EP1234037A2 - DNA ENCODING A NOVEL PROST-Ets POLYPEPTIDE - Google Patents

DNA ENCODING A NOVEL PROST-Ets POLYPEPTIDE

Info

Publication number
EP1234037A2
EP1234037A2 EP00992356A EP00992356A EP1234037A2 EP 1234037 A2 EP1234037 A2 EP 1234037A2 EP 00992356 A EP00992356 A EP 00992356A EP 00992356 A EP00992356 A EP 00992356A EP 1234037 A2 EP1234037 A2 EP 1234037A2
Authority
EP
European Patent Office
Prior art keywords
polypeptide
ets
seq
prost
ammo acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00992356A
Other languages
German (de)
French (fr)
Inventor
Richard Harkins
Richard J. Lin
May Luke
Felipe Monteclaro
Deborah Parkes
Gordon Parry
Renate Steinbrecher
Pamela Toy Van Heuit
Jian-Ai Xuan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bayer Pharma AG
Original Assignee
Schering AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Schering AG filed Critical Schering AG
Publication of EP1234037A2 publication Critical patent/EP1234037A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6843Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a material from animals or humans
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/08Drugs for disorders of the urinary system of the prostate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • This invention relates, in part, to newly identified polynucleotides and polypeptides, variants and derivatives of the polynucleotides and polypeptides, methods of making the polynucleotides and polypeptides, and their variants and derivatives, antibodies directed toward the polypeptides, their variants and derivatives, and uses of the polynucleotides, polypeptides, variants, derivatives and antibodies
  • the invention relates to novel PROST-Ets polypeptides, polynucleotides which encode these polypeptides, antibodies directed toward these polypeptides, and antisense polynucleotides that block
  • Prostate cancer is a frequently occurring disease in man, in that it is found in about one third of men over the age of 45
  • genetic and environmental causes with the majority of cases probably being the result of a combination of both factors
  • prostatic intraepithelial neoplasia PIN
  • early stages of the disease are androgen dependent, while later stages are hormone independent
  • a proliferative disorder of the prostate known as benign prostatic hyperplasia is often detected clinically but is probably not a stage in the development of cancer It is, however, frequently associated with prostate cancer Cancers in the prostate are often multifocal, generally slow growing, and heterogeneous Late stage cancers frequently metastasize to the lymph nodes and to the bone
  • Prostate cancer is usually diagnosed by physical examination and by serum levels of prostate specific antigen (PSA) Radical prostatectomy is the treatment of choice for localized disease Advanced metastatic disease is treated currently by androgen ablation induced by orchiectomy or treatment with GnRH (gonadotrophin releasing hormone), and by anti-androgen therapy However, advanced disease almost invariably becomes hormone resistant and there is no cure for progressive disease Moreover, there are serious side effects associated with both radical prostatectomy and androgen ablation therapy These include a high risk of incontinence and impotence associated with radical prostatectomy and bone fractures and osteoporosis associated with androgen ablation therapy
  • This invention discloses a new transcription factor that is a homologue to the Ets family of proteins This homologue, designated PROST-Ets, is differentially expressed in prostate and breast tissue as compared with other tissues, and may be over-expressed in prostate, breast, and ovarian tumors
  • the invention also discloses agents that reduce the levels of PROST-Ets in tumor cells, thereby inhibiting their growth Such agents, therefore, may be valuable therapeutic agents for prostate, breast, ovarian, and other cancers
  • Ets genes encodes transcription factors that share a highly conserved DNA binding domain, the Ets domain
  • the first Ets gene was originally identified as a viral oncogene in the E26 chicken leukemia virus genome, and numerous cellular homologues spanning organisms from Drosophila to human have been identified Currently, at least 30 different Ets genes are known in vertebrates Important roles for Ets proteins in the regulation of proliferation, transformation, differentiation and apoptosis have been identified (Dittmar and Nordheim, Biochem Biophys Acta 1377 F1 -F1 1 , 1988)
  • Ets proteins are characterized by a highly conserved DNA binding domain, the Ets domain, composed of about 85 ammo acids This Ets domain bears structural similarity to the winged helix-tum-helix set of DNA binding proteins
  • the Ets domain binds to a core recognition motif, 5' -GGA(A T)-3' , that is found in all Ets regulated promoters that have been studied to date There is additional preference for nucleotide binding in the DNA flanking the core recognition motif
  • the Ets domain may be found close to either the N-terminus, the central region, or close to the C-terminus of the protein
  • a second domain that has been found in many Ets genes codes for another highly conserved domain, known as the PNT or pointed domain
  • the pointed domain functions in protein
  • Ets protein activity Another mechanism of regulating Ets protein activity is through auto inhibition by inhibitory sequences flanking the Ets domains that negatively regulate DNA binding This phenomenon has been defined for several Ets proteins and constitutes one of the ways in which Ets functions can be modulated by derepression This may also explain the molecular actions of Ets activating factors
  • Ets-1 and Ets-2 two human transcription factors, has been directly implicated in tumongenicity and in invasion in many sarcoma and carcinoma cell lines
  • uPA urokinase plasminogen activator
  • Ets-1 activity has also been correlated with tumongenicity in gastric and pancreatic cancer (Vandenbunder et al , Invasion and Metastasis 14 198-209, 1994)
  • Growth factors including EGF and FGF promote Ets-1 and Ets-2 expression, leading to activation of uPA and matrix metalloproteinase promoters by Ets proteins in conjunction with other transcription factors (Chen et al , Cancer Res 57 2009-2013, 1997)
  • Ets binding sites and hormonal response elements have been identified in the promoter of the maspin gene This is a tumor suppressing protease inhibitor expressed in the prostate and breast Its regulation by Ets proteins again implicates this family of transcription factors in the tumorigenic process (Sementchenko et al , Oncogene 17 2883-2888, 1998, Oettgen et al , J Biol Chem 275 1216-1225 2000)
  • the present invention provides a polynucleotide sequence which uniquely encodes a novel transcription factor designated herein as PROST-Ets
  • PROST-Ets polypeptide is characterized by a pointed domain, involved with protein-protein interactions, at ammo acids 131 to 213, and an Ets domain, involved with DNA binding, at ammo acids 246 to 332 both of which are general structural characteristics of the Ets family of proteins
  • PROST-Ets shows homology to several members of the Ets family of transcription factors with approximately a 74% homology over 87 ammo acids with Drosophila Ets-4
  • the polynucleotide sequence, designated herein as prost-ets, and described herein in Figure 1 (SEQ ID NO 1 ) encodes the ammo acid sequence for PROST-Ets, which is shown in Figure 2 (SEQ ID NO 2)
  • polypeptides inter alia, that have been identified as novel Ets-like transcription factors, by homology between the am o acid sequence set out in Figure 2 (SEQ ID NO 2) and known ammo acid sequences of other Ets-like transcription factor polypeptides
  • polynucleotides that encode such polypeptides particularly polynucleotides that encode the polypeptide designated herein as PROST-Ets
  • isolated polynucleotides encoding PROST-Ets including mRNAs, cDNAs, genomic DNAs and, in further embodiments of this aspect of the invention, biologically diagnostically, clinically or therapeutically useful variants, analogs or derivatives thereof, or fragments thereof, including fragments of the variants, analogs and de ⁇ vatives
  • novel polypeptides of human origin referred to herein as PROST-Ets as well as biologically, diagnostically or therapeutically useful fragments, variants and derivatives thereof, variants and derivatives of the fragments, and analogs of the foregoing
  • methods of producing the aforementioned PROST- Ets polypeptides comprising culturing host cells having expressibly incorporated therein an exogenously-derived PROST-Ets-encodmg polynucleotide under conditions for expression of human PROST-Ets in the host and then recovering the expressed polypeptide
  • products, compositions and methods for assessing PROST-Ets expression in cells by determining PROST-Ets polypeptides or PROST-Ets-encodmg mRNA, and assaying genetic variation and aberrations, such as defects, in genes for PROST-Ets
  • probes that hybridize to prost-ets polynucleotide sequences
  • antibodies which are highly selective for PROST-Ets polypeptides, or fragments thereof, and which may be employed in a method for diagnosis and/or detection of PROST-Ets expression, which may be associated with prostate cancer
  • antibodies are labeled in such a way as to produce a detectable signal
  • Particularly preferred would be an antibody labeled with a radiolabel, an enzyme, a chromophore or a fluorescer
  • therapeutic agents which are cytotoxic
  • PROST-Ets activity or expression such as prostate cancer
  • peptides and anti-idiotypic antibodies are provided which can be used to stimulate an immune response
  • compositions comprising a prost-ets polynucleotide or a PROST-Ets polypeptide for administration to cells in vitro, to cells ex vivo and to cells in vivo, or to a multicellular organism
  • the compositions comprise a prost-ets polynucleotide for expression of a PROST-Ets poly
  • FIGURE 1 Polynucleotide sequence of prost-ets (SEQ ID NO 1 ), which encodes the biologically or immunologically active form of PROST-Ets
  • FIGURE 2 Deduced ammo acid sequence of the active form of PROST-Ets (SEQ ID NO 2) The pointed (aa 131-213) and Ets (aa 246-332) domains within the sequence are underlmed
  • FIGURE 3 Ammo acid alignment of PROST-Ets with the sequence of Drosophila D- Ets-4 The sequence of PROST-Ets is on the top
  • FIGURE 4 Predicted domain structure of PROST-Ets protein
  • FIGURE 5 Expression of prost-ets mRNA in human tissues by northern blot analysis RNA from human tissues, both tumor and normal, and human cell lines was examined for hybridization of prost-ets mRNA to a radiolabelled probe An mRNA species of 2 4 Kb in size was detected at a high level in prostate and at lower levels in colon and small intestine No expression was detected in the other tissues examined
  • FIGURE 6 Expression of prost-ets mRNA in human tissues by Taqman based PCR analysis RNA from human tissues, both tumor and normal, was isolated by standard techniques Primers and probe to detect prost-ets mRNA expression were designed using Perkm Elmer's Primer Express software and synthesized by Synthetic Genetics Prost-ets mRNA was detected in human prostate tissues, both tumor and normal, and in lower levels in breast tissue, but could not be detected in other normal and tumor tissues
  • FIGURE 7 Immunoreactivity of PROST-Ets synthesized in bacteria Antisera generated against synthetic PROST-Ets sequences (see Example 4) was used in Western blot analysis of PROST-Ets expressed in E co
  • FIGURE 8 Effect of specific reduction of prost-ets mRNA expression on prostate tumor cell growth
  • Three antisense o gonucleotides (13594, 13595, 13642) targeted to prost- ets sequences were utilized (in the form of RNA DNA hybrid molecules) to determine the effect of specific reduction of prost-ets mRNA in the PROST-Ets-expressing PC3 human prostate cell line Mismatched antisense molecules were used as controls and GBC 3 3 is a non-specific antisense control Nuclear area is proportional to cell number
  • FIGURE 9 Growth inhibition of PC3 cells by inducible antisense messages
  • PC3 cell lines were transfected with vectors containing PROST-Ets antisense messages (see Example 6) and were treated with doxycyclme to induce transcription of the antisense ohgonucleotides
  • Cell growth was measured following treatment and demonstrated antisense specific inhibition of growth
  • the antisense molecules used were cDNA , a full-length antisense molecule, 5utr, a 5' antisense molecule, and 3utr, a 3' antisense molecule DETAILED DESCRIPTION OF THE INVENTION
  • PROST-Ets refers to the polypeptide having the ammo acid sequence set out in Figure 2 (SEQ ID NO 2), variants, analogs, derivatives and fragments thereof, and fragments of the variants, analogs and derivatives.
  • fragment when referring to the polypeptide of Figure 2 (SEQ ID NO 2) mean a polypeptide which retains essentially the same biological and/or immunological activity as the polypeptide of Figure 2
  • prost-ets refers to the polynucleotide having the sequence set out in Figure 1 (SEQ ID NO 1 ) and polynucleotides encoding polypeptides having the ammo acid sequence of PROST-Ets set out in Figure 2 (SEQ ID NO 2), and to polynucleotides encoding PROST-Ets variants, analogs, derivatives and fragments, and fragments of the variants analogs and de ⁇ vatives Prost-ets also refers to such polynucleotides composed of RNA as well as to polynucleotides which are the complement of polynucleotides which encode the polypeptide sequence set out in Figure 2 (SEQ ID NO 2)
  • Polynucleot ⁇ de(s) generally refers to any poly ⁇ bonucleotide or polydeox ⁇ bonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA
  • polynucleotides as used herein refers to, among others, smgle-and double- stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double- stranded or a mixture of single- and double-stranded regions
  • polynucleotide as used herein refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA The strands in such regions may be from the same molecule or from different molecules The regions may include all of one or more of the molecules, but more typically involve only a region of some of the molecules One of the molecules of a triple-helical region often is an o gonucleotide
  • polynucleotide includes DNAs or RNAs as described above that contain one or more modified bases
  • DNAs or RNAs with backbones modified for stability or for other reasons are “polynucleotides” as that term is intended herein
  • DNAs or RNAs comprising unusual bases such as mosine, or modified bases, such as t ⁇ tium- labelled bases, to name just two examples are polynucleotides as the term is used herein
  • polynucleotide as it is employed herein embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including simple and complex cells, inter alia
  • Polypeptides includes all polypeptides as described below The basic structure of polypeptides is well known and has been described in innumerable textbooks and other publications in the art In this context, the term is used herein to refer to any peptide or protein comprising two or more am o acids joined to each other in a linear chain by peptide bonds As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types It will be appreciated that polypeptides often contain ammo acids other than the 20 ammo acids commonly referred to as the 20 naturally occurring ammo acids, and that many ammo acids, including the terminal ammo acids, may be modified in a given polypeptide, either by natural processes such as glycosylation and other post-translational modifications, or by chemical modification techniques which are well known in the art Even
  • polypeptides are not always entirely linear
  • polypeptides may be branched as a result of ubiquitmation, and they may be circular, with or without branching, generally as a result of posttranslational events, including natural processing events and events brought about by human manipulation which do not occur naturally Circular, branched and branched circular polypeptides may be synthesized by non-translational natural processes and by entirely synthetic methods, as well
  • Modifications can occur anywhere in a polypeptide, including the peptide backbone, the am o acid side-chains and the ammo or carboxyl termini
  • blockage of the ammo or carboxyl group in a polypeptide, or both, by a covalent modification is common in naturally occurring and synthetic polypeptides and such modifications may be present in polypeptides of the present invention, as well
  • the ammo terminal residue of polypeptides made in E coli, prior to proteolytic processing almost invariably will be N-formylmethionine
  • polypeptides made by expressing a cloned gene in a host for instance, the nature and extent of the modifications in large part will be determined by the host cell posttranslational modification capacity and the modification signals present in the polypeptide ammo acid sequence
  • glycosylation often does not occur in bacterial hosts such as E coli
  • a polypeptide should be expressed in a glycosylatmg host, generally a eukaryotic cell Insect cells often carry out the same posttranslational glycosylations as mammalian cells and, for this reason, insect cell expression systems have been developed to efficiently express mammalian proteins having native patterns of glycosylation, inter alia Similar considerations apply to other modifications
  • polypeptide encompasses all such modifications particularly those that are present in polypeptides synthesized by expressing a polynucleotide in a host cell
  • Polynucleotide encoding a polypeptide encompasses polynucleotides which include a sequence encoding a polypeptide of the present invention, particularly the PROST-Ets polypeptide having the ammo acid sequence set out in Figure 2 (SEQ ID NO 2)
  • the term encompasses polynucleotides that include a single continuous region or discontinuous regions encoding the polypeptide (for example, interrupted by introns) together with additional regions
  • Bioactivity refers to the structural, regulatory or biochemical functions of naturally occurring PROST-Ets polypeptide
  • Immunologic activity refers to the capability of the natural, recombinant or synthetic PROST-Ets, or any fragment thereof, to induce a specific immune response in appropriate animals or cells and to bind with specific antibodies
  • Oligonucleot ⁇ de(s) refers to relatively short polynucleotides Often the term refers to single-stranded deoxyr ibonucleotides but it can refer as well to single- or double-stranded ⁇ bonucleotides, RNA DNA hybrids and double-stranded DNAs, among others
  • Ohgonucleotides, such as single-stranded DNA probe ohgonucleotides often are synthesized by chemical methods, such as those implemented on automated ohgonucleotide synthesizers
  • ohgonucleotides can be made by a variety of other methods, including in vitro recombinant DNA-mediated techniques and by expression of DNAs in cells and organisms
  • “Ohgonucleotides” or “ohgomers” or polynucleotide “fragment”, “portion”, or “segment” refers to a polynucleotide sequence of at least about 10 nucleotides and as many as about 60 nucleotides, preferably about 15 to 30 nucleotides, and more preferably about 20-25 nucleotides
  • Non- occurring PROST-Ets refers to PROST-Ets produced by human cells that have not been genetically engineered and specifically contemplates various PROST-Ets forms arising from post-translational modifications of the polypeptide including but not limited to acetylation, carboxylation, glycosylation, phosphorylation, hpidation, acylation, and cleavage "Var ⁇ ant(s)" of polynucleotides or polypeptides, as the term is used herein, are polynucleotides or polypeptides that differ from a reference polynucleotide or polypeptide, respectively Variants in this sense are described below and elsewhere in the present disclosure in greater detail
  • changes in the polynucleotide sequence of the variant may be silent That is, they may not alter the ammo acids encoded by the polynucleotide Where alterations are limited to silent changes of this type a variant will encode a polypeptide with the same ammo acid sequence as the reference. Also as noted below, changes in the polynucleotide sequence of the variant may alter the ammo acid sequence of a polypeptide encoded by the reference polynucleotide Such polynucleotide changes may result in ammo acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below (2) A polypeptide that differs in ammo acid sequence from another, reference polypeptide Generally, differences are limited so that the sequences of the reference and the variant are closely similar overall and, in many regions, identical A variant and reference polypeptide may differ in ammo acid sequence by one or more substitutions, additions, deletions, fusions and trunc
  • Allehc variant refers to an alternative form of the prost-ets polynucleotide Alleles result from a mutation, i e , a change in the polynucleotide sequence, and generally produce altered mRNAs or polypeptides whose structure or function may or may not be altered Any given gene may have none, one or many alle c forms Common mutational changes which give rise to alleles are generally ascribed to natural deletions, additions or substitutions of nucleotides Each of these types of changes may occur alone, or in combination with the others, or one or more times in a given sequence "Derivative” refers to polynucleotides or polypeptides derived from naturally occurring prost-ets or PROST-Ets, respectively, by chemical modifications such as ubiquitmation, labeling (e g , with radionuclides, various enzymatic modifications), pegylation (de ⁇ vatization with polyethylene glycol) or by insertion or substitution of ammo acids such as or
  • “Deletion” is defined as a change in either polynucleotide or ammo acid sequences in which one or more polynucleotides or am o acid residues, respectively, are absent
  • “Insertion” or “addition” is that change in a polynucleotide or ammo acid sequence which has resulted in the addition of one or more polynucleotides or ammo acid residues respectively, as compared to the naturally occurring polynucleotide or ammo acid sequence
  • substitution results from the replacement of one or more polynucleotides or ammo acids by different polynucleotides or ammo acids, respectively
  • ammo acid substitutions are the result of replacing one ammo acid with another ammo acid having similar structural and/or chemical properties, such as the replacement of a leucine with an isoleucme or vahne, an aspartate with a glutamate, or a threonme with a se ⁇ ne, i e conservative ammo acid replacement Insertions or deletions are typically in the range of about 1 to 5 ammo acids
  • the variation allowed may be experimentally determined by systematically making insertions, deletions, or substitutions of ammo acids in the polypeptide using recombinant DNA techniques and assaying the resulting recombinant variants for activity
  • “Fragment” is a polypeptide having an ammo acid sequence that entirely is the same as part but not all of the ammo acid sequence of the aforementioned PROST-Ets polypeptides and variants or derivatives thereof
  • a polypeptide "fragment”, “portion”, or “segment” is a stretch of ammo acid residues of at least about 5 ammo acids, often at least about 7 am o acids, typically at least about 9 to 13 ammo acids, and in various embodiments, at least about 17 or more ammo acids
  • Recombinant or “recombinant DNA molecule” refers to a polynucleotide sequence which is not naturally occurring, or is made by the artificial combination of two otherwise separated segments of sequence
  • recombinantly produced is meant artificial combination often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of polynuc eotides, e g , by genetic engineering techniques Such manipulation is usually done to replace a codon with a redundant codon encoding the same or a conservative ammo acid, while typically introducing or removing a sequence recognition site Alternatively, it is performed to join together polynucleotide segments with desired functions to generate a single genetic entity comprising a desired combination of functions not found in the common natural forms Restriction enzyme recognition sites, regulation sequences, control sequences, or other useful features may be incorporated by design
  • Recombinant DNA molecules include cloning and expression vectors
  • Recombinant may also refer to a polynucleotide which encodes a polypeptide and
  • isolated means altered “by the hand of man” from its natural state, i e , that, if it occurs in nature, it has been changed or removed from its original environment, or both
  • a naturally occurring polynucleotide or a polypeptide naturally present in a living animal in its natural state is not “isolated”, but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is “isolated”, as the term is employed herein
  • polynucleotides the term isolated means that it is separated from the chromosome and cell in which it naturally occurs
  • Polynucleotides and polypeptides may occur in a composition, such as media formulations, solutions for introduction of polynucleotides or polypeptides, for example into cells compositions or solutions for chemical or enzymatic reactions, for instance, which are not naturally occurring compositions, and, therein remain isolated polynucleotides or polypeptides within the meaning of that term as it is
  • Substantially pure and “substantially homogenous” are used interchangeably and describe PROST-Ets polypeptide, or fragments thereof, or a polynucleotide segment encoding same, where such polypeptide or polynucleotide is separated from components that naturally accompany it
  • a PROST-Ets polypeptide or fragment thereof, or DNA segment encoding same is substantially free of naturally-associated components when it is separated from the native contaminants which accompany it in its natural state
  • a polypeptide that is chemically synthesized or synthesized in a cellular system different from the cell in which it naturally originates will be substantially free from its naturally-associated components
  • a polynucleotide that is chemically synthesized or synthesized in a cellular system different from the cell in which it naturally originated will be substantially free from its naturally-associated components
  • “Polymerase chain reaction” or “PCR” refers to a procedure wherein specific pieces of DNA are amplified as described in U S Pat No 4,683,195, issued 28 July 1987 Generally, sequence information from the ends of the polypeptide fragment of interest or beyond needs to be available, such that oligonucleotide primers can be designed, these primers will point towards one another, and will be identical or similar in sequence to opposite strands of the template to be amplified The 5 terminal nucleotides of the two primers will coincide with the ends of the amplified material PCR can be used to amplify specific
  • Hybridization shall include “any process by which a polynucleotide strand joins with a complementary strand through base pairing” (Coombs, J , Dictionary of Biotechnology, Stockton Press, New York, N Y , 1994)
  • “Therapeutically effective dose” refers to that amount of polypeptide or its antibodies, antagonists, or inhibitors, including antisense molecules and ⁇ bozymes, which ameliorate the symptoms or conditions of a disease state Therapeutic efficacy and toxicity of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e g , ED 50 (the dose therapeutically effective in 50% of the population) and LD 50 (the dose lethal to 50% of the population) The dose ratio between therapeutic and toxic effects is the therapeutic index, and it can be expressed as the ratio, ED 50 /LD 50
  • Treating covers the treatment of a disease-state in a human patient, which disease-state is associated with prostate tumor growth and includes disease states in which the patient is in need of decreased levels of PROST-Ets
  • the present invention relates to novel PROST-Ets polypeptides, prost-ets polynucleotides, and antibodies directed toward PROST-Ets polypeptides, among other things, as described in greater detail below
  • the invention relates to novel PROST-Ets polypeptides and the polynucleotides encoding these PROST-Ets polypeptides, and relates especially to PROST-Ets having the ammo acid sequence set out in Figure 2 (SEQ ID NO 2) and prost-ets having the polynucleotide sequence set out in Figure 1 (SEQ ID NO 1 )
  • the present invention also encompasses PROST-Ets variants
  • a preferred PROST-Ets variant is one having at least 70% similarity (preferably at least 70% identity) to the polypeptide sequence shown in Figure 2 (SEQ ID NO 2) and more preferably at least 90% similarity (more preferably at least 90% identity) to the polypeptide shown in Figure 2 (SEQ ID NO 2) and still more preferably at
  • PROST-Ets contains two domains characteristic of the Ets family of proteins a pointed domain (involved in protein-protein interactions) at ammo acids 131 to 213 and an Ets domain (involved in DNA binding) at ammo acids 246 to 332
  • the present invention is based in part on the structural homology shown in Figure 3 between PROST-Ets and Drosophila D-Ets-4, another member of the Ets family of transcription factors
  • the ammo acid sequence of PROST-Ets is approximately 74% homologous to Drosophila D-Ets-4 over 87 am o acids
  • the invention is also based in part on the expression profile of prost-ets mRNA, which is characterized by expression in prostate tissue libraries and overexpression in prostate tumor libraries. This tissue profile is seen in analysis of mRNA expression in tissue samples from normal and tumor tissues by Northern blotting and by PCR based Taqman analysis Both methods of analysis demonstrated that mRNA encoding PROST-Ets is expressed at high levels in prostate tissues and in a limited number of other tissues, including colon and breast
  • the invention is also based in part on a number of functional studies demonstrating the effect of a reduction in the level of mRNA encoding PROST-Ets on prostate tumor cell growth in culture
  • PC-3 prostate tumor cell line
  • antisense ohgonucleotides to reduce prost-ets mRNA expression
  • Three antisense ohgonucleotide reagents were found that reduced mRNA levels for PROST-Ets when administered to cells in the presence of lipids
  • Administration of these antisense ohgonucleotide reagents to PC-3 cells inhibited proliferation of the cells in a dose dependent manner
  • a control ohgonucleotide mixture composed of a set of random 23mer ohgonucleotides did not affect proliferation of the cells
  • antisense ohgonucleotides directed to regions of the PROST-Ets sequence were transfected into PC
  • isolated polynucleotides that encode the PROST-Ets polypeptide having the deduced am o acid sequence of Figure 2 (SEQ ID NO 2) Using the information provided herein, such as the polynucleotide sequence set out in
  • Figure 1 a polynucleotide of the present invention encoding a PROST-Ets polypeptide may be obtained using standard cloning and screening procedures such as those for cloning cDNAs using mRNA from cells of human tissue as starting material
  • the polynucleotide sequence in Figure 1 was found in cDNA clones obtained from human prostate tissues.
  • Prost-ets was identified as a gene expressed in the prostate by mining Incyte's LifeSeq gene expression database for sequences expressed in either a prostate or tumor specific manner
  • the original clone identified was Incyte Clone 581956, discovered in a prostate tumor library This clustered with other Incyte clones, including 1813005, and 1794731 These clones were acquired from Incyte and used for experimental purposes including sequence determination and expression analysis
  • the nucleotide sequence of Clone 581956 was used for electronic Northern analysis of the expression of the gene in all tissue libraries in Incyte's database
  • Initial screens demonstrated that the PROST-Ets gene was expressed largely in the prostate and overexpressed in prostate tumors In updated versions of the database, it was found to be expressed not only in the prostate but also in breast tumor and ovarian tumor libraries All clones in Incyte's Lifeseq library coding for PROST-Ets were assembled into a contiguous sequence using the Genetics Computer Group (GCG, Wisconsin package) gene assembly program and the sequence of the assembled mRNA evaluated This sequence was edited to improve the quality of the contiguous assembled sequence and an open reading frame coding for a
  • Polynucleotides of the present invention may be in the form of RNA such as mRNA or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced by chemical synthetic techniques or by a combination thereof, or by methods described herein
  • the DNA may be doub'e-stranded or single-stranded Single-stranded DNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand also referred to as the anti-sense strand
  • the coding sequence which encodes the polypeptide may be identical to the coding sequence of the polynucleotide shown in Figure 1 (SEQ ID NO 1 ) It also may be a polynucleotide with a different sequence, which, as a result of the redundancy (degeneracy) of the genetic code, encodes the polypeptide of Figure 2 (SEQ ID NO 2)
  • Polynucleotides of the present invention which encode the polypeptide of Figure 2 may include, but are not limited to, the coding sequence for the polypeptide itself, the coding sequence for the polypeptide and additional coding sequences, such as those encoding a leader or secretory sequence, such as a pre-, or pro- or prepro-prote sequence, the coding sequence of the polypeptide, with or without the aforementioned additional coding sequences, together with additional, non-coding sequences, including for example, but not limited to, introns and non-coding 5 and 3 sequences, such as the transcribed, non- translated sequences that play a role in transcription, mRNA processing (for example, splicing and polyadenylation signals) or additional coding sequences which code for additional ammo acids, such as those which provide additional functionalities
  • the polypeptide may be fused to a marker sequence, such as a peptide, which facilitates purification of the fused polypeptide
  • a marker sequence such as a
  • the polynucleotides may encode a polypeptide which is the polypeptide plus additional ammo or carboxyl-terminal ammo acids, or ammo acids interior to the polypeptide (when the active form has more than one polypeptide chain, for instance)
  • Such sequences may play a role in processing of a polypeptide from precursor to final form, may facilitate polypeptide trafficking, may prolong or shorten polypeptide half-life or may facilitate manipulation of a polypeptide for assay or production, among other things
  • the additional ammo acids may be processed away from the polypeptide by cellular enzymes
  • a precursor polypeptide, having the final form of the polypeptide fused to one or more prosequences may be an inactive form of the polypeptide When prosequences are removed such inactive precursors generally are activated Some or all of the prosequences may be removed before activation Generally, such precursors are called propolypeptides
  • the present invention further relates to variants of the herein above described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced am o acid sequence of Figure 2 (SEQ ID NO 2)
  • a variant of the polynucleotide may be a naturally occurring variant such as a naturally occurring allehc variant, or it may be a variant that is not known to occur naturally
  • Such non-naturally occurring variants of the polynucleotide may be made by mutagenesis techniques, including those applied to polynucleotides, cells or organisms
  • variants in this regard are variants that differ from the aforementioned polynucleotides by polynucleotide substitutions, deletions or additions
  • the substitutions, deletions or additions may involve one or more polynucleotides
  • the variants may be altered in coding or non-coding regions or both Alterations in the coding regions may produce conservative or non-conservative ammo acid substitutions, deletions or additions
  • polypeptides having the am o acid sequence of PROST-Ets set out in Figure 2 SEQ ID NO 2
  • variants, analogs, derivatives and fragments thereof variants of the variants, analogs and derivatives
  • polynucleotides encoding PROST-Ets variants, analogs, derivatives and fragments, and variants, analogs and derivatives of the fragments which have the ammo acid sequence of the PROST-Ets polypeptide of Figure 2 (SEQ ID NO 2) in which several, a few, 5 to 10, 1 to 5, 1 to 3, 2, 1 or no ammo acid residues are substituted, deleted or added, in any combination Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the PROST-Ets polypeptide Also especially preferred in this regard are conservative substitutions Most highly preferred are polynucleotides encoding polypeptides having the am o acid sequence of Figure 2 (SEQ ID NO 2) without substitutions
  • polynucleotides that are at least 70% identical to a polynucleotide encoding the PROST-Ets polypeptide having the ammo acid sequence set out in Figure 2 (SEQ ID NO 2), and polynucleotides which are complementary to such polynucleotides
  • polynucleotides that comprise a region that is at least 80% identical to a polynucleotide encoding the PROST-Ets polypeptide and polynucleotides complementary thereto
  • polynucleotides at least 90% identical to the same are particularly preferred, and among these particularly preferred polynucleotides, those with at least 95% are especially preferred
  • those with at least 97% are highly preferred among those with at least 95%, and among these, those with at least 98% and at least 99% are particularly highly preferred with at least 99% being the more preferred
  • polynucleotides which encode polypeptides which retain substantially the same biological activity as the polypeptide encoded by the polynucleotide sequence of Figure 1 (SEQ ID NO 1 )
  • the present invention further relates to polynucleotides that hybridize to the herein above-described sequences
  • the present invention especially relates to polynucleotides which hybridize under stringent conditions to the herein above-described polynucleotides
  • polynucleotide assays of the invention may be used as a hybridization probes for cDNA and genomic DNA to isolate full-length cDNAs and genomic clones encoding PROST-Ets and to isolate cDNA and genomic clones of other genes that have a high sequence similarity to the prost-ets gene
  • probes generally will comprise at least 15 bases
  • probes will have at least 30 bases and may have at least 50 bases
  • the coding region of the prost-ets gene may be isolated by screening using the known DNA sequence to synthesize an ohgonucleotide probe A labeled ohgonucleotide having a sequence complementary to that of a polynucleotide of the present invention is then used to screen a library of human cDNA, genomic DNA or mRNA to determine to which members of the library the probe hybridizes
  • a polynucleotide of the present invention may encode a polypeptide, a polypeptide plus a leader sequence (which may be referred to as a prepolypeptide), a precursor of a polypeptide having one or more prosequences which are not the leader sequences of a prepolypeptide, or a prepropolypeptide, which is a precursor to a propolypeptide, having a leader sequence and one or more prosequences, which generally are removed during processing steps that produce active forms of the polypeptide
  • the invention also relates to, among others, polynucleotides encoding the polypeptide fragments, polynucleotides that hybridize to polynucleotides encoding polypeptide fragments, particularly those that hybridize under stringent conditions, and polynucleotides, such as PCR primers, for amplifying polynucleotides that encode polypeptide fragments
  • preferred polynucleotides are those that correspond to preferred polypeptide fragments, as discussed below
  • the present invention further relates to a PROST-Ets polypeptide which has the deduced ammo acid sequence of Figure 2 (SEQ ID NO 2)
  • the invention also relates to fragments, analogs and derivatives of these polypeptides
  • fragment, derivative and analog when referring to the polypeptide of Figure 2 (SEQ ID NO 2) means a polypeptide which retains essentially the same biological activity as such a polypeptide
  • an analog includes a propolypeptide which can be activated by cleavage of the propolypeptide portion to produce an active polypeptide of the invention
  • polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide In certain preferred embodiments, it is a recombinant polypeptide
  • the fragment, derivative or analog of the polypeptide of Figure 2 may be (i) one in which one or more of the ammo acid residues are substituted with a conserved or non-conserved am o acid residue (preferably a conserved ammo acid residue) and such substituted am o acid residue may or may not be one encoded by the genetic code, or ( ⁇ ) one in which one or more of the ammo acid residues includes a substituent group, or (in) one in which the polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol) or (iv) one in which the additional ammo acids are fused to the polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the polypeptide
  • a conserved or non-conserved am o acid residue preferably a conserved ammo acid residue
  • substituted am o acid residue may or may not be one encoded by the genetic code
  • polypeptides having the ammo acid sequence of PROST-Ets set out in Figure 2 are polypeptides having the ammo acid sequence of PROST-Ets set out in Figure 2 (SEQ ID NO
  • variants are those that vary from a reference by conservative ammo acid substitutions
  • Such substitutions are those that substitute a given ammo acid in a polypeptide by another ammo acid of like characteristics
  • conservative substitutions are the replacements, one for another, among the aliphatic ammo acids Ala, Val Leu and lie, interchange of the hydroxyl residues Ser and Thr, exchange of the acidic residues Asp and Glu, substitution between the amide residues Asn and Gin, exchange of the basic residues Lys and Arg and replacements among the aromatic residues Phe and Tyr
  • variants, analogs, derivatives and fragments, and variants, analogs and derivatives of the fragments having the ammo acid sequence of the PROST-Ets polypeptide of Figure 2 (SEQ ID NO 2) in which several, a few, 5 to 10, 1 to 5, 1 to 3, 2, 1 or no ammo acid residues are substituted, deleted or added, in any combination Especially preferred among these are silent substitutions, addition
  • polypeptides which have at least 70% similarity (preferably at least 70% identity) to the polypeptide of Figure 2 (SEQ ID NO 2) and more preferably at least 90% similarity (more preferably at least 90% identity) to the polypeptide of Figure 2 (SEQ ID NO 2) and still more preferably at least 95% similarity (still more preferably at least 95% identity) to the polypeptide of Figure 2 (SEQ ID NO 2) and also include portions of such polypeptides with such portion of the polypeptide generally containing at least 30 am o acids and more preferably at least 50 ammo acids
  • Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptides by peptide synthesis, therefore, the fragments may be employed as intermediates for producing the full-length polypeptides Fra ⁇ ments
  • polypeptides comprising fragments of PROST-Ets, most particularly fragments of the PROST- Ets of Figure 2 (SEQ ID NO 2), and fragments of variants and derivatives of the PROST-Ets of Figure 2 (SEQ ID NO 2)
  • a fragment is a polypeptide having an ammo acid sequence that entirely is the same as part but not all of the ammo acid sequence of the aforementioned PROST-Ets polypeptides and variants or derivatives thereof
  • fragments may be "free-standing," i e , not part of or fused to other am o acids or polypeptides, or they may be comprised within a larger polypeptide of which they form a part or region When comprised within a larger polypeptide, the presently discussed fragments most preferably form a single continuous region However, several fragments may be comprised within a single larger polypeptide
  • certain preferred embodiments relate to a fragment of a PROST-Ets polypeptide of the present invention comprised within a precursor polypeptide designed for expression in a host and having heterologous pre- and propolypeptide regions fused to the ammo terminus of the PROST-Ets fragment and an additional region fused to the carboxyl terminus of the fragment Therefore, fragments in one aspect of the meaning intended herein, refers to the portion or portions of a fusion polypeptide or fusion protein derived from PROST-Ets As representative examples of polypeptide fragments of the invention, there may be mentioned those which have from about
  • Truncation mutants include PROST-Ets of Figure 2 (SEQ ID NO 2), or variants or derivatives thereof, except for deletion of a continuous series of residues (that is, a continuous region, part or portion) that includes the am o terminus of the sequence shown in Figure 2 (SEQ ID NO 2), or a continuous series of residues that includes the carboxyl terminus or, as in double truncation mutants, deletion of two continuous series of residues, one including the am o terminus and one including the carboxyl terminus
  • Fragments having the size ranges set out above also are preferred embodiments of truncation fragments, which are especially preferred among fragments generally Especially preferred in this aspect of the invention are fragments characterized by biological and/or immunological attributes of PROST-Ets Most preferred are fragments containing the predicted active domains of PROST-Ets, which encompasses at least ammo acids 131 to 213 and am
  • fragments in this regard are those that comprise regions of PROST-Ets that combine several structural features, such as the features set out above
  • the "pointed” and “Ets' domains, encompassing about ammo acids 131 to 213 and 246 to 332, respectively, which are characteristic of the Ets family of transcription factors, are especially preferred regions
  • Such regions may be comprised within a larger polypeptide or may be by themselves a preferred fragment of the present invention, as discussed above
  • fragments in general are those that mediate activities of PROST-Ets
  • Highly preferred in this regard are fragments that contain regions that are homologs in sequence, or in position, or in both sequence and position to active regions of related polypeptides, such as the other proteins of the Et
  • the present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques
  • vectors which include polynucleotides of the present invention
  • host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques
  • Such techniques are described in Sambrook et al , Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Plamview, N Y , 1989 and Ausubel, F M et al , Current Protocols in Molecular Biology, John Wiley & Sons, New York, N Y , 1989
  • Host cells can be genetically engineered to incorporate polynucleotides and express polypeptides of the present invention
  • polynucleotides may be introduced into host cells using well known techniques of infection, transduction, transfection, transvection and transformation
  • polynucleotides of the invention may be transfected into host cells with another, separate, polynucleotide encoding a selectable marker, using standard techniques for cotransfection and selection in, for instance, mammalian cells
  • the polynucleotides generally will be stably incorporated into the host cell genome
  • the polynucleotides may be joined to a vector containing a selectable marker for propagation in a host
  • the vector construct may be introduced into host cells by the aforementioned techniques
  • a plasmid vector is introduced as DNA in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid Electroporation also may be used to introduce polynucleotides into a host
  • the vector is a virus, it may be packaged in vitro or introduced into a packaging cell and the packaged virus may be transduced into cells
  • a wide variety of techniques suitable for making polynucleotides and for introducing polynucleotides into cells in accordance with this aspect of the invention are well known and routine to those of skill in the art Such techniques are reviewed at length in
  • the vector may be, for example, a plasmid vector, a single or double-stranded phage vector, a single or double- stranded RNA or DNA viral vector
  • Such vectors may be introduced into cells as polynucleotides, preferably DNA, by well known techniques for introducing DNA and RNA into cells
  • the vectors in the case of phage and viral vectors, also may be and preferably are introduced into cells as packaged or encapsidated virus by well known techniques for infection and transduction
  • Viral vectors may be replication competent or replication defective In the latter case viral propagation generally will occur only in complementing host cells
  • Preferred among vectors, in certain respects, are those for expression of polynucleotides and polypeptides of the present invention
  • such vectors comprise cis-acting control regions effective for expression in a host operatively linked to the polynucleot
  • the vectors provide for specific expression
  • Such specific expression may be inducible expression or expression only in certain types of cells or both inducible and cell-specific
  • Particularly preferred among inducible vectors are vectors that can be induced for expression by environmental factors that are easy to manipulate, such as temperature and nutrient additives
  • a variety of vectors suitable to this aspect of the invention including constitutive and inducible expression vectors for use in prokaryotic and eukaryotic hosts, are well known and employed routinely by those of skill in the art
  • the engineered host cells can be cultured in conventional nutrient media, which may be modified as appropriate for, inter alia, activating promoters, selecting transformants or amplifying genes Culture conditions, such as temperature, pH and the like, previously used with the host cell selected for expression generally will be suitable for expression of polypeptides of the present invention as will be apparent to those of skill in the art
  • vectors can be used to express a polypeptide of the invention
  • Such vectors include chromosomal, episomal and virus-derived vectors e g , vectors derived from bacterial plasmids, from bacte ⁇ ophage, from yeast episomes, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses and vectors derived from combinations thereof, such as those derived from plasmid and bacte ⁇ ophage genetic elements such as cosmids and phagemids, all may be used for expression in accordance with this aspect of the present invention
  • any vector suitable to maintain, propagate or express polynucleotides to express a polypeptide in a host may be used for expression in this regard
  • DNA sequence for expression is joined to an expression vector by cleaving the DNA sequence and the expression vector with one or more restriction endonucleases and then joining the restriction fragments together using T4 DNA hgase Procedures for restriction and hgation that can be used to this end are well known and routine to those of skill Suitable procedures in this regard, and for constructing expression vectors using alternative techniques, which also are well known and routine to those of skill, are set forth in great detail in Sambrook et al cited elsewhere herein
  • the DNA sequence in the expression vector is operatively linked to appropriate expression control sequence(s), including for instance, a promoter to direct mRNA transcription
  • appropriate expression control sequence(s) including for instance, a promoter to direct mRNA transcription
  • promoters include the phage lambda PL promoter, the E coli lac, trp and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs to name just a few of the well-known promoters
  • numerous promoters not mentioned are suitable for use in this aspect of the invention, are well known and may readily be employed by those of skill in the manner illustrated by the discussion and the examples herein
  • expression constructs will contain sites for transcription initiation and termination and, in the transcribed region, a ⁇ bosome binding site for translation
  • the coding portion of the transcripts expressed by the constructs will include a translation initiating AUG at the beginning and a termination codon appropriately positioned at the end of the polypeptide to be translated
  • constructs may contain control regions that regulate as well as engender expression Generally, in accordance with many commonly practiced procedures, such regions will operate by controlling transcription, such as repressor binding sites and enhancers, among others
  • Vectors for propagauon and expression generally will include selectable markers Such markers also may be suitable for amplification or the vectors may contain additional markers for this purpose
  • the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells
  • Preferred markers include dihydrofolate reductase or neomycm resistance for eukaryotic cell culture, and tetracyclme, theomycm, kanamycm or ampicilhn resistance genes for culturing E coli and other bacteria
  • the vector containing the appropriate DNA sequence as described elsewhere herein, as well as an appropriate promoter, and other appropriate control sequences may be introduced into an appropriate host using a variety of well known techniques suitable to expression therein of a desired polypeptide
  • Representative examples of appropriate hosts include bacterial cells, such as E coli, Streptomyces and Salmonella typhimunum cells, fungal cells, such as yeast cells, insect cells such as Drosophila S2 and Spodoptera
  • mammalian expression systems include the COS-7 lines of monkey kidney fibroblast (Gluzman et al , Cell 23 175, 1991 )
  • Other cell lines capable of expressing a compatible vector include for example, the C127, 3T3, CHO, HeLa, human kidney 293 and BHK cell lines
  • a number of viral-based expression systems may be utilized
  • the polynucleotide sequence coding for PROST-Ets may be ligated into an adenovirus transcription/translation complex consisting of the late promoter and tripartite leader sequence Insertion in a nonessential E1 or E3 region of the viral genome will result in a viable virus capable of expressing PROST-Ets in infected host cells (Logan and Shenk, Proc Natl Acad Sci USA 81 3655-59, 1984)
  • transcription enhancers such as the rouse sarcoma virus
  • RVS RVS enhancer
  • the present invention also includes recombinant constructs, such as expression constructs, comprising one or more of the sequences described above
  • the constructs comprise a vector, such as a plasmid or viral vector, into which such a sequence of the invention has been inserted
  • the sequence may be inserted in a forward or reverse orientation
  • the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence
  • vectors preferred for use in bacteria are pQE70, pQE60 and pQE-9, available from Qiagen USA (Valencia, CA), pBS vectors, Phagesc ⁇ pt® vectors, Bluesc ⁇ pt® vectors, pNH8A, pNHI6a, pNHI8A, pNH46A, available from Stratagene (LaJolla, CA), and ptrc99a, pK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia Biotech (Piscataway, N J )
  • pTrcHisB vector available from Introgen or the pET15b vector from Novagen
  • preferred eukaryotic vectors are pWLNEO, pSV2CAT, p0G44, PXTI and pSG available from Stratagene, and PSVK3, pBPV, p
  • Promoter regions can be selected from any desired gene using vectors that contain a reporter transcription unit lacking a promoter region, such as a chloramphenicol acetyl transferase ("cat") transcription unit, downstream of restriction site or sites for introducing a candidate promoter fragment, i e , a fragment that may contain a promoter
  • a reporter transcription unit lacking a promoter region such as a chloramphenicol acetyl transferase ("cat") transcription unit, downstream of restriction site or sites for introducing a candidate promoter fragment, i e , a fragment that may contain a promoter
  • introduction into the vector of a promoter-containing fragment at the restriction site upstream of the cat gene engenders production of CAT activity, which can be detected by standard CAT assays
  • Vectors suitable to this end are well known and readily available
  • promoters for expression of polynucleotides of the present invention include not only well known and readily available promoters, but also promoters that readily may be obtained by the
  • bacterial promoters suitable for expression of polynucleotides and polypeptides in accordance with the present invention are the E coli lacl and lacZ promoters the T3 and T7 promoters, the T5 tac promoter, the lambda PR, PL promoters, the trp promoter and the trc hybrid promoter, which is derived from the trp and lac promoters
  • known eukaryotic promoters suitable in this regard are the CMV immediate early promoter, the HSV thymidine kmase promoter, the early and late SV40 promoters, the promoters of retroviral LTRs, such as those of the Rous sarcoma virus ("RSV”) and metallothionein promoters such as the mouse metalloth ⁇ one ⁇ n-l promoter
  • recombinant expression vectors will include origins of replication, a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence, and a selectable marker to permit isolation of vector containing cells after exposure to the vector
  • the present invention also relates to host cells containing the above-described constructs discussed above
  • the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell Constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence
  • Polypeptides can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook et al , cited elsewhere herein
  • Enhancers are cisacting elements of DNA, usually about from 10 to 300 bp that act to increase transc ⁇ ptional activity of a promoter in a given host cell-type
  • enhancers include the SV40 enhancer, which is located on the late side of the replication origin at bp 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers
  • Polynucleotides of the invention, encoding the heterologous structural sequence of a polypeptide of the invention generally will be inserted into the vector using standard techniques so that it is operably linked to the promoter for expression The polynucleotide will be positioned so that the transcription start site is located appropriately 5 to a ⁇ bosome binding site The ⁇ bosome binding site will be 5 to the AUG
  • pET15b vectors may be used to express foreign polypeptides as fusion proteins containing a polyhistidme (6xH ⁇ s) tag for rapid purification Proteins made is such systems are designed to include cleavage sites, such as an enterokinase cleavage site, so that the cloned polypeptide of interest can be released from the fusion peptide moiety at will
  • PROST-Ets polypeptide can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectm chromatography Most preferably, high performance liquid chromatography ("HPLC") is employed for purification.
  • HPLC high performance liquid chromatography
  • Well known techniques for refolding protein may be employed to regenerate active conformation when the polypeptide is denatured during isolation and or purification
  • Various other methods of protein purification well known in the art include those described in Deutscher, M , Methods in Enzymology, Vol 182, Academic Press, San Diego, 1982 and Scopes, R , Protein Purification Principles
  • polypeptides of the present invention can be produced by direct peptide synthesis using solid-phase techniques (Stewart et al , Solid-Phase Peptide Synthesis, W H Freeman Co , San Francisco, 1969, Merrifield, J , J Am Chem Soc 85 2149-2154, 1963)
  • In vitro protein synthesis ma be performed using manual techniques or by automation Automated synthesis may be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer, Foster City, Calif) in accordance with the instructions provided by the manufacturer
  • Various fragments of PROST-Ets may be chemically synthesized separately and combined using chemical methods known in the art to produce the full length molecule
  • Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes
  • PROST-Ets polypeptides and the polynucleotides which encode them
  • Prost-ets polynucleotides and PROST-Ets polypeptides may be used in accordance with the present invention for a variety of applications, particularly those that make use of the chemical and biological properties of PROST-Ets Additional applications relate to diagnosis and to treatment of diseases of cell proliferation, such as prostate cancer
  • PROST-Ets polypeptide sequences of the present invention
  • the rationale for the use of the polynucleotide and polypeptide sequences of the present invention is based in part on the chemical and structural homology between the PROST-Ets polypeptide disclosed herein and other Ets-like transcription factor molecules and on the preferential expression of PROST-Ets in prostate and breast tissues as compared with other tissues
  • PROST-Ets may be used in the diagnosis and treatment of conditions, disorders or diseases associated with inappropriate growth of prostate tissue These would include, but are not limited to, cancer and metastatic tumor growth
  • Prost-ets polynucleotide sequences can be used as DNA probes, and as targets for antisense and nbozyme therapy, or as templates for the production of antisense polynucleotides Administration of such antisense polynucleotides to cells can be used to suppress expression of prost-ets mRNA
  • PROST-Ets polypeptides and fragments thereof can be used to generate antibodies to PROST-Ets which may be useful in detecting the levels of PROST-Ets polypeptide in cells and tissues and in targeting drugs to primary and metastatic tumors Alternatively, antibodies specifically recognizing areas of the PROST-Ets polypeptide which are responsible for its activity may be administered to treat diseases or conditions associated with PROST-Ets activity PROST-Ets polypeptides may be used to stimulate an immune response to PROST-Ets containing cells
  • Polynucleotides encoding PROST-Ets may be useful in diagnostic assays for detecting the levels of polynucleotides encoding PROST-Ets in cells and tissues
  • Prost-ets polynucleotides and PROST-Ets polypeptides of the present invention may be employed in accordance with the present invention by expression of such polypeptides in vitro and in vivo, in treatment modalities often referred to as "gene therapy"
  • PROST-Ets activity such as prostate cancer
  • it may be advantageous to suppress the activity of PROST-Ets activity can be suppressed through introduction of polynucleotides encoding regions of the PROST-Ets polypeptide into tumor cells, where the polypeptides they encode act as dominant negative reagents within the cells blocking PROST-Ets activity
  • polypeptides which act as dominant negative reagents can be introduced directly into tumor cells to block PROST-Ets activity
  • This invention is also related to the use of the prosf-e/s-related polynucleotides to detect complementary polynucleotides such as, for example, as a diagnostic reagent Detection of prost-ets polynucleotides associated with a disease state will provide a tool for the development of in vitro and in vivo diagnostics that can add or define a diagnosis of a disease or susceptibility to a disease which results from tissue specific expression of PROST-Ets
  • RNA or cDNA may also be used in the same ways.
  • PCR primers complementary to the polynucleotide sequence encoding PROST-Ets can be used to identify and analyze prost- ets expression and mutations For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype Point mutations can be identified by hybridizing amplified DNA to radiolabeled prost-ets RNA or alternatively radiolabeled prost-ets antisense DNA sequences Perfectly matched sequences can be
  • Sequence differences between a reference gene and genes having mutations also may be revealed by direct DNA sequencing
  • cloned DNA segments may be employed as probes to detect specific DNA segments
  • the sensitivity of such methods can be greatly enhanced by appropriate use of PCR or another amplification method
  • a sequencing primer is used with double-stranded PCR product or a single-stranded template molecule generated by a modified PCR
  • the sequence determination is performed by conventional procedures with radiolabeled polynucleotide or by automatic sequencing procedures with fluorescent tags
  • DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels, with or without denaturing agents Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see e g , Myers et al , Science, 230 1242, 1985)
  • Sequence changes at specific locations also may be revealed by nuclease protection assays, such as RNase and S1 protection or the chemical cleavage method (e g , Catton et al , Proc Natl Acad Sci , USA, 85 4397-4401 , 1985)
  • the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e g , restriction fragment length polymorphisms ("RFLP”) and Southern blotting of genomic DNA)
  • methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e g , restriction fragment length polymorphisms ("RFLP”) and Southern blotting of genomic DNA)
  • mutations also can be detected by in situ analysis
  • the present invention also relates to a diagnostic assays such as quantitative and diagnostic assays for detecting levels of PROST-Ets polypeptide in cells and tissues and body fluids, including determination of normal and abnormal levels
  • a diagnostic assay in accordance with the invention for detecting over-expression of PROST-Ets polypeptide compared to normal control tissue samples may be used to detect the presence of neoplasia, for example, prostate cancer
  • Such diagnostic tests may be used to detect metastatic tumor growth, as well
  • Assay techniques that can be used to determine levels of a polypeptide, such as a PROST-Ets polypeptide of the present invention, in a sample derived from a host are well-known to those of skill in the art
  • Such assay methods include radioimmunoassays (RIA), competitive-binding assays, western Blot analysis and enzyme- linked immunoabsorbant assays (ELISA ) and fluorescent activated cell sorting (FACS) Among these ELISAs frequently are preferred An
  • a sample is removed from a host and incubated on a solid support, e g a polystyrene dish, that binds the polypeptides in the sample Any free polypeptide binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin
  • the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any PROST-Ets polypeptides attached to the polystyrene dish Unbound monoclonal antibody is washed out with buffer
  • the reporter antibody linked to horseradish peroxidase is placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to PROST-Ets Unattached reporter antibody is then washed out
  • Reagents for peroxidase activity including a colo ⁇ metric substrate are then added to the dish Immobilized peroxidase, linked to PROST-Ets through the primary and secondary antibodies, produces a colored reaction product The amount
  • the invention further relates to antibodies that specifically bind to PROST-Ets, herein referred to as PROST-Ets antibodies
  • PROST-Ets antibodies The prostate-specificity of PROST-Ets makes it an excellent marker for screening, diagnosis, prognosis, follow-up assays and imaging methods
  • this characteristic indicates that PROST-Ets may be an excellent target for therapeutic methods such as targeted antibody therapy, immunotherapy, and gene therapy
  • the term "specifically binds to” refers to the interaction of an antibody and a polypeptide, in which the interaction is dependent upon the presence of a particular structure (i e , the antigenic determinant or epitope) on the polypeptide, in other words, the antibody is recognizing and binding to a specific polypeptide structure rather than to proteins in general
  • the PROST-Ets polypeptides, their fragments or other derivatives, or analogs thereof or cells expressing them can be used as an immunogen to produce antibodies thereto (Harlow Antibodies, Cold Spring Harbor Press, NY (1989)) These antibodies can be, for example, polyclonal or monoclonal antibodies
  • the present invention also includes chime ⁇ c, single chain, and humanized antibodies, as well as Fab fragments, or the product of a Fab expression library Various procedures known in the art may be used for the production of such antibodies and fragments
  • Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obt ained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman The antibody so obtained will then bind the polypeptides itself In this manner even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide
  • any technique which provides antibodies produced by continuous cell line cultures can be used Examples include the hyb ⁇ doma technique (Kohler and Milstem, Nature 256 495-497, 1975), the human B-cell hyb ⁇ doma technique (Kozbor et al , Immunology Today 4 72, I983) and the EBV-hyb ⁇ doma technique to produce human monoclonal antibodies (Cole et al , in Monoclonal Antibodies and Cancer, Alan R Liss, Inc , 77-96, 1985)
  • Antibodies may also be produced by inducing in vivo production in the lymphocyte population or by screening recombinant immunoglobuhn libraries or panels of highly specific binding reagents as disclosed in Orlandi et al (Proc Natl Acad Sci USA 86 3833-3837, 1989) and Winter and Milstem (Nature 349 293-299, 1991 )
  • Antibody fragments which contain specific binding sites for PROST-Ets may also be generated for example, such fragments include, but are not limited to the F(ab')2 fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragments Alternatively, Fab expression libraries may be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity (Huse et al , Science 256 1270-1281 , 1989) The ammo acid sequence of PROST-Ets presented herein may be used to select specific regions of the PROST-Ets polypeptide for generating antibodies As will be understood by those skilled in the art, the regions or epitopes of a PROST-Ets polypeptide to which an antibody is directed may vary with the intended application For example, antibodies intended for use in an immunoassay for the detection of membrane-bound PROST-Ets on prostate cells should be directed toward accessible epi
  • PROST-Ets antibodies may be used to isolate PROST-Ets positive cells using cell sorting and purification techniques
  • PROST-Ets antibodies may be used to isolate prostate cancer cells from xenograft tumor tissue, from cells in culture, etc using antibody-based cell sorting or affinity purification techniques
  • Other uses of the PROST- Ets antibodies of the invention include generating anti-idiotypic antibodies that mimic the PROST-Ets polypeptide
  • PROST-Ets antibodies can be used for detecting the presence of prostate cancer or tumor metastasis
  • the presence of such PROST-Ets-containmg cells within various biological samples, including serum, prostate and other tissue biopsy specimens, may be detected with PROST-Ets antibodies
  • PROST-Ets antibodies may be used in various imaging methodologies such as immunoscintography with Tc-99m (or other isotope) conjugated antibody
  • an imaging protocol similar to the one recently described using an ln-1 1 1 conjugated anti-PSMA antibody may be used to detect recurrent and metastatic prostate carcinomas (Sodee et al , Clin Nuc Med 21 759-766, 1997)
  • the PROST-Ets antibodies of the invention may be labeled with a detectable marker or conjugated to a second molecule, such as a cytotoxic agent, and used for targeting the second molecule to a PROST-Ets positive cell (Vitetta, E S et al , Immunotoxin Therapy, in DeVita, Jr, V T et al , eds, Cancer Principles and Practice of Oncology, 4 th ed , J B Lippincott Co , Philadelphia, 2624-2636, 1993)
  • cytotoxic agents include, but are not limited to ⁇ cin, doxorubicm, daunorubicin, taxol, ethidium bromide, mitomycin, etoposide, tenoposide, vinc ⁇ stine, vinblastme, colchicme, dihydroxy anthracm dione, actmomycin D, dipthe ⁇ a toxin, Pseudo onas exotox ⁇ n(PE)
  • the invention provides various immunotherapeutic methods for treating prostate cancer, including antibody therapy, in vivo vaccines, and ex vivo immunotherapy approaches
  • the invention provides PROST-Ets antibodies which may be used systemically to treat prostate cancer
  • unconjugated PROST-Ets antibodies may be introduced into a patient such that the antibody binds to PROST-Ets on or in prostate cancer cells and mediates the destruction of the cells, and the tumor, by mechanisms which may include complement-mediated cytolysis, antibody-dependent cellular cytotoxicity, altering the physiologic function of PROST-Ets, and/or the inhibition of ligand binding or signal transduction pathways
  • PROST-Ets antibodies conjugated to toxic agents such as ⁇ cin or radioisotopes may also be used therapeutically to deliver the toxic agent directly to PROST-Ets-bea ⁇ ng prostate tumor cells and thereby destroy the tumor cells
  • Prostate cancer immunotherapy using PROST-Ets antibodies may follow the teachings generated from various approaches which have been successfully employed with respect to other types of cancer, including but not limited to colon cancer (Arlen et al , Crit
  • the invention further provides vaccines formulated to contain a PROST-Ets polypeptide or fragment thereof
  • vaccines formulated to contain a PROST-Ets polypeptide or fragment thereof
  • the use of a tumor antigen in a vaccine for generating humoral and cell-mediated immunity for use in anti-cancer therapy is well known in the art and has been employed in prostate cancer using human PSMA and rodent PAP immunogens (Hodge et al , Int J Cancer 63 231 -237, 1995, Fong et al , J Immunol 159 31 13-31 17, 1997)
  • Such methods can be readily practiced by employing a PROST-Ets polypeptide, or fragment thereof, or a PROST-Ets-encodmg nucleic acid molecule and
  • viral gene delivery systems may be used to deliver a PROST-Ets- encoding nucleic acid molecule
  • Various viral gene delivery systems which can be used in the practice of this aspect of the invention include, but are not limited to, vaccinia, fowlpox, canarypox, adenovirus, influenza, pohovirus, adeno-associated virus, lentivirus, and smdbus virus (Restifo, in Curr Opin, Immunol 8 658-663, 1996)
  • Non-viral delivery systems may also be employed by using naked DNA encoding a PROST-Ets polypeptide or fragment thereof introduced into the patient (i e , intramuscularly) to induce an anti-tumor response
  • the full-length human prost-ets cDNA may be employed
  • human prost-ets cDNA fragments may be employed
  • prost-ets nucleic acid molecules encoding specific T lymphocyte (CTL) epitopes may be
  • Dendritic cells can be used to present PROST-Ets polypeptides to T cells in the context of MHC class I and II molecules
  • autologous dendritic cells are pulsed with PROST-Ets polypeptides capable of binding to MHC molecules
  • dendritic cells are pulsed with the complete PROST-Ets polypeptide
  • Yet another embodiment involves engineering the overexpression of the prost-ets gene in dendritic cells using various implementing vectors known in the art, such as adenovirus (Arthur et al , Cancer Gene Ther 4 17-25, 1997), retrovirus (Henderson et al , Cancer Res 56 3763-3770, 1996), lentivirus, adeno-associated virus, DNA transfection (Ribas et al , Cancer Res 57 2865-2869, 1997), and tumor-derived RNA transfection (Ashley et al , J
  • Anti-idiotypic anti-PROST-Ets antibodies can also be used in anti-cancer therapy as a vaccine for inducing an immune response to cells expressing a PROST-Ets polypeptide Specifically, the generation of anti-idiotypic antibodies is well known in the art and can be readily adapted to generate anti-idiotypic anti-PROST-Ets antibodies that mimic an epitope on a PROST-Ets polypeptide (see, for example, Wagner et al , Hybndoma 16 33-40, 1997 Foon et al , J Clin Invest 96 334-342, 1995, Herlyn et al , Cancer Immunol Immunother 43 65-76, 1996) Such an anti-idiotypic antibody can be used in anti-idiotypic therapy as presently practiced with other anti-idiotypic antibodies directed against tumor antigens
  • constructs comprising DNA encoding a PROST-Ets polypeptide/immunogen and appropriate regulatory sequences may be injected directly into muscle or skin of an individual, such that the cells of the muscle or skin take up the construct and express the encoded PROST-Ets polypeptide/immunogen Expression of the PROST-Ets polypeptide/immunogen results in the generation of prophylactic or therapeutic humoral and cellular immunity against prostate cancer
  • prophylactic and therapeutic genetic immunization techniques known in the art may be used (for a review, see information and references published at internet address www qenweb com)
  • the prost-ets polynucleotides and PROST-Ets polypeptides of the present invention may be employed in accordance with the present invention by expression of such polypeptides in vitro and in vivo, in treatment modalities often referred to as "gene therapy"
  • cells from a patient may be engineered with a polynucleotide, such as a DNA or RNA, encoding a polypeptide ex vivo, and the engineered cells then can be provided to a patient to be treated with the polypeptide
  • cells may be engineered ex vivo by the use of a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention
  • cells may be engineered in vivo for expression of a polypeptide in vivo by procedures known in the art
  • a polynucleotide of the invention may be engineered for expression in a replication defective retroviral vector, as discussed above
  • the retroviral expression construct then may be isolated and introduced into a packaging cell is transduced with a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention such that the packaging cell now produces infectious viral particles containing the gene of interest
  • These producer cells may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo
  • Retroviruses from which the retroviral plasmid vectors herein above mentioned may be derived include, but are not limited to, Moloney Mu ⁇ ne Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcom
  • Viruses other than retroviruses may also be used to deliver selected PROST-Ets polynucleotides, i e the DNA viruses, such as adenovirus and adeno-associated virus and Herpes virus, and derivatives thereof Plasmids containing the nucleotide sequences of interest may also be delivered in complexes with lipids or lipid derivatives and in complexes with a variety of other biochemical and chemical reagents that are known to facilitate delivery of polynucleotides into cells in vitro or in vivo (Walter and Stem, Gene Therapy of Cancer Methods and Protocols, Humana Press, Totowa, NJ, 2000)
  • Such vectors will include one or more promoters for expressing the polypeptide Suitable promoters which may be employed include, but are not limited to, the retroviral LTR, the SV40 promoter, and the human cytomegalovirus (CMV) promoter (Miller et al ,
  • any other promoter e g , cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, RNA polymerase III, and ⁇ actm promoters
  • Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kmase (TK) promoters, and B19 parvovirus promoters
  • the promoter also may be the native promoter which controls the gene encoding the polypeptide The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein
  • the retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines
  • packaging cells include, but are not limited to, the PE50I, PA317 Y-2, Y-AM, PAI2, T19-14X, VT-19-17-H2, YCRE, YCRIP,
  • the vector may be transduced into the packaging cells through any means known in the art Such means include, but are not limited to, electroporation, the use of liposomes, and CaP0 4 precipitation
  • the retroviral plasmid vector may be encapsulated into a hposome, or coupled to a lipid, and then administered to a host
  • the producer cell line will generate infectious retroviral vector particles which include the polynucleotide sequence(s) encoding the polypeptides Such retroviral vector particles then may be employed to transduce eukaryotic cells, either in vitro or in vivo
  • the transduced eukaryotic cells will express the polynucleot ⁇ de(s) encoding the polypeptide
  • Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells
  • Viral and non-viral vectors of the kind described above may be used both to deliver polynucleotide sequences which encode the PROST-Ets polypeptide or portions thereof, and polynucleotides complementary to those sequences (i e antisense polynucleotides
  • polynucleotides coding for fragments of PROST-Ets may also be used to modulate the biological activity of PROST-Ets in cells Such expressed polypeptides could compete with native PROST-Ets polypeptide for binding to DNA or to regulatory proteins
  • Such expressed polypeptides are often referred to as dominant negative polypeptides, and the polynucleotides coding for them as dominant negative polynucleotides Preferred fragments of the PROST-Ets polypeptide to be expressed would be those containing am o acids 131 to 213 or 246 to 332, which represent the pointed and Ets domains of the PROST-Ets polypeptide, respectively (Foos et al , J Biol Chem 273 18871-18880, 1998)
  • Anti-sense ohgonucleotides Antisense vectors, and ⁇ bozvmes
  • Anti-sense polynucleotides complementary to prost-ets may be prepared synthetically Such ohgonucleotides may be delivered into cells with or without lipids that may assist uptake of the anti-sense ohgonucleotides into cells
  • expression vectors derived from retroviruses, adenovirus, herpes or vaccinia viruses, or from various bacterial plasmids may be also be used for construction and delivery of recombinant vectors which will express anti-sense prost-ets See, for example, the techniques described in Sambrook et al (supra) and Ausubel et al (supra)
  • polynucleotides comprising the full length cDNA sequence and/or its regulatory elements enable researchers to use prost-ets polynucleotides as an investigative tool in sense strands (Youssoufian and Lodish, Mol Cell Biol 13 98-104, 1993) or antisense strands (Eguchi, et al , Annu Rev Biochem 60 631 -652, 1991 ) for the regulation of gene function
  • sense or antisense ohgomers, or larger fragments can be designed from various locations along the coding or control regions
  • Genes encoding PROST-Ets can be turned off by transfecting a cell or tissue with expression vectors which express high levels of a desired prost-ets polynucleotide fragment
  • Such constructs can flood cells with untranslatable sense or antisense sequences
  • Particularly preferred antisense sequences include, but are not limited to, UCCACCUGUGGCAGUUCCUCAAG (13594, SEQ ID NO 9), UGACUCGACAAAGGCCACAGGCA (13595, SEQ ID NO, 10), and CCAGCAUUUCCAGAGCAGAGCCU (13642, SEQ ID NO 11 )
  • UCCACCUGUGGCAGUUCCUCAAG (13594, SEQ ID NO 9
  • UGACUCGACAAAGGCCACAGGCA (13595, SEQ ID NO, 10
  • CCAGCAUUUCCAGAGCAGAGCCU 13642, SEQ ID NO 11
  • Transient expression may last for a month or more with a non-rephcating vector and even longer
  • RNA U S Patent No 4,987,071 , WO 93/23057
  • the mechanism of ⁇ bozyme action involves sequence-specific hybridization of the ⁇ bozyme molecule to complementary target RNA, followed by endonucleolytic cleavage
  • engineered hammerhead motif ⁇ bozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of RNA encoding PROST-Ets
  • Specific ⁇ bozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ⁇ bozyme cleavage sites which include the following sequences, GUA, GUU and GUC
  • short RNA sequences of between 15 and 20 ⁇ bonucleotides corresponding to the region of the target gene containing the cleavage site may be evaluated for secondary structural features which may render the ohgonucleotide inoperable
  • the suitability of candidate targets may also be evaluated by testing accessibility to hybridization with complementary o
  • Antisense molecules and ribozymes of the invention may be prepared by any method known in the art for the synthesis of RNA molecules These include techniques for chemically synthesizing ohgonucleotides such as solid phase phosphoramidite chemical synthesis
  • RNA molecules may be generated by in vitro and in vivo transcription or by DNA sequences encoding PROST-Ets Such DNA sequences may be incorporated into a wide variety of vectors with suitable RNA polymerase promoters such as T7 or SP6 Alternatively antisense cDNA constructs that synthes ize antisense RNA constitutively or inducibly can be introduced into cell lines, cells or tissues
  • RNA molecules may be modified to increase intracellular stability and half-life Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and/or 3' ends of the molecules or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the backbone of the molecule Increased stability can also be achieved by the inclusion of nontraditional bases such as mosine and queosine as well as acetyl-, methyl-, thio- and similarly modified forms of adenme, cytidine, guanine, thymine, and undine which are not as easily recognized by endogenous endonucleases
  • Methods for introducing antisense vectors into cells or tissues include those methods discussed infra and which are equally suitable for in vivo, in vitro and ex vivo therapy For ex vivo therapy, antisense vectors are introduced into cells taken from the patient and clonally propagated for autologous transplant back into that same patient as presented in U S Pat No
  • the present invention also relates to assays and methods which can be used to identify agents that bind to PROST-Ets Specifically, agents that bind to PROST-Ets can be identified by the ability of the PROST-Ets ligand or other agent or constituent to bind to
  • PROST-Ets and/or the ability to inhibit/stimulate PROST-Ets activity are suitable for use in high through-put screening methods
  • the assay comprises mixing PROST-Ets with a test agent or cellular extract After mixing under conditions that allow association of PROST-Ets with the agent or component of the extract the mixture is analyzed to determine if the agent/component is bound to PROST-Ets Binding agents/components are identified as being able to bind to PROST-Ets Alternatively or consecutively, PROST-Ets activity can be directly assessed as a means for identifying agonists and antagonists of PROST-Ets activity
  • agents that bind to a PROST-Ets polypeptide can be identified using a yeast two-hybrid system or a binding capture assay
  • yeast two hybrid system an expression unit encoding a fusion protein made up of one subunit of a two subunit transcription factor and the PROST-Ets polypeptide is introduced and expressed in a yeast cell
  • the cell is further modified to contain (1 ) an expression unit encoding a detectable marker whose expression requires the two subunit transcription factor for expression and (2) an expression unit that encodes a fusion protein made up of the second subunit of the transcription factor and a cloned segment of DNA If the cloned segment of DNA encodes a protein that binds to the PROST-Ets polypeptide, the expression results in the interaction of PROST-Ets and the encoded protein This brings the two subunits of the transcription factor into binding proximity, allowmg reconstitution of the transcription factor This results in expression of the detectable marker
  • the yeast two hybrid system is particularly useful in screening a
  • PROST-Ets polypeptides which may be used in the above assays include, but are not limited to, an isolated PROST-Ets polypeptide, a fragment of a PROST-Ets polypeptide, a cell that has been altered to express a PROST-Ets polypeptide, or a fraction of a cell that has been altered to express a PROST-Ets polypeptide Further, the PROST-Ets polypeptide can be the entire polypeptide or a defined fragment of the PROST-Ets polypeptide It will be apparent to one of ordinary skill in the art that so long as the PROST-Ets polypeptide can be assayed for agent binding, e g by a shift in molecular weight or activity, the present assay can be used
  • the method used to identify whether an agent cellular component binds to a PROST- Ets polypeptide will be based primarily on the nature of the PROST-Ets polypeptide used For example, a gel retardation assay can be used to determine whether an agent binds to PROST- Ets or a fragment thereof Alternatively, immunodetection and biochip technologies can be adopted for use with the PROST-Ets polypeptide A skilled artisan can readily employ numerous art-known techniques for determining whether a particular agent bind to a PROST- Ets polypeptide
  • Agents and cellular components can be further tested for the ability to modulate the activity of a PROST-Ets polypeptide using a cell-free assay system or a cellular assay system As the activities of the PROST-Ets polypeptide become more defined, functional assays based on the identified activity can be employed
  • an agent is said to antagonize PROST-Ets activity when the agent reduces PROST-Ets activity
  • the preferred antagonist will selectively antagonize PROST-Ets, not affecting any other cellular proteins Further, the preferred antagonist will reduce PROST- Ets activity by more than 50%, more preferably by more than 90%, most preferably eliminating all PROST-Ets activity
  • Agents that are assayed in the above method can be randomly selected or rationally selected or designed as used herein, an agent is said to be randomly selected when the agent is chosen randomly without considering the specific sequences of the PROST-Ets polypeptide
  • An example of randomly selected agents is the use of a chemical library or a peptide combinatorial library, or growth broth of an organism or plant extract
  • an agent is said to be rationally selected or designed when the agent is chosen on a nonrandom basis that takes into account the sequence of the target site an/or its conformation in connection with the agent's action
  • Agents can be rationally selected or rationally designed by utilizing the peptide sequences that make up the PROST-Ets polypeptide
  • a rationally selected peptide agent can be a peptide whose ammo acid sequence is identical to a fragment of a PROST-Ets polypeptide
  • agents tested in the methods of the present invention can be, as examples, peptides, antibodies, ohgonucleotides, small molecules and vitamin derivatives, as well as carbohydrates
  • agents of the present invention are peptide agents whose ammo acid sequences are chosen based on the ammo acid sequence of the PROST-Ets polypeptide
  • Peptide agents can be prepared using standard solid phase (or solution phase) peptide synthesis methods, as is known in the art
  • the DNA encoding these peptides may be synthesized using commercially available ohgonucleotide synthesis instrumentation and produced recombinantly using standard recombinant production systems The production using solid phase peptide synthesis is necessitated if no-gene-encoded am o acids are to be included
  • Another class of agent of the present invention are antibodies immunoreactive with critical positions of the PROST-Ets polypeptide As described above, antibodies are obtained by immunization of suitable mammalian subjects with peptides, containing as antigenic regions those portions of the PROST-Ets polypeptide intended to be targeted by the antibodies Such agents can be used in competitive binding studies to identify second generation inhibitory agents as well as to block PROST-Ets activity
  • the cellular extracts tested in the methods of the present invention can be, as examples, agueous extracts of cells or tissues, organic extracts of cells or tissues or partially purified cellular fractions A skilled artisan can readily recognize that there is no limit as to the source of the cellular extract used in the screening method of the present invention
  • Agents that bind a PROST-Ets polypeptide can be used to modulate the activity of PROST-Ets, to target anticancer agents to appropriate mammalian cells, or to identify agents that block the interaction with PROST-Ets Cells expressing PROST-Ets can be targeted or identified by using an agent that binds to PROST- Ets
  • PROST-Ets binding agents can be used to deliver conjugated toxins, such as diphtheria toxin, cholera toxin, ⁇ cin or pseudomonas exotoxm, to a
  • PROST-Ets expressing cell modulate PROST-Ets activity, to directly kill a PROST-Ets expressing cell, or in screens to identify competitive binding agents
  • a PROST- Ets inhibitory agent can be used to directly inhibit the growth of PROST-Ets expressing cells whereas a PROST-Ets binding agent can be used as a diagnostic agent
  • the present invention also relates to pharmaceutical compositions which may comprise prost-ets polynucleotides, PROST-Ets polypeptides, antibodies, agonists, antagonists, or mhibitors, alone or in combination with at least one other agent, such as stabilizing compound, which may be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water Any of these molecules can be administered to a patient alone, or in combination with other agents, drugs or hormones, in pharmaceutical compositions where it is mixed with exc ⁇ p ⁇ ent(s) or pharmaceutically acceptable carriers
  • the pharmaceutically acceptable carrier is pharmaceutically inert
  • the present invention also relates to the administration of pharmaceutical compositions Such administration is accomplished orally or parenterally Methods of parenteral delivery include topical, intra-arte ⁇ al (directly to the tumor), intramuscular, subcutaneous, intramedullary, intrathecal, intravent ⁇ cular, intravenous, intrape ⁇ toneal, or intranasal administration
  • these pharmaceutical compositions may contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically Further details on techniques for formulation and administration may be found in the latest edition of Remington's Pharmaceutical Sciences (Ed Maack Publishing Co, Easton Pa )
  • compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration Such carriers enable the pharmaceutical compositions to be formulated as tablEts, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for ingestion by the patient
  • compositions for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablEts or dragee cores
  • Suitable excipients are carbohydrate or protein fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol, starch from corn, wheat, rice, potato, or other plants, cellulose such as methyl, cellulose, hydroxypropylmethylcellulose, or sodium carboxymethylcellulose and gums including arable and tragacanth, and proteins such as gelatin and collagen
  • disintegrating or solubilizmg agents may be added, such as the cross-linked polyvinyl pyrrolidone agar, algmic acid, or a salt thereof, such as sodium algmate
  • Dragee cores are provided with suitable coatings such as concentrated sugar solutions, which may also contain gum arable, talc, polyvmylpyrrolidone, carbopol gel, polyethylene glycol and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures Dyestuffs or pigments may be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, ie dosage
  • suitable coatings such as concentrated sugar solutions, which may also contain gum arable, talc, polyvmylpyrrolidone, carbopol gel, polyethylene glycol and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, ie dosage
  • Push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating such as glycerol or sorbitol
  • Push-fit capsules can contain active ingredients mixed with a filler or binders such as lactose or starches, lubricants such as talc or magnesium stearate, and optionally, stabilizers
  • the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol with or without stabilizers
  • compositions for parenteral administration include aqueous solutions of active compounds
  • the pharmaceutical compositions of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiologically buffered saline
  • Aqueous injection suspensions may contain substances which increase viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran
  • suspensions of the active compounds may be prepared as appropriate oily injection suspensions
  • Suitable lipophihc solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes
  • the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions
  • penetrants appropriate to the particular barrier to be permeated are used in the formulation Such penetrants are generally known in the art
  • the invention further relates to pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions of the invention Associated with such conta ⁇ ner(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture use or sale of pharmaceuticals or biological products, reflecting approval by the agency of the manufacture, use or sale of the product for human administration
  • compositions of the present invention may be manufactured in a manner that is known in the art, e g , by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes
  • the pharmaceutical composition may be provided as a salt and can be formed with may acids, including by not limited to hydrochloric, sulfu ⁇ c, acetic, lactic, tarta ⁇ c, malic, succinic, etc Salts tend to be more soluble in aqueous or other protonic solvents that are the corresponding free base forms
  • the preferred preparation may be a lyophi zed powder in 1 mM- 50 mM histidme, 0 1 %-2% sucrose, 2%-7% mannitol at a pH range of 4 5 to 5 5 that is combined with buffer prior to use
  • compositions comprising a compound of the invention formulated in an acceptable carrier
  • labeling would include amount, frequency and method of administration
  • compositions suitable for use in the present invention include compositions wherein the active ingredients are contained in an effective amount to achieve the intended purpose, i e treatment of a particular disease state characterized by PROST-Ets expression
  • the therapeutically effective dose can be estimated initially either in cell culture assays, e g , neoplastic cells, or in animal models, usually mice, rabbits, dogs, or pigs The animal model is also used to achieve a desirable concentration range and route of administration Such information can then be used to determine useful doses and routes for administration in humans
  • a therapeutically effective dose refers to that amount of protein or its antibodies, antagonists, or inhibitors which ameliorate the symptoms or condition
  • Therapeutic efficacy and toxicity of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e g , ED 50 (the dose therapeutically effective in 50% of the population) and LD 50 (the dose lethal to 50% of the population)
  • compositions which exhibit large therapeutic indices are preferred
  • the data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use
  • the dosage of such compounds lies preferably within a range of circulating concentrations what include the ED 50 w ⁇ th little or no toxicity
  • the dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration
  • the exact dosage is chosen by the individual physician in view of the patient to be treated Dosage and administration are adjusted to provide sufficient levels of the active moiety or to maintain the desired effect Additional factors which may be taken into account include the severity of the disease state, eg, tumor size and location, age, weight and gender of the patient diet, time and frequency of administration, drug comb ⁇ nat ⁇ on(s), reaction sensitivities, and tolerance/response to therapy Long acting pharmaceutical compositions might be administered every 3 to 4 days, every week, or once every two weeks depending on half-life and clearance rate of the particular formulation Normal dosage amounts may vary from 0 1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration Guidance as to particular dosages and methods of delivery is provided in the literature See U S Pat Nos 4,657,760, 5,206,344, or 5,225,212 Those skilled in the art will employ different formulations for polynucleotides than for protems or their inhibitors Similarly, delivery of polynucleotides or
  • Prost-ets was identified as a gene expressed in the prostate by mining Incyte's LifeSeq gene expression database Incyte's Lifeseq database was mined for sequences expressed in either a prostate or tumor specific manner The original clone identified was Incyte Clone
  • Northern blot analysis Northern blots were performed using 2 ⁇ g of poly(A) RNA from multiple human tissues (purchased from Clontech) Blots were probed with a radiolabelled probe made from the insert of a prost-ets plasmid (Incyte Clone 1794731 , see
  • PROST-Ets coding region was inserted into the protein expression vector pET15b, which was obtained from Stratagene A 6Xh ⁇ s-tagged PROST-Ets polypeptide was expressed in E coli upon induction with IPTG The expressed polypeptide was purified to greater than
  • Peptides were covalently coupled to keyhole limpet hemocyanm (KLH), via an additional ammo- terminal cysteme, for use as immunogen Similarly, a bovine serum albumin (BSA) conjugate was prepared for the analysis of antisera titers via ELISA
  • Antisera were tested via Western blot for binding to a purified PROST-Ets protein expressed as a 6H ⁇ s-PROST-Ets fusion protein in £ coli (See Figure 7) Antisera which recognized the PROST-Ets fusion protein were further tested for their ability to recognize the naturally occurring protein in lysates prepared from PC3 cells Rabbit polyclonal antisera were also raised against the 6H ⁇ s-PROST-Ets fusion protein purified from £ coli
  • the prostate tumor cell lines PC-3 and LNCaP, were selected for evaluation of the role of PROST-Ets in cell proliferation using antisense ohgonucleotides to reduce mRNA expression in the selected cell lines
  • These two prostate tumor cell lines express prost-ets mRNA, while normal primary prostate epithelial cells and cells derived from a BPH sample do not express significant levels of this mRNA
  • the antisense ohgonucleotides used have the sequences
  • the Tet-On system (Clontech) was used to generate derivatives of the PC3 prostate tumor cells and BPH prostate non-tumorigenic cell line which contained stably integrated reverse tet repressor-VP16 protein, a protein which binds and activates transcription in the presence of doxycychne
  • PC3-tet-on cell lines and two BPH-tet-on cell lines, containing different levels of tet-on activities were generated according to the manufacturer's instructions and stored Two of these PC3-tet-on cell lines were found to have retained the growth rate in vitro and tumongenicity characteristics in vivo of their parent PC3 cell line
  • the pBI-EGFP vector from Clontech was used to express sense and antisense prost-ets messages Several different antisense constructs were made that express different fragments of the prost-ets antisense message The fragments were an approximately 0 45 Kb fragment containing the 5' untranslated region, an approximately 0 5 Kb fragment containing the 3' untranslated region, and a full-length antisense molecule (in Figure 9, 5utr, 3utr, and cDNA, respectively) These fragments were incorporated into the vector using standard techniques
  • polypeptide fragments coding for various portions of the PROST-Ets polypeptide are inserted into vectors and expressed within PC3 -tet-on prostate tumor cells, following induction with doxycychne Alternatively, the fragments are expressed in E coli as fusion proteins with a peptide derived from the HIV TAT protein
  • the TAT peptide has been shown to act as an efficient "protein transduction domain" for a number of intracellular proteins including transcription factors Using either method of polypeptide expression, the presence of these expressed protein fragments is observed to have a negative effect on tumor cell growth, indicating that these fragments are acting as dominant-negative reagents

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Epidemiology (AREA)
  • Urology & Nephrology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

The present invention relates to novel transcription factor polypeptides, designated PROST-Ets, polynucleotides encoding the polypeptides, methods for producing the polypeptides, expression vectors and genetically engineered host cells for expression of the polypeptides. The invention further relates to methods for utilizing the polynucleotides and polypeptides in research, diagnosis, and therapeutic applications.

Description

DNA ENCODING A NOVEL PROST-Ets POLYPEPTIDE
This application claims the benefit of U S Provisional Application No 60/168,182, filed November 30, 1999, which is incorporated herein in full by reference
FIELD OF THE INVENTION
This invention relates, in part, to newly identified polynucleotides and polypeptides, variants and derivatives of the polynucleotides and polypeptides, methods of making the polynucleotides and polypeptides, and their variants and derivatives, antibodies directed toward the polypeptides, their variants and derivatives, and uses of the polynucleotides, polypeptides, variants, derivatives and antibodies In particular, in these and in other regards, the invention relates to novel PROST-Ets polypeptides, polynucleotides which encode these polypeptides, antibodies directed toward these polypeptides, and antisense polynucleotides that block
PROST-Ets expression
BACKGROUND OF THE INVENTION
Prostate cancer is a frequently occurring disease in man, in that it is found in about one third of men over the age of 45 There is evidence for both genetic and environmental causes with the majority of cases probably being the result of a combination of both factors Studies of familial cancer have suggested that genetic predisposition plays a role in about 5-10% of all prostate cancers, and in about 45% of cases in men younger than 55 There is evidence that prostate cancer develops as a multi-step disease, with one of the precursor lesions being prostatic intraepithelial neoplasia (PIN) Early stages of the disease are androgen dependent, while later stages are hormone independent A proliferative disorder of the prostate known as benign prostatic hyperplasia is often detected clinically but is probably not a stage in the development of cancer It is, however, frequently associated with prostate cancer Cancers in the prostate are often multifocal, generally slow growing, and heterogeneous Late stage cancers frequently metastasize to the lymph nodes and to the bone
Prostate cancer is usually diagnosed by physical examination and by serum levels of prostate specific antigen (PSA) Radical prostatectomy is the treatment of choice for localized disease Advanced metastatic disease is treated currently by androgen ablation induced by orchiectomy or treatment with GnRH (gonadotrophin releasing hormone), and by anti-androgen therapy However, advanced disease almost invariably becomes hormone resistant and there is no cure for progressive disease Moreover, there are serious side effects associated with both radical prostatectomy and androgen ablation therapy These include a high risk of incontinence and impotence associated with radical prostatectomy and bone fractures and osteoporosis associated with androgen ablation therapy
There is, therefore, a considerable need for new therapeutic approaches for both early and late stage prostate cancer There is also a significant need for new diagnostic agents, in particular agents that can discriminate stages of the disease, as this significantly influences the treatment options For example, if disease has progressed beyond the prostate and has metastasized to the lymph nodes, radical prostatectomy is not undertaken as it has no effect on progression, but may have significant unwanted side effects An agent that could detect metastasis, in vivo, would have considerable value
Changes in the expression of specific proteins have been demonstrated in prostate cancer including abnormal p53 expression in late stage prostate cancer, reduced levels of TGF-β receptors, reduced levels of E-cadheπn, C-CAM (a cell adhesion molecule), and several integπns The expression of the oncogene bcl-2 is strikingly elevated in late stage androgen independent tumors, and prognosis for patients expressing bcl-2 at elevated levels is relatively poor While the previously mentioned changes in gene expression are well documented, no changes in expression have been identified that have been demonstrated to be causative for the disease It would, therefore, be useful to identify new proteins whose expression is linked to the presence or development of prostate tumors which could serve as molecular targets for prostate cancer diagnosis and therapy
This invention discloses a new transcription factor that is a homologue to the Ets family of proteins This homologue, designated PROST-Ets, is differentially expressed in prostate and breast tissue as compared with other tissues, and may be over-expressed in prostate, breast, and ovarian tumors The invention also discloses agents that reduce the levels of PROST-Ets in tumor cells, thereby inhibiting their growth Such agents, therefore, may be valuable therapeutic agents for prostate, breast, ovarian, and other cancers
The family of Ets genes encodes transcription factors that share a highly conserved DNA binding domain, the Ets domain The first Ets gene was originally identified as a viral oncogene in the E26 chicken leukemia virus genome, and numerous cellular homologues spanning organisms from Drosophila to human have been identified Currently, at least 30 different Ets genes are known in vertebrates Important roles for Ets proteins in the regulation of proliferation, transformation, differentiation and apoptosis have been identified (Dittmar and Nordheim, Biochem Biophys Acta 1377 F1 -F1 1 , 1988)
Structurally, Ets proteins are characterized by a highly conserved DNA binding domain, the Ets domain, composed of about 85 ammo acids This Ets domain bears structural similarity to the winged helix-tum-helix set of DNA binding proteins The Ets domain binds to a core recognition motif, 5' -GGA(A T)-3' , that is found in all Ets regulated promoters that have been studied to date There is additional preference for nucleotide binding in the DNA flanking the core recognition motif However, it is clear that levels of control above and beyond DNA recognition exist for the Ets proteins, and that these levels will be required to mediate the specific actions of individual Ets proteins (Graves and Petersen, Adv In Cancer Res 75 1 -54, 1998) The Ets domain may be found close to either the N-terminus, the central region, or close to the C-terminus of the protein A second domain that has been found in many Ets genes codes for another highly conserved domain, known as the PNT or pointed domain The pointed domain functions in protein - protein interactions that are usually of a heterologous nature Protein - protein interactions through the PNT domain (and other domains) may significantly enhance the specificity and affinity of Ets proteins for promoters, through the selective DNA binding of a partner protein Transcription activation domains (TAD's) have been identified in many Ets proteins and a variety of different mechanisms identified for mediating transcπptional activation in this family It should be noted that both transcπptional activation and repression have been found for certain Ets proteins The Ets family of transcription factors have been identified as nuclear targets for many signal transduction pathways Growth factor signaling pathways act through small GTP binding proteins, stimulating downstream kmases that ultimately activate mitogen activated protein (MAP) kmases Several Ets proteins have been shown to be substrates for MAP kmases, leading to phosphorylation at seπne and threonine residues Such phosphorylation has been reported to enhance transcription activation by Ets proteins (Wasylyk et al , TIBS 23 213-216,
1998)
Another mechanism of regulating Ets protein activity is through auto inhibition by inhibitory sequences flanking the Ets domains that negatively regulate DNA binding This phenomenon has been defined for several Ets proteins and constitutes one of the ways in which Ets functions can be modulated by derepression This may also explain the molecular actions of Ets activating factors
Chromosomal translocations involving Ets loci are found in many cancers These include translocations in 85% of Ewing sarcomas Other translocations leading to acute myeloid leukemia, chronic myelomono-cytic leukemias and lymphoblastic leukemias have been documented (Rabbits, Nature 372 143, 1994, Look, Science, 278 1059-1064, 1997)
The expression of Ets-1 and Ets-2 two human transcription factors, has been directly implicated in tumongenicity and in invasion in many sarcoma and carcinoma cell lines Studies with dominant negative forms of Ets-1 and Ets-2 have demonstrated that Ets family members are involved in control of urokinase plasminogen activator (uPA) activity, cell motility and invasion in mammary cancer Ets-1 activity has also been correlated with tumongenicity in gastric and pancreatic cancer (Vandenbunder et al , Invasion and Metastasis 14 198-209, 1994) Growth factors including EGF and FGF promote Ets-1 and Ets-2 expression, leading to activation of uPA and matrix metalloproteinase promoters by Ets proteins in conjunction with other transcription factors (Chen et al , Cancer Res 57 2009-2013, 1997)
In the case of prostate cancer, elevated levels of Ets-2 transcription have been detected in primary tumors as compared with expression in adjacent tissue This has also been seen in prostate cancer cell lines Antisense molecules targeted against Ets-2 reduced colony formation in agar in DU145 and PC3 cell lines, as does a dominant negative Ets-2 mutant protein There have been additional reports in prostate cells documenting interactions between androgen receptors and Ets proteins in the regulation of invasive genes These interactions may be important in androgen regulation of prostate tumor cell growth (Zang et al , Proc Natl. Acad Sci , USA 94 5673-5678, 1997) Ets binding sites and hormonal response elements have been identified in the promoter of the maspin gene This is a tumor suppressing protease inhibitor expressed in the prostate and breast Its regulation by Ets proteins again implicates this family of transcription factors in the tumorigenic process (Sementchenko et al , Oncogene 17 2883-2888, 1998, Oettgen et al , J Biol Chem 275 1216-1225 2000)
In light of the abundant evidence supporting a role for Ets proteins in tumoπgenesis the identification of a novel Ets protein that is expressed in the prostate and breast, (and likely elevated in prostate, breast, and ovarian cancer), has important implications for prostate and breast cancer diagnosis and therapy
SUMMARY OF THE INVENTION
The present invention provides a polynucleotide sequence which uniquely encodes a novel transcription factor designated herein as PROST-Ets The PROST-Ets polypeptide is characterized by a pointed domain, involved with protein-protein interactions, at ammo acids 131 to 213, and an Ets domain, involved with DNA binding, at ammo acids 246 to 332 both of which are general structural characteristics of the Ets family of proteins PROST-Ets shows homology to several members of the Ets family of transcription factors with approximately a 74% homology over 87 ammo acids with Drosophila Ets-4 The polynucleotide sequence, designated herein as prost-ets, and described herein in Figure 1 (SEQ ID NO 1 ), encodes the ammo acid sequence for PROST-Ets, which is shown in Figure 2 (SEQ ID NO 2)
Toward these ends, and others, it is an object of the present invention to provide polypeptides, inter alia, that have been identified as novel Ets-like transcription factors, by homology between the am o acid sequence set out in Figure 2 (SEQ ID NO 2) and known ammo acid sequences of other Ets-like transcription factor polypeptides It is a further object of the invention, moreover, to provide polynucleotides that encode such polypeptides, particularly polynucleotides that encode the polypeptide designated herein as PROST-Ets In accordance with t us aspect of the invention there are provided isolated polynucleotides encoding PROST-Ets, including mRNAs, cDNAs, genomic DNAs and, in further embodiments of this aspect of the invention, biologically diagnostically, clinically or therapeutically useful variants, analogs or derivatives thereof, or fragments thereof, including fragments of the variants, analogs and deπvatives
Among the particularly preferred embodiments of this aspect of the invention are naturally occurring alle c variants of polynucleotides that encode variants of the polypeptide designated herein as PROST-Ets
In accordance with this aspect of the invention there are provided novel polypeptides of human origin referred to herein as PROST-Ets as well as biologically, diagnostically or therapeutically useful fragments, variants and derivatives thereof, variants and derivatives of the fragments, and analogs of the foregoing
Among the particularly preferred embodiments of this aspect of the invention are variants of PROST-Ets encoded by naturally occurring allehc variants of the prost-ets polynucleotide
It is another object of the invention to provide a method of producing the aforementioned polypeptides, polypeptide fragments variants and derivatives, fragments of the variants and derivatives, and analogs of the foregoing In a preferred embodiment of this aspect of the invention there are provided methods of producing the aforementioned PROST- Ets polypeptides comprising culturing host cells having expressibly incorporated therein an exogenously-derived PROST-Ets-encodmg polynucleotide under conditions for expression of human PROST-Ets in the host and then recovering the expressed polypeptide
In accordance with another object of the invention there are provided products, compositions, processes and methods that utilize the aforementioned polypeptides and polynucleotides for inter alia research, biological, clinical and therapeutic purposes
In accordance with certain preferred embodiments of this aspect of the invention there are provided products, compositions and methods, inter alia, for assessing PROST-Ets expression in cells by determining PROST-Ets polypeptides or PROST-Ets-encodmg mRNA, and assaying genetic variation and aberrations, such as defects, in genes for PROST-Ets In accordance with certain preferred embodiments of this and other aspects of the invention there are provided probes that hybridize to prost-ets polynucleotide sequences
It is a further object of the invention to provide antibodies which are highly selective for PROST-Ets polypeptides, or fragments thereof, and which may be employed in a method for diagnosis and/or detection of PROST-Ets expression, which may be associated with prostate cancer In accordance with certain preferred embodiments of this aspect of the invention, antibodies are labeled in such a way as to produce a detectable signal Particularly preferred would be an antibody labeled with a radiolabel, an enzyme, a chromophore or a fluorescer In a further aspect of the invention there are provided antibodies which are conjugated to a therapeutic agent for administration to cells in vitro, to cells ex vivo and to cells in vivo, or to a multicellular organism Particularly preferred in this regard are therapeutic agents which are cytotoxic In certain preferred embodiments in this regard is administration of such conjugated antibodies to a human patient for treatment of a disease state characterized by
PROST-Ets activity or expression, such as prostate cancer
In a further aspect of the invention, peptides and anti-idiotypic antibodies are provided which can be used to stimulate an immune response
In a further aspect of the invention there are provided πbozymes and polynucleotides complementary to prost-ets polynucleotides (i e antisense polynucleotides) for administration to cells in vitro, to cells ex vivo and to cells in vivo, or to a multicellular organism Particularly preferred in this regard is administration of antisense molecules to a human patient for treatment of a disease state, such as prostate cancer or benign prostatic hyperplasia, which is alleviated by decreasing the level of PROST-Ets activity or expression In a further aspect of the invention there are provided compositions comprising a prost- ets polynucleotide or a PROST-Ets polypeptide for administration to cells in vitro, to cells ex vivo and to cells in vivo, or to a multicellular organism In certain particularly preferred embodiments of this aspect of the invention, the compositions comprise a prost-ets polynucleotide for expression of a PROST-Ets polypeptide in a host organism for treatment of disease Particularly preferred in this regard is expression of the polypeptide in a human patient for treatment of a disease state which is alleviated by reducing the level of PROST-Ets activity
Other objects, features, advantages and aspects of the present invention will become apparent to those of skill from the following description It should be understood, however, that the following description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only Various changes and modifications within the spirit and scope of the disclosed invention will become readily apparent to those skilled in the art from reading the following description and from reading the other parts of the present disclosure
BRIEF DESCRIPTION OF THE DRAWINGS
FIGURE 1 Polynucleotide sequence of prost-ets (SEQ ID NO 1 ), which encodes the biologically or immunologically active form of PROST-Ets
FIGURE 2 Deduced ammo acid sequence of the active form of PROST-Ets (SEQ ID NO 2) The pointed (aa 131-213) and Ets (aa 246-332) domains within the sequence are underlmed
FIGURE 3 Ammo acid alignment of PROST-Ets with the sequence of Drosophila D- Ets-4 The sequence of PROST-Ets is on the top
FIGURE 4 Predicted domain structure of PROST-Ets protein
FIGURE 5 Expression of prost-ets mRNA in human tissues by northern blot analysis RNA from human tissues, both tumor and normal, and human cell lines was examined for hybridization of prost-ets mRNA to a radiolabelled probe An mRNA species of 2 4 Kb in size was detected at a high level in prostate and at lower levels in colon and small intestine No expression was detected in the other tissues examined
FIGURE 6 Expression of prost-ets mRNA in human tissues by Taqman based PCR analysis RNA from human tissues, both tumor and normal, was isolated by standard techniques Primers and probe to detect prost-ets mRNA expression were designed using Perkm Elmer's Primer Express software and synthesized by Synthetic Genetics Prost-ets mRNA was detected in human prostate tissues, both tumor and normal, and in lower levels in breast tissue, but could not be detected in other normal and tumor tissues
FIGURE 7 Immunoreactivity of PROST-Ets synthesized in bacteria Antisera generated against synthetic PROST-Ets sequences (see Example 4) was used in Western blot analysis of PROST-Ets expressed in E co
FIGURE 8 Effect of specific reduction of prost-ets mRNA expression on prostate tumor cell growth Three antisense o gonucleotides (13594, 13595, 13642) targeted to prost- ets sequences (see Example 5) were utilized (in the form of RNA DNA hybrid molecules) to determine the effect of specific reduction of prost-ets mRNA in the PROST-Ets-expressing PC3 human prostate cell line Mismatched antisense molecules were used as controls and GBC 3 3 is a non-specific antisense control Nuclear area is proportional to cell number
FIGURE 9 Growth inhibition of PC3 cells by inducible antisense messages PC3 cell lines were transfected with vectors containing PROST-Ets antisense messages (see Example 6) and were treated with doxycyclme to induce transcription of the antisense ohgonucleotides Cell growth was measured following treatment and demonstrated antisense specific inhibition of growth The antisense molecules used were cDNA , a full-length antisense molecule, 5utr, a 5' antisense molecule, and 3utr, a 3' antisense molecule DETAILED DESCRIPTION OF THE INVENTION
Definitions
As used in the specification, examples and appended claims, unless specified to the contrary, the following terms have the meaning indicated
"PROST-Ets" refers to the polypeptide having the ammo acid sequence set out in Figure 2 (SEQ ID NO 2), variants, analogs, derivatives and fragments thereof, and fragments of the variants, analogs and derivatives The terms "fragment," "derivative" and "analog" when referring to the polypeptide of Figure 2 (SEQ ID NO 2) mean a polypeptide which retains essentially the same biological and/or immunological activity as the polypeptide of Figure 2
(SEQ ID NO 2)
"prost-ets" refers to the polynucleotide having the sequence set out in Figure 1 (SEQ ID NO 1 ) and polynucleotides encoding polypeptides having the ammo acid sequence of PROST-Ets set out in Figure 2 (SEQ ID NO 2), and to polynucleotides encoding PROST-Ets variants, analogs, derivatives and fragments, and fragments of the variants analogs and deπvatives Prost-ets also refers to such polynucleotides composed of RNA as well as to polynucleotides which are the complement of polynucleotides which encode the polypeptide sequence set out in Figure 2 (SEQ ID NO 2)
"Polynucleotιde(s)" generally refers to any polyπbonucleotide or polydeoxπbonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA
Thus, for instance, polynucleotides as used herein refers to, among others, smgle-and double- stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double- stranded or a mixture of single- and double-stranded regions In addition, polynucleotide as used herein refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA The strands in such regions may be from the same molecule or from different molecules The regions may include all of one or more of the molecules, but more typically involve only a region of some of the molecules One of the molecules of a triple-helical region often is an o gonucleotide
As used herein, the term "polynucleotide" includes DNAs or RNAs as described above that contain one or more modified bases Thus, DNAs or RNAs with backbones modified for stability or for other reasons are "polynucleotides" as that term is intended herein Moreover DNAs or RNAs comprising unusual bases such as mosine, or modified bases, such as tπtium- labelled bases, to name just two examples are polynucleotides as the term is used herein
It will be appreciated that a great variety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill in the art The term "polynucleotide" as it is employed herein embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including simple and complex cells, inter alia
"Polypeptides", as used herein, includes all polypeptides as described below The basic structure of polypeptides is well known and has been described in innumerable textbooks and other publications in the art In this context, the term is used herein to refer to any peptide or protein comprising two or more am o acids joined to each other in a linear chain by peptide bonds As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types It will be appreciated that polypeptides often contain ammo acids other than the 20 ammo acids commonly referred to as the 20 naturally occurring ammo acids, and that many ammo acids, including the terminal ammo acids, may be modified in a given polypeptide, either by natural processes such as glycosylation and other post-translational modifications, or by chemical modification techniques which are well known in the art Even the common modifications that occur naturally in polypeptides are too numerous to list exhaustively here, but they are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature, and they are well known to those of skill in the art Among the known modifications which may be present in polypeptides of the present invention are, to name an illustrative few, acetylation, acylation, ADP-πbosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a polynucleotide or polynucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidy nositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystme, formation of pyroglutamate, formylation, gamma-carboxylation, glycation, glycosylation, GPI anchor formation, hydroxylation, lodination, methylation, myπstoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of ammo acids to proteins such as arginylation, and ubiquitmation
Such modifications are well known to those of skill and have been described in great detail in the scientific literature Several particularly common modifications, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP- πbosylation, for instance, are described in most basic texts, such as, for instance, I E Creighton, Proteins-Structure and Molecular Properties, 2nd Ed , W H Freeman and Company New York, I993 Many detailed reviews are available on this subject, such as, for example, those provided by Wold, F , in Posttranslational Covalent Modification of Proteins, B C Johnson, Ed , Academic Press, New York, pp 1 -12, 1983, Seifter et al , Meth Enzymol 182
626-646, 1990 and Rattan et al , Protein Synthesis Posttranslational Modifications and Aging, Ann N Y Acad Sci 663 48-62, 1992
It will be appreciated, as is well known and as noted above, that polypeptides are not always entirely linear For instance polypeptides may be branched as a result of ubiquitmation, and they may be circular, with or without branching, generally as a result of posttranslational events, including natural processing events and events brought about by human manipulation which do not occur naturally Circular, branched and branched circular polypeptides may be synthesized by non-translational natural processes and by entirely synthetic methods, as well
Modifications can occur anywhere in a polypeptide, including the peptide backbone, the am o acid side-chains and the ammo or carboxyl termini In fact, blockage of the ammo or carboxyl group in a polypeptide, or both, by a covalent modification, is common in naturally occurring and synthetic polypeptides and such modifications may be present in polypeptides of the present invention, as well For instance, the ammo terminal residue of polypeptides made in E coli, prior to proteolytic processing, almost invariably will be N-formylmethionine
The modifications that occur in a polypeptide often will be a function of how it is made For polypeptides made by expressing a cloned gene in a host, for instance, the nature and extent of the modifications in large part will be determined by the host cell posttranslational modification capacity and the modification signals present in the polypeptide ammo acid sequence For instance, as is well known, glycosylation often does not occur in bacterial hosts such as E coli Accordingly, when glycosylation is desired, a polypeptide should be expressed in a glycosylatmg host, generally a eukaryotic cell Insect cells often carry out the same posttranslational glycosylations as mammalian cells and, for this reason, insect cell expression systems have been developed to efficiently express mammalian proteins having native patterns of glycosylation, inter alia Similar considerations apply to other modifications
It will be appreciated that the same type of modification may be present to the same or varying degree at several sites in a given polypeptide Also, a given polypeptide may contain many types of modifications In general, as used herein, the term polypeptide encompasses all such modifications particularly those that are present in polypeptides synthesized by expressing a polynucleotide in a host cell
"Polynucleotide encoding a polypeptide" as used herein encompasses polynucleotides which include a sequence encoding a polypeptide of the present invention, particularly the PROST-Ets polypeptide having the ammo acid sequence set out in Figure 2 (SEQ ID NO 2)
The term encompasses polynucleotides that include a single continuous region or discontinuous regions encoding the polypeptide (for example, interrupted by introns) together with additional regions
"Biological activity" refers to the structural, regulatory or biochemical functions of naturally occurring PROST-Ets polypeptide
"Immunologic activity" refers to the capability of the natural, recombinant or synthetic PROST-Ets, or any fragment thereof, to induce a specific immune response in appropriate animals or cells and to bind with specific antibodies "Olιgonucleotιde(s)" refers to relatively short polynucleotides Often the term refers to single-stranded deoxyr ibonucleotides but it can refer as well to single- or double-stranded πbonucleotides, RNA DNA hybrids and double-stranded DNAs, among others Ohgonucleotides, such as single-stranded DNA probe ohgonucleotides, often are synthesized by chemical methods, such as those implemented on automated ohgonucleotide synthesizers
However, ohgonucleotides can be made by a variety of other methods, including in vitro recombinant DNA-mediated techniques and by expression of DNAs in cells and organisms "Ohgonucleotides" or "ohgomers" or polynucleotide "fragment", "portion", or "segment" refers to a polynucleotide sequence of at least about 10 nucleotides and as many as about 60 nucleotides, preferably about 15 to 30 nucleotides, and more preferably about 20-25 nucleotides
"Naturally occurring PROST-Ets" refers to PROST-Ets produced by human cells that have not been genetically engineered and specifically contemplates various PROST-Ets forms arising from post-translational modifications of the polypeptide including but not limited to acetylation, carboxylation, glycosylation, phosphorylation, hpidation, acylation, and cleavage "Varιant(s)" of polynucleotides or polypeptides, as the term is used herein, are polynucleotides or polypeptides that differ from a reference polynucleotide or polypeptide, respectively Variants in this sense are described below and elsewhere in the present disclosure in greater detail
(1 ) A polynucleotide that differs in polynucleotide sequence from another, reference polynucleotide Generally, differences are limited so that the polynucleotide sequences of the reference and the variant are closely similar overall and, in many regions, identical
As noted below, changes in the polynucleotide sequence of the variant may be silent That is, they may not alter the ammo acids encoded by the polynucleotide Where alterations are limited to silent changes of this type a variant will encode a polypeptide with the same ammo acid sequence as the reference Also as noted below, changes in the polynucleotide sequence of the variant may alter the ammo acid sequence of a polypeptide encoded by the reference polynucleotide Such polynucleotide changes may result in ammo acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below (2) A polypeptide that differs in ammo acid sequence from another, reference polypeptide Generally, differences are limited so that the sequences of the reference and the variant are closely similar overall and, in many regions, identical A variant and reference polypeptide may differ in ammo acid sequence by one or more substitutions, additions, deletions, fusions and truncations, which may be present in any combination Recombinant variants encoding these same or similar polypeptides may be synthesized or selected by making use of the "redundancy" in the genetic code Various codon substitutions, such as the silent changes which produce various restriction sites, may be introduced to optimize cloning into a plasmid or viral vector or expression in a particular prokaryotic or eukaryotic system Mutations may also be mtroduced to modify the properties of the polypeptide, to change hgand-binding affinities, interchain affinities, or polypeptide degradation or turnover rate
"Allehc variant" refers to an alternative form of the prost-ets polynucleotide Alleles result from a mutation, i e , a change in the polynucleotide sequence, and generally produce altered mRNAs or polypeptides whose structure or function may or may not be altered Any given gene may have none, one or many alle c forms Common mutational changes which give rise to alleles are generally ascribed to natural deletions, additions or substitutions of nucleotides Each of these types of changes may occur alone, or in combination with the others, or one or more times in a given sequence "Derivative" refers to polynucleotides or polypeptides derived from naturally occurring prost-ets or PROST-Ets, respectively, by chemical modifications such as ubiquitmation, labeling (e g , with radionuclides, various enzymatic modifications), pegylation (deπvatization with polyethylene glycol) or by insertion or substitution of ammo acids such as ornithme (or substitution of the nucleotides which code for such as an ammo acid), which do not normally occur in human proteins
"Deletion" is defined as a change in either polynucleotide or ammo acid sequences in which one or more polynucleotides or am o acid residues, respectively, are absent
"Insertion" or "addition" is that change in a polynucleotide or ammo acid sequence which has resulted in the addition of one or more polynucleotides or ammo acid residues respectively, as compared to the naturally occurring polynucleotide or ammo acid sequence
"Substitution" results from the replacement of one or more polynucleotides or ammo acids by different polynucleotides or ammo acids, respectively
Preferably, ammo acid substitutions are the result of replacing one ammo acid with another ammo acid having similar structural and/or chemical properties, such as the replacement of a leucine with an isoleucme or vahne, an aspartate with a glutamate, or a threonme with a seπne, i e conservative ammo acid replacement Insertions or deletions are typically in the range of about 1 to 5 ammo acids The variation allowed may be experimentally determined by systematically making insertions, deletions, or substitutions of ammo acids in the polypeptide using recombinant DNA techniques and assaying the resulting recombinant variants for activity "Fragment" is a polypeptide having an ammo acid sequence that entirely is the same as part but not all of the ammo acid sequence of the aforementioned PROST-Ets polypeptides and variants or derivatives thereof
A polypeptide "fragment", "portion", or "segment" is a stretch of ammo acid residues of at least about 5 ammo acids, often at least about 7 am o acids, typically at least about 9 to 13 ammo acids, and in various embodiments, at least about 17 or more ammo acids
"Recombinant" or "recombinant DNA molecule" refers to a polynucleotide sequence which is not naturally occurring, or is made by the artificial combination of two otherwise separated segments of sequence By "recombinantly produced" is meant artificial combination often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of polynuc eotides, e g , by genetic engineering techniques Such manipulation is usually done to replace a codon with a redundant codon encoding the same or a conservative ammo acid, while typically introducing or removing a sequence recognition site Alternatively, it is performed to join together polynucleotide segments with desired functions to generate a single genetic entity comprising a desired combination of functions not found in the common natural forms Restriction enzyme recognition sites, regulation sequences, control sequences, or other useful features may be incorporated by design "Recombinant DNA molecules" include cloning and expression vectors "Recombinant" may also refer to a polynucleotide which encodes a polypeptide and is prepared using recombinant DNA techniques
"Isolated" means altered "by the hand of man" from its natural state, i e , that, if it occurs in nature, it has been changed or removed from its original environment, or both For example, a naturally occurring polynucleotide or a polypeptide naturally present in a living animal in its natural state is not "isolated", but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated", as the term is employed herein For example, with respect to polynucleotides, the term isolated means that it is separated from the chromosome and cell in which it naturally occurs Polynucleotides and polypeptides may occur in a composition, such as media formulations, solutions for introduction of polynucleotides or polypeptides, for example into cells compositions or solutions for chemical or enzymatic reactions, for instance, which are not naturally occurring compositions, and, therein remain isolated polynucleotides or polypeptides within the meaning of that term as it is employed herein
"Substantially pure" and "substantially homogenous" are used interchangeably and describe PROST-Ets polypeptide, or fragments thereof, or a polynucleotide segment encoding same, where such polypeptide or polynucleotide is separated from components that naturally accompany it A PROST-Ets polypeptide or fragment thereof, or DNA segment encoding same is substantially free of naturally-associated components when it is separated from the native contaminants which accompany it in its natural state Thus, a polypeptide that is chemically synthesized or synthesized in a cellular system different from the cell in which it naturally originates will be substantially free from its naturally-associated components Similarly, a polynucleotide that is chemically synthesized or synthesized in a cellular system different from the cell in which it naturally originated will be substantially free from its naturally-associated components
"Homologous", when used to describe a polynucleotide, indicates that two polynucleotides, or designated sequences thereof, when optimally aligned and compared, are identical, with appropriate nucleotide insertions or deletions, in at least 70% of the nucleotides, usually from about 75% to 99%, and more preferably at least about 98 to 99% of the nucleotides "Polymerase chain reaction" or "PCR" refers to a procedure wherein specific pieces of DNA are amplified as described in U S Pat No 4,683,195, issued 28 July 1987 Generally, sequence information from the ends of the polypeptide fragment of interest or beyond needs to be available, such that oligonucleotide primers can be designed, these primers will point towards one another, and will be identical or similar in sequence to opposite strands of the template to be amplified The 5 terminal nucleotides of the two primers will coincide with the ends of the amplified material PCR can be used to amplify specific DNA sequences from total genomic DNA, cDNA transcribed from total cellular RNA, plasmid sequences, etc (See generally Mulhs et al , Cold Spring Harbor Symp Quant Biol , 51 263, 1987, Er ch, ed , PCR Technology, Stockton Press, NY, 1989) "Stringency" typically occurs in a range from about Tm (melting temperature)-5°C (5° below the Tm of the probe) to about 20°C to 25°C below Tm As will be understood by those of skill in the art, a stringent hybridization can be used to identify or detect identical polynucleotide sequences or to identify or detect similar or related polynucleotide sequences As herein used the term "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences
"Hybridization" as used herein, shall include "any process by which a polynucleotide strand joins with a complementary strand through base pairing" (Coombs, J , Dictionary of Biotechnology, Stockton Press, New York, N Y , 1994)
"Therapeutically effective dose" refers to that amount of polypeptide or its antibodies, antagonists, or inhibitors, including antisense molecules and πbozymes, which ameliorate the symptoms or conditions of a disease state Therapeutic efficacy and toxicity of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e g , ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population) The dose ratio between therapeutic and toxic effects is the therapeutic index, and it can be expressed as the ratio, ED50/LD50
"Treating" or "treatment" as used herein covers the treatment of a disease-state in a human patient, which disease-state is associated with prostate tumor growth and includes disease states in which the patient is in need of decreased levels of PROST-Ets
Detailed Description of the Invention
The present invention relates to novel PROST-Ets polypeptides, prost-ets polynucleotides, and antibodies directed toward PROST-Ets polypeptides, among other things, as described in greater detail below In particular, the invention relates to novel PROST-Ets polypeptides and the polynucleotides encoding these PROST-Ets polypeptides, and relates especially to PROST-Ets having the ammo acid sequence set out in Figure 2 (SEQ ID NO 2) and prost-ets having the polynucleotide sequence set out in Figure 1 (SEQ ID NO 1 ) The present invention also encompasses PROST-Ets variants A preferred PROST-Ets variant is one having at least 70% similarity (preferably at least 70% identity) to the polypeptide sequence shown in Figure 2 (SEQ ID NO 2) and more preferably at least 90% similarity (more preferably at least 90% identity) to the polypeptide shown in Figure 2 (SEQ ID NO 2) and still more preferably at least 95% similarity (still more preferably at least 95% identity) to the polypeptide sequence shown in Figure 2 (SEQ ID NO 2) and also includes portions of such polypeptides with such portion of the polypeptide generally containing at least 30 am o acids and more preferably at least 50 ammo acids
The coding sequence for the predicted active form of the PROST-Ets polypeptide begins 422 base pairs from the 5 end of the nucleotide sequence shown in Fig 1 (SEQ ID NO 1 ) PROST-Ets contains two domains characteristic of the Ets family of proteins a pointed domain (involved in protein-protein interactions) at ammo acids 131 to 213 and an Ets domain (involved in DNA binding) at ammo acids 246 to 332
The present invention is based in part on the structural homology shown in Figure 3 between PROST-Ets and Drosophila D-Ets-4, another member of the Ets family of transcription factors The ammo acid sequence of PROST-Ets is approximately 74% homologous to Drosophila D-Ets-4 over 87 am o acids
The invention is also based in part on the expression profile of prost-ets mRNA, which is characterized by expression in prostate tissue libraries and overexpression in prostate tumor libraries This tissue profile is seen in analysis of mRNA expression in tissue samples from normal and tumor tissues by Northern blotting and by PCR based Taqman analysis Both methods of analysis demonstrated that mRNA encoding PROST-Ets is expressed at high levels in prostate tissues and in a limited number of other tissues, including colon and breast
The invention is also based in part on a number of functional studies demonstrating the effect of a reduction in the level of mRNA encoding PROST-Ets on prostate tumor cell growth in culture First, the effect of reduction of prost-ets mRNA levels was demonstrated in the prostate tumor cell line, PC-3, using antisense ohgonucleotides to reduce prost-ets mRNA expression Three antisense o gonucleotide reagents were found that reduced mRNA levels for PROST-Ets when administered to cells in the presence of lipids Administration of these antisense ohgonucleotide reagents to PC-3 cells inhibited proliferation of the cells in a dose dependent manner In the same dose range, a control ohgonucleotide mixture composed of a set of random 23mer ohgonucleotides did not affect proliferation of the cells In complimentary experiments, antisense ohgonucleotides directed to regions of the PROST-Ets sequence were transfected into PC-3 cells which had been modified to make transcription of the antisense molecules within the cells doxycychne inducible In the presence of doxycychne, PC3 cells transfected with antisense ohgonucleotides directed against prost-ets mRNA showed a reduction in cell growth as compared with control cells Both of these sets of experiments demonstrate that inhibition of prost-ets mRNA expression reduced the growth of the tumor cell lines in which PROST-Ets polypeptide is normally expressed Polynucleotides
In accordance with one aspect of the present invention, there are provided isolated polynucleotides that encode the PROST-Ets polypeptide having the deduced am o acid sequence of Figure 2 (SEQ ID NO 2) Using the information provided herein, such as the polynucleotide sequence set out in
Figure 1 (SEQ ID NO 1 ), a polynucleotide of the present invention encoding a PROST-Ets polypeptide may be obtained using standard cloning and screening procedures such as those for cloning cDNAs using mRNA from cells of human tissue as starting material Illustrative of the invention, the polynucleotide sequence in Figure 1 (SEQ ID NO 1 ) was found in cDNA clones obtained from human prostate tissues. Prost-ets was identified as a gene expressed in the prostate by mining Incyte's LifeSeq gene expression database for sequences expressed in either a prostate or tumor specific manner
The original clone identified was Incyte Clone 581956, discovered in a prostate tumor library This clustered with other Incyte clones, including 1813005, and 1794731 These clones were acquired from Incyte and used for experimental purposes including sequence determination and expression analysis The nucleotide sequence of Clone 581956 was used for electronic Northern analysis of the expression of the gene in all tissue libraries in Incyte's database Initial screens demonstrated that the PROST-Ets gene was expressed largely in the prostate and overexpressed in prostate tumors In updated versions of the database, it was found to be expressed not only in the prostate but also in breast tumor and ovarian tumor libraries All clones in Incyte's Lifeseq library coding for PROST-Ets were assembled into a contiguous sequence using the Genetics Computer Group (GCG, Wisconsin package) gene assembly program and the sequence of the assembled mRNA evaluated This sequence was edited to improve the quality of the contiguous assembled sequence and an open reading frame coding for a protein was identified The sequence of the mRNA was confirmed by obtaining a physical clone from Incyte (Clone 1794731 ) that contained the most complete 5' sequence in the Lifeseq database, and sequencing the DNA This sequence is shown in Figure 1 (SEQ ID NO 1 )
Polynucleotides of the present invention may be in the form of RNA such as mRNA or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced by chemical synthetic techniques or by a combination thereof, or by methods described herein The DNA may be doub'e-stranded or single-stranded Single-stranded DNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand also referred to as the anti-sense strand
The coding sequence which encodes the polypeptide may be identical to the coding sequence of the polynucleotide shown in Figure 1 (SEQ ID NO 1 ) It also may be a polynucleotide with a different sequence, which, as a result of the redundancy (degeneracy) of the genetic code, encodes the polypeptide of Figure 2 (SEQ ID NO 2)
Polynucleotides of the present invention which encode the polypeptide of Figure 2 (SEQ ID NO 2) may include, but are not limited to, the coding sequence for the polypeptide itself, the coding sequence for the polypeptide and additional coding sequences, such as those encoding a leader or secretory sequence, such as a pre-, or pro- or prepro-prote sequence, the coding sequence of the polypeptide, with or without the aforementioned additional coding sequences, together with additional, non-coding sequences, including for example, but not limited to, introns and non-coding 5 and 3 sequences, such as the transcribed, non- translated sequences that play a role in transcription, mRNA processing (for example, splicing and polyadenylation signals) or additional coding sequences which code for additional ammo acids, such as those which provide additional functionalities Thus, for instance, the polypeptide may be fused to a marker sequence, such as a peptide, which facilitates purification of the fused polypeptide In certain preferred embodiments of this aspect of the invention, the marker sequence is a hexa-histidme peptide, such as the tag provided in a pTrcHisB vector (Invitrogen, Carlsbad, CA) OR A pet15B vector (Novagen) among others, many of which are commercially available As described in Gentz et al (Proc Natl Acad Sci , USA 86 82I-824, 1989), for instance, hexa-histidme provides for convenient purification of the fusion protein The HA tag corresponds to an epitope derived from influenza hemaglutinin protein, which has been described by Wilson et al (Cell 37 767, 1984), for instance
The polynucleotides may encode a polypeptide which is the polypeptide plus additional ammo or carboxyl-terminal ammo acids, or ammo acids interior to the polypeptide (when the active form has more than one polypeptide chain, for instance) Such sequences may play a role in processing of a polypeptide from precursor to final form, may facilitate polypeptide trafficking, may prolong or shorten polypeptide half-life or may facilitate manipulation of a polypeptide for assay or production, among other things As generally is the case in situ, the additional ammo acids may be processed away from the polypeptide by cellular enzymes A precursor polypeptide, having the final form of the polypeptide fused to one or more prosequences may be an inactive form of the polypeptide When prosequences are removed such inactive precursors generally are activated Some or all of the prosequences may be removed before activation Generally, such precursors are called propolypeptides
The present invention further relates to variants of the herein above described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced am o acid sequence of Figure 2 (SEQ ID NO 2) A variant of the polynucleotide may be a naturally occurring variant such as a naturally occurring allehc variant, or it may be a variant that is not known to occur naturally Such non-naturally occurring variants of the polynucleotide may be made by mutagenesis techniques, including those applied to polynucleotides, cells or organisms
Among variants in this regard are variants that differ from the aforementioned polynucleotides by polynucleotide substitutions, deletions or additions The substitutions, deletions or additions may involve one or more polynucleotides The variants may be altered in coding or non-coding regions or both Alterations in the coding regions may produce conservative or non-conservative ammo acid substitutions, deletions or additions
Among the particularly preferred embodiments of the invention in this regard are polynucleotides encoding polypeptides having the am o acid sequence of PROST-Ets set out in Figure 2 (SEQ ID NO 2), variants, analogs, derivatives and fragments thereof, and fragments of the variants, analogs and derivatives
Further particularly preferred in this regard are polynucleotides encoding PROST-Ets variants, analogs, derivatives and fragments, and variants, analogs and derivatives of the fragments, which have the ammo acid sequence of the PROST-Ets polypeptide of Figure 2 (SEQ ID NO 2) in which several, a few, 5 to 10, 1 to 5, 1 to 3, 2, 1 or no ammo acid residues are substituted, deleted or added, in any combination Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the PROST-Ets polypeptide Also especially preferred in this regard are conservative substitutions Most highly preferred are polynucleotides encoding polypeptides having the am o acid sequence of Figure 2 (SEQ ID NO 2) without substitutions
Further preferred embodiments of the invention are polynucleotides that are at least 70% identical to a polynucleotide encoding the PROST-Ets polypeptide having the ammo acid sequence set out in Figure 2 (SEQ ID NO 2), and polynucleotides which are complementary to such polynucleotides Alternatively, most highly preferred are polynucleotides that comprise a region that is at least 80% identical to a polynucleotide encoding the PROST-Ets polypeptide and polynucleotides complementary thereto In this regard, polynucleotides at least 90% identical to the same are particularly preferred, and among these particularly preferred polynucleotides, those with at least 95% are especially preferred Furthermore, those with at least 97% are highly preferred among those with at least 95%, and among these, those with at least 98% and at least 99% are particularly highly preferred with at least 99% being the more preferred
Particularly preferred embodiments in this respect, moreover, are polynucleotides which encode polypeptides which retain substantially the same biological activity as the polypeptide encoded by the polynucleotide sequence of Figure 1 (SEQ ID NO 1 ) The present invention further relates to polynucleotides that hybridize to the herein above-described sequences In this regard, the present invention especially relates to polynucleotides which hybridize under stringent conditions to the herein above-described polynucleotides
As discussed additionally herein regarding polynucleotide assays of the invention, for instance, polynucleotides of the invention as discussed above, may be used as a hybridization probes for cDNA and genomic DNA to isolate full-length cDNAs and genomic clones encoding PROST-Ets and to isolate cDNA and genomic clones of other genes that have a high sequence similarity to the prost-ets gene Such probes generally will comprise at least 15 bases Preferably, such probes will have at least 30 bases and may have at least 50 bases
For example, the coding region of the prost-ets gene may be isolated by screening using the known DNA sequence to synthesize an ohgonucleotide probe A labeled ohgonucleotide having a sequence complementary to that of a polynucleotide of the present invention is then used to screen a library of human cDNA, genomic DNA or mRNA to determine to which members of the library the probe hybridizes
In sum, a polynucleotide of the present invention may encode a polypeptide, a polypeptide plus a leader sequence (which may be referred to as a prepolypeptide), a precursor of a polypeptide having one or more prosequences which are not the leader sequences of a prepolypeptide, or a prepropolypeptide, which is a precursor to a propolypeptide, having a leader sequence and one or more prosequences, which generally are removed during processing steps that produce active forms of the polypeptide
It will be appreciated that the invention also relates to, among others, polynucleotides encoding the polypeptide fragments, polynucleotides that hybridize to polynucleotides encoding polypeptide fragments, particularly those that hybridize under stringent conditions, and polynucleotides, such as PCR primers, for amplifying polynucleotides that encode polypeptide fragments In these regards, preferred polynucleotides are those that correspond to preferred polypeptide fragments, as discussed below
Polypeptides
The present invention further relates to a PROST-Ets polypeptide which has the deduced ammo acid sequence of Figure 2 (SEQ ID NO 2)
The invention also relates to fragments, analogs and derivatives of these polypeptides The terms fragment, derivative and analog when referring to the polypeptide of Figure 2 (SEQ ID NO 2) means a polypeptide which retains essentially the same biological activity as such a polypeptide Thus, an analog includes a propolypeptide which can be activated by cleavage of the propolypeptide portion to produce an active polypeptide of the invention
The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide In certain preferred embodiments, it is a recombinant polypeptide
The fragment, derivative or analog of the polypeptide of Figure 2 (SEQ ID NO 2) may be (i) one in which one or more of the ammo acid residues are substituted with a conserved or non-conserved am o acid residue (preferably a conserved ammo acid residue) and such substituted am o acid residue may or may not be one encoded by the genetic code, or (ιι) one in which one or more of the ammo acid residues includes a substituent group, or (in) one in which the polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol) or (iv) one in which the additional ammo acids are fused to the polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the polypeptide Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein
Among the particularly preferred embodiments of the invention in this regard are polypeptides having the ammo acid sequence of PROST-Ets set out in Figure 2 (SEQ ID NO
2), variants, analogs, derivatives and fragments thereof, and variants, analogs and derivatives of the fragments
Among preferred variants are those that vary from a reference by conservative ammo acid substitutions Such substitutions are those that substitute a given ammo acid in a polypeptide by another ammo acid of like characteristics Typically seen as conservative substitutions are the replacements, one for another, among the aliphatic ammo acids Ala, Val Leu and lie, interchange of the hydroxyl residues Ser and Thr, exchange of the acidic residues Asp and Glu, substitution between the amide residues Asn and Gin, exchange of the basic residues Lys and Arg and replacements among the aromatic residues Phe and Tyr Further particularly preferred in this regard are variants, analogs, derivatives and fragments, and variants, analogs and derivatives of the fragments, having the ammo acid sequence of the PROST-Ets polypeptide of Figure 2 (SEQ ID NO 2) in which several, a few, 5 to 10, 1 to 5, 1 to 3, 2, 1 or no ammo acid residues are substituted, deleted or added, in any combination Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the PROST-Ets polypeptide Also especially preferred in this regard are conservative substitutions Most highly preferred are polypeptides having the ammo acid sequence of Figure 2 (SEQ ID NO 2) without substitutions The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity The polypeptides of the present invention also include the polypeptide of Figure 2
(SEQ ID NO 2) as well as polypeptides which have at least 70% similarity (preferably at least 70% identity) to the polypeptide of Figure 2 (SEQ ID NO 2) and more preferably at least 90% similarity (more preferably at least 90% identity) to the polypeptide of Figure 2 (SEQ ID NO 2) and still more preferably at least 95% similarity (still more preferably at least 95% identity) to the polypeptide of Figure 2 (SEQ ID NO 2) and also include portions of such polypeptides with such portion of the polypeptide generally containing at least 30 am o acids and more preferably at least 50 ammo acids
As known in the art "similarity" between two polypeptides is determined by comparing the ammo acid sequence and its conserved ammo acid substitutes of one polypeptide to the sequence of a second polypeptide
Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptides by peptide synthesis, therefore, the fragments may be employed as intermediates for producing the full-length polypeptides Fraαments
Also among preferred embodiments of this aspect of the present invention are polypeptides comprising fragments of PROST-Ets, most particularly fragments of the PROST- Ets of Figure 2 (SEQ ID NO 2), and fragments of variants and derivatives of the PROST-Ets of Figure 2 (SEQ ID NO 2)
In this regard a fragment is a polypeptide having an ammo acid sequence that entirely is the same as part but not all of the ammo acid sequence of the aforementioned PROST-Ets polypeptides and variants or derivatives thereof
Such fragments may be "free-standing," i e , not part of or fused to other am o acids or polypeptides, or they may be comprised within a larger polypeptide of which they form a part or region When comprised within a larger polypeptide, the presently discussed fragments most preferably form a single continuous region However, several fragments may be comprised within a single larger polypeptide For instance, certain preferred embodiments relate to a fragment of a PROST-Ets polypeptide of the present invention comprised within a precursor polypeptide designed for expression in a host and having heterologous pre- and propolypeptide regions fused to the ammo terminus of the PROST-Ets fragment and an additional region fused to the carboxyl terminus of the fragment Therefore, fragments in one aspect of the meaning intended herein, refers to the portion or portions of a fusion polypeptide or fusion protein derived from PROST-Ets As representative examples of polypeptide fragments of the invention, there may be mentioned those which have from about 25 to about 335 ammo acids In this context "about" includes the particularly recited range and ranges larger or smaller by several, a few, 5, 4, 3, 2 or 1 ammo acid at either extreme or at both extremes For instance, about 25 ammo acids in this context means a polypeptide fragment of 25 plus or minus several, a few, 5, 4, 3, 2 or 1 ammo acids to 335 plus or minus several, a few, 5, 4, 3, 2 or 1 ammo acid residues, i e , ranges as broad as 25 minus several am o acids to 335 plus several am o acids to as narrow as 25 plus several ammo acids to 335 minus several ammo acids
Highly preferred in this regard are the recited ranges plus or minus as many as 5 ammo acids at either or at both extremes Particularly highly preferred are the recited ranges plus or minus as many as 3 ammo acids at either or at both the recited extremes Especially particularly highly preferred are ranges plus or minus 1 ammo acid at either or at both extremes or the recited ranges with no additions or deletions Most highly preferred of all in this regard are fragments from about 25 to about 335 ammo acids
Among especially preferred fragments of the invention are truncation mutants of PROST-Ets Truncation mutants include PROST-Ets of Figure 2 (SEQ ID NO 2), or variants or derivatives thereof, except for deletion of a continuous series of residues (that is, a continuous region, part or portion) that includes the am o terminus of the sequence shown in Figure 2 (SEQ ID NO 2), or a continuous series of residues that includes the carboxyl terminus or, as in double truncation mutants, deletion of two continuous series of residues, one including the am o terminus and one including the carboxyl terminus Fragments having the size ranges set out above also are preferred embodiments of truncation fragments, which are especially preferred among fragments generally Especially preferred in this aspect of the invention are fragments characterized by biological and/or immunological attributes of PROST-Ets Most preferred are fragments containing the predicted active domains of PROST-Ets, which encompasses at least ammo acids 131 to 213 and ammo acids 246 to 332 as shown in Figure 2 (SEQ ID NO 2)
Certain preferred regions in these regards are set out in Figure 2 (SEQ ID NO 2) and include, but are not limited to, regions of the aforementioned types identified by analysis of the ammo acid sequence set out in Figure 2 (SEQ ID NO' 2)
Among highly preferred fragments in this regard are those that comprise regions of PROST-Ets that combine several structural features, such as the features set out above In this regard, the "pointed" and "Ets' domains, encompassing about ammo acids 131 to 213 and 246 to 332, respectively, which are characteristic of the Ets family of transcription factors, are especially preferred regions Such regions may be comprised within a larger polypeptide or may be by themselves a preferred fragment of the present invention, as discussed above It will be appreciated that the term "about" as used in this paragraph has the meaning set out above regarding fragments in general Further preferred regions are those that mediate activities of PROST-Ets Most highly preferred in this regard are fragments that have a chemical, biological or other activity of PROST-Ets, including those with a similar activity or an improved activity, or with a decreased undesirable activity Highly preferred in this regard are fragments that contain regions that are homologs in sequence, or in position, or in both sequence and position to active regions of related polypeptides, such as the other proteins of the Ets-like transcription factor family, which includes PROST-Ets
Vectors, host cells, and expression systems
The present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques Such techniques are described in Sambrook et al , Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Plamview, N Y , 1989 and Ausubel, F M et al , Current Protocols in Molecular Biology, John Wiley & Sons, New York, N Y , 1989 Host cells can be genetically engineered to incorporate polynucleotides and express polypeptides of the present invention For instance, polynucleotides may be introduced into host cells using well known techniques of infection, transduction, transfection, transvection and transformation The polynucleotides may be introduced alone or with other polynucleotides Such other polynucleotides may be introduced independently, co-introduced or introduced joined to the polynucleotides of the invention
Thus, for instance, polynucleotides of the invention may be transfected into host cells with another, separate, polynucleotide encoding a selectable marker, using standard techniques for cotransfection and selection in, for instance, mammalian cells In this case, the polynucleotides generally will be stably incorporated into the host cell genome
Alternatively, the polynucleotides may be joined to a vector containing a selectable marker for propagation in a host The vector construct may be introduced into host cells by the aforementioned techniques Generally, a plasmid vector is introduced as DNA in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid Electroporation also may be used to introduce polynucleotides into a host If the vector is a virus, it may be packaged in vitro or introduced into a packaging cell and the packaged virus may be transduced into cells A wide variety of techniques suitable for making polynucleotides and for introducing polynucleotides into cells in accordance with this aspect of the invention are well known and routine to those of skill in the art Such techniques are reviewed at length in
Sambrook et al cited above, which is illustrative of the many laboratory manuals that detail these techniques In accordance with this aspect of the invention, the vector may be, for example, a plasmid vector, a single or double-stranded phage vector, a single or double- stranded RNA or DNA viral vector Such vectors may be introduced into cells as polynucleotides, preferably DNA, by well known techniques for introducing DNA and RNA into cells The vectors, in the case of phage and viral vectors, also may be and preferably are introduced into cells as packaged or encapsidated virus by well known techniques for infection and transduction Viral vectors may be replication competent or replication defective In the latter case viral propagation generally will occur only in complementing host cells Preferred among vectors, in certain respects, are those for expression of polynucleotides and polypeptides of the present invention Generally, such vectors comprise cis-acting control regions effective for expression in a host operatively linked to the polynucleotide to be expressed Appropriate trans-acting factors either are supplied by the host, supplied by a complementing vector or supplied by the vector itself upon introduction into the host
In certain preferred embodiments in this regard, the vectors provide for specific expression Such specific expression may be inducible expression or expression only in certain types of cells or both inducible and cell-specific Particularly preferred among inducible vectors are vectors that can be induced for expression by environmental factors that are easy to manipulate, such as temperature and nutrient additives A variety of vectors suitable to this aspect of the invention, including constitutive and inducible expression vectors for use in prokaryotic and eukaryotic hosts, are well known and employed routinely by those of skill in the art The engineered host cells can be cultured in conventional nutrient media, which may be modified as appropriate for, inter alia, activating promoters, selecting transformants or amplifying genes Culture conditions, such as temperature, pH and the like, previously used with the host cell selected for expression generally will be suitable for expression of polypeptides of the present invention as will be apparent to those of skill in the art
A great variety of expression vectors can be used to express a polypeptide of the invention Such vectors include chromosomal, episomal and virus-derived vectors e g , vectors derived from bacterial plasmids, from bacteπophage, from yeast episomes, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses and vectors derived from combinations thereof, such as those derived from plasmid and bacteπophage genetic elements such as cosmids and phagemids, all may be used for expression in accordance with this aspect of the present invention Generally, any vector suitable to maintain, propagate or express polynucleotides to express a polypeptide in a host may be used for expression in this regard
The appropriate DNA sequence may be inserted into the vector by any of a variety of well-known and routine techniques In general, a DNA sequence for expression is joined to an expression vector by cleaving the DNA sequence and the expression vector with one or more restriction endonucleases and then joining the restriction fragments together using T4 DNA hgase Procedures for restriction and hgation that can be used to this end are well known and routine to those of skill Suitable procedures in this regard, and for constructing expression vectors using alternative techniques, which also are well known and routine to those of skill, are set forth in great detail in Sambrook et al cited elsewhere herein
The DNA sequence in the expression vector is operatively linked to appropriate expression control sequence(s), including for instance, a promoter to direct mRNA transcription Representatives of such promoters include the phage lambda PL promoter, the E coli lac, trp and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs to name just a few of the well-known promoters It will be understood that numerous promoters not mentioned are suitable for use in this aspect of the invention, are well known and may readily be employed by those of skill in the manner illustrated by the discussion and the examples herein
In general, expression constructs will contain sites for transcription initiation and termination and, in the transcribed region, a πbosome binding site for translation The coding portion of the transcripts expressed by the constructs will include a translation initiating AUG at the beginning and a termination codon appropriately positioned at the end of the polypeptide to be translated
In addition, the constructs may contain control regions that regulate as well as engender expression Generally, in accordance with many commonly practiced procedures, such regions will operate by controlling transcription, such as repressor binding sites and enhancers, among others
Vectors for propagauon and expression generally will include selectable markers Such markers also may be suitable for amplification or the vectors may contain additional markers for this purpose In this regard, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells Preferred markers include dihydrofolate reductase or neomycm resistance for eukaryotic cell culture, and tetracyclme, theomycm, kanamycm or ampicilhn resistance genes for culturing E coli and other bacteria The vector containing the appropriate DNA sequence as described elsewhere herein, as well as an appropriate promoter, and other appropriate control sequences, may be introduced into an appropriate host using a variety of well known techniques suitable to expression therein of a desired polypeptide Representative examples of appropriate hosts include bacterial cells, such as E coli, Streptomyces and Salmonella typhimunum cells, fungal cells, such as yeast cells, insect cells such as Drosophila S2 and Spodoptera Sf9 cells, animal cells such as CHO, COS and Bowes melanoma cells, and plant cells A preferred host is the insect cell BTI-TN-5B1-4 Hosts for a great variety of expression constructs are well known, and those of skill will be enabled by the present disclosure readily to select a host for expressing a polypeptides in accordance with this aspect of the present invention Various mammalian cell culture systems can be employed for expression, as well
Examples of mammalian expression systems include the COS-7 lines of monkey kidney fibroblast (Gluzman et al , Cell 23 175, 1991 ) Other cell lines capable of expressing a compatible vector include for example, the C127, 3T3, CHO, HeLa, human kidney 293 and BHK cell lines In mammalian host cells, a number of viral-based expression systems may be utilized In cases where an adenovirus is used as an expression vector, the polynucleotide sequence coding for PROST-Ets may be ligated into an adenovirus transcription/translation complex consisting of the late promoter and tripartite leader sequence Insertion in a nonessential E1 or E3 region of the viral genome will result in a viable virus capable of expressing PROST-Ets in infected host cells (Logan and Shenk, Proc Natl Acad Sci USA 81 3655-59, 1984) In addition, transcription enhancers, such as the rouse sarcoma virus
(RVS) enhancer, may be used to increase expression in mammalian host cells
More particularly, the present invention also includes recombinant constructs, such as expression constructs, comprising one or more of the sequences described above The constructs comprise a vector, such as a plasmid or viral vector, into which such a sequence of the invention has been inserted The sequence may be inserted in a forward or reverse orientation In certain preferred embodiments in this regard, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence Large numbers of suitable vectors and promoters are known to those of skill in the art, and there are many commercially available vectors suitable for use in the present invention
The following vectors, which are commercially available, are provided by way of example Among vectors preferred for use in bacteria are pQE70, pQE60 and pQE-9, available from Qiagen USA (Valencia, CA), pBS vectors, Phagescπpt® vectors, Bluescπpt® vectors, pNH8A, pNHI6a, pNHI8A, pNH46A, available from Stratagene (LaJolla, CA), and ptrc99a, pK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia Biotech (Piscataway, N J ) Most preferred is the pTrcHisB vector, available from Introgen or the pET15b vector from Novagen Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, p0G44, PXTI and pSG available from Stratagene, and PSVK3, pBPV, pMSG and pSVL available from Pharmacia Biotech These vectors are listed solely by way of illustration of the many commercially available and well known vectors that are available to those of skill in the art for use in accordance with this aspect of the present invention It will be appreciated that any other plasmid or vector suitable for, for example, introduction, maintenance, propagation or expression of a polynucleotide or polypeptide of the invention in a host may be used in this aspect of the invention
Promoter regions can be selected from any desired gene using vectors that contain a reporter transcription unit lacking a promoter region, such as a chloramphenicol acetyl transferase ("cat") transcription unit, downstream of restriction site or sites for introducing a candidate promoter fragment, i e , a fragment that may contain a promoter As is well known, introduction into the vector of a promoter-containing fragment at the restriction site upstream of the cat gene engenders production of CAT activity, which can be detected by standard CAT assays Vectors suitable to this end are well known and readily available Thus, promoters for expression of polynucleotides of the present invention include not only well known and readily available promoters, but also promoters that readily may be obtained by the foregoing technique, using a reporter gene
Among known bacterial promoters suitable for expression of polynucleotides and polypeptides in accordance with the present invention are the E coli lacl and lacZ promoters the T3 and T7 promoters, the T5 tac promoter, the lambda PR, PL promoters, the trp promoter and the trc hybrid promoter, which is derived from the trp and lac promoters Among known eukaryotic promoters suitable in this regard are the CMV immediate early promoter, the HSV thymidine kmase promoter, the early and late SV40 promoters, the promoters of retroviral LTRs, such as those of the Rous sarcoma virus ("RSV") and metallothionein promoters such as the mouse metallothιoneιn-l promoter
Selection of appropriate vectors and promoters for expression in a host cell is a well known procedure and the requisite techniques for expression vector construction introduction of the vector into the host and expression in the host are routine skills in the art
Generally, recombinant expression vectors will include origins of replication, a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence, and a selectable marker to permit isolation of vector containing cells after exposure to the vector
The present invention also relates to host cells containing the above-described constructs discussed above The host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell Constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence
Polypeptides can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook et al , cited elsewhere herein
Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes may be increased by inserting an enhancer sequence into the vector Enhancers are cisacting elements of DNA, usually about from 10 to 300 bp that act to increase transcπptional activity of a promoter in a given host cell-type Examples of enhancers include the SV40 enhancer, which is located on the late side of the replication origin at bp 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers Polynucleotides of the invention, encoding the heterologous structural sequence of a polypeptide of the invention generally will be inserted into the vector using standard techniques so that it is operably linked to the promoter for expression The polynucleotide will be positioned so that the transcription start site is located appropriately 5 to a πbosome binding site The πbosome binding site will be 5 to the AUG that initiates translation of the polypeptide to be expressed Generally, there will be no other open reading frames that begin with an initiation codon, usually AUG, and he between the πbosome binding site and the initiating AUG Also, generally, there will be a translation stop codon at the end of the polypeptide and there will be a polyadenylation signal and a transcription termination signal appropriately disposed at the 3 end of the transcribed region For secretion of the translated protein into the lumen of the endoplasmic reticulum, into the peπplasmic space or into the extracellular environment, appropriate secretion signals may be incorporated into the expressed polypeptide The signals may be endogenous to the polypeptide or they may be heterologous signals The polypeptide may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals but also additional heterologous fuctional regions Thus for instance, a region of additional ammo acids, particularly charged ammo acids, may be added to the N-termmus of the polypeptide to improve stability and persistence in the host cell, during purification or during subsequent handling and storage Also, special regions also may be added to the polypeptide to facilitate puπfication Such regions may be removed prior to final preparation of the polypeptide The addition of peptide moieties to polypeptides to engender secretion or excretion, to improve stability and to facilitate purification, among others, are familiar and routine techniques in the art For example, when large quantities of PROST-Ets are needed for the induction of antibodies, vectors which direct high level expression of fusion proteins that are readily purified may be desirable Such vectors include, but are not limited to, the multifunctional £ coli cloning and expression vectors such as Bluescπpt® (Stratagene), in which the prost-ets coding sequence may be ligated into the vector in frame with sequence for the ammo-terminal Met and the subsequent 7 residues of β-galactosidase so that a hybrid protein is produced, plN vectors (Van Heede and Shuster, J Biol Chem 264 5503-5509, 1989) and the like PtrcHis vectors
(Invitrogen, Carlsbad, CA) or pET15b vectors (Stratagene) may be used to express foreign polypeptides as fusion proteins containing a polyhistidme (6xHιs) tag for rapid purification Proteins made is such systems are designed to include cleavage sites, such as an enterokinase cleavage site, so that the cloned polypeptide of interest can be released from the fusion peptide moiety at will
Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, where the selected promoter is inducible it is induced by appropriate means (e g , temperature shift or exposure to chemical inducer) and cells are cultured for an additional period Cells typically then are harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification
Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysmg agents, such methods are well know to those skilled in the art The PROST-Ets polypeptide can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectm chromatography Most preferably, high performance liquid chromatography ("HPLC") is employed for purification Well known techniques for refolding protein may be employed to regenerate active conformation when the polypeptide is denatured during isolation and or purification Various other methods of protein purification well known in the art include those described in Deutscher, M , Methods in Enzymology, Vol 182, Academic Press, San Diego, 1982 and Scopes, R , Protein Purification Principles and Practice Spπnger-Verlag, New York, 1982
Alternatively, the polypeptides of the present invention can be produced by direct peptide synthesis using solid-phase techniques (Stewart et al , Solid-Phase Peptide Synthesis, W H Freeman Co , San Francisco, 1969, Merrifield, J , J Am Chem Soc 85 2149-2154, 1963) In vitro protein synthesis ma be performed using manual techniques or by automation Automated synthesis may be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer, Foster City, Calif) in accordance with the instructions provided by the manufacturer Various fragments of PROST-Ets may be chemically synthesized separately and combined using chemical methods known in the art to produce the full length molecule
Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes
Uses of PROST-Ets polypeptides and the polynucleotides which encode them Prost-ets polynucleotides and PROST-Ets polypeptides may be used in accordance with the present invention for a variety of applications, particularly those that make use of the chemical and biological properties of PROST-Ets Additional applications relate to diagnosis and to treatment of diseases of cell proliferation, such as prostate cancer These aspects of the invention are illustrated further by the following discussion and are described further within the body of the specification
The rationale for the use of the polynucleotide and polypeptide sequences of the present invention is based in part on the chemical and structural homology between the PROST-Ets polypeptide disclosed herein and other Ets-like transcription factor molecules and on the preferential expression of PROST-Ets in prostate and breast tissues as compared with other tissues PROST-Ets may be used in the diagnosis and treatment of conditions, disorders or diseases associated with inappropriate growth of prostate tissue These would include, but are not limited to, cancer and metastatic tumor growth
Prost-ets polynucleotide sequences can be used as DNA probes, and as targets for antisense and nbozyme therapy, or as templates for the production of antisense polynucleotides Administration of such antisense polynucleotides to cells can be used to suppress expression of prost-ets mRNA
PROST-Ets polypeptides and fragments thereof can be used to generate antibodies to PROST-Ets which may be useful in detecting the levels of PROST-Ets polypeptide in cells and tissues and in targeting drugs to primary and metastatic tumors Alternatively, antibodies specifically recognizing areas of the PROST-Ets polypeptide which are responsible for its activity may be administered to treat diseases or conditions associated with PROST-Ets activity PROST-Ets polypeptides may be used to stimulate an immune response to PROST-Ets containing cells
Polynucleotides encoding PROST-Ets may be useful in diagnostic assays for detecting the levels of polynucleotides encoding PROST-Ets in cells and tissues Prost-ets polynucleotides and PROST-Ets polypeptides of the present invention may be employed in accordance with the present invention by expression of such polypeptides in vitro and in vivo, in treatment modalities often referred to as "gene therapy " In conditions associated with PROST-Ets activity, such as prostate cancer, it may be advantageous to suppress the activity of PROST-Ets PROST-Ets activity can be suppressed through introduction of polynucleotides encoding regions of the PROST-Ets polypeptide into tumor cells, where the polypeptides they encode act as dominant negative reagents within the cells blocking PROST-Ets activity Alternatively, polypeptides which act as dominant negative reagents can be introduced directly into tumor cells to block PROST-Ets activity
Polynucleotide assays
This invention is also related to the use of the prosf-e/s-related polynucleotides to detect complementary polynucleotides such as, for example, as a diagnostic reagent Detection of prost-ets polynucleotides associated with a disease state will provide a tool for the development of in vitro and in vivo diagnostics that can add or define a diagnosis of a disease or susceptibility to a disease which results from tissue specific expression of PROST-Ets
Individuals carrying mutations in the gene encoding PROST-Ets may be detected at the DNA level by a variety of techniques Polynucleotide samples for diagnosis may be obtained from a patient's cells, such as from blood, urine, saliva, tissue biopsy and autopsy material The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR prior to analysis (Saiki et al , Nature, 324 163-166, 1986) RNA or cDNA may also be used in the same ways As an example, PCR primers complementary to the polynucleotide sequence encoding PROST-Ets can be used to identify and analyze prost- ets expression and mutations For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype Point mutations can be identified by hybridizing amplified DNA to radiolabeled prost-ets RNA or alternatively radiolabeled prost-ets antisense DNA sequences Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures
Sequence differences between a reference gene and genes having mutations also may be revealed by direct DNA sequencing In addition, cloned DNA segments may be employed as probes to detect specific DNA segments The sensitivity of such methods can be greatly enhanced by appropriate use of PCR or another amplification method For example, a sequencing primer is used with double-stranded PCR product or a single-stranded template molecule generated by a modified PCR The sequence determination is performed by conventional procedures with radiolabeled polynucleotide or by automatic sequencing procedures with fluorescent tags
Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels, with or without denaturing agents Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see e g , Myers et al , Science, 230 1242, 1985)
Sequence changes at specific locations also may be revealed by nuclease protection assays, such as RNase and S1 protection or the chemical cleavage method (e g , Catton et al , Proc Natl Acad Sci , USA, 85 4397-4401 , 1985)
Thus, the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e g , restriction fragment length polymorphisms ("RFLP") and Southern blotting of genomic DNA)
In addition to more conventional gel-electrophoresis and DNA sequencing, mutations also can be detected by in situ analysis
Polypeptide assays
The present invention also relates to a diagnostic assays such as quantitative and diagnostic assays for detecting levels of PROST-Ets polypeptide in cells and tissues and body fluids, including determination of normal and abnormal levels Thus, for instance, a diagnostic assay in accordance with the invention for detecting over-expression of PROST-Ets polypeptide compared to normal control tissue samples may be used to detect the presence of neoplasia, for example, prostate cancer Such diagnostic tests may be used to detect metastatic tumor growth, as well Assay techniques that can be used to determine levels of a polypeptide, such as a PROST-Ets polypeptide of the present invention, in a sample derived from a host are well-known to those of skill in the art Such assay methods include radioimmunoassays (RIA), competitive-binding assays, western Blot analysis and enzyme- linked immunoabsorbant assays (ELISA ) and fluorescent activated cell sorting (FACS) Among these ELISAs frequently are preferred An ELISA assay initially comprises preparing an antibody specific to PROST-Ets, preferably a monoclonal antibody In addition a reporter antibody generally is prepared which binds to the monoclonal antibody The reporter antibody is attached to a detectable reagent such as a radioactive, fluorescent or enzymatic reagent, in this example horseradish peroxidase enzyme
To carry out an ELISA a sample is removed from a host and incubated on a solid support, e g a polystyrene dish, that binds the polypeptides in the sample Any free polypeptide binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin Next, the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any PROST-Ets polypeptides attached to the polystyrene dish Unbound monoclonal antibody is washed out with buffer The reporter antibody linked to horseradish peroxidase is placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to PROST-Ets Unattached reporter antibody is then washed out Reagents for peroxidase activity, including a coloπmetric substrate are then added to the dish Immobilized peroxidase, linked to PROST-Ets through the primary and secondary antibodies, produces a colored reaction product The amount of color developed in a given time period indicates the amount of PROST-Ets polypeptide present in the sample Quantitative results typically are obtained by reference to a standard curve
A competition assay may be employed wherein antibodies specific to PROST-Ets are attached to a solid support and labeled PROST-Ets and a sample derived from the host are passed over the solid support and the amount of label detected attached to the solid support can be correlated to a quantity of PROST-Ets in the sample
These and other assays are described, among other places, in Hampton et al (Serological Methods, a Laboratory Manual, APS Press, St Paul, Minn, 1990) and Maddox et al (J Exp Med 158 121 1 1 , 1983)
Antibodies
The invention further relates to antibodies that specifically bind to PROST-Ets, herein referred to as PROST-Ets antibodies The prostate-specificity of PROST-Ets makes it an excellent marker for screening, diagnosis, prognosis, follow-up assays and imaging methods In addition, this characteristic indicates that PROST-Ets may be an excellent target for therapeutic methods such as targeted antibody therapy, immunotherapy, and gene therapy As used herein, the term "specifically binds to" refers to the interaction of an antibody and a polypeptide, in which the interaction is dependent upon the presence of a particular structure (i e , the antigenic determinant or epitope) on the polypeptide, in other words, the antibody is recognizing and binding to a specific polypeptide structure rather than to proteins in general
The PROST-Ets polypeptides, their fragments or other derivatives, or analogs thereof or cells expressing them can be used as an immunogen to produce antibodies thereto (Harlow Antibodies, Cold Spring Harbor Press, NY (1989)) These antibodies can be, for example, polyclonal or monoclonal antibodies The present invention also includes chimeπc, single chain, and humanized antibodies, as well as Fab fragments, or the product of a Fab expression library Various procedures known in the art may be used for the production of such antibodies and fragments
Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obt ained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman The antibody so obtained will then bind the polypeptides itself In this manner even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide
For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used Examples include the hybπdoma technique (Kohler and Milstem, Nature 256 495-497, 1975), the human B-cell hybπdoma technique (Kozbor et al , Immunology Today 4 72, I983) and the EBV-hybπdoma technique to produce human monoclonal antibodies (Cole et al , in Monoclonal Antibodies and Cancer, Alan R Liss, Inc , 77-96, 1985)
In addition, techniques developed for the production of "chimeπc antibodies" the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity can be used (Morrison et al , Proc Natl Acad Sci USA
81 6851-6855, 1984, Neuberger et al , Nature 312 604-608, 1984, Takeda et al , Nature 314 452-454, 1985) Alternatively, techniques described for the production of single chain antibodies (U S Pat No 4,946,778) can be adapted to produce PROST-Ets-specific single chain antibodies Antibodies may also be produced by inducing in vivo production in the lymphocyte population or by screening recombinant immunoglobuhn libraries or panels of highly specific binding reagents as disclosed in Orlandi et al (Proc Natl Acad Sci USA 86 3833-3837, 1989) and Winter and Milstem (Nature 349 293-299, 1991 )
Antibody fragments which contain specific binding sites for PROST-Ets may also be generated For example, such fragments include, but are not limited to the F(ab')2 fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragments Alternatively, Fab expression libraries may be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity (Huse et al , Science 256 1270-1281 , 1989) The ammo acid sequence of PROST-Ets presented herein may be used to select specific regions of the PROST-Ets polypeptide for generating antibodies As will be understood by those skilled in the art, the regions or epitopes of a PROST-Ets polypeptide to which an antibody is directed may vary with the intended application For example, antibodies intended for use in an immunoassay for the detection of membrane-bound PROST-Ets on prostate cells should be directed toward accessible epitopes on the PROST-Ets polypeptide Regions of the PROST-Ets polypeptide that show immunogenic structure, as well as other regions and domains, can readily be identified using various other methods known in the art, such as Chou-Fasman, Garnier- Robson, or Jameson-Wolf analysis Fragments containing these residues are particularly suited in generating anti-PROST-Ets antibodies Particularly useful fragments include, but are not limited to, the sequences ERRDWSPSPPATPEQGLS (SEQ ID NO 6), EQFRQRSPLGGD (SEQ ID NO 7), and NYDKLSRSIRQYYKK (SEQ ID NO 8) Generation of polyclonal antibodies to these regions is described in Example 4 PROST-Ets antibodies of the invention may be particularly useful in diagnostic assays, imaging methodologies, and therapeutic methods for the management of prostate cancer The invention proviαes various immunological assays useful for the detection of PROST-Ets polypeptides and for the diagnosis of prostate cancer Such assays generally comprise one or more PROST-Ets antibodies capable of recognizing and binding a PROST-Ets polypeptide The most preferred antibodies will selectively bind to PROST-Ets and will not bind (or bind weakly) to non-PROST-Ets polypeptides The assays include various immunological assay formats well known in the art, including but not limited to various types of radioimmunoassays, enzyme-linked immunoabsorbent assays, and the like In addition, immunological imaging methods capable of detecting prostate cancer are also provided by the invention, including but not limited to radioscmtigraphic imaging methods using labeled PROST-Ets antibodies Such assays may be clinically useful in the detection, monitoring and prognosis of prostate cancer
The above-described antibodies may be employed to isolate or to identify clones expressing the polypeptide or to purify the polypeptide of the present invention by attachment of the antibody to a solid support for isolation and/or purification by affinity chromatography Additionally, PROST-Ets antibodies may be used to isolate PROST-Ets positive cells using cell sorting and purification techniques In particular, PROST-Ets antibodies may be used to isolate prostate cancer cells from xenograft tumor tissue, from cells in culture, etc using antibody-based cell sorting or affinity purification techniques Other uses of the PROST- Ets antibodies of the invention include generating anti-idiotypic antibodies that mimic the PROST-Ets polypeptide
The PROST-Ets antibodies can be used for detecting the presence of prostate cancer or tumor metastasis The presence of such PROST-Ets-containmg cells within various biological samples, including serum, prostate and other tissue biopsy specimens, may be detected with PROST-Ets antibodies In addition, PROST-Ets antibodies may be used in various imaging methodologies such as immunoscintography with Tc-99m (or other isotope) conjugated antibody For example, an imaging protocol similar to the one recently described using an ln-1 1 1 conjugated anti-PSMA antibody may be used to detect recurrent and metastatic prostate carcinomas (Sodee et al , Clin Nuc Med 21 759-766, 1997)
The PROST-Ets antibodies of the invention may be labeled with a detectable marker or conjugated to a second molecule, such as a cytotoxic agent, and used for targeting the second molecule to a PROST-Ets positive cell (Vitetta, E S et al , Immunotoxin Therapy, in DeVita, Jr, V T et al , eds, Cancer Principles and Practice of Oncology, 4th ed , J B Lippincott Co , Philadelphia, 2624-2636, 1993) Examples of cytotoxic agents include, but are not limited to πcin, doxorubicm, daunorubicin, taxol, ethidium bromide, mitomycin, etoposide, tenoposide, vincπstine, vinblastme, colchicme, dihydroxy anthracm dione, actmomycin D, diptheπa toxin, Pseudo onas exotoxιn(PE) A, PE40, abnn, and glucocorticoid and other chemotherapeutic agents, as well as radioisotopes Suitable detectable markers include, but are not limited to, a radioisotope, a fluorescent compound, a bioluminescent compound, chemiluminescent compound, a metal chelator or an enzyme Suitable radioisotopes include the following Antιmony-124, Antιmony-125, Arsenιc-74, Baπum-103, Barιum-140, Beryllιum-7, Bιsmuth-j206, Bιsmuth-207, Cadmιum-109, Cadmιum-1 15m, Calcιum-45, Ceπum-139, Cerιum-141 Ceπum- 144, Cesιum-137, Chromιum-51 , Cobalt-56, Cobalt-57, Cobalt-58, Cobalt-60, Cobalt-64, Erbιum-169, Europιum-152, Gadolιnιum-153, Gold-195, Gold-199, Hafnιum-175, Hafnιum-175-
181 , lndιum-1 1 , lodιne-123, lodιne-131 , lπdιum-192, lron-55, lron-59, Krypton-85, Lead-210, Manganese-54, Mercury-197, Mercury-203, Molybdenum-99, Neodymιum-147, Neptunium- 237, Nιckel-63, Nιobιumo-95, Osmιum-185+191 , Palladιum-103, Platιnum-195m, Praseodymιum-143, Promethιum-147, Protactιnιum-233, Radιum-2226, Rhenιum-186, Rubιdιum-86, Ruthenιum-103, Ruthenιum-106, Scandιum-44, Scandιum-46, Selenιum-75,
Sιlver-110m, Sιlver-1 1 , Sodιum-22, Strontιum-85, Strontιum-89, Strontιum-90, Sulfur-35, Tantalum-182, Technetιum-99m, Tellurιum-125, Telluπum-132, Thalhum-204, Thoπum-228, Throιum-232, Thallιum-170, Tιn-113, Tιtanιum-44, Tungsten-185, Vanadιum-48, Vanadιum-49, Ytterbιum-169, Yttrιum-88, Yttπum-90, Yttrιum-91 , Zιnc-65, and Zιrconιum-95
Immunotherapy for Prostate Cancer
The invention provides various immunotherapeutic methods for treating prostate cancer, including antibody therapy, in vivo vaccines, and ex vivo immunotherapy approaches In one approach, the invention provides PROST-Ets antibodies which may be used systemically to treat prostate cancer For example, unconjugated PROST-Ets antibodies may be introduced into a patient such that the antibody binds to PROST-Ets on or in prostate cancer cells and mediates the destruction of the cells, and the tumor, by mechanisms which may include complement-mediated cytolysis, antibody-dependent cellular cytotoxicity, altering the physiologic function of PROST-Ets, and/or the inhibition of ligand binding or signal transduction pathways PROST-Ets antibodies conjugated to toxic agents such as πcin or radioisotopes may also be used therapeutically to deliver the toxic agent directly to PROST-Ets-beaπng prostate tumor cells and thereby destroy the tumor cells
Prostate cancer immunotherapy using PROST-Ets antibodies may follow the teachings generated from various approaches which have been successfully employed with respect to other types of cancer, including but not limited to colon cancer (Arlen et al , Crit
Rev Immunol 18 133-138, 1998), multiple myeloma (Ozaki et al , Blood 90 3179-3186, 1997, Tsunenaπ et al , Blood 90 2437-2444, 1997), gastric cancer (Kasprzyk et al, Cancer Res 52 2771-2776, 1992), B-cell lymphoma (Funakoshi et al , Immunther Emphasis Tumor Immunol 19 93-101 , 1996), leukemia (Zhong et al , Leuk Res. 20 581 -589, 1996), colorectal cancer (Moun et al , Cancer Res 54 6160-6166, 1994, Velders et al , Cancer Res 55 4398- 4403, 1995), and breast cancer (Shepard et al , J Clin Immunol 1 1 1 17-127, 1991 ) The invention further provides vaccines formulated to contain a PROST-Ets polypeptide or fragment thereof The use of a tumor antigen in a vaccine for generating humoral and cell-mediated immunity for use in anti-cancer therapy is well known in the art and has been employed in prostate cancer using human PSMA and rodent PAP immunogens (Hodge et al , Int J Cancer 63 231 -237, 1995, Fong et al , J Immunol 159 31 13-31 17, 1997) Such methods can be readily practiced by employing a PROST-Ets polypeptide, or fragment thereof, or a PROST-Ets-encodmg nucleic acid molecule and recombinant vectors capable of expressing and appropriately presenting the PROST-Ets immunogen
For example, viral gene delivery systems may be used to deliver a PROST-Ets- encoding nucleic acid molecule Various viral gene delivery systems which can be used in the practice of this aspect of the invention include, but are not limited to, vaccinia, fowlpox, canarypox, adenovirus, influenza, pohovirus, adeno-associated virus, lentivirus, and smdbus virus (Restifo, in Curr Opin, Immunol 8 658-663, 1996) Non-viral delivery systems may also be employed by using naked DNA encoding a PROST-Ets polypeptide or fragment thereof introduced into the patient (i e , intramuscularly) to induce an anti-tumor response In one embodiment, the full-length human prost-ets cDNA may be employed In another embodiment, human prost-ets cDNA fragments may be employed In another embodiment, prost-ets nucleic acid molecules encoding specific T lymphocyte (CTL) epitopes may be employed CTL epitopes can be determined using specific algorithms (e g , Epimer, Brown University) to identify peptides within a PROST-Ets polypeptide which are capable of optimally binding to specified HLA alleles Various ex vivo strategies may also be employed One approach involves the use of dendritic cells to present a PROST-Ets polypeptide as antigen to a patient's immune system Dendritic cells express MHC class I and II, B7 costimulator, and IL-12, and are thus highly specialized antigen presenting cells In prostate cancer, autologous dendritic cells pulsed with peptides of the prostate-specific membrane antigen (PSMA) are being used in a Phase I clinical trial to stimulate prostate cancer patients' immune systems (Tjoa et al , Prostate 28 65-69,
1996, Murphy et al , Prostate 29. 371 -380, 1996) Dendritic cells can be used to present PROST-Ets polypeptides to T cells in the context of MHC class I and II molecules In one embodiment, autologous dendritic cells are pulsed with PROST-Ets polypeptides capable of binding to MHC molecules In another embodiment, dendritic cells are pulsed with the complete PROST-Ets polypeptide Yet another embodiment involves engineering the overexpression of the prost-ets gene in dendritic cells using various implementing vectors known in the art, such as adenovirus (Arthur et al , Cancer Gene Ther 4 17-25, 1997), retrovirus (Henderson et al , Cancer Res 56 3763-3770, 1996), lentivirus, adeno-associated virus, DNA transfection (Ribas et al , Cancer Res 57 2865-2869, 1997), and tumor-derived RNA transfection (Ashley et al , J Exp Med 186 1 177-1182, 1997)
Anti-idiotypic anti-PROST-Ets antibodies can also be used in anti-cancer therapy as a vaccine for inducing an immune response to cells expressing a PROST-Ets polypeptide Specifically, the generation of anti-idiotypic antibodies is well known in the art and can be readily adapted to generate anti-idiotypic anti-PROST-Ets antibodies that mimic an epitope on a PROST-Ets polypeptide (see, for example, Wagner et al , Hybndoma 16 33-40, 1997 Foon et al , J Clin Invest 96 334-342, 1995, Herlyn et al , Cancer Immunol Immunother 43 65-76, 1996) Such an anti-idiotypic antibody can be used in anti-idiotypic therapy as presently practiced with other anti-idiotypic antibodies directed against tumor antigens
Genetic immunization methods may be employed to generate prophylactic or therapeutic humoral and cellular immune responses directed against cancer cells expressing PROST-Ets Using the PROST-Ets-encodmg DNA molecules described herein, constructs comprising DNA encoding a PROST-Ets polypeptide/immunogen and appropriate regulatory sequences may be injected directly into muscle or skin of an individual, such that the cells of the muscle or skin take up the construct and express the encoded PROST-Ets polypeptide/immunogen Expression of the PROST-Ets polypeptide/immunogen results in the generation of prophylactic or therapeutic humoral and cellular immunity against prostate cancer Various prophylactic and therapeutic genetic immunization techniques known in the art may be used (for a review, see information and references published at internet address www qenweb com)
Gene Therapy
The prost-ets polynucleotides and PROST-Ets polypeptides of the present invention may be employed in accordance with the present invention by expression of such polypeptides in vitro and in vivo, in treatment modalities often referred to as "gene therapy "
Thus, for example, cells from a patient may be engineered with a polynucleotide, such as a DNA or RNA, encoding a polypeptide ex vivo, and the engineered cells then can be provided to a patient to be treated with the polypeptide For example, cells may be engineered ex vivo by the use of a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention Such methods are well-known in the art and their use in the present invention will be apparent from the teachings herein
Similarly, cells may be engineered in vivo for expression of a polypeptide in vivo by procedures known in the art For example a polynucleotide of the invention may be engineered for expression in a replication defective retroviral vector, as discussed above The retroviral expression construct then may be isolated and introduced into a packaging cell is transduced with a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention such that the packaging cell now produces infectious viral particles containing the gene of interest These producer cells may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo These and other methods for administering a polypeptide of the present invention by such method should be apparent to those skilled in the art from the teachings of the present invention Retroviruses from which the retroviral plasmid vectors herein above mentioned may be derived include, but are not limited to, Moloney Muπne Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, Lenti virus, Myelopro ferative Sarcoma Virus, and mammary tumor virus In one embodiment, the retroviral plasmid vector is derived from Moloney Muπne Leukemia Virus
Viruses other than retroviruses may also be used to deliver selected PROST-Ets polynucleotides, i e the DNA viruses, such as adenovirus and adeno-associated virus and Herpes virus, and derivatives thereof Plasmids containing the nucleotide sequences of interest may also be delivered in complexes with lipids or lipid derivatives and in complexes with a variety of other biochemical and chemical reagents that are known to facilitate delivery of polynucleotides into cells in vitro or in vivo (Walter and Stem, Gene Therapy of Cancer Methods and Protocols, Humana Press, Totowa, NJ, 2000)
Such vectors will include one or more promoters for expressing the polypeptide Suitable promoters which may be employed include, but are not limited to, the retroviral LTR, the SV40 promoter, and the human cytomegalovirus (CMV) promoter (Miller et al ,
Biotechniques 7 980-990, 1989), or any other promoter (e g , cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, RNA polymerase III, and β actm promoters) Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kmase (TK) promoters, and B19 parvovirus promoters The promoter also may be the native promoter which controls the gene encoding the polypeptide The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein
The retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines Examples of packaging cells which may be transfected include, but are not limited to, the PE50I, PA317 Y-2, Y-AM, PAI2, T19-14X, VT-19-17-H2, YCRE, YCRIP,
GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, A , Human Gene Therapy 1 5-14, 1990 The vector may be transduced into the packaging cells through any means known in the art Such means include, but are not limited to, electroporation, the use of liposomes, and CaP04 precipitation In one alternative, the retroviral plasmid vector may be encapsulated into a hposome, or coupled to a lipid, and then administered to a host
The producer cell line will generate infectious retroviral vector particles which include the polynucleotide sequence(s) encoding the polypeptides Such retroviral vector particles then may be employed to transduce eukaryotic cells, either in vitro or in vivo The transduced eukaryotic cells will express the polynucleotιde(s) encoding the polypeptide Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells Viral and non-viral vectors of the kind described above may be used both to deliver polynucleotide sequences which encode the PROST-Ets polypeptide or portions thereof, and polynucleotides complementary to those sequences (i e antisense polynucleotides) Sense polynucleotides may code for full-length prost-ets mRNA or fragments thereof Antisense polynucleotides may be complementary to either the coding or non-coding regions of the prost- ers mRNA or both, and be of any length Delivery of antisense polynucleotides may serve to reduce the levels of PROST-Ets protein and may be therapeutic for diseases where reduction of PROST-Ets protein levels is desirable
In vivo expression of polynucleotides coding for fragments of PROST-Ets may also be used to modulate the biological activity of PROST-Ets in cells Such expressed polypeptides could compete with native PROST-Ets polypeptide for binding to DNA or to regulatory proteins
Such expressed polypeptides are often referred to as dominant negative polypeptides, and the polynucleotides coding for them as dominant negative polynucleotides Preferred fragments of the PROST-Ets polypeptide to be expressed would be those containing am o acids 131 to 213 or 246 to 332, which represent the pointed and Ets domains of the PROST-Ets polypeptide, respectively (Foos et al , J Biol Chem 273 18871-18880, 1998)
Anti-sense ohgonucleotides. antisense vectors, and πbozvmes
Anti-sense polynucleotides complementary to prost-ets may be prepared synthetically Such ohgonucleotides may be delivered into cells with or without lipids that may assist uptake of the anti-sense ohgonucleotides into cells
Alternatively, expression vectors derived from retroviruses, adenovirus, herpes or vaccinia viruses, or from various bacterial plasmids, may be also be used for construction and delivery of recombinant vectors which will express anti-sense prost-ets See, for example, the techniques described in Sambrook et al (supra) and Ausubel et al (supra)
The polynucleotides comprising the full length cDNA sequence and/or its regulatory elements enable researchers to use prost-ets polynucleotides as an investigative tool in sense strands (Youssoufian and Lodish, Mol Cell Biol 13 98-104, 1993) or antisense strands (Eguchi, et al , Annu Rev Biochem 60 631 -652, 1991 ) for the regulation of gene function Such technology is now well known in the art, and sense or antisense ohgomers, or larger fragments, can be designed from various locations along the coding or control regions
Genes encoding PROST-Ets can be turned off by transfecting a cell or tissue with expression vectors which express high levels of a desired prost-ets polynucleotide fragment Such constructs can flood cells with untranslatable sense or antisense sequences Particularly preferred antisense sequences include, but are not limited to, UCCACCUGUGGCAGUUCCUCAAG (13594, SEQ ID NO 9), UGACUCGACAAAGGCCACAGGCA (13595, SEQ ID NO, 10), and CCAGCAUUUCCAGAGCAGAGCCU (13642, SEQ ID NO 11 ) Even in the absence of integration into the DNA, such vectors may continue to transcribe RNA molecules until all copies are disabled by endogenous nucleases Transient expression may last for a month or more with a non-rephcating vector and even longer if appropriate replication elements are part of the vector system As mentioned above, modification of gene expression can be obtained by designing antisense molecules, DNA or RNA, to control regions of prost-ets, ie, the promoters, enhancers, and mtrons Ohgonucleotides derived from the transcription initiation site, eg, between 10 and +10 regions of the leader sequence, are preferred The antisense molecules may also be designed to block translation of mRNA by preventing the transcript from binding to πbosomes Similarly, inhibition can be achieved using "triple helix" base-pairing methodology Triple helix pairing compromises the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or regulatory molecules Recent therapeutic advances using triplex DNA were reviewed by Gee, J E et al (In Huber and Car, Molecular and Immunologic Approaches, Futura Publishing Co , Mt Kisco, N Y , 1994) Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of
RNA (U S Patent No 4,987,071 , WO 93/23057) The mechanism of πbozyme action involves sequence-specific hybridization of the πbozyme molecule to complementary target RNA, followed by endonucleolytic cleavage Within the scope of the invention are engineered hammerhead motif πbozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of RNA encoding PROST-Ets Specific πbozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for πbozyme cleavage sites which include the following sequences, GUA, GUU and GUC Once identified, short RNA sequences of between 15 and 20 πbonucleotides corresponding to the region of the target gene containing the cleavage site may be evaluated for secondary structural features which may render the ohgonucleotide inoperable The suitability of candidate targets may also be evaluated by testing accessibility to hybridization with complementary ohgonucleotides using πbonuclease protection assays (Iπe et al , Advance Pharmacol 40 207-257, 1997)
Antisense molecules and ribozymes of the invention may be prepared by any method known in the art for the synthesis of RNA molecules These include techniques for chemically synthesizing ohgonucleotides such as solid phase phosphoramidite chemical synthesis
Alternatively, RNA molecules may be generated by in vitro and in vivo transcription or by DNA sequences encoding PROST-Ets Such DNA sequences may be incorporated into a wide variety of vectors with suitable RNA polymerase promoters such as T7 or SP6 Alternatively antisense cDNA constructs that synthes ize antisense RNA constitutively or inducibly can be introduced into cell lines, cells or tissues
RNA molecules may be modified to increase intracellular stability and half-life Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and/or 3' ends of the molecules or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the backbone of the molecule Increased stability can also be achieved by the inclusion of nontraditional bases such as mosine and queosine as well as acetyl-, methyl-, thio- and similarly modified forms of adenme, cytidine, guanine, thymine, and undine which are not as easily recognized by endogenous endonucleases Methods for introducing antisense vectors into cells or tissues include those methods discussed infra and which are equally suitable for in vivo, in vitro and ex vivo therapy For ex vivo therapy, antisense vectors are introduced into cells taken from the patient and clonally propagated for autologous transplant back into that same patient as presented in U S Pat Nos 5,399,493 and 5,437,994, disclosed herein by reference Delivery by transfection and by posome or other lipid based or non- pid based agents are well known in the art
Assays for Identifying Agents Binding to PROST-Ets
The present invention also relates to assays and methods which can be used to identify agents that bind to PROST-Ets Specifically, agents that bind to PROST-Ets can be identified by the ability of the PROST-Ets ligand or other agent or constituent to bind to
PROST-Ets and/or the ability to inhibit/stimulate PROST-Ets activity Assays for PROST-Ets activity (e g binding) using a PROST-Ets polypeptide are suitable for use in high through-put screening methods In one embodiment, the assay comprises mixing PROST-Ets with a test agent or cellular extract After mixing under conditions that allow association of PROST-Ets with the agent or component of the extract the mixture is analyzed to determine if the agent/component is bound to PROST-Ets Binding agents/components are identified as being able to bind to PROST-Ets Alternatively or consecutively, PROST-Ets activity can be directly assessed as a means for identifying agonists and antagonists of PROST-Ets activity
Alternatively, agents that bind to a PROST-Ets polypeptide can be identified using a yeast two-hybrid system or a binding capture assay In the yeast two hybrid system, an expression unit encoding a fusion protein made up of one subunit of a two subunit transcription factor and the PROST-Ets polypeptide is introduced and expressed in a yeast cell The cell is further modified to contain (1 ) an expression unit encoding a detectable marker whose expression requires the two subunit transcription factor for expression and (2) an expression unit that encodes a fusion protein made up of the second subunit of the transcription factor and a cloned segment of DNA If the cloned segment of DNA encodes a protein that binds to the PROST-Ets polypeptide, the expression results in the interaction of PROST-Ets and the encoded protein This brings the two subunits of the transcription factor into binding proximity, allowmg reconstitution of the transcription factor This results in expression of the detectable marker The yeast two hybrid system is particularly useful in screening a library of cDNA encoding segments for cellular binding partners of PROST-Ets
PROST-Ets polypeptides which may be used in the above assays include, but are not limited to, an isolated PROST-Ets polypeptide, a fragment of a PROST-Ets polypeptide, a cell that has been altered to express a PROST-Ets polypeptide, or a fraction of a cell that has been altered to express a PROST-Ets polypeptide Further, the PROST-Ets polypeptide can be the entire polypeptide or a defined fragment of the PROST-Ets polypeptide It will be apparent to one of ordinary skill in the art that so long as the PROST-Ets polypeptide can be assayed for agent binding, e g by a shift in molecular weight or activity, the present assay can be used
The method used to identify whether an agent cellular component binds to a PROST- Ets polypeptide will be based primarily on the nature of the PROST-Ets polypeptide used For example, a gel retardation assay can be used to determine whether an agent binds to PROST- Ets or a fragment thereof Alternatively, immunodetection and biochip technologies can be adopted for use with the PROST-Ets polypeptide A skilled artisan can readily employ numerous art-known techniques for determining whether a particular agent bind to a PROST- Ets polypeptide
Agents and cellular components can be further tested for the ability to modulate the activity of a PROST-Ets polypeptide using a cell-free assay system or a cellular assay system As the activities of the PROST-Ets polypeptide become more defined, functional assays based on the identified activity can be employed
As used herein, an agent is said to antagonize PROST-Ets activity when the agent reduces PROST-Ets activity The preferred antagonist will selectively antagonize PROST-Ets, not affecting any other cellular proteins Further, the preferred antagonist will reduce PROST- Ets activity by more than 50%, more preferably by more than 90%, most preferably eliminating all PROST-Ets activity
Agents that are assayed in the above method can be randomly selected or rationally selected or designed As used herein, an agent is said to be randomly selected when the agent is chosen randomly without considering the specific sequences of the PROST-Ets polypeptide An example of randomly selected agents is the use of a chemical library or a peptide combinatorial library, or growth broth of an organism or plant extract
As used herein, an agent is said to be rationally selected or designed when the agent is chosen on a nonrandom basis that takes into account the sequence of the target site an/or its conformation in connection with the agent's action Agents can be rationally selected or rationally designed by utilizing the peptide sequences that make up the PROST-Ets polypeptide For example, a rationally selected peptide agent can be a peptide whose ammo acid sequence is identical to a fragment of a PROST-Ets polypeptide
The agents tested in the methods of the present invention can be, as examples, peptides, antibodies, ohgonucleotides, small molecules and vitamin derivatives, as well as carbohydrates A skilled artisan can readily recognize that there is no limit as to the structural nature of the agents used in the present screening method One class of agents of the present invention are peptide agents whose ammo acid sequences are chosen based on the ammo acid sequence of the PROST-Ets polypeptide
Peptide agents can be prepared using standard solid phase (or solution phase) peptide synthesis methods, as is known in the art In addition, the DNA encoding these peptides may be synthesized using commercially available ohgonucleotide synthesis instrumentation and produced recombinantly using standard recombinant production systems The production using solid phase peptide synthesis is necessitated if no-gene-encoded am o acids are to be included
Another class of agent of the present invention are antibodies immunoreactive with critical positions of the PROST-Ets polypeptide As described above, antibodies are obtained by immunization of suitable mammalian subjects with peptides, containing as antigenic regions those portions of the PROST-Ets polypeptide intended to be targeted by the antibodies Such agents can be used in competitive binding studies to identify second generation inhibitory agents as well as to block PROST-Ets activity
The cellular extracts tested in the methods of the present invention can be, as examples, agueous extracts of cells or tissues, organic extracts of cells or tissues or partially purified cellular fractions A skilled artisan can readily recognize that there is no limit as to the source of the cellular extract used in the screening method of the present invention
Agents that bind a PROST-Ets polypeptide, such as a PROST-Ets antibody, can be used to modulate the activity of PROST-Ets, to target anticancer agents to appropriate mammalian cells, or to identify agents that block the interaction with PROST-Ets Cells expressing PROST-Ets can be targeted or identified by using an agent that binds to PROST- Ets
How the PROST-Ets binding agents will be used depends on the nature of the PROST-Ets binding agent For example, a PROST-Ets binding agent can be used to deliver conjugated toxins, such as diphtheria toxin, cholera toxin, πcin or pseudomonas exotoxm, to a
PROST-Ets expressing cell, modulate PROST-Ets activity, to directly kill a PROST-Ets expressing cell, or in screens to identify competitive binding agents For example, a PROST- Ets inhibitory agent can be used to directly inhibit the growth of PROST-Ets expressing cells whereas a PROST-Ets binding agent can be used as a diagnostic agent
Pharmaceutical Compositions and Administration
The present invention also relates to pharmaceutical compositions which may comprise prost-ets polynucleotides, PROST-Ets polypeptides, antibodies, agonists, antagonists, or mhibitors, alone or in combination with at least one other agent, such as stabilizing compound, which may be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water Any of these molecules can be administered to a patient alone, or in combination with other agents, drugs or hormones, in pharmaceutical compositions where it is mixed with excιpιent(s) or pharmaceutically acceptable carriers In one embodiment of the present invention, the pharmaceutically acceptable carrier is pharmaceutically inert
The present invention also relates to the administration of pharmaceutical compositions Such administration is accomplished orally or parenterally Methods of parenteral delivery include topical, intra-arteπal (directly to the tumor), intramuscular, subcutaneous, intramedullary, intrathecal, intraventπcular, intravenous, intrapeπtoneal, or intranasal administration In addition to the active ingredients, these pharmaceutical compositions may contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically Further details on techniques for formulation and administration may be found in the latest edition of Remington's Pharmaceutical Sciences (Ed Maack Publishing Co, Easton Pa )
Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration Such carriers enable the pharmaceutical compositions to be formulated as tablEts, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for ingestion by the patient
Pharmaceutical preparations for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablEts or dragee cores Suitable excipients are carbohydrate or protein fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol, starch from corn, wheat, rice, potato, or other plants, cellulose such as methyl, cellulose, hydroxypropylmethylcellulose, or sodium carboxymethylcellulose and gums including arable and tragacanth, and proteins such as gelatin and collagen If desired, disintegrating or solubilizmg agents may be added, such as the cross-linked polyvinyl pyrrolidone agar, algmic acid, or a salt thereof, such as sodium algmate
Dragee cores are provided with suitable coatings such as concentrated sugar solutions, which may also contain gum arable, talc, polyvmylpyrrolidone, carbopol gel, polyethylene glycol and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures Dyestuffs or pigments may be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, ie dosage
Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating such as glycerol or sorbitol Push-fit capsules can contain active ingredients mixed with a filler or binders such as lactose or starches, lubricants such as talc or magnesium stearate, and optionally, stabilizers In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol with or without stabilizers
Pharmaceutical formulations for parenteral administration include aqueous solutions of active compounds For injection, the pharmaceutical compositions of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiologically buffered saline Aqueous injection suspensions may contain substances which increase viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions Suitable lipophihc solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions For topical or nasal administration, penetrants appropriate to the particular barrier to be permeated are used in the formulation Such penetrants are generally known in the art
The invention further relates to pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions of the invention Associated with such contaιner(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture use or sale of pharmaceuticals or biological products, reflecting approval by the agency of the manufacture, use or sale of the product for human administration
Manufacture and Storage
The pharmaceutical compositions of the present invention may be manufactured in a manner that is known in the art, e g , by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes The pharmaceutical composition may be provided as a salt and can be formed with may acids, including by not limited to hydrochloric, sulfuπc, acetic, lactic, tartaπc, malic, succinic, etc Salts tend to be more soluble in aqueous or other protonic solvents that are the corresponding free base forms In other cases, the preferred preparation may be a lyophi zed powder in 1 mM- 50 mM histidme, 0 1 %-2% sucrose, 2%-7% mannitol at a pH range of 4 5 to 5 5 that is combined with buffer prior to use
After pharmaceutical compositions comprising a compound of the invention formulated in an acceptable carrier have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition For administration of PROST-Ets, such labeling would include amount, frequency and method of administration
Therapeutically Effective Dose Pharmaceutical compositions suitable for use in the present invention include compositions wherein the active ingredients are contained in an effective amount to achieve the intended purpose, i e treatment of a particular disease state characterized by PROST-Ets expression The determination of an effective dose is well within the capability of those skilled in the art For any compound, the therapeutically effective dose can be estimated initially either in cell culture assays, e g , neoplastic cells, or in animal models, usually mice, rabbits, dogs, or pigs The animal model is also used to achieve a desirable concentration range and route of administration Such information can then be used to determine useful doses and routes for administration in humans A therapeutically effective dose refers to that amount of protein or its antibodies, antagonists, or inhibitors which ameliorate the symptoms or condition Therapeutic efficacy and toxicity of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e g , ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population) The dose ratio between therapeutic and toxic effects is the therapeutic index, and it can be expressed as the ratio,
ED50/LD50 Pharmaceutical compositions which exhibit large therapeutic indices are preferred The data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use The dosage of such compounds lies preferably within a range of circulating concentrations what include the ED50 wιth little or no toxicity The dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration
The exact dosage is chosen by the individual physician in view of the patient to be treated Dosage and administration are adjusted to provide sufficient levels of the active moiety or to maintain the desired effect Additional factors which may be taken into account include the severity of the disease state, eg, tumor size and location, age, weight and gender of the patient diet, time and frequency of administration, drug combιnatιon(s), reaction sensitivities, and tolerance/response to therapy Long acting pharmaceutical compositions might be administered every 3 to 4 days, every week, or once every two weeks depending on half-life and clearance rate of the particular formulation Normal dosage amounts may vary from 0 1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration Guidance as to particular dosages and methods of delivery is provided in the literature See U S Pat Nos 4,657,760, 5,206,344, or 5,225,212 Those skilled in the art will employ different formulations for polynucleotides than for protems or their inhibitors Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc
The present invention is further described by the following examples The examples are provided solely to illustrate the invention by reference to specific embodiments These exemplifications, while illustrating certain specific aspects of the invention, do not portray the limitations or circumscribe the scope of the disclosed invention
All examples were carried out using standard techniques, which are well known and routine to those of skill in the art, except where otherwise described in detail Routine molecular biology techniques of the following examples can be carried out as described in standard laboratory manuals, such as Sambrook et al , Molecular Cloning A Laboratory Manual, 2nd Ed , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N Y , 1989
Example 1 Identification of human prost-ets polynucleotide
Prost-ets was identified as a gene expressed in the prostate by mining Incyte's LifeSeq gene expression database Incyte's Lifeseq database was mined for sequences expressed in either a prostate or tumor specific manner The original clone identified was Incyte Clone
581956 that was discovered in a prostate tumor library This clustered with other Incyte clones, including 1813005, and 1794731 , that were acquired from Incyte and used for experimental purposes including sequence determination and expression analysis The nucleotide sequence of Clone 581956 was used for electronic Northern analysis of the expression of the gene in all tissue libraries in Incyte's database Initial screens demonstrated that it was expressed largely in the prostate and overexpressed in prostate tumors In updated versions of the database it is expressed in the prostate but also in breast tumor and ovarian tumor libraries All clones in Incyte's Lifeseq library coding for PROST-Ets were assembled into a contiguous sequence using the Genetics Computer Group (GCG, Wisconsin package) gene assembly program and the sequence of the assembled mRNA evaluated This sequence was edited to improve the quality of the contiguous assembled sequence and an open reading frame coding for a protein was identified The sequence of the mRNA was confirmed by obtaining a physical clone from Incyte (Clone 1794731 ) that contained the most complete 5' sequence in the Lifeseq database, and sequencing the DNA This sequence is shown in Figure 1 B DNA and protein sequence analysis The protein sequence predicted by the nucleotide sequence is shown in Figure 2 (SEQ ID NO 2) The nucleotide sequence identified includes both untranslated 5' and 3' regions A comparison of the nucleotide and the predicted protein sequences with sequences in GenBank and the Swiss Pro database revealed a significant homology to the family of Ets transcription factors, as illustrated for Prost-Ets and Drosophilla Ets-4 in Figure 3 Two protein domains ("pointed" and "Ets") which are common to both PROST-Ets and other Ets transcription factors are shown in Figure 4 Their location within the PROST-Ets sequence is shown in Figure 2 The extent of ammo acid sequence homology and the predicted domain structure of PROST-Ets indicate that PROST-Ets constitutes the first reported member of a new sub-family of Ets transcription factors in humans
Example 2 Prost-ets mRNA Expression
The expression of prost-ets mRNA in a variety of samples from normal and tumor tissues and in cell lines, was determined by 2 methods Northern blot analysis and semi- quantitative PCR using a Taqman assay, (Perkin-Elmer) Normal, benign and tumor prostate tissue samples that had been graded according to a modified Gleason grading system were obtained from the Urology Department at Stanford University School of Medicine RNA was isolated from these by standard procedures RNA from other tumor and normal tissues was purchased from commercial sources, including Clontech, and Biochain Prostate tumor cell lines, (PC-3, LNCaP and DU145), were obtained from American Type Culture Collection and propagated in culture by standard methods using serum containing medium Xenograft tumors derived from these cell lines were established in nude mice and harvested from the mice approximately 4-6 weeks after implantation RNA was isolated from the tumors by standard procedures
A Northern blot analysis Northern blots were performed using 2μg of poly(A) RNA from multiple human tissues (purchased from Clontech) Blots were probed with a radiolabelled probe made from the insert of a prost-ets plasmid (Incyte Clone 1794731 , see
Figure 5) An mRNA species of 2 4 Kb in size was detected at a high level in prostate and at lower levels in colon and small intestine Expression of prost-ets mRNA was not detected in many other tissues, including lung, liver, kidney, brain pancreas, and spleen
B Taqman analysis Taqman based PCR analysis was performed using the primers AGT GAC TCG ACA AAG GCC ACA (SEQ ID NO 3) and TCC CTG CAC CAT GCC AG (SEQ
ID NO 4) and the Taqman probe FAM-CCT GCC TCC CAT TCT GCA CCA CA-TAMRA (SEQ ID NO 5)
These primers and probe were designed using Perkm Elmer's Primer Express software and were synthesized by Synthetic Genetics PCR reactions were carried out for 30-40 cycles and quantified using prostate RNA to generate a standard curve for relative comparison This analysis demonstrated that prost-ets mRNA was detected in prostate normal and tumor tissues and also breast tumor samples Expression in tumors was generally higher than in normal tissues Example 3 Expression of PROST-Ets
The PROST-Ets coding region was inserted into the protein expression vector pET15b, which was obtained from Stratagene A 6Xhιs-tagged PROST-Ets polypeptide was expressed in E coli upon induction with IPTG The expressed polypeptide was purified to greater than
90% homogeneity by a combination of Ni affinity chromatography and SDS-PAGE purification procedures well known in the art Approximately 5 mg of this material was used for polyclonal antibody generation
Example 4 Antibody Generation
Rabbit polyclonal antisera were raised against three synthetic peptide sequences derived from the PROST-Ets polypeptide sequence These sequences were selected because of their predicted positions at the surface of the protein, in order to generate antisera that are more likely to recognize surface epitopes Cysteme residues were replaced with ammobutyric acid (Abu) to aid synthesis The specific ammo acid sequences, positions on the PROST-Ets polypeptide and designations for the three peptides are listed below
Designation Position Am o Acid Sequence
Pep 1 39-56 ERRDWSPSPPATPEQGLS (SEQ ID NO 6)
Pep 2 189-200 EQFRQRSPLGGD (SEQ ID NO 7)
Pep 3 301 -315 NYDKLSRSIRQYYKK (SEQ ID NO 8)
Peptides were covalently coupled to keyhole limpet hemocyanm (KLH), via an additional ammo- terminal cysteme, for use as immunogen Similarly, a bovine serum albumin (BSA) conjugate was prepared for the analysis of antisera titers via ELISA
Two animals were immunized with each peptide Initial immunizations were performed in Freunds complete adjuvant (0 5 mg/animal), followed by periodic boosts at three week intervals with 0 25 mg/animal in Freunds incomplete adjuvant applied intramuscularly Periodic test bleeds were taken and antibody titers against the specific BSA-peptide conjugate were measured by ELISA and compared with preimmune sera
Antisera were tested via Western blot for binding to a purified PROST-Ets protein expressed as a 6Hιs-PROST-Ets fusion protein in £ coli (See Figure 7) Antisera which recognized the PROST-Ets fusion protein were further tested for their ability to recognize the naturally occurring protein in lysates prepared from PC3 cells Rabbit polyclonal antisera were also raised against the 6Hιs-PROST-Ets fusion protein purified from £ coli
Example 5 Effect of specific reduction of prost-ets mRNA on prostate tumor cell growth
The prostate tumor cell lines, PC-3 and LNCaP, were selected for evaluation of the role of PROST-Ets in cell proliferation using antisense ohgonucleotides to reduce mRNA expression in the selected cell lines These two prostate tumor cell lines express prost-ets mRNA, while normal primary prostate epithelial cells and cells derived from a BPH sample do not express significant levels of this mRNA The antisense ohgonucleotides used have the sequences
UCC ACC UGU GGC AGU UCC UCA AG (13594, SEQ ID NO 9 ), UGA CUC GAC AAA GGC CAC AGG CA (13595, SEQ ID NO 10) and CCA GCA UUU CCA GAG CAG AGC CU (13642, SEQ ID NO 1 1 ) These sequences are used as reagents which are RNA/DNA hybrid molecules, 23 nucleotides in length The antisense molecules used reduced mRNA levels for PROST-Ets when administered to cells in the presence of lipids (NC388 lipid mixture provided by Atugen Corp ) These reagents contain the ohgonucleotide regions shown, which are complementary to the prost-ets mRNA Administration of these sequences to PC3 and LNCaP cells inhibited proliferation of cells in a dose dependent manner in the range 7 5 to 120 nM ohgonucleotide when given as a complex with the lipid NC388 In the same dose range, a control ohgonucleotide mixture (GBC 3 3) composed of a set of random 23mer ohgonucleotides did not affect proliferation of the cells An antisense ohgonucleotide directed against the enzyme inosme monophosphate dehydrogenase, (IMPDH II), an enzyme required for nucleic acid synthesis, also caused growth inhibition in LNCaP and PC3 cells This experiment demonstrated that reduction of PROST-Ets expression was reflected by reduced tumor cell growth Antisense ohgonucleotides which contained 2 base pair mismatches had significantly less effect on cell growth (see Figure 8)
Example 6 Doxycychne-induced growth inhibition of PC3 cells
The Tet-On system (Clontech) was used to generate derivatives of the PC3 prostate tumor cells and BPH prostate non-tumorigenic cell line which contained stably integrated reverse tet repressor-VP16 protein, a protein which binds and activates transcription in the presence of doxycychne Four PC3-tet-on cell lines and two BPH-tet-on cell lines, containing different levels of tet-on activities, were generated according to the manufacturer's instructions and stored Two of these PC3-tet-on cell lines were found to have retained the growth rate in vitro and tumongenicity characteristics in vivo of their parent PC3 cell line
The pBI-EGFP vector from Clontech was used to express sense and antisense prost-ets messages Several different antisense constructs were made that express different fragments of the prost-ets antisense message The fragments were an approximately 0 45 Kb fragment containing the 5' untranslated region, an approximately 0 5 Kb fragment containing the 3' untranslated region, and a full-length antisense molecule (in Figure 9, 5utr, 3utr, and cDNA, respectively) These fragments were incorporated into the vector using standard techniques
Vectors containing the fragments as well as a vector control were transfected into the PC3-tet-on cell lines to generate stable pools The activities of the antisense fragments were assessed by culturing the cells in medium with and without doxycychne induction Doxycychne treatment did not greatly change the growth rate of the PC3-tet-on parent or the PC3-tet-on cells transfected with the full-length antisense molecule In contrast, however, a significant reduction in the growth rate of the PC3-tet-on cells transfected with the 3'-untranslated and the 5'- untranslated antisense constructs did occur (see Figure 9) These experiments further demonstrate that reduction of prost-ets mRNA leads to inhibition of growth of PC3 prostate tumor cells
Example 7 Domains of the PROST-Ets protein as dominant-negative mutants
Several polynucleotide fragments coding for various portions of the PROST-Ets polypeptide (C-termmal 90 ammo acids, N-terminal 248 am o acids, full-length polypeptide containing point mutations) are inserted into vectors and expressed within PC3 -tet-on prostate tumor cells, following induction with doxycychne Alternatively, the fragments are expressed in E coli as fusion proteins with a peptide derived from the HIV TAT protein The TAT peptide has been shown to act as an efficient "protein transduction domain" for a number of intracellular proteins including transcription factors Using either method of polypeptide expression, the presence of these expressed protein fragments is observed to have a negative effect on tumor cell growth, indicating that these fragments are acting as dominant-negative reagents
* * * * *
All publications and patents mentioned in the above specification are herein incorporated by reference While the present invention has been described with reference to the specific embodiments thereof, it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the invention In addition, many modifications may be made to adapt a particular situation, material, composition of matter, process, process step or steps, to the objective, spirit and scope of the present invention All such modifications are intended to be within the scope of the claims appended hereto

Claims

WHAT IS CLAIMED IS
1 An isolated polynucleotide comprising a polynucleotide which is at least 70% identical to a member selected from the group consisting of
(a) a polynucleotide encoding a polypeptide, or a biologically or immunologically active fragment thereof, comprising the ammo acid sequence set forth in
Figure 2 (SEQ ID NO 2),
(b) a polynucleotide encoding a polypeptide comprising ammo acid 131 to ammo acid 213 as set forth in Figure 2 (SEQ ID NO 2),
(c) a polynucleotide encoding a polypeptide comprising ammo acid 246 to ammo acid 332 as set forth in Figure 2 (SEQ ID NO 2), and
(d) polynucleotide which is complementary to the polynucleotide of (a), (b) or (c)
2 The polynucleotide of Claim 1 wherein the polynucleotide is DNA
3 The polynucleotide of Claim 1 wherein the polynucleotide is RNA
4 The polynucleotide of Claim 1 wherein the polynucleotide is genomic DNA
5 The polynucleotide of Claim 2 wherein the polynucleotide encodes the polypeptide comprising ammo acids 1 to 335 as set forth in Figure 2 (SEQ ID NO 2)
6 The polynucleotide of Claim 2 wherein the polynucleotide encodes the polypeptide comprising am o acid 131 to ammo acid 213 as set forth in Figure 2 (SEQ ID NO
2)
7 The polynucleotide of Claim 2 wherein the polynucleotide encodes the polypeptide comprising ammo acid 246 to ammo acid 332 as set forth in Figure 2 (SEQ ID NO 2)
8 The polynucleotide of Claim 1 wherein the polynucleotide comprises the sequence as set forth in Figure 1 (SEQ ID NO 1 ) from nucleotide 1 to nucleotide 1900
9 The polynucleotide of Claim 1 wherein the polynucleotide comprises the sequence as set forth in Figure 1 (SEQ ID NO 1 ) from nucleotide 422 to nucleotide 1429
10 A vector comprising the polynucleotide of Claim 2
1 1 A host cell comprising the vector of Claim 10 12 A method of producing a polypeptide comprising expressing from the host cell of Claim 1 1 the polypeptide encoded by the polynucleotide
13 The method of Claim 12 wherein the polypeptide comprises ammo acid 1 to ammo acid 335 as set forth in Figure 2 (SEQ ID NO 2)
14 The method of Claim 12 wherein the polypeptide comprises am o acid 131 to ammo acid 213 as set forth in Figure 2 (SEQ ID NO 2)
15 The method of Claim 12 wherein the polypeptide comprises ammo acid 246 to ammo acid 332 as set forth in Figure 2 (SEQ ID NO 2)
16 A method of producing a polypeptide wherein the polypeptide comprises the ammo acid sequence shown in Figure 2 (SEQ ID NO 2), the method comprising the steps of (a) culturing the host cell of Claim 1 1 under conditions whereby the polypeptide is expressed, and
(b) recovering the polypeptide from the culture
17 A method for producing a cell which expresses a polypeptide comprising genetically engineering the cell with the vector of Claim 10
18 A polypeptide comprising a member selected from the group consisting of (a) a polypeptide, or a biologically or immunologically active fragment thereof comprising the am o acid sequence as set forth in Figure 2 (SEQ ID NO 2) (b) a polypeptide comprising ammo acid 131 to ammo acid 213 as set forth in
Figure 2 (SEQ ID NO 2),
(c) a polypeptide comprising ammo acid 246 to ammo acid 332 as set forth in Figure 2 (SEQ ID NO 2),
(d) a polypeptide comprising ammo acid 39 to ammo acid 56 as set forth in Figure 2 (SEQ ID NO 2),
(e) a polypeptide comprising ammo acid 189 to ammo acid 200 as set forth in Figure 2 (SEQ ID NO 2),
(f) a polypeptide comprising ammo acid 301 to ammo acid 315 as set forth in Figure 2 (SEQ ID NO 2), and (g) a polypeptide which is at least 70% identical to the polypeptide of (a) (b), (c),
(d), (e), or (f)
19 The polypeptide of Claim 18 wherein the polypeptide comprises ammo acids 1 to 335 as set forth in Figure 2 (SEQ ID NO 2)
20 The polypeptide of Claim 18 wherein the polypeptide comprises am o acids 131 to 213 as set forth in Figure 2 (SEQ ID NO 2)
21 The polypeptide of Claim 18 wherein the polypeptide comprises ammo acids 246 to 332 as set forth in Figure 2 (SEQ ID NO 2)
22 An isolated antibody, or antibody fragment, which specifically binds to a polypeptide comprising a member selected from the group consisting of
(a) a polypeptide, or a biologically or immunologically active fragment thereof, comprising the ammo acid sequence as set forth in Figure 2 (SEQ ID NO 2),
(b) a polypeptide comprising ammo acid 39 to ammo acid 56 as set forth in Figure 2 (SEQ ID NO 2), (c) a polypeptide comprising ammo acid 189 to ammo acid 200 as set forth in
Figure 2 (SEQ ID NO 2),
(d) a polypeptide comprising ammo acid 301 to ammo acid 315 as set forth in Figure 2 (SEQ ID NO 2), and
(e) a polypeptide which is at least 70% identical to the polypeptide of (a), (b), (c), or (d)
23 The antibody of Claim 22, wherein the antibody specifically binds to the ammo acid sequence ERRDWSPSPPATPEQGLS (SEQ ID NO 6)
24 The antibody of Claim 22, wherein the antibody specifically binds to the ammo acid sequence EQFRQRSPLGGD (SEQ ID NO 7)
25 The antibody of Claim 22, wherein the antibody specifically binds to the ammo acid sequence NYDKLSRSIRQYYKK (SEQ ID NO 8)
26 The antibody of Claim 22, wherein the antibody is a polyclonal antibody
27 The antibody of Claim 22, wherein the antibody is a monoclonal antibody
28 An immunoconjugate comprising an isolated antibody, or antibody fragment, which specifically binds to a polypeptide comprising a member selected from the group consisting of
(a) a polypeptide, or a biologically or immunologically active fragment thereof, compπsing the ammo acid sequence as set forth in Figure 2 (SEQ ID NO 2),
(b) a polypeptide comprising am o acid 39 to ammo acid 56 as set forth in Figure 2 (SEQ ID NO 2),
(c) a polypeptide comprising ammo acid 189 to ammo acid 200 as set forth in Figure 2 (SEQ ID NO 2),
(d) a polypeptide comprising ammo acid 301 to ammo acid 315 as set forth in Figure 2 (SEQ ID NO 2), and
(e) a polypeptide which is at least 70% identical to the polypeptide of (a), (b), (c), or (d) conjugated to a therapeutic agent
29 The immunoconjugate of Claim 28, wherein the therapeutic agent is a cytotoxic agent
30 The immunoconjugate of Claim 29, wherein the cytotoxic agent is selected from the group consisting of πcin, doxorubic , daunorubicm, taxol, ethidium bromide, mitomycin, etoposied, tenoposide, vincπstine, vmblastine, colchicme, dihydroxy anthracm dione, actinomycin D, diphteπa toxin, Pseudomonas exotox (PE) A, PE40, πcin, abπn, glucocorticoid and radioisotopes
31 The immunoconjugate of Claim 28, wherein the antibody fragments are selected from the group consisting of Fv, F(ab') and F(ab')2 fragments
32 A method for selectively destroying a cell expressing the polypeptide of Figure 2 (SEQ ID NO 2) comprising reacting the immunoconjugate of Claim 28 with the cell so that the therapeutic agent of the immunoconjugate can destroy the cell
33 A method of treating a disease-state in a human patient which disease-state is associated with expression of PROST-Ets and wherein the method comprises administering to the patient a therapeutically effective amount of the immunoconjugate of Claim 28
34 A method of treating a disease-state in a human patient which disease-state is associated with expression of PROST-Ets and wherein the patient is in need of decreased levels of a polypeptide comprising a member selected from the group consisting of
(a) a polypeptide, or a biologically or immunologically active fragment thereof, comprising the am o acid sequence as set forth in Figure 2 (SEQ ID NO 2), and
(b) a polypeptide which is at least 70% identical to the polypeptide of (a) and wherein the method comprises administering to the patient a therapeutically effective amount of a πbozyme which specifically cleaves RNA encoding the polypeptide 35 A method of treating a disease-state in a human patient which disease-state is associated with inappropriate expression of PROST-Ets and wherein the patient is in need of decreased levels of a polypeptide having the ammo acid sequence as set forth in Figure 2 (SEQ ID NO 2), wherein the method comprises administering to the patient a therapeutically effective amount of a polynucleotide which is complementary to a polynucleotide wherein the polynucleotide comprises the sequence set forth in Figure 1 (SEQ ID NO 1 ) or a portion thereof
36 The method of Claim 35 wherein the polynucleotide administered has the sequence UCCACCUGUGGCAGUUCCUCAAG (SEQ ID NO 9)
37 The method of Claim 35 wherein the polynucleotide administered has the sequence UGACUCGACAAAGGCCACAGGCA (SEQ ID NO 10)
38 The method of Claim 35 wherein the polynucleotide administered has the sequence CCAGCAUUUCCAGAGCAGAGCCU (SEQ ID NO 11 )
39 A diagnostic method wherein the method comprises analyzing a sample derived from a host for the presence of a polypeptide comprising a member selected from the group consisting of
(a) a polypeptide, or a biologically or immunologically active fragment thereof, comprising the ammo acid sequence as set forth in Figure 2 (SEQ ID NO 2),
(b) a polypeptide comprising ammo acid 39 to ammo acid 56 as set forth in Figure 2 (SEQ ID NO 2), (c) a polypeptide comprising ammo acid 189 to ammo acid 200 as set forth in
Figure 2 (SEQ ID NO 2),
(d) a polypeptide comprising ammo acid 301 to ammo acid 315 as set forth in Figure 2 (SEQ ID NO 2), and
(e) a polypeptide which is at least 70% identical to the polypeptide of (a), (b), (c), or (d)
40 The method of Claim 39, wherein analyzing comprises contacting the sample with the antibody or antibody fragment of Claim 22, which specifically bind to the polypeptide and detecting binding of the antibody to the polypeptide in the sample
41 A diagnostic method wherein the method comprises analyzing for the presence of a polynucleotide comprising a polynucleotide which is at least 70% identical to a member selected from the group consisting of (a) a polynucleotide encoding a polypeptide, or a biologically or immunologically active fragment thereof, comprising the am o acid sequence set forth in Figure 2 (SEQ ID NO 2), and
(b) a polynucleotide which is complementary to the polynucleotide of (a)
42 A method for diagnosing in a subject a metastasis associated with the polypeptide of Figure 2 (SEQ ID NO 2) comprising
(a) obtaining from the subject a tissue and/or fluid sample,
(b) contacting the sample with the antibody of Claim 22, and (c) detecting the binding of the antibody with the polypeptide in the sample
43 The method of Claim 42, wherein the antibody is labeled so as to directly or indirectly produce a detectable signal with a compound selected from the group consisting of a radiolabel, an enzyme, a chromophore and a fluorescer
44 A method of treating a disease-state in a human patient which disease-state is associated with PROST-Ets activity and wherein the patient is in need of decreased levels of said activity wherein the method comprises administering to the patient a therapeutically effective amount of a polypeptide comprising a member selected from the group consisting of (a) a polypeptide having the ammo acid sequence as set forth in Figure 2 (SEQ ID
NO 2),
(b) a polypeptide comprising ammo acid 131 to ammo acid 213 as set forth in Figure 2 (SEQ ID NO 2),
(c) a polypeptide comprising ammo acid 246 to ammo acid 332 as set forth in Figure 2 (SEQ ID NO 2), and
(d) a polypeptide which is at least 70% identical to the polypeptide of (a), (b) or (c)
45 The method of Claim 44 wherein said therapeutically effective amount of the polypeptide is administered by providing to the patient a polynucleotide encoding the polypeptide and expressing the polypeptide in vivo
EP00992356A 1999-11-30 2000-11-29 DNA ENCODING A NOVEL PROST-Ets POLYPEPTIDE Withdrawn EP1234037A2 (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US16818299P 1999-11-30 1999-11-30
US168182P 1999-11-30
US71815900A 2000-11-21 2000-11-21
US718159 2000-11-21
PCT/US2000/042295 WO2001042472A2 (en) 1999-11-30 2000-11-29 DNA ENCODING A NOVEL PROST-Ets POLYPEPTIDE

Publications (1)

Publication Number Publication Date
EP1234037A2 true EP1234037A2 (en) 2002-08-28

Family

ID=26863872

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00992356A Withdrawn EP1234037A2 (en) 1999-11-30 2000-11-29 DNA ENCODING A NOVEL PROST-Ets POLYPEPTIDE

Country Status (6)

Country Link
EP (1) EP1234037A2 (en)
JP (1) JP2003533177A (en)
AU (1) AU4306401A (en)
HK (1) HK1049352A1 (en)
NO (1) NO20022542L (en)
WO (1) WO2001042472A2 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7867731B2 (en) 1998-11-04 2011-01-11 Novartis Vaccines And Diagnostics, Inc. HX2004-6 polypeptide expressed in cancerous cells
EP1179093A1 (en) 1999-05-14 2002-02-13 Chiron Corporation Expression of ets-domain proteins in cancer
EP2280030A3 (en) 2001-04-10 2011-06-15 Agensys, Inc. Nucleic acids and corresponding proteins useful in the detection and treatment of various cancers

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6265565B1 (en) * 1998-04-03 2001-07-24 Incyte Genomics, Inc. Prostate associated Ets protein
US20010010934A1 (en) * 1998-07-31 2001-08-02 Towia Aron Libermann Prostate derived ets factor
AU3395900A (en) * 1999-03-12 2000-10-04 Human Genome Sciences, Inc. Human lung cancer associated gene sequences and polypeptides
EP1179093A1 (en) * 1999-05-14 2002-02-13 Chiron Corporation Expression of ets-domain proteins in cancer

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CHANG C-H. ET AL: "EXON 4-ENCODED ACIDIC DOMAIN IN THE EPITHELIUM-RESTRICTED ETS FACTOR,", ONCOGENE, vol. 18, 24 June 1999 (1999-06-24), pages 3682 - 3695, XP009003387, DOI: doi:10.1038/sj.onc.1202674 *
See also references of WO0142472A3 *
SLUSKY ET AL: "STRUCTURE OF THE ETS-1 POINTED DOMAIN AND MITOGEN-ACTIVATED PROTEIN KINASE PHOSPHORYLATION SITE", PROC. NATL. ACAD. SCI., vol. 95, October 1998 (1998-10-01), pages 12129 - 12134 *
WASYLYK B. ET AL: "Ets transcription factors: nuclear effectors of the Ras-MAP-kinase", TRENDS IN BIOCHEMICAL SCIENCES, vol. 23, no. 6, June 1998 (1998-06-01), pages 213 - 216, XP004122314, DOI: doi:10.1016/S0968-0004(98)01211-0 *

Also Published As

Publication number Publication date
WO2001042472A2 (en) 2001-06-14
NO20022542L (en) 2002-07-29
WO2001042472A3 (en) 2002-05-10
AU4306401A (en) 2001-06-18
NO20022542D0 (en) 2002-05-29
HK1049352A1 (en) 2003-05-09
JP2003533177A (en) 2003-11-11

Similar Documents

Publication Publication Date Title
US7893217B2 (en) Isolated human antibodies that bind epitopes on RG1
EP2343085A2 (en) Antibody against prostate stem cell antigen (PSCA)
US20020009455A1 (en) DNA encoding a novel PROST 03 polypeptide
WO2001025446A1 (en) Dna encoding prost 07 polypeptide
WO2001042472A2 (en) DNA ENCODING A NOVEL PROST-Ets POLYPEPTIDE
US20080267863A1 (en) Method of Diagnosing, Monitoring, Staging, Imaging and Treating Colon Cancer

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020528

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Free format text: AL PAYMENT 20020528;LT PAYMENT 20020528;LV PAYMENT 20020528;MK PAYMENT 20020528;RO PAYMENT 20020528;SI PAYMENT 20020528

17Q First examination report despatched

Effective date: 20021113

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20040127

REG Reference to a national code

Ref country code: HK

Ref legal event code: WD

Ref document number: 1049352

Country of ref document: HK