EP1239922A2 - Treatment of excessive bone or cartilage loss with an activator of ror alpha and assay for identifying such activator - Google Patents

Treatment of excessive bone or cartilage loss with an activator of ror alpha and assay for identifying such activator

Info

Publication number
EP1239922A2
EP1239922A2 EP00972703A EP00972703A EP1239922A2 EP 1239922 A2 EP1239922 A2 EP 1239922A2 EP 00972703 A EP00972703 A EP 00972703A EP 00972703 A EP00972703 A EP 00972703A EP 1239922 A2 EP1239922 A2 EP 1239922A2
Authority
EP
European Patent Office
Prior art keywords
rorα
bone
compound
activator
receptor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00972703A
Other languages
German (de)
French (fr)
Inventor
Thomas Meyer
Michaela Kneissel
Brigitte Fournier
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis Pharma GmbH
Novartis AG
Original Assignee
Novartis Erfindungen Verwaltungs GmbH
Novartis AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novartis Erfindungen Verwaltungs GmbH, Novartis AG filed Critical Novartis Erfindungen Verwaltungs GmbH
Publication of EP1239922A2 publication Critical patent/EP1239922A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6887—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids from muscle, cartilage or connective tissue
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/02—Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/566—Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/70567—Nuclear receptors, e.g. retinoic acid receptor [RAR], RXR, nuclear orphan receptors
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/10—Musculoskeletal or connective tissue disorders
    • G01N2800/105—Osteoarthritis, e.g. cartilage alteration, hypertrophy of bone

Definitions

  • This invention relates to biologically active organic compounds, in particular to compounds which have activity as promoters of bone growth and development and to processes for the identification of such compounds and also to the therapeutic use of such compounds.
  • ROR ⁇ retinoic acid related orphan receptor alpha, also known as RZR
  • RZR retinoic acid related orphan receptor alpha
  • ROR ⁇ has three isoforms, referred to as ROR ⁇ l, ROR ⁇ 2 and ROR ⁇ 3, of which the ROR ⁇ l and ROR ⁇ 2 isotypes were found to bind as monomers to hormone response elements present in certain gene sequences and composed of an AT rich sequence preceding a half site core motif PuGGTCA. Recently it has been reported (Wiesenberg et al.
  • ROR ⁇ l is a nuclear receptor for the pineal gland hormone melatonin.
  • ROR ⁇ is proposed as a new therapeutic target for treatment of diseases and medical conditions which involve excessive bone or cartilage loss, such as osteoporosis.
  • the invention provides a method for the prophylaxis or treatment of a disease or medical condition which involves excessive bone or cartilage loss comprising administering to a patient an effective amount of an activator of ROR ⁇ .
  • the invention provides the use of an activator of ROR ⁇ in the preparation of a medicament for the treatment of a disease or medical condition which involves excessive bone or cartilage loss.
  • the diseases or medical conditions which involve excessive bone or cartilage loss which may be treated according to the invention include all bone conditions which are associated with increased calcium depletion or resorption or in which calcium fixation in the bone is desired, e.g. osteoporosis of various genesis (e.g. juvenile, menopausal, postmenopausal, post-traumatic, post-transplantation, caused by old age, by cortico-steroid therapy or by inactivity), fractures, osteopathy, including acute and chronic states associated with skeletal demineralisation, osteo-malacia, gingival disease such as gingivitis and periodontitis, Paget's disease, tumour induced hypercalcemia, metabolic bone disease, or bone loss due to arthritis or osteoarthritis.
  • the invention may be used for the treatment or prophylaxis of osteoporosis of various genesis.
  • the invention relates to the use of activators of ROR ⁇ l to treat diseases of excessive bone or cartilage loss.
  • the activators of ROR ⁇ which may be used in the present invention are preferably compounds not previously known to be activators of ROR ⁇ , including novel compounds.
  • International patent application WO 95/27202 describes use of a receptor of the RZR/ROR receptor family or a functional fragment thereof in a test for identifying a compound with anti-autoimmune, anti-arthritic, anti-tumour, melatonin like and/or melatonin antagonist activity. The testing procedures described in WO 95/27202 may be used to identify compounds which have bone growth or development promoting activity.
  • WO 95/27202 in particular the disclosure relating to to the use of a receptor of the RZR/ROR receptor family or a functional fragment thereof in a test for identification of a compound ROR ⁇ , e.g. ROR ⁇ l activating activity, is incorporated by reference into the teaching of the present application.
  • the invention provides use of a receptor of the RZR/ROR receptor family, e.g. ROR ⁇ , especially ROR ⁇ l, or a funtional fragment thereof in a test for identifying a compound with bone growth or development promoting activity.
  • a receptor of the RZR/ROR receptor family e.g. ROR ⁇ , especially ROR ⁇ l, or a funtional fragment thereof in a test for identifying a compound with bone growth or development promoting activity.
  • the invention provides a method for the identification of a compound having bone growth or development promoting activity which comprises contacting a test compound with a biological system which comprises a functional ROR ⁇ receptor and which is capable of generating a detectable signal in response to activation of the ROR ⁇ receptor by a compound having bone growth or bone formation promoting activity, and monitoring the system for the generation of the signal.
  • ROR ⁇ -LBD ROR ⁇ ligand binding domain
  • the method of the invention may be used to screen individual compounds and libraries of compounds, including combinatorial compound libraries.
  • the method may be used as a first line screening assay to identify lead compounds and may be used to compare or quantify the ROR ⁇ activating activity of compounds, e.g. to compare compounds produced from medicinal chemistry lead optimisation derivatisation programmes.
  • the invention provides: i) a method for the identification of a compound having bone growth or formation promoting activity comprising contacting the compound with a biological system which comprises a functional ROR ⁇ receptor and which is capable of generating a detectable signal in response to activation of the ROR ⁇ receptor by a compound having bone growth promoting activity, measuring the detectable signal in the presence of the test compound and comparing the result obtained with a control, and ⁇ ) a method for the comparison of compounds which have bone growth or formation promoting activity, comprising separately contacting the compounds with a biological system which comprises a functional ROR ⁇ receptor and which is capable of generating a detectable signal in response to activation of the ROR ⁇ receptor by a compound having bone growth promoting activity, measuring the detectable signal in the presence of each test compound and comparing the signals obtained.
  • Suitable procedures for carrying out the identification and comparison methods of the invention include those described in WO 95/27202
  • bone growth promoting activity means increased proliferation of osteoblast precursors cells, increased differentiation of such cells, increased matrix synthesis by osteoblasts, prolonged life span of osteoblasts or osteocytes, for instance, leading ultimately to increased bone mass or maintenance of bone mass .
  • Figure 1 which shows agarose gel electrophoresis patterns of PCR products obtained from mRNA samples collected at different time of human mesenchymal stem cells differentiation.
  • Figure 2 which is a graph showing Quantitative analysis of the expression of ROR ⁇ during human MSCs differentiation
  • Figure 3 which is a graph showing induction of mouse bone sialoprotein promoter activity by ROR ⁇ .
  • Figure 4 which is a graph showing ROR ⁇ repression of the osteocalcin promoter is dominant over vitD activation.
  • Figure 5 which are graphs showing shows the bone mineral content, area, density, and length (d) of the whole tibia of mice with a deletion within the ROR ⁇ gene copmpared to wildtype mice as evaluated by double energy X-ray absorptiometry (DEXA);
  • Figure 6 which are graphs showing the total bone mineral content, area, and density in a cross section of the proximal tibia of mice with a deletion within the ROR ⁇ gene copmpared to wildtype mice as evaluated by peripheral quantitative computed tomography (pQCT);
  • Figure 7 are graphs showing the cortical thickness and trabecular bone mineral density in a cross section of the proximal tibia of mice with a deletion within the ROR ⁇ gene copmpared to wildtype mice as evaluated by peripheral quantitative computed tomography (pQCT), and
  • Figure 8 which is a graph showing the trabecular bone mineral density in a cross section of the proximal tibia of ageing mice which are heterozygous for a deletion within the ROR ⁇ gene compared to ageing wildtype mice as evaluated by peripheral quantitative computed tomography (pQCT);
  • Human Mesenchymal stem cell culture and RT-PCR Human mesenchymal stem cells, derived from 4 different donors, were cultivated and differentiated (osteogenic pathway) according to standard protocols (1 ⁇ M dexamethasone; 50 ⁇ M ascorbic acid-2-phosphate; 100 ⁇ M ⁇ -glycerophosphate). The cells were harvested after 0, 4, 8, and 15 days after starting the treatment and processed according to the manufacturers protocol for total RNA preparation (RNeasy midi RNA, Quiagen).
  • PCR conditions were: cDNA synthesis at 50°C, 30 min; 94°C, 2 min; 95°C, lmin; 56, 30 sec; 72°C, 1 min. All experiments were performed twice using RNA-preparation from MSCs derived from different donors. The PCR-fragments were visualized on a 1.5% agarose gel.
  • Quantitative real time PCR This technique was used to quantitatively monitor mRNA expression.
  • mRNA was extracted from hMSCs or ROS17 2.8 cells cultured as described in other sections of experimental procedures.
  • a gene-specific PCR oligonucleotide primer pair and an oligonucleotide probe labeled with a reporter fluorescent dye at the 5 -end and a quencher dye a the 3" -end were designed using primer express l.o software.
  • hROR ⁇ gene (5 N -3 ): forward primer GTGCGACTTCATTTTCCTCCAT; reverse primer GCTTAGGTGATAACATTTACCCATCA; and probe CACTTCAGAATTTGAGCCAGCAATGCAA.
  • mRNA (10 ng) was added to a 50 ⁇ l RT-PCR reaction mix (Perkin Elmer). The thermal cycle conditions included 1 cycle at 50°C for 30 min, 1 Cycle at 95 °C for 10 min alternating 40 cycles at 90°C for 15 sec, 40 cycles at 60°C for 1 min.
  • the plasmid pBS 2.5 BSP (kind gift of J. Aubin, University of Toronto) containing the promoter region of the target gene was cut with Xhol and Xbal to obtain a 2.5 kb fragment of the mouse BSP promoter.
  • the fragment was ligated into the Xhol and Nhel sites of pG12-basic vector (Promega, Wi) to drive the firefly luciferase gene (BSP-luc).
  • the ROR ⁇ l expression construct and the DR8tk luc were obtained from Dr. M Becker- Andre, Geneva and are described previously (Giguere et al.,GENES & DEVELOPMENT 8:538-553, 1994).
  • the osteocalcin promoter constructs are described in Meyer et al. ( J Biol Chem., 272, 21090-21095, 1997).
  • ROS 17/2.8 and MG63 cells were cultered at 37°C in a humified atmosphere with 5% CO2 in Dulbecco's modified Eagle's medium/F12 nutrition mixture buffered with bicarbonate and supplemented with 10% fetal bovine serum, penicillin (100 IU/ml) and streptomycin (0.1 mg/ml).
  • Cells were seeded in 6 well plates 24 hours before a transfection and transfected at 50-60% confluence using FuGene ⁇ transfection reagent (Boehringer Mannheim).
  • a typical reaction mixture contained 2 ⁇ g reporter plasmid and 1 ⁇ g expression plasmid. After 4 h exposure to the transfection mix, medium was refreshed and cells treated for 24 with Vit D3 if indicated.
  • Transfected cells were subsequently harvested for luciferase assay by scraping the cells into in 0.25 ml lysis buffer (Promega, Madison, Wi) after washing them in phosphate-buffered saline. Luciferase activity was monitored according to the Promega luciferase assay kit using an automatic luminometer LB96P (Berthold, Regensburg, Germany). Results are expressed in relative light units (RLU) per mg protein. All experiments were performed in triplicate on three separate occasions. Results
  • RNA prepared from hMSC at different stages during osteogenic differentiation.
  • OS treated
  • ROR ⁇ reverse transcriptase
  • RNA prepared from hMSC at different stages during osteogenic differentiation.
  • OS treated
  • ROR ⁇ we monitored a differential expression pattern of distinct ROR ⁇ messenger signals during the commitment of MSCs into the osteogenic pathway.
  • Figure 1 ⁇ vhich shows agarose gel electrophoresis patterns of PCR products obtained from mRNA samples collected at different time points during human MSC differentiation.
  • the identity of the PCR product obtained in these experiments was assessed by subcloning and sequencing analysis.
  • Other members of the ROR subfamily such as ROR ⁇ and ROR ⁇ were not detected in human MSCs.
  • RNA prepared from cells of different origin (brain) were used as as a positive control (C).
  • ROR ⁇ rat osteosarcoma cell line 17/2.8
  • ROS 17/2.8 rat osteosarcoma cell line 17/2.8
  • BSP bone sialoprotein
  • OC osteocalcin
  • ROR ⁇ conditionally active transcription factor
  • the Figure 3 shows the mean +SD of three experiments, each carried out with three independent triplicate analyses.
  • Co-expression of ROR ⁇ resulted in a 7 fold increase in luciferase activity of the BSP luc construct compared to basal levels as shown in Figure 3.
  • Luciferase activity was assayed in cells from 6 well plates and related to the activity in cells transfected with an empty expression plasmid. The results were normalized to the protein content. The figure shows the mean +SD of three experiments, each carried out with three independent triplicate analyses. Overexpression of ROR ⁇ had no influence on the basal activity of the OC-890 promoter spanning nucleotides -890/+34 or on a shorter promoter construct OC-344 spanning nucleotides -344/+34.
  • the OC-800 promoter construct was regulated by vitamin D3 up to 5 fold, since a palindromic DNA sequence shown to bind the VDR/ retinoid X receptor (RXR) heterodimer is located between bp -513 -493 upstream of the transcription start site of the human osteocalcin promoter.
  • the cotransfection of the ROR ⁇ expression plasmid with the OC-890 construct resulted in a partial suppression of the vitamin D-activated level, up to 50%, of the OC-890 promoter reporter gene as shown in Figure 4.
  • ROR ⁇ expression is correlated with osteoblast differentiation. From in vitro and in vivo data we can conclude that ROR ⁇ plays a central role in bone metabolism. Thus an activator of ROR ⁇ may be potentially useful for the treatment of osteoporosis.
  • the search for a ligand may be done in different ways. A cell line, which has stably integrated an expression vector for ROR ⁇ and a reporter containing direct repeats of the sequence AGGTCA driven by a tk promoter linked to a luciferase reporter gene is used. Direct repeats have been shown to be binding site for ROR ⁇ .
  • the expression vector pCMX ROR ⁇ l has been described by Giguere et al. (Genes & Development, 8:538-553).
  • the reporter plasmid consists of two repeats of the sequence AGGTCA with an 8 bp spacing placed in front of a tk minimal promoter driving the firefly luciferase reporter gene.
  • the expression vector for ROR ⁇ l and the reporter (DRS)tk-luc are transfected in Rosl7/2.8 cells using Fugene as described in the previous section.
  • an antibiotic resistant gene construct such as the puromycin resistant gene is cotransfected with these two plasmids.
  • Cells which have stably integrated the puromycin resistant gene as well as the reporter and the expression vector for ROR ⁇ produce stable cell lines suitable for the search of ROR ⁇ ligands or activators.
  • the mouse mutant staggerer (sg) - a mutation, which occurred spontaneously in a stock of obese mice in 1955 - maps within 160 kb of the position of ROR ⁇ , suggesting the latter as the site of the sg mutation.
  • a deletion within the ROR ⁇ gene that prevents translation of the ligand-binding domain was found in staggerer mice. Homozygotes for the staggerer show a staggering gait, mild tremor, hypotonia, and small size.
  • the cerebellar cortex is grossly underdeveloped with a deficiency of granule cells and Purkinje cells.
  • ROR ⁇ KO mice generated in the mid-nineties display a similar phenotype.
  • the excised left tibia was put into 4°C fixative (Kamovsky) for 24 hours followed by dehydration.
  • X-ray based evaluations were performed in 70% ethanol (DEXA, pQCT).
  • X-rays (Mammomat, Siemens, Dietikon, Switzerland) were taken for measurement of bone length.
  • Tibial bone mineral content (BMC) and bone mineral density (BMD, mg/cm 2 ) were measured using a regular Hologic QDR-1000 instrument (Hologic, Waltham, MA, USA) adapted for measurements of small animals.
  • a collimator with 0.9 cm diameter and an ultrahigh-resolution mode (line spacing 0.0254 cm, resolution: 0.0127 cm) was used. The stability of the measurement was controlled daily by scanning a phantom.
  • Cortical and cancellous bone mass and geometry were monitored in the proximal tibia metaphysis 2.5 mm distal to the medial and lateral intercondylar tubercle using a Stratec-Norland XCT-2000 (Pforzheim, Germany).
  • the following setup was chosen for the measurements: voxel-size: 0.1 mm x 0.1 mm x 0.5mm (slice thickness), scan speed: scout view - 10 mm/s, CT - 2 mm s, 1 block, contour mode 1, peelmode 2, cortical threshold: 400 mg/cm 3 .
  • the bones were placed into a plastic container filled with 70% ethanol. The stability of the measurement was controlled daily by scanning a phantom.
  • results are expressed as mean ⁇ standard error (SEM). All statistical analysis was carried out using BMDP (Version 1990 for VAX/VMS, BMDP Statistical Software Inc., Cork Ireland). The data were subjected to one-way analysis of variance (ANOVA). Levene F-test was used to test for equality of variances, and differences between groups were tested using Dunnett test (significance level: p ⁇ 0.05). All statistical tests were two-tailed. Differences between all groups were tested for statistical significance. Results
  • the homozygote mouse mutant staggerer who has a deletion within the RORa gene, has a reduced long bone diameter compared to heterozygotes and the wildtype. More interestingly the bones of the homozygote (sg/sg) animals are osteopenic as indicated by bone mineral measurements (DEXA, pQCT) compared to the wildtype (+/+) animals. Mice, who are heterozygous for the deletion (sg/+), develop normal bone mass. However they exhibit accelerated bone loss during aging compared to their wildtype (+/+) littermates.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Physical Education & Sports Medicine (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Public Health (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Veterinary Medicine (AREA)
  • Rheumatology (AREA)
  • Urology & Nephrology (AREA)
  • Molecular Biology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Hematology (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

A method for the identification of a compound having bone growth promoting activity comprising contacting a test compound with a biological system which comprises a functional RORα receptor and which is capable of generating a detectable signal in response to activation of the RORα receptor by a compound having bone growth promoting activity, and monitoring the system for the generation of the signal and the use of such compounds for the prophylaxis or treatment of diseases or medical conditions which involve excessive bone or cartilage loss.

Description

ASSAY METHOD
This invention relates to biologically active organic compounds, in particular to compounds which have activity as promoters of bone growth and development and to processes for the identification of such compounds and also to the therapeutic use of such compounds.
There are a number of diseases and medical conditions which involve excessive bone or cartilage loss, including osteoporosis, gingival disease such as gingivitis and periodontitis, Paget's disease, tumour induced hypercalcemia and metabolic bone disease. Compounds which have activity as promoters of bone growth and development are potentially useful for the therapeutic treatment of such diseases and conditions.
RORα (retinoic acid related orphan receptor alpha, also known as RZR) was cloned and functionally characterised by Giguere et al. (GENES & DEVELOPMENT 8:538-553, 1994) as a new member of the steroid hormone nuclear receptor super family, with an unknown ligand binding specificity or physiological role. RORα has three isoforms, referred to as RORαl, RORα2 and RORα3, of which the RORαl and RORα2 isotypes were found to bind as monomers to hormone response elements present in certain gene sequences and composed of an AT rich sequence preceding a half site core motif PuGGTCA. Recently it has been reported (Wiesenberg et al. Nucleic Acids Research, 1995, Vol.23, No.3 327-333; Steinhilber et al. J. Biol. Chem. 1995, Vol. 270, No. 13, 7073-7040) that RORαl is a nuclear receptor for the pineal gland hormone melatonin.
We have now found, in accordance with the present invention, that expression of RORα mRNA is differentially upregulated during the differentiation of mesenchymal stem cells into osteoblasts, indicating that RORα is involved in the development and differentiation of bone-forming cells. Furthermore we have shown that the mouse mutant staggerer (sg), which has a deletion within the RORα gene which prevents translation of the RORα ligand binding domain, exhibits an osteopenic phenotype, indicating that expression of fully functional RORα is required for a normal, healthy bone phenotype. Furthermore animals which are heterozygous for the deletion exhibit accelerated bone loss with aging. Taken together these results support the proposition that activation of RORα is a key step in the activation of expression of bone related proteins by RORα and in bone growth and development. Thus, in accordance with the present invention, RORα is proposed as a new therapeutic target for treatment of diseases and medical conditions which involve excessive bone or cartilage loss, such as osteoporosis.
Accordingly in a first aspect the invention provides a method for the prophylaxis or treatment of a disease or medical condition which involves excessive bone or cartilage loss comprising administering to a patient an effective amount of an activator of RORα.
In an alternative embodiment of the first aspect the invention provides the use of an activator of RORα in the preparation of a medicament for the treatment of a disease or medical condition which involves excessive bone or cartilage loss.
The diseases or medical conditions which involve excessive bone or cartilage loss which may be treated according to the invention include all bone conditions which are associated with increased calcium depletion or resorption or in which calcium fixation in the bone is desired, e.g. osteoporosis of various genesis (e.g. juvenile, menopausal, postmenopausal, post-traumatic, post-transplantation, caused by old age, by cortico-steroid therapy or by inactivity), fractures, osteopathy, including acute and chronic states associated with skeletal demineralisation, osteo-malacia, gingival disease such as gingivitis and periodontitis, Paget's disease, tumour induced hypercalcemia, metabolic bone disease, or bone loss due to arthritis or osteoarthritis. In particular the invention may be used for the treatment or prophylaxis of osteoporosis of various genesis.
In particular the invention relates to the use of activators of RORαl to treat diseases of excessive bone or cartilage loss.
The activators of RORα which may be used in the present invention are preferably compounds not previously known to be activators of RORα, including novel compounds. International patent application WO 95/27202 describes use of a receptor of the RZR/ROR receptor family or a functional fragment thereof in a test for identifying a compound with anti-autoimmune, anti-arthritic, anti-tumour, melatonin like and/or melatonin antagonist activity. The testing procedures described in WO 95/27202 may be used to identify compounds which have bone growth or development promoting activity. The disclosure of WO 95/27202, in particular the disclosure relating to to the use of a receptor of the RZR/ROR receptor family or a functional fragment thereof in a test for identification of a compound RORα, e.g. RORαl activating activity, is incorporated by reference into the teaching of the present application.
Thus in a further aspect the invention provides use of a receptor of the RZR/ROR receptor family, e.g. RORα, especially RORαl, or a funtional fragment thereof in a test for identifying a compound with bone growth or development promoting activity.
In a preferred embodiment of this further aspect the invention provides a method for the identification of a compound having bone growth or development promoting activity which comprises contacting a test compound with a biological system which comprises a functional RORα receptor and which is capable of generating a detectable signal in response to activation of the RORα receptor by a compound having bone growth or bone formation promoting activity, and monitoring the system for the generation of the signal.
Thus for example, advantage can be taken of the known interaction between the RORα ligand binding domain (RORα-LBD) and the coactivator GRIP. This interaction will be modified by the binding of a ligand to the RORα-LBD and induce a change of conformation which translates into differences in fluorescence which can be monitored using standard techniques
The method of the invention may be used to screen individual compounds and libraries of compounds, including combinatorial compound libraries. The method may be used as a first line screening assay to identify lead compounds and may be used to compare or quantify the RORα activating activity of compounds, e.g. to compare compounds produced from medicinal chemistry lead optimisation derivatisation programmes. Thus in preferred embodiments the invention provides: i) a method for the identification of a compound having bone growth or formation promoting activity comprising contacting the compound with a biological system which comprises a functional RORα receptor and which is capable of generating a detectable signal in response to activation of the RORα receptor by a compound having bone growth promoting activity, measuring the detectable signal in the presence of the test compound and comparing the result obtained with a control, and ϋ) a method for the comparison of compounds which have bone growth or formation promoting activity, comprising separately contacting the compounds with a biological system which comprises a functional RORα receptor and which is capable of generating a detectable signal in response to activation of the RORα receptor by a compound having bone growth promoting activity, measuring the detectable signal in the presence of each test compound and comparing the signals obtained.
Suitable procedures for carrying out the identification and comparison methods of the invention include those described in WO 95/27202
In the present description "bone growth promoting activity" means increased proliferation of osteoblast precursors cells, increased differentiation of such cells, increased matrix synthesis by osteoblasts, prolonged life span of osteoblasts or osteocytes, for instance, leading ultimately to increased bone mass or maintenance of bone mass . The invention is further described by way of illustration of the invention only in the following examples which relates to a particular assay of the invention and refer to the accompanying figures:
Figure 1, which shows agarose gel electrophoresis patterns of PCR products obtained from mRNA samples collected at different time of human mesenchymal stem cells differentiation.
Figure 2, which is a graph showing Quantitative analysis of the expression of RORα during human MSCs differentiation ; Figure 3, which is a graph showing induction of mouse bone sialoprotein promoter activity by RORα.
Figure 4, which is a graph showing RORα repression of the osteocalcin promoter is dominant over vitD activation.
Figure 5, which are graphs showing shows the bone mineral content, area, density, and length (d) of the whole tibia of mice with a deletion within the RORα gene copmpared to wildtype mice as evaluated by double energy X-ray absorptiometry (DEXA); Figure 6, which are graphs showing the total bone mineral content, area, and density in a cross section of the proximal tibia of mice with a deletion within the RORα gene copmpared to wildtype mice as evaluated by peripheral quantitative computed tomography (pQCT);
Figure 7, which are graphs showing the cortical thickness and trabecular bone mineral density in a cross section of the proximal tibia of mice with a deletion within the RORα gene copmpared to wildtype mice as evaluated by peripheral quantitative computed tomography (pQCT), and
Figure 8, which is a graph showing the trabecular bone mineral density in a cross section of the proximal tibia of ageing mice which are heterozygous for a deletion within the RORα gene compared to ageing wildtype mice as evaluated by peripheral quantitative computed tomography (pQCT);
EXAMPLES
Example 1: Differential Expression of RORα during Differentiation of Mesenchymal Stem Cells /Analysis of the functional ability for RORα
Experimental procedures
Human Mesenchymal stem cell culture and RT-PCR. Human mesenchymal stem cells, derived from 4 different donors, were cultivated and differentiated (osteogenic pathway) according to standard protocols (1 μM dexamethasone; 50 μM ascorbic acid-2-phosphate; 100 μM β-glycerophosphate). The cells were harvested after 0, 4, 8, and 15 days after starting the treatment and processed according to the manufacturers protocol for total RNA preparation (RNeasy midi RNA, Quiagen). 100 ng of total RNA was added to PCR-reactions containing the appropriate primers for RORα (5'- 3 'forward primer, GTAGAAACCGCTGCCAACA, reverse primer, ATCACCTCCCGCTGCTT), and the reaction mix (Superscript one-step RT-PCR system, GibcoBRL). PCR conditions were: cDNA synthesis at 50°C, 30 min; 94°C, 2 min; 95°C, lmin; 56, 30 sec; 72°C, 1 min. All experiments were performed twice using RNA-preparation from MSCs derived from different donors. The PCR-fragments were visualized on a 1.5% agarose gel.
Quantitative real time PCR (Taqman assay). This technique was used to quantitatively monitor mRNA expression. mRNA was extracted from hMSCs or ROS17 2.8 cells cultured as described in other sections of experimental procedures. A gene-specific PCR oligonucleotide primer pair and an oligonucleotide probe labeled with a reporter fluorescent dye at the 5 -end and a quencher dye a the 3" -end were designed using primer express l.o software. The primer and probes used were as follows: hRORα gene (5N-3 ): forward primer GTGCGACTTCATTTTCCTCCAT; reverse primer GCTTAGGTGATAACATTTACCCATCA; and probe CACTTCAGAATTTGAGCCAGCAATGCAA. mRNA (10 ng) was added to a 50 μl RT-PCR reaction mix (Perkin Elmer). The thermal cycle conditions included 1 cycle at 50°C for 30 min, 1 Cycle at 95 °C for 10 min alternating 40 cycles at 90°C for 15 sec, 40 cycles at 60°C for 1 min.
Preparation of promoter constructs and plasmids. The plasmid pBS 2.5 BSP (kind gift of J. Aubin, University of Toronto) containing the promoter region of the target gene was cut with Xhol and Xbal to obtain a 2.5 kb fragment of the mouse BSP promoter. The fragment was ligated into the Xhol and Nhel sites of pG12-basic vector (Promega, Wi) to drive the firefly luciferase gene (BSP-luc). The RORαl expression construct and the DR8tk luc were obtained from Dr. M Becker- Andre, Geneva and are described previously (Giguere et al.,GENES & DEVELOPMENT 8:538-553, 1994). The osteocalcin promoter constructs are described in Meyer et al. ( J Biol Chem., 272, 21090-21095, 1997).
Cell culture, transient transfections and luciferase assay.
ROS 17/2.8 and MG63 cells were cultered at 37°C in a humified atmosphere with 5% CO2 in Dulbecco's modified Eagle's medium/F12 nutrition mixture buffered with bicarbonate and supplemented with 10% fetal bovine serum, penicillin (100 IU/ml) and streptomycin (0.1 mg/ml). Cells were seeded in 6 well plates 24 hours before a transfection and transfected at 50-60% confluence using FuGeneό transfection reagent (Boehringer Mannheim). A typical reaction mixture contained 2 μg reporter plasmid and 1 μg expression plasmid. After 4 h exposure to the transfection mix, medium was refreshed and cells treated for 24 with Vit D3 if indicated. Transfected cells were subsequently harvested for luciferase assay by scraping the cells into in 0.25 ml lysis buffer (Promega, Madison, Wi) after washing them in phosphate-buffered saline. Luciferase activity was monitored according to the Promega luciferase assay kit using an automatic luminometer LB96P (Berthold, Regensburg, Germany). Results are expressed in relative light units (RLU) per mg protein. All experiments were performed in triplicate on three separate occasions. Results
The experimental basis for this study relied on a reverse transcriptase (RT)- PCR coupled reaction and the use of RNA prepared from hMSC at different stages during osteogenic differentiation. We directly compared samples of cells in a treated (OS) or untreated stage. In the case of RORα, we monitored a differential expression pattern of distinct RORα messenger signals during the commitment of MSCs into the osteogenic pathway. The results obtained are given in Figure 1 , λvhich shows agarose gel electrophoresis patterns of PCR products obtained from mRNA samples collected at different time points during human MSC differentiation. The identity of the PCR product obtained in these experiments was assessed by subcloning and sequencing analysis. Other members of the ROR subfamily such as RORβ and RORγ were not detected in human MSCs. RNA prepared from cells of different origin (brain) were used as as a positive control (C).
In addition, we set up a real-time PCR technique, which allowed us to quantify the RORα expression at different stages of the osteoblastic differentiation. RORα expression was normalised with GAPDH. The results obtained are given in Figure 2, which is a graph of the quantitative determination of fold induction of RORα obtained by comparing RORα levels in samples of cells in a treated (OS) or untreated stage (C), related to the expression level of cells in the native state (day 0).
Next the functional importance of RORα was examined in cellular transfection assays using the rat osteosarcoma cell line 17/2.8 (ROS 17/2.8) as host cells. Given the background that secreted components of the bone organic matrix like bone sialoprotein (BSP) or osteocalcin (OC) are modulators of mineralization and remodeling a conditionally active transcription factor like RORα, which is believed to be involved in regulation of bone metabolism should regulate the promoters of these bone specific genes. The BSP has already been suggested as a potential ROR target gene since Schrader et al.(JBC, 271, 19731-19736, 1996) identified already hexameric consensus motifs RGGTCA (R=A or G) within the human and rat BSP promoter sequence. Within the mouse BSP promoter we found similar consensus element located (GGGTCA) between position -2007 to-2001 in respect to the transcription start site. Therefore, a 2500 bp spanning fragment of the mouse BSP promoter was used to drive the firefly luciferase gene. Rosl7/2.8 cells were transfected with parent expression vector (Crt) or expression vector for RORα together with a luciferase reporter gene. The reporter gene was driven by the 2500 promoter fragment of the mouse bone- sialoprotein gene. Luciferase activity was assayed in cells from 6 well plates and related to the activity in cells transfected with an empty expression plasmid. The results were normalized to the protein content. The Figure 3 shows the mean +SD of three experiments, each carried out with three independent triplicate analyses. We used a RORαl cDNA since the α2 or α3 version was not detectable by RT-PCR in hMSCs (data not shown) and furthermore, since it has been described that RORαl has the strongest transcriptional activity of the three subtypes. Co-expression of RORα resulted in a 7 fold increase in luciferase activity of the BSP luc construct compared to basal levels as shown in Figure 3.
This increase in luciferase activity was similar to the one obtained with a reporter construct containing a simple RORα response element (DR8) under the same conditions (data not shown). Further in vivo evidence for RORα action in bone cells was collected by studying the effect of RORα on the osteocalcin gene activity. As shown in Fig. 4, ROS 17/2.8 cells were transfected with a luciferase reporter gene driven by either -344/+34 or - 890/+34 of the human osteocalcin promoter together with an expression vector for RORα (2/1 mg) (hatched bares) or without (solid bars). The cells were incubated with 10 nM vitD. Luciferase activity was assayed in cells from 6 well plates and related to the activity in cells transfected with an empty expression plasmid. The results were normalized to the protein content. The figure shows the mean +SD of three experiments, each carried out with three independent triplicate analyses. Overexpression of RORα had no influence on the basal activity of the OC-890 promoter spanning nucleotides -890/+34 or on a shorter promoter construct OC-344 spanning nucleotides -344/+34. As expected only the OC-800 promoter construct was regulated by vitamin D3 up to 5 fold, since a palindromic DNA sequence shown to bind the VDR/ retinoid X receptor (RXR) heterodimer is located between bp -513 -493 upstream of the transcription start site of the human osteocalcin promoter. The cotransfection of the RORα expression plasmid with the OC-890 construct resulted in a partial suppression of the vitamin D-activated level, up to 50%, of the OC-890 promoter reporter gene as shown in Figure 4.
Summary
The results obtained show evidence for a differential expression of RORα during the differentiation of hMSCs into osteoblasts and support the proposition that RORα is involved in bone development. Moreover RORα is able to transcriptionaly regulate two major non collagenous proteins, bone sialoprotein and osteocalcin. In the case of the bone sialoprotein we observed a positive regulation, whereas in the case of osteocalcin we observed a repression of the vitamin D activated osteocalcin transcriptional level. This has two major implications. Osteocalcin itself is a major player in bone metabolism since it has been shown that in osteocalcin deficient mice bone formation was increased Ducy et al. (NATURE, 1996, 382:448-452). In addition vitamin D is a major calciotrophic hormone and we demonstrate a cross/talk between the vitamin D receptor and RORα. Taken together these data suggest a physiological role of RORα in bone cell differentiation and in regulation of important bone non collagenous protein.
Example 2: Screening Assay
ROR α expression is correlated with osteoblast differentiation. From in vitro and in vivo data we can conclude that RORα plays a central role in bone metabolism. Thus an activator of RORα may be potentially useful for the treatment of osteoporosis. The search for a ligand may be done in different ways. A cell line, which has stably integrated an expression vector for RORα and a reporter containing direct repeats of the sequence AGGTCA driven by a tk promoter linked to a luciferase reporter gene is used. Direct repeats have been shown to be binding site for RORα.
Plasmids used
The expression vector pCMX RORαl has been described by Giguere et al. (Genes & Development, 8:538-553). The reporter plasmid consists of two repeats of the sequence AGGTCA with an 8 bp spacing placed in front of a tk minimal promoter driving the firefly luciferase reporter gene.
Establishment of a stable cell line
The expression vector for RORαl and the reporter (DRS)tk-luc are transfected in Rosl7/2.8 cells using Fugene as described in the previous section. In addition, an antibiotic resistant gene construct such as the puromycin resistant gene is cotransfected with these two plasmids. Cells which have stably integrated the puromycin resistant gene as well as the reporter and the expression vector for RORα produce stable cell lines suitable for the search of RORα ligands or activators.
Example 3: Examination of the bone phenotype of Staggerer (sg) Mice
Animals
The mouse mutant staggerer (sg) - a mutation, which occurred spontaneously in a stock of obese mice in 1955 - maps within 160 kb of the position of RORα, suggesting the latter as the site of the sg mutation. A deletion within the RORα gene that prevents translation of the ligand-binding domain was found in staggerer mice. Homozygotes for the staggerer show a staggering gait, mild tremor, hypotonia, and small size. The cerebellar cortex is grossly underdeveloped with a deficiency of granule cells and Purkinje cells. RORα KO mice generated in the mid-nineties display a similar phenotype.
We collected bones from 16 week old homozygote (sg/sg), heterozygote (sg/+), and wildtype (+/+) male mice (n=10/group, littermates from several mothers) to determine whether the bone phenotype of these mice would be changed by the deletion within the RORα gene.
We also collected the bones from 10 and 18 month old heterozygote (sg/+), and wildtype (+/+) male mice to determine whether the bones of heterozygous mice would exhibit the same rate of bone loss with aging as those of wildtype mice. Methods
The excised left tibia was put into 4°C fixative (Kamovsky) for 24 hours followed by dehydration. X-ray based evaluations were performed in 70% ethanol (DEXA, pQCT).
X-rays
X-rays (Mammomat, Siemens, Dietikon, Switzerland) were taken for measurement of bone length.
Dual-energy X-ray absorptiometry - DEXA
Tibial bone mineral content (BMC) and bone mineral density (BMD, mg/cm2) were measured using a regular Hologic QDR-1000 instrument (Hologic, Waltham, MA, USA) adapted for measurements of small animals. A collimator with 0.9 cm diameter and an ultrahigh-resolution mode (line spacing 0.0254 cm, resolution: 0.0127 cm) was used. The stability of the measurement was controlled daily by scanning a phantom.
Peripheral quantitative computed tomography - pQCT
Cortical and cancellous bone mass and geometry were monitored in the proximal tibia metaphysis 2.5 mm distal to the medial and lateral intercondylar tubercle using a Stratec-Norland XCT-2000 (Pforzheim, Germany). The following setup was chosen for the measurements: voxel-size: 0.1 mm x 0.1 mm x 0.5mm (slice thickness), scan speed: scout view - 10 mm/s, CT - 2 mm s, 1 block, contour mode 1, peelmode 2, cortical threshold: 400 mg/cm3. The bones were placed into a plastic container filled with 70% ethanol. The stability of the measurement was controlled daily by scanning a phantom.
Statistical analysis
The results are expressed as mean ± standard error (SEM). All statistical analysis was carried out using BMDP (Version 1990 for VAX/VMS, BMDP Statistical Software Inc., Cork Ireland). The data were subjected to one-way analysis of variance (ANOVA). Levene F-test was used to test for equality of variances, and differences between groups were tested using Dunnett test (significance level: p<0.05). All statistical tests were two-tailed. Differences between all groups were tested for statistical significance. Results
DEXA
As shown in Figure 5 the bone mineral content of the tibia was significantly reduced in homozygote sg/sg mice compared to heterozygote sg/+ and wildtype +/+ mice (Figure 5a). This was mainly due to a decreased density (Figure 5c) and not to reduced bone size (Figure 5b, d). (Figure 5: Bone mineral content (a), area (b), density (c), and length (d) of the tibia (DEXA); Mean ± SEM; ANOVA, Dunnett, p<0.05, a = sg/sg <= +/+, b = sg sg sg +;)
PQCT
The total bone mineral content of a cross section through the proximal tibial metaphysis was significantly reduced in the sg/sg animals compared to sg/+ and +/+ animals (Figure 6 a). This was both due to a reduced cross-sectional area (Figure 7 b), indicating a thinner tibia metaphysis in those animals, and to a decreased mineral density (Figure 6 c). Cortical thickness and trabecular density were also reduced (Figure 7 a, b). The heterozygotes (sg/+) did not display this bone phenotype at all. Compared to control wildtype animals (+/+) they showed similar bone geometry and mass (Figure 6, 7) at the age of 4 month, when the animals had reached their peak bone mass. However bone loss was accelerated with aging in heterozygous (sg/+) animals as indicated by an increased loss of cancellous bone density compared to wildtype (+/+) animals (Figure 8). In addition we found that the animals display a stiffness in their hindlimbs, suggesting accelerated joint degeneration.
(Figure 6: Total bone mineral content (a), area (b), and density (c) in a cross section of the proximal tibia (pQCT); Mean ± SEM; ANOVA, Dunnett, p<0.05, a = sg/sg <= +/+, b = sg/sg <=> sg/+;)
(Figure 7: Cortical thickness (a) and trabecular bone mineral density (b) in a cross section of the proximal tibia (pQCT); Mean ± SEM; ANOVA, Dunnett, p<0.05, a = sg sg <=» +/+, b = sg/sg <=> sg +, c = sg/+ «=» +/+;)
(Figure 8: Trabecular bone mineral density in a cross section of the proximal tibia (pQCT); Mean ± SEM; ANOVA, Dunnett, p<0.05; c = sg/+ = +/+;) Summary
The homozygote mouse mutant staggerer, who has a deletion within the RORa gene, has a reduced long bone diameter compared to heterozygotes and the wildtype. More interestingly the bones of the homozygote (sg/sg) animals are osteopenic as indicated by bone mineral measurements (DEXA, pQCT) compared to the wildtype (+/+) animals. Mice, who are heterozygous for the deletion (sg/+), develop normal bone mass. However they exhibit accelerated bone loss during aging compared to their wildtype (+/+) littermates.

Claims

CLAEMS
1. A method for the prophylaxis or treatment of a disease or medical condition which involves excessive bone or cartilage loss comprising administering to a patient an effective amount of an activator of RORα.
2. Use of an activator of RORα in the preparation of a medicament for the treatment of a disease or medical condition which involves excessive bone or cartilage loss.
3. A method for the identification of a compound having bone growth promoting activity which comprises contacting a test compound with a biological system which comprises a functional RORα receptor and which is capable of generating a detectable signal in response to activation of the RORα receptor by a compound having bone growth promoting activity, and monitoring the system for the generation of the signal.
4. A method according to claim 3 for the identification of a compound having bone growth promoting activity comprising contacting the compound with a biological system which comprises a functional RORα receptor and which is capable of generating a detectable signal in response to activation of the RORα receptor by a compound having bone growth promoting activity, measuring the detectable signal in the presence of the test compound and comparing the result obtained with a control.
5. A method according to claim 3 for the comparison of compounds which have bone growth promoting activity, comprising separately contactmg the compounds with a biological system which comprises a functional RORα receptor and which is capable of generating a detectable signal in response to activation of the RORα receptor by a compound having bone growth promoting activity, measuring the detectable signal in the presence of each test compound and comparing the signals obtained.
6. A compound when identified by a method according to claim 3.
7. Use of a compound according to claim 6 in a method for the prophylaxis or treatment of a disease or medical condition which involves excessive bone or cartilage loss.
8. Use of a compound according to claim 6 in the preparation of a medicament for the treatment of a disease or medical condition which involves excessive bone or cartilage loss.
EP00972703A 1999-10-11 2000-10-09 Treatment of excessive bone or cartilage loss with an activator of ror alpha and assay for identifying such activator Withdrawn EP1239922A2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
GBGB9924057.4A GB9924057D0 (en) 1999-10-11 1999-10-11 Organic compounds
GB9924057 1999-10-11
PCT/EP2000/009883 WO2001026737A2 (en) 1999-10-11 2000-10-09 Treatment of excessive bone or cartilage loss with an activator of ror alpha and assay for identifying such activator

Publications (1)

Publication Number Publication Date
EP1239922A2 true EP1239922A2 (en) 2002-09-18

Family

ID=10862542

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00972703A Withdrawn EP1239922A2 (en) 1999-10-11 2000-10-09 Treatment of excessive bone or cartilage loss with an activator of ror alpha and assay for identifying such activator

Country Status (5)

Country Link
EP (1) EP1239922A2 (en)
JP (1) JP2003511426A (en)
AU (1) AU1134601A (en)
GB (1) GB9924057D0 (en)
WO (1) WO2001026737A2 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003000732A2 (en) * 2001-05-07 2003-01-03 Centre National De La Recherche Scientifique Fragments of the retinoic acid-related orphan receptor (ror) comprising the lig and binding domain (lbd), crystal structure of the lbd of ror-beta and their applications
AU2003227689A1 (en) * 2002-04-29 2003-11-17 Novartis Ag Crystal structure of the ligand binding domain of the retinoic acid-related orphan receptor alpha (ror-alpha)
AU2003292144A1 (en) * 2002-11-27 2004-06-18 Develogen Aktiengesellschaft Fur Entwicklungsbiologische Forschung Proteins involved in the regulation of energy homeostasis

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0552612A3 (en) * 1992-01-22 1993-10-20 Hoffmann La Roche Methods for determining and isolating compounds which bind directly to nucleosolic proteins
AU2109695A (en) * 1994-03-30 1995-10-23 Novartis Ag Screening method using the rzr receptor family
US5789434A (en) * 1994-11-15 1998-08-04 Bayer Corporation Derivatives of substituted 4-biarylbutyric acid as matrix metalloprotease inhibitors
FR2776388B1 (en) * 1998-03-20 2006-04-28 Lipha USE OF ROR FAMILY RECEPTORS FOR SCREENING OF SUBSTANCES USEFUL FOR THE TREATMENT OF ATHEROSCLEROSIS

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0126737A2 *

Also Published As

Publication number Publication date
WO2001026737A3 (en) 2001-10-18
JP2003511426A (en) 2003-03-25
AU1134601A (en) 2001-04-23
GB9924057D0 (en) 1999-12-15
WO2001026737A2 (en) 2001-04-19

Similar Documents

Publication Publication Date Title
Zhao et al. Bone morphogenetic protein 2 induces dental follicle cells to differentiate toward a cementoblast/osteoblast phenotype
Watkins et al. Osteoblast connexin43 modulates skeletal architecture by regulating both arms of bone remodeling
Chen et al. Bone morphogenetic protein 2 mediates dentin sialophosphoprotein expression and odontoblast differentiation via NF-Y signaling
Diascro JR et al. High fatty acid content in rabbit serum is responsible for the differentiation of osteoblasts into adipocyte‐like cells
Xu et al. Connexin 43 channels are essential for normal bone structure and osteocyte viability
Chang et al. Noncanonical Wnt-4 signaling enhances bone regeneration of mesenchymal stem cells in craniofacial defects through activation of p38 MAPK
Boabaid et al. Leucine‐rich amelogenin peptide: A candidate signaling molecule during cementogenesis
Kanda et al. 17β-estradiol enhances the production of nerve growth factor in THP-1-derived macrophages or peripheral blood monocyte-derived macrophages
Johnson et al. Novel oxysterols have pro‐osteogenic and anti‐adipogenic effects in vitro and induce spinal fusion in vivo
Tada et al. Elevated extracellular calcium increases expression of bone morphogenetic protein-2 gene via a calcium channel and ERK pathway in human dental pulp cells
AU2007339325A1 (en) Inhibition of PPAR gamma expression by specific osteogenic oxysterols
Ge et al. Discoidin receptor 2 controls bone formation and marrow adipogenesis
WO2011006087A1 (en) Inhibition of ppar gamma expression in preadipocyte cells by oxysterols
MXPA05001694A (en) Bmp-2 estrogen responsive element and methods of using the same.
Reppe et al. Sox‐4 messenger RNA is expressed in the embryonic growth plate and regulated via the parathyroid hormone/parathyroid hormone‐related protein receptor in osteoblast‐like cells
Xie et al. FGFR3 deficient mice have accelerated fracture repair
Shalhoub et al. Multiple levels of steroid hormone‐dependent control of osteocalcin during osteoblast differentiation: Glucocorticoid regulation of basal and vitamin D stimulated gene expression
Wan et al. Proliferation and osteo/odontogenic differentiation of stem cells from apical papilla regulated by Zinc fingers and homeoboxes 2: An in vitro study
Kitagawa et al. F-spondin regulates the differentiation of human cementoblast-like (HCEM) cells via BMP7 expression
Fujita et al. Transactivation of core binding factor α1 as a basic mechanism to trigger parathyroid hormone-induced osteogenesis
Rego et al. Effect of PGE2 induced by compressive and tensile stresses on cementoblast differentiation in vitro
Qu et al. Effect of enamel matrix derivative on proliferation and differentiation of osteoblast cells grown on the titanium implant surface
WO2001026737A2 (en) Treatment of excessive bone or cartilage loss with an activator of ror alpha and assay for identifying such activator
Han et al. Bioactive semaphorin 3A promotes sequential formation of sensory nerve and type H vessels during in situ osteogenesis
Chua et al. Hematopoietic wnts modulate endochondral ossification during fracture healing

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020201

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: NOVARTIS AG

Owner name: NOVARTIS PHARMA GMBH

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: NOVARTIS AG

Owner name: NOVARTIS PHARMA GMBH

17Q First examination report despatched

Effective date: 20031125

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20040607

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: NOVARTIS AG

Owner name: NOVARTIS PHARMA GMBH