EP1242124A1 - Polynucleotide vaccines expressing codon optimized hiv-1 pol and modified hiv-1 pol - Google Patents
Polynucleotide vaccines expressing codon optimized hiv-1 pol and modified hiv-1 polInfo
- Publication number
- EP1242124A1 EP1242124A1 EP00989347A EP00989347A EP1242124A1 EP 1242124 A1 EP1242124 A1 EP 1242124A1 EP 00989347 A EP00989347 A EP 00989347A EP 00989347 A EP00989347 A EP 00989347A EP 1242124 A1 EP1242124 A1 EP 1242124A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- pol
- lys
- dna
- val
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5256—Virus expressing foreign proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16211—Human Immunodeficiency Virus, HIV concerning HIV gagpol
- C12N2740/16222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
Definitions
- the present invention relates to HIV Pol polynucleotide pharmaceutical products, as well as the production and use thereof which, when directly introduced into living vertebrate tissue, preferably a mammalian host such as a human or a non-human mammal of commercial or domestic veterinary importance, express the HIV Pol protein or biologically relevant portions thereof within the animal, inducing a cellular immune response which specifically recognizes human immunodeficiency virus-l (HIV-1).
- the polynucleotides of the present invention are synthetic DNA molecules encoding codon optimized HIV-1 Pol and derivatives of optimized HTV-l Pol, including constructs wherein protease, reverse transcriptase, RNAse H and integrase activity of HIV-1 Pol is inactivated.
- the polynucleotide vaccines of the present invention should offer a prophylactic advantage to previously uninfected individuals and/or provide a therapeutic effect by reducing viral load levels within an infected individual, thus prolonging the asymptomatic phase of HIV-1 infection.
- HIV-1 Human Immunodeficiency Virus-l
- HIV-1 is an RNA virus of the Retro viridae family and exhibits the 5'UTR-gag-pol-env- LTR 3 Organization of all retro viruses.
- the integrated form of HIV-1, known as the provirus is approximately 9.8 Kb in length.
- Each end of the viral genome contains flanking sequences known as long terminal repeats (LTRs).
- LTRs long terminal repeats
- the HIV genes encode at least nine proteins and are divided into three classes; the major structural proteins (Gag, Pol, and Env), the regulatory proteins (Tat and Rev); and the accessory proteins (Vpu, Vpr, Vif and Nef).
- the gag gene encodes a 55-kilodalton (kDa) precursor protein (p55) which is expressed from the unspliced viral mRNA and is proteolytically processed by the HIV protease, a product of the pol gene.
- the mature p55 protein products are pl7 (matrix), p24 (capsid), p9 (nucleocapsid) and p6.
- the pol gene encodes proteins necessary for virus replication; a reverse transcriptase, a protease, integrase and RNAse H. These viral proteins are expressed as a Gag-Pol fusion protein, a 160 kDa precursor protein which is generated via a ribosomal frame shifting.
- the nef gene encodes an early accessory HIV protein (Nef) which has been shown to possess several activities such as down regulating CD4 expression, disturbing T-cell activation and stimulating HIV infectivity.
- the env gene encodes the viral envelope glycoprotein that is translated as a
- kDa precursor 160-kilodalton (kDa) precursor (gpl60) and then cleaved by a cellular protease to yield the external 120-kDa envelope glycoprotein (gpl20) and the transmembrane 41- kDa envelope glycoprotein (gp41).
- Gpl20 and gp41 remain associated and are displayed on the viral particles and the surface of HIV-infected cells.
- the tat gene encodes a long form and a short form of the Tat protein, a RNA binding protein which is a transcriptional transactivator essential for HTV-l replication.
- the rev gene encodes the 13 kDa Rev protein, a RNA binding protein.
- the Rev protein binds to a region of the viral RNA termed the Rev response element (RRE).
- the Rev protein is promotes transfer of unspliced viral RNA from the nucleus to the cytoplasm.
- the Rev protein is required for HIV late gene expression and in turn, HIV replication.
- Gpl20 binds to the CD4/chemokine receptor present on the surface of helper T-lymphocytes, macrophages and other target cells in addition to other co-receptor molecules.
- X4 macrophage tropic
- R5 T-cell line tropic
- gp41 mediates the fusion event responsible for virus entry. The virus fuses with and enters the target cell, followed by reverse transcription of its single stranded RNA genome into the double-stranded DNA via a RNA dependent DNA polymerase.
- the viral DNA enters the cell nucleus, where the viral DNA directs the production of new viral RNA within the nucleus, expression of early and late HIV viral proteins, and subsequently the production and cellular release of new virus particles.
- provirus enters the cell nucleus, where the viral DNA directs the production of new viral RNA within the nucleus, expression of early and late HIV viral proteins, and subsequently the production and cellular release of new virus particles.
- Recent advances in the ability to detect viral load within the host shows that the primary infection results in an extremely high generation and tissue distribution of the virus, followed by a steady state level of virus (albeit through a continual viral production and turnover during this phase), leading ultimately to another burst of virus load which leads to the onset of clinical AIDS.
- Productively infected cells have a half life of several days, whereas chronically or latently infected cells have a 3-week half life, followed by non-productively infected cells which have a long half life (over 100 days) but do not significantly contribute to day to day viral loads seen throughout the course of disease.
- CD4 helper T lymphocytes which are critical to immune defense, is a major cause of the progressive immune dysfunction that is the hallmark of HIV infection.
- the loss of CD4 T-cells seriously impairs the body's ability to fight most invaders, but it has a particularly severe impact on the defenses against viruses, fungi, parasites and certain bacteria, including mycobacteria.
- the outcome of disease is the result of a balance between the kinetics and the magnitude of the immune response and the pathogen replicative rate and accessibility to the immune response.
- Pre-existing immunity may be more successful with an acute infection than an evolving immune response can be with an established infection.
- a second factor is the considerable genetic variability of the virus.
- anti-HIV-1 antibodies exist that can neutralize HIV-1 infectivity in cell culture, these antibodies are generally virus isolate-specific in their activity. It has proven impossible to define serological groupings of HIV-1 using traditional methods. Rather, the virus seems to define a serological "continuum" so that individual neutralizing antibody responses, at best, are effective against only a handful of viral variants.
- antigen in order to generate CTL responses antigen must be synthesized within or introduced into cells, subsequently processed into small peptides by the proteasome complex, and translocated into the endoplasmic reticulum/Golgi complex secretory pathway for eventual association with major histocompatibility complex (MHC) class I proteins.
- MHC major histocompatibility complex
- CD8 + T lymphocytes recognize antigen in association with class I MHC via the T cell receptor (TCR) and the CD8 cell surface protein.
- Activation of naive CD8 + T cells into activated effector or memory cells generally requires both TCR engagement of antigen as described above as well as engagement of costimulatory proteins.
- Optimal induction of CTL responses usually requires "help" in the form of cytokines from CD4 + T lymphocytes which recognize antigen associated with MHC class II molecules via TCR and CD4 engagement.
- Larder, et al., (1987, Nature 321: 716-717) and Larder, et al., (1989, Proc. Natl. Acad. Sci. 86: 4803-4807) disclose site specific mutagenesis of HIV-1 RT and the effect such changes have on in vitro activity and infectivity related to interaction with known inhibitors of RT.
- Mizrahi, et al. (1990, Nucl. Acids. Res. 18: pp. 5359-5353) disclose additional mutations Asp443Asn and Asp498Asn in the RNase region of the pol gene which also results in defective RNase activity. The authors note that the Asp498Asn mutant was difficult to characterize due to instability of this mutant protein.
- Wiskerchen, et al. (1995, J. Virol. 69: 376-386) disclose singe and double mutants, including mutation of aspartic acid residues which effect HIV-1 IN and viral replication functions.
- the present invention addresses and meets this needs by disclosing a class of DNA vaccines based on host delivery and expression of modified versions of the HIV-1 gene, pol.
- the present invention relates to synthetic DNA molecules (also referred to herein as “polynucleotides”) and associated DNA vaccines (also referred to herein as “polynucleotide vaccines”) which elicit cellular immune and humoral responses upon administration to the host, including primates and especially humans, and also including a non-human mammal of commercial or domestic veterinary importance.
- An effect of the cellular immune-directed vaccines of the present invention should be the lower transmission rate to previously uninfected individuals and/or reduction in the levels of the viral loads within an infected individual, so as to prolong the asymptomatic phase of HIV-1 infection.
- the present invention relates to DNA vaccines which encode various forms of HIV-1 Pol, wherein administration, intracellular delivery and expression of the HIV-1 Pol gene of interest elicits a host CTL and Th response.
- the preferred synthetic DNA molecules of the present invention encode codon optimized versions of wild type HIV-1 Pol, codon optimized versions of HIV-1 Pol fusion proteins, and codon optimized versions of HIV-1 Pol proteins and fusion protein, including but not limited to pol modifications involving residues within the catalytic regions responsible for RT, RNase and IN activity within the host cell.
- a particular embodiment of the present invention relates to codon optimized wt-pol DNA constructs wherein DNA sequences encoding the protease (PR) activity are deleted, leaving codon optimized "wild type" sequences which encode RT (reverse transcriptase and RNase H activity) and IN integrase activity.
- the nucleotide sequence of a DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:l and the corresponding amino acid sequence of the expressed protein is disclosed herein as SEQ TD NO:2.
- the present invention preferably relates to a HIV-1 DNA pol construct which is devoid of DNA sequences encoding any PR activity, as well as containing a mutation(s) which at least partially, and preferably substantially, abolishes RT, RNase and/or IN activity.
- HIV-1 pol mutant may include but is not limited to a mutated DNA molecule comprising at least one nucleotide substitution which results in a point mutation which effectively alters an active site within the RT, RNase and/or TN regions of the expressed protein, resulting in at least substantially decreased enzymatic activity for the RT, RNase H and/or IN functions of HIV-1 Pol.
- a HIV-1 DNA pol construct contains a mutation or mutations within the Pol coding region which effectively abolishes RT, RNase H and IN activity.
- Such a HIV-1 Pol mutant will most likely comprise at least one point mutation in or around each catalytic domain responsible for RT, RNase H and IN activity, respectfully.
- an especially preferred HIV-1 DNA pol construct is exemplified herein and contains nine codon substitution mutations which results in an inactivated Pol protein (IA Pol: SEQ TD NO:4, Figure 2A-C) which has no PR, RT, RNase or TN activity, wherein three such point mutations reside within each of the RT, RNase and IN catalytic domains.
- IA Pol inactivated Pol protein
- Any combination of the mutations disclosed herein may suitable and therefore may be utilized as an IA-Pol-based vaccine of the present invention.
- the preferred mutation is a point mutation resulting in a substitution of the wild type amino acid with an alternative amino acid residue.
- Another aspect of the present invention is to generate HIV-1 Pol-based vaccine constructions which comprise a eukaryotic trafficking signal peptide such as the leader peptide from human tPA.
- the present invention relates to a DNA molecule which encodes a codon optimized wt-pol DNA construct wherein the protease (PR) activity is deleted and a human tPA leader sequence is fused to the 5' end of the coding region.
- a DNA molecule which encodes this protein is disclosed herein as SEQ TD NO:5, the open reading frame disclosed herein as SEQ TD NO:6.
- the present invention especially relates to a HIV-1 Pol mutant such as IA-Pol
- SEQ TD NO:4 which comprises a leader peptide, such as the human tPA leader, at the amino terminal portion of the protein, which may effect cellular trafficking and hence, immunogenicity of the expressed protein within the host cell.
- a leader peptide such as the human tPA leader
- Any such HIV-1 DNA pol mutant disclosed in the above paragraphs is suitable for fusion downstream of a leader peptide, including but by no means limited to the human tPA leader sequence.
- any such leader peptide-based HIV-1 pol mutant construct may include but is not limited to a mutated DNA molecule which effectively alters the catalytic activity of the RT, RNase and or TN region of the expressed protein, resulting in at least substantially decreased enzymatic activity one or more of the RT, RNase H and/or IN functions of HTV-l Pol.
- a leader peptide/HIV-1 DNA pol construct contains a mutation or mutations within the Pol coding region which effectively abolishes RT, RNase H and IN activity.
- An especially preferable HIV-1 DNA pol construct is a DNA molecule which contains at least one point mutation which alters the active site and catalytic activity within the RT, RNase H and TN domains of Pol, such that each activity is at least substantially abolished, and preferably totally abolished.
- Such a HIV-1 Pol mutant will most likely comprise at least one point mutation in or around each catalytic domain responsible for RT, RNase H and IN activity, respectfully.
- An especially preferred embodiment of this portion of the invention relates to a human tPA leader fused to the IA-Pol protein comprising the nine mutations shown in Table 1.
- the DNA molecule is disclosed herein as SEQ TD NO:7 and the expressed tPA-IA Pol protein comprises a fusion junction as shown in Figure 3.
- the complete amino acid sequence of the expressed protein is set forth in SEQ ID NO:8.
- the present invention also relates to a substantially purified protein expressed from the DNA polynucleotide vaccines of the present invention, especially the purified proteins set forth below as SEQ ID NOs: 2, 4, 6, and 8. These purified proteins may be useful as protein-based HIV vaccines.
- the present invention also relates to non-codon optimized versions of DNA molecules and associated polynucleotides and associated DNA vaccines which encode the various wild type and modified forms of the HIV Pol protein disclosed herein.
- Partial or fully codon optimized DNA vaccine expression vector constructs are preferred, but it is within the scope of the present invention to utilize "non-codon optimized" versions of the constructs disclosed herein, especially modified versions of HIV Pol which are shown to promote a substantial cellular immune and humoral immune responses subsequent to host administration.
- DNA backbone of the DNA vaccines of the present invention are preferably DNA plasmid expression vectors.
- DNA plasmid expression vectors utilized in the present invention include but are not limited to constructs which comprise the cytomegalovirus promoter with the intron A sequence (CMV-intA) and a bovine growth hormone transcription termination sequence.
- DNA plasmid vectors of the present invention preferably comprise an antibiotic resistance marker, including but not limited to an ampicillin resistance gene, a neomycin resistance gene or any other pharmaceutically acceptable antibiotic resistance marker.
- an appropriate polylinker cloning site and a prokaryotic origin of replication sequence are also preferred.
- DNA vectors exemplified herein include VI, VI J (SEQ TD NO: 13), VlJneo (SEQ ID NO: 14), VlJns ( Figure 1A, SEQ TD NO: 15), V1R (SEQ ID NO:26), and any of the aforementioned vectors wherein a nucleotide sequence encoding a leader peptide, preferably the human tPA leader, is fused directly downstream of the CMV-intA promoter, including but not limited to VlJns-tpa, as shown in Figure IB and SEQ TD NO:28.
- the present invention especially relates to a DNA vaccine and a pharmaceutically active vaccine composition which contains this DNA vaccine, and the use as prophylactic and/or therapeutic vaccine for host immunization, preferably human host immunization, against an HIV infection or to combat an existing HIV condition.
- DNA vaccines are represented by codon optimized DNA molecules encoding codon optimized HIV-1 Pol (e.g. SEQ ID NO:2), codon optimized HTV-T Pol fused to an amino terminal localized leader sequence (e.g.
- IA Pol biologically inactive Pol proteins
- SEQ TD NO:6 biologically inactive Pol proteins
- IA Pol biologically inactive Pol proteins
- SEQ TD NO:4 biologically inactive Pol proteins
- constructs are ligated within an appropriate DNA plasmid vector, with or without a nucleotide sequence encoding a functional leader peptide.
- Preferred DNA vaccines of the present invention comprise codon optimized DNA molecules encoding codon optimized HIV-1 Pol and inactivated version of Pol, ligated in DNA vectors disclosed herein, or any of the aforementioned vectors wherein a nucleotide sequence encoding a leader peptide, preferably the human tPA leader, is fused directly downstream of the CMV-intA promoter, including but not limited to VlJns-tpa, as shown in Figure IB and SEQ TD NO:28.
- the present invention relates to DNA vaccines which include, but are in no way limited to VI Jns-WTPol (comprising the DNA molecule encoding WT Pol, as set forth in SEQ TD NO:2), VI Jns-tPA-WTPol, (comprising the DNA molecule encoding tPA Pol, as set forth in SEQ TD NO:6), VI Jns-IAPol (comprising the DNA molecule encoding IA Pol, as set forth in SEQ TD NO:4), and VlJns-tPA- IAPol, (comprising the DNA molecule encoding tPA-IA Pol, as set forth in SEQ ID NO:8).
- VI Jns-WTPol comprising the DNA molecule encoding WT Pol, as set forth in SEQ TD NO:2
- VI Jns-tPA-WTPol comprising the DNA molecule encoding tPA Pol, as set forth in SEQ TD NO:
- the present invention also relates to HIV Pol polynucleotide pharmaceutical products, as well as the production and use thereof, wherein the DNA vaccines are formulated with an adjuvant or adjuvants which may increase immunogenicity of the DNA polynucleotide vaccines of the present invention, namely by promoting an enhanced cellular and/or humoral response subsequent to inoculation.
- a preferred adjuvant is an aluminum phosphate-based adjuvant or a calcium phosphate based adjuvant, with an aluminum phosphate adjuvant being especially preferred.
- Another preferred adjuvant is a non-ionic block copolymer, preferably comprising the blocks of polyoxyethylene (POE) and polyoxypropylene (POP) such as a POE-POP-POE block copolymer.
- POE polyoxyethylene
- POP polyoxypropylene
- a DNA vaccine or DNA polynucleotide vaccine is a DNA molecule (i.e., "nucleic acid", “polynucleotide”) which contains essential regulatory elements such that upon introduction into a living, vertebrate cell, it is able to direct the cellular machinery to produce translation products encoded by the respective pol genes of the present invention.
- Figure 1 A-B shows schematic representation of DNA vaccine expression vectors VI Jns (A) and VlJns-tPA (B) utilized for HIV-1 pol and HIV-1 modified pol constructs.
- Figure 2A-C shows the nucleotide (SEQ ID NO:3) and amino acid sequence (SEQ TD NO:4) of IA-Pol. Underlined codons and amino acids denote mutations, as listed in Table 1.
- Figure 3 shows the codon optimized nucleotide and amino acid sequences through the fusion junction of tPA-IA-Pol (contained within SEQ ID NOs: 7 and 8, respectively). The underlined portion represents the NH 2 -terminal region of IA-Pol.
- Figure 5 shows the number of JEN-gamma secreting cells per 10e6 cells following stimulation with pools of either CD4 + (aa641-660, aa731-750) or CD8 + (aa201-220, aa311-330, aa571-590, aa781-800) specific peptides of splenocytes (pool of 5 spleens/cohort) from control mice and those vaccinated with increasing single dose of codon optimized VlJns-IApol or 30 ug of codon optimized VI Jns-tpa-IApol (13 wks post dose 1).
- mice vaccinated with a second dose of 30 ug of either plasmid were analyzed in an Elispot assay at 6 wks post dose 2. Reported are the sums of the number of spots stimulated by each individual CD8 + peptides because the spots in the wells to which the pool was added are too dense to acquire accurate counts. The CD4 + cell counts are taken from the responses to the peptide pool. Error bars represent standard deviations for counts from triplicate wells per sample per antigen.
- Antigen-specific IFN-gamma secretion was stimulated by adding one of two pools consisting of 20-mer peptides derived from vaccine sequence (mpol-1, aal-420; mpol-2, aa411-850).
- SFC spot-forming cells
- Figure 7A-B show bulk CTL killing from rhesus macaques immunized with codon optimized VlJns-IApol (A)or codon optimized VI Jns-tpa-IApol (B) at 8 weeks following the third vaccination. Restimulation was performed using recombinant vaccinia virus expressing pol and target cells were prepared by pulsing with the peptide pools, mpol-1 and mpol-2.
- Figure 8 shows detection of in vitro pol expression from cell lysates of 293 cells transfected with 10 ug of various pol constructs. Bands were detected using anti- serum from an HIV-1 seropositive human subject. Equal amounts of total protein were loaded for each lane.
- the lanes contain the lysates from cells transfected with the following: 1: mock; 2: VUns-wt-pol; 3: VlJns-IApol (codon optimized); 4: VlJns-tpa-IApol (codon optimized); 5: VlJns-tpa-pol (codon optimized); 6: V1R- wt-pol (codon optimized); 7: blank; and 8: 80 ng RT.
- Figure 9 shows the geometric mean anti-RT titers (GMT) plus the standard errors of the geometric means for cohorts of 5 mice that received one (open circles) or two doses (solid circles) of 1, 10, 100 ⁇ g of VlR-wt-pol (codon optimized) or VlJns- wt-pol. Sera from all animals were collected at 2 weeks post dose 2 (or 7 wks post dose 1) and assayed simultaneously. Statistical analyses were performed to compare cohorts that received the same amount and number of immunization of either plasmids; p values (two-tail) less than 5% are above the bars the connect the correlated cohorts to reflect statistically significant differences.
- GTT geometric mean anti-RT titers
- Figure 10 shows cellular immune responses in BALB/c mice vaccinated i.m. with 1 (pdl) or 2 (pd2) doses of varying amounts of either wt-pol (virus derived) or wt-pol (codon optimized) plasmids.
- frequencies of TFN- ⁇ - secreting splenocytes are determined from pools of 5 spleens per cohort against mixtures of either CD4 + eptides (aa21-40, aa411-430, aa531-550, aa641-660, aa731- 750, aa771-790) or CD8 + peptides (aa201-220, aa311-330) at 4 ⁇ g/mL final concentration per peptide.
- the present invention relates to synthetic DNA molecules and associated DNA vaccines which elicit CTL and Th cellular immune responses upon administration to the host, including primates and especially humans.
- An effect of the cellular immune-directed vaccines of the present invention should be a lower transmission rate to previously uninfected individuals and/or reduction in the levels of the viral loads within an infected individual, so as to prolong the asymptomatic phase of HIV-1 infection.
- the present invention relates to DNA vaccines which encode various forms of HIV-1 Pol, wherein administration, intracellular delivery and expression of the HIV-1 Pol gene of interest elicits a host CTL and Th response.
- the preferred synthetic DNA molecules of the present invention encode codon optimized wild type Pol (without Pro activity) and various codon optimized inactivated HIV-1 Pol proteins.
- the HIV-1 pol constructs disclosed herein are especially preferred for pharmaceutical uses, especially for human administration as a DNA vaccine.
- the HIV-1 genome employs predominantly uncommon codons compared to highly expressed human genes. Therefore, the pol open reading frame has been synthetically manipulated using optimal codons for human expression.
- a preferred embodiment of the present invention relates to DNA molecules which comprise a HIV-1 pol open reading frame, whether encoding full length pol or a modification or fusion as described herein, wherein the codon usage has been optimized for expression in a mammal, especially a human.
- the synthetic pol gene disclosed herein comprises the coding sequences for the reverse transcriptase (or RT which consists of a polymerase and RNase H activity) and integrase (IN).
- the protein sequence is based on that of Hxb2r, a clonal isolate of TUB; this sequence has been shown to be closest to the consensus clade B sequence with only 16 nonidentical residues out of 848 (Korber, et al., 1998, Human retroviruses and AIDS, Los Alamos National Laboratory, Los Alamos, New Mexico).
- any available HIV-1 or HTV-2 strain provides a potential template for the generation of HIV pol DNA vaccine constructs disclosed herein.
- protease gene is excluded from the DNA vaccine constructs of the present invention to insure safety from any residual protease activity in spite of mutational inactivation.
- the design of the gene sequences for both wild-type (wt-pol) and inactivated pol (IA-pol) incorporates the use of human preferred ("humanized") codons for each amino acid residue in the sequence in order to maximize in vivo mammalian expression (Lathe, 1985, J. Mol. Biol. 183:1-12).
- codon usage for mammalian optimization is preferred: Met (ATG), Gly (GGC), Lys (AAG), Trp (TGG), Ser (TCC), Arg (AGG), Val (GTG), Pro (CCC), Thr (ACC), Glu (GAG); Leu (CTG), His (CAC), He (ATC), Asn (AAC), Cys (TGC), Ala (GCC), Gin (CAG), Phe (TTC) and Tyr (TAC).
- the present invention also relates to non-codon optimized versions of DNA molecules and associated DNA vaccines which encode the various wild type and modified forms of the HJV Pol protein disclosed herein.
- codon optimization of these constructs is a preferred embodiment of this invention.
- a particular embodiment of the present invention relates to codon optimized wt-pol DNA constructs (herein, "wt-pol” or “wt-pol (codon optimized))" wherein DNA sequences encoding the protease (PR) activity are deleted, leaving codon optimized "wild type” sequences which encode RT (reverse transcriptase and RNase H activity) and IN integrase activity.
- wt-pol codon optimized wt-pol DNA constructs
- the open reading frame ofthe wild type pol construct disclosed as SEQ TD NO:l contains 850 amino acids, disclosed herein as SEQ TD NO:2, as follows: Met Ala Pro He Ser Pro He Glu Thr Val Pro Val Lys Leu Lys Pro Gly Met Asp Gly Pro Lys Val Lys Gin Trp Pro Leu Thr Glu Glu Lys He Lys Ala Leu.
- the present invention especially relates to a codon optimized HIV-1 DNA pol construct wherein, in addition to deletion of the portion of the wild type sequence encoding the protease activity, a combination of active site residue mutations are introduced which are deleterious to HTV-l pol (RT-RH-IN) activity of the expressed protein. Therefore, the present invention preferably relates to a HIV-1 DNA pol construct which is devoid of DNA sequences encoding any PR activity, as well as containing a mutation(s) which at least partially, and preferably substantially, abolishes RT, RNase and/or IN activity.
- HTV-l pol mutant may include but is not limited to a mutated DNA molecule comprising at least one nucleotide substitution which results in a point mutation which effectively alters an active site within the RT, RNase and/or TN regions of the expressed protein, resulting in at least substantially decreased enzymatic activity for the RT, RNase H and/or IN functions of HTV-l Pol.
- a HIV-1 DNA pol construct contains a mutation or mutations within the Pol coding region which effectively abolishes RT, RNase H and TN activity.
- An especially preferable HTV-l DNA pol construct in a DNA molecule which contains at least one point mutation which alters the active site of the RT, RNase H and TN domains of Pol, such that each activity is at least substantially abolished.
- Such a HIV-1 Pol mutant will most likely comprise at least one point mutation in or around each catalytic domain responsible for RT, RNase H and IN activity, respectfully.
- an especially preferred HTV-l DNA pol construct is exemplified herein and contains nine codon substitution mutations which results in an inactivated Pol protein (IA Pol: SEQ ID NO:4, Figure 2A-C) which has no PR, RT, RNase or IN activity, wherein three such point mutations reside within each of the RT, RNase and IN catalytic domains. Therefore, an especially preferred exemplification is a DNA molecule which encodes IA-pol, which contains all nine mutations as shown below in Table 1.
- An additional preferred amino acid residue for substitution is Asp551, localized within the RNase domain of Pol. Any combination of the mutations disclosed herein may suitable and therefore may be utilized as an IA-Pol-based vaccine of the present invention. While addition and deletion mutations are contemplated and within the scope of the invention, the preferred mutation is a point mutation resulting in a substitution of the wild type amino acid with an alternative amino acid residue.
- Glu 714 Ala IN It is preferred that point mutations be incorporated into the IApol mutant vaccines of the present invention so as to lessen the possibility of altering epitopes in and around the active site(s) of HIV-1 Pol.
- SEQ ID NO:3 discloses the nucleotide sequence which codes for a codon optimized pol in addition to the nine mutations shown in Table 1, disclosed as follows, and referred to herein as "IApol":
- HIV pol integrase function was abolished through three mutations at Asp626, Asp678 and Glu714. Again, each of these residues has been substituted with an Ala residue (Wiskerchen, et al., 1995, J. Virol. 69: 376-386; Leavitt, et al., 1993, J. Biol. Chem. 268: 2113-2119).
- Amino acid residue Pro3 of SEQ ID NO:4 marks the start of the RT gene.
- the complete amino acid sequence of IA-Pol is disclosed herein as SEQ TD NO:4, as follows: Met Ala Pro He Ser Pro He Glu Thr Val Pro Val Lys Leu Lys Pro Gly Met Asp Gly Pro Lys Val Lys Gin Trp Pro Leu Thr Glu Glu Lys He Lys Ala Leu Val Glu He Cys Thr Glu Met Glu Lys Glu Gly Lys He Ser Lys He Gly Pro Glu Asn Pro Tyr Asn Thr Pro Val Phe Ala He Lys Lys Lys Asp Ser Thr Lys Trp Arg Lys Leu Val Asp Phe Arg Glu Leu Asn Lys Arg Thr Gin Asp Phe Trp Glu Val Gin Leu Gly He Pro His Pro Ala Gly Leu Lys Lys Lys Lys Ser Val Thr Val Leu Ala Val Gly Asp Ala Tyr Phe Ser Val Pro Leu Asp Glu As
- any combination of the mutations disclosed above may be suitable and therefore be utilized as an IA-pol-based vaccine of the present invention.
- the IA-pol construct described above and disclosed as SEQ ID NO:3, as well as the expressed protein (SEQ ID NO:4) is preferred. It is also preferred that at least one mutation be present in each of the three catalytic domains.
- Another aspect of the present invention is to generate codon optimized HIV-1 Pol-based vaccine constructions which comprise a eukaryotic trafficking signal peptide such as from tPA (tissue-type plasminogen activator) or by a leader peptide such as is found in highly expressed mammalian proteins such as immunoglobulin leader peptides. Any functional leader peptide may be tested for efficacy.
- a preferred embodiment of the present invention is to provide for HTV-l Pol mutant vaccine constructions as disclosed herein which also comprise a leader peptide, preferably a leader peptide from human tPA.
- a codon optimized HIV-1 Pol mutant such as IA-Pol (SEQ TD NO:4) may also comprise a leader peptide at the amino terminal portion of the protein, which may effect cellular trafficking and hence, immunogenicity of the expressed protein within the host cell.
- a DNA vector which may be utilized to practice the present invention may be modified by known recombinant DNA methodology to contain a leader signal peptide of interest, such that downstream cloning of the modified HIV-1 protein of interest results in a nucleotide sequence which encodes a modified HIV-1 tP A/Pol protein.
- insertion of a nucleotide sequence which encodes a leader peptide may be inserted into a DNA vector housing the open reading frame for the Pol protein of interest.
- the end result is a polynucleotide vaccine which comprises vector components for effective gene expression in conjunction with nucleotide sequences which encode a modified HIV-1 Pol protein of interest, including but not limited to a HTV-l Pol protein which contains a leader peptide.
- the amino acid sequence of the human tPA leader utilized herein is as follows:
- MDAMKRGLCCVLLLCGAVFVSPSEISS SEQ TD NO:28. Therefore, another aspect of the present invention is to generate HIV-1 Pol-based vaccine constructions which comprise a eukaryotic trafficking signal peptide such as from tPA.
- the present invention relates to a DNA molecule which encodes a codon optimized wt-pol DNA construct wherein the protease (PR) activity is deleted and a human tPA leader sequence is fused to the 5' end of the coding region.
- a DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:5, the open reading frame disclosed herein as SEQ ID NO:6.
- the present invention relates to a DNA molecule which encodes a codon optimized wt-pol DNA construct wherein the protease (PR) activity is deleted and a human tPA leader sequence is fused to the 5' end of the coding region ( herein, "tPA-wt-pol").
- a DNA molecule which encodes this protein is disclosed herein as SEQ TD NO:5, the open reading frame being contained from an initiating Met residue at nucleotides 8-10 to a termination codon from nucleotides 2633-2635.
- SEQ ID NO:5 is as follows:
- the open reading frame ofthe wild type tPA-pol construct disclosed as SEQ ID NO:5 contains 875 amino acids, disclosed herein as SEQ ID NO:6, as follows: Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly Ala Val Phe Val Ser Pro Ser Glu He Ser Ala Pro He Ser Pro He Glu Thr Val Pro Val Lys Leu Lys Pro Gly Met Asp Gly Pro Lys Val Lys Gin Trp Pro Leu Thr Glu Glu Lys He Lys Ala Leu Val Glu He Cys Thr Glu Met Glu Lys Glu Gly Lys He Ser Lys He Gly Pro Glu Asn Pro Tyr Asn Thr Pro Val Phe Ala He Lys Lys Lys Asp Ser Thr Lys Trp Arg Lys Leu Val Asp Phe Arg Glu Leu Asn Lys Arg Thr Gin Asp Phe Trp Glu Val Gin Leu Gly He Pro His Pro Ala Gly Leu Lys Lys Ly
- Trp Gin Ala Thr Trp He Pro Glu Trp Glu Phe Val Asn Thr Pro Pro
- the present invention also relates to a codon optimized HTV-l Pol mutant such as IA-Pol (SEQ TD NO:4) which comprises a leader peptide at the amino terminal portion of the protein, which may effect cellular trafficking and hence, immunogenicity of the expressed protein within the host cell.
- a codon optimized HTV-l Pol mutant such as IA-Pol (SEQ TD NO:4) which comprises a leader peptide at the amino terminal portion of the protein, which may effect cellular trafficking and hence, immunogenicity of the expressed protein within the host cell.
- Any such HIV-1 DNA pol mutant disclosed in the above paragraphs is suitable for fusion downstream of a leader peptide, such as a leader peptide including but not limited to the human tPA leader sequence.
- any such leader peptide-based HIV-1 pol mutant construct may include but is not limited to a mutated DNA molecule which effectively alters the catalytic activity of the RT, RNase and/or TN region of the expressed protein, resulting in at least substantially decreased enzymatic activity one or more of the RT, RNase H and/or TN functions of HIV-1 Pol.
- a leader peptide/HIV-1 DNA pol construct contains a mutation or mutations within the Pol coding region which effectively abolishes RT, RNase H and IN activity.
- An especially preferable HIV-1 DNA pol construct is a DNA molecule which contains at least one point mutation which alters the active site and catalytic activity within the RT, RNase H and IN domains of Pol, such that each activity is at least substantially abolished, and preferably totally abolished.
- Such a HIV-1 Pol mutant will most likely comprise at least one point mutation in or around each catalytic domain responsible for RT, RNase H and IN activity, respectfully.
- An especially preferred embodiment of this portion of the invention relates to a human tPA leader fused to the IA-Pol protein comprising the nine mutations shown in Table 1.
- the DNA molecule is disclosed herein as SEQ ID NO:7 and the expressed tPA-IA Pol protein comprises a fusion junction as shown in Figure 3.
- SEQ ID NO:7 discloses the nucleotide sequence which codes for a human tPA leader fused to the IA Pol protein comprising the nine mutations shown in Table 1 (herein, "tPA- opt-IApol").
- the open reading frame begins with the initiating Met (nucleotides 8-10) and terminates with a "TAA" codon at nucleotides 2633-2635.
- the nucleotide sequence encoding tPA-IAPol is also disclosed as follows:
- the open reading frame ofthe tPA-IA-pol construct disclosed as SEQ TD NO:7 contains 875 amino acids, disclosed herein as tPA-IA-Pol and SEQ ID NO:8, as follows:
- the present invention also relates to a substantially purified protein expressed from the DNA polynucleotide vaccines of the present invention, especially the purified proteins set forth below as SEQ ID NOs: 2, 4, 6, and 8. These purified proteins may be useful as protein-based HJV vaccines.
- the DNA backbone of the DNA vaccines of the present invention are preferably DNA plasmid expression vectors.
- DNA plasmid expression vectors are well known in the art and the present DNA vector vaccines may be comprised of any such expression backbone which contains at least a promoter for RNA polymerase transcription, and a transcriptional terminator 3 'to the HJV pol coding sequence.
- the promoter is the Rous sarcoma virus (RSV) long terminal repeat (LTR) which is a strong transcriptional promoter.
- RSV Rous sarcoma virus
- LTR long terminal repeat
- a more preferred promoter is the cytomegalovirus promoter with the intron A sequence (CMV-intA).
- a preferred transcriptional terminator is the bovine growth hormone terminator.
- an antibiotic resistance marker is also preferably included in the expression vector.
- Ampicillin resistance genes, neomycin resistance genes or any other pharmaceutically acceptable antibiotic resistance marker may be used.
- the antibiotic resistance gene encodes a gene product for neomycin resistance.
- the vector to aid in the high level production of the pharmaceutical by fermentation in prokaryotic organisms, it is advantageous for the vector to contain an origin of replication and be of high copy number. Any of a number of commercially available prokaryotic cloning vectors provide these benefits. In a preferred embodiment of this invention, these functionalities are provided by the commercially available vectors known as pUC. It is desirable to remove non-essential DNA sequences. Thus, the lacZ and lad coding sequences of pUC are removed in one embodiment of the invention.
- DNA expression vectors which exemplify but in no way limit the present invention are disclosed in PCT International Application No. PCT/US94/02751 , International Publication No. WO 94/21797, hereby incorporated by reference.
- a first DNA expression vector is the expression vector pnRS V, wherein the rous sarcoma virus (RSV) long terminal repeat (LTR) is used as the promoter.
- RSV rous sarcoma virus
- LTR long terminal repeat
- a second embodiment relates to plasmid VI, a mutated pBR322 vector into which the CMV promoter and the BGH transcriptional terminator is cloned.
- Another embodiment regarding DNA vector backbones relates to plasmid V1J.
- Plasmid V1J is derived from plasmid VI and removes promoter and transcription termination elements in order to place them within a more defined context, create a more compact vector, and to improve plasmid purification yields. Therefore, VI J also contains the CMVintA promoter and (BGH) transcription termination elements which control the expression of the HIV pol-based genes disclosed herein.
- the backbone of VI J is provided by pUC18. It is known to produce high yields of plasmid, is well-characterized by sequence and function, and is of minimum size.
- the entire lac operon was removed and the remaining plasmid was purified from an agarose electrophoresis gel, blunt-ended with the T4 DNA polymerase, treated with calf intestinal alkaline phosphatase, and ligated to the CMVintA/BGH element.
- the ampicillin resistance gene is removed from VI J and replaced with a neomycin resistance gene, to generate VlJneo.
- An especially preferred DNA expression vector is VI Jns, which is the same as V1J except that a unique Sfil restriction site has been engineered into the single Kpnl site at position 2114 of VlJneo. The incidence of Sfil sites in human genomic DNA is very low (approximately 1 site per 100,000 bases).
- this vector allows careful monitoring for expression vector integration into host DNA, simply by Sfil digestion of extracted genomic DNA.
- Yet another preferred DNA expression vector used as the backbone to the HIV-1 pol-based DNA vaccines of the present invention is V1R.
- V1R DNA expression vector used as the backbone to the HIV-1 pol-based DNA vaccines of the present invention
- This vector is a derivative of VI Jns. This vector allows larger inserts to be used, with less concern that undesirable sequences are encoded and optimizes uptake by cells when the construct encoding specific influenza virus genes is introduced into surrounding tissue.
- the specific DNA vectors of the present invention include but are not limited to VI, VI J (SEQ ID NO: 13), VlJneo (SEQ ID NO: 14), VI Jns ( Figure IA, SEQ TD NO: 15), V1R (SEQ TD NO:26), and any of the aforementioned vectors wherein a nucleotide sequence encoding a leader peptide, preferably the human tPA leader, is fused directly downstream of the CMV-intA promoter, including but not limited to VlJns-tpa, as shown in Figure IB and SEQ TD NO:28.
- the present invention especially relates to a DNA vaccine and a pharmaceutically active vaccine composition which contains this DNA vaccine, and the use as prophylactic and/or therapeutic vaccine for host immunization, preferably human host immunization, against an HIV infection or to combat an existing HJV condition.
- These DNA vaccines are represented by codon optimized DNA molecules encoding HIV-1 Pol or biologically active Pol modifications or Pol-containing fusion proteins which are ligated within an appropriate DNA plasmid vector, with or without a nucleotide sequence encoding a functional leader peptide.
- DNA vaccines of the present invention may comprise codon optimized DNA molecules encoding HIV-1 Pol or biologically active Pol modifications or Pol-containing fusion proteins ligated in DNA vectors VI, VI J (SEQ ID NO: 14), VlJneo (SEQ TD NO: 15), VI Jns ( Figure IA, SEQ ID NO: 16), V1R (SEQ ID NO:26), or any of the aforementioned vectors wherein a nucleotide sequence encoding a leader peptide, preferably the human tPA leader, is fused directly downstream of the CMV-intA promoter, including but not limited to VlJns-tpa, as shown in Figure IB and SEQ TD NO:28.
- polynucleotide vaccine constructions include , VlJns-wtpol and VlR-wtpol (comprising the DNA molecule encoding WT Pol, as set forth in SEQ ID NO:2), VI Jns-tPA-WTPol, (comprising the DNA molecule encoding tPA Pol, as set forth in SEQ ID NO:6), VUns-IAPol (comprising the DNA molecule encoding IA Pol, as set forth in SEQ TD NO:4), and VlJns-tPA-IAPol, (comprising the DNA molecule encoding tPA-IA Pol, as set forth in SEQ TD NO:8).
- Polynucleotide vaccine constructions VlR-wtpol, VUns-IAPol, and VlJns-tPA-IAPol are exemplified in Example Sections 3-5.
- vector/Pol antigen constructs may be generated. While the exemplified constructs are preferred, any number of vector/Pol antigen combinations are within the scope of the present invention, especially wild type or modified/inactivated Pol proteins which comprise at least one, preferably 5 or more and especially all nine mutations as shown in Table 1, with or without the inclusion of a leader sequence such as human tPA.
- the DNA vector vaccines of the present invention may be formulated in any pharmaceutically effective formulation for host administration.
- Any such formulation may be, for example, a saline solution such as phosphate buffered saline (PBS). It will be useful to utilize pharmaceutically acceptable formulations which also provide long-term stability of the DNA vector vaccines of the present invention.
- PBS phosphate buffered saline
- DNA plasmid vaccines undergo a physiochemical change in which the supercoiled plasmid converts to the open circular and linear form. A variety of storage conditions (low pH, high temperature, low ionic strength) can accelerate this process.
- the buffer type, pH, salt concentration, light exposure, as well as the type of sterilization process used to prepare the vials may be controlled in the formulation to optimize the stability of the DNA vaccine.
- formulations that will provide the highest stability of the DNA vaccine will be one that includes a demetalated solution containing a buffer (phosphate or bicarbonate) with a pH in the range of 7-8, a salt (NaCl, KCl or LiCl) in the range of 100-200 mM, a metal ion chelator (e.g., EDTA, diethylenetriaminepenta-acetic acid (DTP A), malate, inositol hexaphosphate, tripolyphosphate or polyphosphoric acid), a non- reducing free radical scavenger (e.g.
- a buffer phosphate or bicarbonate
- a salt NaCl, KCl or LiCl
- a metal ion chelator e.g., EDTA, diethylenetriaminepenta-acetic acid (DTP A), malate, inositol hexaphosphate, tripolyphosphate or polyphosphoric acid
- DTP A diethylene
- a particularly preferred formulation which will enhance long term stability of the DNA vector vaccines of the present invention would comprise a Tris-HCl buffer at a pH from about 8.0 to about 9.0; ethanol or glycerol at about 3% w/v; EDTA or DTPA in a concentration range up to about 5 mM; and NaCl at a concentration from about 50 mM to about 500 mM.
- a Tris-HCl buffer at a pH from about 8.0 to about 9.0
- ethanol or glycerol at about 3% w/v
- EDTA or DTPA in a concentration range up to about 5 mM
- NaCl at a concentration from about 50 mM to about 500 mM.
- the DNA vector vaccines of the present invention may also be formulated with an adjuvant or adjuvants which may increase immunogenicity of the DNA polynucleotide vaccines of the present invention.
- adjuvants are known in the art and are available for use in a DNA vaccine, including but not limited to particle bombardment using DNA-coated gold beads, co-administration of DNA vaccines with plasmid DNA expressing cytokines, chemokines, or costimulatory molecules, formulation of DNA with cationic lipids or with experimental adjuvants such as saponin, monophosphoryl lipid A or other compounds which increase immunogenicity of the DNA vaccine.
- Another adjuvant for use in the DNA vector vaccines of the present invention are one or more forms of an aluminum phosphate-based adjuvant wherein the aluminum phosphate-based adjuvant possesses a molar PO 4 /Al ratio of approximately 0.9.
- An additional mineral-based adjuvant may be generated from one or more forms of a calcium phosphate. These mineral-based adjuvants are useful in increasing cellular and humoral responses to DNA vaccination. These mineral-based compounds for use as DNA vaccines adjuvants are disclosed in PCT International Application No. PCT/US98/02414, PCT International Publication No. WO 98/35562, which is hereby incorporated by reference.
- Another preferred adjuvant is a non-ionic block copolymer which shows adjuvant activity with DNA vaccines.
- the basic structure comprises blocks of polyoxyethylene (POE) and polyoxypropylene (POP) such as a POE-POP-POE block copolymer.
- POE polyoxyethylene
- POP polyoxypropylene
- Newman et al. (1998, Critical Reviews in Therapeutic Drug Carrier Systems 15(2): 89-142) review a class of non-ionic block copolymers which show adjuvant activity.
- the basic structure comprises blocks of polyoxyethylene (POE) and polyoxypropylene (POP) such as a POE-POP-POE block copolymer. Newman et al.
- POE-POP-POE block copolymers may be useful as adjuvants to an influenza protein-based vaccine, namely higher molecular weight POE-POP-POE block copolymers containing a central POP block having a molecular weight of over about 9000 daltons to about 20,000 daltons and flanking POE blocks which comprise up to about 20% of the total molecular weight of the copolymer (see also U.S. Reissue Patent No. 36,665, U.S. Patent No. 5,567,859, U.S. Patent No.
- the DNA vector vaccines of the present invention are administered to the host by any means known in the art, such as enteral and parenteral routes. These routes of delivery include but are not limited to intramusclar injection, intraperitoneal injection, intravenous injection, inhalation or intranasal delivery, oral delivery, sublingual administration, subcutaneous administration, transdermal administration, transcutaneous administration, percutaneous administration or any form of particle bombardment, such as a biolostic device such as a "gene gun” or by any available needle-free injection device.
- the preferred methods of delivery of the HIV-1 Pol- based DNA vaccines disclosed herein are intramuscular injection, subcutaneous administration and needle-free injection. An especially preferred method is intramuscular delivery.
- the amount of expressible DNA to be introduced to a vaccine recipient will depend on the strength of the transcriptional and translational promoters used in the DNA construct, and on the immunogenicity of the expressed gene product.
- an immunologically or prophylactically effective dose of about 1 ⁇ g to greater than about 20 mg, and preferably in doses from about 1 mg to about 5 mg is administered directly into muscle tissue.
- subcutaneous injection, intradermal introduction, impression through the skin, and other modes of administration such as intraperitoneal, intravenous, inhalation and oral delivery are also contemplated. It is also contemplated that booster vaccinations are to be provided in a fashion which optimizes the overall immune response to the Pol-based DNA vector vaccines of the present invention.
- the aforementioned polynucleotides when directly introduced into a vertebrate in vivo, express the respective HIV-1 Pol protein within the animal and in turn induce a cellular immune response within the host to the expressed Pol antigen.
- the present invention also relates to methods of using the HIV-1 Pol- based polynucleotide vaccines of the present invention to provide effective immunoprophylaxis, to prevent establishment of an HIV-1 infection following exposure to this virus, or as a post-HIV infection therapeutic vaccine to mitigate the acute HTV-l infection so as to result in the establishment of a lower virus load with beneficial long term consequences.
- the present invention contemplates a method of administration or use of the DNA pol-based vaccines of the present invention using an any of the known routes of introducing polynucleotides into living tissue to induce expression of proteins. Therefore, the present invention provides for methods of using a DNA pol- based vaccine utilizing the various parameters disclosed herein as well as any additional parameters known in the art, which, upon introduction into mammalian tissue induces intracellular expression of these DNA pol-based vaccines. This intracellular expression of the Pol-based immunogen induces a cellular immune response which provides a substantial level of protection against an existing HIV-1 infection or provides a substantial level of protection against a future infection in a presently uninfected host.
- EXAMPLE 1 Vaccine Vectors VI - Vaccine vector VI was constructed from pCMVIE-AKI-DHFR (Whang et al., 1987, J. Virol. .61 : 1796). The AKI and DHFR genes were removed by cutting the vector with EcoRI and self-ligating. This vector does not contain intron A in the CMV promoter, so it was added as a PCR fragment that had a deleted internal Sad site [at 1855 as numbered in Chapman, et al, 1991, Nuc. Acids Res. 19: 3979).
- the template used for the PCR reactions was pCMVintA-Lux, made by ligating the Hindlll and Nhel fragment from pCMV6al20 (see Chapman et al., ibid), which includes hCMV-IEl enhancer/promoter and intron A, into the HindlTT and Xbal sites of pBL3 to generate pCMVIntBL.
- the 1881 base pair lucif erase gene fragment (Hindi ⁇ -Smal Klenow filled-in) from RSV-Lux (de Wet et al., 1987, Mol. Cell Biol. 7: 725) was ligated into the Sail site of pCMVIntBL, which was Klenow filled-in and phosphatase treated.
- the primers that spanned intron A are: 5' primer: 5'-CTATAT AAGCAGAGCTCGTTTAG-3' (SEQ TD NO: 10); 3' primer: 5'-GTAGCAAA GATCTAAGGACGGTGACTGCAG-3' (SEQ TD NO: 11).
- the primers used to remove the Sad site are: sense primer, 5'-GTATGTGTCTGAAAATGAGCG TGGAGATTGGGCTCGCAC-3' (SEQ TD NO: 12) and the antisense primer, 5'-GTGCGAGCCCAATCTCCACGCTCATTTTCAGAC ACATAC-3' (SEQ TD NO:
- the PCR fragment was cut with Sac I and Bgl II and inserted into the vector which had been cut with the same enzymes.
- V1J- Vaccine vector VI J was generated to remove the promoter and transcription termination elements from vector VI in order to place them within a more defined context, create a more compact vector, and to improve plasmid purification yields.
- V1J is derived from vectors VI and pUC18, a commercially available plasmid. VI was digested with Sspl and EcoRI restriction enzymes producing two fragments of DNA. The smaller of these fragments, containing the CMVintA promoter and Bovine Growth Hormone (BGH) transcription termination elements which control the expression of heterologous genes, was purified from an agarose electrophoresis gel.
- BGH Bovine Growth Hormone
- pUC18 was chosen to provide the "backbone" of the expression vector. It is known to produce high yields of plasmid, is well- characterized by sequence and function, and is of small size. The entire lac operon was removed from this vector by partial digestion with the Haell restriction enzyme. The remaining plasmid was purified from an agarose electrophoresis gel, blunt-ended with the T4 DNA polymerase treated with calf intestinal alkaline phosphatase, and ligated to the CMVintA/BGH element described above.
- VI J Plasmids exhibiting either of two possible orientations of the promoter elements within the pUC backbone were obtained. One of these plasmids gave much higher yields of DNA in E. coli and was designated VI J. This vector's structure was verified by sequence analysis of the junction regions and was subsequently demonstrated to give comparable or higher expression of heterologous genes compared with VI.
- the nucleotide sequence of VI J is as follows:
- VlJneo - Construction of vaccine vector VlJneo expression vector involved removal of the ampf gene and insertion of the kanr gene (neomycin phosphotransf erase).
- the amp r gene from the pUC backbone of VI J was removed by digestion with Sspl and Eaml 1051 restriction enzymes.
- the remaining plasmid was purified by agarose gel electrophoresis, blunt-ended with T4 DNA polymerase, and then treated with calf intestinal alkaline phosphatase.
- the commercially available kanf gene derived from transposon 903 and contained within the pUC4K plasmid, was excised using the Pstl restriction enzyme, purified by agarose gel electrophoresis, and blunt-ended with T4 DNA polymerase. This fragment was ligated with the VI J backbone and plasmids with the kanf gene in either orientation were derived which were designated as VlJneo #'s 1 and 3. Each of these plasmids was confirmed by restriction enzyme digestion analysis, DNA sequencing of the junction regions, and was shown to produce similar quantities of plasmid as VI J. Expression of heterologous gene products was also comparable to VI J for these VlJneo vectors.
- VlJneo#3 referred to as VlJneo hereafter, was selected which contains the katf gene in the same orientation as the amp r gene in V1J as the expression construct and provides resistance to neomycin, kanamycin and G418.
- the nucleotide sequence of VlJneo is as follows:
- VI Jns - The expression vector VUns was generated by adding an Sfil site to VlJneo to facilitate integration studies. A commercially available 13 base pair Sfil linker (New England BioLabs) was added at the Kpnl site within the BGH sequence of the vector. VlJneo was linearized with Kpnl, gel purified, blunted by T4 DNA polymerase, and ligated to the blunt Sfil linker. Clonal isolates were chosen by restriction mapping and verified by sequencing through the linker. The new vector was designated VI Jns. Expression of heterologous genes in VI Jns (with Sfil) was comparable to expression of the same genes in VlJneo (with Kpnl). The nucleotide sequence of VI Jns is as follows:
- the underlined nucleotides of SEQ TD NO: 16 represent the Sfil site introduced into the Kpn 1 site of VlJneo.
- VUns-tPA - The vaccine vector VI Jns-tPA was constructed in order to fuse an heterologous leader peptide sequence to the pol DNA constructs of the present invention. More specifically, the vaccine vector VlJns was modified to include the human tissue-specific plasminogen activator (tPA) leader. As an exemplification, but by no means a limitation of generating a pol DNA construct comprising an amino- terminal leader sequence, plasmid VlJneo was modified to include the human tissue- specific plasminogen activator (tPA) leader. Two synthetic complementary oligomers were annealed and then ligated into VI Jneo which had been Bglll digested.
- tPA tissue-specific plasminogen activator
- the sense and antisense oligomers were 5 '-G ATC ACC ATGG ATGC A ATGA AGAG AGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGTTTCGCCCAG CGA-3' (SEQ TD NO: 17); and, 5'-GATCTCGCTGGGCGAAACGAAGACTGCTCC ACACAGCAGCAGCACACAGCAGAGCCCTCTCTTCATTGCATCCATGGT-3' (SEQ ID NO: 18).
- the Kozak sequence is underlined in the sense oligomer. These oligomers have overhanging bases compatible for ligation to Bglll-cleaved sequences.
- VlJns-tpa vector nucleotide sequence is as follows:
- V1R - Vaccine vector V1R was constructed to obtain a minimum-sized vaccine vector without unneeded DNA sequences, which still retained the overall optimized heterologous gene expression characteristics and high plasmid yields that VIJ and VlJns afford. It was determined that (1) regions within the pUC backbone comprising the E. coli origin of replication could be removed without affecting plasmid yield from bacteria; (2) the 3 '-region of the kan gene following the kanamycin open reading frame could be removed if a bacterial terminator was inserted in its place; and, (3) ⁇ 300 bp from the 3'- half of the BGH terminator could be removed without affecting its regulatory function (following the original Kpnl restriction enzyme site within the BGH element).
- V1R was constructed by using PCR to synthesize three segments of DNA from VlJns representing the CM Vint A promoter/BGH terminator, origin of replication, and kanamycin resistance elements, respectively. Restriction enzymes unique for each segment were added to each segment end using the PCR oligomers: Sspl and Xhol for CMVintA/BGH; EcoRV and BamHI for the kan r gene; and, Bell and Sail for the ori r These enzyme sites were chosen because they allow directional ligation of each of the PCR-derived DNA segments with subsequent loss of each site: EcoRV and Sspl leave blunt-ended DNAs which are compatible for ligation while BamHI and Bell leave complementary overhangs as do Sail and Xhol.
- each segment was digested with the appropriate restriction enzymes indicated above and then ligated together in a single reaction mixture containing all three DNA segments.
- the 5'-end of the ori r was designed to include the T2 rho independent terminator sequence that is normally found in this region so that it could provide termination information for the kanamycin resistance gene.
- the ligated product was confirmed by restriction enzyme digestion (>8 enzymes) as well as by DNA sequencing of the ligation junctions.
- PCR oligomer sequences used to synthesize V1R are as follows: (1) 5 -GGTAC A A ATATTGGCTATTGG CCATTGCATACG-3' (SEQ TD NO: 19) [Sspl]; (2) 5 -CC ACATCTCGAGGAAC CGGGTCAATTCTTCAGCACC-3' (SEQ TD NO:20) [Xhol] (for CMVintA/BGH segment); (3) 5 -GGTAC AGATATCGGAAAGCCACGTTGTG TCTCAAAATC-3' (SEQ TD NO:21) [EcoRV]; (4) 5 '-C AC ATGGATCCGTAAT GCTCTGCCAGTGTT ACAACC-3' (SEQ TD NO:2) [BamHI], (for kanamycin resistance gene segment) (5) 5 -GGTACATG ATCACGTAGAAAAGATCA AAGGATCTTCTTG-3' (SEQ ID NO:23)
- EXAMPLE 2 Codon Optimized HIV-1 Pol and HIV-1 IA Pol Derivatives as DNA Vector Vaccines Synthesis of WT-optpol and IA-opt-pol Gene - Construction of both genes were conducted by Midland Certified Reagent Company (Midland, TX) following established strategies. Ten double stranded oligonucleotides, ranging from 159 to 340 bases long and encompassing the entire pol gene, were synthesized by solid state methods and cloned separately into pUC18.
- Kpnl #1296 -Xctnl #1636 pJS6Fl-5
- Xcml #1636 -Ns ⁇ l #1847 pJS6Gl-2
- Beta The EcoRl-Apal small fragment of pJS6Dl-4 was inserted into the corresponding sites of pJS6 ⁇ l-2 to give pJS6DEl-2. Also, the EcoR ⁇ -Xcml small fragment of pJS6Fl-5 was inserted into the corresponding sites of pJS6Gl-2 to give pJS6FGl-l. Then the EcoRl-Kp ⁇ l small fragment of pJS6D ⁇ l-2 was inserted into the corresponding sites of pJS6FGl-l to give pJS6 ⁇ l-l.
- the wt-pol alpha, beta, gamma were ligated into the entire sequence as follows: The EcoRI-EcZT36II small fragment of pJS6 ⁇ l-8 was inserted into the EcoRI-Sm ⁇ l sites of pJS6 ⁇ l-l to give pJS6 ⁇ 2-l.
- Nsil #1847 - Bglll half site at #2174 pJS7Hl-5 These were then used in the same reconstruction strategy as described above to give pUC18-IA-pol.
- the IA-pol gene was PCR-amplified from VlR-IA-pol using pfu polymerase and the following pair of primers: 5'-GGTACAAGATCTCCGCCCCCATCTCCCCCATTGAGA-3' (SEQ TD NO:26), and 5'-CCACATAGATCTGCCCGGGCTTTAGTCCTCATC-3' (SEQ TD NO:27).
- the upstream primer was designed to remove the initiation met codon and place the pol gene in frame with the tpa leader coding sequence from VlJns-tpa.
- the PCR product was purified from the agarose gel slab using Sigma DNA Purification spin columns. The purified products were digested with BglH and subcloned into the Bglll site of VlJns-tpa.
- E. coli DH5 strain penicillin, streptomycin, ACK lysis buffer, hepes, L-glutamine, RPMI1640, and ultrapure CsCl were obtained from Gibco/BRL (Grand Island, NY).
- Fetal bovine serum (FBS) was purchased from Hyclone. Kanamycin, Tween 20, bovine serum albumin, hydrogen peroxide (30%), concentrated sulfuric acid, ⁇ -mercaptoethanol ( ⁇ -ME ), and concanavalin A were obtained from Sigma (St. Louis, MO).
- Female balb/c mice at 4-6 wks of age were obtained from Taconic Farms (Germantown, NY).
- 0.3-mL insulin syringes were purchased from Myoderm.
- H ⁇ V-IT ⁇ B RT p66 recombinant protein was obtained from Advanced Biotechnologies, Inc. (Columbia, MD). 20-mer peptides were synthesized by Research Genetics (Huntsville, AL). Horseradish peroxidase (HRP)-conjugated rabbit anti-mouse IgGl was obtained from ZYMED (San Francisco, CA). 1,2- phenylenediamine dihydrochloride (OPD) tablets was obtained from DAKO (Norway).
- HRP horseradish peroxidase
- OPD 1,2- phenylenediamine dihydrochloride
- rat anti-mouse TFN-gamma IgGl, clone R4-6A2
- biotin- conjugated rat anti-mouse TFN-gamma IgGl, clone XMG 1.2
- strepavi din- alkaline phosphatase conjugate was purchased from PharMingen (San Diego, CA).
- 1-STEP NBT/BCIP dye was obtained from Pierce Chemicals (Rockford, TL).
- 96-well Multiscreen membrane plate was purchased from Millipore (France).
- Cell strainer was obtained from Becton-Dickinson (Franklin Lakes, NJ). Plasmid Preparation - E.
- coli DH5 ⁇ cells expressing the pol plasmids were grown to saturation in LB broth supplemented with 100 ug mL kanamycin. Plasmid were purified by standard CsCl method and solubilized in saline at concentrations greater than 5 mg/mL until further use.
- Vaccination - The plasmids were prepared in phosphate-buffered saline and administered into balb/c by needle injection (28-1/2G insulin syringe) of 50 uL aliquot into each quad muscle. VlJns-IApol was administered at 0.3, 3, 30 ug dose and for comparison, VI Jns-tpa-IApol was given at 30 ug dose.
- the blocking solution was decanted; 100 uL aliquot of serially diluted serum samples were added per well and incubated for 2 h at room temperature. The plates were washed and 100 uL of 1/1000-diluted HRP-rabbit anti-mouse IgG were added with 1 h incubation. The plates were washed thoroughly and soaked with 100 uL OPD/H 2 O solution for 15 min. The reaction was quenched by adding 100 uL of 0.5M H 2 SO4 per well. OD 92 readings were recorded.
- R10 medium RPMI1640, 10% FBS, 2mM L-glutamine, lOOU/mL Penicillin, 100 u/mL streptomycin, 10 mM Hepes, 50 uM ⁇ -ME).
- Multiscreen opaque plates were coated with lOO ⁇ l/well of capture mAb (purified R4- 6A2 diluted in PBS to 5 ⁇ g/ml) at 4°C overnight. The plates were washed with PBS/Pen/Strep in hood and blocked with 200 ⁇ l/well of complete R10 medium for 37°C for at least 2 hrs.
- the mouse spleens were ground on steel mesh, collected into 15ml tubes and centrifuged at 1200rpm for lOmin. The pellet was treated in ACK buffer (4ml of lysis buffer per spleen) for 5min at room temperature to lyse red blood cells. The cell pellet was centrifuged as before, resuspended in K-medium (5ml per mouse spleen), filtered through a cell strainer and counted using a hemacytometer. Block medium was decanted from the plates and lOO ⁇ l/well of cell samples (5.0xl0e5 cells per well) plus antigens were added.
- Pol-specific CD4 + cells were stimulated using a mixture of previously identified two epitope-containing peptides (aa641-660, aa731-750).
- Antigen-specific CD8+ cells were stimulated using a pool of four peptide epitope-containing peptides (aa201-220, aa311-330, aa571-590, aa781-800) or with individual peptides. A final concentration of 4 ug/mL per peptide was used.
- Each splenocyte sample is tested for IFN-gamma secretion by adding the mitogen, concanavalin A. Plates were incubated at 37°C, 5% CO 2 for 20-24 h.
- the plates were washed with PBS/0.05% Tween 20 and soaked with 100 uL/well of 5 ug/mL biotin-conjugated rat anti-mouse TEN- mAb (clone XMG1.2) at 4°C overnight.
- the plates were washed and soaked with 100 uL/well 1/2500 dilution of strepavidin-AP (in PBS/0.005% Tween/5%FCS) for 30 min at 37 °C.
- spots were developed by incubating with lOO ⁇ l/well 1-step NBT/BCTP for 6-10 min.
- the plates were washed with water and allowed to air dry. The number of spots in each wells were determined using a dissecting microscope and normalized to 10e6 cells.
- TFN-gamma secretion from splenocytes can be detected from 3 and 30 ug cohort following stimulation with pools of peptides that contain CD4+ and CD8+ T cell epitopes. These epitopes were identified by (1) screening 20-mer peptides that encompass the entire pol sequence and overlap by 10 amino acid for ability to stimulate TFN-gamma secretion from vaccinee splenocytes, and (2) determining the T cell type (CD4+ or CD8+) by depleting either population in an Elispot assay.
- 1-Step NBT/BCIP dye was obtained form Pierce Chemicals (Rockford, TL).
- Rat anti-human TFN-gamma mAb and biotin-conjugated anti-human IFN-gamma reagent were obtained from R&D Systems (Minneapolis, MN).
- Dynabeads M-450 anti-human CD4 were obtained from Dynal (Norway).
- HIVp24 antigen assay was purchased from Coulter Corporation (Miami, FL).
- HTV- I IIIB RT p66 recombinant protein was obtained from Advanced Biotechnologies, Inc. (Columbia, MD).
- Plastic 8 well strips/plates, flat bottom, Maxisorp, are obtained from NUNC (Rochester, NY).
- HIV+ human serum 9711234 was obtained from Biological Specialty Corp. Plasmid Preparation - E. coli DH5 cells expressing the pol plasmids were grown to saturation in LB supplemented with 100 ug/mL kanamycin. Plasmid were purified by standard CsCl method and solubilized in saline at concentrations greater than 5 mg mL until further use.
- Vaccination - Cohorts of 3 rhesus macaques were vaccinated with 5 mg dose of either VlJns-IApol or VI Jns-tpa-IApol.
- the vaccine was administered by needle injection of two 0.5 mL aliquots of 5 mg/mL plasmid solution (in phosphate-buffered saline, pH 7.2) into both deltoid muscles.
- the monkeys Prior to vaccination, the monkeys were chemically restraint with i.m. injection of 10 mg/kg ketamine.
- ELIspot Assay - Immobilon-IP plates were coated with 100 uL/well of rat anti- human TFN-gamma mAb at 15 ug/mL at 4 °C overnight. The plates are then washed with PBS and block by adding 200 uL/well of R10 medium. 4 10e5 peripheral blood cells were plated per well and to each well, either media or one of the pol peptide pools (final concentration of 4 ug/mL per peptide) or PHA, a known mitogen, is added to a final volume of 100 uL. Duplicate wells were set up per sample per antigen and stimulation was performed for 20-24 h at 37 °C.
- the plates are then washed; biotinylated anti-human TFN-gamma reagent is added (0.1 ug/mL, 100 uL per well) and allowed to incubate for overnight at 4 °C.
- the plates are again washed and 100 uL of 1:2500 dilution of the strepavi din-alkaline phosphatase reagent (in PBS/0.005% Tween/5% FCS) is added and allowed to incubate for 2 h at ambient room temperature. After another wash, spots are developed by incubating with 100 uL/well of 1-step NBT/BCIP for 6-10 min.
- CD4- T cell depletion was performed by adding 1 bead particle/10 cell of Dynabeads M450 anti-human CD4, prewashed with PBS, and incubating on the shaker at 4 °C for 30 min.
- the beads are fractionated magnetically and the unbound cells collected and quantified before plating onto the ELISpot assay plates ( at 4x10e5 cells per well).
- CTL Assay - Procedures for establishing bulk CTL culture with fresh or cryopreserved peripheral blood mononuclear cells (PBMC) are as follows.
- PBMC Twenty percent total PBMC were infected in 0.5 ml volume with recombinant vaccinia virus, Vac-tpaPol, respectively, at multiplicity of infection (moi) of 5 for 1 hr at 37°C, and then combined with the remaining PBMC sample.
- the cells were washed once in 10 ml R-10 medium, and plated in a 12 well plate at approximately 5 to 10 x 10 6 cells/well in 4 ml R-10 medium.
- Recombinant human TL-7 was added to the culture at the concentration of 330 U/ml. Two or three days later, one milliliter of R-10 containing recombinant human IL-2 (100 U/ml) was added to each well.
- BLCL autologous B lymphoid cell lines
- a mock target was prepared by pulsing cells with peptide-free DMSO diluent to match the DMSO concentration in the peptide-pulsed targets. The cells were enumerated the next morning, and 1 x 10 6 cells were resuspended in 0.5 ml R-10 medium. Five to ten
- ELISA Assay The pol-specific antibodies in the monkeys were measured in a competitive RT EIA assay, wherein sample activity is determined by the ability to block RT antigen from binding to coating antibody on the plate well. Briefly, Maxisorp plates were coated with saturating amounts of pol positive human serum (97111234). 250 uL of each sample is incubated with 15 uL of 266 ng/mL RT recombinant protein (in RCM 563, 1% BSA, 0.1% tween, 0.1% NaN 3 ) and 20 uL of lysis buffer (Coulter p24 antigen assay kit) for 15 min at room temperature.
- VlJns-IApol or VI Jns-tpa-IApol expressed in mMU/mL 5 mgs of VlJns-IApol or VI Jns-tpa-IApol expressed in mMU/mL.
- EXAMPLE 5 Effect of Codon Optimization on In Vivo Expression and Cellular Immune Response of wt-pol Materials and Methods - Extraction of virus-derived pol gene -
- the gene for RT-TN (wt-pol; a non-codon optimized wild type pol gene derived directly from the HIV IJJB genome) was extracted and amplified from the HIV TUB genome using two primers, 5 -CAG GCG AGA TCT ACC ATG GCC CCC ATT AGC CCT ATT GAG ACT GTA-3' (SEQ TD NO:29) and 5'-CAG GCG AGA TCT GCC CGG GCT TTA ATC CTC ATC CTG TCT ACT TGC CAC-3' (SEQ TD NO:30 ), containing BglU sites.
- the reaction contained 200 nmol of each primer, 2.5 U of pfu Turbo DNA polymerase (Stratagene, La Jolla, CA), 0.2 mM of each dNTPs, and the template DNA in lOmM KCl, lOmM (NH 4 ) 2 SO 4 , 20mM Tris-HCl pH 8.75, 2mM MgSO 4 , 0.1% TritonX-100, O.lmg/ml bovine serum albumin (BSA).
- Thermocycling conditions were as follows: 20 cycles of 1 min at 95 °C, 1 min at 56 °C, and 4 mins at 72 °C with 15-min capping at 72 °C.
- the digested PCR fragment was subcloned into the Bglll site of the expression plasmid VlJns (Shiver, et al., 1995, Immune responses to HIV gpl20 elicited by DNA vaccination. In Chanock, R. M., Brown, F., Ginsberg, H. S., and Norrby, E. (Eds.) Vaccines 95. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, pp 95-98; see also Example section 1 herein) expression plasmid following similar procedures as described above. The ligation mixtures were then used to transform competent E. coli DH5 cells and screened by PCR amplification of individual colonies. Sequence of the entire gene insert was confirmed.
- the pol product was detected using anti-serum from a seropositive patient (Scripps Clinic, San Diego, CA) diluted 1 : 1000 and the bands developed using goat anti-human IgG-HRP (Bethyl, Montgomery, TX) at 1:2000 dilution and standard ECL reagent kit (Pharmacia LKB Biotechnology, Uppsala, Sweden).
- Reverse Transcriptase assay using Perkin Elmer 7700, Taqman technology (Arnold, et al., 1999, One-step fluorescent probe product-enhanced reverse transcriptase assay. In McClelland, M., Pardee, A. (Eds.) Expression genetics: accelerated and high-throughput methods. Biotechniques Books, Natick, MA, pp. 201-210). Background levels for this assay were determined using 1:100,000 dilution of lysates from mock (chemical treatment only, no vector) transfected 293 cells.
- Cells lysates were prepared similarly for the following samples: mock transfection with empty VlJns vector; no vector control; transfection with VlJns-tpa-pol (codon optimized); and transfection with VlJns-IApol (codon optimized). Samples were serially diluted to 1:100,000 in PERT buffer and 24 replicates for each sample at this dilution were assayed for RT activity.
- Rodent immunization with optimized and virus-derived pol plasmids were vaccinated with 1 ⁇ g, 10 ⁇ g, and 100 ⁇ g doses of VlR-wt-pol (codon optimized) and VlJns-wt-pol plasmid (virus derived). At 5 weeks post dose 1, 5 of 10 mice per cohort were boosted with the same dose of plasmid they initially received.
- the vaccines were suspended or diluted in 6 mM sodium phosphate, 150 mM sodium chloride, pH 7.2, and the total dose was injected to both quadricep muscles in 50 ⁇ L aliquots using a 0.3-mL insulin syringe with 28-1/2G needles (Becton-Dickinson, Franklin Lakes, NJ).
- Anti-RT ELISA - Anti-RT titers were obtained following standard secondary antibody-based ELISA. Maxisorp plates (NUNC, Rochester, NY) were coated by overnight incubation with 100 ⁇ L of 1 ⁇ g /mL HIV-1 RT protein (Advanced Biotechnologies, Columbia, MD) in PBS. The plates were washed with PBS/0.05% Tween 20 using Titertek MAP instrument (Hunstville, AL) and incubated for approximately 2h with 200 ⁇ L/well of blocking solution (PBS/0.05% tween/1 %
- the blocking solution was decanted; 100 ⁇ L aliquot of serially diluted serum samples were added per well and incubated for 2 h at room temperature. An initial dilution of 100-fold is performed followed by 4-fold serial dilution.
- the plates were washed and 100 ⁇ L of 1/1000-diluted HRP-rabbit anti-mouse IgG (ZYMED, San Francisco, CA) were added with 1 h incubation.
- the plates were washed thoroughly and soaked with 100 ⁇ L 1,2-phenylenediamine dihydrochloride/hydrogen peroxide (DAKO, Norway) solution for 15 min. The reaction was quenched by adding 100 ⁇ L of 0.5M H 2 SO4 per well.
- OD 492 readings were recorded using Titertek Multiskan MCC/340 with S20 stacker. Endpoint titers were defined as the highest serum dilution that resulted in an absorbance value of greater than or equal to 0.1 OD (2.5 times the background value).
- ELIspot assay Antigen-specific INF ⁇ -secreting cells from mouse spleens were detected using the ELIspot assay (Miyahira, et al., 1995, Quantification of antigen specific CD8 + T cells using an ELISPOT assay. J. Immunol. Methods 1995, 181, 45-54).
- spleens were collected from 3-5 mice/cohort and pooled into a tube of 8-mL complete RPMI media (RPMIT640, 10% FBS, 2mM L-glutamine, lOOU/mL Penicillin, 100 u/mL streptomycin, 10 mM Hepes, 50 uM ⁇ -ME).
- Multiscreen opaque plates (Millipore, France) were coated with 100 ⁇ L/well of 5 ⁇ g/mL purified rat anti-mouse TFN- ⁇ IgGl, clone R4-6A2 (Pharmingen, San Diego, CA), in PBS at 4°C overnight.
- the plates were washed with PBS/penicillin/streptomycin in hood and blocked with 200 ⁇ L/well of complete RPMI media for 37 °C for at least 2 h.
- the mouse spleens were ground on steel mesh, collected into 15ml tubes and centrifuged at 1200rpm for 10 min. The pellet was treated with 4 mL ACK buffer (Gibco/BRL) for 5 min at room temperature to lyse red blood cells.
- the cell pellet was centrifuged as before, resuspended in complete RPMI media (5 ml per mouse spleen), filtered through a cell strainer and counted using a hemacytometer.
- Block media was decanted from the plates and to each well, 100 ⁇ L of cell samples (5xl0 5 cells per well) and 100 ⁇ L of the antigen solution were added.
- 100 ⁇ L of the media were added; for specific responses, peptide pools containing either CD4 + or CD8 + epitopes were added. In all cases, a final concentration of 4 ⁇ g/mL per peptide was used. Each sample/antigen mixture were performed in triplicate wells.
- Plates were incubated at 37°C, 5% CO 2 , 90% humidity for 20-24 h.
- the plates were washed with PBS/0.05% Tween 20 and incubated with 100 ⁇ L/well of 1.25 ⁇ g/mL biotin-conjugated rat anti- mouse TFN- ⁇ mAb, clone XMG1.2 (Pharmingen) at 4°C overnight.
- the plates were washed and incubated with 100 ⁇ L/well 1/2500 dilution of strepavidin-alkaline phosphatase conjugate (Pharmingen) in PBS/0.005% Tween/5% FBS for 30 min at 37 °C.
- spots were developed by incubating with 100 ⁇ l/well 1-step NBT/BCIP (Pierce Chemicals) for 6-10 min. The plates were washed with water and allowed to air dry. The number of spots in each well was determined using a dissecting microscope and the data normalized to 10 6 cell input.
- Ultrasensitive RT assay of cells transfected with Pol constructs - Table 4 summarizes the levels of polymerase activity from mock (vector only) control, IApol (codon optimized)and wt-pol plasmids (codon optimized). Results indicate that the wild-type POL transfected cells contained RT activity approximately 4-5 logs higher than the 293 cell only baseline values. Mock transfected cells contained activity no higher than baseline values. The RT activity from opt-IApol-transfected cells was also found to be no different than baseline values; no individual reaction tube resulted in RT activity higher than the established cut-off value of 56.
- mice vaccinated with the humanized gene construct gave cohort anti-RT titers (>1000) significantly above background levels at doses above 10 ug.
- the responses seen at 10 and 100 ug dose of VI R- wt-pol (codon optimized) were boosted approximately 10-fold with a second immunization, reaching titers as high as 10 6 .
- Spleens from all mice in each of the cohorts were collected to be analyzed for IFN- ⁇ secretion following stimulation with mixtures of either CD4+ peptide epitopes or CD8+ peptide epitopes. The results are shown in Figure 10. All wt-pol vaccinees did not show any significant cellular response above the background controls.
- strong antigen-stimulated IFN- ⁇ secretion were observed in a dose-responsive manner from animals vaccinated with one or two doses of 10 or more ⁇ g of the wt-pol (codon optimized) construct.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Virology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Public Health (AREA)
- General Chemical & Material Sciences (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Tropical Medicine & Parasitology (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- AIDS & HIV (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Veterinary Medicine (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17154299P | 1999-12-22 | 1999-12-22 | |
| US171542P | 1999-12-22 | ||
| PCT/US2000/034724 WO2001045748A1 (en) | 1999-12-22 | 2000-12-21 | Polynucleotide vaccines expressing codon optimized hiv-1 pol and modified hiv-1 pol |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP1242124A1 true EP1242124A1 (en) | 2002-09-25 |
| EP1242124A4 EP1242124A4 (en) | 2004-07-14 |
Family
ID=22624133
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP00989347A Withdrawn EP1242124A4 (en) | 1999-12-22 | 2000-12-21 | POLYNUCLEOTIDE VACCINES EXPRESSING THE POL-CODON-OPTIMIZED HIV-1 POL GENE AND THE MODIFIED POL-HIV-1 GENE |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP1242124A4 (en) |
| JP (1) | JP2003520786A (en) |
| AU (1) | AU779951B2 (en) |
| CA (1) | CA2395429A1 (en) |
| WO (1) | WO2001045748A1 (en) |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2487300A (en) | 1998-12-31 | 2000-07-31 | Chiron Corporation | Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof |
| AU2221600A (en) | 1998-12-31 | 2000-07-31 | Chiron Corporation | Improved expression of hiv polypeptides and production of virus-like particles |
| CA2378539A1 (en) | 1999-07-06 | 2001-01-11 | Merck & Co., Inc. | Adenovirus carrying gag gene hiv vaccine |
| US6733993B2 (en) | 2000-09-15 | 2004-05-11 | Merck & Co., Inc. | Enhanced first generation adenovirus vaccines expressing codon optimized HIV1-gag, pol, nef and modifications |
| JP2004508064A (en) * | 2000-09-15 | 2004-03-18 | メルク エンド カムパニー インコーポレーテッド | Enhanced first generation adenovirus vaccine expressing codon-optimized HIV1-GAG, POL, NEF and modifications |
| EP1411770A4 (en) | 2001-07-05 | 2006-05-10 | Chiron Corp | POLYNUCLEOTIDES ENCODING ANTIGENIC HIV TYPE C POLYPEPTIDES, POLYPEPTIDES AND USES THEREOF |
| US20030170614A1 (en) | 2001-08-31 | 2003-09-11 | Megede Jan Zur | Polynucleotides encoding antigenic HIV type B polypeptides, polypeptides and uses thereof |
| CA2458995C (en) * | 2001-08-31 | 2013-04-30 | Chiron Corporation | Polynucleotides encoding antigenic hiv type b polypeptides, polypeptides and uses thereof |
| US8071561B2 (en) | 2007-08-16 | 2011-12-06 | Chrontech Pharma Ab | Immunogen platform |
| IT201900016718A1 (en) | 2019-09-19 | 2021-03-19 | Takis S R L | Combination of immunomodulatory agents with tumor-specific neoantigens for use in the prevention and treatment of tumors. |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5858646A (en) * | 1989-02-23 | 1999-01-12 | University Of Ottawa | Modified HIV-pol polypeptide having immunological activity for use as diagnostic reagent |
| US5851813A (en) * | 1990-07-12 | 1998-12-22 | President And Fellows Of Harvard College | Primate lentivirus antigenic compositions |
| PL328730A1 (en) * | 1996-02-22 | 1999-02-15 | Merck & Co Inc | Synthetic hiv genes |
| US6099848A (en) * | 1997-11-18 | 2000-08-08 | The Trustees Of The University Of Pennsylvania | Immunogenic compositions comprising DAL/DAT double-mutant, auxotrophic, attenuated strains of Listeria and their methods of use |
-
2000
- 2000-12-21 WO PCT/US2000/034724 patent/WO2001045748A1/en not_active Ceased
- 2000-12-21 EP EP00989347A patent/EP1242124A4/en not_active Withdrawn
- 2000-12-21 CA CA002395429A patent/CA2395429A1/en not_active Abandoned
- 2000-12-21 AU AU25858/01A patent/AU779951B2/en not_active Ceased
- 2000-12-21 JP JP2001546687A patent/JP2003520786A/en not_active Withdrawn
Also Published As
| Publication number | Publication date |
|---|---|
| JP2003520786A (en) | 2003-07-08 |
| AU779951B2 (en) | 2005-02-24 |
| CA2395429A1 (en) | 2001-06-28 |
| WO2001045748A1 (en) | 2001-06-28 |
| EP1242124A4 (en) | 2004-07-14 |
| AU2585801A (en) | 2001-07-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2388527T3 (en) | HIV vaccines based on multiple HIV clade Env | |
| AU734690B2 (en) | Coordinate in vivo gene expression | |
| Cease et al. | Helper T-cell antigenic site identification in the acquired immunodeficiency syndrome virus gp120 envelope protein and induction of immunity in mice to the native protein using a 16-residue synthetic peptide. | |
| AU782193B2 (en) | Polynucleotide vaccines expressing codon optimized HIV-1 Nef and modified HIV-1 Nef | |
| US6534312B1 (en) | Vaccines comprising synthetic genes | |
| US6783939B2 (en) | Alphavirus vectors and virosomes with modified HIV genes for use in vaccines | |
| KR101501495B1 (en) | Vaccine for prevention and treatment of hiv-infection | |
| AU728422B2 (en) | Vaccines comprising synthetic genes | |
| CN107574156A (en) | Virus like particle compositions and its application method | |
| CN101277971A (en) | Anti-AIDS vaccine containing CMV/R-nucleic acid construct | |
| PL211762B1 (en) | Novel use | |
| AU779951B2 (en) | Polynucleotide vaccines expressing codon optimized HIV-1 pol and modified HIV-1 pol | |
| BG63126B1 (en) | NUCLEIC ACID BASED PREPARATIONS | |
| US20030096778A1 (en) | Polynucleotide vaccines expressing codon optimized hiv-1 nef and modified hiv-1 nef | |
| JP2005507377A (en) | A vaccine comprising gp120 and Nef and / or Tat for immunization against HIV | |
| US20060148750A1 (en) | Polynucleotide vaccines expressing codon optimized HIV-1 Pol and modified HIV-1 Pol | |
| KR102709250B1 (en) | Multiple malaria pre-erythrocyte antigens and their use in inducing protective immune responses in the host | |
| Bojak et al. | Impact of codon usage modification on T cell immunogenicity and longevity of HIV-1 gag-specific DNA vaccines | |
| WO2001082962A2 (en) | Immunizing against hiv infection | |
| Achour et al. | Induction of anti-gp160 cytotoxic T cells cross-reacting with various V3 loop P18 peptides in human immunodeficiency virus type 1 envelope-immunized individuals | |
| Puaux et al. | New gene-based approaches for an AIDS vaccine | |
| US20040116660A1 (en) | Process for the selection of hiv-1 subtype c Isolates, selected hiv-1 subtype c isolates, their genes and modifications and derivatives thereof | |
| HK40013238A (en) | Multiple malaria pre-erythrocytic antigens and their use in the elicitation of a protective immune response in a host | |
| HK40013238B (en) | Multiple malaria pre-erythrocytic antigens and their use in the elicitation of a protective immune response in a host |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20020722 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
| AX | Request for extension of the european patent |
Free format text: AL PAYMENT 20020722;LT PAYMENT 20020722;LV PAYMENT 20020722;MK PAYMENT 20020722;RO PAYMENT 20020722;SI PAYMENT 20020722 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: 7C 12N 15/85 A Ipc: 7C 07K 14/16 B Ipc: 7A 61K 48/00 B Ipc: 7A 61K 39/21 B |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20040528 |
|
| 17Q | First examination report despatched |
Effective date: 20040726 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20080603 |