EP1234037A2 - DNA ENCODING A NOVEL PROST-Ets POLYPEPTIDE - Google Patents
DNA ENCODING A NOVEL PROST-Ets POLYPEPTIDEInfo
- Publication number
- EP1234037A2 EP1234037A2 EP00992356A EP00992356A EP1234037A2 EP 1234037 A2 EP1234037 A2 EP 1234037A2 EP 00992356 A EP00992356 A EP 00992356A EP 00992356 A EP00992356 A EP 00992356A EP 1234037 A2 EP1234037 A2 EP 1234037A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- polypeptide
- ets
- seq
- prost
- ammo acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
- A61K47/6843—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a material from animals or humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/08—Drugs for disorders of the urinary system of the prostate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- This invention relates, in part, to newly identified polynucleotides and polypeptides, variants and derivatives of the polynucleotides and polypeptides, methods of making the polynucleotides and polypeptides, and their variants and derivatives, antibodies directed toward the polypeptides, their variants and derivatives, and uses of the polynucleotides, polypeptides, variants, derivatives and antibodies
- the invention relates to novel PROST-Ets polypeptides, polynucleotides which encode these polypeptides, antibodies directed toward these polypeptides, and antisense polynucleotides that block
- Prostate cancer is a frequently occurring disease in man, in that it is found in about one third of men over the age of 45
- genetic and environmental causes with the majority of cases probably being the result of a combination of both factors
- prostatic intraepithelial neoplasia PIN
- early stages of the disease are androgen dependent, while later stages are hormone independent
- a proliferative disorder of the prostate known as benign prostatic hyperplasia is often detected clinically but is probably not a stage in the development of cancer It is, however, frequently associated with prostate cancer Cancers in the prostate are often multifocal, generally slow growing, and heterogeneous Late stage cancers frequently metastasize to the lymph nodes and to the bone
- Prostate cancer is usually diagnosed by physical examination and by serum levels of prostate specific antigen (PSA) Radical prostatectomy is the treatment of choice for localized disease Advanced metastatic disease is treated currently by androgen ablation induced by orchiectomy or treatment with GnRH (gonadotrophin releasing hormone), and by anti-androgen therapy However, advanced disease almost invariably becomes hormone resistant and there is no cure for progressive disease Moreover, there are serious side effects associated with both radical prostatectomy and androgen ablation therapy These include a high risk of incontinence and impotence associated with radical prostatectomy and bone fractures and osteoporosis associated with androgen ablation therapy
- This invention discloses a new transcription factor that is a homologue to the Ets family of proteins This homologue, designated PROST-Ets, is differentially expressed in prostate and breast tissue as compared with other tissues, and may be over-expressed in prostate, breast, and ovarian tumors
- the invention also discloses agents that reduce the levels of PROST-Ets in tumor cells, thereby inhibiting their growth Such agents, therefore, may be valuable therapeutic agents for prostate, breast, ovarian, and other cancers
- Ets genes encodes transcription factors that share a highly conserved DNA binding domain, the Ets domain
- the first Ets gene was originally identified as a viral oncogene in the E26 chicken leukemia virus genome, and numerous cellular homologues spanning organisms from Drosophila to human have been identified Currently, at least 30 different Ets genes are known in vertebrates Important roles for Ets proteins in the regulation of proliferation, transformation, differentiation and apoptosis have been identified (Dittmar and Nordheim, Biochem Biophys Acta 1377 F1 -F1 1 , 1988)
- Ets proteins are characterized by a highly conserved DNA binding domain, the Ets domain, composed of about 85 ammo acids This Ets domain bears structural similarity to the winged helix-tum-helix set of DNA binding proteins
- the Ets domain binds to a core recognition motif, 5' -GGA(A T)-3' , that is found in all Ets regulated promoters that have been studied to date There is additional preference for nucleotide binding in the DNA flanking the core recognition motif
- the Ets domain may be found close to either the N-terminus, the central region, or close to the C-terminus of the protein
- a second domain that has been found in many Ets genes codes for another highly conserved domain, known as the PNT or pointed domain
- the pointed domain functions in protein
- Ets protein activity Another mechanism of regulating Ets protein activity is through auto inhibition by inhibitory sequences flanking the Ets domains that negatively regulate DNA binding This phenomenon has been defined for several Ets proteins and constitutes one of the ways in which Ets functions can be modulated by derepression This may also explain the molecular actions of Ets activating factors
- Ets-1 and Ets-2 two human transcription factors, has been directly implicated in tumongenicity and in invasion in many sarcoma and carcinoma cell lines
- uPA urokinase plasminogen activator
- Ets-1 activity has also been correlated with tumongenicity in gastric and pancreatic cancer (Vandenbunder et al , Invasion and Metastasis 14 198-209, 1994)
- Growth factors including EGF and FGF promote Ets-1 and Ets-2 expression, leading to activation of uPA and matrix metalloproteinase promoters by Ets proteins in conjunction with other transcription factors (Chen et al , Cancer Res 57 2009-2013, 1997)
- Ets binding sites and hormonal response elements have been identified in the promoter of the maspin gene This is a tumor suppressing protease inhibitor expressed in the prostate and breast Its regulation by Ets proteins again implicates this family of transcription factors in the tumorigenic process (Sementchenko et al , Oncogene 17 2883-2888, 1998, Oettgen et al , J Biol Chem 275 1216-1225 2000)
- the present invention provides a polynucleotide sequence which uniquely encodes a novel transcription factor designated herein as PROST-Ets
- PROST-Ets polypeptide is characterized by a pointed domain, involved with protein-protein interactions, at ammo acids 131 to 213, and an Ets domain, involved with DNA binding, at ammo acids 246 to 332 both of which are general structural characteristics of the Ets family of proteins
- PROST-Ets shows homology to several members of the Ets family of transcription factors with approximately a 74% homology over 87 ammo acids with Drosophila Ets-4
- the polynucleotide sequence, designated herein as prost-ets, and described herein in Figure 1 (SEQ ID NO 1 ) encodes the ammo acid sequence for PROST-Ets, which is shown in Figure 2 (SEQ ID NO 2)
- polypeptides inter alia, that have been identified as novel Ets-like transcription factors, by homology between the am o acid sequence set out in Figure 2 (SEQ ID NO 2) and known ammo acid sequences of other Ets-like transcription factor polypeptides
- polynucleotides that encode such polypeptides particularly polynucleotides that encode the polypeptide designated herein as PROST-Ets
- isolated polynucleotides encoding PROST-Ets including mRNAs, cDNAs, genomic DNAs and, in further embodiments of this aspect of the invention, biologically diagnostically, clinically or therapeutically useful variants, analogs or derivatives thereof, or fragments thereof, including fragments of the variants, analogs and de ⁇ vatives
- novel polypeptides of human origin referred to herein as PROST-Ets as well as biologically, diagnostically or therapeutically useful fragments, variants and derivatives thereof, variants and derivatives of the fragments, and analogs of the foregoing
- methods of producing the aforementioned PROST- Ets polypeptides comprising culturing host cells having expressibly incorporated therein an exogenously-derived PROST-Ets-encodmg polynucleotide under conditions for expression of human PROST-Ets in the host and then recovering the expressed polypeptide
- products, compositions and methods for assessing PROST-Ets expression in cells by determining PROST-Ets polypeptides or PROST-Ets-encodmg mRNA, and assaying genetic variation and aberrations, such as defects, in genes for PROST-Ets
- probes that hybridize to prost-ets polynucleotide sequences
- antibodies which are highly selective for PROST-Ets polypeptides, or fragments thereof, and which may be employed in a method for diagnosis and/or detection of PROST-Ets expression, which may be associated with prostate cancer
- antibodies are labeled in such a way as to produce a detectable signal
- Particularly preferred would be an antibody labeled with a radiolabel, an enzyme, a chromophore or a fluorescer
- therapeutic agents which are cytotoxic
- PROST-Ets activity or expression such as prostate cancer
- peptides and anti-idiotypic antibodies are provided which can be used to stimulate an immune response
- compositions comprising a prost-ets polynucleotide or a PROST-Ets polypeptide for administration to cells in vitro, to cells ex vivo and to cells in vivo, or to a multicellular organism
- the compositions comprise a prost-ets polynucleotide for expression of a PROST-Ets poly
- FIGURE 1 Polynucleotide sequence of prost-ets (SEQ ID NO 1 ), which encodes the biologically or immunologically active form of PROST-Ets
- FIGURE 2 Deduced ammo acid sequence of the active form of PROST-Ets (SEQ ID NO 2) The pointed (aa 131-213) and Ets (aa 246-332) domains within the sequence are underlmed
- FIGURE 3 Ammo acid alignment of PROST-Ets with the sequence of Drosophila D- Ets-4 The sequence of PROST-Ets is on the top
- FIGURE 4 Predicted domain structure of PROST-Ets protein
- FIGURE 5 Expression of prost-ets mRNA in human tissues by northern blot analysis RNA from human tissues, both tumor and normal, and human cell lines was examined for hybridization of prost-ets mRNA to a radiolabelled probe An mRNA species of 2 4 Kb in size was detected at a high level in prostate and at lower levels in colon and small intestine No expression was detected in the other tissues examined
- FIGURE 6 Expression of prost-ets mRNA in human tissues by Taqman based PCR analysis RNA from human tissues, both tumor and normal, was isolated by standard techniques Primers and probe to detect prost-ets mRNA expression were designed using Perkm Elmer's Primer Express software and synthesized by Synthetic Genetics Prost-ets mRNA was detected in human prostate tissues, both tumor and normal, and in lower levels in breast tissue, but could not be detected in other normal and tumor tissues
- FIGURE 7 Immunoreactivity of PROST-Ets synthesized in bacteria Antisera generated against synthetic PROST-Ets sequences (see Example 4) was used in Western blot analysis of PROST-Ets expressed in E co
- FIGURE 8 Effect of specific reduction of prost-ets mRNA expression on prostate tumor cell growth
- Three antisense o gonucleotides (13594, 13595, 13642) targeted to prost- ets sequences were utilized (in the form of RNA DNA hybrid molecules) to determine the effect of specific reduction of prost-ets mRNA in the PROST-Ets-expressing PC3 human prostate cell line Mismatched antisense molecules were used as controls and GBC 3 3 is a non-specific antisense control Nuclear area is proportional to cell number
- FIGURE 9 Growth inhibition of PC3 cells by inducible antisense messages
- PC3 cell lines were transfected with vectors containing PROST-Ets antisense messages (see Example 6) and were treated with doxycyclme to induce transcription of the antisense ohgonucleotides
- Cell growth was measured following treatment and demonstrated antisense specific inhibition of growth
- the antisense molecules used were cDNA , a full-length antisense molecule, 5utr, a 5' antisense molecule, and 3utr, a 3' antisense molecule DETAILED DESCRIPTION OF THE INVENTION
- PROST-Ets refers to the polypeptide having the ammo acid sequence set out in Figure 2 (SEQ ID NO 2), variants, analogs, derivatives and fragments thereof, and fragments of the variants, analogs and derivatives.
- fragment when referring to the polypeptide of Figure 2 (SEQ ID NO 2) mean a polypeptide which retains essentially the same biological and/or immunological activity as the polypeptide of Figure 2
- prost-ets refers to the polynucleotide having the sequence set out in Figure 1 (SEQ ID NO 1 ) and polynucleotides encoding polypeptides having the ammo acid sequence of PROST-Ets set out in Figure 2 (SEQ ID NO 2), and to polynucleotides encoding PROST-Ets variants, analogs, derivatives and fragments, and fragments of the variants analogs and de ⁇ vatives Prost-ets also refers to such polynucleotides composed of RNA as well as to polynucleotides which are the complement of polynucleotides which encode the polypeptide sequence set out in Figure 2 (SEQ ID NO 2)
- Polynucleot ⁇ de(s) generally refers to any poly ⁇ bonucleotide or polydeox ⁇ bonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA
- polynucleotides as used herein refers to, among others, smgle-and double- stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double- stranded or a mixture of single- and double-stranded regions
- polynucleotide as used herein refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA The strands in such regions may be from the same molecule or from different molecules The regions may include all of one or more of the molecules, but more typically involve only a region of some of the molecules One of the molecules of a triple-helical region often is an o gonucleotide
- polynucleotide includes DNAs or RNAs as described above that contain one or more modified bases
- DNAs or RNAs with backbones modified for stability or for other reasons are “polynucleotides” as that term is intended herein
- DNAs or RNAs comprising unusual bases such as mosine, or modified bases, such as t ⁇ tium- labelled bases, to name just two examples are polynucleotides as the term is used herein
- polynucleotide as it is employed herein embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including simple and complex cells, inter alia
- Polypeptides includes all polypeptides as described below The basic structure of polypeptides is well known and has been described in innumerable textbooks and other publications in the art In this context, the term is used herein to refer to any peptide or protein comprising two or more am o acids joined to each other in a linear chain by peptide bonds As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types It will be appreciated that polypeptides often contain ammo acids other than the 20 ammo acids commonly referred to as the 20 naturally occurring ammo acids, and that many ammo acids, including the terminal ammo acids, may be modified in a given polypeptide, either by natural processes such as glycosylation and other post-translational modifications, or by chemical modification techniques which are well known in the art Even
- polypeptides are not always entirely linear
- polypeptides may be branched as a result of ubiquitmation, and they may be circular, with or without branching, generally as a result of posttranslational events, including natural processing events and events brought about by human manipulation which do not occur naturally Circular, branched and branched circular polypeptides may be synthesized by non-translational natural processes and by entirely synthetic methods, as well
- Modifications can occur anywhere in a polypeptide, including the peptide backbone, the am o acid side-chains and the ammo or carboxyl termini
- blockage of the ammo or carboxyl group in a polypeptide, or both, by a covalent modification is common in naturally occurring and synthetic polypeptides and such modifications may be present in polypeptides of the present invention, as well
- the ammo terminal residue of polypeptides made in E coli, prior to proteolytic processing almost invariably will be N-formylmethionine
- polypeptides made by expressing a cloned gene in a host for instance, the nature and extent of the modifications in large part will be determined by the host cell posttranslational modification capacity and the modification signals present in the polypeptide ammo acid sequence
- glycosylation often does not occur in bacterial hosts such as E coli
- a polypeptide should be expressed in a glycosylatmg host, generally a eukaryotic cell Insect cells often carry out the same posttranslational glycosylations as mammalian cells and, for this reason, insect cell expression systems have been developed to efficiently express mammalian proteins having native patterns of glycosylation, inter alia Similar considerations apply to other modifications
- polypeptide encompasses all such modifications particularly those that are present in polypeptides synthesized by expressing a polynucleotide in a host cell
- Polynucleotide encoding a polypeptide encompasses polynucleotides which include a sequence encoding a polypeptide of the present invention, particularly the PROST-Ets polypeptide having the ammo acid sequence set out in Figure 2 (SEQ ID NO 2)
- the term encompasses polynucleotides that include a single continuous region or discontinuous regions encoding the polypeptide (for example, interrupted by introns) together with additional regions
- Bioactivity refers to the structural, regulatory or biochemical functions of naturally occurring PROST-Ets polypeptide
- Immunologic activity refers to the capability of the natural, recombinant or synthetic PROST-Ets, or any fragment thereof, to induce a specific immune response in appropriate animals or cells and to bind with specific antibodies
- Oligonucleot ⁇ de(s) refers to relatively short polynucleotides Often the term refers to single-stranded deoxyr ibonucleotides but it can refer as well to single- or double-stranded ⁇ bonucleotides, RNA DNA hybrids and double-stranded DNAs, among others
- Ohgonucleotides, such as single-stranded DNA probe ohgonucleotides often are synthesized by chemical methods, such as those implemented on automated ohgonucleotide synthesizers
- ohgonucleotides can be made by a variety of other methods, including in vitro recombinant DNA-mediated techniques and by expression of DNAs in cells and organisms
- “Ohgonucleotides” or “ohgomers” or polynucleotide “fragment”, “portion”, or “segment” refers to a polynucleotide sequence of at least about 10 nucleotides and as many as about 60 nucleotides, preferably about 15 to 30 nucleotides, and more preferably about 20-25 nucleotides
- Non- occurring PROST-Ets refers to PROST-Ets produced by human cells that have not been genetically engineered and specifically contemplates various PROST-Ets forms arising from post-translational modifications of the polypeptide including but not limited to acetylation, carboxylation, glycosylation, phosphorylation, hpidation, acylation, and cleavage "Var ⁇ ant(s)" of polynucleotides or polypeptides, as the term is used herein, are polynucleotides or polypeptides that differ from a reference polynucleotide or polypeptide, respectively Variants in this sense are described below and elsewhere in the present disclosure in greater detail
- changes in the polynucleotide sequence of the variant may be silent That is, they may not alter the ammo acids encoded by the polynucleotide Where alterations are limited to silent changes of this type a variant will encode a polypeptide with the same ammo acid sequence as the reference. Also as noted below, changes in the polynucleotide sequence of the variant may alter the ammo acid sequence of a polypeptide encoded by the reference polynucleotide Such polynucleotide changes may result in ammo acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below (2) A polypeptide that differs in ammo acid sequence from another, reference polypeptide Generally, differences are limited so that the sequences of the reference and the variant are closely similar overall and, in many regions, identical A variant and reference polypeptide may differ in ammo acid sequence by one or more substitutions, additions, deletions, fusions and trunc
- Allehc variant refers to an alternative form of the prost-ets polynucleotide Alleles result from a mutation, i e , a change in the polynucleotide sequence, and generally produce altered mRNAs or polypeptides whose structure or function may or may not be altered Any given gene may have none, one or many alle c forms Common mutational changes which give rise to alleles are generally ascribed to natural deletions, additions or substitutions of nucleotides Each of these types of changes may occur alone, or in combination with the others, or one or more times in a given sequence "Derivative” refers to polynucleotides or polypeptides derived from naturally occurring prost-ets or PROST-Ets, respectively, by chemical modifications such as ubiquitmation, labeling (e g , with radionuclides, various enzymatic modifications), pegylation (de ⁇ vatization with polyethylene glycol) or by insertion or substitution of ammo acids such as or
- “Deletion” is defined as a change in either polynucleotide or ammo acid sequences in which one or more polynucleotides or am o acid residues, respectively, are absent
- “Insertion” or “addition” is that change in a polynucleotide or ammo acid sequence which has resulted in the addition of one or more polynucleotides or ammo acid residues respectively, as compared to the naturally occurring polynucleotide or ammo acid sequence
- substitution results from the replacement of one or more polynucleotides or ammo acids by different polynucleotides or ammo acids, respectively
- ammo acid substitutions are the result of replacing one ammo acid with another ammo acid having similar structural and/or chemical properties, such as the replacement of a leucine with an isoleucme or vahne, an aspartate with a glutamate, or a threonme with a se ⁇ ne, i e conservative ammo acid replacement Insertions or deletions are typically in the range of about 1 to 5 ammo acids
- the variation allowed may be experimentally determined by systematically making insertions, deletions, or substitutions of ammo acids in the polypeptide using recombinant DNA techniques and assaying the resulting recombinant variants for activity
- “Fragment” is a polypeptide having an ammo acid sequence that entirely is the same as part but not all of the ammo acid sequence of the aforementioned PROST-Ets polypeptides and variants or derivatives thereof
- a polypeptide "fragment”, “portion”, or “segment” is a stretch of ammo acid residues of at least about 5 ammo acids, often at least about 7 am o acids, typically at least about 9 to 13 ammo acids, and in various embodiments, at least about 17 or more ammo acids
- Recombinant or “recombinant DNA molecule” refers to a polynucleotide sequence which is not naturally occurring, or is made by the artificial combination of two otherwise separated segments of sequence
- recombinantly produced is meant artificial combination often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of polynuc eotides, e g , by genetic engineering techniques Such manipulation is usually done to replace a codon with a redundant codon encoding the same or a conservative ammo acid, while typically introducing or removing a sequence recognition site Alternatively, it is performed to join together polynucleotide segments with desired functions to generate a single genetic entity comprising a desired combination of functions not found in the common natural forms Restriction enzyme recognition sites, regulation sequences, control sequences, or other useful features may be incorporated by design
- Recombinant DNA molecules include cloning and expression vectors
- Recombinant may also refer to a polynucleotide which encodes a polypeptide and
- isolated means altered “by the hand of man” from its natural state, i e , that, if it occurs in nature, it has been changed or removed from its original environment, or both
- a naturally occurring polynucleotide or a polypeptide naturally present in a living animal in its natural state is not “isolated”, but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is “isolated”, as the term is employed herein
- polynucleotides the term isolated means that it is separated from the chromosome and cell in which it naturally occurs
- Polynucleotides and polypeptides may occur in a composition, such as media formulations, solutions for introduction of polynucleotides or polypeptides, for example into cells compositions or solutions for chemical or enzymatic reactions, for instance, which are not naturally occurring compositions, and, therein remain isolated polynucleotides or polypeptides within the meaning of that term as it is
- Substantially pure and “substantially homogenous” are used interchangeably and describe PROST-Ets polypeptide, or fragments thereof, or a polynucleotide segment encoding same, where such polypeptide or polynucleotide is separated from components that naturally accompany it
- a PROST-Ets polypeptide or fragment thereof, or DNA segment encoding same is substantially free of naturally-associated components when it is separated from the native contaminants which accompany it in its natural state
- a polypeptide that is chemically synthesized or synthesized in a cellular system different from the cell in which it naturally originates will be substantially free from its naturally-associated components
- a polynucleotide that is chemically synthesized or synthesized in a cellular system different from the cell in which it naturally originated will be substantially free from its naturally-associated components
- “Polymerase chain reaction” or “PCR” refers to a procedure wherein specific pieces of DNA are amplified as described in U S Pat No 4,683,195, issued 28 July 1987 Generally, sequence information from the ends of the polypeptide fragment of interest or beyond needs to be available, such that oligonucleotide primers can be designed, these primers will point towards one another, and will be identical or similar in sequence to opposite strands of the template to be amplified The 5 terminal nucleotides of the two primers will coincide with the ends of the amplified material PCR can be used to amplify specific
- Hybridization shall include “any process by which a polynucleotide strand joins with a complementary strand through base pairing” (Coombs, J , Dictionary of Biotechnology, Stockton Press, New York, N Y , 1994)
- “Therapeutically effective dose” refers to that amount of polypeptide or its antibodies, antagonists, or inhibitors, including antisense molecules and ⁇ bozymes, which ameliorate the symptoms or conditions of a disease state Therapeutic efficacy and toxicity of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e g , ED 50 (the dose therapeutically effective in 50% of the population) and LD 50 (the dose lethal to 50% of the population) The dose ratio between therapeutic and toxic effects is the therapeutic index, and it can be expressed as the ratio, ED 50 /LD 50
- Treating covers the treatment of a disease-state in a human patient, which disease-state is associated with prostate tumor growth and includes disease states in which the patient is in need of decreased levels of PROST-Ets
- the present invention relates to novel PROST-Ets polypeptides, prost-ets polynucleotides, and antibodies directed toward PROST-Ets polypeptides, among other things, as described in greater detail below
- the invention relates to novel PROST-Ets polypeptides and the polynucleotides encoding these PROST-Ets polypeptides, and relates especially to PROST-Ets having the ammo acid sequence set out in Figure 2 (SEQ ID NO 2) and prost-ets having the polynucleotide sequence set out in Figure 1 (SEQ ID NO 1 )
- the present invention also encompasses PROST-Ets variants
- a preferred PROST-Ets variant is one having at least 70% similarity (preferably at least 70% identity) to the polypeptide sequence shown in Figure 2 (SEQ ID NO 2) and more preferably at least 90% similarity (more preferably at least 90% identity) to the polypeptide shown in Figure 2 (SEQ ID NO 2) and still more preferably at
- PROST-Ets contains two domains characteristic of the Ets family of proteins a pointed domain (involved in protein-protein interactions) at ammo acids 131 to 213 and an Ets domain (involved in DNA binding) at ammo acids 246 to 332
- the present invention is based in part on the structural homology shown in Figure 3 between PROST-Ets and Drosophila D-Ets-4, another member of the Ets family of transcription factors
- the ammo acid sequence of PROST-Ets is approximately 74% homologous to Drosophila D-Ets-4 over 87 am o acids
- the invention is also based in part on the expression profile of prost-ets mRNA, which is characterized by expression in prostate tissue libraries and overexpression in prostate tumor libraries. This tissue profile is seen in analysis of mRNA expression in tissue samples from normal and tumor tissues by Northern blotting and by PCR based Taqman analysis Both methods of analysis demonstrated that mRNA encoding PROST-Ets is expressed at high levels in prostate tissues and in a limited number of other tissues, including colon and breast
- the invention is also based in part on a number of functional studies demonstrating the effect of a reduction in the level of mRNA encoding PROST-Ets on prostate tumor cell growth in culture
- PC-3 prostate tumor cell line
- antisense ohgonucleotides to reduce prost-ets mRNA expression
- Three antisense ohgonucleotide reagents were found that reduced mRNA levels for PROST-Ets when administered to cells in the presence of lipids
- Administration of these antisense ohgonucleotide reagents to PC-3 cells inhibited proliferation of the cells in a dose dependent manner
- a control ohgonucleotide mixture composed of a set of random 23mer ohgonucleotides did not affect proliferation of the cells
- antisense ohgonucleotides directed to regions of the PROST-Ets sequence were transfected into PC
- isolated polynucleotides that encode the PROST-Ets polypeptide having the deduced am o acid sequence of Figure 2 (SEQ ID NO 2) Using the information provided herein, such as the polynucleotide sequence set out in
- Figure 1 a polynucleotide of the present invention encoding a PROST-Ets polypeptide may be obtained using standard cloning and screening procedures such as those for cloning cDNAs using mRNA from cells of human tissue as starting material
- the polynucleotide sequence in Figure 1 was found in cDNA clones obtained from human prostate tissues.
- Prost-ets was identified as a gene expressed in the prostate by mining Incyte's LifeSeq gene expression database for sequences expressed in either a prostate or tumor specific manner
- the original clone identified was Incyte Clone 581956, discovered in a prostate tumor library This clustered with other Incyte clones, including 1813005, and 1794731 These clones were acquired from Incyte and used for experimental purposes including sequence determination and expression analysis
- the nucleotide sequence of Clone 581956 was used for electronic Northern analysis of the expression of the gene in all tissue libraries in Incyte's database
- Initial screens demonstrated that the PROST-Ets gene was expressed largely in the prostate and overexpressed in prostate tumors In updated versions of the database, it was found to be expressed not only in the prostate but also in breast tumor and ovarian tumor libraries All clones in Incyte's Lifeseq library coding for PROST-Ets were assembled into a contiguous sequence using the Genetics Computer Group (GCG, Wisconsin package) gene assembly program and the sequence of the assembled mRNA evaluated This sequence was edited to improve the quality of the contiguous assembled sequence and an open reading frame coding for a
- Polynucleotides of the present invention may be in the form of RNA such as mRNA or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced by chemical synthetic techniques or by a combination thereof, or by methods described herein
- the DNA may be doub'e-stranded or single-stranded Single-stranded DNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand also referred to as the anti-sense strand
- the coding sequence which encodes the polypeptide may be identical to the coding sequence of the polynucleotide shown in Figure 1 (SEQ ID NO 1 ) It also may be a polynucleotide with a different sequence, which, as a result of the redundancy (degeneracy) of the genetic code, encodes the polypeptide of Figure 2 (SEQ ID NO 2)
- Polynucleotides of the present invention which encode the polypeptide of Figure 2 may include, but are not limited to, the coding sequence for the polypeptide itself, the coding sequence for the polypeptide and additional coding sequences, such as those encoding a leader or secretory sequence, such as a pre-, or pro- or prepro-prote sequence, the coding sequence of the polypeptide, with or without the aforementioned additional coding sequences, together with additional, non-coding sequences, including for example, but not limited to, introns and non-coding 5 and 3 sequences, such as the transcribed, non- translated sequences that play a role in transcription, mRNA processing (for example, splicing and polyadenylation signals) or additional coding sequences which code for additional ammo acids, such as those which provide additional functionalities
- the polypeptide may be fused to a marker sequence, such as a peptide, which facilitates purification of the fused polypeptide
- a marker sequence such as a
- the polynucleotides may encode a polypeptide which is the polypeptide plus additional ammo or carboxyl-terminal ammo acids, or ammo acids interior to the polypeptide (when the active form has more than one polypeptide chain, for instance)
- Such sequences may play a role in processing of a polypeptide from precursor to final form, may facilitate polypeptide trafficking, may prolong or shorten polypeptide half-life or may facilitate manipulation of a polypeptide for assay or production, among other things
- the additional ammo acids may be processed away from the polypeptide by cellular enzymes
- a precursor polypeptide, having the final form of the polypeptide fused to one or more prosequences may be an inactive form of the polypeptide When prosequences are removed such inactive precursors generally are activated Some or all of the prosequences may be removed before activation Generally, such precursors are called propolypeptides
- the present invention further relates to variants of the herein above described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced am o acid sequence of Figure 2 (SEQ ID NO 2)
- a variant of the polynucleotide may be a naturally occurring variant such as a naturally occurring allehc variant, or it may be a variant that is not known to occur naturally
- Such non-naturally occurring variants of the polynucleotide may be made by mutagenesis techniques, including those applied to polynucleotides, cells or organisms
- variants in this regard are variants that differ from the aforementioned polynucleotides by polynucleotide substitutions, deletions or additions
- the substitutions, deletions or additions may involve one or more polynucleotides
- the variants may be altered in coding or non-coding regions or both Alterations in the coding regions may produce conservative or non-conservative ammo acid substitutions, deletions or additions
- polypeptides having the am o acid sequence of PROST-Ets set out in Figure 2 SEQ ID NO 2
- variants, analogs, derivatives and fragments thereof variants of the variants, analogs and derivatives
- polynucleotides encoding PROST-Ets variants, analogs, derivatives and fragments, and variants, analogs and derivatives of the fragments which have the ammo acid sequence of the PROST-Ets polypeptide of Figure 2 (SEQ ID NO 2) in which several, a few, 5 to 10, 1 to 5, 1 to 3, 2, 1 or no ammo acid residues are substituted, deleted or added, in any combination Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the PROST-Ets polypeptide Also especially preferred in this regard are conservative substitutions Most highly preferred are polynucleotides encoding polypeptides having the am o acid sequence of Figure 2 (SEQ ID NO 2) without substitutions
- polynucleotides that are at least 70% identical to a polynucleotide encoding the PROST-Ets polypeptide having the ammo acid sequence set out in Figure 2 (SEQ ID NO 2), and polynucleotides which are complementary to such polynucleotides
- polynucleotides that comprise a region that is at least 80% identical to a polynucleotide encoding the PROST-Ets polypeptide and polynucleotides complementary thereto
- polynucleotides at least 90% identical to the same are particularly preferred, and among these particularly preferred polynucleotides, those with at least 95% are especially preferred
- those with at least 97% are highly preferred among those with at least 95%, and among these, those with at least 98% and at least 99% are particularly highly preferred with at least 99% being the more preferred
- polynucleotides which encode polypeptides which retain substantially the same biological activity as the polypeptide encoded by the polynucleotide sequence of Figure 1 (SEQ ID NO 1 )
- the present invention further relates to polynucleotides that hybridize to the herein above-described sequences
- the present invention especially relates to polynucleotides which hybridize under stringent conditions to the herein above-described polynucleotides
- polynucleotide assays of the invention may be used as a hybridization probes for cDNA and genomic DNA to isolate full-length cDNAs and genomic clones encoding PROST-Ets and to isolate cDNA and genomic clones of other genes that have a high sequence similarity to the prost-ets gene
- probes generally will comprise at least 15 bases
- probes will have at least 30 bases and may have at least 50 bases
- the coding region of the prost-ets gene may be isolated by screening using the known DNA sequence to synthesize an ohgonucleotide probe A labeled ohgonucleotide having a sequence complementary to that of a polynucleotide of the present invention is then used to screen a library of human cDNA, genomic DNA or mRNA to determine to which members of the library the probe hybridizes
- a polynucleotide of the present invention may encode a polypeptide, a polypeptide plus a leader sequence (which may be referred to as a prepolypeptide), a precursor of a polypeptide having one or more prosequences which are not the leader sequences of a prepolypeptide, or a prepropolypeptide, which is a precursor to a propolypeptide, having a leader sequence and one or more prosequences, which generally are removed during processing steps that produce active forms of the polypeptide
- the invention also relates to, among others, polynucleotides encoding the polypeptide fragments, polynucleotides that hybridize to polynucleotides encoding polypeptide fragments, particularly those that hybridize under stringent conditions, and polynucleotides, such as PCR primers, for amplifying polynucleotides that encode polypeptide fragments
- preferred polynucleotides are those that correspond to preferred polypeptide fragments, as discussed below
- the present invention further relates to a PROST-Ets polypeptide which has the deduced ammo acid sequence of Figure 2 (SEQ ID NO 2)
- the invention also relates to fragments, analogs and derivatives of these polypeptides
- fragment, derivative and analog when referring to the polypeptide of Figure 2 (SEQ ID NO 2) means a polypeptide which retains essentially the same biological activity as such a polypeptide
- an analog includes a propolypeptide which can be activated by cleavage of the propolypeptide portion to produce an active polypeptide of the invention
- polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide In certain preferred embodiments, it is a recombinant polypeptide
- the fragment, derivative or analog of the polypeptide of Figure 2 may be (i) one in which one or more of the ammo acid residues are substituted with a conserved or non-conserved am o acid residue (preferably a conserved ammo acid residue) and such substituted am o acid residue may or may not be one encoded by the genetic code, or ( ⁇ ) one in which one or more of the ammo acid residues includes a substituent group, or (in) one in which the polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol) or (iv) one in which the additional ammo acids are fused to the polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the polypeptide
- a conserved or non-conserved am o acid residue preferably a conserved ammo acid residue
- substituted am o acid residue may or may not be one encoded by the genetic code
- polypeptides having the ammo acid sequence of PROST-Ets set out in Figure 2 are polypeptides having the ammo acid sequence of PROST-Ets set out in Figure 2 (SEQ ID NO
- variants are those that vary from a reference by conservative ammo acid substitutions
- Such substitutions are those that substitute a given ammo acid in a polypeptide by another ammo acid of like characteristics
- conservative substitutions are the replacements, one for another, among the aliphatic ammo acids Ala, Val Leu and lie, interchange of the hydroxyl residues Ser and Thr, exchange of the acidic residues Asp and Glu, substitution between the amide residues Asn and Gin, exchange of the basic residues Lys and Arg and replacements among the aromatic residues Phe and Tyr
- variants, analogs, derivatives and fragments, and variants, analogs and derivatives of the fragments having the ammo acid sequence of the PROST-Ets polypeptide of Figure 2 (SEQ ID NO 2) in which several, a few, 5 to 10, 1 to 5, 1 to 3, 2, 1 or no ammo acid residues are substituted, deleted or added, in any combination Especially preferred among these are silent substitutions, addition
- polypeptides which have at least 70% similarity (preferably at least 70% identity) to the polypeptide of Figure 2 (SEQ ID NO 2) and more preferably at least 90% similarity (more preferably at least 90% identity) to the polypeptide of Figure 2 (SEQ ID NO 2) and still more preferably at least 95% similarity (still more preferably at least 95% identity) to the polypeptide of Figure 2 (SEQ ID NO 2) and also include portions of such polypeptides with such portion of the polypeptide generally containing at least 30 am o acids and more preferably at least 50 ammo acids
- Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptides by peptide synthesis, therefore, the fragments may be employed as intermediates for producing the full-length polypeptides Fra ⁇ ments
- polypeptides comprising fragments of PROST-Ets, most particularly fragments of the PROST- Ets of Figure 2 (SEQ ID NO 2), and fragments of variants and derivatives of the PROST-Ets of Figure 2 (SEQ ID NO 2)
- a fragment is a polypeptide having an ammo acid sequence that entirely is the same as part but not all of the ammo acid sequence of the aforementioned PROST-Ets polypeptides and variants or derivatives thereof
- fragments may be "free-standing," i e , not part of or fused to other am o acids or polypeptides, or they may be comprised within a larger polypeptide of which they form a part or region When comprised within a larger polypeptide, the presently discussed fragments most preferably form a single continuous region However, several fragments may be comprised within a single larger polypeptide
- certain preferred embodiments relate to a fragment of a PROST-Ets polypeptide of the present invention comprised within a precursor polypeptide designed for expression in a host and having heterologous pre- and propolypeptide regions fused to the ammo terminus of the PROST-Ets fragment and an additional region fused to the carboxyl terminus of the fragment Therefore, fragments in one aspect of the meaning intended herein, refers to the portion or portions of a fusion polypeptide or fusion protein derived from PROST-Ets As representative examples of polypeptide fragments of the invention, there may be mentioned those which have from about
- Truncation mutants include PROST-Ets of Figure 2 (SEQ ID NO 2), or variants or derivatives thereof, except for deletion of a continuous series of residues (that is, a continuous region, part or portion) that includes the am o terminus of the sequence shown in Figure 2 (SEQ ID NO 2), or a continuous series of residues that includes the carboxyl terminus or, as in double truncation mutants, deletion of two continuous series of residues, one including the am o terminus and one including the carboxyl terminus
- Fragments having the size ranges set out above also are preferred embodiments of truncation fragments, which are especially preferred among fragments generally Especially preferred in this aspect of the invention are fragments characterized by biological and/or immunological attributes of PROST-Ets Most preferred are fragments containing the predicted active domains of PROST-Ets, which encompasses at least ammo acids 131 to 213 and am
- fragments in this regard are those that comprise regions of PROST-Ets that combine several structural features, such as the features set out above
- the "pointed” and “Ets' domains, encompassing about ammo acids 131 to 213 and 246 to 332, respectively, which are characteristic of the Ets family of transcription factors, are especially preferred regions
- Such regions may be comprised within a larger polypeptide or may be by themselves a preferred fragment of the present invention, as discussed above
- fragments in general are those that mediate activities of PROST-Ets
- Highly preferred in this regard are fragments that contain regions that are homologs in sequence, or in position, or in both sequence and position to active regions of related polypeptides, such as the other proteins of the Et
- the present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques
- vectors which include polynucleotides of the present invention
- host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques
- Such techniques are described in Sambrook et al , Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Plamview, N Y , 1989 and Ausubel, F M et al , Current Protocols in Molecular Biology, John Wiley & Sons, New York, N Y , 1989
- Host cells can be genetically engineered to incorporate polynucleotides and express polypeptides of the present invention
- polynucleotides may be introduced into host cells using well known techniques of infection, transduction, transfection, transvection and transformation
- polynucleotides of the invention may be transfected into host cells with another, separate, polynucleotide encoding a selectable marker, using standard techniques for cotransfection and selection in, for instance, mammalian cells
- the polynucleotides generally will be stably incorporated into the host cell genome
- the polynucleotides may be joined to a vector containing a selectable marker for propagation in a host
- the vector construct may be introduced into host cells by the aforementioned techniques
- a plasmid vector is introduced as DNA in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid Electroporation also may be used to introduce polynucleotides into a host
- the vector is a virus, it may be packaged in vitro or introduced into a packaging cell and the packaged virus may be transduced into cells
- a wide variety of techniques suitable for making polynucleotides and for introducing polynucleotides into cells in accordance with this aspect of the invention are well known and routine to those of skill in the art Such techniques are reviewed at length in
- the vector may be, for example, a plasmid vector, a single or double-stranded phage vector, a single or double- stranded RNA or DNA viral vector
- Such vectors may be introduced into cells as polynucleotides, preferably DNA, by well known techniques for introducing DNA and RNA into cells
- the vectors in the case of phage and viral vectors, also may be and preferably are introduced into cells as packaged or encapsidated virus by well known techniques for infection and transduction
- Viral vectors may be replication competent or replication defective In the latter case viral propagation generally will occur only in complementing host cells
- Preferred among vectors, in certain respects, are those for expression of polynucleotides and polypeptides of the present invention
- such vectors comprise cis-acting control regions effective for expression in a host operatively linked to the polynucleot
- the vectors provide for specific expression
- Such specific expression may be inducible expression or expression only in certain types of cells or both inducible and cell-specific
- Particularly preferred among inducible vectors are vectors that can be induced for expression by environmental factors that are easy to manipulate, such as temperature and nutrient additives
- a variety of vectors suitable to this aspect of the invention including constitutive and inducible expression vectors for use in prokaryotic and eukaryotic hosts, are well known and employed routinely by those of skill in the art
- the engineered host cells can be cultured in conventional nutrient media, which may be modified as appropriate for, inter alia, activating promoters, selecting transformants or amplifying genes Culture conditions, such as temperature, pH and the like, previously used with the host cell selected for expression generally will be suitable for expression of polypeptides of the present invention as will be apparent to those of skill in the art
- vectors can be used to express a polypeptide of the invention
- Such vectors include chromosomal, episomal and virus-derived vectors e g , vectors derived from bacterial plasmids, from bacte ⁇ ophage, from yeast episomes, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses and vectors derived from combinations thereof, such as those derived from plasmid and bacte ⁇ ophage genetic elements such as cosmids and phagemids, all may be used for expression in accordance with this aspect of the present invention
- any vector suitable to maintain, propagate or express polynucleotides to express a polypeptide in a host may be used for expression in this regard
- DNA sequence for expression is joined to an expression vector by cleaving the DNA sequence and the expression vector with one or more restriction endonucleases and then joining the restriction fragments together using T4 DNA hgase Procedures for restriction and hgation that can be used to this end are well known and routine to those of skill Suitable procedures in this regard, and for constructing expression vectors using alternative techniques, which also are well known and routine to those of skill, are set forth in great detail in Sambrook et al cited elsewhere herein
- the DNA sequence in the expression vector is operatively linked to appropriate expression control sequence(s), including for instance, a promoter to direct mRNA transcription
- appropriate expression control sequence(s) including for instance, a promoter to direct mRNA transcription
- promoters include the phage lambda PL promoter, the E coli lac, trp and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs to name just a few of the well-known promoters
- numerous promoters not mentioned are suitable for use in this aspect of the invention, are well known and may readily be employed by those of skill in the manner illustrated by the discussion and the examples herein
- expression constructs will contain sites for transcription initiation and termination and, in the transcribed region, a ⁇ bosome binding site for translation
- the coding portion of the transcripts expressed by the constructs will include a translation initiating AUG at the beginning and a termination codon appropriately positioned at the end of the polypeptide to be translated
- constructs may contain control regions that regulate as well as engender expression Generally, in accordance with many commonly practiced procedures, such regions will operate by controlling transcription, such as repressor binding sites and enhancers, among others
- Vectors for propagauon and expression generally will include selectable markers Such markers also may be suitable for amplification or the vectors may contain additional markers for this purpose
- the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells
- Preferred markers include dihydrofolate reductase or neomycm resistance for eukaryotic cell culture, and tetracyclme, theomycm, kanamycm or ampicilhn resistance genes for culturing E coli and other bacteria
- the vector containing the appropriate DNA sequence as described elsewhere herein, as well as an appropriate promoter, and other appropriate control sequences may be introduced into an appropriate host using a variety of well known techniques suitable to expression therein of a desired polypeptide
- Representative examples of appropriate hosts include bacterial cells, such as E coli, Streptomyces and Salmonella typhimunum cells, fungal cells, such as yeast cells, insect cells such as Drosophila S2 and Spodoptera
- mammalian expression systems include the COS-7 lines of monkey kidney fibroblast (Gluzman et al , Cell 23 175, 1991 )
- Other cell lines capable of expressing a compatible vector include for example, the C127, 3T3, CHO, HeLa, human kidney 293 and BHK cell lines
- a number of viral-based expression systems may be utilized
- the polynucleotide sequence coding for PROST-Ets may be ligated into an adenovirus transcription/translation complex consisting of the late promoter and tripartite leader sequence Insertion in a nonessential E1 or E3 region of the viral genome will result in a viable virus capable of expressing PROST-Ets in infected host cells (Logan and Shenk, Proc Natl Acad Sci USA 81 3655-59, 1984)
- transcription enhancers such as the rouse sarcoma virus
- RVS RVS enhancer
- the present invention also includes recombinant constructs, such as expression constructs, comprising one or more of the sequences described above
- the constructs comprise a vector, such as a plasmid or viral vector, into which such a sequence of the invention has been inserted
- the sequence may be inserted in a forward or reverse orientation
- the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence
- vectors preferred for use in bacteria are pQE70, pQE60 and pQE-9, available from Qiagen USA (Valencia, CA), pBS vectors, Phagesc ⁇ pt® vectors, Bluesc ⁇ pt® vectors, pNH8A, pNHI6a, pNHI8A, pNH46A, available from Stratagene (LaJolla, CA), and ptrc99a, pK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia Biotech (Piscataway, N J )
- pTrcHisB vector available from Introgen or the pET15b vector from Novagen
- preferred eukaryotic vectors are pWLNEO, pSV2CAT, p0G44, PXTI and pSG available from Stratagene, and PSVK3, pBPV, p
- Promoter regions can be selected from any desired gene using vectors that contain a reporter transcription unit lacking a promoter region, such as a chloramphenicol acetyl transferase ("cat") transcription unit, downstream of restriction site or sites for introducing a candidate promoter fragment, i e , a fragment that may contain a promoter
- a reporter transcription unit lacking a promoter region such as a chloramphenicol acetyl transferase ("cat") transcription unit, downstream of restriction site or sites for introducing a candidate promoter fragment, i e , a fragment that may contain a promoter
- introduction into the vector of a promoter-containing fragment at the restriction site upstream of the cat gene engenders production of CAT activity, which can be detected by standard CAT assays
- Vectors suitable to this end are well known and readily available
- promoters for expression of polynucleotides of the present invention include not only well known and readily available promoters, but also promoters that readily may be obtained by the
- bacterial promoters suitable for expression of polynucleotides and polypeptides in accordance with the present invention are the E coli lacl and lacZ promoters the T3 and T7 promoters, the T5 tac promoter, the lambda PR, PL promoters, the trp promoter and the trc hybrid promoter, which is derived from the trp and lac promoters
- known eukaryotic promoters suitable in this regard are the CMV immediate early promoter, the HSV thymidine kmase promoter, the early and late SV40 promoters, the promoters of retroviral LTRs, such as those of the Rous sarcoma virus ("RSV”) and metallothionein promoters such as the mouse metalloth ⁇ one ⁇ n-l promoter
- recombinant expression vectors will include origins of replication, a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence, and a selectable marker to permit isolation of vector containing cells after exposure to the vector
- the present invention also relates to host cells containing the above-described constructs discussed above
- the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell Constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence
- Polypeptides can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook et al , cited elsewhere herein
- Enhancers are cisacting elements of DNA, usually about from 10 to 300 bp that act to increase transc ⁇ ptional activity of a promoter in a given host cell-type
- enhancers include the SV40 enhancer, which is located on the late side of the replication origin at bp 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers
- Polynucleotides of the invention, encoding the heterologous structural sequence of a polypeptide of the invention generally will be inserted into the vector using standard techniques so that it is operably linked to the promoter for expression The polynucleotide will be positioned so that the transcription start site is located appropriately 5 to a ⁇ bosome binding site The ⁇ bosome binding site will be 5 to the AUG
- pET15b vectors may be used to express foreign polypeptides as fusion proteins containing a polyhistidme (6xH ⁇ s) tag for rapid purification Proteins made is such systems are designed to include cleavage sites, such as an enterokinase cleavage site, so that the cloned polypeptide of interest can be released from the fusion peptide moiety at will
- PROST-Ets polypeptide can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectm chromatography Most preferably, high performance liquid chromatography ("HPLC") is employed for purification.
- HPLC high performance liquid chromatography
- Well known techniques for refolding protein may be employed to regenerate active conformation when the polypeptide is denatured during isolation and or purification
- Various other methods of protein purification well known in the art include those described in Deutscher, M , Methods in Enzymology, Vol 182, Academic Press, San Diego, 1982 and Scopes, R , Protein Purification Principles
- polypeptides of the present invention can be produced by direct peptide synthesis using solid-phase techniques (Stewart et al , Solid-Phase Peptide Synthesis, W H Freeman Co , San Francisco, 1969, Merrifield, J , J Am Chem Soc 85 2149-2154, 1963)
- In vitro protein synthesis ma be performed using manual techniques or by automation Automated synthesis may be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer, Foster City, Calif) in accordance with the instructions provided by the manufacturer
- Various fragments of PROST-Ets may be chemically synthesized separately and combined using chemical methods known in the art to produce the full length molecule
- Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes
- PROST-Ets polypeptides and the polynucleotides which encode them
- Prost-ets polynucleotides and PROST-Ets polypeptides may be used in accordance with the present invention for a variety of applications, particularly those that make use of the chemical and biological properties of PROST-Ets Additional applications relate to diagnosis and to treatment of diseases of cell proliferation, such as prostate cancer
- PROST-Ets polypeptide sequences of the present invention
- the rationale for the use of the polynucleotide and polypeptide sequences of the present invention is based in part on the chemical and structural homology between the PROST-Ets polypeptide disclosed herein and other Ets-like transcription factor molecules and on the preferential expression of PROST-Ets in prostate and breast tissues as compared with other tissues
- PROST-Ets may be used in the diagnosis and treatment of conditions, disorders or diseases associated with inappropriate growth of prostate tissue These would include, but are not limited to, cancer and metastatic tumor growth
- Prost-ets polynucleotide sequences can be used as DNA probes, and as targets for antisense and nbozyme therapy, or as templates for the production of antisense polynucleotides Administration of such antisense polynucleotides to cells can be used to suppress expression of prost-ets mRNA
- PROST-Ets polypeptides and fragments thereof can be used to generate antibodies to PROST-Ets which may be useful in detecting the levels of PROST-Ets polypeptide in cells and tissues and in targeting drugs to primary and metastatic tumors Alternatively, antibodies specifically recognizing areas of the PROST-Ets polypeptide which are responsible for its activity may be administered to treat diseases or conditions associated with PROST-Ets activity PROST-Ets polypeptides may be used to stimulate an immune response to PROST-Ets containing cells
- Polynucleotides encoding PROST-Ets may be useful in diagnostic assays for detecting the levels of polynucleotides encoding PROST-Ets in cells and tissues
- Prost-ets polynucleotides and PROST-Ets polypeptides of the present invention may be employed in accordance with the present invention by expression of such polypeptides in vitro and in vivo, in treatment modalities often referred to as "gene therapy"
- PROST-Ets activity such as prostate cancer
- it may be advantageous to suppress the activity of PROST-Ets activity can be suppressed through introduction of polynucleotides encoding regions of the PROST-Ets polypeptide into tumor cells, where the polypeptides they encode act as dominant negative reagents within the cells blocking PROST-Ets activity
- polypeptides which act as dominant negative reagents can be introduced directly into tumor cells to block PROST-Ets activity
- This invention is also related to the use of the prosf-e/s-related polynucleotides to detect complementary polynucleotides such as, for example, as a diagnostic reagent Detection of prost-ets polynucleotides associated with a disease state will provide a tool for the development of in vitro and in vivo diagnostics that can add or define a diagnosis of a disease or susceptibility to a disease which results from tissue specific expression of PROST-Ets
- RNA or cDNA may also be used in the same ways.
- PCR primers complementary to the polynucleotide sequence encoding PROST-Ets can be used to identify and analyze prost- ets expression and mutations For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype Point mutations can be identified by hybridizing amplified DNA to radiolabeled prost-ets RNA or alternatively radiolabeled prost-ets antisense DNA sequences Perfectly matched sequences can be
- Sequence differences between a reference gene and genes having mutations also may be revealed by direct DNA sequencing
- cloned DNA segments may be employed as probes to detect specific DNA segments
- the sensitivity of such methods can be greatly enhanced by appropriate use of PCR or another amplification method
- a sequencing primer is used with double-stranded PCR product or a single-stranded template molecule generated by a modified PCR
- the sequence determination is performed by conventional procedures with radiolabeled polynucleotide or by automatic sequencing procedures with fluorescent tags
- DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels, with or without denaturing agents Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see e g , Myers et al , Science, 230 1242, 1985)
- Sequence changes at specific locations also may be revealed by nuclease protection assays, such as RNase and S1 protection or the chemical cleavage method (e g , Catton et al , Proc Natl Acad Sci , USA, 85 4397-4401 , 1985)
- the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e g , restriction fragment length polymorphisms ("RFLP”) and Southern blotting of genomic DNA)
- methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e g , restriction fragment length polymorphisms ("RFLP”) and Southern blotting of genomic DNA)
- mutations also can be detected by in situ analysis
- the present invention also relates to a diagnostic assays such as quantitative and diagnostic assays for detecting levels of PROST-Ets polypeptide in cells and tissues and body fluids, including determination of normal and abnormal levels
- a diagnostic assay in accordance with the invention for detecting over-expression of PROST-Ets polypeptide compared to normal control tissue samples may be used to detect the presence of neoplasia, for example, prostate cancer
- Such diagnostic tests may be used to detect metastatic tumor growth, as well
- Assay techniques that can be used to determine levels of a polypeptide, such as a PROST-Ets polypeptide of the present invention, in a sample derived from a host are well-known to those of skill in the art
- Such assay methods include radioimmunoassays (RIA), competitive-binding assays, western Blot analysis and enzyme- linked immunoabsorbant assays (ELISA ) and fluorescent activated cell sorting (FACS) Among these ELISAs frequently are preferred An
- a sample is removed from a host and incubated on a solid support, e g a polystyrene dish, that binds the polypeptides in the sample Any free polypeptide binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin
- the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any PROST-Ets polypeptides attached to the polystyrene dish Unbound monoclonal antibody is washed out with buffer
- the reporter antibody linked to horseradish peroxidase is placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to PROST-Ets Unattached reporter antibody is then washed out
- Reagents for peroxidase activity including a colo ⁇ metric substrate are then added to the dish Immobilized peroxidase, linked to PROST-Ets through the primary and secondary antibodies, produces a colored reaction product The amount
- the invention further relates to antibodies that specifically bind to PROST-Ets, herein referred to as PROST-Ets antibodies
- PROST-Ets antibodies The prostate-specificity of PROST-Ets makes it an excellent marker for screening, diagnosis, prognosis, follow-up assays and imaging methods
- this characteristic indicates that PROST-Ets may be an excellent target for therapeutic methods such as targeted antibody therapy, immunotherapy, and gene therapy
- the term "specifically binds to” refers to the interaction of an antibody and a polypeptide, in which the interaction is dependent upon the presence of a particular structure (i e , the antigenic determinant or epitope) on the polypeptide, in other words, the antibody is recognizing and binding to a specific polypeptide structure rather than to proteins in general
- the PROST-Ets polypeptides, their fragments or other derivatives, or analogs thereof or cells expressing them can be used as an immunogen to produce antibodies thereto (Harlow Antibodies, Cold Spring Harbor Press, NY (1989)) These antibodies can be, for example, polyclonal or monoclonal antibodies
- the present invention also includes chime ⁇ c, single chain, and humanized antibodies, as well as Fab fragments, or the product of a Fab expression library Various procedures known in the art may be used for the production of such antibodies and fragments
- Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obt ained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman The antibody so obtained will then bind the polypeptides itself In this manner even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide
- any technique which provides antibodies produced by continuous cell line cultures can be used Examples include the hyb ⁇ doma technique (Kohler and Milstem, Nature 256 495-497, 1975), the human B-cell hyb ⁇ doma technique (Kozbor et al , Immunology Today 4 72, I983) and the EBV-hyb ⁇ doma technique to produce human monoclonal antibodies (Cole et al , in Monoclonal Antibodies and Cancer, Alan R Liss, Inc , 77-96, 1985)
- Antibodies may also be produced by inducing in vivo production in the lymphocyte population or by screening recombinant immunoglobuhn libraries or panels of highly specific binding reagents as disclosed in Orlandi et al (Proc Natl Acad Sci USA 86 3833-3837, 1989) and Winter and Milstem (Nature 349 293-299, 1991 )
- Antibody fragments which contain specific binding sites for PROST-Ets may also be generated for example, such fragments include, but are not limited to the F(ab')2 fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragments Alternatively, Fab expression libraries may be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity (Huse et al , Science 256 1270-1281 , 1989) The ammo acid sequence of PROST-Ets presented herein may be used to select specific regions of the PROST-Ets polypeptide for generating antibodies As will be understood by those skilled in the art, the regions or epitopes of a PROST-Ets polypeptide to which an antibody is directed may vary with the intended application For example, antibodies intended for use in an immunoassay for the detection of membrane-bound PROST-Ets on prostate cells should be directed toward accessible epi
- PROST-Ets antibodies may be used to isolate PROST-Ets positive cells using cell sorting and purification techniques
- PROST-Ets antibodies may be used to isolate prostate cancer cells from xenograft tumor tissue, from cells in culture, etc using antibody-based cell sorting or affinity purification techniques
- Other uses of the PROST- Ets antibodies of the invention include generating anti-idiotypic antibodies that mimic the PROST-Ets polypeptide
- PROST-Ets antibodies can be used for detecting the presence of prostate cancer or tumor metastasis
- the presence of such PROST-Ets-containmg cells within various biological samples, including serum, prostate and other tissue biopsy specimens, may be detected with PROST-Ets antibodies
- PROST-Ets antibodies may be used in various imaging methodologies such as immunoscintography with Tc-99m (or other isotope) conjugated antibody
- an imaging protocol similar to the one recently described using an ln-1 1 1 conjugated anti-PSMA antibody may be used to detect recurrent and metastatic prostate carcinomas (Sodee et al , Clin Nuc Med 21 759-766, 1997)
- the PROST-Ets antibodies of the invention may be labeled with a detectable marker or conjugated to a second molecule, such as a cytotoxic agent, and used for targeting the second molecule to a PROST-Ets positive cell (Vitetta, E S et al , Immunotoxin Therapy, in DeVita, Jr, V T et al , eds, Cancer Principles and Practice of Oncology, 4 th ed , J B Lippincott Co , Philadelphia, 2624-2636, 1993)
- cytotoxic agents include, but are not limited to ⁇ cin, doxorubicm, daunorubicin, taxol, ethidium bromide, mitomycin, etoposide, tenoposide, vinc ⁇ stine, vinblastme, colchicme, dihydroxy anthracm dione, actmomycin D, dipthe ⁇ a toxin, Pseudo onas exotox ⁇ n(PE)
- the invention provides various immunotherapeutic methods for treating prostate cancer, including antibody therapy, in vivo vaccines, and ex vivo immunotherapy approaches
- the invention provides PROST-Ets antibodies which may be used systemically to treat prostate cancer
- unconjugated PROST-Ets antibodies may be introduced into a patient such that the antibody binds to PROST-Ets on or in prostate cancer cells and mediates the destruction of the cells, and the tumor, by mechanisms which may include complement-mediated cytolysis, antibody-dependent cellular cytotoxicity, altering the physiologic function of PROST-Ets, and/or the inhibition of ligand binding or signal transduction pathways
- PROST-Ets antibodies conjugated to toxic agents such as ⁇ cin or radioisotopes may also be used therapeutically to deliver the toxic agent directly to PROST-Ets-bea ⁇ ng prostate tumor cells and thereby destroy the tumor cells
- Prostate cancer immunotherapy using PROST-Ets antibodies may follow the teachings generated from various approaches which have been successfully employed with respect to other types of cancer, including but not limited to colon cancer (Arlen et al , Crit
- the invention further provides vaccines formulated to contain a PROST-Ets polypeptide or fragment thereof
- vaccines formulated to contain a PROST-Ets polypeptide or fragment thereof
- the use of a tumor antigen in a vaccine for generating humoral and cell-mediated immunity for use in anti-cancer therapy is well known in the art and has been employed in prostate cancer using human PSMA and rodent PAP immunogens (Hodge et al , Int J Cancer 63 231 -237, 1995, Fong et al , J Immunol 159 31 13-31 17, 1997)
- Such methods can be readily practiced by employing a PROST-Ets polypeptide, or fragment thereof, or a PROST-Ets-encodmg nucleic acid molecule and
- viral gene delivery systems may be used to deliver a PROST-Ets- encoding nucleic acid molecule
- Various viral gene delivery systems which can be used in the practice of this aspect of the invention include, but are not limited to, vaccinia, fowlpox, canarypox, adenovirus, influenza, pohovirus, adeno-associated virus, lentivirus, and smdbus virus (Restifo, in Curr Opin, Immunol 8 658-663, 1996)
- Non-viral delivery systems may also be employed by using naked DNA encoding a PROST-Ets polypeptide or fragment thereof introduced into the patient (i e , intramuscularly) to induce an anti-tumor response
- the full-length human prost-ets cDNA may be employed
- human prost-ets cDNA fragments may be employed
- prost-ets nucleic acid molecules encoding specific T lymphocyte (CTL) epitopes may be
- Dendritic cells can be used to present PROST-Ets polypeptides to T cells in the context of MHC class I and II molecules
- autologous dendritic cells are pulsed with PROST-Ets polypeptides capable of binding to MHC molecules
- dendritic cells are pulsed with the complete PROST-Ets polypeptide
- Yet another embodiment involves engineering the overexpression of the prost-ets gene in dendritic cells using various implementing vectors known in the art, such as adenovirus (Arthur et al , Cancer Gene Ther 4 17-25, 1997), retrovirus (Henderson et al , Cancer Res 56 3763-3770, 1996), lentivirus, adeno-associated virus, DNA transfection (Ribas et al , Cancer Res 57 2865-2869, 1997), and tumor-derived RNA transfection (Ashley et al , J
- Anti-idiotypic anti-PROST-Ets antibodies can also be used in anti-cancer therapy as a vaccine for inducing an immune response to cells expressing a PROST-Ets polypeptide Specifically, the generation of anti-idiotypic antibodies is well known in the art and can be readily adapted to generate anti-idiotypic anti-PROST-Ets antibodies that mimic an epitope on a PROST-Ets polypeptide (see, for example, Wagner et al , Hybndoma 16 33-40, 1997 Foon et al , J Clin Invest 96 334-342, 1995, Herlyn et al , Cancer Immunol Immunother 43 65-76, 1996) Such an anti-idiotypic antibody can be used in anti-idiotypic therapy as presently practiced with other anti-idiotypic antibodies directed against tumor antigens
- constructs comprising DNA encoding a PROST-Ets polypeptide/immunogen and appropriate regulatory sequences may be injected directly into muscle or skin of an individual, such that the cells of the muscle or skin take up the construct and express the encoded PROST-Ets polypeptide/immunogen Expression of the PROST-Ets polypeptide/immunogen results in the generation of prophylactic or therapeutic humoral and cellular immunity against prostate cancer
- prophylactic and therapeutic genetic immunization techniques known in the art may be used (for a review, see information and references published at internet address www qenweb com)
- the prost-ets polynucleotides and PROST-Ets polypeptides of the present invention may be employed in accordance with the present invention by expression of such polypeptides in vitro and in vivo, in treatment modalities often referred to as "gene therapy"
- cells from a patient may be engineered with a polynucleotide, such as a DNA or RNA, encoding a polypeptide ex vivo, and the engineered cells then can be provided to a patient to be treated with the polypeptide
- cells may be engineered ex vivo by the use of a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention
- cells may be engineered in vivo for expression of a polypeptide in vivo by procedures known in the art
- a polynucleotide of the invention may be engineered for expression in a replication defective retroviral vector, as discussed above
- the retroviral expression construct then may be isolated and introduced into a packaging cell is transduced with a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention such that the packaging cell now produces infectious viral particles containing the gene of interest
- These producer cells may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo
- Retroviruses from which the retroviral plasmid vectors herein above mentioned may be derived include, but are not limited to, Moloney Mu ⁇ ne Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcom
- Viruses other than retroviruses may also be used to deliver selected PROST-Ets polynucleotides, i e the DNA viruses, such as adenovirus and adeno-associated virus and Herpes virus, and derivatives thereof Plasmids containing the nucleotide sequences of interest may also be delivered in complexes with lipids or lipid derivatives and in complexes with a variety of other biochemical and chemical reagents that are known to facilitate delivery of polynucleotides into cells in vitro or in vivo (Walter and Stem, Gene Therapy of Cancer Methods and Protocols, Humana Press, Totowa, NJ, 2000)
- Such vectors will include one or more promoters for expressing the polypeptide Suitable promoters which may be employed include, but are not limited to, the retroviral LTR, the SV40 promoter, and the human cytomegalovirus (CMV) promoter (Miller et al ,
- any other promoter e g , cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, RNA polymerase III, and ⁇ actm promoters
- Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kmase (TK) promoters, and B19 parvovirus promoters
- the promoter also may be the native promoter which controls the gene encoding the polypeptide The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein
- the retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines
- packaging cells include, but are not limited to, the PE50I, PA317 Y-2, Y-AM, PAI2, T19-14X, VT-19-17-H2, YCRE, YCRIP,
- the vector may be transduced into the packaging cells through any means known in the art Such means include, but are not limited to, electroporation, the use of liposomes, and CaP0 4 precipitation
- the retroviral plasmid vector may be encapsulated into a hposome, or coupled to a lipid, and then administered to a host
- the producer cell line will generate infectious retroviral vector particles which include the polynucleotide sequence(s) encoding the polypeptides Such retroviral vector particles then may be employed to transduce eukaryotic cells, either in vitro or in vivo
- the transduced eukaryotic cells will express the polynucleot ⁇ de(s) encoding the polypeptide
- Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells
- Viral and non-viral vectors of the kind described above may be used both to deliver polynucleotide sequences which encode the PROST-Ets polypeptide or portions thereof, and polynucleotides complementary to those sequences (i e antisense polynucleotides
- polynucleotides coding for fragments of PROST-Ets may also be used to modulate the biological activity of PROST-Ets in cells Such expressed polypeptides could compete with native PROST-Ets polypeptide for binding to DNA or to regulatory proteins
- Such expressed polypeptides are often referred to as dominant negative polypeptides, and the polynucleotides coding for them as dominant negative polynucleotides Preferred fragments of the PROST-Ets polypeptide to be expressed would be those containing am o acids 131 to 213 or 246 to 332, which represent the pointed and Ets domains of the PROST-Ets polypeptide, respectively (Foos et al , J Biol Chem 273 18871-18880, 1998)
- Anti-sense ohgonucleotides Antisense vectors, and ⁇ bozvmes
- Anti-sense polynucleotides complementary to prost-ets may be prepared synthetically Such ohgonucleotides may be delivered into cells with or without lipids that may assist uptake of the anti-sense ohgonucleotides into cells
- expression vectors derived from retroviruses, adenovirus, herpes or vaccinia viruses, or from various bacterial plasmids may be also be used for construction and delivery of recombinant vectors which will express anti-sense prost-ets See, for example, the techniques described in Sambrook et al (supra) and Ausubel et al (supra)
- polynucleotides comprising the full length cDNA sequence and/or its regulatory elements enable researchers to use prost-ets polynucleotides as an investigative tool in sense strands (Youssoufian and Lodish, Mol Cell Biol 13 98-104, 1993) or antisense strands (Eguchi, et al , Annu Rev Biochem 60 631 -652, 1991 ) for the regulation of gene function
- sense or antisense ohgomers, or larger fragments can be designed from various locations along the coding or control regions
- Genes encoding PROST-Ets can be turned off by transfecting a cell or tissue with expression vectors which express high levels of a desired prost-ets polynucleotide fragment
- Such constructs can flood cells with untranslatable sense or antisense sequences
- Particularly preferred antisense sequences include, but are not limited to, UCCACCUGUGGCAGUUCCUCAAG (13594, SEQ ID NO 9), UGACUCGACAAAGGCCACAGGCA (13595, SEQ ID NO, 10), and CCAGCAUUUCCAGAGCAGAGCCU (13642, SEQ ID NO 11 )
- UCCACCUGUGGCAGUUCCUCAAG (13594, SEQ ID NO 9
- UGACUCGACAAAGGCCACAGGCA (13595, SEQ ID NO, 10
- CCAGCAUUUCCAGAGCAGAGCCU 13642, SEQ ID NO 11
- Transient expression may last for a month or more with a non-rephcating vector and even longer
- RNA U S Patent No 4,987,071 , WO 93/23057
- the mechanism of ⁇ bozyme action involves sequence-specific hybridization of the ⁇ bozyme molecule to complementary target RNA, followed by endonucleolytic cleavage
- engineered hammerhead motif ⁇ bozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of RNA encoding PROST-Ets
- Specific ⁇ bozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ⁇ bozyme cleavage sites which include the following sequences, GUA, GUU and GUC
- short RNA sequences of between 15 and 20 ⁇ bonucleotides corresponding to the region of the target gene containing the cleavage site may be evaluated for secondary structural features which may render the ohgonucleotide inoperable
- the suitability of candidate targets may also be evaluated by testing accessibility to hybridization with complementary o
- Antisense molecules and ribozymes of the invention may be prepared by any method known in the art for the synthesis of RNA molecules These include techniques for chemically synthesizing ohgonucleotides such as solid phase phosphoramidite chemical synthesis
- RNA molecules may be generated by in vitro and in vivo transcription or by DNA sequences encoding PROST-Ets Such DNA sequences may be incorporated into a wide variety of vectors with suitable RNA polymerase promoters such as T7 or SP6 Alternatively antisense cDNA constructs that synthes ize antisense RNA constitutively or inducibly can be introduced into cell lines, cells or tissues
- RNA molecules may be modified to increase intracellular stability and half-life Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and/or 3' ends of the molecules or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the backbone of the molecule Increased stability can also be achieved by the inclusion of nontraditional bases such as mosine and queosine as well as acetyl-, methyl-, thio- and similarly modified forms of adenme, cytidine, guanine, thymine, and undine which are not as easily recognized by endogenous endonucleases
- Methods for introducing antisense vectors into cells or tissues include those methods discussed infra and which are equally suitable for in vivo, in vitro and ex vivo therapy For ex vivo therapy, antisense vectors are introduced into cells taken from the patient and clonally propagated for autologous transplant back into that same patient as presented in U S Pat No
- the present invention also relates to assays and methods which can be used to identify agents that bind to PROST-Ets Specifically, agents that bind to PROST-Ets can be identified by the ability of the PROST-Ets ligand or other agent or constituent to bind to
- PROST-Ets and/or the ability to inhibit/stimulate PROST-Ets activity are suitable for use in high through-put screening methods
- the assay comprises mixing PROST-Ets with a test agent or cellular extract After mixing under conditions that allow association of PROST-Ets with the agent or component of the extract the mixture is analyzed to determine if the agent/component is bound to PROST-Ets Binding agents/components are identified as being able to bind to PROST-Ets Alternatively or consecutively, PROST-Ets activity can be directly assessed as a means for identifying agonists and antagonists of PROST-Ets activity
- agents that bind to a PROST-Ets polypeptide can be identified using a yeast two-hybrid system or a binding capture assay
- yeast two hybrid system an expression unit encoding a fusion protein made up of one subunit of a two subunit transcription factor and the PROST-Ets polypeptide is introduced and expressed in a yeast cell
- the cell is further modified to contain (1 ) an expression unit encoding a detectable marker whose expression requires the two subunit transcription factor for expression and (2) an expression unit that encodes a fusion protein made up of the second subunit of the transcription factor and a cloned segment of DNA If the cloned segment of DNA encodes a protein that binds to the PROST-Ets polypeptide, the expression results in the interaction of PROST-Ets and the encoded protein This brings the two subunits of the transcription factor into binding proximity, allowmg reconstitution of the transcription factor This results in expression of the detectable marker
- the yeast two hybrid system is particularly useful in screening a
- PROST-Ets polypeptides which may be used in the above assays include, but are not limited to, an isolated PROST-Ets polypeptide, a fragment of a PROST-Ets polypeptide, a cell that has been altered to express a PROST-Ets polypeptide, or a fraction of a cell that has been altered to express a PROST-Ets polypeptide Further, the PROST-Ets polypeptide can be the entire polypeptide or a defined fragment of the PROST-Ets polypeptide It will be apparent to one of ordinary skill in the art that so long as the PROST-Ets polypeptide can be assayed for agent binding, e g by a shift in molecular weight or activity, the present assay can be used
- the method used to identify whether an agent cellular component binds to a PROST- Ets polypeptide will be based primarily on the nature of the PROST-Ets polypeptide used For example, a gel retardation assay can be used to determine whether an agent binds to PROST- Ets or a fragment thereof Alternatively, immunodetection and biochip technologies can be adopted for use with the PROST-Ets polypeptide A skilled artisan can readily employ numerous art-known techniques for determining whether a particular agent bind to a PROST- Ets polypeptide
- Agents and cellular components can be further tested for the ability to modulate the activity of a PROST-Ets polypeptide using a cell-free assay system or a cellular assay system As the activities of the PROST-Ets polypeptide become more defined, functional assays based on the identified activity can be employed
- an agent is said to antagonize PROST-Ets activity when the agent reduces PROST-Ets activity
- the preferred antagonist will selectively antagonize PROST-Ets, not affecting any other cellular proteins Further, the preferred antagonist will reduce PROST- Ets activity by more than 50%, more preferably by more than 90%, most preferably eliminating all PROST-Ets activity
- Agents that are assayed in the above method can be randomly selected or rationally selected or designed as used herein, an agent is said to be randomly selected when the agent is chosen randomly without considering the specific sequences of the PROST-Ets polypeptide
- An example of randomly selected agents is the use of a chemical library or a peptide combinatorial library, or growth broth of an organism or plant extract
- an agent is said to be rationally selected or designed when the agent is chosen on a nonrandom basis that takes into account the sequence of the target site an/or its conformation in connection with the agent's action
- Agents can be rationally selected or rationally designed by utilizing the peptide sequences that make up the PROST-Ets polypeptide
- a rationally selected peptide agent can be a peptide whose ammo acid sequence is identical to a fragment of a PROST-Ets polypeptide
- agents tested in the methods of the present invention can be, as examples, peptides, antibodies, ohgonucleotides, small molecules and vitamin derivatives, as well as carbohydrates
- agents of the present invention are peptide agents whose ammo acid sequences are chosen based on the ammo acid sequence of the PROST-Ets polypeptide
- Peptide agents can be prepared using standard solid phase (or solution phase) peptide synthesis methods, as is known in the art
- the DNA encoding these peptides may be synthesized using commercially available ohgonucleotide synthesis instrumentation and produced recombinantly using standard recombinant production systems The production using solid phase peptide synthesis is necessitated if no-gene-encoded am o acids are to be included
- Another class of agent of the present invention are antibodies immunoreactive with critical positions of the PROST-Ets polypeptide As described above, antibodies are obtained by immunization of suitable mammalian subjects with peptides, containing as antigenic regions those portions of the PROST-Ets polypeptide intended to be targeted by the antibodies Such agents can be used in competitive binding studies to identify second generation inhibitory agents as well as to block PROST-Ets activity
- the cellular extracts tested in the methods of the present invention can be, as examples, agueous extracts of cells or tissues, organic extracts of cells or tissues or partially purified cellular fractions A skilled artisan can readily recognize that there is no limit as to the source of the cellular extract used in the screening method of the present invention
- Agents that bind a PROST-Ets polypeptide can be used to modulate the activity of PROST-Ets, to target anticancer agents to appropriate mammalian cells, or to identify agents that block the interaction with PROST-Ets Cells expressing PROST-Ets can be targeted or identified by using an agent that binds to PROST- Ets
- PROST-Ets binding agents can be used to deliver conjugated toxins, such as diphtheria toxin, cholera toxin, ⁇ cin or pseudomonas exotoxm, to a
- PROST-Ets expressing cell modulate PROST-Ets activity, to directly kill a PROST-Ets expressing cell, or in screens to identify competitive binding agents
- a PROST- Ets inhibitory agent can be used to directly inhibit the growth of PROST-Ets expressing cells whereas a PROST-Ets binding agent can be used as a diagnostic agent
- the present invention also relates to pharmaceutical compositions which may comprise prost-ets polynucleotides, PROST-Ets polypeptides, antibodies, agonists, antagonists, or mhibitors, alone or in combination with at least one other agent, such as stabilizing compound, which may be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water Any of these molecules can be administered to a patient alone, or in combination with other agents, drugs or hormones, in pharmaceutical compositions where it is mixed with exc ⁇ p ⁇ ent(s) or pharmaceutically acceptable carriers
- the pharmaceutically acceptable carrier is pharmaceutically inert
- the present invention also relates to the administration of pharmaceutical compositions Such administration is accomplished orally or parenterally Methods of parenteral delivery include topical, intra-arte ⁇ al (directly to the tumor), intramuscular, subcutaneous, intramedullary, intrathecal, intravent ⁇ cular, intravenous, intrape ⁇ toneal, or intranasal administration
- these pharmaceutical compositions may contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically Further details on techniques for formulation and administration may be found in the latest edition of Remington's Pharmaceutical Sciences (Ed Maack Publishing Co, Easton Pa )
- compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration Such carriers enable the pharmaceutical compositions to be formulated as tablEts, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for ingestion by the patient
- compositions for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablEts or dragee cores
- Suitable excipients are carbohydrate or protein fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol, starch from corn, wheat, rice, potato, or other plants, cellulose such as methyl, cellulose, hydroxypropylmethylcellulose, or sodium carboxymethylcellulose and gums including arable and tragacanth, and proteins such as gelatin and collagen
- disintegrating or solubilizmg agents may be added, such as the cross-linked polyvinyl pyrrolidone agar, algmic acid, or a salt thereof, such as sodium algmate
- Dragee cores are provided with suitable coatings such as concentrated sugar solutions, which may also contain gum arable, talc, polyvmylpyrrolidone, carbopol gel, polyethylene glycol and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures Dyestuffs or pigments may be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, ie dosage
- suitable coatings such as concentrated sugar solutions, which may also contain gum arable, talc, polyvmylpyrrolidone, carbopol gel, polyethylene glycol and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures
- Dyestuffs or pigments may be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, ie dosage
- Push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating such as glycerol or sorbitol
- Push-fit capsules can contain active ingredients mixed with a filler or binders such as lactose or starches, lubricants such as talc or magnesium stearate, and optionally, stabilizers
- the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol with or without stabilizers
- compositions for parenteral administration include aqueous solutions of active compounds
- the pharmaceutical compositions of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiologically buffered saline
- Aqueous injection suspensions may contain substances which increase viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran
- suspensions of the active compounds may be prepared as appropriate oily injection suspensions
- Suitable lipophihc solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes
- the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions
- penetrants appropriate to the particular barrier to be permeated are used in the formulation Such penetrants are generally known in the art
- the invention further relates to pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions of the invention Associated with such conta ⁇ ner(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture use or sale of pharmaceuticals or biological products, reflecting approval by the agency of the manufacture, use or sale of the product for human administration
- compositions of the present invention may be manufactured in a manner that is known in the art, e g , by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes
- the pharmaceutical composition may be provided as a salt and can be formed with may acids, including by not limited to hydrochloric, sulfu ⁇ c, acetic, lactic, tarta ⁇ c, malic, succinic, etc Salts tend to be more soluble in aqueous or other protonic solvents that are the corresponding free base forms
- the preferred preparation may be a lyophi zed powder in 1 mM- 50 mM histidme, 0 1 %-2% sucrose, 2%-7% mannitol at a pH range of 4 5 to 5 5 that is combined with buffer prior to use
- compositions comprising a compound of the invention formulated in an acceptable carrier
- labeling would include amount, frequency and method of administration
- compositions suitable for use in the present invention include compositions wherein the active ingredients are contained in an effective amount to achieve the intended purpose, i e treatment of a particular disease state characterized by PROST-Ets expression
- the therapeutically effective dose can be estimated initially either in cell culture assays, e g , neoplastic cells, or in animal models, usually mice, rabbits, dogs, or pigs The animal model is also used to achieve a desirable concentration range and route of administration Such information can then be used to determine useful doses and routes for administration in humans
- a therapeutically effective dose refers to that amount of protein or its antibodies, antagonists, or inhibitors which ameliorate the symptoms or condition
- Therapeutic efficacy and toxicity of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e g , ED 50 (the dose therapeutically effective in 50% of the population) and LD 50 (the dose lethal to 50% of the population)
- compositions which exhibit large therapeutic indices are preferred
- the data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use
- the dosage of such compounds lies preferably within a range of circulating concentrations what include the ED 50 w ⁇ th little or no toxicity
- the dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration
- the exact dosage is chosen by the individual physician in view of the patient to be treated Dosage and administration are adjusted to provide sufficient levels of the active moiety or to maintain the desired effect Additional factors which may be taken into account include the severity of the disease state, eg, tumor size and location, age, weight and gender of the patient diet, time and frequency of administration, drug comb ⁇ nat ⁇ on(s), reaction sensitivities, and tolerance/response to therapy Long acting pharmaceutical compositions might be administered every 3 to 4 days, every week, or once every two weeks depending on half-life and clearance rate of the particular formulation Normal dosage amounts may vary from 0 1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration Guidance as to particular dosages and methods of delivery is provided in the literature See U S Pat Nos 4,657,760, 5,206,344, or 5,225,212 Those skilled in the art will employ different formulations for polynucleotides than for protems or their inhibitors Similarly, delivery of polynucleotides or
- Prost-ets was identified as a gene expressed in the prostate by mining Incyte's LifeSeq gene expression database Incyte's Lifeseq database was mined for sequences expressed in either a prostate or tumor specific manner The original clone identified was Incyte Clone
- Northern blot analysis Northern blots were performed using 2 ⁇ g of poly(A) RNA from multiple human tissues (purchased from Clontech) Blots were probed with a radiolabelled probe made from the insert of a prost-ets plasmid (Incyte Clone 1794731 , see
- PROST-Ets coding region was inserted into the protein expression vector pET15b, which was obtained from Stratagene A 6Xh ⁇ s-tagged PROST-Ets polypeptide was expressed in E coli upon induction with IPTG The expressed polypeptide was purified to greater than
- Peptides were covalently coupled to keyhole limpet hemocyanm (KLH), via an additional ammo- terminal cysteme, for use as immunogen Similarly, a bovine serum albumin (BSA) conjugate was prepared for the analysis of antisera titers via ELISA
- Antisera were tested via Western blot for binding to a purified PROST-Ets protein expressed as a 6H ⁇ s-PROST-Ets fusion protein in £ coli (See Figure 7) Antisera which recognized the PROST-Ets fusion protein were further tested for their ability to recognize the naturally occurring protein in lysates prepared from PC3 cells Rabbit polyclonal antisera were also raised against the 6H ⁇ s-PROST-Ets fusion protein purified from £ coli
- the prostate tumor cell lines PC-3 and LNCaP, were selected for evaluation of the role of PROST-Ets in cell proliferation using antisense ohgonucleotides to reduce mRNA expression in the selected cell lines
- These two prostate tumor cell lines express prost-ets mRNA, while normal primary prostate epithelial cells and cells derived from a BPH sample do not express significant levels of this mRNA
- the antisense ohgonucleotides used have the sequences
- the Tet-On system (Clontech) was used to generate derivatives of the PC3 prostate tumor cells and BPH prostate non-tumorigenic cell line which contained stably integrated reverse tet repressor-VP16 protein, a protein which binds and activates transcription in the presence of doxycychne
- PC3-tet-on cell lines and two BPH-tet-on cell lines, containing different levels of tet-on activities were generated according to the manufacturer's instructions and stored Two of these PC3-tet-on cell lines were found to have retained the growth rate in vitro and tumongenicity characteristics in vivo of their parent PC3 cell line
- the pBI-EGFP vector from Clontech was used to express sense and antisense prost-ets messages Several different antisense constructs were made that express different fragments of the prost-ets antisense message The fragments were an approximately 0 45 Kb fragment containing the 5' untranslated region, an approximately 0 5 Kb fragment containing the 3' untranslated region, and a full-length antisense molecule (in Figure 9, 5utr, 3utr, and cDNA, respectively) These fragments were incorporated into the vector using standard techniques
- polypeptide fragments coding for various portions of the PROST-Ets polypeptide are inserted into vectors and expressed within PC3 -tet-on prostate tumor cells, following induction with doxycychne Alternatively, the fragments are expressed in E coli as fusion proteins with a peptide derived from the HIV TAT protein
- the TAT peptide has been shown to act as an efficient "protein transduction domain" for a number of intracellular proteins including transcription factors Using either method of polypeptide expression, the presence of these expressed protein fragments is observed to have a negative effect on tumor cell growth, indicating that these fragments are acting as dominant-negative reagents
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Epidemiology (AREA)
- Urology & Nephrology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
Abstract
Description
Claims
Applications Claiming Priority (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16818299P | 1999-11-30 | 1999-11-30 | |
| US168182P | 1999-11-30 | ||
| US71815900A | 2000-11-21 | 2000-11-21 | |
| US718159 | 2000-11-21 | ||
| PCT/US2000/042295 WO2001042472A2 (en) | 1999-11-30 | 2000-11-29 | DNA ENCODING A NOVEL PROST-Ets POLYPEPTIDE |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP1234037A2 true EP1234037A2 (en) | 2002-08-28 |
Family
ID=26863872
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP00992356A Withdrawn EP1234037A2 (en) | 1999-11-30 | 2000-11-29 | DNA ENCODING A NOVEL PROST-Ets POLYPEPTIDE |
Country Status (6)
| Country | Link |
|---|---|
| EP (1) | EP1234037A2 (en) |
| JP (1) | JP2003533177A (en) |
| AU (1) | AU4306401A (en) |
| HK (1) | HK1049352A1 (en) |
| NO (1) | NO20022542L (en) |
| WO (1) | WO2001042472A2 (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7867731B2 (en) | 1998-11-04 | 2011-01-11 | Novartis Vaccines And Diagnostics, Inc. | HX2004-6 polypeptide expressed in cancerous cells |
| EP1179093A1 (en) | 1999-05-14 | 2002-02-13 | Chiron Corporation | Expression of ets-domain proteins in cancer |
| EP2280030A3 (en) | 2001-04-10 | 2011-06-15 | Agensys, Inc. | Nucleic acids and corresponding proteins useful in the detection and treatment of various cancers |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6265565B1 (en) * | 1998-04-03 | 2001-07-24 | Incyte Genomics, Inc. | Prostate associated Ets protein |
| US20010010934A1 (en) * | 1998-07-31 | 2001-08-02 | Towia Aron Libermann | Prostate derived ets factor |
| AU3395900A (en) * | 1999-03-12 | 2000-10-04 | Human Genome Sciences, Inc. | Human lung cancer associated gene sequences and polypeptides |
| EP1179093A1 (en) * | 1999-05-14 | 2002-02-13 | Chiron Corporation | Expression of ets-domain proteins in cancer |
-
2000
- 2000-11-29 AU AU43064/01A patent/AU4306401A/en not_active Abandoned
- 2000-11-29 EP EP00992356A patent/EP1234037A2/en not_active Withdrawn
- 2000-11-29 JP JP2001544345A patent/JP2003533177A/en active Pending
- 2000-11-29 WO PCT/US2000/042295 patent/WO2001042472A2/en not_active Ceased
- 2000-11-29 HK HK03101484.8A patent/HK1049352A1/en unknown
-
2002
- 2002-05-29 NO NO20022542A patent/NO20022542L/en unknown
Non-Patent Citations (4)
| Title |
|---|
| CHANG C-H. ET AL: "EXON 4-ENCODED ACIDIC DOMAIN IN THE EPITHELIUM-RESTRICTED ETS FACTOR,", ONCOGENE, vol. 18, 24 June 1999 (1999-06-24), pages 3682 - 3695, XP009003387, DOI: doi:10.1038/sj.onc.1202674 * |
| See also references of WO0142472A3 * |
| SLUSKY ET AL: "STRUCTURE OF THE ETS-1 POINTED DOMAIN AND MITOGEN-ACTIVATED PROTEIN KINASE PHOSPHORYLATION SITE", PROC. NATL. ACAD. SCI., vol. 95, October 1998 (1998-10-01), pages 12129 - 12134 * |
| WASYLYK B. ET AL: "Ets transcription factors: nuclear effectors of the Ras-MAP-kinase", TRENDS IN BIOCHEMICAL SCIENCES, vol. 23, no. 6, June 1998 (1998-06-01), pages 213 - 216, XP004122314, DOI: doi:10.1016/S0968-0004(98)01211-0 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2001042472A2 (en) | 2001-06-14 |
| NO20022542L (en) | 2002-07-29 |
| WO2001042472A3 (en) | 2002-05-10 |
| AU4306401A (en) | 2001-06-18 |
| NO20022542D0 (en) | 2002-05-29 |
| HK1049352A1 (en) | 2003-05-09 |
| JP2003533177A (en) | 2003-11-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7893217B2 (en) | Isolated human antibodies that bind epitopes on RG1 | |
| EP2343085A2 (en) | Antibody against prostate stem cell antigen (PSCA) | |
| US20020009455A1 (en) | DNA encoding a novel PROST 03 polypeptide | |
| WO2001025446A1 (en) | Dna encoding prost 07 polypeptide | |
| WO2001042472A2 (en) | DNA ENCODING A NOVEL PROST-Ets POLYPEPTIDE | |
| US20080267863A1 (en) | Method of Diagnosing, Monitoring, Staging, Imaging and Treating Colon Cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20020528 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
| AX | Request for extension of the european patent |
Free format text: AL PAYMENT 20020528;LT PAYMENT 20020528;LV PAYMENT 20020528;MK PAYMENT 20020528;RO PAYMENT 20020528;SI PAYMENT 20020528 |
|
| 17Q | First examination report despatched |
Effective date: 20021113 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20040127 |
|
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: WD Ref document number: 1049352 Country of ref document: HK |