile deionized water, 20 μL dilution buffer, 100 μL loading dye and 12 μL AmpliTaq Gold into a microfuge tube and mix gently.
5. Carefully open the vial lid and pipette 5 μL of the enzyme dilution into the vials using separate tips and re-cap.
6. Pipette 5 μL of test or DNA Control sample to each vial using separate tips. Add one drop of Sigma light white mineral oil to cover the aqueous phase if using a thermal cycler without a heated lid. Re-cap firmly.
7. For the negative control add 5 μL sterile water to a separate vial . Add one drop of Sigma light white mineral oil to cover the aqueous phase if using a thermal cycler without a heated lid. Re-cap firmly.
8. Microfuge vials until all liquid is at the bottom of each vial. 9. Place all tubes firmly in the thermal cycler block. Initiate the 94 °C activation program. On completion of the activation program, run the amplification program.
10. On completion of the final extension stage, the samples may be stored at room temperature overnight or at 2-8 °C for up to 7 days before analysis by gel electrophoresis.
Example 4.2 Procedure
1. 15 x 12 cm horizontal submarine gels with combs of 1.5 mm x 5 mm suspended 1 mm above the gel tray, were prepared using 100 mL of 3% NuSieve™ (FMC Corporation) 3:1 agarose in 134 mM (16.2 g/L) Tris-base, 74.9 mM (4.63 g/L) boric acid, 2.55 mM (0.95 g/L) EDTA buffer with 0.1 μg/mL ethidium bromide (TBE/EtBr). TBE/EtBr was also used as the running buffer. 2. A 50 Base-Pair Ladder (Amersham Pharmacia Biotech) at 1.5 μg/15μL was prepared in the loading dye (80 μL distilled water / lOμL loading dye / lOμL 50 Base-Pair Ladder). 15μL of this dilution was run adjacent to samples as a molecular weight marker.
3. 15 μL of PCR products from samples or control vials were loaded on a gel (for CF20 A, B and C trios were loaded in adjacent wells).
4. Electrophoresis was carried out at 5 to 6 V/cm between electrodes until the dye front had migrated 5 cm from the loading wells towards the anode (1.5 to 2 hours).
5. After electrophoresis the gels were placed on a UV transilluminator at 260 nm then visualised and photographed.
Example 4.3 Interpretation of Results for CF20 and CF-MEP
PCR products will be observed as bands in the vial tracks of the gel.
1. The upper and lower control band must be clearly visible in all samples.
2. All tracks should be free of excessive smearing and background fluorescence. 3. The position of the upper and lower control bands should indicate the correct molecular size (see Figure 5 or Figure 6).
4. The negative control should show no bands in the tracks within the area coπesponding to the upper and lower control bands. A diagnostic band should not be interpreted if a similar band is also seen in the negative control for that PCR run as this is indicative of contamination with genomic DNA.
If any of the above points are not observed the results should not be interpreted and a repeat test carried out.
5. An individual has two copies of the CFTR gene. Where these copies have the same sequence for any given site, an individual is described as being homozygous for this site. Where the copies differ in sequence at a given site, an individual is described as being heterozygous for this site.
6. The presence of PCR product generated from the normal DF508 primer in vial B of CF20 indicates that the sample contains the normal sequence for this site. The normal PCR product will be observed in the vial B track of the gel at 160bp and is identified by comparison of theband position with an adjacent marker track.
7. For CF20 the PCR products from an individual carrying any of the 1717-IOA, G542X, W1282X, N1303K, DF508 and 3849+lOkbOT mutations will be observed in the vial A track of the gel and are identified by comparison of the band position with an adjacent marker track. The product band sizes in base pairs are shown in Figure 5. Only product bands of the correct size should be interpreted.
8. For CF20 the PCR products from an individual carrying any of the 621+1G>T, R553X, G551D, Rl 17H, Rl 162X, and R334W mutations will be observed in the vial B track of the gel and are identified by comparison of the band position with an adjacent marker track. The product band sizes in base pairs are shown in Figure 5. Only product bands of the coπect size should be interpreted.
9. For CF20 the PCR products from an individual carrying any of the A455E, 2183AA>G, 3659delC, 1078deIT, DI507, R347P, S1251N and E60X mutations will be observed in the vial C track of the gel and are identified by comparison of the band position with an adjacent marker track. The product band sizes in base pairs are shown in Figure 5. Only product bands of the correct size should be interpreted.
Interpretation of Results for CF Poly-T
PCR products will be observed as bands in the vial tracks of the gel.
1. The bands should be of similar intensity to the 250bp band in the 50bp ladder, loaded at 1.5mg/15ml (Amersham Pharmacia Biotech).
2. At least one of the CF Poly-T products should be visible in each DNA sample. 3. No bands should be visible in the negative control
4. If any of the above points are not observed the results should not be interpreted and a repeat test carried out.
5. For CF Poly-T the product band sizes in base pairs are shown in Figure 4. Only product bands of the correct size should be interpreted. 6. As a result of allele expansion within the microsatellite region (TG)8-13, contiguous to the Poly-T region, the length of the diagnostic PCR products may vary. As a result very small product band shifts may be observed during electrophoresis. These shifts do not alter the interpretation of test results.
7. Owing to the nature of the sequence surrounding the Poly-T locus, heteroduplexes may occasionally be formed from the PCR products and may therefore be visible in some test sample tracks. The position of these heteroduplexes is indicated in figure
8. The observed heteroduplexes are summarised as follows: A 7T/7T individual may have a heteroduplex band larger than the 7T allele but not as large as the 9T allele.
A 5T/7T individual may have a heteroduplex that runs in a similar position to the 9T allele. Therefore if all three diagnostic bands are visible the individual's genotype is 5T/7T. The heteroduplex, if present, is generally weaker than the corresponding 5T and 7T diagnostic products.
A 5T/9T individual occasionally has a heteroduplex which run larger than the 9T allele.
Owing to the sequence variability in the region proximal to the Poly-T repeat, additional (previously unseen) heteroduplexes may be observed.
Example 4.4 Performance Characteristics
For CF20 one hundred EDTA blood samples were tested using the procedures described in Examples 4.1 and 4.2 in a 'blind' in-house study. Samples were prepared using the method described in Example 4.5. Each result obtained was confirmed for each of the 20 mutations using alternative methods. Of the 100 individuals tested, 92 were normal and 8 were DF508 heterozygotes.
In addition blood and mouthwash samples were taken from each of 40 individuals and tested using the diagnostic assay. The result obtained from each mouthwash sample was concordant with that obtained using the blood sample from the same individual.
A number of compound heterozygotes within the same multiplex test were sourced and analysed using the diagnostic assay. In all cases, both mutations were detected. Those tested were:
The 'A mix' 1717-lOA / N1303K, 1717-lOA / DF508, G542X / W1282X, G542X / N1303K,
G542X / DF508, W1282X / N1303K, W1282X / DF508 , W1282X /3849+lOkbOT, N1303K / DF508, DF508 / 3849+lOkbOT. The 'B mix'
R553X / G551D, R553X / R334W. Owing to the rarity of the remaining combinations and the subsequent unavailability of samples, other compound heterozygotes were not evaluated. The rare R1283M, 1717-2A>G, Rl 17C, 621+2T>C, Rl 17L, I506V mutations have been evaluated for cross reactivity. These were tested using the procedures described in Examples 1.2 and 1.3 and were not detected. In addition the following polymorphisms were not detected by the test: 3617G/T, 1655T/G (F508C), 1651A/G. Evaluation of known mutations and polymorphisms in the CFTR gene using the procedures described in Examples 4.1 and 4.2 has highlighted the following observations:
1. DI507 in combination with dupl 716+51 >61 will produce a PCR product of 233bp in the 'C mix' rather than the expected 222bp.
2. Slight cross reactivity of the R347P primer in the 'C mix' with the rare R347H mutation was observed which results in faint PCR product visible at the R347P position in the
'C mix'.
3. A recently reported mutation, 2184insG , will theoretically cross react with the
2183AA>G primer in the 'C mix'. A diagnostic 2183AA>G band may indicate that the
2184insG mutation is present. 4. The following mutations, which have not been checked due to unavailability of relevant samples, may interfere with test function: Rl 17P, 621+2T>G, R553G, R553Q,
R347L, I506T, I506S and the rare combination of DI507 with the polymorphism 1651A/G.
For CF Poly-T one hundred EDTA blood samples were tested using the procedures described in Examples 4.1 and 4.2 in a 'blind' in-house study. Samples were prepared using the method described in Example 4.5. The genotype for each sample was independently confirmed.
Additionally 100 mouthwash samples paired with the blood samples were tested on the CF
Poly-T test. The result obtained from each mouthwash sample was concordant with that obtained using the blood sample from the same individual.
There are a number of sequence variants in the CFTR gene of unknown frequency which are located close to the Poly-T tract. The following mutations, which have not been checked due to unavailability of relevant samples, may theorecticallyinterfere with test function:
1. The 1342-11TTT>G mutation which results in a (TG)13(T)3 individual with an apparent 5T disease state will produce diagnostic PCR product from the 5T primer.
2. The 1342-13G/T polymorphism which alters the final TG repeat to TT by substitution of the final does not affect the performance of the test as this polymorphism changes the status of individuals with respect to the polythymidine tract length. 3. The effects of the 1342- 1 G>C, and 1342-2A>C and 1342-2delAG mutations have not been tested but may affect the performance of the ELUCIGENE™ CF Poly-T test. For CF-MEP one hundred EDTA blood samples were tested using the procedures described in Examples 4.1 and 4.2 in a 'blind' in-house study. Samples were prepared using the method described in Example 4.5. All 100 samples tested were normal with respect to the CF-MEP mutations.
One compound heterozygotes within the same multiplex test was sourced and analysed using the diagnostic assay. In the sample G85E/D1152H both mutations were detected
Example 4.5 Method for Preparation of DNA from Whole Blood (EDTA) Samples:
1. Pipette 80 μL of each blood sample into a screw-topped microfuge tube.
2. Pipette 320 μL of 170 mM (9.09 g/L) NH4C1 solution into each tube.
3. Mix for 20 minutes by gentle swirling and inversion. Avoid vigorous agitation and formation of foam.
4. Centrifuge each tube for 2 minutes at 12 OOOg until a cell pellet is formed.
5. Using a pipette remove and discard the supernatant liquid.
6. Pipette 300 μL of 10 mM (0.58 g/L) NaCl/ 10 mM (3.72 g/L) EDTA into each tube and resuspend the cells by vortex mixing. 7. Centrifuge each tube for 1 minute at 12 OOOg until a cell pellet is formed.
8. Repeat steps 5 to 7 at least a further two times until all visible red coloration in the supernatant liquid has been removed.
9. Using a pipette remove and discard the supernatant liquid.
10. Pipette 200 μL of 50 mM (2 g/L) NaOH solution into each tube and resuspend the cells by vortex mixing.
11. Incubate at 100°C for 10 minutes.
12. Pipette 40 μL of 1 M (121.1 g/L) Tris/HCI (pH 7.5) into each tube and vortex mix.
13. Add 1ml sterile deionised water to each microfuge tube to give a total DNA sample volume of 1.24mL.
14. Centrifuge each tube for 1 minute at 12 OOOg until a pellet of cell debris is formed. The DNA is contained within the supernatant liquid. Example 4.6 Method for Preparation of DNA from Mouthwash Samples:
I. Agitate 10 mL of 0.9% saline in the mouth for 20 seconds. Collect the suspension in a sterile plastic universal tube. 2. Pellet the cells by centrifugation at 800g for 10 minutes at 18-28 °C.
3. Using a pipette remove and discard the supernatant liquid.
4. Pipette 500 μL of 10 mM (0.58 g/L) NaCl/10 mM (3.72 g/L) EDTA into each tube and resuspend the cells by vortex mixing.
5. Transfer each sample to a screw-capped microfuge tube. 6. Centrifuge each tube for 1 minute at 12 OOOg until a cell pellet is formed.
7. Using a pipette carefully remove and discard the supernatant liquid.
8. Pipette 500 μL of 50 mM (2g/L) NaOH solution into each tube and resuspend the cells by vortex mixing.
9. Incubate at 100°C for 10 minutes 10. Pipette 100 μL of 1 M (121.1 g/L) Tris/HCl (pH 7.5) into each tube and vortex mix.
I I . Centrifuge each tube for 1 minute at 12 OOOg until a pellet of cell debris is formed. The DNA is contained within the supernatant liquid.
12. Transfer 100 μL of the supernatant (DNA sample) to a fresh, labelled microfuge tube.
13. Add 400 μL of sterile deionised water to each DNA sample to give a total volume of 500 μL.
The mix formulation for mix 1 is presented below (Table 1). The 25μl total reaction volume also includes lx ARMS, lOOmM dNTP, 1.5U AmpliTaq Gold, lx CRS.
Table 1
The mix formulation for the 2A mix is presented below (Table 2). The 25μl total reaction volume also includes lx ARMS, lOOmM dNTP, 1.5U AmpliTaq Gold, lx CRS
Table 2
The mix formulation for the 2B mix is presented below (Table 3). The 25μl total reaction volume also includes lx ARMS, lOOmM dNTP, 1.5U AmpliTaq Gold, lx CRS.
Table 3
The mix formulation for the 2C mix is presented below (Table 4). The 25μl total reaction volume also includes lx ARMS, lOOmM dNTP, 1.5U AmpliTaq Gold, lx CRS.
Table 4
The mix formulation for mix 3 is presented below (Table 5). The 25μl total reaction volume also includes lx ARMS, lOOmM dNTP, 1.5U AmpliTaq Gold, lx CRS.
Table 5

Claims

Claims:
1. A diagnostic method for the detection of the 5T, 7T and 9T alleles in intron 8 of the human CFTR gene which method comprises contacting a test sample of nucleic acid from an individual with a multiplex of diagnostic primers comprising (i) 5T variant primer
5'(N)nAAAGAC3', (ii) 7T variant primer 5'(N*)n*(N)nAAAAGC3' and (iii) 9T variant primer 5'(N*)n*(N)nAAAATC3', wherein N represents additional nucleotides which base pair with the corresponding genomic sequence in the respective allele and n is an integer between 10 and 30 and N* represents additional non-homologous nucleotides which do not base pair with the corresponding genomic sequence in the respective allele and n* is an integer between 5 and 60, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that a diagnostic primer is extended only when the corresponding allelic variant is present in the sample; and detecting the presence or absence of the allelic variant by reference to the presence or absence of a diagnostic primer extension product.
2. A method as claimed in claim 1 and which comprises the detection of further human CFTR gene alleles by, in a separate ARMS reaction, the use of one or more of :
DF508 mutant primer 5'(N)nACCATT3', 3849+lOkb OT mutant primer 5'(N)nTACGCA3',
N1303K mutant primer 5'(N)nTCCATC3', 1717-lOA mutant primer 5'(N)nTAATTA3', W1282X mutant primer 5'(N)nCAGTCA3', and
G542X mutant primer 5'(N)nTTCTCT3' wherein N and n are as previously defined, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that a diagnostic primer is extended only when the corresponding allelic variant is present in the sample; and detecting the presence or absence of the allelic variant by reference to the presence or absence of a diagnostic primer extension product.
3. A method as claimed in claim 1 and which comprises the detection of further human CFTR gene alleles by, in a separate ARMS reaction, the use of one or more of : DF508 non-mutant primer 5'(N)nACCACA3', W1282X mutant primer 5'(N)nCAGTCA3',
1717-1 mutant primer 5'(N)nTAATTA3',
G542X mutant primer 5'(N)nTTCTCT3',
N1303K mutant primer 5'(N)nTCCATC3', DF508 non-mutant primer 5'(N)nACCACA3',
DF508 mutant primer 5'(N)nACCATT3' and
3849+1 Okb OT mutant primer 5'(N)nTACGCA3' wherein N and n are as previously defined, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that a diagnostic primer is extended only when the corresponding allelic variant is present in the sample; and detecting the presence or absence of the allelic variant by reference to the presence or absence of a diagnostic primer extension product.
4. A method as claimed in claim 1 and which comprises the detection of further human CFTR gene alleles by, in a separate ARMS reaction, the use of one or more of : A455E mutant primer 5'(N)nGTTGTA3',
2183AA>G mutant primer 5'(N)nGATAGC3', 3659delC mutant primer 5'(N)nCCTAGA3', DI507 mutant primer 5'(N)nATAACT3', 1078delT mutant primer 5'(N)nTTCCTG3\ R347P mutant primer 5'(N)nTCTACC3',
SI 25 IN mutant primer 5'(N)nGAAGCA3' and E60X mutant primer 5'(N)nCAGTTA3' wherein N and n are as previously defined, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that a diagnostic primer is extended only when the corresponding allelic variant is present in the sample; and detecting the presence or absence of the allelic variant by reference to the presence or absence of a diagnostic primer extension product.
5. A method as claimed in claim 1 and which comprises the detection of further human CFTR gene alleles by, in a separate ARMS reaction, the use of one or more of :
G85E mutant primer 5'(N)nCTACGA3', 405+lG>A mutant primer 5'(N)nTAGTGA3', S549R mutant primer 5'(N)nCTGACG3',
W1089X mutant primer 5'(N)nCAAATA3' and
DI 152H mutant primer 5'(N)nCACTTG3' wherein N and n are as previously defined, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that a diagnostic primer is extended only when the corresponding allelic variant is present in the sample; and detecting the presence or absence of the allelic variant by reference to the presence or absence of a diagnostic primer extension product.
6. A method as claimed in any one of the previous claims and which further comprises the use of one or more common amplification primer(s) in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, and subjecting the mixture to PCR amplification such that a diagnostic primer is extended only when the corresponding allelic variant is present in the sample; and detecting the presence or absence of the allelic variant by reference to the presence or absence of a corresponding PCR amplification product.
7. A method as claimed in any one of claims 2-6 and wherein two or more diagnostic primers are used as a multiplex.
8. A method as claimed in any one of claims 2-6 and wherein all of the diagnostic primers are used in a single multiplex reaction.
9. A method as claimed in any one of the previous claims and which further comprises the use of one or more control primers.
10. A method as claimed in claim 1 and used in conjunction with any known diagnostic CFTR gene procedure.
11. A diagnostic primer selected from any one of 5T variant primer 5'(N)nTGTTAAAGAC3', 7T variant primer 5 '(N*)n*(N)nTTAAAAAAGC3 ' and
9T variant primer 5'(N*)n*(N)nAAAAAAAATC3' wherein N, n, N* and n* are as defined in claim 1 and n is an integer between 6 and 26
12. A diagnostic primer selected from any one of
5T variant primer 5'TAATTCCCCAAATCCCTGTTAAAGAC3', 7T variant primer 5'(N*)n*TAATTCCCCAAATCCCTGTTAAAAAAGC3' and 9T variant primer 5 '(N*)n*TAATTCCCCAAATCCCTGTTAAAAAAAATC3 ' wherein N* and n* are as defined in claim 1.
13. A diagnostic primer selected from any one of 7T variant primer 5 'GTTAATCATTCAGCTACTACGCACCTAATTCCCCAAATCCCTGTTAAAAAAGC3 ' and 9T variant primer
5 ' GACTGTACGATACTCATTTATATGAAGTC AGCTACTTACCTATAGAACGCTTGC TAGTTTAATTCCCCAAATCCCTGTTAAAAAAAATC3 '
14. A set of diagnostic primers as set out in Table 1
15. A diagnostic primer selected from any one of DF508 mutant primer 5'(N)nACCATT3', 3849+lOkb OT mutant primer 5'(N)nTACGCA3', N1303K mutant primer 5'(N)nTCCATC3',
1717-lOA mutant primer 5'(N)nTAATTA3',
W1282X mutant primer 5'(N)nCAGTCA3', and
G542X mutant primer 5'(N)nTTCTCT3' wherein N and n are as defined in claim 1 and n is an integer between 6 and 26
16. A diagnostic primer selected from any one of W1282X mutant primer 5'(N)nGCAACAGTCA3', 1717-lOA mutant primer 5'(N)nTTGGTAATTA3\ G542X mutant primer 5'(N)nATAGTTCTCT3', N1303K mutant primer 5'(N)nGGGATCCATC3', DF508 mutant primer 5'(N)nAAACACCATT3' and
3849+1 Okb OT mutant primer 5'(N)nGTCTTACGCA3' wherein N and n are as defined in claim 1 and n is an integer between 6 and 26
17. A diagnostic primer selected from any one of
W1282X mutant primer 5'TCTTGGGATTCAATAACTTTGCAACAGTCA3', 1717-lOA mutant primer 5'TCTCGAATTTTCTATTTTTGGTAATTA3', G542X mutant primer 5 'AGTTTGCAGAGAAAGAC AATATAGTTCTCT3 ' , N1303K mutant primer 5'TGATCACTCCACTGTTCATAGGGATCCATC3', DF508 mutant primer 5'GTATCTATATTCATCATAGGAAACACCATT3', and 3849+lOkb OT mutant primer 5'GAACATTTCCTTTCAGGGTGTCTTACGCA3'.
18. A set of diagnostic primers as set out in Table 2
19. A diagnostic primer selected from any one of DF508 non-mutant primer 5'(N)nACCACA3', W1282X mutant primer 5'(N)nCAGTCA3', 1717-1 mutant primer 5'(N)nTAATTA3',
G542X mutant primer 5'(N)nTTCTCT3\
N1303K mutant primer 5'(N)nTCCATC3',
DF508 non-mutant primer 5'(N)nACCACA3',
DF508 mutant primer 5'(N)nACCATT3' and 3849+ 1 Okb OT mutant primer 5 ' (N)nT ACGC A3 ' wherein N and n are as defined in claim 1 and n is an integer between 6 and 26
20. A diagnostic primer selected from any one of DF508 non-mutant primer 5'(N)nAAACACCACA3', Rl 17H mutant primer 5'(N)nGCGATAGACT3',
621+1G>T mutant primer 5'(N)nGAAGTATTGA3',
R334W mutant primer 5'(N)nATCATCCTGT3',
Rl 162X mutant primer 5'(N)nTCTGTGAGTT3',
R553X mutant primer 5'(N)nTTCTTGCTGA3' and G551D mutant primer 5'(N)nGCTCGTTGTT3' wherein N and n are as defined in claim 1 and n is an integer between 6 and 26
21. A diagnostic primer selected from any one of
Rl 17H mutant primer5'AGCCTATGCCTAGATAAATCGCGATAGACT3', 621+lOT mutant primer 5'TGCCATGGGGCCTGTGCAAGGAAGTATTGA3', R334W mutant primer 5'CCTATGCACTAATCAAAGGAATCATCCTGT3', Rl 162X mutant primer 5'TATTTTTATTTCAGATGCGATCTGTGAGTT3', R553X mutant primer 5'TTATTCACCTTGCTAAAGAAATTCTTGCTGA3', G551D mutant primer 5'GCTAAAGAAATTCTTGCTCGTTGTT3'.
22. A set of diagnostic primers as set out in Table 3
23. A diagnostic primer selected from any one of A455E mutant primer 5'(N)nGTTGTA3', 2183AA>G mutant primer 5'(N)nGATAGC3', 3659delC mutant primer 5'(N)nCCTAGA3', DI507 mutant primer 5'(N)nATAACT3',
1078delT mutant primer 5'(N)nTTCCTG3',
R347P mutant primer 5'(N)nTCTACC3',
S 125 IN mutant primer 5'(N)nGAAGCA3' and
E60X mutant primer 5'(N)nCAGTTA3' wherein N and n are as defined in claim 1 and n is an integer between 6 and 26
24. A diagnostic primer selected from any one of A455E mutant primer 5'(N)nAGTTGTTGTA3', 1078delT mutant primer 5'(N)nAGGGTTCCTG3', R347P mutant primer 5'(N)nTTGTTCTACC3',
DI507 mutant primer 5'(N)nGAAAATAACT3\
3659delC mutant primer 5'(N)nTAAACCTAGA3',
2183AA>G mutant primer 5'(N)nAAAAGATAGC3',
S1251N mutant primer 5'(N)nCAGGGAAGCA3' and E60X mutant primer 5'(N)nAAGCCAGTTA3' wherein N and n are as defined in claim 1 and n is an integer between 6 and 26
25. A diagnostic primer selected from any one of
A455E mutant primer 5'TTCAAGATAGAAAGAGGACAGTTGTTGTA3', 1078delT mutant primer 5'CCTTCTTCTTCTCAGGGTTCCTG3', R347P mutant primer 5'CACCATCTCATTCTGCATTGTTCTACC3', DI507 mutant primer 5'GCCTGGCACCATTAAAGAAAATAACT3', 3659delC mutant primer 5ΑTGCCAACAGAAGGTAAACCTAGA3', 2183AA>G mutant primer 5'CAAACTCTCCAGTCTGTTTAAAAGATAGC3', SI 25 IN mutant primer 5'GGAAGAACTGGATCAGGGAAGCA3' and E60X mutant primer 5 TAGGATTTTTCTTTGAAGCCAGTTA3'.
26. A set of diagnostic primers as set out in Table 4
27. A diagnostic primer selected from any one of G85E mutant primer 5'(N)nCTACGA3', 405+lOA mutant primer 5'(N)nTAGTGA3\
S549R mutant primer 5'(N)nCTGACG3',
W1089X mutant primer 5'(N)nCAAATA3' and
DI 152H mutant primer 5'(N)nCACTTG3' wherein N and n are as defined in claim 1 and n is an integer between 6 and 26
28. A diagnostic primer selected from any one of G85E mutant primer 5'(N)nTGTTCTACGA3\ 405+lOA mutant primer 5'(N)nTATTTAGTGA3', S549R mutant primer 5'(N)nCACACTGACG3', Wl 089X mutant primer 5 '(N)nCTGCCAAATA3 ',
DI 152H mutant primer 5'(N)nTATCCACTTG3' wherein N and n are as defined in claim 1 and n is an integer between 6 and 26
29. A diagnostic primer selected from any one of G85E mutant primer
5 'TAGCCATTGATGACGGAGCGATGTTTTTTCTGGAGATTTATGTTCTACGA3 ' 405+1 G>A mutant primer 5'GATTTATGTTCTATGGAATCTTTTTATATTTAGTGA3', S549R mutant primer 5'TGGAGAAGGTGGAATCACACTGACG3', W1089X mutant primer 5ΑAGCTCTGAATTTACATACTGCCAAATA3' and DI 152H mutant primer 5ΑAAGATGATAAGACTTACCAAGCTATCCACTTG3'
30. A set of diagnostic primers as set out in Table 5
EP00960854A 1999-09-24 2000-09-19 Assay for detection of human cftr allele variants using specific diagnostic primers Withdrawn EP1242619A2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
GBGB9922527.8A GB9922527D0 (en) 1999-09-24 1999-09-24 Assay
GB9922527 1999-09-24
PCT/GB2000/003597 WO2001021833A2 (en) 1999-09-24 2000-09-19 Assay for detection of human cftr allele variants using specific diagnostic primers

Publications (1)

Publication Number Publication Date
EP1242619A2 true EP1242619A2 (en) 2002-09-25

Family

ID=10861465

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00960854A Withdrawn EP1242619A2 (en) 1999-09-24 2000-09-19 Assay for detection of human cftr allele variants using specific diagnostic primers

Country Status (5)

Country Link
EP (1) EP1242619A2 (en)
AU (1) AU7302200A (en)
CA (1) CA2385920A1 (en)
GB (1) GB9922527D0 (en)
WO (1) WO2001021833A2 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100112563A1 (en) * 2006-08-03 2010-05-06 National University Of Singapore Multiplex analysis of nucleic acids

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IE66125B1 (en) * 1991-01-31 1995-12-13 Zeneca Ltd Detection method for variant nucleotides
US5853989A (en) * 1991-08-27 1998-12-29 Zeneca Limited Method of characterisation of genomic DNA
WO1993018177A1 (en) * 1992-03-13 1993-09-16 The Children's Hospital Of Philadelphia Diagnosis of cystic fibrosis using allele specific multiplex polymerase chain reactions
GB9609441D0 (en) * 1996-05-04 1996-07-10 Zeneca Ltd Process
GB9800536D0 (en) * 1998-01-13 1998-03-11 Zeneca Ltd Sequences

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0121833A2 *

Also Published As

Publication number Publication date
WO2001021833A3 (en) 2002-07-25
WO2001021833A2 (en) 2001-03-29
GB9922527D0 (en) 1999-11-24
CA2385920A1 (en) 2001-03-29
AU7302200A (en) 2001-04-24

Similar Documents

Publication Publication Date Title
Tsai et al. Molecular and biochemical approaches in the identification of heterozygotes for homocystinuria
US20100144903A1 (en) Methods of diagnosis and treatment of crohn&#39;s disease
US20100184050A1 (en) Diagnosis and treatment of inflammatory bowel disease in the puerto rican population
US7419782B2 (en) Methods of using a major histocompatibility complex class III haplotype to diagnose Crohn&#39;s disease
WO1999010529A1 (en) Methods for analyzing ltc4 synthase polymorphisms and diagnostic use
JP2010535501A (en) Methods to identify individuals at risk of thiopurine drug resistance and thiopurine drug intolerance
CN108456721B (en) Method for synchronously detecting gene mutation and methylation and application thereof
CN110699446B (en) SNP marker rs3174298 related to non-syndrome cleft lip and palate diagnosis and application thereof
CN110656112B (en) Liddle syndrome gene detection kit
CN108753945B (en) SNP (single nucleotide polymorphism) locus related to obesity and/or hypertriglyceridemia of Chinese children and application thereof
WO2013078690A1 (en) Ankylosing spondylitis susceptibility and mononucleotide polymorphism detection method, kit and use thereof
Szulman et al. Investigation of pseudogenes RHDΨ and RHD-CE-D hybrid gene in D-negative blood donors by the real time PCR method
Prior et al. A model for molecular screening of newborns: simultaneous detection of Duchenne/Becker muscular dystrophies and cystic fibrosis
WO2001021833A2 (en) Assay for detection of human cftr allele variants using specific diagnostic primers
TWI351436B (en) Method for detecting a risk of the development of
Fortina et al. Non-radioactive detection of the most common mutations in the cystic fibrosis transmembrane conductance regulator gene by multiplex allele-specific polymerase chain reaction
WO1999018237A1 (en) Detection of allelic variants in human protease inhibitor gene
CN111690736A (en) Warfarin medication gene detection kit and use method thereof
Lucotte et al. Polymerase chain reaction detection of S and Z alpha-1-antitrypsin variants by duplex PCR assay
Ho et al. Rapid identification of heterozygous or homozygous JAK2V617F mutations in myeloproliferative neoplasms using melting curve analysis
Seyrantepe et al. Identification of mutations in the galactose‐1‐phosphate uridyltransferase (GALT) gene in 16 Turkish patients with galactosemia, including a novel mutation of F294Y
Tirado et al. Rapid detection of the 46C→ T polymorphism in the factor XII gene, a novel genetic risk factor for thrombosis, by melting peak analysis using fluorescence hybridization probes
EP3545102A1 (en) DETERMINATION OF THE GENOTYPE UNDERLYING THE S-s-U- PHENOTYPE OF THE MNSs BLOOD GROUP SYSTEM
JP7570087B2 (en) Pathogenic variant-based prostate cancer testing methods
AU2001260263B2 (en) Method and probes for the genetic diagnosis of hemochromatosis

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020411

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20050401