EP1237900A4 - UNDER UNITS OPTIMIZED FUSION PROTEINS - Google Patents

UNDER UNITS OPTIMIZED FUSION PROTEINS

Info

Publication number
EP1237900A4
EP1237900A4 EP00963585A EP00963585A EP1237900A4 EP 1237900 A4 EP1237900 A4 EP 1237900A4 EP 00963585 A EP00963585 A EP 00963585A EP 00963585 A EP00963585 A EP 00963585A EP 1237900 A4 EP1237900 A4 EP 1237900A4
Authority
EP
European Patent Office
Prior art keywords
fusion protein
protein
sequence
milk
transgenic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00963585A
Other languages
German (de)
French (fr)
Other versions
EP1237900A1 (en
Inventor
Dan Pollock
Harry M Meade
Klaus Bosslet
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
rEVO Biologics Inc
Original Assignee
GTC Biotherapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by GTC Biotherapeutics Inc filed Critical GTC Biotherapeutics Inc
Publication of EP1237900A1 publication Critical patent/EP1237900A1/en
Publication of EP1237900A4 publication Critical patent/EP1237900A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01031Beta-glucuronidase (3.2.1.31)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3007Carcino-embryonic Antigens
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K19/00Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/24Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405Glucanases
    • C12N9/2434Glucanases acting on beta-1,4-glucosidic bonds
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/55Fusion polypeptide containing a fusion with a toxin, e.g. diphteria toxin
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/74Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
    • C07K2319/75Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor containing a fusion for activation of a cell surface receptor, e.g. thrombopoeitin, NPY and other peptide hormones

Definitions

  • the invention relates to a fusion protein having a first and a second member, wherein the second member of the fusion protein assembles into a multimer and the other member is chosen, or modified, such that it promotes assembly of the second member into a preselected or an optimal number of subunits.
  • Fusion proteins can combine useful properties of distinct proteins.
  • a fusion protein can combine the targeting property of an antibody molecule with the cytotoxic effect of a toxin.
  • the invention features, a method of making a fusion protein having: a first member, e.g., a targeting moiety, e.g., an immunoglobulin subunit (e.g., an immunoglobulin heavy chain or light chain, or a fragment of either) fused to a second member, e.g., an enzyme, e.g., a toxin (e.g., an enzyme or toxin subunit).
  • a targeting moiety e.g., an immunoglobulin subunit (e.g., an immunoglobulin heavy chain or light chain, or a fragment of either) fused to a second member, e.g., an enzyme, e.g., a toxin (e.g., an enzyme or toxin subunit).
  • a targeting moiety e.g., an immunoglobulin subunit (e.g., an immunoglobulin heavy chain or light chain, or a fragment of either) fused to a second member, e
  • the first member, or the fusion protein assembles into a form having the same number of subunits as are present in an active, e.g., native, form of the second member. In preferred embodiments the first member, or the fusion protein, assembles into a form having fewer subunits than are present in an active, e.g., native, form of the second member. In preferred embodiments, the fusion protein assembles into a complex, e.g., a di-, tri-, tetra-, or higher multi-meric complex. Preferably, the fusion protein assembles into a dimer or a tetramer.
  • the fusion protein assembles into a complex having enzymatic activity.
  • the first member is a monomer.
  • it is a species which is normally monomeric, or which has been modified, e.g., by mutation of a site which modulates formation or maintenance of a multimer of subunits.
  • the monomeric form is useful because it does not prevent formation of a multimer by the second member.
  • the first member is a forms a dimmer, e.g., a heterodimer or homodimer.
  • a dimmer e.g., a heterodimer or homodimer.
  • it is a species which is normally dimeric, or which has been modified, e.g., by mutation of a site which modulates formation or maintenance of a multimerof subunits, to be dimeric.
  • the dimeric form is useful because it does not prevent formation of a multimer by the second member.
  • the fusion protein has the formula: R1-L-R2; R2-L-R1 ; R2-R1; or R1-R2, wherein Rl is a first member, e.g., an immunoglobulin subunit, L is a peptide linker and R2 is a second member, e.g., an enzyme subunit.
  • Rl and R2 are covalently linked, e.g., directly fused or linked via a peptide linker.
  • the first or the second member of the fusion protein, or both are modified by, e.g., substituting or deleting, a portion of the amino acid sequence.
  • the fusion protein includes a first member which is an Ig superfamily member, preferably an Ig subunit, which has been modified to inhibit formation of a multimeric form, e.g., a tetrameric form.
  • the modification which can be a change, insertion, or deletion of one or more amino acid residues, results in a subunit which does not form a multimer or which forms a lower order multimer that it normally would form, e.g., it forms a dimer rather than a tetramer.
  • a region which mediates formation or maintenance of a multimeric structure is modified and thereby wholly or partly inactivated.
  • a portion of an immunoglobulin subunit e.g., a heavy chain, e.g., the hinge region, is modified, e.g., deleted.
  • the modified immunoglobulin is monovalent.
  • the modification of the first member inhibits the assembly of the first member, or the fusion protein into a multimer, e.g., results in the production of a monomer, or, e.g., of a dimer, where a higher order multimer would otherwise be formed.
  • the first member is a targeting agent, e.g., a polypeptide having a high affinity for a target, e.g., an antibody, a ligand, or an enzyme.
  • the first member is an immunoglobulin or a fragment thereof, e.g., an antigen binding fragment thereof.
  • the immunoglobulin is a monoclonal antibody, e.g., a human, murine (e.g., mouse) monoclonal antibody; or a recombinant monoclonal antibody.
  • the monoclonal antibody is a human antibody.
  • the monoclonal antibody is a recombinant antibody, e.g., a chimeric or a humanized antibody (e.g., it has a variable region, or at least a complementarity determining region (CDR), derived from a non-human antibody (e.g., murine) with the remaining portion(s) are human in origin); or a transgenically produced human antibody (e.g., an antibody produced by a hybridoma which includes a B cell obtained from a transgenic non-human animal, e.g., a transgenic mouse, having a genome comprising a human heavy chain transgene and a light chain transgene fused to an immortalized cell).
  • a recombinant antibody e.g., a chimeric or a humanized antibody (e.g., it has a variable region, or at least a complementarity determining region (CDR), derived from a non-human antibody (e.g., murine) with the remaining portion(s
  • the first member is a full-length antibody (e.g., an IgGl or IgG4 antibody) or includes only an antigen-binding portion (e.g., a Fab, F(ab')2, Fv or a single chain Fv fragment).
  • the first member is an immunoglobulin subunit selected from the group consisting of a subunit of : IgG (e.g., IgGl, IgG2, IgG3, IgG4), IgM, IgAl, IgA2, IgA.sub.sec, IgD, of IgE.
  • the immunoglobulin subunit is an IgG isotype, e.g., IgG3.
  • the first member is a monomer, e.g., a single chain antibody; or forms a dimer, e.g., a dimer of an immunoglobulin heavy chain and a light chain.
  • the first member is a monovalent antibody (e.g., it includes one pair of heavy and light chains, or antigen binding portions thereof). In other embodiments, the first member is divalent antibody (e.g., it includes two pairs of heavy and light chains, or antigen binding portions thereof).
  • the first member includes an immunoglobulin heavy chain or a fragment thereof, e.g., an antigen binding fragment thereof.
  • the immunoglobulin heavy chain or fragment thereof e.g., an antigen binding fragment thereof
  • the immunoglobulin heavy chain-enzyme fusion protein is capable of assembling into a functional complex, e.g., a di-, tri-, tetra-, or multi-meric complex having enzymatic activity.
  • the first member includes an immunoglobulin heavy chain or fragment thereof (e.g., an antigen binding fragment thereof), and a light chain or a fragment thereof (e.g., an antigen binding fragment thereof).
  • the immunoglobulin heavy chain is linked, e.g., linked via a peptide linker or directly fused, to an enzyme.
  • the fused immunoglobulin heavy chain -enzyme fusion protein assembles with a light chain, e.g., to produce a functional complex, e.g., a di-, tri-, tetra-, or multi-meric complex having enzymatic activity.
  • the most preferred form is dimeric.
  • the first member is an immunoglobulin that interacts with (e.g., binds to) a cell surface antigen on a target cell, e.g., a cancer cell.
  • a tumor cell antigen e.g., carcinoembryonic antigen (CEA), TAG- 72, her-2/neu, epidermal growth factor receptor, transferrin receptor, among others.
  • the first member localizes, e.g., increases the concentration of, a fusion protein in proximity to a target cell, e.g., a cancer cell.
  • the second member is a subunit of an enzyme, e.g., an enzyme having one or more subunits (e.g., catalytic subunits).
  • the enzyme include one, preferably two, more preferably three, most preferably four subunits.
  • a preferred enzyme is beta-glucuronidase, e.g., a human beta-glucuronidase.
  • the enzyme can be a homo-, or a hetero-multimer. If the enzyme is a heteromultimer, two (or more) fusion proteins are needed to form the active product.
  • the second member is capable of converting a precursor drug, e.g., a prodrug, to a toxic drug.
  • the first member is an immunoglobulin G (IgG) heavy and light chains
  • the second member is human beta-glucuronidase fusion protein.
  • the light chain of the first member has an amino acid sequence as shown in Figure IB (SEQ ID NO:2); the light chain of the first member has an amino acid sequence at least 60%, 70%, 75%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% sequence identity or homology with an amino acid sequence from Figure IB (SEQ ID NO:2).
  • the light chain of the first member has an amino acid sequence that is encoded by a nucleotide sequence as shown in Figure IB (SEQ ID NO: 1), or Figure 2 (SEQ ID NO:37); the light chain of the first member has an amino acid sequence that is encoded by a nucleotide sequence at least 60%, 70%, 75%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% sequence identity or homology with a nucleotide sequence shown in Figure IB (SEQ ID NOs:2, 3, or 4), or Figure 2 (SEQ ID NO:37); the light chain of the first member has an amino acid sequence that is encoded by a nucleotide sequence that is capable of hybridizing under stringent conditions to the nucleotide sequence shown in Figure IB.
  • the heavy chain of the first member has an amino acid sequence as shown in Figure 4B (SEQ ID NO:6, 7, 8, 9, 10 and/or 11), or Figure 5 (SEQ ID NOs:13, 14, 15 and/or 16); the heavy chain of the first member has an amino acid sequence at least 60%, 70%, 75%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% sequence identity or homology with an amino acid sequence from Figure 4B (SEQ ID NO: 6, 7, 8, 9, 10 and/or 11), or Figure 5 (SEQ ID Nos: 13, 14, 15 and/or 16).
  • the heavy chain of the first member has an amino acid sequence that is encoded by a nucleotide sequence as shown in Figure 4B (SEQ ID NO: 5), or Figure 5 (SEQ ID NO: 12); the heavy chain of the first member has an amino acid sequence that is encoded by a nucleotide sequence at least 60%, 70%, 75%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% sequence identity or homology with a nucleotide sequence shown in Figure 4B (SEQ ID NO:5), or Figure 5 (SEQ ID NO: 12); the heavy chain of the first member has an amino acid sequence that is encoded by a nucleotide sequence that is capable of hybridizing under stringent conditions to the nucleotide sequence shown in Figure 4B, or 5.
  • the fusion protein includes a peptide linker and the peptide linker has one or more of the following characteristics: a) it allows for the rotation of the first and the second member relative to each other; b) it is resistant to digestion by proteases; c) it does not interact with the first or the second; d) it allows the fusion protein to form a complex (e.g., a di-, tri-, terra-, or multi-meric complex) that retains enzymatic activity; and e) it promotes folding and/or assembly of the fusion protein into an active complex.
  • a complex e.g., a di-, tri-, terra-, or multi-meric complex
  • the fusion protein includes a peptide linker and the peptide linker is 5 to 60, more preferably, 10 to 30, amino acids in length; the peptide linker is 20 amino acids in length; the peptide linker is 17 amino acids in length; each of the amino acids in the peptide linker is selected from the group consisting of Gly, Ser, Asn, Thr and Ala; the peptide linker includes a Gly-Ser element.
  • the fusion protein includes a peptide linker and the peptide linker includes a sequence having the formula (Ser-Gly-Gly-Gly-Gly)y wherein y is
  • the peptide linker includes a sequence having the formula (Ser-Gly-Gly-Gly-Gly)3.
  • the peptide linker includes a sequence having the formula ((Ser-Gly-Gly-Gly)3-Ser-Pro).
  • the fusion protein is produced recombinantly, e.g., produced in a host cell (e.g., a cultured cell), or in a transgenic animal, e.g., a transgenic mammal (e.g., a goat, a cow, or a rodent (e.g., a mouse).
  • a transgenic mammal e.g., a goat, a cow, or a rodent (e.g., a mouse).
  • the fusion protein is produced in a transgenic mammal
  • the method further includes: providing a transgenic animal, which includes a transgene which provides for the expression of a fusion protein described herein; allowing the transgene to be expressed; and, preferably, recovering fusion protein, from the milk of the transgenic mammal.
  • the fusion protein can further include: a signal sequence which directs the secretion of the fusion protein, e.g., a signal from a secreted protein (e.g., a signal from a protein secreted into milk; or an immunoglobulin secretory signal); and
  • a sequence which encodes a sufficient portion of the amino terminal coding region of a secreted protein e.g., a protein secreted into milk, or an immunoglobulin, to promote secretion, e.g., in the milk of a transgenic mammal, of the fusion protein.
  • the fusion protein is made in a mammary gland of the transgenic mammal, e.g., a ruminant, e.g., a goat or a cow.
  • the fusion protein is secreted into the milk of the transgenic mammal, e.g., a ruminant, e.g., a dairy animal, e.g., a goat or a cow.
  • a ruminant e.g., a dairy animal, e.g., a goat or a cow.
  • the fusion protein is secreted into the milk of a transgenic mammal at concentrations of at least about 0.1 mg/ml, 0.5 mg/ml, 1.0 mg/ml, 1.5 mg/ml, 2 mg/ml, 3 mg/ml, 5 mg/ml or higher.
  • the fusion protein is made under the control of a mammary gland specific promoter, e.g., a milk specific promoter, e.g., a milk serum protein or casein promoter.
  • a milk specific promoter e.g., a milk serum protein or casein promoter.
  • the milk specific promoter can be a casein promoter, beta lactoglobulin promoter, whey acid protein promoter, or lactalbumin promoter.
  • the promoter is a goat ⁇ casein promoter.
  • the transgene encoding the fusion protein is a nucleic acid construct which includes:
  • a promoter e.g., a mammary epithelial specific promoter, e.g., a milk protein promoter
  • nucleotide sequence which encodes a sufficient portion of the amino terminal coding region of a secreted protein, e.g. a protein secreted into milk, or an immunoglobulin, to allow secretion, e.g., in the milk of a transgenic mammal, of the fusion protein; (e) one or more nucleotide sequences which encode a fusion protein, e.g., an immunoglobulin-enzyme fusion protein as described herein; and
  • a 3' untranslated region from a mammalian gene e.g., a mammary epithelial specific gene, (e.g., a milk protein gene).
  • elements a (if present), b, c, d (if present), and f of the transgene are from the same gene; the elements a (if present), b, c, d (if present), and f of the transgene are from two or more genes.
  • the signal sequence, the promoter sequence and the 3' untranslated sequence can be from a mammary epithelial specific gene, e.g., a milk serum protein or casein gene (e.g., a ⁇ casein gene).
  • the signal sequence, the promoter sequence and the 3' untranslated sequence are from a goat ⁇ casein gene.
  • the promoter of the transgene is a mammary epithelial specific promoter, e.g., a milk serum protein or casein promoter (e.g., a ⁇ casein promoter).
  • the milk specific promoter can be a casein promoter, beta lactoglobulin promoter, whey acid protein promoter, or lactalbumin promoter.
  • the promoter is a goat ⁇ casein promoter.
  • the signal sequence encoded by the transgene is an amino terminal sequence which directs the expression of the protein to the exterior of a cell, or into the cell membrane.
  • the signal sequence can be obtained from an immunoglobulin protein.
  • the signal sequence is from a protein which is secreted into the milk, e.g., the milk of the transgenic animal.
  • the one or more nucleotide sequences encoding a fusion protein include one or more of: a nucleotide sequence encoding a first member, e.g., an immunoglobulin heavy chain (or an antigen binding portion thereof) operably linked to a second member, e.g., an enzyme; (optionally) a nucleotide sequence encoding an immunoglobulin light chain (or an antigen binding portion thereof), or both.
  • the nucleotide sequences encoding the heavy chain fusion and the light chain are operatively linked in a single construct, e.g., a single cosmid.
  • the nucleotide sequences encoding the heavy chain fusion and the light chain are introduced into a transgenic animal in separate constructs. Preferably, when linked, the nucleotide sequences are arranged in the following order:
  • Nl is a first member, e.g., an immunoglobulin heavy chain (or an antigen binding portion thereof) operably linked to a second member, e.g., an enzyme; and N2 is an immunoglobulin light chain (or an antigen binding portion thereof).
  • the nucleotide sequences can be in any orientation with respect to each other, e.g., sense/sense; reverse/reverse; sense/reverse; or reverse/sense.
  • the 3' untranslated region of the transgene includes a polyadenylation site, and is obtained from a mammalian gene, e.g., a mammary epithelial specific gene, e.g., a milk serum protein gene or casein gene.
  • the 3' untranslated region can be obtained from a casein gene (e.g., a ⁇ casein gene), a beta lactoglobulin gene, whey acid protein gene, or lactalbumin gene.
  • the 3' untranslated region is from a goat ⁇ casein gene.
  • the transgene e.g., the transgene as described herein, integrates into a germ cell and/or a somatic cell of the transgenic animal.
  • the invention features, a method for providing a transgenically produced fusion protein, e.g., a fusion protein as described herein, in the milk, of a transgenic mammal.
  • the method includes obtaining milk from a transgenic mammal, which includes a fusion protein encoding transgene, e.g., one which has been introduced into its germline, e.g., a nucleic acid construct as described herein, that result in the expression of the protein-coding sequence of fusion protein in mammary gland epithelial cells, thereby secreting the fusion protein in the milk of the mammal.
  • the transgenic mammal is selected from the group consisting of sheep, mice, pigs, cows and goats.
  • the preferred transgenic mammal is a goat.
  • the fusion protein is secreted into the milk of a transgenic mammal at concentrations of at least about 0.1 mg/ml, 0.5 mg/ml, 1.0 mg/ml, 1.5 mg/ml, 2 mg/ml, 3 mg/ml, 5 mg/ml or higher.
  • the transgene encoding the immunoglobulin-enzyme fusion protein is a nucleic acid construct which includes:
  • a promoter e.g., a mammary epithelial specific promoter, e.g., a milk protein promoter
  • a nucleotide sequence which encodes a sufficient portion of the amino terminal coding region of a secreted protein, e.g., a protein secreted into milk, or an immunoglobulin, to allow secretion, e.g., in the milk of a transgenic mammal, of the non- secreted protein;
  • fusion protein e.g., a fusion protein as described herein;
  • elements a (if present), b, c, d (if present), and f of the transgene are from the same gene; the elements a (if present), b, c, d (if present), and f of the transgene are from two or more genes.
  • the signal sequence, the promoter sequence and the 3' untranslated sequence can be from a mammalian gene, e.g., a mammary epithelial specific gene, e.g., a milk serum protein or casein gene (e.g., a ⁇ casein gene).
  • a mammary epithelial specific gene e.g., a milk serum protein or casein gene (e.g., a ⁇ casein gene).
  • the signal sequence, the promoter sequence and the 3' untranslated sequence are from a goat ⁇ casein gene.
  • the promoter of the transgene is a mammary epithelial specific promoter, e.g., a milk serum protein or casein promoter (e.g., a ⁇ casein promoter).
  • the milk specific promoter can be a casein promoter, beta lactoglobulin promoter, whey acid protein promoter, or lactalbumin promoter.
  • the promoter is a goat ⁇ casein promoter.
  • the signal sequence encoded by the transgene is an amino terminal sequence which directs the expression of the protein to the exterior of a cell, or into the cell membrane.
  • the signal sequence is from a protein which is secreted into the milk, e.g., the milk of the transgenic animal.
  • the one or more nucleotide sequences encoding an fusion protein include one or more of: a nucleotide sequence encoding an immunoglobulin heavy chain (or an antigen binding portion thereof) fused to an enzyme; a nucleotide sequence encoding an immunoglobulin light chain (or an antigen binding portion thereof), or both.
  • the nucleotide sequences encoding the heavy chain fusion and the light chain are operatively linked in a single construct, e.g., a single cosmid.
  • the nucleotide sequences encoding the heavy chain fusion and the light chain are introduced into a transgenic animal in separate constructs.
  • the nucleotide sequences are arranged in the following order:
  • nucleotide sequences can be in any orientation with respect to each other, e.g., sense/sense; reverse/reverse; sense/reverse; or reverse/sense.
  • the 3' untranslated region of the transgene includes a polyadenylation site, and is obtained from a mammalian gene, e.g., a mammary epithelial specific gene, (e.g., a milk serum protein gene or casein gene).
  • the 3' untranslated region can be obtained from a casein gene (e.g., a ⁇ casein gene), a beta lactoglobulin gene, whey acid protein gene, or lactalbumin gene.
  • the 3' untranslated region is from a goat ⁇ casein gene.
  • the transgene e.g., the transgene as described herein, integrates into a germ cell and/or a somatic cell of the transgenic animal.
  • the invention features, a transgene, e.g., a nucleic acid construct, preferably, an isolated nucleic acid construct, which includes:
  • a promoter e.g., a mammary epithelial specific promoter, e.g., a milk protein promoter
  • a nucleotide sequence which encodes a signal sequence which can direct the secretion of the fusion protein e.g. a signal sequence from a milk specific protein, or an immunoglobulin
  • a nucleotide sequence which encodes a sufficient portion of the amino terminal coding region of a secreted protein e.g. a protein secreted into milk, or an immunoglobulin, to allow secretion, e.g., in the milk of a transgenic mammal, of the fusion protein protein;
  • fusion protein e.g., a fusion protein as described herein;
  • a 3' untranslated region from a mammalian gene e.g., a mammary epithelial specific gene, (e.g., a milk protein gene).
  • elements a (if present), b, c, d (if present), and f of the transgene are from the same gene; the elements a (if present), b, c, d (if present), and f of the transgene are from two or more genes.
  • the signal sequence, the promoter sequence and the 3' untranslated sequence can be from a mammalian gene, e.g., a mammary epithelial specific gene, e.g., a milk serum protein or casein gene (e.g., a ⁇ casein gene).
  • the signal sequence, the promoter sequence and the 3' untranslated sequence are from a goat ⁇ casein gene.
  • the promoter of the transgene is a mammary epithelial specific promoter, e.g., a milk serum protein or casein promoter (e.g., a ⁇ casein promoter).
  • the milk specific promoter can be a casein promoter, beta lactoglobulin promoter, whey acid protein promoter, or lactalbumin promoter.
  • the promoter is a goat ⁇ casein promoter.
  • the signal sequence encoded by the transgene is an amino terminal sequence which directs the expression of the protein to the exterior of a cell, or into the cell membrane.
  • the signal sequence is from a milk specific protein, or an immunoglobulin.
  • the signal sequence directs secretion of the encoded fusion protein into the milk of a transgenic animal, e.g., a transgenic mammal.
  • the one or more nucleotide sequences encoding a fusion protein include one or more of: a nucleotide sequence encoding an immunoglobulin heavy chain (or an antigen binding portion thereof) fused to an enzyme; a nucleotide sequence encoding an immunoglobulin light chain (or an antigen binding portion thereof), or both.
  • the nucleotide sequences encoding the heavy chain fusion and the light chain are operatively linked in a single construct, e.g., a single cosmid.
  • the nucleotide sequences encoding the heavy chain fusion and the light chain are introduced into a transgenic animal in separate constructs.
  • the nucleotide sequences when linked, are arranged in the following order: 5'-Nl-3' linked to 5'-N2-3'; or 5'-N2-3' linked to 5'-Nl-3' wherein Nl is an immunoglobulin heavy chain (or an antigen binding portion thereof) linked to an enzyme; and N2 is an immunoglobulin light chain (or an antigen binding portion thereof).
  • the nucleotide sequences can be in any orientation with respect to each other, e.g., sense/sense; reverse/reverse; sense/reverse; or reverse/sense.
  • the 3' untranslated region of the transgene includes a polyadenylation site, and is obtained from a mammalian gene, e.g., a mammary epithelial specific gene, (e.g., a milk serum protein gene or casein gene).
  • the 3' untranslated region can be obtained from a casein gene (e.g., a ⁇ casein gene), a beta lactoglobulin gene, whey acid protein gene, or lactalbumin gene.
  • the 3' untranslated region is from a goat ⁇ casein gene.
  • the invention features a nucleic acid molecule encoding a fusion protein, e.g., a fusion protein as described herein.
  • nucleic acid has a nucleotide sequence as shown in Figure IB (SEQ ID NO:l), Figure 2 (SEQ ID NO:37), Figure 4B (SEQ ID NO:5), or Figure 5 (SEQ ID NO: 12); the nucleic acid has a nucleotide sequence at least 60%, 70%, 75%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% sequence identity or homology with a nucleotide sequence shown in Figure IB (SEQ ID NO:l), Figure 2 (SEQ ID NO:37), Figure 4B (SEQ ID NO:5), or Figure 5 (SEQ ID NO: 12); the nucleic acid has a nucleotide sequence that is capable of hybridizing under stringent conditions to the nucleotide sequence shown in Figure IB, Figure 2, Figure 4B, or Figure 5.
  • the nucleic acid has a nucleotide sequence which encodes an amino acid sequence as shown in Figure 1 A (SEQ ID NOs:2, 3, 4), Figure 4B (SEQ ID NO:6, 7, 8, 9, 10, 11), or Figure 5 (SEQ ID NO:13, 14, 15, 16); the nucleic acid has a nucleotide sequence which encodes an amino acid sequence which is at least 60%, 70%, 75%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% sequence identity or homology with an amino acid sequence from Figure 1A (SEQ ID NO:2, 3, 4), Figure 4B (SEQ ID NO:6, 7, 8, 9, 10, 11), or Figure 5 (SEQ ID NO:13, 14, 15, 16).
  • the invention features a host cell, e.g., an isolated host cell (e.g., a cultured cell), which includes a nucleic acid of the invention (e.g., a nucleic acid, or a transgene, e.g., a nucleic acid construct, as described herein).
  • a host cell e.g., an isolated host cell (e.g., a cultured cell)
  • a nucleic acid of the invention e.g., a nucleic acid, or a transgene, e.g., a nucleic acid construct, as described herein.
  • the invention features, a fusion protein described herein, or a purified preparation thereof
  • a pharmaceutical or nutraceutical composition having a therapeutically effective amount of a fusion protein, e.g., a fusion protein as described herein, and a pharmaceutically acceptable carrier.
  • the composition includes milk.
  • the invention features, a transgenic animal which includes a transgene that encodes a fusion protein, e.g., a transgene which encodes a fusion protein described herein.
  • Preferred transgenic animals include: mammals; birds; reptiles; marsupials; and amphibians.
  • Suitable mammals include: ruminants; ungulates; domesticated mammals; and dairy animals.
  • Particularly preferred animals include: mice, goats, sheep, camels, rabbits, cows, pigs, horses, oxen, and llamas.
  • Suitable birds include chickens, geese, and turkeys.
  • the transgenic protein is secreted into the milk of a transgenic animal
  • the animal should be able to produce at least 1, and more preferably at least 10, or 100, liters of milk per year.
  • the transgenic animal is a ruminant, e.g., a goat, cow or sheep. Most preferably, the transgenic animal is a goat.
  • the transgenic mammals has germ cells and somatic cells containing a transgene that encodes a fusion protein, e.g., a transgene which encodes a fusion protein described herein.
  • the fusion protein expressed in the transgenic animal is under the control of a mammary gland specific promoter, e.g., a milk specific promoter, e.g., a milk serum protein or casein promoter.
  • a milk specific promoter e.g., a milk serum protein or casein promoter.
  • the milk specific promoter can be a casein promoter, beta lactoglobulin promoter, whey acid protein promoter, or lactalbumin promoter.
  • the promoter is a goat ⁇ casein promoter.
  • the transgenic animal is a mammal
  • the fusion protein is secreted into the milk of the transgenic animal at concentrations of at least about 0.1 mg/ml, 0.5 mg/ml, 1.0 mg/ml, 1.5 mg/ml, 2 mg/ml, 3 mg/ml, 5 mg/ml or higher.
  • the invention features, a method of making a transgenic organism which has a fusion protein transgene.
  • the method includes providing or forming in a cell of an organism, a fusion protein, e.g., a transgene which encodes a fusion protein described herein; and allowing the cell, or a descendent of the cell, to give rise to a transgenic organism.
  • the transgenic organism is a transgenic plant or animal.
  • Preferred transgenic animals include: mammals; birds; reptiles; marsupials; and amphibians.
  • Suitable mammals include: ruminants; ungulates; domesticated mammals; and dairy animals.
  • Particularly preferred animals include: mice, goats, sheep, camels, rabbits, cows, pigs, horses, oxen, and llamas.
  • Suitable birds include chickens, geese, and turkeys.
  • the transgenic protein is secreted into the milk of a transgenic animal, the animal should be able to produce at least 1, and more preferably at least 10, or 100, liters of milk per year.
  • the fusion protein is under the control of a mammary gland specific promoter, e.g., a milk specific promoter, e.g., a milk serum protein or casein promoter.
  • a milk specific promoter e.g., a milk serum protein or casein promoter.
  • the milk specific promoter can be a casein promoter, beta lactoglobulin promoter, whey acid protein promoter, or lactalbumin promoter.
  • the promoter is a goat ⁇ casein promoter.
  • the organism is a mammal
  • the fusion protein is secreted into the milk of the transgenic animal at concentrations of at least about 0.1 mg/ml, 0.5 mg/ml, 1.0 mg/ml, 1.5 mg/ml, 2 mg/ml, 3 mg/ml, 5 mg/ml or higher.
  • the invention features, a method of selectively killing an aberrant or diseased cell which expresses on its surface a target antigen, e.g., a cancer cell expressing a cell suface antigen.
  • the method includes: contacting said aberrant or diseased cell with an effective amount of a fusion protein, e.g., a fusion protein described herein, wherein either the first or the second member of the fusion protein recognizes said target antigen, such that selective killing of the cell occurs.
  • the subject method can be used on cells in culture, e.g. in vitro or ex vivo (e.g., cultures comprising cancer cells).
  • cells can be cultured in vitro in culture medium and the contacting step can be effected by adding the fusion protein of the invention to the culture medium.
  • the method can be performed on cells (e.g., cancer cells) present in a subject, e.g., as part of an in vivo (e.g., therapeutic or prophylactic) protocol.
  • the invention features, a method of selectively killing an aberrant or diseased cell which expresses on its surface a target antigen, e.g., a cancer cell expressing a cell suface antigen.
  • the method includes: introducing into said aberrant or diseased cell a nucleic acid encoding a fusion protein, e.g., a fusion protein described herein, wherein either the first or the second member of the fusion protein recognizes said target antigen, such that selective killing of the cell occurs.
  • the subject method can be used on cells in culture, e.g. in vitro or ex vivo (e.g., cultures comprising cancer cells).
  • cells can be cultured in vitro in culture medium and the nucleic acids of the invention can be introduced to the culture medium.
  • the method can be performed on cells (e.g., cancer cells) present in a subject, e.g., as part of an in vivo (e.g., therapeutic or prophylactic) gene therapy protocol.
  • the invention provides, a method of treating in a subject, a disorder characterized by aberrant growth or activity of a cell which expresses on its surface a target antigen, e.g., a cancer cell expressing a target antigen.
  • the method includes administering to the subject an effective amount of a fusion protein, or a nucleic acid encoding a fusion protein (e.g., a fusion protein described herein), wherein either the first or the second member of the fusion protein recognizes said target antigen.
  • the disease is characterized by aberrant growth or activity of a cell, e.g., cancer cell, an immune cell.
  • the present invention provides a method for detecting in vitro or in vivo the presence of target antigen in a sample, e.g., for diagnosing a disease. The method comprises (i) contacting a sample or a control sample under conditions that allow interaction of a labelled fusion protein, e.g.. a fusion protein as described herein, and (ii) detecting formation of a complex. A statistically significant change in the formation of the complex between the fusion protein antibody and the target antigen with respect to a control sample is indicative the presence of target antigen in the sample.
  • the second member is an enzyme, e.g., horseradish peroxidase.
  • the invention features fusion proteins in which the ability of a first member of the fusion to from a multimer is chosen so as to optimize a characteristic, e.g., activity or solubility, of the second member.
  • a purified preparation, substantially pure preparation of a polypeptide, or an isolated polypeptide as used herein means a polypeptide that has been separated from at least one other protein, lipid, or nucleic acid with which it occurs in the cell or organism which expresses it, e.g., from a protein, lipid, or nucleic acid in a transgenic animal or in a fluid, e.g., milk, or other substance, e.g., an egg, produced by a transgenic animal.
  • the polypeptide is preferably separated from substances, e.g., antibodies or gel matrix, e.g., polyacrylamide, which are used to purify it.
  • the polypeptide preferably constitutes at least 10, 20, 50 70, 80 or 95% dry weight of the purified preparation.
  • the preparation contains: sufficient polypeptide to allow protein sequencing; at least 1, 10, or 100 ⁇ g of the polypeptide; at least 1, 10, or 100 mg of the polypeptide.
  • a substantially pure nucleic acid is a nucleic acid which is one or both of: not immediately contiguous with either one or both of the sequences, e.g., coding sequences, with which it is immediately contiguous (i.e., one at the 5' end and one at the 3' end) in the naturally-occurring genome of the organism from which the nucleic acid is derived; or which is substantially free of a nucleic acid sequence with which it occurs in the organism from which the nucleic acid is derived.
  • the term includes, for example, a recombinant DNA which is inco ⁇ orated into a vector, e.g., into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other DNA sequences.
  • Substantially pure DNA also includes a recombinant DNA which is part of a hybrid gene encoding additional fusion protein sequence.
  • Homology, or sequence identity refers to the sequence similarity between two polypeptide molecules or between two nucleic acid molecules. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are homologous at that position (i.e., as used herein amino acid or nucleic acid "homology” is equivalent to amino acid or nucleic acid "identity”).
  • the two sequences are 60% homologous or have 60% sequence identity.
  • the DNA sequences ATTGCC and TATGGC share 50% homology or sequence identity.
  • a comparison is made when two sequences are aligned to give maximum homology or sequence identity.
  • the comparison of sequences and determination of percent homology between two sequences can be accomplished using a mathematical algorithm.
  • a preferred, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci.
  • transgene means a nucleic acid sequence (encoding, e.g., one or more fusion protein polypeptides), which is introduced into the genome of a transgenic organism.
  • a transgene can include one or more transcriptional regulatory sequences and other nucleic acid, such as introns, that may be necessary for optimal expression and secretion of a nucleic acid encoding the fusion protein.
  • a transgene can include an enhancer sequence.
  • a fusion protein sequence can be operatively linked to a tissue specific promoter, e.g., mammary gland specific promoter sequence that results in the secretion of the protein in the milk of a transgenic mammal, a urine specific promoter, or an egg specific promoter.
  • tissue specific promoter e.g., mammary gland specific promoter sequence that results in the secretion of the protein in the milk of a transgenic mammal, a urine specific promoter, or an egg specific promoter.
  • the term "transgenic cell” refers to a
  • transgenic organism refers to a transgenic animal or plant.
  • a transgenic animal is a non-human animal in which one or more, and preferably essentially all, of the cells of the animal contain a transgene introduced by way of human intervention, such as by transgenic techniques known in the art.
  • the transgene can be introduced into the cell, directly or indirectly by introduction into a precursor of the cell, by way of deliberate genetic manipulation, such as by microinjection or by infection with a recombinant virus.
  • Mammals are defined herein as all animals, excluding humans, that have mammary glands and produce milk.
  • a "dairy animal” refers to a milk producing non-human animal which is larger than a rodent.
  • the dairy animal produce large volumes of milk and have long lactating periods, e.g., cows or goats.
  • non-human animals include vertebrates, e.g., mammals and non-mammals, such as non-human primates, ruminants, birds, amphibians, reptiles and rodents, e.g., mice and rats.
  • the term also includes rabbits.
  • a "transgenic plant” is a plant, preferably a multi-celled or higher plant, in which one or more, and preferably essentially all, of the cells of the plant contain a transgene introduced by way of human intervention, such as by transgenic techniques known in the art.
  • the term "plant” refers to either a whole plant, a plant part, a plant cell, or a group of plant cells.
  • the class of plants which can be used in methods of the invention is generally as broad as the class of higher plants amenable to transformation techniques, including both monocotyledonous and dicotyledonous plants. It includes plants of a variety of ploidy levels, including polyploid, diploid and haploid.
  • immunoglobulin and “antibody” refer to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds.
  • Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as HCVR or VH) and a heavy chain constant region.
  • the heavy chain constant region is comprised of three domains, CHI, CH2 and CH3.
  • Each light chain is comprised of a light chain variable region (abbreviated herein as LCVR or VL) and a light chain constant region.
  • the light chain constant region is comprised of one domain, CL.
  • VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR).
  • CDR complementarity determining regions
  • FR framework regions
  • Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
  • the variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
  • the constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.
  • antibody portion refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen (e.g. a target antigen). It has been shown that the antigen- binding function of an antibody can be performed by fragments of a full-length antibody.
  • binding fragments encompassed within the term "antigen-binding portion" of an antibody include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CHI domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (Ward et al., (1989) Nature 341:544-546), which consists of a VH domain; and (vi) an isolated complementarity determining region (CDR).
  • a Fab fragment a monovalent fragment consisting of the VL, VH, CL and CHI domains
  • F(ab')2 fragment a bivalent fragment comprising two Fab fragments linked by a dis
  • the two domains of the Fv fragment, VL and VH are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see e.g., Bird et al. (1988) Science 242:423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883).
  • single chain Fv single chain Fv
  • Such single chain antibodies are also intended to be encompassed within the term "antigen- binding portion" of an antibody.
  • the term "monoclonal antibody” as used herein refers to an antibody molecule of single molecular composition.
  • a monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope.
  • the term “human monoclonal antibody” refers to antibodies displaying a single binding specificity which have variable and constant regions derived from human germline immunoglobulin sequences.
  • the human monoclonal antibodies are produced by a hybridoma which includes a B cell obtained from a transgenic non-human animal, e.g., a transgenic mouse, having a genome comprising a human heavy chain transgene and a light chain transgene fused to an immortalized cell.
  • recombinant human antibody is intended to include all human antibodies that are prepared, expressed, created or isolated by recombinant means, such as antibodies isolated from an animal (e.g., a mouse) that is transgenic for human immunoglobulin genes; antibodies expressed using a recombinant expression vector transfected into a host cell, antibodies isolated from a recombinant, combinatorial human antibody library, or antibodies prepared, expressed, created or isolated by any other means that involves splicing of human immunoglobulin gene sequences to other DNA sequences.
  • Such recombinant human antibodies have variable and constant regions derived from human germline immunoglobulin sequences.
  • such recombinant human antibodies are subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the VH and VL regions of the recombinant antibodies are sequences that, while derived from and related to human germline VH and VL sequences, may not naturally exist within the human antibody germline repertoire in vivo.
  • a nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence.
  • a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence.
  • operably linked means that the DNA sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame.
  • vector or "construct”, as used herein, is intended to refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • plasmid refers to a circular double stranded DNA loop into which additional DNA segments may be ligated.
  • viral vector Another type of vector is a viral vector, wherein additional DNA segments may be ligated into the viral genome.
  • Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors).
  • vectors e.g., non-episomal mammalian vectors
  • vectors can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.
  • certain vectors are capable of directing the expression of genes to which they are operatively linked.
  • Such vectors are referred to herein as "recombinant expression vectors” (or simply, “expression vectors”).
  • expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
  • plasmid and vector may be used interchangeably as the plasmid is the most commonly used form of vector.
  • the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated vectors.
  • viral vectors e.g., replication defective retroviruses, adenoviruses and adeno-associated vectors.
  • recombinant host cell (or simply "host cell), as used herein, is intended to refer to a cell into which a recombinant expression vector has been introduced. It should be understood that such terms are intended to refer not only to the particular subject cell but to the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term “host cell” as used herein.
  • Figure 1A is a schematic diagram of a construct containing the genomic sequence of the light chain (LC) of humanized anti-carcinoembryonic antigen antibody 431.
  • the location of the signal peptide sequence (s) and the light chain variable (Vk) and the Ck regions are also indicated.
  • the location of the restriction enzyme sites is also indicated.
  • Figure IB depicts the nucleotide and amino acid sequence for the light chain of humanized anti-carcinoembryonic antigen antibody 431. The location of the restriction enzyme sites is indicated.
  • Figure 2 depicts the nucleotide sequence for a Sal I insert containing the coding sequences for light chain of humanized anti-carcinoembryonic antigen antibody 431.
  • Figure 3 is a schematic diagram of a construct (Be 458) which includes the Sal I insert containing the coding sequences for light chain of humanized anti-carcinoembryonic antigen antibody 431. Also indicated is the location of the silencer, 5' ⁇ -casein untranslated region, the light chain coding region, and the 3' ⁇ -casein untranslated region.
  • Figure 4 A is a schematic diagram of a construct containing the genomic sequence of the heavy chain (HC) of humanized anti-carcinoembryonic antigen antibody 431 linked to the ⁇ -glucuronidase sequence.
  • HC heavy chain
  • FIG. 4B depicts the nucleotide and amino acid sequence for the heavy chain of humanized anti-carcinoembryonic antigen antibody 431. The location of the restriction enzyme sites is indicated.
  • Figure 5 depicts the nucleotide and amino acid sequence for the mutant heavy chain of humanized anti-carcinoembryonic antigen antibody 431.
  • the mutant heavy chain lacks the hinge region. The location of the restriction enzyme sites is indicated.
  • Figure 6 is a schematic diagram of a construct (Be 454) containing the mutant heavy chain of humanized anti-carcinoembryonic antigen antibody 431 linked to the ⁇ - glucuronidase sequence. The location of the silencer, 5' ⁇ -casein untranslated region, the heavy chain mutant/ ⁇ -glucuronidase fusion coding region, and the 3' ⁇ -casein untranslated region. The location of the restriction enzyme sites is also indicated.
  • Figure 7 is an overview of the construction of the heavy chain mutants.
  • Figure 8 is an enlarged view of the mutations to ⁇ -glucuronidase
  • the present invention provides, at least in part, transgenically produced fusion proteins wherein one member of the fusion protein assembles into a multimer and the other member is chosen, or modified, to promote assembly into the optimal number of subunits.
  • the fusion protein includes an immunoglobulin subunit (e.g., an immunoglobulin heavy or light chain) fused to a toxin (e.g., a subunit of an enzyme).
  • the immunogloblulin-enzyme fusion proteins described herein serve to target a cytotoxic agent (e.g. the enzyme) to an undesirable cell, e.g., a tumor cell.
  • the fusion proteins described in the Examples below can be used to target, to a tumor cell.
  • a non-toxic prodrug can be administered. This prodrug is converted to a highly cytotoxic drug by the action of the targeted enzyme localized at the tumor site, permitting to achieve therapeutic levels of the drug without unacceptable toxicity for the patients.
  • a monoclonal antibody against a target antigen, e.g., a cell surface protein (e.g., receptor) on a cell can be produced by a variety of techniques, including conventional monoclonal antibody methodology e.g., the standard somatic cell hybridization technique of Kohler and Milstein, Nature 256: 495 (1975). Although somatic cell hybridization procedures are preferred, in principle, other techniques for producing monoclonal antibody can be employed e.g., viral or oncogenic transformation of B lymphocytes.
  • the preferred animal system for preparing hybridomas is the murine system.
  • Hybridoma production in the mouse is a very well-established procedure. Immunization protocols and techniques for isolation of immunized splenocytes for fusion are known in the art. Fusion partners (e.g., murine myeloma cells) and fusion procedures are also known. Human monoclonal antibodies (mAbs) directed against human proteins can be generated using transgenic mice carrying the complete human immune system rather than the mouse system. Splenocytes from these transgenic mice immunized with the antigen of interest are used to produce hybridomas that secrete human mAbs with specific affinities for epitopes from a human protein (see, e.g., Wood et al. International Application WO 91/00906, Kucherlapati et al.
  • Monoclonal antibodies can also be generated by other methods known to those skilled in the art of recombinant DNA technology.
  • An alternative method referred to as the "combinatorial antibody display” method, has been developed to identify and isolate antibody fragments having a particular antigen specificity, and can be utilized to produce monoclonal antibodies (for descriptions of combinatorial antibody display see e.g., Sastry et al. 1989 PNAS 86:5728; Huse et al. 1989 Science 246:1275; and Orlandi et al. 1989 PNAS 86:3833). After immunizing an animal with an immunogen as described above, the antibody repertoire of the resulting B-cell pool is cloned.
  • Methods are generally known for obtaining the DNA sequence of the variable regions of a diverse population of immunoglobulin molecules by using a mixture of oligomer primers and PCR.
  • mixed oligonucleotide primers corresponding to the 5' leader (signal peptide) sequences and or framework 1 (FR1) sequences, as well as primer to a conserved 3' constant region primer can be used for PCR amplification of the heavy and light chain variable regions from a number of murine antibodies (Larrick et al., 1991 , Biotechniques 11 :152- 156).
  • a similar strategy can also been used to amplify human heavy and light chain variable regions from human antibodies (Larrick et al., 1991, Methods: Companion to Methods in Enzymology 2:106-110).
  • RNA is isolated from B lymphocytes, for example, peripheral blood cells, bone marrow, or spleen preparations, using standard protocols (e.g., U.S. Patent No. 4,683,202; Orlandi, et al. PNAS (1989) 86:3833-3837; Sastry et al., PNAS (1989) 86:5728-5732; and Huse et al. (1989) Science 246:1275-1281.) First-strand cDNA is synthesized using primers specific for the constant region of the heavy chain(s) and each of the K and ⁇ light chains, as well as primers for the signal sequence.
  • variable region PCR primers the variable regions of both heavy and light chains are amplified, each alone or in combinantion, and ligated into appropriate vectors for further manipulation in generating the display packages.
  • Oligonucleotide primers useful in amplification protocols may be unique or degenerate or incorporate inosine at degenerate positions. Restriction endonuclease recognition sequences may also be incorporated into the primers to allow for the cloning of the amplified fragment into a vector in a predetermined reading frame for expression.
  • the V-gene library cloned from the immunization-derived antibody repertoire can be expressed by a population of display packages, preferably derived from filamentous phage, to form an antibody display library.
  • the display package comprises a system that allows the sampling of very large variegated antibody display libraries, rapid sorting after each affinity separation round, and easy isolation of the antibody gene from purified display packages.
  • kits for generating phage display libraries e.g., the Pharmacia Recombinant Phage Antibody System, catalog no. 27-9400-01 ; and the Stratagene Swr Z4RTM phage display kit, catalog no. 240612
  • methods and reagents particularly amenable for use in generating a variegated antibody display library can be found in, for example, Ladner et al. U.S. Patent No. 5,223,409; Kang et al. International Publication No.
  • the V region domains of heavy and light chains can be expressed on the same polypeptide, joined by a flexible linker to form a single-chain Fv fragment, and the scFV gene subsequently cloned into the desired expression vector or phage genome.
  • a flexible linker As generally described in McCafferty et al., Nature (1990) 348:552-554, complete Vjr and VL domains of an antibody, joined by a flexible (Gly4-Ser)3 linker can be used to produce a single chain antibody which can render the display package separable based on antigen affinity. Isolated scFV antibodies immunoreactive with the antigen can subsequently be formulated into a pharmaceutical preparation for use in the subject method.
  • the antibody library is screened with the target antigen, or peptide fragment thereof, to identify and isolate packages that express an antibody having specificity for the target antigen.
  • Nucleic acid encoding the selected antibody can be recovered from the display package (e.g., from the phage genome) and subcloned into other expression vectors by standard recombinant DNA techniques.
  • Specific antibody molecules with high affinities for a surface protein can be made according to methods known to those in the art, e.g, methods involving screening of libraries (Ladner, R.C., et al, U.S. Patent 5,233,409; Ladner, R.C., et al, U.S. Patent 5,403,484). Further, the methods of these libraries can be used in screens to obtain binding determinants that are mimetics of the structural determinants of antibodies.
  • the Fv binding surface of a particular antibody molecule interacts with its target ligand according to principles of protein-protein interactions, hence sequence data for VJJ and VL (the latter of which may be of the K or ⁇ chain type) is the basis for protein engineering techniques known to those with skill in the art.
  • sequence data for VJJ and VL is the basis for protein engineering techniques known to those with skill in the art.
  • Details of the protein surface that comprises the binding determinants can be obtained from antibody sequence information, by a modeling procedure using previously determined three-dimensional structures from other antibodies obtained from NMR studies or crytallographic data. See for example Bajorath, J. and S. Sheriff, 1996, Proteins: Struct., Fund., and Genet. 24 (2), 152-157; Webster, D.M. and A. R. Rees, 1995, "Molecular modeling of antibody- combining sites,"in S.
  • a variegated peptide library is expressed by a population of display packages to form a peptide display library.
  • the display package comprises a system that allows the sampling of very large variegated peptide display libraries, rapid sorting after each affinity separation round, and easy isolation of the peptide-encoding gene from purified display packages.
  • Peptide display libraries can be in, e.g., prokaryotic organisms and viruses, which can be amplified quickly, are relatively easy to manipulate, and which allows the creation of large number of clones.
  • Preferred display packages include, for example, vegetative bacterial cells, bacterial spores, and most preferably, bacterial viruses (especially DNA viruses).
  • the present invention also contemplates the use of eukaryotic cells, including yeast and their spores, as potential display packages. Phage display libraries are described above.
  • soluble receptor e.g., a target antigen
  • affinity chromatography with an appropriate "receptor”, e.g., a target antigen
  • identification of the isolated binding agents or ligands by conventional techniques (e.g., mass spectrometry and NMR).
  • the soluble receptor is conjugated to a label (e.g., fluorophores, colorimetric enzymes, radioisotopes, or luminescent compounds) that can be detected to indicate ligand binding.
  • a label e.g., fluorophores, colorimetric enzymes, radioisotopes, or luminescent compounds
  • immobilized compounds can be selectively released and allowed to diffuse through a membrane to interact with a receptor.
  • Combinatorial libraries of compounds can also be synthesized with "tags" to encode the identity of each member of the library (see, e.g., W.C. Still et al, International Application WO 94/08051 ).
  • this method features the use of inert but readily detectable tags, that are attached to the solid support or to the compounds. When an active compound is detected, the identity of the compound is determined by identification of the unique accompanying tag.
  • This tagging method permits the synthesis of large libraries of compounds which can be identified at very low levels among to total set of all compounds in the library.
  • modified antibody is also intended to include antibodies, such as monoclonal antibodies, chimeric antibodies, and humanized antibodies which have been modified by, e.g., deleting, adding, or substituting portions of the antibody.
  • an antibody can be modified by deleting the hinge region, thus generating a monovalent antibody. Any modification is within the scope of the invention so long as the antibody has at least one antigen binding region specific.
  • Chimeric mouse-human monoclonal antibodies can be produced by recombinant DNA techniques known in the art. For example, a gene encoding the Fc constant region of a murine (or other species) monoclonal antibody molecule is digested with restriction enzymes to remove the region encoding the murine Fc, and the equivalent portion of a gene encoding a human Fc constant region is substituted, (see Robinson et al, International Patent Publication PCT/US86/02269; Akira, et al., European Patent Application 184,187; Taniguchi, M., European Patent Application 171,496; Morrison et al., European Patent Application 173,494; Neuberger et al., International Application WO 86/01533; Cabilly et al. U.S. Patent No. 4,816,567; Cabilly et al.,
  • the chimeric antibody can be further humanized by replacing sequences of the Fv variable region which are not directly involved in antigen binding with equivalent sequences from human Fv variable regions.
  • General reviews of humanized chimeric antibodies are provided by Morrison, S. L., 1985, Science 229:1202-1207 and by Oi et al., 1986, BioTechniques 4:214. Those methods include isolating, manipulating, and expressing the nucleic acid sequences that encode all or part of immunoglobulin Fv variable regions from at least one of a heavy or light chain. Sources of such nucleic acid are well known to those skilled in the art and, for example, may be obtained from 7E3, an anti- GPIIbIII a antibody producing hybridoma. The recombinant DNA encoding the chimeric antibody, or fragment thereof, can then be cloned into an appropriate expression vector. Suitable humanized antibodies can alternatively be produced by CDR substitution U.S.
  • Patent 5,225,539 Jones et al. 1986 Nature 321 :552-525; Verhoeyan et al. 1988 Science
  • All of the CDRs of a particular human antibody may be replaced with at least a portion of a non-human CDR or only some of the CDRs may be replaced with non-human CDRs. It is only necessary to replace the number of CDRs required for binding of the humanized antibody to the Fc receptor.
  • An antibody can be humanized by any method, which is capable of replacing at least a portion of a CDR of a human antibody with a CDR derived from a non-human antibody.
  • chimeric and humanized antibodies in which specific amino acids have been substituted, deleted or added.
  • preferred humanized antibodies have amino acid substitutions in the framework region, such as to improve binding to the antigen.
  • amino acids located in the human framework region can be replaced with the amino acids located at the corresponding positions in the mouse antibody. Such substitutions are known to improve binding of humanized antibodies to the antigen in some instances.
  • Antibodies in which amino acids have been added, deleted, or subsituted are referred to herein as modified antibodies or altered antibodies.
  • the first member of the fusion proteins of the present invention is a targeting agent, e.g., a polypeptide having a high affinity for a target, e.g., an antibody, a ligand, or an enzyme.
  • a targeting agent e.g., a polypeptide having a high affinity for a target, e.g., an antibody, a ligand, or an enzyme.
  • the fusion proteins of the invention can be used to selectively direct (e.g., localize) the second member of the fusion protein to the vicinity of an undesirable cell.
  • the first member can be an immunoglobulin that interacts with (e.g., binds to a target antigen).
  • the target antigen is present on the surface of a cell, e.g., an aberrant cell such a hyperproliferative cell (e.g., a cancer cell).
  • exemplary target antigens include carcinoembryonic antigen (CEA), TAG-72, her-2/neu, epidermal growth factor receptor, transferrin receptor, among others.
  • target cell shall mean any undesirable cell in a subject (e.g., a human or animal) that can be targeted by a fusion protein of the invention.
  • exemplary target cells include tumor cells, such as carcinoma or adenocarcinoma-derived cells (e.g., colon, breast, prostate, ovarian and endometrial cancer cells) (Thor, A. et al. (1997) Cancer Res 46: 3118; Soisson A. P. et al. (1989) Am. J. Obstet. Gynecol: 1258-63).
  • carcinoma is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, ovarian carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas.
  • Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary.
  • carcinosarcomas e.g., which include malignant tumors composed of carcinomatous and sarcomatous tissues.
  • An "adenocarcinoma” refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures.
  • sarcoma is art recognized and refers to malignant tumors of mesenchymal derivation.
  • the first and second members of the fusion protein can be linked to each other, preferably via a linker sequence.
  • the linker sequence should separate the first and second members of the fusion protein by a distance sufficient to ensure that each member properly folds into its secondary and tertiary structures.
  • Preferred linker sequences (1) should adopt a flexible extended conformation, (2) should not exhibit a propensity for developing an ordered secondary structure which could interact with the functional first and second members, and (3) should have minimal hydrophobic or charged character, which could promote interaction with the functional protein domains.
  • Typical surface amino acids in flexible protein regions include Gly, Asn and Ser. Permutations of amino acid sequences containing Gly, Asn and Ser would be expected to satisfy the above criteria for a linker sequence.
  • Other near neutral amino acids, such as Thr and Ala can also be used in the linker sequence.
  • a linker sequence length of 20 amino acids can be used to provide a suitable separation of functional protein domains, although longer or shorter linker sequences may also be used.
  • the length of the linker sequence separating the first and second members can be from 5 to 500 amino acids in length, or more preferably from 5 to 100 amino acids in length.
  • the linker sequence is from about 5-30 amino acids in length.
  • the linker sequence is from about 5 to about 20 amino acids, and is advantageously from about 10 to about 20 amino acids.
  • Amino acid sequences useful as linkers of the first and second member include, but are not limited to, (SerGly4)y wherein y is greater than or equal to 8, or Gly4SerGly5Ser.
  • a preferred linker sequence has the formula (SerGly4)4-
  • Another preferred linker has the sequence ((Ser-Ser-Ser-Ser-Gly)3-
  • the first and second members can be directly fused without a linker sequence.
  • C-terminal amino acid regions which can be used to separate the functional domains and prevent steric interference.
  • the C-terminus of first member can be directly fused to the N-terminus of second, or viceversa.
  • a fusion protein of the invention can be prepared with standard recombinant DNA techniques using a nucleic acid molecule encoding the fusion protein.
  • a nucleotide sequence encoding a fusion protein can be synthesized by standard DNA synthesis methods.
  • a nucleic acid encoding a fusion protein can be introduced into a host cell, e.g., a cell of a primary or immortalized cell line. The recombinant cells can be used to produce the fusion protein.
  • a nucleic acid encoding a fusion protein can be introduced into a host cell, e.g., by homologous recombination. In most cases, a nucleic acid encoding the fusion protein is incorporated into a recombinant expression vector.
  • the nucleotide sequence encoding a fusion protein can be operatively linked to one or more regulatory sequences, selected on the basis of the host cells to be used for expression.
  • operably linked means that the sequences encoding the fusion protein compound are linked to the regulatory sequence(s) in a manner that allows for expression of the fusion protein.
  • regulatory sequence refers to promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990), the content of which are incorporated herein by reference.
  • Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells, those that direct expression of the nucleotide sequence only in certain host cells (e.g. , tissue-specific regulatory sequences) and those that direct expression in a regulatable manner (e.g., only in the presence of an inducing agent). It will be appreciated by those skilled in the art that the design of the expression vector may depend on such factors as the choice of the host cell to be transformed, the level of expression of fusion protein desired, and the like.
  • the fusion protein expression vectors can be introduced into host cells to thereby produce fusion proteins encoded by nucleic acids.
  • Recombinant expression vectors can be designed for expression of fusion proteins in prokaryotic or eukaryotic cells.
  • fusion proteins can be expressed in bacterial cells such as E. coli, insect cells (e.g., in the baculovirus expression system), yeast cells or mammalian cells.
  • suitable host cells are discussed further in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
  • yeast S. cerevisiae examples include pYepSecl (Baldari et al, (1987) EMBO J.
  • Baculovirus vectors available for expression of fusion proteins in cultured insect cells include the pAc series (Smith et al. , (1983) Mol. Cell Biol. 3:2156-2165) and the pVL series (Lucklow, V.A., and Summers, M.D., (1989) Virology 170:31-39).
  • mammalian expression vectors examples include pCDM8 (Seed, B., (1987) Nature 329:840) and pMT2PC (Kaufman et al (1987), EMBO J. 6:187-195).
  • the expression vector's control functions are often provided by viral regulatory elements.
  • commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40.
  • the recombinant expression vector can contain additional nucleotide sequences.
  • the recombinant expression vector may encode a selectable marker gene to identify host cells that have inco ⁇ orated the vector.
  • the recombinant expression vector can encode a signal sequence operatively linked to sequences encoding the amino- terminus of the fusion protein such that upon expression, the fusion protein is synthesized with the signal sequence fused to its amino terminus.
  • This signal sequence directs the fusion protein into the secretory pathway of the cell and is then cleaved, allowing for release of the mature fusion protein (i.e., the fusion protein without the signal sequence) from the host cell.
  • a signal sequence to facilitate secretion of proteins or peptides from mammalian host cells is known in the art.
  • Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques.
  • transformation and transfection refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co- precipitation, DEAE-dextran-mediated transfection, lipofection, electroporation, microinjection and viral-mediated transfection.
  • Suitable methods for transforming or transfecting host cells can be found in Sambrook et al (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press (1989)), and other laboratory manuals.
  • a gene that encodes a selectable marker can be introduced into the host cells along with the gene encoding the fusion protein.
  • selectable markers include those that confer resistance to drugs, such as G418, hygromycin and methotrexate.
  • Nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as that encoding the fusion protein or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have inco ⁇ orated the selectable marker gene will survive, while the other cells die).
  • a recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
  • DNA constructs can be introduced into the germ line of a mammal to make a transgenic mammal.
  • one or several copies of the construct can be inco ⁇ orated into the genome of a mammalian embryo by standard transgenic techniques. It is often desirable to express the transgenic protein in the milk of a transgenic mammal. Mammals that produce large volumes of milk and have long lactating periods are preferred. Preferred mammals are ruminants, e.g., cows, sheep, camels or goats, e.g., goats of Swiss origin, e.g., the Alpine, Saanen and Toggenburg breed goats. Other preferred animals include oxen, rabbits and pigs.
  • ruminants e.g., cows, sheep, camels or goats, e.g., goats of Swiss origin, e.g., the Alpine, Saanen and Toggenburg breed goats.
  • Other preferred animals include oxen, rabbits and pigs.
  • a transgenic non-human animal is produced by introducing a transgene into the germline of the non-human animal.
  • Transgenes can be introduced into embryonal target cells at various developmental stages. Different methods are used depending on the stage of development of the embryonal target cell. The specific line(s) of any animal used should, if possible, be selected for general good health, good embryo yields, good pronuclear visibility in the embryo, and good reproductive fitness.
  • fusion protein transgene can be introduced into a mammal by microinjection of the construct into the pronuclei of the fertilized mammalian egg(s) to cause one or more copies of the construct to be retained in the cells of the developing mammal(s).
  • the egg can be incubated in vitro for varying amounts of time, or reimplanted into the surrogate host, or both.
  • One common method is to incubate the embryos in vitro for about 1-7 days, depending on the species, and then reimplant them into the surrogate host.
  • the progeny of the transgenically manipulated embryos can be tested for the presence of the construct by Southern blot analysis of a segment of tissue.
  • An embryo having one or more copies of the exogenous cloned construct stably integrated into the genome can be used to establish a permanent transgenic mammal line carrying the transgenically added construct.
  • Litters of transgenically altered mammals can be assayed after birth for the inco ⁇ oration of the construct into the genome of the offspring. This can be done by hybridizing a probe corresponding to the DNA sequence coding for the fusion protein or a segment thereof onto chromosomal material from the progeny. Those mammalian progeny found to contain at least one copy of the construct in their genome are grown to maturity. The female species of these progeny will produce the desired protein in or along with their milk. The transgenic mammals can be bred to produce other transgenic progeny useful in producing the desired proteins in their milk.
  • Transgenic females may be tested for protein secretion into milk, using an art-known assay technique, e.g., a Western blot or enzymatic assay.
  • an art-known assay technique e.g., a Western blot or enzymatic assay.
  • Fusion protein can be expressed from a variety of transgenic animals.
  • a protocol for the production of a transgenic pig can be found in White and Yannoutsos, Current Topics in Complement Research: 64th Forum in Immunology, pp. 88-94; US Patent No. 5,523,226; US Patent No. 5,573,933; PCT Application WO93/25071; and PCT Application WO95/04744.
  • a protocol for the production of a transgenic mouse can be found in US Patent No. 5,530,177.
  • a protocol for the production of a transgenic rat can be found in Bader and Ganten, Clinical and Experimental Pharmacology and Physiology, Supp. 3:S81- S87, 1996.
  • a protocol for the production of a transgenic cow can be found in Transgenic Animal Technology, A Handbook, 1994, ed., Carl A. Pinkert, Academic Press, Inc.
  • a protocol for the production of a transgenic sheep can be found in Transgenic Animal Technology, A Handbook, 1994, ed., Carl A. Pinkert, Academic Press, Inc.
  • a protocol for the production of a transgenic rabbit can be found in Hammer et al., Nature 315:680-683, 1985 and Taylor and Fan, Frontiers in Bioscience 2:d298-308, 1997.
  • Milk Specific Promoters Useful transcriptional promoters are those promoters that are preferentially activated in mammary epithelial cells, including promoters that control the genes encoding milk proteins such as caseins, beta lactoglobulin (Clark et al., (1989) Bio/Technology 1_: 487- 492), whey acid protein (Gorton et al. (1987) Bio/Technology 5: 1183-1187), and lactalbumin (Soulier et al., (1992) FEBS Letts. 297: B).
  • caseins such as caseins, beta lactoglobulin (Clark et al., (1989) Bio/Technology 1_: 487- 492), whey acid protein (Gorton et al. (1987) Bio/Technology 5: 1183-1187), and lactalbumin (Soulier et al., (1992) FEBS Letts. 297: B).
  • the alpha, beta, gamma or kappa casein gene promoter of any mammalian species can be used to provide mammary expression; a preferred promoter is the goat beta casein gene promoter (DiTullio, (1992) Bio/Technology K):74-77).
  • Milk-specific protein promoter or the promoters that are specifically activated in mammary tissue can be isolated from cDNA or genomic sequences. Preferably, they are genomic in origin. DNA sequence information is available for mammary gland specific genes listed above, in at least one, and often in several organisms. See, e.g., Richards et al., J. Biol. Chem.
  • signal sequences are milk-specific signal sequences or other signal sequences which result in the secretion of eukaryotic or prokaryotic proteins.
  • the signal sequence is selected from milk-specific signal sequences, i.e., it is from a gene which encodes a product secreted into milk.
  • the milk-specific signal sequence is related to the milk-specific promoter used in the expression system of this invention.
  • the size of the signal sequence is not critical for this invention. All that is required is that the sequence be of a sufficient size to effect secretion of the desired recombinant protein, e.g., in the mammary tissue.
  • signal sequences from genes coding for caseins e.g., alpha, beta, gamma or kappa caseins, beta lactoglobulin, whey acid protein, and lactalbumin are useful in the present invention.
  • a preferred signal sequence is the goat ⁇ -casein signal sequence.
  • Signal sequences from other secreted proteins e.g., immunoglobulins, or proteins secreted by liver cells, kidney cell, or pancreatic cells can also be used.
  • the DNA constructs of the invention further comprise at least one insulator sequence.
  • the terms "insulator”, “insulator sequence” and “insulator element” are used interchangeably herein.
  • An insulator element is a control element which insulates the transcription of genes placed within its range of action but which does not perturb gene expression, either negatively or positively.
  • an insulator sequence is inserted on either side of the DNA sequence to be transcribed.
  • the insulator can be positioned about 200 bp to about 1 kb, 5' from the promoter, and at least about 1 kb to 5 kb from the promoter, at the 3' end of the gene of interest.
  • the distance of the insulator sequence from the promoter and the 3' end of the gene of interest can be determined by those skilled in the art, depending on the relative sizes of the gene of interest, the promoter and the enhancer used in the construct.
  • more than one insulator sequence can be positioned 5' from the promoter or at the 3' end of the transgene.
  • two or more insulator sequences can be positioned 5' from the promoter.
  • the insulator or insulators at the 3' end of the transgene can be positioned at the 3' end of the gene of interest, or at the 3'end of a 3' regulatory sequence, e.g., a 3' untranslated region (UTR) or a 3' flanking sequence.
  • UTR 3' untranslated region
  • a preferred insulator is a DNA segment which encompasses the 5' end of the chicken ⁇ -globin locus and corresponds to the chicken 5' constitutive hypersensitive site as described in PCT Publication 94/23046, the contents of which is inco ⁇ orated herein by reference.
  • a fusion protein can be expressed from a construct which includes a promoter specific for mammary epithelial cells, e.g., a casein promoter, e.g., a goat beta casein promoter, a milk-specific signal sequence, e.g., a casein signal sequence, e.g., a ⁇ -casein signal sequence, and a DNA encoding a fusion protein.
  • a promoter specific for mammary epithelial cells e.g., a casein promoter, e.g., a goat beta casein promoter
  • a milk-specific signal sequence e.g., a casein signal sequence, e.g., a ⁇ -casein signal sequence
  • a DNA encoding a fusion protein e.g., a DNA encoding a fusion protein.
  • a construct can also include a 3' untranslated region downstream of the DNA sequence coding for the non-secreted protein. Such regions can stabilize the RNA transcript of the expression system and thus increases the yield of desired protein from the expression system.
  • the 3' untranslated regions useful in the constructs of this invention are sequences that provide a poly A signal. Such sequences may be derived, e.g., from the SV40 small t antigen, the casein 3' untranslated region or other 3' untranslated sequences well known in the art.
  • the 3' untranslated region is derived from a milk specific protein. The length of the 3' untranslated region is not critical but the stabilizing effect of its poly A transcript appears important in stabilizing the RNA of the expression sequence.
  • a construct can include a 5' untranslated region between the promoter and the DNA sequence encoding the signal sequence.
  • Such untranslated regions can be from the same control region from which promoter is taken or can be from a different gene, e.g., they may be derived from other synthetic, semi-synthetic or natural sources. Again their specific length is not critical, however, they appear to be useful in improving the level of expression.
  • a construct can also include about 10%, 20%, 30%, or more of the N-terminal coding region of a gene preferentially expressed in mammary epithelial cells.
  • the N-terminal coding region can correspond to the promoter used, e.g., a goat ⁇ -casein N- terminal coding region.
  • Prior art methods can include making a construct and testing it for the ability to produce a product in cultured cells prior to placing the construct in a transgenic animal.
  • the transgenic fusion protein can be produced in milk at relatively high concentrations and in large volumes, providing continuous high level output of normally processed peptide that is easily harvested from a renewable resource.
  • Milk proteins usually are isolated by a combination of processes.
  • Raw milk first is fractionated to remove fats, for example, by skimming, centrifugation, sedimentation (H.E. Swaisgood, Developments in Dairy Chemistry, I: Chemistry of Milk Protein, Applied Science Publishers, NY, 1982), acid precipitation (U.S. Patent No. 4,644,056) or enzymatic coagulation with rennin or chymotrypsin (Swaisgood, ibid.).
  • the major milk proteins may be fractionated into either a clear solution or a bulk precipitate from which the specific protein of interest may be readily purified.
  • USSN 08/648,235 discloses a method for isolating a soluble milk component, such as a peptide, in its biologically active form from whole milk or a milk fraction by tangential flow filtration. Unlike previous isolation methods, this eliminates the need for a first fractionation of whole milk to remove fat and casein micelles, thereby simplifying the process and avoiding losses of recovery and bioactivity. This method may be used in combination with additional purification steps to further remove contaminants and purify the component of interest.
  • a soluble milk component such as a peptide
  • a fusion protein can be produced in tissues, secretions, or other products, e.g., an egg, of a transgenic animal.
  • fusion proteins can be produced in the eggs of a transgenic animal, preferably a transgenic turkey, duck, goose, ostrich, guinea fowl, peacock, partridge, pheasant, pigeon, and more preferably a transgenic chicken, using methods known in the art (Sang et al., Trends Biotechnology, 12:415-20, 1994).
  • Genes encoding proteins specifically expressed in the egg such as yolk-protein genes and albumin-protein genes, can be modified to direct expression of fusion protein.
  • Useful transcriptional promoters are those promoters that are preferentially activated in the egg, including promoters that control the genes encoding egg proteins, e.g., ovalbumin, lysozyme and avidin. Promoters from the chicken ovalbumin, lysozyme or avidin genes are preferred.
  • Egg-specific protein promoters or the promoters that are specifically activated in egg tissue can be from cDNA or genomic sequences. Preferably, the egg-specific promoters are genomic in origin.
  • a fusion protein can be expressed in a transgenic organism, e.g., a transgenic plant, e.g., a transgenic plant in which the DNA transgene is inserted into the nuclear or plastidic genome. Plant transformation is known as the art. See, in general, Methods in Enzymology Vol. 153 ("Recombinant DNA Part D") 1987, Wu and Grossman Eds., Academic Press and
  • nucleic acid can be introduced into plant cells or protoplasts by several methods. For example, nucleic acid can be mechanically transferred by microinjection directly into plant cells by use of micropipettes. Foreign nucleic acid can also be transferred into a plant cell by using polyethylene glycol which forms a precipitation complex with the genetic material that is taken up by the cell (Paszkowski et al. (1984) EMBOJ. 3:2712-22).
  • Foreign nucleic acid can be introduced into a plant cell by electroporation (Fromm et al.
  • plant protoplasts are electroporated in the presence of plasmids or nucleic acids containing the relevant genetic construct. Electrical impulses of high field strength reversibly permeabihze biomembranes allowing the introduction of the plasmids. Electroporated plant protoplasts reform the cell wall, divide, and form a plant callus. Selection of the transformed plant cells with the transformed gene can be accomplished using phenotypic markers.
  • Cauliflower mosaic virus can be used as a vector for introducing foreign nucleic acid into plant cells (Hohn et al. (1982) "Molecular Biology of Plant Tumors," Academic Press, New York, pp. 549-560; Howell, U.S. Pat. No. 4,407,956).
  • CaMV viral DNA genome is inserted into a parent bacterial plasmid creating a recombinant DNA molecule which can be propagated in bacteria.
  • the recombinant plasmid can be further modified by introduction of the desired DNA sequence.
  • the modified viral portion of the recombinant plasmid is then excised from the parent bacterial plasmid, and used to inoculate the plant cells or plants.
  • Nucleic acid is disposed within the matrix of small beads or particles, or on the surface (Klein et al. (1987) Nature 327:70-73). Although typically only a single introduction of a new nucleic acid segment is required, this method also provides for multiple introductions.
  • a nucleic acid can be introduced into a plant cell by infection of a plant cell, an explant, a meristem or a seed with Agrobacterium tumefaciens transformed with the nucleic acid. Under appropriate conditions, the transformed plant cells are grown to form shoots, roots, and develop further into plants.
  • the nucleic acids can be introduced into plant cells, for example, by means of the Ti plasmid of Agrobacterium tumefaciens. The Ti plasmid is transmitted to plant cells upon infection by Agrobacterium tumefaciens, and is stably integrated into the plant genome (Horsch et al. (1984) "Inheritance of Functional Foreign Genes in Plants," Science 233:496-498; Fraley et al. (1983) Proc. Natl. Acad. Sci. USA 80:4803).
  • Plants from which protoplasts can be isolated and cultured to give whole regenerated plants can be transformed so that whole plants are recovered which contain the transferred foreign gene.
  • Some suitable plants include, for example, species from the genera Fragaria, Lotus, Medicago, Onobrychis, Trifolium, Trigonella, Vigna, Citrus, Linum, Geranium, Manihot, Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa, Capsicum, Hyoscyamus, Lycopersicon, Nicotiana, Solanum, Petunia, Digitalis, Majorana, Ciohorium, Helianthus, Lactuca, Bromus, Asparagus, Antirrhinum, Hererocallis, Nemesia, Pelargonium, Panicum, Pennisetum, Ranunculus, Senecio, Salpiglossis, Cucumis, Browaalia, Glycine, Lolium, Zea, Triticum, Sorghum
  • Regeneration from protoplasts varies from species to species of plants, but generally a suspension of transformed protoplasts containing copies of the exogenous sequence is first generated. In certain species, embryo formation can then be induced from the protoplast suspension, to the stage of ripening and germination as natural embryos.
  • the culture media can contain various amino acids and hormones, such as auxin and cytokinins. It can also be advantageous to add glutamic acid and proline to the medium, especially for such species as corn and alfalfa. Shoots and roots normally develop simultaneously. Efficient regeneration will depend on the medium, on the genotype, and on the history of the culture. If these three variables are controlled, then regeneration is fully reproducible and repeatable.
  • the mature transgenic plants can be propagated by the taking of cuttings or by tissue culture techniques to produce multiple identical plants for trialling, such as testing for production characteristics. Selection of a desirable transgenic plant is made and new varieties are obtained thereby, and propagated vegetatively for commercial sale.
  • the mature transgenic plants can be self crossed to produce a homozygous inbred plant.
  • the inbred plant produces seed containing the gene for the newly introduced foreign gene activity level. These seeds can be grown to produce plants that have the selected phenotype.
  • the inbreds according to this invention can be used to develop new hybrids. In this method a selected inbred line is crossed with another inbred line to produce the hybrid.
  • Parts obtained from a transgenic plant such as flowers, seeds, leaves, branches, fruit, and the like are covered by the invention, provided that these parts include cells which have been so transformed. Progeny and variants, and mutants of the regenerated plants are also included within the scope of this invention, provided that these parts comprise the introduced DNA sequences. Progeny and variants, and mutants of the regenerated plants are also included within the scope of this invention.
  • transgenic plants or plant cells can be based upon a visual assay, such as observing color changes (e.g., a white flower, variable pigment production, and uniform color pattern on flowers or irregular patterns), but can also involve biochemical assays of either enzyme activity or product quantitation.
  • Transgenic plants or plant cells are grown into plants bearing the plant part of interest and the gene activities are monitored, such as by visual appearance (for flavonoid genes) or biochemical assays (Northern blots); Western blots; enzyme assays and flavonoid compound assays, including spectroscopy, see,
  • Examples 1 and 2 below describe the generation of two constructs: a light chain construct and a heavy chain/ ⁇ -glucuronidase fusion constructs.
  • Two plasmids, one containing a clone of an antibody heavy chain/ human ( ⁇ -glucuronidase fusion protein and the other containing kappa light chain sequence were received obtained from Behringwerke AG.
  • the Example describes the generation of a light chain nucleic acid construct using the light chain nucleotide sequence from a humanized monoclonal antibody against carcinoembryonic antigen (431) subcloned into a mammary specific expression vector
  • the original construct contained approximately 1300 bases of unknown sequence.
  • the Gapped Heteroduplex method was used to create a Sal I site just after the termination codon. Sac I sites just before the termination codon and near the Eco Rl site were used to make the gap, which was filled using Klenow fragment, deoxynucleotides, T4 DNA ligase, and the following oligonucleotide:
  • the gapped region (through the termination codon and new Sal I site) was then sequenced to confirm that no changes were made in sequence.
  • a second Nco I site was found in the unknown sequence that was removed for a subsequent step described below.
  • the construct containing the new Sal I site was digested with Eco Rl, ends filled with Klenow fragment and deoxynucleotides, and ligated to a Sal I linker, purchased from New England Biolabs following routine experimental procedures.
  • This construct containing two Sal I sites was then digested with Sal I-and religated, removing the unknown sequence containing the second Nco I site.
  • a Sal I site and Kozak consensus sequence were then inserted immediately before the initial methionine codon (instead of simply changing the Hind III site) because there were several ATG sequences prior to the correct starting codon that could possibly have been used as alternative start sites.
  • the original 5' prime region had the nucleotide sequence (ATG sequences are capitalized; ATG corresponding to initial methionine is indicated in bold):
  • FIG. 1A is a schematic diagram of the light chain construct (431 A). The nucleotide and amino acid sequences are shown in Figure IB.
  • Figure 2 depicts the nucleotide sequence for a Sal I insert containing the coding sequences for light chain of humanized anti-carcinoembryonic antigen antibody 431.
  • FIG. 3 Shown as Figure 3 is a schematic diagram of a construct (Be 458) which includes the Sal I insert containing the coding sequences for light chain of humanized anti-carcinoembryonic antigen antibody 431. Also indicated is the location of the silencer, 5' ⁇ -casein untranslated region, the light chain coding region, and the 3' ⁇ -casein untranslated region.
  • the Example describes the generation of a heavy chain/ ⁇ -glucuronidase fusion construct using the heavy chain nucleotide sequence from a humanized monoclonal antibody against carcinoembryonic antigen (431) subcloned into a mammary specific expression vector (Bel 63) and a commercial mammalian expression vector (pcDNA3).
  • the Hind III -Xba I fragment containing the heavy chain/ ⁇ -glucuronidase fusion sequence was subcloned into pGEM3z to facilitate further manipulation.
  • Three mutations were made to the coding region of the heavy chain/ ⁇ -glucuronidase fusion construct: a) To create a Sal I, Xho I, and Kozak consensus sequence at the beginning of the coding region; b) to change the sequence at the internal Sal I site while retaining thecorrect amino acid sequence; and c) to create a Sal I site immediately after the termination codon.
  • the signal sequence that was used for the light chain was also used for the heavy chain. Again, the region between the Hind III and Nco I sites was removed and replaced with the same set of oligonucleotides used in the light chain to create a Sal I site and Kozak consensus sequence immediately before the initial methionine codon. (see above).
  • the internal Sal I site had to be changed for the ptupose of subcloning the fragment into a beta casein expression vector.
  • the 3 -prime flanking sequence contained two polyadenylation signal sites and a string of 16 adenine residues between the translational stop codon and the Xba I site. To remove these sequences, a Sal I site was inserted just after the stop codon.
  • the Gapped Heteroduplex method was used to make the changes above.
  • the original plan was to gap the DNA between the Not I and Xba I sites and change the internal Sal I site and add the 3-prime Sal I site at the same time. This proved difficult to accomplish so the 3-prime Sal I site was added first and a new gap was made between the two Bgl II sites to change the internal Sal I site.
  • the gapped regions were then sequenced in entirety to confirm that no changes were made to the sequence. The only difference found was in the fourth intron, 1673 bases from the initial ATG.
  • a cytosine was found in both the mutated and the original plasmid instead of adenine, as shown in the printed sequence above.
  • FIG. 4A is a schematic diagram of the light chain construct (431 A). The nucleotide and amino acid sequences are shown in Figure 4B.
  • This Example described the generation of a construct which includes the light chain and the heavy chain/ ⁇ -glucuronidase fusion, along with their corresponding upstream and downstream beta casein sequences ligated together into a single cosmid.
  • both chains along with their own corresponding upstream and downstream beta casein sequences were ligated together into a single cosmid.
  • this supercosl (Stiratagene) was modified by inserting the following oligonucleotides into the Bam HI site:
  • Bel 81 and Bel 82 are essentially the same insert when cut away from the vector. When viewed in the sense direction, they both contain the heavy chain/ ⁇ -glucuronidase Sal I cassette followed by and linked to the light chain Sal I cassette. Each Sal I cassette contains the 5-prime beta casein promoter region, the antibody coding region, and the 3-prime beta casein flanking sequence.
  • the manipulated DNA fragments were tested in tissue culture using the pcDNA3 constructs described above transfected into cos 7 cells using the standard protocol for Lipofectamine using Opti-MEM (Gibco-BRL). Conditioned media (DMEM +10%FBS) was removed after 48 hours and run on a 10 -20% SDS-PAGE gels for Western blotting.
  • Detection was with the ECL kit from Amersham. Mab 2149/80 was the only antibody that showed a signal on the western blot. For the light chain, samples were again run under reducing conditions and electroblotted onto nitrocellulose. The nitrocellulose was then incubated overnight with horse radish peroxidase conjugated goat anti-human Kappa chain antibody (Cappel no. 55233). Detection was with the ECL kit from Amersham.
  • Microinjection fragments were prepared by cutting the beta casein constructs Be 174 (light chain) and Be 175 (heavy chain) with Sal I to release the bacterial sequences. Fragments were gel purified then buffer exchanged and concentrated using the Wizard system by Promega. Microinjections of the original nucleotide sequences were tested in the mouse model system using an expression vector containing the goat beta casein upstream and coding sequences. Two separate constructions were made and co-injected into mouse embryos, from which founder lines were identified and tested further. The original DNA sequences were also co-injected with an "insulator" sequence which allows us to produce a higher percentage of high producing animal lines. For example, without the insulator generally one in three lines would be a relatively high producer.
  • the first mutation was to remove the hinge region of the construct.
  • the second mutation removes the hinge and linker sequence (ala-ala-ala-ala- val) (SEQ ID NO:31) at the beginning of the ⁇ -glucuronidase coding sequence, fusing the CH2 portion to ⁇ glucuronidase.
  • gapped heteroduplex mutagenesis was again used.
  • the construct Behring HC5 (which contains the fusion protein in pGem3Z with both ends modified and an internal Sal I site removed) was linearized with (Xba I). A second aliquot was cut with BstE2 plus Not I. When boiled together and cooled some of each strand anneal forming the heteroduplex containing a single stranded gap, in this case between the BstE2 and Not I sites. Two new constructs were then made, sequencing over the gapped portion to make sure no other mutations were made inadvertently.
  • GTC #403 using the oligonucleotide "Behr hinge-alternate" (in bold below) removes the hinge region and part of the introns immediately preceding and after it.
  • GTC #406 using the oligonucleotide "Behr hinge/linker" (in bold below) removes the hinge region and ala-ala-ala-ala-val linker, fusing the CH2 and ⁇ -glucuronidase coding regions.
  • CH2 coding sequence ⁇ -glucuronidase (SEQ ID NO: 33)
  • the mutated fusion protein coding sequence can then be excised using Sal I and subcloned into an appropriate expression vector.
  • Bc454 Bc450 with heavy chain mutant 403 (minus hinge)
  • Bc456 Bc450 with heavy chain mutant 406 (minus hinge/linker)
  • Figure 5 depicts the nucleotide and amino acid sequence for the mutant heavy chain of humanized anti-carcinoembryonic antigen antibody 431 lacking the hinge region.
  • Figure 6 is a schematic diagram of a construct (Be 454) containing the mutant heavy chain of humanized anti-carcinoembryonic antigen antibody 431 linked to the ⁇ - glucuronidase sequence. The location of the silencer, 5' ⁇ -casein untranslated region, the heavy chain mutant/ ⁇ -glucuronidase fusion coding region, and the 3 ' ⁇ -casein untranslated region.
  • the previous examples describe the testing of the original fusion protein and two heavy chain mutants in the milk expression system.
  • the original fusion proteins were tested both without the insulator and also co injected with a separate insulator fragments.
  • the heavy chain mutants on the other hand, were tested with the insulator integrated into the construct.
  • the concentration of the fusion protein produced in milk was estimated by comparing the signal of a sample to that of a standard on a Western blot. Later, experiments measured activity rather than concentration based on Western blots. The activity measurements were more accurate. Except for the first set of constructs, Bcl74 + Bcl75, estimates of protein concentration by Western blot are rough estimates. Generally, lines that express well appear to be in the 1-2 mg/ml range.
  • Swiss-origin goats e.g., the Alpine, Saanen, and Toggenburg breeds, are preferred in the production of transgenic goats.
  • estrus in the donors is synchronized on Day 0 by 6 mg subcutaneous norgestomet ear implants (Syncromate-B, CEVA Laboratories, Inc., Overland Park, KS).
  • Prostaglandin is administered after the first seven to nine days to shut down the endogenous synthesis of progesterone.
  • FSH - Schering Co ⁇ ., Kenilworth, NJ follicle-stimulating hormone
  • the implant is removed on Day 14. Twenty-four hours following implant removal the donor animals are mated several times to fertile males over a two-day period (Selgrath, et al., Theriogenology, 1990. pp. 1195-1205).
  • a 20 gauge needle is placed in the uterus approximately 0.5 cm from the uterotubal junction.
  • Ten to twenty ml of sterile phosphate buffered saline (PBS) is flushed through the cannulated oviduct and collected in a Petri dish. This procedure is repeated on the opposite side and then the reproductive tract is replaced in the abdomen.
  • PBS phosphate buffered saline
  • 10-20 ml of a sterile saline glycerol solution is poured into the abdominal cavity to prevent adhesions.
  • the linea alba is closed with simple interrupted sutures of 2.0 Polydioxanone or Supramid and the skin closed with sterile wound clips.
  • Fertilized goat eggs are collected from the PBS oviductal flushings on a stereomicroscope, and are then washed in Ham's F12 medium (Sigma, St. Louis, MO) containing 10% fetal bovine serum (FBS) purchased from Sigma. In cases where the pronuclei are visible, the embryos is immediately microinjected. If pronuclei are not visible, the embryos can be placed in Ham's F12 containing 10% FBS for short term culture at 37°C in a humidified gas chamber containing 5% CO2 in air until the pronuclei become visible (Selgrath, et al., Theriogenology, 1990. pp. 1195-1205).
  • One-cell goat embryos are placed in a microdrop of medium under oil on a glass depression slide. Fertilized eggs having two visible pronuclei are immobilized on a flame- polished holding micropipet on a Zeiss upright microscope with a fixed stage using Normarski optics.
  • a pronucleus is microinjected with the DNA construct of interest, e.g., a BC355 vector containing the fusion protein gene operably linked to the regulatory elements of the goat beta-casein gene, in injection buffer (Tris-EDTA) using a fine glass microneedle (Selgrath, et al., Theriogenology, 1990. pp. 1195-1205).
  • the surviving embryos are placed in a culture of Ham's F12 containing 10% FBS and then incubated in a humidified gas chamber containing 5% CO2 in air at 37°C until the recipient animals are prepared for embryo transfer (Selgrath, et al., Theriogenology, 1990. p. 1195-1205). Preparation of recipients:
  • Estrus synchronization in recipient animals is induced by 6 mg norgestomet ear implants (Syncromate-B).
  • the animals On Day 13 after insertion of the implant, the animals are given a single non-superovulatory injection (400 LU.) of pregnant mares serum gonadotropin (PMSG) obtained from Sigma. Recipient females are mated to vasectomized males to ensure estrus synchrony (Selgrath, et al., Theriogenology, 1990. pp. 1195-1205).
  • All embryos from one donor female are kept together and transferred to a single recipient when possible.
  • the surgical procedure is identical to that outlined for embryo collection outlined above, except that the oviduct is not cannulated, and the embryos are transferred in a minimal volume of Ham's F12 containing 10% FBS into the oviductal lumen via the fimbria using a glass micropipet. Animals having more than six to eight ovulation points on the ovary are deemed unsuitable as recipients. Incision closure and post-operative care are the same as for donor animals (see, e.g., Selgrath, et al., Theriogenology, 1990. pp. 1195-1205).
  • Pregnancy is determined by ultrasonography 45 days after the first day of standing estrus.
  • a second ultrasound exam is conducted to confirm pregnancy and assess fetal stress.
  • the pregnant recipient doe is vaccinated with tetanus toxoid and Clostridium C&D.
  • Selenium and vitamin E (Bo-Se) are given IM and Ivermectin was given SC.
  • the does are moved to a clean stall on Day 145 and allowed to acclimatize to this environment prior to inducing labor on about Day 147. Parturition is induced at Day 147 with 40 mg of PGF2a (Lutalyse®, Upjohn Company, Kalamazoo Michigan). This injection is given IM in two doses, one 20 mg dose followed by a 20 mg dose four hours later.
  • the doe is under periodic observation during the day and evening following the first injection of
  • Lutalyse® on Day 147. Observations are increased to every 30 minutes beginning on the morning of the second day. Parturition occurred between 30 and 40 hours after the first injection. Following delivery the doe is milked to collect the colostrum and passage of the placenta is confirmed.
  • genomic DNA is isolated from two different cell lines to avoid missing any mosaic transgenics.
  • a mosaic animal is defined as any goat that does not have at least one copy of the transgene in every cell. Therefore, an ear tissue sample (mesoderm) and blood sample are taken from a two day old F ⁇ animal for the isolation of genomic DNA (Lacy, et al., A Laboratory Manual, 1986, Cold Springs Harbor, NY; and Herrmann and Frischauf, Methods Enzymology, 1987. 152: pp. 180-183).
  • the DNA samples are analyzed by the polymerase chain reaction (Gould, et al., Proc. Natl. Acad. Sci, 1989. 86:pp.
  • transgenic founder (FQ) goats as well as other transgenic goats.
  • the transgenic FQ founder goats for example, are bred to produce milk, if female, or to produce a transgenic female offspring if it is a male founder.
  • This transgenic founder male can be bred to non-transgenic females, to produce transgenic female offspring.
  • Transmission of the transgene of interest, in the goat line is analyzed in ear tissue and blood by PCR and Southern blot analysis.
  • Southern blot analysis of the founder male and the three transgenic offspring shows no rearrangement or change in the copy number between generations.
  • the Southern blots are probed with immunoglobulin- enzyme fusion protein cDNA probe.
  • the blots are analyzed on a Betascope 603 and copy number determined by comparison of the transgene to the goat beta casein endogenous gene.
  • the expression level of the transgenic protein, in the milk of transgenic animals is determined using enzymatic assays or Western blots.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Oncology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Physics & Mathematics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

A method of making a fusion protein having: a first member, fused to a second member wherein the first and second members are chosen such that the fusion protein assembles into a complex having a number of subunits which optimizes activity of the multimeric form of the second member.

Description

SUBUNIT OPTIMIZED FUSION PROTEINS
Related Applications
This application claims the benefit of a previously filed Provisional Application No. 60/101,083 filed September 18, 1998, which is hereby incorporated by reference.
Field of the Invention
The invention relates to a fusion protein having a first and a second member, wherein the second member of the fusion protein assembles into a multimer and the other member is chosen, or modified, such that it promotes assembly of the second member into a preselected or an optimal number of subunits.
Background of the Invention
Fusion proteins can combine useful properties of distinct proteins. E.g., a fusion protein can combine the targeting property of an antibody molecule with the cytotoxic effect of a toxin.
Summary of the Invention
In general, the invention features, a method of making a fusion protein having: a first member, e.g., a targeting moiety, e.g., an immunoglobulin subunit (e.g., an immunoglobulin heavy chain or light chain, or a fragment of either) fused to a second member, e.g., an enzyme, e.g., a toxin (e.g., an enzyme or toxin subunit). The first and second members are chosen such that the fusion protein assembles into a complex having a number of subunits which optimizes activity of the multimeric form of the second member. In preferred embodiments the first member, or the fusion protein, assembles into a form having the same number of subunits as are present in an active, e.g., native, form of the second member. In preferred embodiments the first member, or the fusion protein, assembles into a form having fewer subunits than are present in an active, e.g., native, form of the second member. In preferred embodiments, the fusion protein assembles into a complex, e.g., a di-, tri-, tetra-, or higher multi-meric complex. Preferably, the fusion protein assembles into a dimer or a tetramer.
In preferred embodiments, the fusion protein assembles into a complex having enzymatic activity.
In a preferred embodiment, the first member is a monomer. E.g., it is a species which is normally monomeric, or which has been modified, e.g., by mutation of a site which modulates formation or maintenance of a multimer of subunits. In some embodiments the monomeric form is useful because it does not prevent formation of a multimer by the second member.
In another preferred embodiment, the first member is a forms a dimmer, e.g., a heterodimer or homodimer. E.g., it is a species which is normally dimeric, or which has been modified, e.g., by mutation of a site which modulates formation or maintenance of a multimerof subunits, to be dimeric. In some embodiments the dimeric form is useful because it does not prevent formation of a multimer by the second member.
In preferred embodiments, the fusion protein has the formula: R1-L-R2; R2-L-R1 ; R2-R1; or R1-R2, wherein Rl is a first member, e.g., an immunoglobulin subunit, L is a peptide linker and R2 is a second member, e.g., an enzyme subunit. Preferably, Rl and R2 are covalently linked, e.g., directly fused or linked via a peptide linker.
In preferred embodiments, the first or the second member of the fusion protein, or both are modified by, e.g., substituting or deleting, a portion of the amino acid sequence. In a particularly preferred embodiment the fusion protein includes a first member which is an Ig superfamily member, preferably an Ig subunit, which has been modified to inhibit formation of a multimeric form, e.g., a tetrameric form. Preferably the modification, which can be a change, insertion, or deletion of one or more amino acid residues, results in a subunit which does not form a multimer or which forms a lower order multimer that it normally would form, e.g., it forms a dimer rather than a tetramer. Preferably, a region which mediates formation or maintenance of a multimeric structure is modified and thereby wholly or partly inactivated. E.g., a portion of an immunoglobulin subunit , e.g., a heavy chain, e.g., the hinge region, is modified, e.g., deleted. In those embodiments where the hinge region of the immunoglobulin is modified, e.g., removed, the modified immunoglobulin is monovalent.
In preferred embodiments, the modification of the first member inhibits the assembly of the first member, or the fusion protein into a multimer, e.g., results in the production of a monomer, or, e.g., of a dimer, where a higher order multimer would otherwise be formed.
In preferred embodiments, the first member is a targeting agent, e.g., a polypeptide having a high affinity for a target, e.g., an antibody, a ligand, or an enzyme. In preferred embodiments, the first member is an immunoglobulin or a fragment thereof, e.g., an antigen binding fragment thereof. Preferably, the immunoglobulin is a monoclonal antibody, e.g., a human, murine (e.g., mouse) monoclonal antibody; or a recombinant monoclonal antibody. Preferably, the monoclonal antibody is a human antibody. In other embodiments, the monoclonal antibody is a recombinant antibody, e.g., a chimeric or a humanized antibody (e.g., it has a variable region, or at least a complementarity determining region (CDR), derived from a non-human antibody (e.g., murine) with the remaining portion(s) are human in origin); or a transgenically produced human antibody (e.g., an antibody produced by a hybridoma which includes a B cell obtained from a transgenic non-human animal, e.g., a transgenic mouse, having a genome comprising a human heavy chain transgene and a light chain transgene fused to an immortalized cell).
In preferred embodiments, the first member is a full-length antibody (e.g., an IgGl or IgG4 antibody) or includes only an antigen-binding portion (e.g., a Fab, F(ab')2, Fv or a single chain Fv fragment). In preferred embodiments, the first member is an immunoglobulin subunit selected from the group consisting of a subunit of : IgG (e.g., IgGl, IgG2, IgG3, IgG4), IgM, IgAl, IgA2, IgA.sub.sec, IgD, of IgE. Preferably, the immunoglobulin subunit is an IgG isotype, e.g., IgG3. In preferred embodiments, the first member is a monomer, e.g., a single chain antibody; or forms a dimer, e.g., a dimer of an immunoglobulin heavy chain and a light chain.
In preferred embodiments, the first member is a monovalent antibody (e.g., it includes one pair of heavy and light chains, or antigen binding portions thereof). In other embodiments, the first member is divalent antibody (e.g., it includes two pairs of heavy and light chains, or antigen binding portions thereof).
In preferred embodiments, the first member includes an immunoglobulin heavy chain or a fragment thereof, e.g., an antigen binding fragment thereof. Preferably, the immunoglobulin heavy chain or fragment thereof (e.g., an antigen binding fragment thereof) is linked, e.g., linked via a peptide linker or is directly fused, to an enzyme. Preferably, the immunoglobulin heavy chain-enzyme fusion protein is capable of assembling into a functional complex, e.g., a di-, tri-, tetra-, or multi-meric complex having enzymatic activity. The most preferred form is dimeric In preferred embodiments, the first member includes an immunoglobulin heavy chain or fragment thereof (e.g., an antigen binding fragment thereof), and a light chain or a fragment thereof (e.g., an antigen binding fragment thereof). Preferably, the immunoglobulin heavy chain is linked, e.g., linked via a peptide linker or directly fused, to an enzyme. Preferably, the fused immunoglobulin heavy chain -enzyme fusion protein assembles with a light chain, e.g., to produce a functional complex, e.g., a di-, tri-, tetra-, or multi-meric complex having enzymatic activity. The most preferred form is dimeric.
In preferred embodiments, the first member is an immunoglobulin that interacts with (e.g., binds to) a cell surface antigen on a target cell, e.g., a cancer cell. For example, the immunoglobulin binds to a tumor cell antigen, e.g., carcinoembryonic antigen (CEA), TAG- 72, her-2/neu, epidermal growth factor receptor, transferrin receptor, among others.
In preferred embodiments, the first member localizes, e.g., increases the concentration of, a fusion protein in proximity to a target cell, e.g., a cancer cell.
In preferred embodiments, the second member is a subunit of an enzyme, e.g., an enzyme having one or more subunits (e.g., catalytic subunits). Preferably, the enzyme include one, preferably two, more preferably three, most preferably four subunits. A preferred enzyme is beta-glucuronidase, e.g., a human beta-glucuronidase. The enzyme can be a homo-, or a hetero-multimer. If the enzyme is a heteromultimer, two (or more) fusion proteins are needed to form the active product.
In preferred embodiments, the second member is capable of converting a precursor drug, e.g., a prodrug, to a toxic drug.
In preferred embodiments, the first member is an immunoglobulin G (IgG) heavy and light chains, and the second member is human beta-glucuronidase fusion protein.
In preferred embodiments, the light chain of the first member has an amino acid sequence as shown in Figure IB (SEQ ID NO:2); the light chain of the first member has an amino acid sequence at least 60%, 70%, 75%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% sequence identity or homology with an amino acid sequence from Figure IB (SEQ ID NO:2).
In preferred embodiments, the light chain of the first member has an amino acid sequence that is encoded by a nucleotide sequence as shown in Figure IB (SEQ ID NO: 1), or Figure 2 (SEQ ID NO:37); the light chain of the first member has an amino acid sequence that is encoded by a nucleotide sequence at least 60%, 70%, 75%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% sequence identity or homology with a nucleotide sequence shown in Figure IB (SEQ ID NOs:2, 3, or 4), or Figure 2 (SEQ ID NO:37); the light chain of the first member has an amino acid sequence that is encoded by a nucleotide sequence that is capable of hybridizing under stringent conditions to the nucleotide sequence shown in Figure IB.
In preferred embodiments, the heavy chain of the first member has an amino acid sequence as shown in Figure 4B (SEQ ID NO:6, 7, 8, 9, 10 and/or 11), or Figure 5 (SEQ ID NOs:13, 14, 15 and/or 16); the heavy chain of the first member has an amino acid sequence at least 60%, 70%, 75%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% sequence identity or homology with an amino acid sequence from Figure 4B (SEQ ID NO: 6, 7, 8, 9, 10 and/or 11), or Figure 5 (SEQ ID Nos: 13, 14, 15 and/or 16). In preferred embodiments, the heavy chain of the first member has an amino acid sequence that is encoded by a nucleotide sequence as shown in Figure 4B (SEQ ID NO: 5), or Figure 5 (SEQ ID NO: 12); the heavy chain of the first member has an amino acid sequence that is encoded by a nucleotide sequence at least 60%, 70%, 75%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% sequence identity or homology with a nucleotide sequence shown in Figure 4B (SEQ ID NO:5), or Figure 5 (SEQ ID NO: 12); the heavy chain of the first member has an amino acid sequence that is encoded by a nucleotide sequence that is capable of hybridizing under stringent conditions to the nucleotide sequence shown in Figure 4B, or 5. In a preferred embodiment, the fusion protein includes a peptide linker and the peptide linker has one or more of the following characteristics: a) it allows for the rotation of the first and the second member relative to each other; b) it is resistant to digestion by proteases; c) it does not interact with the first or the second; d) it allows the fusion protein to form a complex (e.g., a di-, tri-, terra-, or multi-meric complex) that retains enzymatic activity; and e) it promotes folding and/or assembly of the fusion protein into an active complex.
In a preferred embodiment: the fusion protein includes a peptide linker and the peptide linker is 5 to 60, more preferably, 10 to 30, amino acids in length; the peptide linker is 20 amino acids in length; the peptide linker is 17 amino acids in length; each of the amino acids in the peptide linker is selected from the group consisting of Gly, Ser, Asn, Thr and Ala; the peptide linker includes a Gly-Ser element.
In a preferred embodiment, the fusion protein includes a peptide linker and the peptide linker includes a sequence having the formula (Ser-Gly-Gly-Gly-Gly)y wherein y is
1, 2, 3, 4, 5, 6, 7, or 8. Preferably, the peptide linker includes a sequence having the formula (Ser-Gly-Gly-Gly-Gly)3. Preferably, the peptide linker includes a sequence having the formula ((Ser-Gly-Gly-Gly-Gly)3-Ser-Pro).
In preferred embodiments, the fusion protein is produced recombinantly, e.g., produced in a host cell (e.g., a cultured cell), or in a transgenic animal, e.g., a transgenic mammal (e.g., a goat, a cow, or a rodent (e.g., a mouse). In preferred embodiments, the fusion protein is produced in a transgenic mammal
(e.g., a goat, a cow, or a rodent (e.g., a mouse). Thus, the method further includes: providing a transgenic animal, which includes a transgene which provides for the expression of a fusion protein described herein; allowing the transgene to be expressed; and, preferably, recovering fusion protein, from the milk of the transgenic mammal.
For embodiments where the fusion protein is produced transgenically, the fusion protein can further include: a signal sequence which directs the secretion of the fusion protein, e.g., a signal from a secreted protein (e.g., a signal from a protein secreted into milk; or an immunoglobulin secretory signal); and
(optionally) a sequence which encodes a sufficient portion of the amino terminal coding region of a secreted protein, e.g., a protein secreted into milk, or an immunoglobulin, to promote secretion, e.g., in the milk of a transgenic mammal, of the fusion protein. In preferred embodiments, the fusion protein is made in a mammary gland of the transgenic mammal, e.g., a ruminant, e.g., a goat or a cow.
In preferred embodiments, the fusion protein is secreted into the milk of the transgenic mammal, e.g., a ruminant, e.g., a dairy animal, e.g., a goat or a cow.
In preferred embodiments, the fusion protein is secreted into the milk of a transgenic mammal at concentrations of at least about 0.1 mg/ml, 0.5 mg/ml, 1.0 mg/ml, 1.5 mg/ml, 2 mg/ml, 3 mg/ml, 5 mg/ml or higher.
In preferred embodiments, the fusion protein is made under the control of a mammary gland specific promoter, e.g., a milk specific promoter, e.g., a milk serum protein or casein promoter. The milk specific promoter can be a casein promoter, beta lactoglobulin promoter, whey acid protein promoter, or lactalbumin promoter. Preferably, the promoter is a goat β casein promoter.
In preferred embodiments, the transgene encoding the fusion protein is a nucleic acid construct which includes:
(a) optionally, an insulator sequence; (b) a promoter, e.g., a mammary epithelial specific promoter, e.g., a milk protein promoter;
(c) a nucleotide sequence which encodes a signal sequence which can direct the secretion of the fusion protein, e.g. a signal from a milk specific protein, or an immunoglobulin;
(d) optionally, a nucleotide sequence which encodes a sufficient portion of the amino terminal coding region of a secreted protein, e.g. a protein secreted into milk, or an immunoglobulin, to allow secretion, e.g., in the milk of a transgenic mammal, of the fusion protein; (e) one or more nucleotide sequences which encode a fusion protein, e.g., an immunoglobulin-enzyme fusion protein as described herein; and
(f) (optionally) a 3' untranslated region from a mammalian gene, e.g., a mammary epithelial specific gene, (e.g., a milk protein gene).
In preferred embodiments, elements a (if present), b, c, d (if present), and f of the transgene are from the same gene; the elements a (if present), b, c, d (if present), and f of the transgene are from two or more genes. For example, the signal sequence, the promoter sequence and the 3' untranslated sequence can be from a mammary epithelial specific gene, e.g., a milk serum protein or casein gene (e.g., a β casein gene). Preferably, the signal sequence, the promoter sequence and the 3' untranslated sequence are from a goat β casein gene.
In preferred embodiments, the promoter of the transgene is a mammary epithelial specific promoter, e.g., a milk serum protein or casein promoter (e.g., a β casein promoter). The milk specific promoter can be a casein promoter, beta lactoglobulin promoter, whey acid protein promoter, or lactalbumin promoter. Preferably, the promoter is a goat β casein promoter.
In preferred embodiments, the signal sequence encoded by the transgene is an amino terminal sequence which directs the expression of the protein to the exterior of a cell, or into the cell membrane. For example, the signal sequence can be obtained from an immunoglobulin protein. Preferably, the signal sequence is from a protein which is secreted into the milk, e.g., the milk of the transgenic animal. In preferred embodiments, the one or more nucleotide sequences encoding a fusion protein include one or more of: a nucleotide sequence encoding a first member, e.g., an immunoglobulin heavy chain (or an antigen binding portion thereof) operably linked to a second member, e.g., an enzyme; (optionally) a nucleotide sequence encoding an immunoglobulin light chain (or an antigen binding portion thereof), or both. In one embodiment, the nucleotide sequences encoding the heavy chain fusion and the light chain are operatively linked in a single construct, e.g., a single cosmid. In another embodiment, the nucleotide sequences encoding the heavy chain fusion and the light chain are introduced into a transgenic animal in separate constructs. Preferably, when linked, the nucleotide sequences are arranged in the following order:
5'-Nl-3' linked to 5'-N2-3'; or 5'-N2-3' linked to 5'-Nl-3' wherein Nl is a first member, e.g., an immunoglobulin heavy chain (or an antigen binding portion thereof) operably linked to a second member, e.g., an enzyme; and N2 is an immunoglobulin light chain (or an antigen binding portion thereof). The nucleotide sequences can be in any orientation with respect to each other, e.g., sense/sense; reverse/reverse; sense/reverse; or reverse/sense. In preferred embodiments, the 3' untranslated region of the transgene includes a polyadenylation site, and is obtained from a mammalian gene, e.g., a mammary epithelial specific gene, e.g., a milk serum protein gene or casein gene. The 3' untranslated region can be obtained from a casein gene (e.g., a β casein gene), a beta lactoglobulin gene, whey acid protein gene, or lactalbumin gene. Preferably, the 3' untranslated region is from a goat β casein gene.
In preferred embodiments, the transgene, e.g., the transgene as described herein, integrates into a germ cell and/or a somatic cell of the transgenic animal.
In another aspect, the invention features, a method for providing a transgenically produced fusion protein, e.g., a fusion protein as described herein, in the milk, of a transgenic mammal. The method includes obtaining milk from a transgenic mammal, which includes a fusion protein encoding transgene, e.g., one which has been introduced into its germline, e.g., a nucleic acid construct as described herein, that result in the expression of the protein-coding sequence of fusion protein in mammary gland epithelial cells, thereby secreting the fusion protein in the milk of the mammal.
In preferred embodiments the transgenic mammal is selected from the group consisting of sheep, mice, pigs, cows and goats. The preferred transgenic mammal is a goat.
In preferred embodiments, the fusion protein is secreted into the milk of a transgenic mammal at concentrations of at least about 0.1 mg/ml, 0.5 mg/ml, 1.0 mg/ml, 1.5 mg/ml, 2 mg/ml, 3 mg/ml, 5 mg/ml or higher.
In preferred embodiments, the transgene encoding the immunoglobulin-enzyme fusion protein is a nucleic acid construct which includes:
(a) optionally, an insulator sequence;
(b) a promoter, e.g., a mammary epithelial specific promoter, e.g., a milk protein promoter;
(c) a nucleotide sequence which encodes a signal sequence which can direct the secretion of the fusion protein, e.g., a signal from a milk specific protein, or an immunoglobulin;
(d) optionally, a nucleotide sequence which encodes a sufficient portion of the amino terminal coding region of a secreted protein, e.g., a protein secreted into milk, or an immunoglobulin, to allow secretion, e.g., in the milk of a transgenic mammal, of the non- secreted protein;
(e) one or more nucleotide sequences which encode a fusion protein, e.g., a fusion protein as described herein; and
(f) optionally, a 3' untranslated region from a mammalian gene, e.g., a mammary epithelial specific gene, (e.g., a milk protein gene). In preferred embodiments, elements a (if present), b, c, d (if present), and f of the transgene are from the same gene; the elements a (if present), b, c, d (if present), and f of the transgene are from two or more genes. For example, the signal sequence, the promoter sequence and the 3' untranslated sequence can be from a mammalian gene, e.g., a mammary epithelial specific gene, e.g., a milk serum protein or casein gene (e.g., a β casein gene). Preferably, the signal sequence, the promoter sequence and the 3' untranslated sequence are from a goat β casein gene.
In preferred embodiments, the promoter of the transgene is a mammary epithelial specific promoter, e.g., a milk serum protein or casein promoter (e.g., a β casein promoter). The milk specific promoter can be a casein promoter, beta lactoglobulin promoter, whey acid protein promoter, or lactalbumin promoter. Preferably, the promoter is a goat β casein promoter.
In preferred embodiments, the signal sequence encoded by the transgene is an amino terminal sequence which directs the expression of the protein to the exterior of a cell, or into the cell membrane. Preferably, the signal sequence is from a protein which is secreted into the milk, e.g., the milk of the transgenic animal.
In preferred embodiments, the one or more nucleotide sequences encoding an fusion protein include one or more of: a nucleotide sequence encoding an immunoglobulin heavy chain (or an antigen binding portion thereof) fused to an enzyme; a nucleotide sequence encoding an immunoglobulin light chain (or an antigen binding portion thereof), or both. In one embodiment, the nucleotide sequences encoding the heavy chain fusion and the light chain are operatively linked in a single construct, e.g., a single cosmid. In another embodiment, the nucleotide sequences encoding the heavy chain fusion and the light chain are introduced into a transgenic animal in separate constructs. Preferably, when linked, the nucleotide sequences are arranged in the following order:
5'-Nl-3' linked to 5'-N2-3'; or 5'-N2-3' linked to 5'-Nl-3' wherein Nl is an immunoglobulin heavy chain (or an antigen binding portion thereof) linked to an enzyme; and N2 is an immunoglobulin light chain (or an antigen binding portion thereof). The nucleotide sequences can be in any orientation with respect to each other, e.g., sense/sense; reverse/reverse; sense/reverse; or reverse/sense.
In preferred embodiments, the 3' untranslated region of the transgene includes a polyadenylation site, and is obtained from a mammalian gene, e.g., a mammary epithelial specific gene, (e.g., a milk serum protein gene or casein gene). The 3' untranslated region can be obtained from a casein gene (e.g., a β casein gene), a beta lactoglobulin gene, whey acid protein gene, or lactalbumin gene. Preferably, the 3' untranslated region is from a goat β casein gene.
In preferred embodiments, the transgene, e.g., the transgene as described herein, integrates into a germ cell and/or a somatic cell of the transgenic animal.
In another aspect, the invention features, a transgene, e.g., a nucleic acid construct, preferably, an isolated nucleic acid construct, which includes:
(a) optionally, an insulator sequence; (b) a promoter, e.g., a mammary epithelial specific promoter, e.g., a milk protein promoter;
(c) a nucleotide sequence which encodes a signal sequence which can direct the secretion of the fusion protein, e.g. a signal sequence from a milk specific protein, or an immunoglobulin; (d) optionally, a nucleotide sequence which encodes a sufficient portion of the amino terminal coding region of a secreted protein, e.g. a protein secreted into milk, or an immunoglobulin, to allow secretion, e.g., in the milk of a transgenic mammal, of the fusion protein protein;
(e) one or more nucleotide sequences which encode a fusion protein, e.g., a fusion protein as described herein; and
(f) optionally, a 3' untranslated region from a mammalian gene, e.g., a mammary epithelial specific gene, (e.g., a milk protein gene).
In preferred embodiments, elements a (if present), b, c, d (if present), and f of the transgene are from the same gene; the elements a (if present), b, c, d (if present), and f of the transgene are from two or more genes. For example, the signal sequence, the promoter sequence and the 3' untranslated sequence can be from a mammalian gene, e.g., a mammary epithelial specific gene, e.g., a milk serum protein or casein gene (e.g., a β casein gene). Preferably, the signal sequence, the promoter sequence and the 3' untranslated sequence are from a goat β casein gene. In preferred embodiments, the promoter of the transgene is a mammary epithelial specific promoter, e.g., a milk serum protein or casein promoter (e.g., a β casein promoter). The milk specific promoter can be a casein promoter, beta lactoglobulin promoter, whey acid protein promoter, or lactalbumin promoter. Preferably, the promoter is a goat β casein promoter.
In preferred embodiments, the signal sequence encoded by the transgene is an amino terminal sequence which directs the expression of the protein to the exterior of a cell, or into the cell membrane. Preferably, the signal sequence is from a milk specific protein, or an immunoglobulin. Preferably, the signal sequence directs secretion of the encoded fusion protein into the milk of a transgenic animal, e.g., a transgenic mammal.
In preferred embodiments, the one or more nucleotide sequences encoding a fusion protein include one or more of: a nucleotide sequence encoding an immunoglobulin heavy chain (or an antigen binding portion thereof) fused to an enzyme; a nucleotide sequence encoding an immunoglobulin light chain (or an antigen binding portion thereof), or both. In one embodiment, the nucleotide sequences encoding the heavy chain fusion and the light chain are operatively linked in a single construct, e.g., a single cosmid. In another embodiment, the nucleotide sequences encoding the heavy chain fusion and the light chain are introduced into a transgenic animal in separate constructs. Preferably, when linked, the nucleotide sequences are arranged in the following order: 5'-Nl-3' linked to 5'-N2-3'; or 5'-N2-3' linked to 5'-Nl-3' wherein Nl is an immunoglobulin heavy chain (or an antigen binding portion thereof) linked to an enzyme; and N2 is an immunoglobulin light chain (or an antigen binding portion thereof). The nucleotide sequences can be in any orientation with respect to each other, e.g., sense/sense; reverse/reverse; sense/reverse; or reverse/sense.
In preferred embodiments, the 3' untranslated region of the transgene includes a polyadenylation site, and is obtained from a mammalian gene, e.g., a mammary epithelial specific gene, (e.g., a milk serum protein gene or casein gene). The 3' untranslated region can be obtained from a casein gene (e.g., a β casein gene), a beta lactoglobulin gene, whey acid protein gene, or lactalbumin gene. Preferably, the 3' untranslated region is from a goat β casein gene. In another aspect, the invention features a nucleic acid molecule encoding a fusion protein, e.g., a fusion protein as described herein.
In preferred embodiments, nucleic acid has a nucleotide sequence as shown in Figure IB (SEQ ID NO:l), Figure 2 (SEQ ID NO:37), Figure 4B (SEQ ID NO:5), or Figure 5 (SEQ ID NO: 12); the nucleic acid has a nucleotide sequence at least 60%, 70%, 75%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% sequence identity or homology with a nucleotide sequence shown in Figure IB (SEQ ID NO:l), Figure 2 (SEQ ID NO:37), Figure 4B (SEQ ID NO:5), or Figure 5 (SEQ ID NO: 12); the nucleic acid has a nucleotide sequence that is capable of hybridizing under stringent conditions to the nucleotide sequence shown in Figure IB, Figure 2, Figure 4B, or Figure 5.
In a preferred embodiment, the nucleic acid has a nucleotide sequence which encodes an amino acid sequence as shown in Figure 1 A (SEQ ID NOs:2, 3, 4), Figure 4B (SEQ ID NO:6, 7, 8, 9, 10, 11), or Figure 5 (SEQ ID NO:13, 14, 15, 16); the nucleic acid has a nucleotide sequence which encodes an amino acid sequence which is at least 60%, 70%, 75%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, most preferably at least 98%, 99% sequence identity or homology with an amino acid sequence from Figure 1A (SEQ ID NO:2, 3, 4), Figure 4B (SEQ ID NO:6, 7, 8, 9, 10, 11), or Figure 5 (SEQ ID NO:13, 14, 15, 16).
In another aspect, the invention features a host cell, e.g., an isolated host cell (e.g., a cultured cell), which includes a nucleic acid of the invention (e.g., a nucleic acid, or a transgene, e.g., a nucleic acid construct, as described herein).
In another aspect, the invention features, a fusion protein described herein, or a purified preparation thereof In another aspect, the invention features, a pharmaceutical or nutraceutical composition having a therapeutically effective amount of a fusion protein, e.g., a fusion protein as described herein, and a pharmaceutically acceptable carrier.
In a preferred embodiment, the composition includes milk.
In another aspect, the invention features, a transgenic animal which includes a transgene that encodes a fusion protein, e.g., a transgene which encodes a fusion protein described herein. Preferred transgenic animals include: mammals; birds; reptiles; marsupials; and amphibians. Suitable mammals include: ruminants; ungulates; domesticated mammals; and dairy animals. Particularly preferred animals include: mice, goats, sheep, camels, rabbits, cows, pigs, horses, oxen, and llamas. Suitable birds include chickens, geese, and turkeys. Where the transgenic protein is secreted into the milk of a transgenic animal, the animal should be able to produce at least 1, and more preferably at least 10, or 100, liters of milk per year. Preferably, the transgenic animal is a ruminant, e.g., a goat, cow or sheep. Most preferably, the transgenic animal is a goat.
In preferred embodiments, the transgenic mammals has germ cells and somatic cells containing a transgene that encodes a fusion protein, e.g., a transgene which encodes a fusion protein described herein.
In preferred embodiments, the fusion protein expressed in the transgenic animal is under the control of a mammary gland specific promoter, e.g., a milk specific promoter, e.g., a milk serum protein or casein promoter. The milk specific promoter can be a casein promoter, beta lactoglobulin promoter, whey acid protein promoter, or lactalbumin promoter. Preferably, the promoter is a goat β casein promoter.
In preferred embodiments, the transgenic animal is a mammal, and the fusion protein is secreted into the milk of the transgenic animal at concentrations of at least about 0.1 mg/ml, 0.5 mg/ml, 1.0 mg/ml, 1.5 mg/ml, 2 mg/ml, 3 mg/ml, 5 mg/ml or higher. In another aspect, the invention features, a method of making a transgenic organism which has a fusion protein transgene. The method includes providing or forming in a cell of an organism, a fusion protein, e.g., a transgene which encodes a fusion protein described herein; and allowing the cell, or a descendent of the cell, to give rise to a transgenic organism.
In a preferred embodiment, the transgenic organism is a transgenic plant or animal. Preferred transgenic animals include: mammals; birds; reptiles; marsupials; and amphibians. Suitable mammals include: ruminants; ungulates; domesticated mammals; and dairy animals. Particularly preferred animals include: mice, goats, sheep, camels, rabbits, cows, pigs, horses, oxen, and llamas. Suitable birds include chickens, geese, and turkeys. Where the transgenic protein is secreted into the milk of a transgenic animal, the animal should be able to produce at least 1, and more preferably at least 10, or 100, liters of milk per year.
In preferred embodiments, the fusion protein is under the control of a mammary gland specific promoter, e.g., a milk specific promoter, e.g., a milk serum protein or casein promoter. The milk specific promoter can be a casein promoter, beta lactoglobulin promoter, whey acid protein promoter, or lactalbumin promoter. Preferably, the promoter is a goat β casein promoter.
In preferred embodiments, the organism is a mammal, and the fusion protein is secreted into the milk of the transgenic animal at concentrations of at least about 0.1 mg/ml, 0.5 mg/ml, 1.0 mg/ml, 1.5 mg/ml, 2 mg/ml, 3 mg/ml, 5 mg/ml or higher.
In another aspect, the invention features, a method of selectively killing an aberrant or diseased cell which expresses on its surface a target antigen, e.g., a cancer cell expressing a cell suface antigen. The method includes: contacting said aberrant or diseased cell with an effective amount of a fusion protein, e.g., a fusion protein described herein, wherein either the first or the second member of the fusion protein recognizes said target antigen, such that selective killing of the cell occurs. The subject method can be used on cells in culture, e.g. in vitro or ex vivo (e.g., cultures comprising cancer cells). For example, cells can be cultured in vitro in culture medium and the contacting step can be effected by adding the fusion protein of the invention to the culture medium. Alternatively, the method can be performed on cells (e.g., cancer cells) present in a subject, e.g., as part of an in vivo (e.g., therapeutic or prophylactic) protocol.
In another aspect, the invention features, a method of selectively killing an aberrant or diseased cell which expresses on its surface a target antigen, e.g., a cancer cell expressing a cell suface antigen. The method includes: introducing into said aberrant or diseased cell a nucleic acid encoding a fusion protein, e.g., a fusion protein described herein, wherein either the first or the second member of the fusion protein recognizes said target antigen, such that selective killing of the cell occurs.
The subject method can be used on cells in culture, e.g. in vitro or ex vivo (e.g., cultures comprising cancer cells). For example, cells can be cultured in vitro in culture medium and the nucleic acids of the invention can be introduced to the culture medium. Alternatively, the method can be performed on cells (e.g., cancer cells) present in a subject, e.g., as part of an in vivo (e.g., therapeutic or prophylactic) gene therapy protocol.
In another aspect, the invention provides, a method of treating in a subject, a disorder characterized by aberrant growth or activity of a cell which expresses on its surface a target antigen, e.g., a cancer cell expressing a target antigen. The method includes administering to the subject an effective amount of a fusion protein, or a nucleic acid encoding a fusion protein (e.g., a fusion protein described herein), wherein either the first or the second member of the fusion protein recognizes said target antigen.
In a preferred embodiment, the disease is characterized by aberrant growth or activity of a cell, e.g., cancer cell, an immune cell. In yet another aspect, the present invention provides a method for detecting in vitro or in vivo the presence of target antigen in a sample, e.g., for diagnosing a disease. The method comprises (i) contacting a sample or a control sample under conditions that allow interaction of a labelled fusion protein, e.g.. a fusion protein as described herein, and (ii) detecting formation of a complex. A statistically significant change in the formation of the complex between the fusion protein antibody and the target antigen with respect to a control sample is indicative the presence of target antigen in the sample.
In preferred embodiments, the second member is an enzyme, e.g., horseradish peroxidase. The invention features fusion proteins in which the ability of a first member of the fusion to from a multimer is chosen so as to optimize a characteristic, e.g., activity or solubility, of the second member.
The terms peptides, proteins, and polypeptides are used interchangeably herein. A purified preparation, substantially pure preparation of a polypeptide, or an isolated polypeptide as used herein, means a polypeptide that has been separated from at least one other protein, lipid, or nucleic acid with which it occurs in the cell or organism which expresses it, e.g., from a protein, lipid, or nucleic acid in a transgenic animal or in a fluid, e.g., milk, or other substance, e.g., an egg, produced by a transgenic animal. The polypeptide is preferably separated from substances, e.g., antibodies or gel matrix, e.g., polyacrylamide, which are used to purify it. The polypeptide preferably constitutes at least 10, 20, 50 70, 80 or 95% dry weight of the purified preparation. Preferably, the preparation contains: sufficient polypeptide to allow protein sequencing; at least 1, 10, or 100 μg of the polypeptide; at least 1, 10, or 100 mg of the polypeptide. A substantially pure nucleic acid, is a nucleic acid which is one or both of: not immediately contiguous with either one or both of the sequences, e.g., coding sequences, with which it is immediately contiguous (i.e., one at the 5' end and one at the 3' end) in the naturally-occurring genome of the organism from which the nucleic acid is derived; or which is substantially free of a nucleic acid sequence with which it occurs in the organism from which the nucleic acid is derived. The term includes, for example, a recombinant DNA which is incoφorated into a vector, e.g., into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other DNA sequences. Substantially pure DNA also includes a recombinant DNA which is part of a hybrid gene encoding additional fusion protein sequence.
Homology, or sequence identity, as used herein, refers to the sequence similarity between two polypeptide molecules or between two nucleic acid molecules. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are homologous at that position (i.e., as used herein amino acid or nucleic acid "homology" is equivalent to amino acid or nucleic acid "identity"). The percent homology between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % homology = # of identical positions/total # of positions x 100). For example, if 6 of 10, of the positions in two sequences are matched or homologous then the two sequences are 60% homologous or have 60% sequence identity. By way of example, the DNA sequences ATTGCC and TATGGC share 50% homology or sequence identity. Generally, a comparison is made when two sequences are aligned to give maximum homology or sequence identity. The comparison of sequences and determination of percent homology between two sequences can be accomplished using a mathematical algorithm. A preferred, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-77. Such an algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J Mol. Biol. 215:403-10. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, wordlength = 12 to obtain nucleotide sequences homologous to ITALY nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score = 50, wordlength = 3 to obtain amino acid sequences homologous to ITALY protein molecules of the invention. To obtain gapped alignments for comparison puφoses, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See http://www.ncbi.nlm.nih.gov. Another preferred, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). Such an algorithm is incorporated into the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM 120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.
As used herein, the term transgene means a nucleic acid sequence (encoding, e.g., one or more fusion protein polypeptides), which is introduced into the genome of a transgenic organism. A transgene can include one or more transcriptional regulatory sequences and other nucleic acid, such as introns, that may be necessary for optimal expression and secretion of a nucleic acid encoding the fusion protein. A transgene can include an enhancer sequence. A fusion protein sequence can be operatively linked to a tissue specific promoter, e.g., mammary gland specific promoter sequence that results in the secretion of the protein in the milk of a transgenic mammal, a urine specific promoter, or an egg specific promoter. As used herein, the term "transgenic cell" refers to a cell containing a transgene.
A transgenic organism, as used herein, refers to a transgenic animal or plant. As used herein, a "transgenic animal" is a non-human animal in which one or more, and preferably essentially all, of the cells of the animal contain a transgene introduced by way of human intervention, such as by transgenic techniques known in the art. The transgene can be introduced into the cell, directly or indirectly by introduction into a precursor of the cell, by way of deliberate genetic manipulation, such as by microinjection or by infection with a recombinant virus.
Mammals are defined herein as all animals, excluding humans, that have mammary glands and produce milk. As used herein, a "dairy animal" refers to a milk producing non-human animal which is larger than a rodent. In preferred embodiments, the dairy animal produce large volumes of milk and have long lactating periods, e.g., cows or goats.
As used herein, the language "subject" includes human and non-human animals. The term "non-human animals" of the invention includes vertebrates, e.g., mammals and non-mammals, such as non-human primates, ruminants, birds, amphibians, reptiles and rodents, e.g., mice and rats. The term also includes rabbits.
As used herein, a "transgenic plant" is a plant, preferably a multi-celled or higher plant, in which one or more, and preferably essentially all, of the cells of the plant contain a transgene introduced by way of human intervention, such as by transgenic techniques known in the art.
As used herein, the term "plant" refers to either a whole plant, a plant part, a plant cell, or a group of plant cells. The class of plants which can be used in methods of the invention is generally as broad as the class of higher plants amenable to transformation techniques, including both monocotyledonous and dicotyledonous plants. It includes plants of a variety of ploidy levels, including polyploid, diploid and haploid.
As used herein, the terms "immunoglobulin" and "antibody" refer to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds. Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as HCVR or VH) and a heavy chain constant region. The heavy chain constant region is comprised of three domains, CHI, CH2 and CH3. Each light chain is comprised of a light chain variable region (abbreviated herein as LCVR or VL) and a light chain constant region. The light chain constant region is comprised of one domain, CL. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.
The term "antigen-binding portion" of an antibody (or simply "antibody portion"), as used herein, refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen (e.g. a target antigen). It has been shown that the antigen- binding function of an antibody can be performed by fragments of a full-length antibody. Examples of binding fragments encompassed within the term "antigen-binding portion" of an antibody include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CHI domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (Ward et al., (1989) Nature 341:544-546), which consists of a VH domain; and (vi) an isolated complementarity determining region (CDR). Furthermore, although the two domains of the Fv fragment, VL and VH, are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see e.g., Bird et al. (1988) Science 242:423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883). Such single chain antibodies are also intended to be encompassed within the term "antigen- binding portion" of an antibody. These antibody fragments are obtained using conventional techniques known to those with skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies.
The term "monoclonal antibody" as used herein refers to an antibody molecule of single molecular composition. A monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope. Accordingly, the term "human monoclonal antibody" refers to antibodies displaying a single binding specificity which have variable and constant regions derived from human germline immunoglobulin sequences. In one embodiment, the human monoclonal antibodies are produced by a hybridoma which includes a B cell obtained from a transgenic non-human animal, e.g., a transgenic mouse, having a genome comprising a human heavy chain transgene and a light chain transgene fused to an immortalized cell.
The term "recombinant human antibody", as used herein, is intended to include all human antibodies that are prepared, expressed, created or isolated by recombinant means, such as antibodies isolated from an animal (e.g., a mouse) that is transgenic for human immunoglobulin genes; antibodies expressed using a recombinant expression vector transfected into a host cell, antibodies isolated from a recombinant, combinatorial human antibody library, or antibodies prepared, expressed, created or isolated by any other means that involves splicing of human immunoglobulin gene sequences to other DNA sequences. Such recombinant human antibodies have variable and constant regions derived from human germline immunoglobulin sequences. In certain embodiments, however, such recombinant human antibodies are subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the VH and VL regions of the recombinant antibodies are sequences that, while derived from and related to human germline VH and VL sequences, may not naturally exist within the human antibody germline repertoire in vivo.
A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence. With respect to transcription regulatory sequences, operably linked means that the DNA sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame.
The terms "vector" or "construct", as used herein, is intended to refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded DNA loop into which additional DNA segments may be ligated. Another type of vector is a viral vector, wherein additional DNA segments may be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "recombinant expression vectors" (or simply, "expression vectors"). In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. In the present specification, "plasmid" and "vector" may be used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated vectors. The term "recombinant host cell" (or simply "host cell"), as used herein, is intended to refer to a cell into which a recombinant expression vector has been introduced. It should be understood that such terms are intended to refer not only to the particular subject cell but to the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term "host cell" as used herein.
Other features and advantages of the invention will be apparent from the following detailed description, and from the claims.
Detailed Description
The drawings are first described.
Figure 1A is a schematic diagram of a construct containing the genomic sequence of the light chain (LC) of humanized anti-carcinoembryonic antigen antibody 431. The location of the signal peptide sequence (s) and the light chain variable (Vk) and the Ck regions are also indicated. The location of the restriction enzyme sites is also indicated.
Figure IB depicts the nucleotide and amino acid sequence for the light chain of humanized anti-carcinoembryonic antigen antibody 431. The location of the restriction enzyme sites is indicated.
Figure 2 depicts the nucleotide sequence for a Sal I insert containing the coding sequences for light chain of humanized anti-carcinoembryonic antigen antibody 431. Figure 3 is a schematic diagram of a construct (Be 458) which includes the Sal I insert containing the coding sequences for light chain of humanized anti-carcinoembryonic antigen antibody 431. Also indicated is the location of the silencer, 5' β-casein untranslated region, the light chain coding region, and the 3' β-casein untranslated region. Figure 4 A is a schematic diagram of a construct containing the genomic sequence of the heavy chain (HC) of humanized anti-carcinoembryonic antigen antibody 431 linked to the β-glucuronidase sequence. The location of the signal peptide sequence (s) and the heavy chain variable (Vh) and CHI are also indicated. The location of the restriction enzyme sites is also indicated. Figure 4B depicts the nucleotide and amino acid sequence for the heavy chain of humanized anti-carcinoembryonic antigen antibody 431. The location of the restriction enzyme sites is indicated.
Figure 5 depicts the nucleotide and amino acid sequence for the mutant heavy chain of humanized anti-carcinoembryonic antigen antibody 431. The mutant heavy chain lacks the hinge region. The location of the restriction enzyme sites is indicated.
Figure 6 is a schematic diagram of a construct (Be 454) containing the mutant heavy chain of humanized anti-carcinoembryonic antigen antibody 431 linked to the β- glucuronidase sequence. The location of the silencer, 5' β-casein untranslated region, the heavy chain mutant/β-glucuronidase fusion coding region, and the 3' β-casein untranslated region. The location of the restriction enzyme sites is also indicated.
Figure 7 is an overview of the construction of the heavy chain mutants.
Figure 8 is an enlarged view of the mutations to β-glucuronidase
The present invention provides, at least in part, transgenically produced fusion proteins wherein one member of the fusion protein assembles into a multimer and the other member is chosen, or modified, to promote assembly into the optimal number of subunits. In one embodiment, the fusion protein includes an immunoglobulin subunit (e.g., an immunoglobulin heavy or light chain) fused to a toxin (e.g., a subunit of an enzyme). The immunogloblulin-enzyme fusion proteins described herein serve to target a cytotoxic agent (e.g. the enzyme) to an undesirable cell, e.g., a tumor cell. For example, the fusion proteins described in the Examples below, (i.e., an antibody against carcinoembryonic antigen (CEA) fused to an enzyme, e.g., glucuronidase) can be used to target, to a tumor cell. After allowing sufficient time for the immunoglobulin-enzyme fusion to localize at the tumor site, a non-toxic prodrug can be administered. This prodrug is converted to a highly cytotoxic drug by the action of the targeted enzyme localized at the tumor site, permitting to achieve therapeutic levels of the drug without unacceptable toxicity for the patients.
Production of Immunoglobulins
A monoclonal antibody against a target antigen, e.g., a cell surface protein (e.g., receptor) on a cell can be produced by a variety of techniques, including conventional monoclonal antibody methodology e.g., the standard somatic cell hybridization technique of Kohler and Milstein, Nature 256: 495 (1975). Although somatic cell hybridization procedures are preferred, in principle, other techniques for producing monoclonal antibody can be employed e.g., viral or oncogenic transformation of B lymphocytes. The preferred animal system for preparing hybridomas is the murine system.
Hybridoma production in the mouse is a very well-established procedure. Immunization protocols and techniques for isolation of immunized splenocytes for fusion are known in the art. Fusion partners (e.g., murine myeloma cells) and fusion procedures are also known. Human monoclonal antibodies (mAbs) directed against human proteins can be generated using transgenic mice carrying the complete human immune system rather than the mouse system. Splenocytes from these transgenic mice immunized with the antigen of interest are used to produce hybridomas that secrete human mAbs with specific affinities for epitopes from a human protein (see, e.g., Wood et al. International Application WO 91/00906, Kucherlapati et al. PCT publication WO 91/10741; Lonberg et al. International Application WO 92/03918; Kay et al. International Application 92/03917; Lonberg, N. et al. 1994 Nature 368:856-859; Green, L.L. et al. 1994 Nature Genet. 7:13-21; Morrison, S.L. et al. 1994 Proc. Natl. Acad. Sci. USA 81 :6851-6855; Bruggeman et al. 1993 Year Immunol 7:33-40; Tuaillon et al. 1993 PNAS 90:3720-3724; Bruggeman et al. 1991 Eur J Immunol 21 :1323-1326). Monoclonal antibodies can also be generated by other methods known to those skilled in the art of recombinant DNA technology. An alternative method, referred to as the "combinatorial antibody display" method, has been developed to identify and isolate antibody fragments having a particular antigen specificity, and can be utilized to produce monoclonal antibodies (for descriptions of combinatorial antibody display see e.g., Sastry et al. 1989 PNAS 86:5728; Huse et al. 1989 Science 246:1275; and Orlandi et al. 1989 PNAS 86:3833). After immunizing an animal with an immunogen as described above, the antibody repertoire of the resulting B-cell pool is cloned. Methods are generally known for obtaining the DNA sequence of the variable regions of a diverse population of immunoglobulin molecules by using a mixture of oligomer primers and PCR. For instance, mixed oligonucleotide primers corresponding to the 5' leader (signal peptide) sequences and or framework 1 (FR1) sequences, as well as primer to a conserved 3' constant region primer can be used for PCR amplification of the heavy and light chain variable regions from a number of murine antibodies (Larrick et al., 1991 , Biotechniques 11 :152- 156). A similar strategy can also been used to amplify human heavy and light chain variable regions from human antibodies (Larrick et al., 1991, Methods: Companion to Methods in Enzymology 2:106-110).
In an illustrative embodiment, RNA is isolated from B lymphocytes, for example, peripheral blood cells, bone marrow, or spleen preparations, using standard protocols (e.g., U.S. Patent No. 4,683,202; Orlandi, et al. PNAS (1989) 86:3833-3837; Sastry et al., PNAS (1989) 86:5728-5732; and Huse et al. (1989) Science 246:1275-1281.) First-strand cDNA is synthesized using primers specific for the constant region of the heavy chain(s) and each of the K and λ light chains, as well as primers for the signal sequence. Using variable region PCR primers, the variable regions of both heavy and light chains are amplified, each alone or in combinantion, and ligated into appropriate vectors for further manipulation in generating the display packages. Oligonucleotide primers useful in amplification protocols may be unique or degenerate or incorporate inosine at degenerate positions. Restriction endonuclease recognition sequences may also be incorporated into the primers to allow for the cloning of the amplified fragment into a vector in a predetermined reading frame for expression. The V-gene library cloned from the immunization-derived antibody repertoire can be expressed by a population of display packages, preferably derived from filamentous phage, to form an antibody display library. Ideally, the display package comprises a system that allows the sampling of very large variegated antibody display libraries, rapid sorting after each affinity separation round, and easy isolation of the antibody gene from purified display packages. In addition to commercially available kits for generating phage display libraries (e.g., the Pharmacia Recombinant Phage Antibody System, catalog no. 27-9400-01 ; and the Stratagene Swr Z4RTM phage display kit, catalog no. 240612), examples of methods and reagents particularly amenable for use in generating a variegated antibody display library can be found in, for example, Ladner et al. U.S. Patent No. 5,223,409; Kang et al. International Publication No. WO 92/18619; Dower et al. International Publication No. WO 91/17271; Winter et al. International Publication WO 92/20791; Markland et al. International Publication No. WO 92/15679; Breitling et al. International Publication WO 93/01288; McCafferty et al. International Publication No. WO 92/01047; Garrard et al. International Publication No. WO 92/09690; Ladner et al. International Publication No. WO 90/02809; Fuchs et al. (1991) Bio/Technology 9:1370-1372; Hay et al. (1992) Hum Antibod Hybridomas 3:81-85; Huse et al. (1989) Science 246:1275-1281; Griffths et al. (1993) EMBO J 12:725-734; Hawkins et al. (1992) J Mol Biol 226:889-896; Clackson et al. (1991) Nature 352:624-628; Gram et al. (1992) PNAS 89:3576-3580; Garrad et al. (1991) Bio/Technology 9:1373-1377; Hoogenboom et al. (1991) Nuc AcidRes 19:4133-4137; and Barbas et al. (1991) PNAS 88:7978-7982.
In certain embodiments, the V region domains of heavy and light chains can be expressed on the same polypeptide, joined by a flexible linker to form a single-chain Fv fragment, and the scFV gene subsequently cloned into the desired expression vector or phage genome. As generally described in McCafferty et al., Nature (1990) 348:552-554, complete Vjr and VL domains of an antibody, joined by a flexible (Gly4-Ser)3 linker can be used to produce a single chain antibody which can render the display package separable based on antigen affinity. Isolated scFV antibodies immunoreactive with the antigen can subsequently be formulated into a pharmaceutical preparation for use in the subject method. Once displayed on the surface of a display package (e.g., filamentous phage), the antibody library is screened with the target antigen, or peptide fragment thereof, to identify and isolate packages that express an antibody having specificity for the target antigen. Nucleic acid encoding the selected antibody can be recovered from the display package (e.g., from the phage genome) and subcloned into other expression vectors by standard recombinant DNA techniques.
Specific antibody molecules with high affinities for a surface protein can be made according to methods known to those in the art, e.g, methods involving screening of libraries (Ladner, R.C., et al, U.S. Patent 5,233,409; Ladner, R.C., et al, U.S. Patent 5,403,484). Further, the methods of these libraries can be used in screens to obtain binding determinants that are mimetics of the structural determinants of antibodies.
In particular, the Fv binding surface of a particular antibody molecule interacts with its target ligand according to principles of protein-protein interactions, hence sequence data for VJJ and VL (the latter of which may be of the K or λ chain type) is the basis for protein engineering techniques known to those with skill in the art. Details of the protein surface that comprises the binding determinants can be obtained from antibody sequence information, by a modeling procedure using previously determined three-dimensional structures from other antibodies obtained from NMR studies or crytallographic data. See for example Bajorath, J. and S. Sheriff, 1996, Proteins: Struct., Fund., and Genet. 24 (2), 152-157; Webster, D.M. and A. R. Rees, 1995, "Molecular modeling of antibody- combining sites,"in S. Paul, Ed., Methods in Molecular Biol. 51, Antibody Engineering Protocols, Humana Press, Totowa, NJ, pp 17-49; and Johnson, G., Wu, T.T. and E.A. Kabat, 1995, "Seqhunt: A program to screen aligned nucleotide and amino acid sequences," in Methods in Molecular Biol.51, op. cit., pp 1-15. In one embodiment, a variegated peptide library is expressed by a population of display packages to form a peptide display library. Ideally, the display package comprises a system that allows the sampling of very large variegated peptide display libraries, rapid sorting after each affinity separation round, and easy isolation of the peptide-encoding gene from purified display packages. Peptide display libraries can be in, e.g., prokaryotic organisms and viruses, which can be amplified quickly, are relatively easy to manipulate, and which allows the creation of large number of clones. Preferred display packages include, for example, vegetative bacterial cells, bacterial spores, and most preferably, bacterial viruses (especially DNA viruses). However, the present invention also contemplates the use of eukaryotic cells, including yeast and their spores, as potential display packages. Phage display libraries are described above.
Other techniques include affinity chromatography with an appropriate "receptor", e.g., a target antigen, followed by identification of the isolated binding agents or ligands by conventional techniques (e.g., mass spectrometry and NMR). Preferably, the soluble receptor is conjugated to a label (e.g., fluorophores, colorimetric enzymes, radioisotopes, or luminescent compounds) that can be detected to indicate ligand binding. Alternatively, immobilized compounds can be selectively released and allowed to diffuse through a membrane to interact with a receptor.
Combinatorial libraries of compounds can also be synthesized with "tags" to encode the identity of each member of the library (see, e.g., W.C. Still et al, International Application WO 94/08051 ). In general, this method features the use of inert but readily detectable tags, that are attached to the solid support or to the compounds. When an active compound is detected, the identity of the compound is determined by identification of the unique accompanying tag. This tagging method permits the synthesis of large libraries of compounds which can be identified at very low levels among to total set of all compounds in the library.
The term modified antibody is also intended to include antibodies, such as monoclonal antibodies, chimeric antibodies, and humanized antibodies which have been modified by, e.g., deleting, adding, or substituting portions of the antibody. For example, an antibody can be modified by deleting the hinge region, thus generating a monovalent antibody. Any modification is within the scope of the invention so long as the antibody has at least one antigen binding region specific.
Chimeric mouse-human monoclonal antibodies (i.e., chimeric antibodies) can be produced by recombinant DNA techniques known in the art. For example, a gene encoding the Fc constant region of a murine (or other species) monoclonal antibody molecule is digested with restriction enzymes to remove the region encoding the murine Fc, and the equivalent portion of a gene encoding a human Fc constant region is substituted, (see Robinson et al, International Patent Publication PCT/US86/02269; Akira, et al., European Patent Application 184,187; Taniguchi, M., European Patent Application 171,496; Morrison et al., European Patent Application 173,494; Neuberger et al., International Application WO 86/01533; Cabilly et al. U.S. Patent No. 4,816,567; Cabilly et al.,
European Patent Application 125,023; Better et al. (1988 Science 240:1041-1043); Liu et al. (1987) PNAS 84:3439-3443; Liu et al., 1987, J. Immunol. 139:3521-3526; Sun et al. (1987) PNAS 84:214-218; Nishimura et al., 1987, Cane. Res. 47:999-1005; Wood et al. (1985) Nature 314:446-449; and Shaw et al., 1988, J. Natl Cancer Inst. 80:1553-1559). The chimeric antibody can be further humanized by replacing sequences of the Fv variable region which are not directly involved in antigen binding with equivalent sequences from human Fv variable regions. General reviews of humanized chimeric antibodies are provided by Morrison, S. L., 1985, Science 229:1202-1207 and by Oi et al., 1986, BioTechniques 4:214. Those methods include isolating, manipulating, and expressing the nucleic acid sequences that encode all or part of immunoglobulin Fv variable regions from at least one of a heavy or light chain. Sources of such nucleic acid are well known to those skilled in the art and, for example, may be obtained from 7E3, an anti- GPIIbIIIa antibody producing hybridoma. The recombinant DNA encoding the chimeric antibody, or fragment thereof, can then be cloned into an appropriate expression vector. Suitable humanized antibodies can alternatively be produced by CDR substitution U.S.
Patent 5,225,539; Jones et al. 1986 Nature 321 :552-525; Verhoeyan et al. 1988 Science
239:1534; and Beidler et al. 1988 J. Immunol. 141:4053-4060.
All of the CDRs of a particular human antibody may be replaced with at least a portion of a non-human CDR or only some of the CDRs may be replaced with non-human CDRs. It is only necessary to replace the number of CDRs required for binding of the humanized antibody to the Fc receptor.
An antibody can be humanized by any method, which is capable of replacing at least a portion of a CDR of a human antibody with a CDR derived from a non-human antibody.
Winter describes a method which may be used to prepare the humanized antibodies of the present invention (UK Patent Application GB 2188638A, filed on March 26, 1987), the contents of which is expressly incorporated by reference. The human CDRs may be replaced with non-human CDRs using oligonucleotide site-directed mutagenesis.
Also within the scope of the invention are chimeric and humanized antibodies in which specific amino acids have been substituted, deleted or added. In particular, preferred humanized antibodies have amino acid substitutions in the framework region, such as to improve binding to the antigen. For example, in a humanized antibody having mouse CDRs, amino acids located in the human framework region can be replaced with the amino acids located at the corresponding positions in the mouse antibody. Such substitutions are known to improve binding of humanized antibodies to the antigen in some instances. Antibodies in which amino acids have been added, deleted, or subsituted are referred to herein as modified antibodies or altered antibodies.
Target Antigens
In preferred embodiments, the first member of the fusion proteins of the present invention is a targeting agent, e.g., a polypeptide having a high affinity for a target, e.g., an antibody, a ligand, or an enzyme. Accordingly, the fusion proteins of the invention can be used to selectively direct (e.g., localize) the second member of the fusion protein to the vicinity of an undesirable cell.
For example, the first member can be an immunoglobulin that interacts with (e.g., binds to a target antigen). In certain embodiments, the target antigen is present on the surface of a cell, e.g., an aberrant cell such a hyperproliferative cell (e.g., a cancer cell). Exemplary target antigens include carcinoembryonic antigen (CEA), TAG-72, her-2/neu, epidermal growth factor receptor, transferrin receptor, among others.
As used herein, "target cell" shall mean any undesirable cell in a subject (e.g., a human or animal) that can be targeted by a fusion protein of the invention. Exemplary target cells include tumor cells, such as carcinoma or adenocarcinoma-derived cells (e.g., colon, breast, prostate, ovarian and endometrial cancer cells) (Thor, A. et al. (1997) Cancer Res 46: 3118; Soisson A. P. et al. (1989) Am. J. Obstet. Gynecol: 1258-63). The term "carcinoma" is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, ovarian carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary. The term also includes carcinosarcomas, e.g., which include malignant tumors composed of carcinomatous and sarcomatous tissues. An "adenocarcinoma" refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures. The term "sarcoma" is art recognized and refers to malignant tumors of mesenchymal derivation.
Production of Fusion Proteins
The first and second members of the fusion protein can be linked to each other, preferably via a linker sequence. The linker sequence should separate the first and second members of the fusion protein by a distance sufficient to ensure that each member properly folds into its secondary and tertiary structures. Preferred linker sequences (1) should adopt a flexible extended conformation, (2) should not exhibit a propensity for developing an ordered secondary structure which could interact with the functional first and second members, and (3) should have minimal hydrophobic or charged character, which could promote interaction with the functional protein domains. Typical surface amino acids in flexible protein regions include Gly, Asn and Ser. Permutations of amino acid sequences containing Gly, Asn and Ser would be expected to satisfy the above criteria for a linker sequence. Other near neutral amino acids, such as Thr and Ala, can also be used in the linker sequence.
A linker sequence length of 20 amino acids can be used to provide a suitable separation of functional protein domains, although longer or shorter linker sequences may also be used. The length of the linker sequence separating the first and second members can be from 5 to 500 amino acids in length, or more preferably from 5 to 100 amino acids in length. Preferably, the linker sequence is from about 5-30 amino acids in length. In preferred embodiments, the linker sequence is from about 5 to about 20 amino acids, and is advantageously from about 10 to about 20 amino acids. Amino acid sequences useful as linkers of the first and second member include, but are not limited to, (SerGly4)y wherein y is greater than or equal to 8, or Gly4SerGly5Ser. A preferred linker sequence has the formula (SerGly4)4- Another preferred linker has the sequence ((Ser-Ser-Ser-Ser-Gly)3-
Ser-Pro). The first and second members can be directly fused without a linker sequence.
Linker sequences are unnecessary where the proteins being fused have non-essential N-or
C-terminal amino acid regions which can be used to separate the functional domains and prevent steric interference. In preferred embodiments, the C-terminus of first member can be directly fused to the N-terminus of second, or viceversa.
Recombinant Production
A fusion protein of the invention can be prepared with standard recombinant DNA techniques using a nucleic acid molecule encoding the fusion protein. A nucleotide sequence encoding a fusion protein can be synthesized by standard DNA synthesis methods. A nucleic acid encoding a fusion protein can be introduced into a host cell, e.g., a cell of a primary or immortalized cell line. The recombinant cells can be used to produce the fusion protein. A nucleic acid encoding a fusion protein can be introduced into a host cell, e.g., by homologous recombination. In most cases, a nucleic acid encoding the fusion protein is incorporated into a recombinant expression vector. The nucleotide sequence encoding a fusion protein can be operatively linked to one or more regulatory sequences, selected on the basis of the host cells to be used for expression. The term "operably linked" means that the sequences encoding the fusion protein compound are linked to the regulatory sequence(s) in a manner that allows for expression of the fusion protein. The term "regulatory sequence" refers to promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990), the content of which are incorporated herein by reference. Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells, those that direct expression of the nucleotide sequence only in certain host cells (e.g. , tissue-specific regulatory sequences) and those that direct expression in a regulatable manner (e.g., only in the presence of an inducing agent). It will be appreciated by those skilled in the art that the design of the expression vector may depend on such factors as the choice of the host cell to be transformed, the level of expression of fusion protein desired, and the like. The fusion protein expression vectors can be introduced into host cells to thereby produce fusion proteins encoded by nucleic acids.
Recombinant expression vectors can be designed for expression of fusion proteins in prokaryotic or eukaryotic cells. For example, fusion proteins can be expressed in bacterial cells such as E. coli, insect cells (e.g., in the baculovirus expression system), yeast cells or mammalian cells. Some suitable host cells are discussed further in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Examples of vectors for expression in yeast S. cerevisiae include pYepSecl (Baldari et al, (1987) EMBO J. 6:229-234), pMFa (Kurjan and Herskowitz, (1982) Cell 30:933-943), pJRY88 (Schultz et al, (1987) Gene 54:113-123), and pYES2 (Invirrogen Corporation, San Diego, CA). Baculovirus vectors available for expression of fusion proteins in cultured insect cells (e.g. , Sf 9 cells) include the pAc series (Smith et al. , (1983) Mol. Cell Biol. 3:2156-2165) and the pVL series (Lucklow, V.A., and Summers, M.D., (1989) Virology 170:31-39).
Examples of mammalian expression vectors include pCDM8 (Seed, B., (1987) Nature 329:840) and pMT2PC (Kaufman et al (1987), EMBO J. 6:187-195). When used in mammalian cells, the expression vector's control functions are often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40.
In addition to the regulatory control sequences discussed above, the recombinant expression vector can contain additional nucleotide sequences. For example, the recombinant expression vector may encode a selectable marker gene to identify host cells that have incoφorated the vector. Moreover, to facilitate secretion of the fusion protein from a host cell, in particular mammalian host cells, the recombinant expression vector can encode a signal sequence operatively linked to sequences encoding the amino- terminus of the fusion protein such that upon expression, the fusion protein is synthesized with the signal sequence fused to its amino terminus. This signal sequence directs the fusion protein into the secretory pathway of the cell and is then cleaved, allowing for release of the mature fusion protein (i.e., the fusion protein without the signal sequence) from the host cell. Use of a signal sequence to facilitate secretion of proteins or peptides from mammalian host cells is known in the art. Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection" refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co- precipitation, DEAE-dextran-mediated transfection, lipofection, electroporation, microinjection and viral-mediated transfection. Suitable methods for transforming or transfecting host cells can be found in Sambrook et al (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press (1989)), and other laboratory manuals.
Often only a small fraction of mammalian cells integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene that encodes a selectable marker (e.g., resistance to antibiotics) can be introduced into the host cells along with the gene encoding the fusion protein. Preferred selectable markers include those that confer resistance to drugs, such as G418, hygromycin and methotrexate. Nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as that encoding the fusion protein or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incoφorated the selectable marker gene will survive, while the other cells die).
A recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
Transgenic Mammals
Methods for generating non-human transgenic animals are described herein. DNA constructs can be introduced into the germ line of a mammal to make a transgenic mammal.
For example, one or several copies of the construct can be incoφorated into the genome of a mammalian embryo by standard transgenic techniques. It is often desirable to express the transgenic protein in the milk of a transgenic mammal. Mammals that produce large volumes of milk and have long lactating periods are preferred. Preferred mammals are ruminants, e.g., cows, sheep, camels or goats, e.g., goats of Swiss origin, e.g., the Alpine, Saanen and Toggenburg breed goats. Other preferred animals include oxen, rabbits and pigs.
In an exemplary embodiment, a transgenic non-human animal is produced by introducing a transgene into the germline of the non-human animal. Transgenes can be introduced into embryonal target cells at various developmental stages. Different methods are used depending on the stage of development of the embryonal target cell. The specific line(s) of any animal used should, if possible, be selected for general good health, good embryo yields, good pronuclear visibility in the embryo, and good reproductive fitness.
Introduction of the fusion protein transgene into the embryo can be accomplished by any of a variety of means known in the art such as microinjection, electroporation, or lipofection. For example, a fusion protein transgene can be introduced into a mammal by microinjection of the construct into the pronuclei of the fertilized mammalian egg(s) to cause one or more copies of the construct to be retained in the cells of the developing mammal(s). Following introduction of the transgene construct into the fertilized egg, the egg can be incubated in vitro for varying amounts of time, or reimplanted into the surrogate host, or both. One common method is to incubate the embryos in vitro for about 1-7 days, depending on the species, and then reimplant them into the surrogate host.
The progeny of the transgenically manipulated embryos can be tested for the presence of the construct by Southern blot analysis of a segment of tissue. An embryo having one or more copies of the exogenous cloned construct stably integrated into the genome can be used to establish a permanent transgenic mammal line carrying the transgenically added construct.
Litters of transgenically altered mammals can be assayed after birth for the incoφoration of the construct into the genome of the offspring. This can be done by hybridizing a probe corresponding to the DNA sequence coding for the fusion protein or a segment thereof onto chromosomal material from the progeny. Those mammalian progeny found to contain at least one copy of the construct in their genome are grown to maturity. The female species of these progeny will produce the desired protein in or along with their milk. The transgenic mammals can be bred to produce other transgenic progeny useful in producing the desired proteins in their milk.
Transgenic females may be tested for protein secretion into milk, using an art-known assay technique, e.g., a Western blot or enzymatic assay.
Other Transgenic Animals
Fusion protein can be expressed from a variety of transgenic animals. A protocol for the production of a transgenic pig can be found in White and Yannoutsos, Current Topics in Complement Research: 64th Forum in Immunology, pp. 88-94; US Patent No. 5,523,226; US Patent No. 5,573,933; PCT Application WO93/25071; and PCT Application WO95/04744. A protocol for the production of a transgenic mouse can be found in US Patent No. 5,530,177. A protocol for the production of a transgenic rat can be found in Bader and Ganten, Clinical and Experimental Pharmacology and Physiology, Supp. 3:S81- S87, 1996. A protocol for the production of a transgenic cow can be found in Transgenic Animal Technology, A Handbook, 1994, ed., Carl A. Pinkert, Academic Press, Inc. A protocol for the production of a transgenic sheep can be found in Transgenic Animal Technology, A Handbook, 1994, ed., Carl A. Pinkert, Academic Press, Inc. A protocol for the production of a transgenic rabbit can be found in Hammer et al., Nature 315:680-683, 1985 and Taylor and Fan, Frontiers in Bioscience 2:d298-308, 1997.
Production of Transgenic Protein in the Milk of a Transgenic Animal
Milk Specific Promoters Useful transcriptional promoters are those promoters that are preferentially activated in mammary epithelial cells, including promoters that control the genes encoding milk proteins such as caseins, beta lactoglobulin (Clark et al., (1989) Bio/Technology 1_: 487- 492), whey acid protein (Gorton et al. (1987) Bio/Technology 5: 1183-1187), and lactalbumin (Soulier et al., (1992) FEBS Letts. 297: B). The alpha, beta, gamma or kappa casein gene promoter of any mammalian species can be used to provide mammary expression; a preferred promoter is the goat beta casein gene promoter (DiTullio, (1992) Bio/Technology K):74-77). Milk-specific protein promoter or the promoters that are specifically activated in mammary tissue can be isolated from cDNA or genomic sequences. Preferably, they are genomic in origin. DNA sequence information is available for mammary gland specific genes listed above, in at least one, and often in several organisms. See, e.g., Richards et al., J. Biol. Chem. 256, 526-532 (1981) (α-lactalbumin rat); Campbell et al., Nucleic Acids Res. 12, 8685-8697 (1984) (rat WAP); Jones et al., J. Biol. Chem. 260, 7042-7050 (1985) (rat β- casein); Yu-Lee & Rosen, J Biol. Chem. 258, 10794-10804 (1983) (rat γ-casein); Hall, Biochem. J. 242, 735-742 (1987) (α-lactalbumin human); Stewart, Nucleic Acids Res. 12, 389 (1984) (bovine αsl and K casein cDNAs); Gorodetsky et al., Gene 66, 87-96 (1988) (bovine β casein); Alexander et al., Ewr. J. Biochem. 178, 395-401 (1988) (bovine K casein); Brignon et al., FEBS Lett. 188, 48-55 (1977) (bovine αS2 casein); Jamieson et al, Gene 61, 85-90 (1987), Ivanov et al., Biol. Chem. Hoppe-Seyler 369, 425-429 (1988), Alexander et al., Nucleic Acids Res. 17, 6739 (1989) (bovine β lactoglobulin); Vilotte et al., Biochimie 69, 609-620 (1987) (bovine α-lactalbumin). The structure and function of the various milk protein genes are reviewed by Mercier & Vilotte, J. Dairy Sci. 76, 3079-3098 (1993) (incoφorated by reference in its entirety for all puφoses). If additional flanking sequence are useful in optimizing expression, such sequences can be cloned using the existing sequences as probes. Mammary-gland specific regulatory sequences from different organisms can be obtained by screening libraries from such organisms using known cognate nucleotide sequences, or antibodies to cognate proteins as probes.
Signal Sequences Useful signal sequences are milk-specific signal sequences or other signal sequences which result in the secretion of eukaryotic or prokaryotic proteins. Preferably, the signal sequence is selected from milk-specific signal sequences, i.e., it is from a gene which encodes a product secreted into milk. Most preferably, the milk-specific signal sequence is related to the milk-specific promoter used in the expression system of this invention. The size of the signal sequence is not critical for this invention. All that is required is that the sequence be of a sufficient size to effect secretion of the desired recombinant protein, e.g., in the mammary tissue. For example, signal sequences from genes coding for caseins, e.g., alpha, beta, gamma or kappa caseins, beta lactoglobulin, whey acid protein, and lactalbumin are useful in the present invention. A preferred signal sequence is the goat β-casein signal sequence.
Signal sequences from other secreted proteins, e.g., immunoglobulins, or proteins secreted by liver cells, kidney cell, or pancreatic cells can also be used.
Insulator Sequences The DNA constructs of the invention further comprise at least one insulator sequence. The terms "insulator", "insulator sequence" and "insulator element" are used interchangeably herein. An insulator element is a control element which insulates the transcription of genes placed within its range of action but which does not perturb gene expression, either negatively or positively. Preferably, an insulator sequence is inserted on either side of the DNA sequence to be transcribed. For example, the insulator can be positioned about 200 bp to about 1 kb, 5' from the promoter, and at least about 1 kb to 5 kb from the promoter, at the 3' end of the gene of interest. The distance of the insulator sequence from the promoter and the 3' end of the gene of interest can be determined by those skilled in the art, depending on the relative sizes of the gene of interest, the promoter and the enhancer used in the construct. In addition, more than one insulator sequence can be positioned 5' from the promoter or at the 3' end of the transgene. For example, two or more insulator sequences can be positioned 5' from the promoter. The insulator or insulators at the 3' end of the transgene can be positioned at the 3' end of the gene of interest, or at the 3'end of a 3' regulatory sequence, e.g., a 3' untranslated region (UTR) or a 3' flanking sequence.
A preferred insulator is a DNA segment which encompasses the 5' end of the chicken β-globin locus and corresponds to the chicken 5' constitutive hypersensitive site as described in PCT Publication 94/23046, the contents of which is incoφorated herein by reference. DNA Constructs
A fusion protein can be expressed from a construct which includes a promoter specific for mammary epithelial cells, e.g., a casein promoter, e.g., a goat beta casein promoter, a milk-specific signal sequence, e.g., a casein signal sequence, e.g., a β-casein signal sequence, and a DNA encoding a fusion protein.
A construct can also include a 3' untranslated region downstream of the DNA sequence coding for the non-secreted protein. Such regions can stabilize the RNA transcript of the expression system and thus increases the yield of desired protein from the expression system. Among the 3' untranslated regions useful in the constructs of this invention are sequences that provide a poly A signal. Such sequences may be derived, e.g., from the SV40 small t antigen, the casein 3' untranslated region or other 3' untranslated sequences well known in the art. Preferably, the 3' untranslated region is derived from a milk specific protein. The length of the 3' untranslated region is not critical but the stabilizing effect of its poly A transcript appears important in stabilizing the RNA of the expression sequence. A construct can include a 5' untranslated region between the promoter and the DNA sequence encoding the signal sequence. Such untranslated regions can be from the same control region from which promoter is taken or can be from a different gene, e.g., they may be derived from other synthetic, semi-synthetic or natural sources. Again their specific length is not critical, however, they appear to be useful in improving the level of expression. A construct can also include about 10%, 20%, 30%, or more of the N-terminal coding region of a gene preferentially expressed in mammary epithelial cells. For example, the N-terminal coding region can correspond to the promoter used, e.g., a goat β-casein N- terminal coding region.
Prior art methods can include making a construct and testing it for the ability to produce a product in cultured cells prior to placing the construct in a transgenic animal.
Suφrisingly, the inventors have found that such a protocol may not be of predictive value in determining if a normally non-secreted protein can be secreted, e.g., in the milk of a transgenic animal. Therefore, it may be desirable to test constructs directly in transgenic animals, e.g., transgenic mice, as some constructs which fail to be secreted in CHO cells are secreted into the milk of transgenic animals. Purification from milk
The transgenic fusion protein can be produced in milk at relatively high concentrations and in large volumes, providing continuous high level output of normally processed peptide that is easily harvested from a renewable resource. There are several different methods known in the art for isolation of proteins from milk.
Milk proteins usually are isolated by a combination of processes. Raw milk first is fractionated to remove fats, for example, by skimming, centrifugation, sedimentation (H.E. Swaisgood, Developments in Dairy Chemistry, I: Chemistry of Milk Protein, Applied Science Publishers, NY, 1982), acid precipitation (U.S. Patent No. 4,644,056) or enzymatic coagulation with rennin or chymotrypsin (Swaisgood, ibid.). Next, the major milk proteins may be fractionated into either a clear solution or a bulk precipitate from which the specific protein of interest may be readily purified.
USSN 08/648,235 discloses a method for isolating a soluble milk component, such as a peptide, in its biologically active form from whole milk or a milk fraction by tangential flow filtration. Unlike previous isolation methods, this eliminates the need for a first fractionation of whole milk to remove fat and casein micelles, thereby simplifying the process and avoiding losses of recovery and bioactivity. This method may be used in combination with additional purification steps to further remove contaminants and purify the component of interest.
Production of Transgenic Protein in the Eggs of a Transgenic Animal
A fusion protein can be produced in tissues, secretions, or other products, e.g., an egg, of a transgenic animal. For example, fusion proteins can be produced in the eggs of a transgenic animal, preferably a transgenic turkey, duck, goose, ostrich, guinea fowl, peacock, partridge, pheasant, pigeon, and more preferably a transgenic chicken, using methods known in the art (Sang et al., Trends Biotechnology, 12:415-20, 1994). Genes encoding proteins specifically expressed in the egg, such as yolk-protein genes and albumin-protein genes, can be modified to direct expression of fusion protein. Egg Specific Promoters
Useful transcriptional promoters are those promoters that are preferentially activated in the egg, including promoters that control the genes encoding egg proteins, e.g., ovalbumin, lysozyme and avidin. Promoters from the chicken ovalbumin, lysozyme or avidin genes are preferred. Egg-specific protein promoters or the promoters that are specifically activated in egg tissue can be from cDNA or genomic sequences. Preferably, the egg-specific promoters are genomic in origin.
DNA sequences of egg specific genes are known in the art (see, e.g., Burley et al.,
"The Avian Egg", John Wiley and Sons, p. 472, 1989, the contents of which are incoφorated herein by reference). If additional flanking sequence are useful in optimizing expression, such sequences can be cloned using the existing sequences as probes. Egg specific regulatory sequences from different organisms can be obtained by screening libraries from such organisms using known cognate nucleotide sequences, or antibodies to cognate proteins as probes.
Transgenic Plants
A fusion protein can be expressed in a transgenic organism, e.g., a transgenic plant, e.g., a transgenic plant in which the DNA transgene is inserted into the nuclear or plastidic genome. Plant transformation is known as the art. See, in general, Methods in Enzymology Vol. 153 ("Recombinant DNA Part D") 1987, Wu and Grossman Eds., Academic Press and
European Patent Application EP 693554.
Foreign nucleic acid can be introduced into plant cells or protoplasts by several methods. For example, nucleic acid can be mechanically transferred by microinjection directly into plant cells by use of micropipettes. Foreign nucleic acid can also be transferred into a plant cell by using polyethylene glycol which forms a precipitation complex with the genetic material that is taken up by the cell (Paszkowski et al. (1984) EMBOJ. 3:2712-22).
Foreign nucleic acid can be introduced into a plant cell by electroporation (Fromm et al.
(1985) Proc. Natl. Acad. Sci. USA 82:5824). In this technique, plant protoplasts are electroporated in the presence of plasmids or nucleic acids containing the relevant genetic construct. Electrical impulses of high field strength reversibly permeabihze biomembranes allowing the introduction of the plasmids. Electroporated plant protoplasts reform the cell wall, divide, and form a plant callus. Selection of the transformed plant cells with the transformed gene can be accomplished using phenotypic markers.
Cauliflower mosaic virus (CaMV) can be used as a vector for introducing foreign nucleic acid into plant cells (Hohn et al. (1982) "Molecular Biology of Plant Tumors," Academic Press, New York, pp. 549-560; Howell, U.S. Pat. No. 4,407,956). CaMV viral DNA genome is inserted into a parent bacterial plasmid creating a recombinant DNA molecule which can be propagated in bacteria. The recombinant plasmid can be further modified by introduction of the desired DNA sequence. The modified viral portion of the recombinant plasmid is then excised from the parent bacterial plasmid, and used to inoculate the plant cells or plants.
High velocity ballistic penetration by small particles can be used to introduce foreign nucleic acid into plant cells. Nucleic acid is disposed within the matrix of small beads or particles, or on the surface (Klein et al. (1987) Nature 327:70-73). Although typically only a single introduction of a new nucleic acid segment is required, this method also provides for multiple introductions.
A nucleic acid can be introduced into a plant cell by infection of a plant cell, an explant, a meristem or a seed with Agrobacterium tumefaciens transformed with the nucleic acid. Under appropriate conditions, the transformed plant cells are grown to form shoots, roots, and develop further into plants. The nucleic acids can be introduced into plant cells, for example, by means of the Ti plasmid of Agrobacterium tumefaciens. The Ti plasmid is transmitted to plant cells upon infection by Agrobacterium tumefaciens, and is stably integrated into the plant genome (Horsch et al. (1984) "Inheritance of Functional Foreign Genes in Plants," Science 233:496-498; Fraley et al. (1983) Proc. Natl. Acad. Sci. USA 80:4803).
Plants from which protoplasts can be isolated and cultured to give whole regenerated plants can be transformed so that whole plants are recovered which contain the transferred foreign gene. Some suitable plants include, for example, species from the genera Fragaria, Lotus, Medicago, Onobrychis, Trifolium, Trigonella, Vigna, Citrus, Linum, Geranium, Manihot, Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa, Capsicum, Hyoscyamus, Lycopersicon, Nicotiana, Solanum, Petunia, Digitalis, Majorana, Ciohorium, Helianthus, Lactuca, Bromus, Asparagus, Antirrhinum, Hererocallis, Nemesia, Pelargonium, Panicum, Pennisetum, Ranunculus, Senecio, Salpiglossis, Cucumis, Browaalia, Glycine, Lolium, Zea, Triticum, Sorghum, and Datura. Plant regeneration from cultured protoplasts is described in Evans et al., "Protoplasts
Isolation and Culture," Handbook of Plant Cell Cultures 1 :124-176 (MacMillan Publishing Co. New York 1983); M.R. Davey, "Recent Developments in the Culture and Regeneration of Plant Protoplasts," Protoplasts (1983)-Lecture Proceedings, pp. 12-29, (Birkhauser, Basal 1983); P.J. Dale, "Protoplast Culture and Plant Regeneration of Cereals and Other Recalcitrant Crops," Protoplasts (1983)-Lecture Proceedings, pp. 31-41, (Birkhauser, Basel 1983); and H. Binding, "Regeneration of Plants," Plant Protoplasts, pp. 21-73, (CRC Press, Boca Raton 1985).
Regeneration from protoplasts varies from species to species of plants, but generally a suspension of transformed protoplasts containing copies of the exogenous sequence is first generated. In certain species, embryo formation can then be induced from the protoplast suspension, to the stage of ripening and germination as natural embryos. The culture media can contain various amino acids and hormones, such as auxin and cytokinins. It can also be advantageous to add glutamic acid and proline to the medium, especially for such species as corn and alfalfa. Shoots and roots normally develop simultaneously. Efficient regeneration will depend on the medium, on the genotype, and on the history of the culture. If these three variables are controlled, then regeneration is fully reproducible and repeatable.
In vegetatively propagated crops, the mature transgenic plants can be propagated by the taking of cuttings or by tissue culture techniques to produce multiple identical plants for trialling, such as testing for production characteristics. Selection of a desirable transgenic plant is made and new varieties are obtained thereby, and propagated vegetatively for commercial sale. In seed propagated crops, the mature transgenic plants can be self crossed to produce a homozygous inbred plant. The inbred plant produces seed containing the gene for the newly introduced foreign gene activity level. These seeds can be grown to produce plants that have the selected phenotype. The inbreds according to this invention can be used to develop new hybrids. In this method a selected inbred line is crossed with another inbred line to produce the hybrid.
Parts obtained from a transgenic plant, such as flowers, seeds, leaves, branches, fruit, and the like are covered by the invention, provided that these parts include cells which have been so transformed. Progeny and variants, and mutants of the regenerated plants are also included within the scope of this invention, provided that these parts comprise the introduced DNA sequences. Progeny and variants, and mutants of the regenerated plants are also included within the scope of this invention.
Selection of transgenic plants or plant cells can be based upon a visual assay, such as observing color changes (e.g., a white flower, variable pigment production, and uniform color pattern on flowers or irregular patterns), but can also involve biochemical assays of either enzyme activity or product quantitation. Transgenic plants or plant cells are grown into plants bearing the plant part of interest and the gene activities are monitored, such as by visual appearance (for flavonoid genes) or biochemical assays (Northern blots); Western blots; enzyme assays and flavonoid compound assays, including spectroscopy, see,
Harborne et al. (Eds.), (1975) 77ze Flavonoids, Vols. 1 and 2, [Acad. Press]). Appropriate plants are selected and further evaluated. Methods for generation of genetically engineered plants are further described in US Patent No. 5,283,184, US Patent No. 5, 482,852, and European Patent Application EP 693 554, all of which are hereby incoφorated by reference.
Embodiments of the invention are further illustrated by the following examples which should not be construed as being limiting. The contents of all cited references (including literature references, issued patents, published patent applications, and co- pending patent applications) cited throughout this application are hereby expressly incoφorated by reference.
Examples 1 and 2 below describe the generation of two constructs: a light chain construct and a heavy chain/β-glucuronidase fusion constructs. Two plasmids, one containing a clone of an antibody heavy chain/ human (β-glucuronidase fusion protein and the other containing kappa light chain sequence were received obtained from Behringwerke AG.
EXAMPLE 1 : Construction of Light Chain (LC) Construct
The Example describes the generation of a light chain nucleic acid construct using the light chain nucleotide sequence from a humanized monoclonal antibody against carcinoembryonic antigen (431) subcloned into a mammary specific expression vector
(Be 163) and a commercial mammalian expression vector (pcDNA3). Briefly, a Hind III -Eco Rl fragment containing the light chain sequence was subcloned into pGEM3z to facilitate further manipulation. Two mutations were made: a) To create a Sal I, Xho I, and Kozak consensus sequence at the beginning of the coding region; and b) To creation a Sal I site immediately after the termination codon.
The original construct contained approximately 1300 bases of unknown sequence. To remove the unknown sequences, the Gapped Heteroduplex method was used to create a Sal I site just after the termination codon. Sac I sites just before the termination codon and near the Eco Rl site were used to make the gap, which was filled using Klenow fragment, deoxynucleotides, T4 DNA ligase, and the following oligonucleotide:
TGT TAG AGG TCG ACG CCC CAC (SEQ ID NO:21) term Sal I
The gapped region (through the termination codon and new Sal I site) was then sequenced to confirm that no changes were made in sequence.
A second Nco I site was found in the unknown sequence that was removed for a subsequent step described below. To remove this site, the construct containing the new Sal I site was digested with Eco Rl, ends filled with Klenow fragment and deoxynucleotides, and ligated to a Sal I linker, purchased from New England Biolabs following routine experimental procedures. This construct containing two Sal I sites was then digested with Sal I-and religated, removing the unknown sequence containing the second Nco I site. A Sal I site and Kozak consensus sequence were then inserted immediately before the initial methionine codon (instead of simply changing the Hind III site) because there were several ATG sequences prior to the correct starting codon that could possibly have been used as alternative start sites. While these ATG sequences do not seem to be a problem in tissue culture, the safest route was to remove this region. These ATG sequences were removed by excising the Hind III Nco I site and replacing it with a Hind III —Nco I adapter containing Sal I and Xho I and a Kozak consensus sequence. The replaced region was also confirmed by sequencing.
The sequence changes were as follows:
The original 5' prime region had the nucleotide sequence (ATG sequences are capitalized; ATG corresponding to initial methionine is indicated in bold):
aagctt ATG aat ATG caaatcctgctc ATG aat ATG caaatcctctga atctac ATG gtaaatataggtttgtctataccacaaacagaaaaac ATG agat cacagttctctctacagttactgagcacacaggacctcacc ATG (SEQ ID NO:22)
The original sequence was replace with the following replacement sequence:
Hind III Sal I Xhol
AAGCTT GTCGAC CTCGAG CCACCATG
Kozak (consensus sequence) (SEQ ID NO:23)
The Sal I fragment containing the entire coding region of the light chain was then subcloned into the Xho I site of Be 163, a mammary specific expression vector and pcDNA3, a commercial mammalian expression vector. Orientation was determined by restriction enzyme analysis and/or sequencing. Figure 1A is a schematic diagram of the light chain construct (431 A). The nucleotide and amino acid sequences are shown in Figure IB. Figure 2 depicts the nucleotide sequence for a Sal I insert containing the coding sequences for light chain of humanized anti-carcinoembryonic antigen antibody 431. Shown as Figure 3 is a schematic diagram of a construct (Be 458) which includes the Sal I insert containing the coding sequences for light chain of humanized anti-carcinoembryonic antigen antibody 431. Also indicated is the location of the silencer, 5' β-casein untranslated region, the light chain coding region, and the 3' β-casein untranslated region.
EXAMPLE 2: Construction of Heavy Chain/β-Glucuronidase Fusion Construct
The Example describes the generation of a heavy chain/β-glucuronidase fusion construct using the heavy chain nucleotide sequence from a humanized monoclonal antibody against carcinoembryonic antigen (431) subcloned into a mammary specific expression vector (Bel 63) and a commercial mammalian expression vector (pcDNA3). The Hind III -Xba I fragment containing the heavy chain/β-glucuronidase fusion sequence was subcloned into pGEM3z to facilitate further manipulation. Three mutations were made to the coding region of the heavy chain/β-glucuronidase fusion construct: a) To create a Sal I, Xho I, and Kozak consensus sequence at the beginning of the coding region; b) to change the sequence at the internal Sal I site while retaining thecorrect amino acid sequence; and c) to create a Sal I site immediately after the termination codon.
The signal sequence that was used for the light chain was also used for the heavy chain. Again, the region between the Hind III and Nco I sites was removed and replaced with the same set of oligonucleotides used in the light chain to create a Sal I site and Kozak consensus sequence immediately before the initial methionine codon. (see above).
The internal Sal I site had to be changed for the ptupose of subcloning the fragment into a beta casein expression vector.
Asn Gly Val Asp Thr Leu (SEQ ID NO:24) original sequence AAT GGG GTC GAC ACG CTA (SEQ ID NO:25) new sequence GTG GAT (SEQ ID NO:26) Val Asp
The 3 -prime flanking sequence contained two polyadenylation signal sites and a string of 16 adenine residues between the translational stop codon and the Xba I site. To remove these sequences, a Sal I site was inserted just after the stop codon.
Phe Thr * * * original sequence TTT ACT TGA GCA AGA CTG (SEQ ID NO:27) new sequence TTT ACT TGA GGT CGA CTG (SEQ ID NO:28) Sai l
The Gapped Heteroduplex method was used to make the changes above. The original plan was to gap the DNA between the Not I and Xba I sites and change the internal Sal I site and add the 3-prime Sal I site at the same time. This proved difficult to accomplish so the 3-prime Sal I site was added first and a new gap was made between the two Bgl II sites to change the internal Sal I site. The gapped regions were then sequenced in entirety to confirm that no changes were made to the sequence. The only difference found was in the fourth intron, 1673 bases from the initial ATG. A cytosine was found in both the mutated and the original plasmid instead of adenine, as shown in the printed sequence above. The Sal I fragment containing the entire coding region of the heavy chain ~ glucuronidase fusion protein was then subcloned into the Xho I site of Be 163, a mammary specific expression vector and pcDNA3, a commercial mammalian expression vector. Orientation was determined by restriction enzyme analysis and/or sequencing. Figure 4A is a schematic diagram of the light chain construct (431 A). The nucleotide and amino acid sequences are shown in Figure 4B.
EXAMPLE 3: Generation of Linked Construct
This Example described the generation of a construct which includes the light chain and the heavy chain/β-glucuronidase fusion, along with their corresponding upstream and downstream beta casein sequences ligated together into a single cosmid. In order to eliminate the possibility of integrating only one chain of a two chain protein, such as an antibody, that has been co-injected into mice or other species, both chains along with their own corresponding upstream and downstream beta casein sequences were ligated together into a single cosmid. To achieve this do this supercosl (Stiratagene) was modified by inserting the following oligonucleotides into the Bam HI site:
Pvu I Pvu I
T3... GAT CAC CGA TCG TCG ACC CCC TCG AGC GAT CGA ...TI (SEQ ID NO:29) TG GCT AGC AGC TGG GCG AGC TCG CTA GCT ACT AG (SEQ ID NO:30)
Sal I Xhol
These modifications create a new supercos plamid, designated supercos 334, with unique Sal I and Xho I sites. Pvu I, Not I, and Eco Rl sites flank these sites and the Barn HI site is destroyed.
The Sal I fragments from Bel 74 or Bel 75, containing the modified light chain and heavy chain β-glucuronidase coding regions within the beta casein 5-prime and 3-prime flanking regions respectively, were inserted into the Xho I site of supercos 334. Three clones were isolated and prepared. The orientation was determined by restriction enzyme analysis.
clone # name insert orientation
1 LCI 4 LC reverse
2 LCI 3 LC sense 11 HC9 HC reverse
The complementary Sal I fragments from Be 174 and Be 175 (used above) were then ligated into the Sal I site of the above constructions. (Heavy chain fragment into LCI 3 and LCI 4, light chain fragment into HC9). The resulting ligations were then large enough to package in-vitro into lambda phage particles (Amersham kit N. 334) and were used to infect E. coli XL1 Blue. Three versions were generated and one of each of these clones was isolated and prepared: clone # name insert orientation 1 Bcl80 HC/LC reverse/reverse 9 Bcl81 HC/LC sense /sense 20 Bel 82 LC/HC reverse/reverse
Although made through two different pathways, Bel 81 and Bel 82 are essentially the same insert when cut away from the vector. When viewed in the sense direction, they both contain the heavy chain/β-glucuronidase Sal I cassette followed by and linked to the light chain Sal I cassette. Each Sal I cassette contains the 5-prime beta casein promoter region, the antibody coding region, and the 3-prime beta casein flanking sequence.
In essence, two species were made: the light chain cassette followed by the heavy chain cassette, or the heavy chain cassette followed by the light chain cassette.
EXAMPLE 4: Characterization of the Light Chain and Heavy Chain/b-Glucuronidase Constructs
The manipulated DNA fragments were tested in tissue culture using the pcDNA3 constructs described above transfected into cos 7 cells using the standard protocol for Lipofectamine using Opti-MEM (Gibco-BRL). Conditioned media (DMEM +10%FBS) was removed after 48 hours and run on a 10 -20% SDS-PAGE gels for Western blotting.
Western Blots were conducted following standard procedures, Briefly, for the heavy chain/beta-glucuronidase, samples were run in triplicate under reducing conditions and electroblotted onto nitrocellulose. The nitrocellulose was then cut into three sections and incubated overnight with each of three monoclonal antibodies: Mab 2149/80, Mab 2156/94, and Mab 2156/215. The secondary antibody used for detection was from Cappel (cat. no.
55570 ), affinity purified horse radish peroxidase conjugated goat anti-mouse IgG.
Detection was with the ECL kit from Amersham. Mab 2149/80 was the only antibody that showed a signal on the western blot. For the light chain, samples were again run under reducing conditions and electroblotted onto nitrocellulose. The nitrocellulose was then incubated overnight with horse radish peroxidase conjugated goat anti-human Kappa chain antibody (Cappel no. 55233). Detection was with the ECL kit from Amersham.
EXAMPLE 5: Production of Transgenic Animals
Microinjection fragments were prepared by cutting the beta casein constructs Be 174 (light chain) and Be 175 (heavy chain) with Sal I to release the bacterial sequences. Fragments were gel purified then buffer exchanged and concentrated using the Wizard system by Promega. Microinjections of the original nucleotide sequences were tested in the mouse model system using an expression vector containing the goat beta casein upstream and coding sequences. Two separate constructions were made and co-injected into mouse embryos, from which founder lines were identified and tested further. The original DNA sequences were also co-injected with an "insulator" sequence which allows us to produce a higher percentage of high producing animal lines. For example, without the insulator generally one in three lines would be a relatively high producer. With the insulator, in many cases, almost all of the lines produced are high expressing lines. Two sets of injections were carried out as follows: For the first set of injections, 1249 embryos were injected of which 838 survived, and 737 were transferred to pseudopregnant females. From these females 80 live pups were born, of which 8 were transgenic, 7 of which carried both chains.
For the second set of injections, 508 embryos were injected of which 435 survived, and 426 were transferred to pseudopregnant females. From these females 44 live pups were born of which 2 were transgenic, both of which carried both chains. Bcl81 was injected over three days. In this set, 840 embryos were injected of which
641 survived, and 618 were transferred to pseudopregnant females. From these females 39 live pups were born, of which 5 were transgenic, 3 of which carried both chains. Due to the repetition of the flanking beta casein sequences, it appears that in some cases recombination occurs deleting one chain or the other. Bel 81 was co injected with the silencer fragment over four days. In this case, 1495 goat embryos were injected of which 1183 survived, and 1073 were transferred to pseudopregnant goat females. From these, 111 live pups were born and 10 of these were transgenic, six carrying both chains. Two of the pups carry both the silencer fragment and both antibody chains.
EXAMPLE 5: Generation of Mutants of the Heavy Chain/β-Glucuronidase fusion Protein
In an attempt to increase expression of active molecules, two mutations to the heavy chain fusion protein were carried out. The first mutation was to remove the hinge region of the construct. The second mutation removes the hinge and linker sequence (ala-ala-ala-ala- val) (SEQ ID NO:31) at the beginning of the β-glucuronidase coding sequence, fusing the CH2 portion to β glucuronidase.
To achieve this, gapped heteroduplex mutagenesis was again used. The construct Behring HC5 (which contains the fusion protein in pGem3Z with both ends modified and an internal Sal I site removed) was linearized with (Xba I). A second aliquot was cut with BstE2 plus Not I. When boiled together and cooled some of each strand anneal forming the heteroduplex containing a single stranded gap, in this case between the BstE2 and Not I sites. Two new constructs were then made, sequencing over the gapped portion to make sure no other mutations were made inadvertently.
GTC #403: using the oligonucleotide "Behr hinge-alternate" (in bold below) removes the hinge region and part of the introns immediately preceding and after it.
ccaaactctctactcACTCAGCTCA CGCATCCACCtccatcccagatccccgt (SEQ ID NO:32) intron intron
GTC #406: using the oligonucleotide "Behr hinge/linker" (in bold below) removes the hinge region and ala-ala-ala-ala-val linker, fusing the CH2 and β-glucuronidase coding regions.
agcaacaccaaggtgGACAAGAGAGTT CAGGGCGGGATGctgtacccccaggag
CH2 coding sequence β-glucuronidase (SEQ ID NO: 33) The mutated fusion protein coding sequence can then be excised using Sal I and subcloned into an appropriate expression vector.
High levels of expression of the encoded proteins was obtained with a vector consisting of a silencer (or insulator) fragment followed by the goat beta casein promoter, insert DNA, and goat beta casein 3 prime untranslated regions. Both mutant heavy chains and the light chain have been subcloned into such a vector, Bc450, which is flanked by Sal I sites which release the entire injection fragment.
Bc454: Bc450 with heavy chain mutant 403 (minus hinge) Bc456: Bc450 with heavy chain mutant 406 (minus hinge/linker)
Bc458: Bc450 with the light chain
Figure 5 depicts the nucleotide and amino acid sequence for the mutant heavy chain of humanized anti-carcinoembryonic antigen antibody 431 lacking the hinge region. Figure 6 is a schematic diagram of a construct (Be 454) containing the mutant heavy chain of humanized anti-carcinoembryonic antigen antibody 431 linked to the β- glucuronidase sequence. The location of the silencer, 5' β-casein untranslated region, the heavy chain mutant/ β -glucuronidase fusion coding region, and the 3 ' β-casein untranslated region.
EXAMPLE 6: Characterization of Transgenic Animals
The previous examples describe the testing of the original fusion protein and two heavy chain mutants in the milk expression system. The original fusion proteins were tested both without the insulator and also co injected with a separate insulator fragments. The heavy chain mutants, on the other hand, were tested with the insulator integrated into the construct.
Initially, the concentration of the fusion protein produced in milk was estimated by comparing the signal of a sample to that of a standard on a Western blot. Later, experiments measured activity rather than concentration based on Western blots. The activity measurements were more accurate. Except for the first set of constructs, Bcl74 + Bcl75, estimates of protein concentration by Western blot are rough estimates. Generally, lines that express well appear to be in the 1-2 mg/ml range.
Expression data is summarized below, with more detained data sets for each construct attached.
Essentially the results shown herein indicate that while high levels of protein can be made in milk, most of this protein is not active. Such inactivity may be due to a folding problem or a problem in the assembly of the tetramer. Removal of the hinge and linker also produced a protein with low activity. In contast, substantial amount of enzymatic activity was achieved upon the removal of the hinge alone.
Approximately, 8 mg of this protein have been produced in mouse milk. The isolated protein is currently being tested in in vivo studies ("human CEA positive colon cancer metastasis model").
A summary of the data regarding the mice produced and analysis done follows, in table form.
A. Be 174/175 founders Original DNA without the insulator
n.a. = not analyzed (line carries only one chain)
B. Bel 81 founders
Original DNA without the insulator; a fusion of the Be 174 and Be 175 injection fragments
n.a. = not analyzed
C . Be 181 + insulator founders
Original DNA (fusion of the Be 174 and Be 175 injection fragments) co-injected with the insulator
n.a. = not analyzed
P. Bc456 + Bc458 founders Mutation removing the hinge and linker:
E. Bc454 + Bc458
Mutation removing the hinge only
Example 7: Generation and Characterization of Transgenic Goats
The sections outlined below briefly describe the major steps in the production of transgenic goats.
Goat Species and breeds:
Swiss-origin goats, e.g., the Alpine, Saanen, and Toggenburg breeds, are preferred in the production of transgenic goats.
Goat superovulation:
The timing of estrus in the donors is synchronized on Day 0 by 6 mg subcutaneous norgestomet ear implants (Syncromate-B, CEVA Laboratories, Inc., Overland Park, KS). Prostaglandin is administered after the first seven to nine days to shut down the endogenous synthesis of progesterone. Starting on Day 13 after insertion of the implant, a total of 18 mg of follicle-stimulating hormone (FSH - Schering Coφ., Kenilworth, NJ) is given intramuscularly over three days in twice-daily injections. The implant is removed on Day 14. Twenty-four hours following implant removal the donor animals are mated several times to fertile males over a two-day period (Selgrath, et al., Theriogenology, 1990. pp. 1195-1205).
Embryo collection:
Surgery for embryo collection occurs on the second day following breeding (or 72 hours following implant removal). Superovulated does are removed from food and water
36 hours prior to surgery. Does are administered 0.8 mg/kg Diazepam (Valium®) IV, followed immediately by 5.0 mg/kg Ketamine (Keteset), IV. Halothane (2.5%) is administered during surgery in 2 L/min oxygen via an endotracheal tube. The reproductive tract is exteriorized through a midline laparotomy incision. Coφora lutea, unruptured follicles greater than 6 mm in diameter, and ovarian cysts are counted to evaluate superovulation results and to predict the number of embryos that should be collected by oviductal flushing. A cannula is placed in the ostium of the oviduct and held in place with a single temporary ligature of 3.0 Prolene. A 20 gauge needle is placed in the uterus approximately 0.5 cm from the uterotubal junction. Ten to twenty ml of sterile phosphate buffered saline (PBS) is flushed through the cannulated oviduct and collected in a Petri dish. This procedure is repeated on the opposite side and then the reproductive tract is replaced in the abdomen. Before closure, 10-20 ml of a sterile saline glycerol solution is poured into the abdominal cavity to prevent adhesions. The linea alba is closed with simple interrupted sutures of 2.0 Polydioxanone or Supramid and the skin closed with sterile wound clips.
Fertilized goat eggs are collected from the PBS oviductal flushings on a stereomicroscope, and are then washed in Ham's F12 medium (Sigma, St. Louis, MO) containing 10% fetal bovine serum (FBS) purchased from Sigma. In cases where the pronuclei are visible, the embryos is immediately microinjected. If pronuclei are not visible, the embryos can be placed in Ham's F12 containing 10% FBS for short term culture at 37°C in a humidified gas chamber containing 5% CO2 in air until the pronuclei become visible (Selgrath, et al., Theriogenology, 1990. pp. 1195-1205).
Microinjection procedure:
One-cell goat embryos are placed in a microdrop of medium under oil on a glass depression slide. Fertilized eggs having two visible pronuclei are immobilized on a flame- polished holding micropipet on a Zeiss upright microscope with a fixed stage using Normarski optics. A pronucleus is microinjected with the DNA construct of interest, e.g., a BC355 vector containing the fusion protein gene operably linked to the regulatory elements of the goat beta-casein gene, in injection buffer (Tris-EDTA) using a fine glass microneedle (Selgrath, et al., Theriogenology, 1990. pp. 1195-1205).
Embryo development:
After microinjection, the surviving embryos are placed in a culture of Ham's F12 containing 10% FBS and then incubated in a humidified gas chamber containing 5% CO2 in air at 37°C until the recipient animals are prepared for embryo transfer (Selgrath, et al., Theriogenology, 1990. p. 1195-1205). Preparation of recipients:
Estrus synchronization in recipient animals is induced by 6 mg norgestomet ear implants (Syncromate-B). On Day 13 after insertion of the implant, the animals are given a single non-superovulatory injection (400 LU.) of pregnant mares serum gonadotropin (PMSG) obtained from Sigma. Recipient females are mated to vasectomized males to ensure estrus synchrony (Selgrath, et al., Theriogenology, 1990. pp. 1195-1205).
Embryo Transfer:
All embryos from one donor female are kept together and transferred to a single recipient when possible. The surgical procedure is identical to that outlined for embryo collection outlined above, except that the oviduct is not cannulated, and the embryos are transferred in a minimal volume of Ham's F12 containing 10% FBS into the oviductal lumen via the fimbria using a glass micropipet. Animals having more than six to eight ovulation points on the ovary are deemed unsuitable as recipients. Incision closure and post-operative care are the same as for donor animals (see, e.g., Selgrath, et al., Theriogenology, 1990. pp. 1195-1205).
Monitoring of pregnancy and parturition:
Pregnancy is determined by ultrasonography 45 days after the first day of standing estrus. At Day 110 a second ultrasound exam is conducted to confirm pregnancy and assess fetal stress. At Day 130 the pregnant recipient doe is vaccinated with tetanus toxoid and Clostridium C&D. Selenium and vitamin E (Bo-Se) are given IM and Ivermectin was given SC. The does are moved to a clean stall on Day 145 and allowed to acclimatize to this environment prior to inducing labor on about Day 147. Parturition is induced at Day 147 with 40 mg of PGF2a (Lutalyse®, Upjohn Company, Kalamazoo Michigan). This injection is given IM in two doses, one 20 mg dose followed by a 20 mg dose four hours later. The doe is under periodic observation during the day and evening following the first injection of
Lutalyse® on Day 147. Observations are increased to every 30 minutes beginning on the morning of the second day. Parturition occurred between 30 and 40 hours after the first injection. Following delivery the doe is milked to collect the colostrum and passage of the placenta is confirmed.
Verification of the transgenic nature of Fp animals: To screen for transgenic FQ animals, genomic DNA is isolated from two different cell lines to avoid missing any mosaic transgenics. A mosaic animal is defined as any goat that does not have at least one copy of the transgene in every cell. Therefore, an ear tissue sample (mesoderm) and blood sample are taken from a two day old Fø animal for the isolation of genomic DNA (Lacy, et al., A Laboratory Manual, 1986, Cold Springs Harbor, NY; and Herrmann and Frischauf, Methods Enzymology, 1987. 152: pp. 180-183). The DNA samples are analyzed by the polymerase chain reaction (Gould, et al., Proc. Natl. Acad. Sci, 1989. 86:pp. 1934-1938) using primers specific for the fusion protein gene and by Southern blot analysis (Thomas, Proc Natl. Acad. Sci., 1980. 77:5201-5205) using a random primed first member or second member cDNA probe (Feinberg and Vogelstein, Anal Bioc, 1983. 132: pp. 6-13). Assay sensitivity is estimated to be the detection of one copy of the transgene in 10% of the somatic cells.
Generation and Selection of production herd
The procedures described above can be used for production of transgenic founder (FQ) goats, as well as other transgenic goats. The transgenic FQ founder goats, for example, are bred to produce milk, if female, or to produce a transgenic female offspring if it is a male founder. This transgenic founder male, can be bred to non-transgenic females, to produce transgenic female offspring.
Transmission of transgene and pertinent characteristics
Transmission of the transgene of interest, in the goat line is analyzed in ear tissue and blood by PCR and Southern blot analysis. For example, Southern blot analysis of the founder male and the three transgenic offspring shows no rearrangement or change in the copy number between generations. The Southern blots are probed with immunoglobulin- enzyme fusion protein cDNA probe. The blots are analyzed on a Betascope 603 and copy number determined by comparison of the transgene to the goat beta casein endogenous gene.
Evaluation of expression levels The expression level of the transgenic protein, in the milk of transgenic animals, is determined using enzymatic assays or Western blots.
Other embodiments are within the following claims.

Claims

What is claimed is:
1. A method of making a fusion protein having: a first member, fused to a second member wherein the first and second members are chosen such that the fusion protein assembles into a complex having a number of subunits which optimizes activity of the multimeric form of the second member.
2. The method of claim 1 , wherein the first member, or the fusion protein, assembles into a form having the same number of subunits as are present in an active form of the second member.
3. The method of claim 1, wherein the first member includes an Ig subunit.
4. The method of claim 1 , wherein the second member, is other than an Ig subunit.
5. The method of claim 1 , wherein the first member is has been modified at a site which modulates formation or maintenance of a multimer of subunits.
6. The method of claim 1, wherein the first member forms a dimmer.
7. The method of claim 1, wherein the first member includes an Ig subunit, which has been modified to inhibit formation of a multimeric form.
8. The method of claim 7, wherein the modification is a change, insertion, or deletion of one or more amino acid residues, and results in a subunit which does not form a multimer or which forms a lower order multimer that it normally would form.
9. The method of claim 7, wherein hinge region of the immunoglobulin is modified.
10. The method of claim 7, wherein the modification results in a dimeric Ig structure.
11. The method of claim 10, wherein the dimer includes a heavy chain fusion and a light chain fusion.
12. The method of claim 1 , wherein the second member includes beta- glucuronidase.
13. The method of claim 1 , wherein the first member is an immunoglobulin (Ig) heavy of light chain, and the second member is human beta-glucuronidase fusion protein.
14. The method of claim 1 , wherein the fusion protein is produced in a transgenic animal.
15. A method for providing a transgenically produced fusion protein of claim 1 , comprising obtaining milk from a transgenic mammal, which includes a fusion protein encoding transgene that result in the expression of the protein-coding sequence of fusion protein in mammary gland epithelial cells, thereby secreting the fusion protein in the milk of the mammal.
16. A nucleic acid construct, which includes: (a) optionally, an insulator sequence;
(b) a promoter, e.g., a mammary epithelial specific promoter, e.g., a milk protein promoter;
(c) a nucleotide sequence which encodes a signal sequence which can direct the secretion of the fusion protein, e.g. a signal sequence from a milk specific protein, or an immunoglobulin; (d) optionally, a nucleotide sequence which encodes a sufficient portion of the amino terminal coding region of a secreted protein, e.g. a protein secreted into milk, or an immunoglobulin, to allow secretion, e.g., in the milk of a transgenic mammal, of the fusion protein protein; (e) one or more nucleotide sequences which encode a fusion protein, e.g., a fusion protein as described herein; and
(f) optionally, a 3' untranslated region from a mammary epithelial specific gene, e.g., a milk protein gene.
17. A nucleic acid construct, which includes a nucleic acid molecule encoding a fusion protein of claim 1.
18. A fusion protein described in claim 1.
19. A transgenic animal which includes a transgene that encodes a fusion protein of claim 1.
EP00963585A 1999-09-17 2000-09-18 UNDER UNITS OPTIMIZED FUSION PROTEINS Withdrawn EP1237900A4 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US399079 1995-03-08
US39907999A 1999-09-17 1999-09-17
PCT/US2000/025558 WO2001019842A1 (en) 1999-09-17 2000-09-18 Subunit optimized fusion proteins

Publications (2)

Publication Number Publication Date
EP1237900A1 EP1237900A1 (en) 2002-09-11
EP1237900A4 true EP1237900A4 (en) 2005-08-03

Family

ID=23578058

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00963585A Withdrawn EP1237900A4 (en) 1999-09-17 2000-09-18 UNDER UNITS OPTIMIZED FUSION PROTEINS

Country Status (14)

Country Link
EP (1) EP1237900A4 (en)
JP (1) JP2003509038A (en)
KR (1) KR20020039346A (en)
CN (1) CN1379782A (en)
AU (1) AU781462B2 (en)
BR (1) BR0014524A (en)
CA (1) CA2384766A1 (en)
HU (1) HUP0202702A2 (en)
IL (1) IL148549A0 (en)
MX (1) MXPA02002768A (en)
NO (1) NO20021244L (en)
NZ (1) NZ517774A (en)
RU (1) RU2002110116A (en)
WO (1) WO2001019842A1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030035798A1 (en) 2000-08-16 2003-02-20 Fang Fang Humanized antibodies
EP1578917A4 (en) 2001-07-19 2008-01-23 Perlan Therapeutics Inc Multimeric proteins and methods of making and using same
CA2929846C (en) * 2013-11-19 2020-09-15 Regeneron Pharmaceuticals, Inc. Non-human animals having a humanized b-cell activating factor gene

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995027782A1 (en) * 1994-04-08 1995-10-19 Ppl Therapeutics (Scotland) Ltd Peptide production as fusion protein in transgenic mammal milk
WO1998037224A1 (en) * 1997-02-25 1998-08-27 Genzyme Transgenics Corporation Transgenically produced non-secreted proteins
WO1998050563A1 (en) * 1997-05-01 1998-11-12 Ppl Therapeutics (Scotland) Ltd. Methods of production of an amidated peptide through the use of a fusion protein
US5959171A (en) * 1994-08-17 1999-09-28 Pharming B.V. Method for the production of biologically active polypeptides in a mammal's
WO1999066054A2 (en) * 1998-06-15 1999-12-23 Genzyme Transgenics Corp. Erythropoietin analog-human serum albumin fusion protein

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL111748A0 (en) * 1993-12-03 1995-01-24 Zeneca Ltd Proteins
US5635363A (en) * 1995-02-28 1997-06-03 The Board Of Trustees Of The Leland Stanford Junior University Compositions and methods for the detection, quantitation and purification of antigen-specific T cells

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995027782A1 (en) * 1994-04-08 1995-10-19 Ppl Therapeutics (Scotland) Ltd Peptide production as fusion protein in transgenic mammal milk
US5959171A (en) * 1994-08-17 1999-09-28 Pharming B.V. Method for the production of biologically active polypeptides in a mammal's
WO1998037224A1 (en) * 1997-02-25 1998-08-27 Genzyme Transgenics Corporation Transgenically produced non-secreted proteins
WO1998050563A1 (en) * 1997-05-01 1998-11-12 Ppl Therapeutics (Scotland) Ltd. Methods of production of an amidated peptide through the use of a fusion protein
WO1999066054A2 (en) * 1998-06-15 1999-12-23 Genzyme Transgenics Corp. Erythropoietin analog-human serum albumin fusion protein

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
LEE S H ET AL: "Production of biomedical proteins in the milk of transgenic dairy cows: the state of the art", JOURNAL OF CONTROLLED RELEASE, ELSEVIER SCIENCE PUBLISHERS B.V. AMSTERDAM, NL, vol. 29, 1994, pages 213 - 221, XP002120416, ISSN: 0168-3659 *
NEWTON D L ET AL: "ANTITRANSFERRIN RECEPTOR ANTIBODY-RNASE FUSION PROTEIN EXPRESSED INTHE MAMMARY GLAND OF TRANSGENIC MICE", JOURNAL OF IMMUNOLOGICAL METHODS, ELSEVIER SCIENCE PUBLISHERS B.V.,AMSTERDAM, NL, vol. 231, 1999, pages 159 - 167, XP002934495, ISSN: 0022-1759 *
See also references of WO0119842A1 *

Also Published As

Publication number Publication date
WO2001019842A9 (en) 2002-11-14
RU2002110116A (en) 2004-03-10
AU781462B2 (en) 2005-05-26
CA2384766A1 (en) 2001-03-22
IL148549A0 (en) 2002-09-12
EP1237900A1 (en) 2002-09-11
NO20021244D0 (en) 2002-03-13
HUP0202702A2 (en) 2002-12-28
BR0014524A (en) 2002-06-11
NO20021244L (en) 2002-05-13
JP2003509038A (en) 2003-03-11
KR20020039346A (en) 2002-05-25
WO2001019842A1 (en) 2001-03-22
AU3883101A (en) 2001-04-17
NZ517774A (en) 2005-01-28
MXPA02002768A (en) 2002-08-30
CN1379782A (en) 2002-11-13

Similar Documents

Publication Publication Date Title
US6548653B1 (en) Erythropoietin analog-human serum albumin fusion
US20090246194A1 (en) ERYTHROPOIETIN ANALOG-IgG FUSION PROTEINS
US20060026695A1 (en) Transgenically produced fusion proteins
AU782840B2 (en) Transgenically produced fusion proteins
US6545198B1 (en) Transgenically produced prolactin
US20050160483A1 (en) Transgenically produced decorin
AU2001259465A1 (en) Transgenically produced decorin
AU781462B2 (en) Subunit optimized fusion proteins
EP1012233A1 (en) Transgenically produced prolactin

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020417

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: GTC BIOTHERAPEUTICS, INC.

A4 Supplementary search report drawn up and despatched

Effective date: 20050621

RIC1 Information provided on ipc code assigned before grant

Ipc: 7C 12N 15/70 B

Ipc: 7C 07K 14/00 B

Ipc: 7C 12N 5/00 B

Ipc: 7C 12N 5/02 B

Ipc: 7C 07H 21/02 B

Ipc: 7C 07K 1/00 B

Ipc: 7C 07H 21/04 A

Ipc: 7C 12N 15/63 B

Ipc: 7C 12N 15/00 B

Ipc: 7C 12N 15/74 B

Ipc: 7C 12N 15/09 B

17Q First examination report despatched

Effective date: 20050920

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20070717