EP1242441A2 - Polynucleotide vaccines expressing codon optimized hiv-1 nef and modified hiv-1 nef - Google Patents
Polynucleotide vaccines expressing codon optimized hiv-1 nef and modified hiv-1 nefInfo
- Publication number
- EP1242441A2 EP1242441A2 EP00989282A EP00989282A EP1242441A2 EP 1242441 A2 EP1242441 A2 EP 1242441A2 EP 00989282 A EP00989282 A EP 00989282A EP 00989282 A EP00989282 A EP 00989282A EP 1242441 A2 EP1242441 A2 EP 1242441A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- nef
- dna
- seq
- hiv
- dna vaccine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/53—DNA (RNA) vaccination
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16311—Human Immunodeficiency Virus, HIV concerning HIV regulatory proteins
- C12N2740/16322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
Definitions
- the present invention relates to HIV Nef polynucleotide pharmaceutical products, as well as the production and use thereof which, when directly introduced into living vertebrate tissue, preferably a mammalian host such as a human or a non-human mammal of commercial or domestic veterinary importance, express the HIV Nef protein or biologically relevant portions thereof within the animal, inducing a cellular immune response which specifically recognizes human immunodeficiency virus-1 (HIV-1).
- the polynucleotides of the present invention are synthetic DNA molecules encoding codon optimized HIV-1 Nef and derivatives of optimized HIV-1 Nef, including nef mutants which effect wild type characteristics of Nef, such as myristylation and down regulation of host CD4.
- the polynucleotide vaccines of the present invention should offer a prophylactic advantage to previously uninfected individuals and/or provide a therapeutic effect by reducing viral load levels within an infected individual, thus prolonging the asymptomatic phase of HIV-1 infection.
- HIV-1 Human Immunodeficiency Virus- 1
- HIV-1 is an RNA virus of the Retroviridae family and exhibits the ⁇ 'LTR-gag-pol-env- LTR 3 Organization of all retroviruses.
- the integrated form of HIV-1, known as the provirus is approximately 9.8 Kb in length.
- Each end of the viral genome contains flanking sequences known as long terminal repeats (LTRs).
- LTRs long terminal repeats
- the HIV genes encode at least nine proteins and are divided into three classes; the major structural proteins (Gag, Pol, and Env), the regulatory proteins (Tat and Rev); and the accessory proteins (Vpu, Vpr, Vif and Nef).
- the gag gene encodes a 55-kilodalton (kDa) precursor protein ( ⁇ 55) which is expressed from the unspliced viral mRNA and is proteolytically processed by the HIV protease, a product of the pol gene.
- the mature p55 protein products are pl7 (matrix), p24 (capsid), p9 (nucleocapsid) and p6.
- the pol gene encodes proteins necessary for virus replication; a reverse transcriptase, a protease, integrase and RNAse H. These viral proteins are expressed as a Gag-Pol fusion protein, a 160 kDa precursor protein which is generated via a ribosomal frame shifting.
- the nef gene encodes an early accessory HIV protein (Nef) which has been shown to possess several activities such as down regulating CD4 expression, disturbing T-cell activation and stimulating HIV infectivity.
- the env gene encodes the viral envelope glycoprotein that is translated as a
- kDa precursor 160-kilodalton (kDa) precursor (gpl60) and then cleaved by a cellular protease to yield the external 120-kDa envelope glycoprotein (gpl20) and the transmembrane 41- kDa envelope glycoprotein (gp41).
- Gpl20 and gp41 remain associated and are displayed on the viral particles and the surface of HIV-infected cells.
- the tat gene encodes a long form and a short form of the Tat protein, a RNA binding protein which is a transcriptional transactivator essential for HIV-1 replication.
- the rev gene encodes the 13 kDa Rev protein, a RNA binding protein.
- the Rev protein binds to a region of the viral RNA termed the Rev response element (RRE).
- the Rev protein is promotes transfer of unspliced viral RNA from the nucleus to the cytoplasm.
- the Rev protein is required for HIV late gene expression and in turn, HIV replication.
- Gpl20 binds to the CD4/chemokine receptor present on the surface of helper T-lymphocytes, macrophages and other target cells in addition to other co-receptor molecules.
- X4 macrophage tropic
- R5 T-cell line tropic
- gp41 mediates the fusion event responsible for virus entry. The virus fuses with and enters the target cell, followed by reverse transcription of its single stranded RNA genome into the double-stranded DNA via a RNA dependent DNA polymerase.
- the viral DNA enters the cell nucleus, where the viral DNA directs the production of new viral RNA within the nucleus, expression of early and late HIV viral proteins, and subsequently the production and cellular release of new virus particles.
- provirus enters the cell nucleus, where the viral DNA directs the production of new viral RNA within the nucleus, expression of early and late HIV viral proteins, and subsequently the production and cellular release of new virus particles.
- Recent advances in the ability to detect viral load within the host shows that the primary infection results in an extremely high generation and tissue distribution of the virus, followed by a steady state level of virus (albeit through a continual viral production and turnover during this phase), leading ultimately to another burst of virus load which leads to the onset of clinical AIDS.
- Productively infected cells have a half life of several days, whereas chronically or latently infected cells have a 3-week half life, followed by non-productively infected cells which have a long half life (over 100 days) but do not significantly contribute to day to day viral loads seen throughout the course of disease.
- CD4 helper T lymphocytes which are critical to immune defense, is a major cause of the progressive immune dysfunction that is the hallmark of HIV infection.
- the loss of CD4 T-cells seriously impairs the body's ability to fight most invaders, but it has a particularly severe impact on the defenses against viruses, fungi, parasites and certain bacteria, including mycobacteria.
- the outcome of disease is the result of a balance between the kinetics and the magnitude of the immune response and the pathogen replicative rate and accessibility to the immune response.
- Pre-existing immunity may be more successful with an acute infection than an evolving immune response can be with an established infection.
- a second factor is the considerable genetic variability of the virus.
- anti-HIV-1 antibodies exist that can neutralize HIV-1 infectivity in cell culture, these antibodies are generally virus isolate-specific in their activity. It has proven impossible to define serological groupings of HIV-1 using traditional methods. Rather, the virus seems to define a serological "continuum" so that individual neutralizing antibody responses, at best, are effective against only a handful of viral variants.
- antigen in order to generate CTL responses antigen must be synthesized within or introduced into cells, subsequently processed into small peptides by the proteasome complex, and translocated into the endoplasmic reticulum/Golgi complex secretory pathway for eventual association with major histocompatibility complex (MHC) class I proteins.
- MHC major histocompatibility complex
- CD8 + T lymphocytes recognize antigen in association with class I MHC via the T cell receptor (TCR) and the CD8 cell surface protein.
- Activation of naive CD8 + T cells into activated effector or memory cells generally requires both TCR engagement of antigen as described above as well as engagement of costimulatory proteins.
- Optimal induction of CTL responses usually requires "help" in the form of cytokines from CD4 + T lymphocytes which recognize antigen associated with MHC class II molecules via TCR and CD4 engagement.
- the nef gene encodes an early accessory HIV protein (Nef) which has been shown to possess several activities such as down regulating CD4 expression, disturbing T-cell activation and stimulating HIV infectivity.
- Zazopoulos and Haseltine (1992, Proc. Natl. Acad. Sci. 89: 6634-6638) disclose mutations to the HIV-1 nef gene which effect the rate of virus replication. The authors show that the nef open reading frame mutated to encode Ala-2 in place of Gly-2 inhibits myristolation of the protein and results in delayed viral replication rates in Jurkat cells and PBMCs.
- mice with a Ub-nef construct containing an Arg residue at the amino terminus induces a Nef-specific CTL response.
- the authors reported a reduction in the humoral response from the Nef / IL-12 co-administration as compared to administration of the plasmid construct expressing Nef alone.
- the present invention addresses and meets this needs by disclosing a class of DNA vaccines based on host delivery and expression of the early HIV gene, nef.
- the present invention relates to synthetic DNA molecules (also referred to herein as “polynucleotides”) and associated DNA vaccines (also referred to herein as “polynucleotide vaccines”) which elicit CTL responses upon administration to the host, such as a mammalian host and including primates and especially humans, as well as non-human mammals of commercial or domestic veterinary importance.
- synthetic DNA molecules also referred to herein as "polynucleotides”
- associated DNA vaccines also referred to herein as “polynucleotide vaccines”
- the CTL-directed vaccines of the present invention should lower transmission rate to previously uninfected individuals and/or reduce levels of the viral loads within an infected individual, so as to prolong the asymptomatic phase of HTV-1 infection.
- the present invention relates to DNA vaccines which encode various forms of HIV-1 Nef, wherein administration, intracellular delivery and expression of the HIV-1 nef gene of interest elicits a host CTL and Th response.
- the preferred synthetic DNA molecules of the present invention encode codon optimized versions of wild type HIV-1 Nef, codon optimized versions of HIV-1 Nef fusion proteins, and codon optimized versions of HIV-1 Nef derivatives, including but not limited to nef modifications involving introduction of an amino-terminal leader sequence, removal of an amino-terminal myristylation site and/or introduction of dileucine motif mutations.
- the Nef-based fusion and modified proteins disclosed within this specification may possess altered trafficking and/or host cell function while retaining the ability to be properly presented to the host MHC I complex and in turn elicit a host CTL and Th response.
- a particular embodiment of the present invention relates to a DNA molecule encoding HIV-1 Nef from the HIV-1 jfrl isolate wherein the codons are optimized for expression in a mammalian system such as a human.
- the DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:l, while the expressed open reading frame is disclosed herein as SEQ ID NO:2.
- a codon optimized DNA molecule encoding a protein containing the human plasminogen activator (tpa) leader peptide fused with the NH 2 -terminus of the HIV-1 Nef polypeptide.
- the DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:3, while the expressed open reading frame is disclosed herein as SEQ ID NO:4.
- the present invention relates to a DNA molecule encoding optimized HIV-1 Nef wherein the open reading frame codes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu-174-Leu-175 dileucine motif to Ala-174-Ala-175, herein described as opt nef (G2A,LLAA).
- the DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:5, while the expressed open reading frame is disclosed herein as SEQ ID NO:6.
- Another additional embodiment of the present invention relates to a DNA molecule encoding optimized HIV-1 Nef wherein the amino terminal myristylation site and dileucine motif have been deleted, as well as comprising a tPA leader peptide.
- This DNA molecule, opt tpanef (LLAA) comprises an open reading frame which encodes a Nef protein containing a tPA leader sequence fused to amino acid residue 6-216 of HIV-1 Nef (jfrl), wherein Leu-174 and Leu-175 are substituted with Ala-174 and Ala-175, herein referred to as opt tpanef (LLAA) is disclosed herein as SEQ ID NO:7, while the expressed open reading frame is disclosed herein as SEQ ID NO:8.
- the present invention also relates to non-codon optimized versions of DNA molecules and associated DNA vaccines which encode the various wild type and modified forms of the HIV Nef protein disclosed herein. Partial or fully codon optimized DNA vaccine expression vector constructs are preferred, but it is within the scope of the present invention to utilize "non-codon optimized" versions of the constructs disclosed herein, especially modified versions of HIV Nef which are shown to promote a substantial cellular immune response subsequent to host administration.
- the DNA backbone of the DNA vaccines of the present invention are preferably DNA plasmid expression vectors.
- DNA plasmid expression vectors utilized in the present invention include but are not limited to constructs which comprise the cytomegalovirus promoter with the intron A sequence (CMV-intA) and a bovine growth hormone transcription termination sequence.
- DNA plasmid vectors of the present invention preferably comprise an antibiotic resistance marker, including but not limited to an ampicillin resistance gene, a neomycin resistance gene or any other pharmaceutically acceptable antibiotic resistance marker.
- an appropriate polylinker cloning site and a prokaryotic origin of replication sequence are also preferred.
- Specific DNA vectors of the present invention include but are not limited to VI, VIJ (SEQ ID NO:14), VlJneo (SEQ ED NO: 15), VlJns ( Figure 1A, SEQ ID NO: 16), V1R (SEQ ID NO:26), and any of the aforementioned vectors wherein a nucleotide sequence encoding a leader peptide, preferably the human tPA leader, is fused directly downstream of the CMV-intA promoter, including but not limited to VlJns-tpa, as shown in Figure IB and SEQ ID NO: 19.
- the present invention especially relates to a DNA vaccine and a pharmaceutically active vaccine composition which contains this DNA vaccine, and the use as a prophylactic and/or therapeutic vaccine for host immunization, preferably human host immunization, against an HIV infection or to combat an existing HIV condition.
- These DNA vaccines are represented by codon optimized DNA molecules encoding HIV-1 Nef of biologically active Nef modifications or Nef-containing fusion proteins which are ligated within an appropriate DNA plasmid vector, with or without a nucleotide sequence encoding a functional leader peptide.
- DNA vaccines of the present invention relate in part to codon optimized DNA molecules encoding HIV-1 Nef of biologically active Nef modifications or Nef-containing fusion proteins ligated in DNA vectors VI, VIJ (SEQ ID NO: 14), VlJneo (SEQ ID NO:15), VlJns ( Figure 1A, SEQ ID NO: 16), V1R (SEQ ID NO:26), or any of the aforementioned vectors wherein a nucleotide sequence encoding a leader peptide, preferably the human tPA leader, is fused directly downstream of the CMV-intA promoter, including but not limited to VlJns-tpa, as shown in Figure IB and SEQ ID NO: 19.
- Especially preferred DNA vaccines of the present invention include codon optimized DNA vaccine constructs VlJns/nef, VlJns/tpanef, VlJns/tpanef(LLAA) and VlJns/(G2A,LLAA), as exemplified in Example Section 2.
- the present invention also relates to HIV Nef polynucleotide pharmaceutical products, as well as the production and use thereof, wherein the DNA vaccines are formulated with an adjuvant or adjuvants which may increase immunogenicity of the DNA polynucleotide vaccines of the present invention, namely by increasing a humoral response to inoculation.
- a preferred adjuvant is an aluminum phosphate-based adjuvant or a calcium phosphate based adjuvant, with an aluminum phosphate adjuvant being especially preferred.
- Another preferred adjuvant is a non-ionic block copolymer, preferably comprising the blocks of polyoxyethylene (POE) and polyoxypropylene (POP) such as a POE- POP-POE block copolymer.
- a DNA vaccine or DNA polynucleotide vaccine or polynucleotide vaccine is a DNA molecule (i.e., "nucleic acid", “polynucleotide”) which contains essential regulatory elements such that upon introduction into a living, vertebrate cell, it is able to direct the cellular machinery to produce translation products encoded by the respective nef genes of the present invention.
- FIGURES Figure 1A-B show a schematic representation of DNA vaccine expression vectors VlJns (A) and VUns/tpa utilized for HIV-1 nef and HIV-1 modified nef constructs.
- Figure 2A-B show a nucleotide sequence comparison between wild type nef(jrfl) and codon optimized nef.
- the wild type nef gene from the jrfl isolate consists of 648 nucleotides capable of encoding a 216 amino acid polypeptide.
- WT wild type sequence (SEQ ED NO:9); opt, codon-optimized sequence (contained within
- Figure 3A-C show nucleotide sequences at junctions between nef coding sequence and plasmid backbone of nef expression vectors VlJns/nef ( Figure 3 A),
- VUns/nef(G2A,LLAA) Figure 3B
- VlJns/tpanef Figure 3C
- VI Jns/tpanef(LLAA) ( Figure 3C, also). 5' and 3' flanking sequences of codon optimized nef or codon optimized nef mutant genes are indicated by bold/italic letters; nef and nef mutant coding sequences are indicated by plain letters. Also indicated (as underlined) are the restriction endonuclease sites involved in construction of respective nef expression vectors. VlJns/tpanef and VlJns/tpanef (LLAA) have identical sequences at the junctions.
- Figure 4 shows a schematic presentation of nef and nef derivatives. Amino acid residues involved in Nef derivatives are presented. Glycine 2 and Leucinel74 and 175 are the sites involved in myristylation and dileucine motif, respectively. For both versions of the tpanef fusion genes, the putative leader peptide cleavage sites are indicated with "*", and a exogenous serine residue introduced during the construction of the mutants is underlined.
- Figure 5 shows Western blot analysis of nef and modified nef proteins expressed in transfected 293 cells. 293 cells grown in 100 mm culture dish were transfected with respective codon optimized nef constructs.
- A cells transfected with VUns/gag only;
- B cells transfected with VlJns/gag and VlJns/nef;
- C cells transfected with VlJns/gag and VlJns/nef(G2A, LLAA);
- D cells transfected with VlJns/gag and VlJns/tpanef;
- E cells transfected with VlJns/gag and VI Jns/tpanef(LLAA).
- the low case letter c and m represent medium and cellular fractions, respectively.
- M.W. molecular weight marker.
- Figure 6 shows an Elispot assay of cell-mediated responses to Nef peptides.
- Nef peptide pool A consists of all 21 Nef peptides; Nef peptide pool B consists of 11 non-overlapping peptide started from residue 1; Nef peptide pool C consists of 10 non-overlapping peptides started from residue 11. SFC, INF-gamma secreting spot-forming cells.
- Figure 7A-C show Nef-specific CD8 and CD4 epitope mapping.
- the immunization regime is as per Figure 6.
- Mouse splenocytes were isolated and fractionated into CD8 + and CD8 " cells using Miltenyi's magnetic cell separator. The resultant CD8 + and CD8 " cells were then tested in an Elispot assay against individual Nef peptides. SFC, INF-gamma secreting spot-forming cells.
- the mice strains tested are Balb/c mice ( Figure 7A), C57BL/6 mice ( Figure 7B), and C3H mice ( Figure 7C).
- FIG 8A-C show identification of a Nef CTL epitope.
- Splenocytes from nef immunized C57BL/6 mice were stimulated in vitro with peptide-pulsed, irradiated naive splenocytes for 7 days. Following the in vitro stimulation, cells were harvested and tested in a standard 51 Cr-releasing assay using peptide pulsed EL-4 cells as targets. Open symbol, specific killings of EL-4 cells without peptide; solid symbol, specific killing of EL-4 cells with peptide.
- Figure 9A-B shows a comparison of the immunogenicity of codon optimized
- experiment 1 In experiment 1 (Panel A), three codon optimized nef constructs were tested, namely, VlJns/nef, VlJns/tpanef (LLAA) and VI Jns/nef(G2A,LLAA), whereas in experiment 2 (Panel B) all four codon optimized nef constructs were tested.
- the data represent means plus standard deviation of 5 mice per group.
- the present invention relates to synthetic DNA molecules (also referred to herein as “nucleic acid” molecules or “polynucleotides”) and associated DNA vector vaccines (also referred to herein as “polynucleotide vaccines”) which elicit CTL and humoral responses upon administration to the host, including primates and especially humans.
- the present invention relates to DNA vector vaccines which encode various forms of HIV-1 Nef, wherein administration, intracellular delivery and expression of the HIV-1 nef gene of interest elicits a host CTL and Th response.
- the synthetic DNA molecules of the present invention encode codon optimized versions of wild type HIV-1 Nef, codon optimized versions of HIV-1 Nef fusion proteins, and codon optimized versions of HIV-1 Nef derivatives, including but not limited to nef modifications involving introduction of an amino-terminal leader sequence, removal of an amino-terminal myristylation site and/or introduction of dileucine motif mutations.
- the Nef-based fusion and modified proteins disclosed within this specification possess altered trafficking and/or host cell function while retaining the ability to be properly presented to the host MHC I complex.
- nef genes from HIV-2 strains which express Nef proteins having analogous function to HIV-1 Nef would be expected to generate immune responses analogous to those described herein for HIV-1 constructs.
- the immunogen In order to generate a CTL response, the immunogen must be synthesized within (MHO presentation) or introduced into cells (MHCII presentation). For intracellular synthesized immunogens, the protein is expressed and then processed into small peptides by the proteasome complex, and translocated into the endoplasmic reticulum/Golgi complex secretory pathway for eventual association with major histocompatibility complex (MHC) class I proteins.
- MHC major histocompatibility complex
- CD8 + T lymphocytes recognize antigen in association with class I MHC via the T cell receptor (TCR). Activation of naive CD8 + T cells into activated effector or memory cells generally requires both TCR engagement of antigen as described above as well as engagement of co-stimulatory proteins.
- Optimal induction of CTL responses usually requires "help" in the form of cytokines from CD4 + T lymphocytes which recognize antigen associated with MHC class II molecules via TCR.
- the HIV-1 genome employs predominantly uncommon codons compared to highly expressed human genes. Therefore, the nef open reading frame has been synthetically manipulated using optimal codons for human expression.
- a preferred embodiment of the present invention relates to DNA molecules which comprise a HIV-1 nef open reading frame, whether encoding full length nef or a modification or fusion as described herein, wherein the codon usage has been optimized for expression in a mammal, especially a human.
- the nucleotide sequence of the codon optimized version of HIV-1 jrfl nef gene is disclosed herein as SEQ ID NO: 1, as shown herein:
- codon usage for mammalian optimization is preferred: Met (ATG), Gly (GGC), Lys (AAG), Tip (TGG), Ser (TCC), Arg (AGG), Val (GTG), Pro (CCC), Thr (ACC), Glu (GAG); Leu (CTG), His (CAC), He (ATC), Asn (AAC), Cys (TGC), Ala (GCC), Gin (CAG), Phe (TTC) and Tyr (TAC).
- the open reading frame for SEQ ID NO:l above comprises an initiating methionine residue at nucleotides 12-14 and a "TAA" stop codon from nucleotides 660-662.
- the open reading frame of SEQ ED NO:l provides for a 216 amino acid HIV-1 Nef protein expressed through utilization of a codon optimized DNA vaccine vector.
- the 216 amino acid HIV-1 Nef (jfrl) protein is disclosed herein as SEQ ED NO:2, and as follows:
- HIV-1 Nef is a 206 amino acid cytosolic protein which associates with the inner surface of the host cell plasma membrane through myristylation of Gly-2 (Franchini et al., 1986, Virology 155: 593-599). While not all possible Nef functions have been elucidated, it has become clear that correct trafficking of Nef to the inner plasma membrane promotes viral replication by altering the host intracellular environment to facilitate the early phase of the HIV-1 life cycle and by increasing the infectivity of progeny viral particles.
- either the DNA vaccine vector molecule or the HIV-1 nef construct is modified to contain a nucleotide sequence which encodes a heterologous leader peptide such that the amino terminal region of the expressed protein will contain the leader peptide.
- the diversity of function that typifies eukaryotic cells depends upon the structural differentiation of their membrane boundaries. To generate and maintain these structures, proteins must be transported from their site of synthesis in the endoplasmic reticulum to predetermined destinations throughout the cell. This requires that the trafficking proteins display sorting signals that are recognized by the molecular machinery responsible for route selection located at the access points to the main trafficking pathways.
- Sorting decisions for most proteins need to be made only once as they traverse their biosynthetic pathways since their final destination, the cellular location at which they perform their function, becomes their permanent residence. Maintenance of intracellular integrity depends in part on the selective sorting and accurate transport of proteins to their correct destinations. Defined sequence motifs exist in proteins which can act as 'address labels'. A number of sorting signals have been found associated with the cytoplasmic domains of membrane proteins. An effective induction of CTL responses often required sustained, high level endogenous expression of an antigen. In light of its diverse biological activities, vaccines composed of wild-type Nef could potentially have adverse effects on the host cells.
- mutants lacking myristylation, by glycine-to-alanine change, change of the dileucine motif and/or by substitution with a tpa leader sequence as described herein, will be functionally defective, and therefore will have improved safety profile compared to wild-type Nef for use as an HIV-1 vaccine component.
- either the DNA vector or the HIV-1 nef nucleotide sequence is modified to include the human tissue-specific plasminogen activator (tPA) leader.
- tPA tissue-specific plasminogen activator
- a DNA vector which may be utilized to practice the present invention may be modified by known recombinant DNA methodology to contain a leader signal peptide of interest, such that downstream cloning of the modified HIV-1 protein of interest results in a nucleotide sequence which encodes a modified HIV-1 tPA/Nef protein.
- insertion of a nucleotide sequence which encodes a leader peptide may be inserted into a DNA vector housing the open reading frame for the Nef protein of interest.
- the end result is a polynucleotide vaccine which comprises vector components for effective gene expression in conjunction with nucleotide sequences which encode a modified HIV-1 Nef protein of interest, including but not limited to a HIV-1 Nef protein which contains a leader peptide.
- the amino acid sequence of the human tPA leader utilized herein is as follows: MDAMKRGLCCVLLLCGAVFVSPSEISS (SEQ ID NO: 19).
- the modifications introduced into the DNA vaccines of the present invention include but are not limited to additions, deletions or substitutions to the nef open reading frame which results in the expression of a modified Nef protein which includes an amino terminal leader peptide, modification or deletion of the amino terminal myristylation site, and modification or deletion of the dileucine motif within the Nef protein and which alter function within the infected host cell.
- a central theme of the DNA molecules and DNA vaccines of the present invention is (1) host administration and intracellular delivery of a codon optimized nef-based DNA vector vaccine; (2) expression of a modified Nef protein which is immunogenic in terms of eliciting both CTL and Th responses; and, (3) inhibiting or at least altering known early viral functions of Nef which have been shown to promote HIV-1 replication and load within an infected host.
- the nef coding region is altered, resulting in a DNA vaccine which expresses a modified Nef protein wherein the amino terminal Gly-2 myristylation residue is either deleted or modified to express alternate amino acid residues.
- the nef coding region is altered, resulting in a DNA vaccine which expresses a modified Nef protein wherein the dileucine motif is either deleted or modified to express alternate amino acid residues.
- the present invention relates to an isolated DNA molecule, regardless of codon usage, which expresses a wild type or modified Nef protein as described herein, including but not limited to modified Nef proteins which comprise a deletion or substitution of Gly 2, a deletion or substitution of Leu 174 and Leu 175 and/or inclusion of a leader sequence.
- the present invention also relates to a substantially purified protein expressed from the DNA polynucleotide vaccines of the present invention, especially the purified proteins set forth below as SEQ ID NOs: 2, 4, 6, and 8. These purified proteins may be useful as protein-based HIV vaccines.
- an open reading frame which encodes a Nef protein which comprises a tPA leader sequence fused to amino acid residue 6-216 of HIV-1 Nef (jfrl) is referred to herein as opt tpanef.
- the nucleotide sequence comprising the open reading frame of opt tpanef is disclosed herein as SEQ ED NO:3, as shown below:
- the open reading frame for SEQ ED NO:3 comprises an initiating methionine residue at nucleotides 2-4 and a "TAA" stop codon from nucleotides 713-715.
- the open reading frame of SEQ ID NO:3 provides for a 237 amino acid HIV-1 Nef protein which comprises a tPA leader sequence fused to amino acids 6-216 of HIV-1 Nef, including the dileucine motif at amino acid residues 174 and 175.
- This 237 amino acid tPA Nef (jfrl) fusion protein is disclosed herein as SEQ ED NO:4, and is shown as follows:
- this exemplified Nef protein contains both a tPA leader sequence as well as deleting the myristylation site of Gly-2A DNA molecule encoding HIV-1 Nef from the HIV-1 jfrl isolate wherein the codons are optimized for expression in a mammalian system such as a human.
- a DNA molecule which encodes optimized HIV-1 Nef wherein the open reading frame codes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu-174-Leu-175 dileucine motif to Ala-174-Ala-175.
- This open reading frame is herein described as opt nef (G2A LAA) and is disclosed as SEQ ED NO:5, which comprises an initiating methionine residue at nucleotides 12-14 and a "TAA" stop codon from nucleotides 660-662.
- nucleotide sequence of this codon optimized version of HIV-1 jrfl nef gene with the above mentioned modifications is disclosed herein as SEQ ID NO:5, as follows: GATCTGCCAC CATGGCCGGC AAGTGGTCCA AGAGGTCCGT GCCCGGCTGG TCCACCGTGA GGGAGAGGAT GAGGAGGGCC GAGCCCGCCG CCGACAGGGT GAGGAGGACC GAGCCCGCCG CCGTGGGCGT GGGCCGTG TCCAGGGACC TGGAGAAGCA CGGCGCCATC ACCTCCTCCA ACACCGCCGC CACCAACGCC GACTGCCT GGCTGGAGGC CCAGGAGGAC GAGGAGGTGG GCTTCCCCGT GAGGCCCCAG GTGCCCCTGA GGCCCATGAC CTACAAGGGC GCCGTGGACC TGTCCCACTT CCTGAAGGAG AAGGGCGGCC TGGAGGGCCT GATCCACTCC CAGAAGAGGC AGGACATCCT GGACCTGTGG GTGTGG GT
- SEQ ED NO:5 encodes Nef (G2A,LLAA), disclosed herein as SEQ ID NO:6, as follows: Met Ala Gly Lys Trp Ser Lys Arg Ser Val Pro Gly Trp Ser Thr Val Arg Glu Arg Met Arg Arg Ala Glu Pro Ala Ala Asp Arg Val Arg Arg Thr Glu Pro Ala Ala Val Gly Val Gly Ala Val Ser Arg Asp Leu Glu Lys His Gly Ala lie Thr Ser Ser Asn Thr Ala Ala Thr Asn Ala Asp Cys Ala Trp Leu Glu Ala Gin Glu Asp Glu Glu Val Gly Phe Pro Val Arg Pro Gin Val Pro Leu Arg Pro Met Thr Tyr Lys Gly Ala Val Asp Leu Ser His Phe Leu Lys Glu Lys Gly Gly Leu lie His Ser Gin Lys Arg Gin Asp lie Leu Asp Leu Trp Val Tyr His Thr Gin Gly Tyr Phe
- An additional embodiment of the present invention relates to another DNA molecule encoding optimized HIV-1 Nef wherein the amino terminal myristylation site and dileucine motif have been deleted, as well as comprising a tPA leader peptide.
- This DNA molecule, opt tpanef (LLAA) comprises an open reading frame which encodes a Nef protein containing a tPA leader sequence fused to amino acid residue 6-216 of HIV-1 Nef (jfrl), wherein Leu-174 and Leu-175 are substituted with Ala-174 and Ala-175 (Ala-195 and Ala-196 in this tPA-based fusion protein).
- the nucleotide sequence comprising the open reading frame of opt tpanef (LLAA) is disclosed herein as SEQ ED NO:7, as shown below:
- SEQ ID NO:7 The open reading frame of SEQ ID NO:7 encoding tPA-Nef (LLAA), disclosed herein as SEQ ID NO:8, is as follows:
- the present invention also relates in part to any DNA molecule, regardless of codon usage, which expresses a wild type or modified Nef protein as described herein, including but not limited to modified Nef proteins which comprise a deletion or substitution of Gly 2, a deletion of substitution of Leu 174 and Leu 175 and/or inclusion of a leader sequence. Therefore, partial or fully codon optimized DNA vaccine expression vector constructs are preferred since such constructs should result in increased host expression. However, it is within the scope of the present invention to utilize "non-codon optimized" versions of the constructs disclosed herein, especially modified versions of HIV Nef which are shown to promote a substantial cellular immune response subsequent to host administration.
- the DNA backbone of the DNA vaccines of the present invention are preferably DNA plasmid expression vectors.
- DNA plasmid expression vectors are well known in the art and the present DNA vector vaccines may be comprised of any such expression backbone which contains at least a promoter for RNA polymerase transcription, and a transcriptional terminator 3' to the HIV nef coding sequence.
- the promoter is the Rous sarcoma virus (RSV) long terminal repeat (LTR) which is a strong transcriptional promoter.
- RSV Rous sarcoma virus
- LTR long terminal repeat
- a more preferred promoter is the cytomegalovirus promoter with the intron A sequence (CMV-intA).
- a preferred transcriptional terminator is the bovine growth hormone terminator.
- an antibiotic resistance marker is also preferably included in the expression vector.
- Ampicillin resistance genes, neomycin resistance genes or any other pharmaceutically acceptable antibiotic resistance marker may be used.
- the antibiotic resistance gene encodes a gene product for neomycin resistance.
- the vector to aid in the high level production of the pharmaceutical by fermentation in prokaryotic organisms, it is advantageous for the vector to contain an origin of replication and be of high copy number. Any of a number of commercially available prokaryotic cloning vectors provide these benefits. In a preferred embodiment of this invention, these functionalities are provided by the commercially available vectors known as pUC. It is desirable to remove non-essential DNA sequences. Thus, the lacZ and lad coding sequences of pUC are removed in one embodiment of the invention.
- DNA expression vectors exemplified herein are also disclosed in PCT International Application No. PCT/US94/02751, International Publication No. WO 94/21797, hereby incorporated by reference.
- a first DNA expression vector is the expression vector pnRSV, wherein the rous sarcoma virus (RSV) long terminal repeat (LTR) is used as the promoter.
- RSV rous sarcoma virus
- LTR long terminal repeat
- a second embodiment relates to plasmid VI, a mutated pBR322 vector into which the CMV promoter and the BGH transcriptional terminator is cloned.
- Another embodiment regarding DNA vector backbones relates to plasmid VIJ.
- Plasmid VIJ is derived from plasmid VI and removes promoter and transcription termination elements in order to place them within a more defined context, create a more compact vector, and to improve plasmid purification yields. Therefore, VIJ also contains the CMVintA promoter and (BGH) transcription termination elements which control the expression of the HIV nef-based genes disclosed herein.
- the backbone of VIJ is provided by pUC18. It is known to produce high yields of plasmid, is well-characterized by sequence and function, and is of minimum size.
- VlJns A DNA expression vector specifically exemplified herein is VlJns, which is the same as VIJ except that a unique Sfil restriction site has been engineered into the single Kpnl site at position 2114 of VI J-neo.
- V1R DNA expression vector for use as the backbone to the HIV-1 nef-based DNA vaccines of the present invention.
- V1R DNA expression vector for use as the backbone to the HIV-1 nef-based DNA vaccines of the present invention.
- This vector as much non-essential DNA as possible is "trimmed" from the vector to produce a highly compact vector.
- This vector is a derivative of VlJns. This vector allows larger inserts to be used, with less concern that undesirable sequences are encoded and optimizes uptake by cells when the construct encoding specific influenza virus genes is introduced into surrounding tissue.
- vector/Nef antigen constructs may be generated. While the exemplified constructs (VlJns/nef, VlJns/tpanef, VlJns/tpanef(LLAA) and VlJns/(G2A,LLAA) are preferred, any number of vector/Nef antigen combinations are within the scope of the present invention, especially wild type or modified Nef proteins which comprise a deletion or substitution of Gly 2, a deletion of substitution of Leu 174 and Leu 175 and/or inclusion of a leader sequence.
- the present invention especially relates to DNA vaccines and a pharmaceutically active vaccine composition which contains this DNA vector vaccine, and the use as prophylactic and/or therapeutic vaccine for host immunization, preferably human host immunization, against an HIV infection or to combat an existing HIV condition.
- DNA vaccines are represented by codon optimized DNA molecules encoding HIV-1 Nef of biologically active Nef modifications or Nef-containing fusion proteins which are ligated within an appropriate DNA plasmid vector, with or without a nucleotide sequence encoding a functional leader peptide.
- DNA vaccines of the present invention include but in no way are limited to codon optimized DNA molecules encoding HIV-1 Nef of biologically active Nef modifications or Nef-containing fusion proteins ligated in DNA vectors VI, VIJ (SEQ ID NO: 14), VlJneo (SEQ ED NO: 15), VlJns ( Figure 1A, SEQ ED NO: 16), V1R (SEQ ID NO:26), or any of the aforementioned vectors wherein a nucleotide sequence encoding a leader peptide, preferably the human tPA leader, is fused directly downstream of the CMV-intA promoter, including but not limited to VlJns-tpa, as shown in Figure IB and SEQ ID NO: 19.
- DNA vaccines of the present invention include as VlJns/nef, VlJns/tpanef, VlJns/tpanef (LLAA) and VUns/(G2A,LLAA), as exemplified in Example Section 2.
- the DNA vector vaccines of the present invention may be formulated in any pharmaceutically effective formulation for host administration. Any such formulation may be, for example, a saline solution such as phosphate buffered saline (PBS). It will be useful to utilize pharmaceutically acceptable formulations which also provide long-term stability of the DNA vector vaccines of the present invention.
- PBS phosphate buffered saline
- DNA plasmid vaccines undergo a physiochemical change in which the supercoiled plasmid converts to the open circular and linear form.
- a variety of storage conditions can accelerate this process. Therefore, the removal and/or chelation of trace metal ions (with succinic or malic acid, or with chelators containing multiple phosphate ligands) from the DNA plasmid solution, from the formulation buffers or from the vials and closures, stabilizes the DNA plasmid from this degradation pathway during storage.
- non-reducing free radical scavengers such as ethanol or glycerol
- inclusion of non-reducing free radical scavengers are useful to prevent damage of the DNA plasmid from free radical production that may still occur, even in apparently demetalated solutions.
- the buffer type, pH, salt concentration, light exposure, as well as the type of sterilization process used to prepare the vials may be controlled in the formulation to optimize the stability of the DNA vaccine.
- formulations that will provide the highest stability of the DNA vaccine will be one that includes a demetalated solution containing a buffer (phosphate or bicarbonate) with a pH in the range of 7-8, a salt (NaCl, KCl or LiCl) in the range of 100-200 mM, a metal ion chelator (e.g., EDTA, diethylenetriaminepenta-acetic acid (DTP A), malate, inositol hexaphosphate, tripolyphosphate or polyphosphoric acid), a non-reducing free radical scavenger (e.g.
- a buffer phosphate or bicarbonate
- a salt NaCl, KCl or LiCl
- a metal ion chelator e.g., EDTA, diethylenetriaminepenta-acetic acid (DTP A), malate, inositol hexaphosphate, tripolyphosphate or polyphosphoric acid
- DTP A diethylenetri
- a particularly preferred formulation which will enhance long term stability of the DNA vector vaccines of the present invention would comprise a Tris-HCl buffer at a pH from about 8.0 to about 9.0; ethanol or glycerol at about 3% w/v; EDTA or DTPA in a concentration range up to about 5 mM; and NaCl at a concentration from about 50 mM to about 500 mM.
- a Tris-HCl buffer at a pH from about 8.0 to about 9.0
- ethanol or glycerol at about 3% w/v
- EDTA or DTPA in a concentration range up to about 5 mM
- NaCl at a concentration from about 50 mM to about 500 mM.
- the DNA vector vaccines of the present invention may, in addition to generating a strong CTL-based immune response, provide for a measurable humoral response subsequent immunization. This response may occur with or without the addition of adjuvant to the respective vaccine formulation.
- the DNA vector vaccines of the present invention may also be formulated with an adjuvant or adjuvants which may increase immunogenicity of the DNA polynucleotide vaccines of the present invention.
- a number of these adjuvants are known in the art and are available for use in a DNA vaccine, including but not limited to particle bombardment using DNA-coated gold beads, co-administration of DNA vaccines with plasmid DNA expressing cytokines, chemokines, or costimulatory molecules, formulation of DNA with cationic lipids or with experimental adjuvants such as saponin, monophosphoryl lipid A or other compounds which increase immunogenicity of the DNA vaccine.
- One preferred adjuvant for use in the DNA vector vaccines of the present invention are one or more forms of an aluminum phosphate-based adjuvant.
- Aluminum phosphate is known in the art for use with live, killed or subunit vaccines, but is only recently disclosed as a useful adjuvant in DNA vaccine formulations.
- the artisan may alter the ratio of DNA to aluminum phosphate to provide for an optimal immune response.
- the aluminum phosphate-based adjuvant possesses a molar PO ⁇ Al ratio of approximately 0.9, and may again be altered by the skilled artisan to provide for an optimal immune response.
- An additional mineral-based adjuvant may be generated from one or more forms of a calcium phosphate. These mineral-based adjuvants are useful in increasing humoral responses to DNA vaccination without imparting a negative effect on an appropriate cellular immune response. Complete guidance for use of these mineral-based compounds for use as DNA vaccines adjuvants are disclosed in PCT International Application No. PCT/US98/02414, PCT International Publication No.
- WO 98/35562 which are hereby incorporated by reference in their entirety.
- Another preferred adjuvant is a non-ionic block copolymer which shows adjuvant activity with DNA vaccines.
- the basic structure comprises blocks of polyoxyethylene (POE) and polyoxypropylene (POP) such as a POE-POP-POE block copolymer.
- POE polyoxyethylene
- POP polyoxypropylene
- Newman et al. (1998, Critical Reviews in Therapeutic Drug Carrier Systems 15(2): 89-142) review a class of non-ionic block copolymers which show adjuvant activity.
- the basic structure comprises blocks of polyoxyethylene (POE) and polyoxypropylene (POP) such as a POE-POP-POE block copolymer. Newman et al.
- POE-POP-POE block copolymers may be useful as adjuvants to an influenza protein-based vaccine, namely higher molecular weight POE-POP-POE block copolymers containing a central POP block having a molecular weight of over about 9000 daltons to about 20,000 daltons and flanking POE blocks which comprise up to about 20% of the total molecular weight of the copolymer (see also U.S. Reissue Patent No. 36,665, U.S. Patent No. 5,567,859, U.S. Patent No.
- the DNA vector vaccines of the present invention are administered to the host by any means known in the art, such as enteral and parenteral routes. These routes of delivery include but are not limited to intramusclar injection, intraperitoneal injection, intravenous injection, inhalation or intranasal delivery, oral delivery, sublingual administration, subcutaneous administration, transdermal administration, transcutaneous administration, percutaneous administration or any form of particle bombardment, such as a biolostic device such as a "gene gun” or by any available needle-free injection device.
- the preferred methods of delivery of the HIV-1 Nef- based DNA vaccines disclosed herein are intramuscular injection and needle-free injection. An especially preferred method is intramuscular delivery.
- the amount of expressible DNA to be introduced to a vaccine recipient will depend on the strength of the transcriptional and translational promoters used in the DNA construct, and on the immunogenicity of the expressed gene product.
- an immunologically or prophylactically effective dose of about 1 ⁇ g to greater than about 20 mg, and preferably in doses from about 1 mg to about 5 mg is administered directly into muscle tissue.
- subcutaneous injection, intradermal introduction, impression through the skin, and other modes of administration such as intraperitoneal, intravenous, inhalation and oral delivery are also contemplated.
- booster vaccinations are to be provided in a fashion which optimizes the overall immune response to the Nef-based DNA vector vaccines of the present invention.
- the aforementioned polynucleotides when directly introduced into a vertebrate in vivo, express the respective HIV-1 Nef protein within the animal and in turn induce a cytotoxic T lymphocyte (CTL) response within the host to the expressed Nef antigen.
- CTL cytotoxic T lymphocyte
- the present invention also relates to methods of using the HIV-1 Nef-based polynucleotide vaccines of the present invention to provide effective immunoprophylaxis, to prevent establishment of an HIV-1 infection following exposure to this virus, or as a post-HIV infection therapeutic vaccine to mitigate the acute HIV-1 infection so as to result in the establishment of a lower virus load with beneficial long term consequences.
- the present invention contemplates a method of administration or use of the DNA nef-based vaccines of the present invention using an any of the known routes of introducing polynucleotides into living tissue to induce expression of proteins.
- the present invention provides for methods of using a DNA nef- based vaccine utilizing the various parameters disclosed herein as well as any additional parameters known in the art, which, upon introduction into mammalian tissue induces in vivo, intracellular expression of these DNA nef-based vaccines.
- This intracellular expression of the Nef-based immunogen induces a CTL and humoral response which provides a substantial level of protection against an existing HIV-1 infection or provides a substantial level of protection against a future infection in a presently uninfected host.
- Vaccine Vectors VI - Vaccine vector VI was constructed from pCMVIE-AKI-DHFR (Whang et al., 1987, J. Virol. 61: 1796). The AKI and DHFR genes were removed by cutting the vector with EcoRI and self-ligating. This vector does not contain intron A in the CMV promoter, so it was added as a PCR fragment that had a deleted internal Sad site [at 1855 as numbered in Chapman, et al., (1991, Nuc. Acids Res. 19: 3979)].
- the template used for the PCR reactions was pCMVintA-Lux, made by ligating the Hindlll and Nhel fragment from pCMV6al20 (see Chapman et al., ibid.), which includes hCMV-IEl enhancer/promoter and intron A, into the Hindlll and Xbal sites of pBL3 to generate pCMVIntBL.
- the 1881 base pair luciferase gene fragment (Hindlll-Smal Klenow filled-in) from RSV-Lux (de Wet et al., 1987, Mol. Cell Biol.
- the primers that spanned intron A are: 5' primer: 5'-CTATATAAGCAGAGCTCGTTTAG-3' (SEQ ID NO: 10); 3' primer:
- the primers used to remove the Sad site are: sense primer, 5'-GTATGTGTCTG AAAATGAGC GTGGAGATTGGGCTCGCAC-3' (SEQ ID NO: 12) and the antisense primer, 5'-GTGCGAGCCCAATCTCCACGCTCATTTTCAGAC ACATAC-3' (SEQ ID NO: 13).
- the PCR fragment was cut with Sac I and Bgl II and inserted into the vector which had been cut with the same enzymes.
- VIJ - Vaccine vector VIJ was generated to remove the promoter and transcription termination elements from vector VI in order to place them within a more defined context, create a more compact vector, and to improve plasmid purification yields.
- VIJ is derived from vectors VI and pUC18, a commercially available plasmid. VI was digested with Sspl and EcoRI restriction enzymes producing two fragments of DNA. The smaller of these fragments, containing the CMVintA promoter and Bovine Growth Hormone (BGH) transcription termination elements which control the expression of heterologous genes, was purified from an agarose electrophoresis gel.
- BGH Bovine Growth Hormone
- pUC18 was chosen to provide the "backbone" of the expression vector. It is known to produce high yields of plasmid, is well- characterized by sequence and function, and is of small size. The entire lac operon was removed from this vector by partial digestion with the Haell restriction enzyme. The remaining plasmid was purified from an agarose electrophoresis gel, blunt-ended with the T4 DNA polymerase treated with calf intestinal alkaline phosphatase, and ligated to the CMVintA/BGH element described above.
- VIJ plasmids exhibiting either of two possible orientations of the promoter elements within the pUC backbone were obtained.
- One of these plasmids gave much higher yields of DNA in E. coli and was designated VIJ.
- This vector's structure was verified by sequence analysis of the junction regions and was subsequently demonstrated to give comparable or higher expression of heterologous genes compared with VI.
- the nucleotide sequence of VIJ is as follows:
- VlJneo - Construction of vaccine vector VlJneo expression vector involved removal of the amp r gene and insertion of the kan r gene (neomycin phosphotransf erase).
- the ampr gene from the pUC backbone of VIJ was removed by digestion with Sspl and Eaml 1051 restriction enzymes.
- the remaining plasmid was purified by agarose gel electrophoresis, blunt-ended with T4 DNA polymerase, and then treated with calf intestinal alkaline phosphatase.
- the commercially available kan r gene derived from transposon 903 and contained within the pUC4K plasmid, was excised using the Pstl restriction enzyme, purified by agarose gel electrophoresis, and blunt-ended with T4 DNA polymerase. This fragment was ligated with the VIJ backbone and plasmids with the kan r gene in either orientation were derived which were designated as VlJneo #'s 1 and 3. Each of these plasmids was confirmed by restriction enzyme digestion analysis, DNA sequencing of the junction regions, and was shown to produce similar quantities of plasmid as VIJ. Expression of heterologous gene products was also comparable to VIJ for these VlJneo vectors.
- VlJneo VUneo#3, referred to as VlJneo hereafter, was selected which contains the kanr gene in the same orientation as the amp r gene in VIJ as the expression construct and provides resistance to neomycin, kanamycin and G418.
- the nucleotide sequence of VlJneo is as follows:
- VlJns The expression vector VlJns was generated by adding an Sfil site to VlJneo to facilitate integration studies. A commercially available 13 base pair Sfil linker (New England BioLabs) was added at the Kpnl site within the BGH sequence of the vector. VlJneo was linearized with Kpnl, gel purified, blunted by T4 DNA polymerase, and ligated to the blunt Sfil linker. Clonal isolates were chosen by restriction mapping and verified by sequencing through the linker. The new vector was designated VlJns. Expression of heterologous genes in VlJns (with Sfil) was comparable to expression of the same genes in VlJneo (with Kpnl).
- the nucleotide sequence of VlJns is as follows: TCGCGCGTTT CGGTGATGAC GGTGAAAACC TCTGACACAT GCAGCTCCCG GAGACGGTCA CAGCTTGTCT GTAAGCGGAT GCCGGGAGCA GACAAGCCCG TCAGGGCGCG TCAGCGGGTG TTGGCGGGTG TCGGGGCTGG CTTAACTATG CGGCATCAGA GCAGATTGTA CTGAGAGTGC ACCATATGCG GTGTGAAATA CCGCACAGAT GCGTAAGGAG AAAATACCGC ATCAGATTGG CTATTGGCCA TTGCATACGT TGTATCCATA TCATAATATG TACATTTATA TTGGCTCATG TCCAACATTA CCGCCATGTT GACATTGATT ATTGACTAGT TATTAATAGT AATCAATTAC GGGGTCATTA GTTCATAGCC CATATATGGA GTTCCGCGTT ACATAACTTA CGGTAAATGG CCCGCCTGGC TGACCGCCCA ACGACC
- VUns-tPA The vaccine vector VlJns-tPA was constructed in order to fuse an heterologous leader peptide sequence to the nef DNA constructs of the present invention. More specifically, the vaccine vector VlJns was modified to include the human tissue-specific plasminogen activator (tPA) leader. As an exemplification, but by no means a limitation of generating a nef DNA construct comprising an amino- terminal leader sequence, plasmid VlJneo was modified to include the human tissue-specific plasminogen activator (tPA) leader. Two synthetic complementary oligomers were annealed and then ligated into VlJneo which had been Bglll digested.
- tPA tissue-specific plasminogen activator
- the sense and antisense oligomers were 5' GATCACCATGGATGCAATGAAGAGAG GGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGTTTCGCCCAG CGA-3' (SEQ ID NO: 17); and, 5'-GATCTCGCTGGGCGAAACGAAGACTGC TCCACACAGCAGCAGCACACAGCAGAGCCCTCTTCATTGCATCCAT GGT-3' (SEQ ID NO: 18).
- the Kozak sequence is underlined in the sense oligomer.
- These oligomers have overhanging bases compatible for ligation to Bglll-cleaved sequences. After ligation the upstream Bglll site is destroyed while the downstream Bglll is retained for subsequent ligations.
- VlJns-tpa vector nucleotide sequence is as follows:
- TCTGTAACAT CATTGGCAAC GCTACCTTTG CCATGTTTCA GAAACAACTC TGGCGCATCG
- CGACATTATC GCGAGCCCAT
- the underlined nucleotides of SEQ ID NO:9 represent the Sfil site introduced into the Kpn 1 site of VlJneo while the underlined/italicized nucleotides represent the human tPA leader sequence.
- VIR - Vaccine vector VIR was constructed to obtain a minimum-sized vaccine vector without unneeded DNA sequences, which still retained the overall optimized heterologous gene expression characteristics and high plasmid yields that VIJ and VlJns afford. It was determined that (1) regions within the pUC backbone comprising the E. coli origin of replication could be removed without affecting plasmid yield from bacteria; (2) the 3'-region of the kan ⁇ gene following the kanamycin open reading frame could be removed if a bacterial terminator was inserted in its place; and, (3) -300 bp from the 3'- half of the BGH terminator could be removed without affecting its regulatory function (following the original Kpnl restriction enzyme site within the BGH element).
- VIR was constructed by using PCR to synthesize three segments of DNA from VlJns representing the CMVintA promoter/BGH terminator, origin of replication, and kanamycin resistance elements, respectively. Restriction enzymes unique for each segment were added to each segment end using the PCR oligomers: Sspl and Xhol for CMVintA/BGH; EcoRV and BamHI for the lan r gene; and, Bell and Sail for the ori r. These enzyme sites were chosen because they allow directional ligation of each of the PCR-derived DNA segments with subsequent loss of each site: EcoRV and Sspl leave blunt-ended DNAs which are compatible for ligation while BamHI and Bell leave complementary overhangs as do Sail and Xhol.
- each segment was digested with the appropriate restriction enzymes indicated above and then ligated together in a single reaction mixture containing all three DNA segments.
- the 5 -end of the ori r was designed to include the T2 rho independent terminator sequence that is normally found in this region so that it could provide termination information for the kanamycin resistance gene.
- the ligated product was confirmed by restriction enzyme digestion (>8 enzymes) as well as by DNA sequencing of the ligation junctions.
- PCR oligomer sequences used to synthesize VIR are as follows: (1) 5 -GGTAC AAATATTGGCTATTGGC CATTGCATACG-3' (SEQ ED NO:20) [Sspl]; (2) 5 '-CC AC ATCTCG AGG AA
- CCGGGTCAATTCTTCAGCACC-3' (SEQ ID NO:21) [Xhol] (for CMVintA/BGH segment); (3) 5 '-GGTAC AGATATCGGA A AGCC ACGTTGTG TCTCAAAATC-3' (SEQ ID NO:22) [EcoRV]; (4) 5'-CACATGGATCCGTAATGCTCTGCCAGTGT TACAACC-3' (SEQ ID NO:23) [BamHI], (for kanamycin resistance gene segment) (5) 5 '-GGTACATG ATCACGTAGAAAAGATC AAAGGATCTTCTTG-3 ' (SEQ ID NO:24) [Bell]; (6) 5 '-CC AC ATGTCG ACCCGTA A AA AGGCCGCGTTGCTGG-3 ' (SEQ ID NO:25): [Sail], (for E. coli origin of replication).
- the nucleotide sequence of vector VIR is as follows:
- HIV-1 Nef Vaccine Vectors - Codon optimized nef gene coding for wt Nef protein of HIV-1 jrfl isolate was assembled from complementary, overlapping synthetic oligonucleotides by polymerase chain reaction (PCR).
- the PCR primers used were designed in such that a Bglll site was included in the extension of 5' primer and an Srfl site and a Bglll site in the extension of 3' primer.
- the PCR product was digested with Bglll and cloned into Bglll site of a human cytomeglovirus early promoter-based expression vector, VlJns ( Figure 1A).
- nef fragment in the context of the expression cassette was determined by asymmetric restriction mapping.
- the resultant plasmid is VlJns/nef.
- the 5' and 3' nucleotide sequence junctions of codon optimized VlJns/nef are shown in Figure 3A.
- the mutant nef (G2A,LLAA) was also made from synthetic oligonucleotides. To assist in cloning, a Pstl site and an Srfl site were included in the extensions of 5' and 3' PCR primers, respectively.
- the PCR product was digested with Pstl and Srfl, and cloned into the Pstl and Srfl sites of VlJns/nef, replacing the original nef with nef(G2A,LLAA) fragment. This resulted in VlJns/nef(G2A,LLAA).
- the 5' and 3" nucleotide sequence junctions of codon optimized VlJns/nef (G2A,LLAA) are shown in Figure 3B.
- nef fusion gene i.e., VI Jns/tPAnef
- VI Jns/tPAnef a truncated nef gene fragment, lacking the coding sequence for the five amino terminal residues
- PCR amplified fragment was then digested with Bglll and cloned into Bglll site of the expression vector, VlJns/tpa ( Figure IB).
- VlJns/tPAnef The 5' and 3' nucleotide sequence junctions of codon optimized VlJns/tPAnef are shown in Figure 3C. Construction of VlJns/tpanef (LLAA) was carried out by replacing the Bsu36-
- Transfection and protein expression - 293 cells (adenovirus transformed human embryonic kidney cell line 293) grown at approximately 30% confluence in minimum essential medium (MEM; GIBCO, Grand Island, MD) supplemented with 10% fetal bovine serum (FBS; GIBCO) in a 100 mm culture dish, were transfected with 4 ug gag expression vector, VlJns/gag, or a mixture of 4 ug gag expression vector and 4 ug nef expression vector by Lipofectin following manufacture's protocol (GIBCO). Twelve hours post-transfection, cells were washed once with 10 ml of serum-free medium, Opti-MEM I (GIBCO) and replenished with 5 ml of Opti-MEM. Following an additional 60 hr incubation, culture supematants and cells were collected separately and used for Western blot analysis.
- MEM minimum essential medium
- FBS fetal bovine serum
- Plates were washed three times with PBS containing 0.05% Tween-20 (PBST), and blocked with 5% skim milk in PBST (milk-PBST) at 24°C for 2 hr, and then incubated with serial dilutions of testing samples in milk-PBST at 24°C for 2 hr. Plates were washed with PBST three times, and added with 50 ul of HRP-conjugated goat anti-mouse IgG (Zymed) per well and incubated at 24°C for 1 hr.
- PBST PBS containing 0.05% Tween-20
- Enzyme-linked spot assay (Elispot) - Nitrocellulose membrane-backed 96 well plates (MSHA plates; Millipore, Bedford, MA) were coated with 50 ul of rat anti- mouse IFN-gamma mAb, capture antibody, (R4-6A2; PharMingen, San Diego, CA) at a concentration of 5ug/ml in PBS per well at 4°C overnight. Plates were washed three times with PBST and blocked with 10% FBS in RPMI-1640 (FBS-RPMI) at 37°C in a CO2 incubator for 2 to 4 hrs. Splenocytes were suspended in RPMI-1640 with 10% FBS at 4 x 10 6 cells per ml.
- FBS-RPMI RPMI-1640
- EL-4 cells were incubated at 37°C for 1 hr with or without 20ug/ml of a designated peptide in the presence of sodium 51Cr-chromate and used as target cells.
- 10 4 target cells were added to a 96-well plate along with different numbers of splenocytes cells. Plates were incubated at 37°C for 4 hr. After incubation, supernatants were collected and counted in a Wallac gamma-counter. Specific lysis was calculated as ([experimental release - spontaneous release]/maximum release- spontaneous release]) x 100%. Spontaneous release was determined by incubating target cells in medium alone, and maximum release was determined by incubating target cells in 2.5% TritonX-100. The assay was performed with triplicate samples.
- mice Female mice (Charles River Laboratories, Wilmington, MA), 6 to 10 weeks old, were injected in quadriceps with 100 ul of DNA in PBS. Two weeks after immunization, spleens from individual mice were collected and used for CTL and Elispot assays.
- Nef protein sequence is based on HIV-1 clade B jrfl isolate.
- a codon-optimized nef gene was chosen for vaccine construction and for use as the parental gene for other exemplified constructs.
- Figure 2A-B show the comparison of coding sequence of wt nef(jrfl) and the codon optimized nef(jrfl).
- Two forms of myristylation site mutations were constructed; one contains a Gly2Ala change and the other a human tissue plasminogen activator (tpa) leader sequence was fused to sixth residue, Ser, of Nef (tpanef).
- FIG. 4 shows the schematic depiction of the Nef and Nef mutants.
- the nef genes were cloned into expression vector, VlJns.
- the resultant plasmids containing wt nef, tpanef, tpanef with dileucine motif mutation, and nef mutant with the Gly2Ala myristylation site and dileucine motif mutations were named as VlJns/nef, VlJns/tpanef, VlJns/tpanef(LLAA) and VlJns/(G2A,LLAA), respectively.
- mice In Balb/c mice ( Figure 7A), four Nef peptides, namely, aal l-30, aa61-80, aal91-210 and aa200-216, were found to be able to induce significant numbers of CD4 SFCs. In C57BL/6 mice ( Figure 7B), only one peptide, ie., aa81-100, elicited significant numbers of CD4 SFCs.
- C3H mice Compared to Balb/c and C57BL/6 mice, C3H mice (Figure 7C) showed no dominant CD4 SFC responses with particular peptides; instead, there were modest number of SFCs in response to an array of peptides, including aa21-40, aa31-50, aal21-140 aal31-150, aal81-200 and aal91-210. With respect to CD8 cells, significant SFC responses were detected with a single peptide, ie., aa51-70, in C57BL/6 mice only.
- Nef peptide aa51-70 contained an H-2b restricted CD8 cell epitope.
- CTL cytotoxic T cell
- a conventional CTL assay was carried out.
- the peptide aa51-70 ( Figure 8A) induced low level of specific killings only. Peptides longer than 9 amino acids of a typical CTL epitope often have lower binding affinity to MHC class I molecule. It was contemplated that the low specific killings observed with peptide aa51-70 could be potentially resulted from the low binding affinity of this 20 amino acid peptide.
- aa60-68 and aa58-70 were synthesized and tested in CTL assays. While the peptide aa60-68 failed to elicit any specific killings (Figure 8B), the peptide aa58-70 exhibited a drastic increase of specific killing as compared to its longer counterpart, peptide aa61-80 ( Figure 8C). For example, the percentage of specific killings induced by peptide aa58-70 at an effector/target ratio of 5 to 1 was comparable to that induced by peptide aa51-80 at an effector/target ratio of 45.
- mice Two weeks post immunization, splenocytes from individual mice were isolated and analyzed by Elispot assay for Nef-specific CD8 and CD4 EFN-gamma SFCs using Nef peptide aa58-66 and aa81-100, respectively. The results are shown in Figure 9A-B.
- Figure 9A the mice receiving the codon optimized tpanef (LLAA) construct developed the highest CD8 and CD4 cell responses; comparing between tpanef(LLAA) and the nef, the former elicited about 40-fold higher CD8 SFCs and 10-fold higher CD4 SFCs.
- nef(G2A,LLAA) mutant was poorly immunogenic; mice receiving this mutant had barely detectable CD8 and CD4 SFCS, under conditions tested. Similar response profiles between the three mutants were also observed in the experiment 2 ( Figure 9B), except that the overall CD8 response of mice receiving tpanef(LLAA) was approximately 10-folder higher in experiment 2 than that observed in experiment 1.
- the tPAnef mutant showed comparable responses as that of tpanef(LLAA). The results therefore showed that both codon optimized tpanef and tpanef(LLAA) had significantly enhanced immunogenicity.
- Monkeys were immunized with 5 mg of indicated plasmids at week 0, 4 and 8. Four weeks after each immunization, peripheral blood mononuclear cells were collected and tested for the Nef-specific IFN-gamma secreting cells.
- nef gene coding for HIV-1 jrfl isolate Nef polypeptide was synthesized. The resultant synthetic nef gene was well expressed in the in vitro transfected cells. Using this synthetic gene as parental molecule, nef mutants involving myristylation site and dileucine motif mutations were constructed. Two forms of myristylation site mutation were made, one involving a single Gly2Ala change and the other by fusing human plasminogen activator(tpa) leader peptide with the N-terminus of Nef polypeptide. The dileucine motif mutation was generated by Leul74Ala and Leul75Ala changes.
- nef constructs were named as nef, tpanef, tpanef(LLAA) and nef(G2A,LLAA).
- tpa leader peptide sequence resulted in significantly increased expression of the nef gene in vitro; in contrast, either Gly2Ala mutation or dileucine mutation reduced the nef gene expression.
- experiments were carried out to map nef CTL and Th epitopes in mice. A single CTL epitope and a dominant Th epitope, both restricted by H-2b, were identified.
- C57BL ⁇ 3 mice were immunized with different nef constructs by DNA immunization means, and splenocytes from immunized mice were determined for Nef-specific CTL and Th responses using Elisopt assay and the defined T cell epitopes.
- the results showed that tpanef and tpanef(LLAA) were significantly more immunogenic than nef in terms of eliciting both CTL and Th responses.
- these aforementioned polynucleotides when directly introduced into a vertebrate in vivo, including mammals such as primates and humans, should express the respective HIV-1 Nef protein within the animal and in turn induce at least a cytotoxic T lymphocyte (CTL) response within the host to the expressed Nef antigen.
- CTL cytotoxic T lymphocyte
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Virology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Public Health (AREA)
- General Chemical & Material Sciences (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Tropical Medicine & Parasitology (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- AIDS & HIV (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Veterinary Medicine (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17244299P | 1999-12-17 | 1999-12-17 | |
| US172442P | 1999-12-17 | ||
| PCT/US2000/034162 WO2001043693A2 (en) | 1999-12-17 | 2000-12-15 | Polynucleotide vaccines expressing codon optimized hiv-1 nef and modified hiv-1 nef |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP1242441A2 true EP1242441A2 (en) | 2002-09-25 |
| EP1242441A4 EP1242441A4 (en) | 2004-04-14 |
Family
ID=22627710
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP00989282A Withdrawn EP1242441A4 (en) | 1999-12-17 | 2000-12-15 | POLYNUCLEOTIDE VACCINES EXPRESSING CODON-OPTIMIZED NEF HIV-1 PROTEIN AND MODIFIED HIV-1 NEF PROTEIN |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP1242441A4 (en) |
| JP (1) | JP2003516741A (en) |
| AU (1) | AU782193B2 (en) |
| CA (1) | CA2393861A1 (en) |
| WO (1) | WO2001043693A2 (en) |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1980617A1 (en) | 1998-12-31 | 2008-10-15 | Novartis Vaccines and Diagnostics, Inc. | Improved expression of HIV polypeptides and production of virus-like particles |
| WO2000039304A2 (en) | 1998-12-31 | 2000-07-06 | Chiron Corporation | Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof |
| WO2001002607A1 (en) | 1999-07-06 | 2001-01-11 | Merck & Co., Inc. | Adenovirus carrying gag gene hiv vaccine |
| IL150961A0 (en) | 2000-02-04 | 2003-02-12 | Univ Duke | Human immunodeficiency virus vaccine |
| US6733993B2 (en) | 2000-09-15 | 2004-05-11 | Merck & Co., Inc. | Enhanced first generation adenovirus vaccines expressing codon optimized HIV1-gag, pol, nef and modifications |
| CA2452015C (en) | 2001-07-05 | 2012-07-03 | Chiron Corporation | Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof |
| US20030170614A1 (en) | 2001-08-31 | 2003-09-11 | Megede Jan Zur | Polynucleotides encoding antigenic HIV type B polypeptides, polypeptides and uses thereof |
| MXPA04002631A (en) * | 2001-09-20 | 2004-07-08 | Glaxo Group Ltd | Use of immidazoquinolinamines as adjuvants in dna vaccination. |
| AU2005294805B2 (en) | 2004-05-28 | 2012-02-16 | Oryxe | A mixture for transdermal delivery of low and high molecular weight compounds |
| GB0417494D0 (en) | 2004-08-05 | 2004-09-08 | Glaxosmithkline Biolog Sa | Vaccine |
| BRPI0515553A (en) * | 2004-09-17 | 2008-07-29 | Centelion | stable liquid plasmid DNA formulations |
| WO2009022236A2 (en) | 2007-08-16 | 2009-02-19 | Tripep Ab | Immunogen platform |
| PL229124B1 (en) | 2015-02-10 | 2018-06-29 | Inst Biochemii I Biofizyki Polskiej Akademii Nauk | DNA vaccine directed against the flue H5N1 virus, modified nucleotide sequence and application of the modified nucleotide sequence for production of the vaccine |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5851813A (en) * | 1990-07-12 | 1998-12-22 | President And Fellows Of Harvard College | Primate lentivirus antigenic compositions |
| AU2001294562B2 (en) * | 2000-09-15 | 2007-05-24 | Merck & Co., Inc. | Enhanced First Generation Adenovirus Vaccines Expressing Codon Optimized HIV1-Gag, Pol, Nef and Modifications |
-
2000
- 2000-12-15 CA CA002393861A patent/CA2393861A1/en not_active Abandoned
- 2000-12-15 WO PCT/US2000/034162 patent/WO2001043693A2/en not_active Ceased
- 2000-12-15 JP JP2001544634A patent/JP2003516741A/en not_active Withdrawn
- 2000-12-15 EP EP00989282A patent/EP1242441A4/en not_active Withdrawn
- 2000-12-15 AU AU25810/01A patent/AU782193B2/en not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| EP1242441A4 (en) | 2004-04-14 |
| WO2001043693A2 (en) | 2001-06-21 |
| AU782193B2 (en) | 2005-07-07 |
| AU2581001A (en) | 2001-06-25 |
| CA2393861A1 (en) | 2001-06-21 |
| JP2003516741A (en) | 2003-05-20 |
| WO2001043693A3 (en) | 2002-02-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU734690B2 (en) | Coordinate in vivo gene expression | |
| ES2388527T3 (en) | HIV vaccines based on multiple HIV clade Env | |
| US6534312B1 (en) | Vaccines comprising synthetic genes | |
| Cease et al. | Helper T-cell antigenic site identification in the acquired immunodeficiency syndrome virus gp120 envelope protein and induction of immunity in mice to the native protein using a 16-residue synthetic peptide. | |
| AU782193B2 (en) | Polynucleotide vaccines expressing codon optimized HIV-1 Nef and modified HIV-1 Nef | |
| KR101501495B1 (en) | Vaccine for prevention and treatment of hiv-infection | |
| AU728422B2 (en) | Vaccines comprising synthetic genes | |
| CN101277971A (en) | Anti-AIDS vaccine containing CMV/R-nucleic acid construct | |
| PL211762B1 (en) | Novel use | |
| CN107574156A (en) | Virus like particle compositions and its application method | |
| BG63126B1 (en) | NUCLEIC ACID BASED PREPARATIONS | |
| NO311807B1 (en) | HIV peptides, antigens, vaccine preparations, immunoassay test kits and a method for detecting antibodies induced by HIV | |
| JP2010187681A (en) | VACCINE COMPRISING gp120 AND Nef AND/OR Tat FOR IMMUNISATION AGAINST HIV | |
| AU779951B2 (en) | Polynucleotide vaccines expressing codon optimized HIV-1 pol and modified HIV-1 pol | |
| US20030096778A1 (en) | Polynucleotide vaccines expressing codon optimized hiv-1 nef and modified hiv-1 nef | |
| CN110582295B (en) | Multiple malarial preerythroblast antigens and their use in eliciting a protective immune response in a host | |
| US20060148750A1 (en) | Polynucleotide vaccines expressing codon optimized HIV-1 Pol and modified HIV-1 Pol | |
| Bojak et al. | Impact of codon usage modification on T cell immunogenicity and longevity of HIV-1 gag-specific DNA vaccines | |
| WO1999043841A1 (en) | Self-replicating vector for dna immunization against hiv | |
| Marsac et al. | In vivo induction of cellular and humoral immune responses by hybrid DNA vectors encoding simian/human immunodeficiency virus/hepatitis B surface antigen virus particles in BALB/c and HLA-A2-transgenic mice | |
| HK40013238A (en) | Multiple malaria pre-erythrocytic antigens and their use in the elicitation of a protective immune response in a host | |
| US20040116660A1 (en) | Process for the selection of hiv-1 subtype c Isolates, selected hiv-1 subtype c isolates, their genes and modifications and derivatives thereof | |
| CZ276699A3 (en) | Synthetic GAG HIV genes | |
| ZA200308825B (en) | Vaccine composition. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
| AX | Request for extension of the european patent |
Free format text: AL;LT;LV;MK;RO;SI |
|
| 17P | Request for examination filed |
Effective date: 20020821 |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20040226 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: 7A 61K 39/00 B Ipc: 7C 07K 14/16 B Ipc: 7C 12N 15/00 B Ipc: 7A 61K 48/00 B Ipc: 7C 12N 15/09 B Ipc: 7C 07H 21/04 A Ipc: 7A 61P 31/18 B Ipc: 7A 61K 39/39 B |
|
| 17Q | First examination report despatched |
Effective date: 20051110 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20080304 |