EP1231831A1 - Stress-resistant oversized transgenic plants capable of growing in salinized soil - Google Patents

Stress-resistant oversized transgenic plants capable of growing in salinized soil

Info

Publication number
EP1231831A1
EP1231831A1 EP00980337A EP00980337A EP1231831A1 EP 1231831 A1 EP1231831 A1 EP 1231831A1 EP 00980337 A EP00980337 A EP 00980337A EP 00980337 A EP00980337 A EP 00980337A EP 1231831 A1 EP1231831 A1 EP 1231831A1
Authority
EP
European Patent Office
Prior art keywords
plant
transgenic plant
avpl
transgenic
plants
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00980337A
Other languages
German (de)
French (fr)
Other versions
EP1231831A4 (en
Inventor
Roberto A. Gaiola
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
WHITEHEAD INSTITUTE
University of Connecticut
Whitehead Institute for Biomedical Research
Original Assignee
WHITEHEAD INSTITUTE
University of Connecticut
Whitehead Institute for Biomedical Research
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by WHITEHEAD INSTITUTE, University of Connecticut, Whitehead Institute for Biomedical Research filed Critical WHITEHEAD INSTITUTE
Publication of EP1231831A1 publication Critical patent/EP1231831A1/en
Publication of EP1231831A4 publication Critical patent/EP1231831A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance

Definitions

  • the present invention relates to genetically-altered plants that are hardy with respect to environmental stresses, such as drought and/or freezing, oversized with respect to vegetative and/or sexual structure (as compared to their normal phenotypic counterparts), and capable of growing in media of high salinity.
  • ABA abcisic acid
  • Yet another area of agricultural interest is to improve the yield of crop plants and to improve the aesthetic qualities of certain decorative plants.
  • the yield of a plant crop, and the aesthetics of certain decorative plants may be improved by growing plants that are larger than the wild-type plant in vegetative and/or reproductive structure. It is known in the art that certain growth factors may be used to increase plant and/or plant flower size. Unfortunately, application of such growth factors is costly and time consuming.
  • the present invention discloses a transgenic plant having upregulated expression of vacuolar pyrophosphatase. It has been found that plants displaying such upregulated activity are generally larger than wild-type counterparts, demonstrate improved stress resistance to drought and/or freeze, and have increased tolerance to salt in the media in which they are growing.
  • exogenous nucleic acid molecule which alters expression of vacuolar pyrophosphatase in the plant can be used to transform the transgenic plants in accord with the present invention.
  • the exogenous nucleic acid can comprise nucleic acid that encodes a vacuolar pyrophosphatase protein (an exogenous vacuolar pyrophosphatase), such as AVPi, a functional portion thereof (peptide, polypeptide), or a homologue thereof, and/or nucleic acid that alters expression of the endogenous vacuolar pyrophosphatase of the plant into which the exogenous nucleic acid is introduced.
  • exogenous nucleic acid it is meant a nucleic acid from a source other than the plant cell into which it is introduced, or into a plant or plant part from which the transgenic part was produced.
  • the exogenous nucleic acid used for transformation can be RNA or DNA, (e.g., cDNA, genomic DNA).
  • the exogenous nucleic acid can be circular or linear, double-stranded or single-stranded molecules. Single-stranded nucleic acid can be the sense strand or the anti-sense strand.
  • a “functional portion” of a nucleic acid that encodes a vacuolar pyrophosphatase protein it is meant a portion of the nucleic acid that encodes a protein or polypeptide which retains a functional characteristic of a vacuolar pyrophosphatase protein.
  • the nucleic acid encodes AVP1, a functional portion or a homologue thereof.
  • Nucleic acid that alters expression of the endogenous vacuolar pyrophosphatase of the plant into which the exogenous nucleic acid is introduced includes regulatory sequences (e.g., inducible, constitutive) which function in plants and antisense nucleic acid.
  • regulatory sequences include promoters, enhancers and/or suppressors of vacuolar pyrophosphatase.
  • the nucleic acid can also include, for example, polyadenylation site, reporter gene and/or intron sequences and the like whose presence may not be necessary for function or expression of the nucleic acid but can provide improved expression and/or function of the nucleic acid by affecting, for example, transcription and or stability (e.g., of mRNA). Such elements can be included in the nucleic acid molecule to obtain optimal performance of the nucleic acid.
  • the nucleic acid for use in the present invention can be obtained from a variety of sources using known methods.
  • the nucleic acid encoding a vacuolar pyrophosphatase (e.g., AVP1) for use in the present invention can be derived from a natural source, such as tobacco, bacteria, tomato or corn.
  • the nucleic acid encodes a vacuolar pyrophosphatase that co ⁇ esponds to a wild type of the transgenic plant.
  • the nucleic acid encodes a vacuolar pyrophosphatase that does not conespond to a wild type of the transgenic plant.
  • Nucleic acid that alters expression of the endogenous vacuolar pyrophosphatase of the plant into which the exogenous nucleic acid is introduced can also be chemically synthesized, recombinantly produced and/or obtained from commercial sources.
  • a variety of methods for introducing the nucleic acid of the present invention into plants are known to those of skill in the art. For example, Agrobacterium- mediated plant transformation, particle bombardment, microparticle bombardment (e.g., U.S. Patent No. 4,945,050; U.S. Patent No. 5,100,792) protoplast transformation, gene transfer into pollen, injection into reproductive organs and injection into immature embryos can be used.
  • the exogenous nucleic acid can be introduced into any suitable cell(s) of the plant, such a root cell(s), stem cell(s) and or leaf cell(s) of the plant.
  • transgenic plants of the present invention Any suitable plant can be used to produce the transgenic plants of the present invention.
  • tomato, corn, tobacco, rice, sorghum, cucumber, lettuce, turf grass, ornamental (e.g., larger flowers, larger leaves) and legume plants can be transformed as described herein to produce the transgenic plants of the present invention.
  • the transgenic plants of the present invention can be grown in any medium which supports plant growth such as soil or water (hydroponically).
  • a transgenic plant of the present invention is preferably tolerant to high salt concentrations in soil.
  • salt it is meant to include any salt, that is a compound formed when hydrogen of an acid is replaced by a metal or its equivalent, and includes, without limitation, salts comprising monovalent and divalent toxic cations, NaCl, KC1, CaCl 2 , MgCl, CdCl, ZnCl, and sulfide salts.
  • Salt tolerance may be introduced into a plant of the present invention by transforming plant cells with exogenous nucleic acid which alters the expression of vacuolar pyrophosphatase in the plant such that expression is upregulated.
  • Any suitable vacuolar pyrophosphatase can be used in the compositions and methods of the present invention (e.g., Sarasian, Z., et al, Proc. Natl. Acad. Sci., USA, 89:1115-1119 (1992); Jenslerchl, et al, Molec. Biol, 29: 833-840 (1995); Kim, Y., et al, Plant Physiol, 106:315-382 (1994)).
  • the present invention relates to a transgenic plant which is tolerant to salt comprising an exogenous nucleic acid construct which is designed to overexpress AVPl (Sarasian, Z., et al, Proc. Natl. Acad. Sci., USA, 89:1115-1119 (1992)). Transformation of the plant cells may be carried out in a whole plant, seeds, leaves, roots or any other plant part. Such transgenic plants are preferably altered such that they grow in a concentration of salt that inhibits growth of a conesponding non-transgenic plant.
  • Transgenic progeny of the transgenic plants seeds produced by the transgenic plant and progeny transgenic plants grown from the transgenic seed, which are also the subject of the present invention, advantageously carry such salt tolerant trait.
  • Plants may be regenerated from transformed cells to yield transgenic plants, which may be screened for certain levels of salt tolerance.
  • the exogenous nucleic acid encodes AVPl, or a homologue thereof.
  • expression of the vacuolar pyrophosphatase in the plant is enhanced to an extent that the transgenic plant is tolerant to sodium chloride (NaCl) when the NaCl concentration is from about 0.2M to about 0.3M.
  • a transgenic plant capable of growing in salt water may also be produced by introducing into one or more cells of a plant nucleic acid which upregulates expression of vacuolar pyrophosphatase in the plant to yield transformed cells.
  • salt water includes water characterized by the presence of salt, and preferably wherein the concentration of salt in the water is from about 0.2M to about 0.4M.
  • salt water refers to sea water.
  • the transgenic plants of the present invention can also be used to produce double transgenic plants which are tolerant to salt (about 0.2M to about 0.4M salt concentration).
  • the present invention relates to a double transgenic plant which is tolerant to salt comprising one or more plant cells transformed with exogenous nucleic acid which alters expression of a vacuolar pyrophosphatase and an Na + /H + antiporter in the plant.
  • the vacuolar pyrophosphatase in an advantageous construct is AVPl, or a homologue thereof, and the NaVH + antiporter is AtNHXl, or a homologue thereof.
  • the present invention also encompasses transgenic progeny of the double transgenic plant, as well as seeds produced by the transgenic plant and a progeny transgenic plant grown from the seed.
  • Drought and/or freeze tolerance may also be introduced into plants by transforming plant cells with exogenous nucleic acid which alters the expression of vacuolar pyrophosphatase in the plant such that such expression is upregulated.
  • a substantially drought and/or freeze resistant transgenic plant which comprises a genome having one or more exogenously introduced vacuolar H + -translocating pump genes.
  • a particularly prefened fertile transgenic plant eliciting drought and/or freeze tolerance, as well as the ability to grow in saline soils comprises an isolated exogenous chimeric DNA construct encoding vacuolar Yf- translocating pump, preferably operably linked to a promoter, such as the 35-S promoter or any other strong promoter, including, without limitation, tissue specific promoters.
  • the transgenic plant may contain a polynucleotide sequence comprising an exogenous tonoplast pyrophosphate FT pump gene operably linked to a promoter.
  • the polynucleotide sequence comprises an exogenous tonoplast pyrophosphate FT 1" pump gene operably linked to a double tandem enhancer of the 35S promoter.
  • a particularly prefened tonoplast pyrophosphate IT 1" pump gene is the AVPl gene.
  • Upregulation of expression of vacuolar pyrophosphatase by the methods described above may also be used to provide a plant having larger vegetative and/or sexual organs than wild type counterpart plants. That is, the present invention provides for a method of increasing the yield of a plant comprising introducing into one or more cells of a plant nucleic acid which alters expression of vacuolar pyrophosphatase in the plant to yield transformed cells, thereby increasing the yield of the plant. The method can further comprise regenerating plants from the transformed cells to yield transgenic plants and selecting a transgenic plant which is larger than its conesponding wild type plant, thereby producing a transgenic plant which is larger than its conesponding wild type plant.
  • transgenic plant e.g., an ornamental plant
  • a method of making a transgenic plant comprising introducing into one or more cells of a plant nucleic acid which alters expression of vacuolar pyrophosphatase in the plant to yield transformed cells.
  • novel gene cassettes including cassettes comprising a tonoplast pyrophosphate driven T pump gene operably linked to a chimeric promoter, a novel gene cassette comprising a exogenous tonoplast pyrophosphate driven H* pump gene operably linked to a promoter, as well as novel coding sequences comprising an exogenous tonoplast pyrophosphate driven H + pump gene operably linked to a double tandem enhancer of the 35S promoter.
  • coding sequence is designed to overexpress AVPl.
  • novel expression vectors including an expression vector containing a polynucleotide sequence comprising a exogenous tonoplast pyrophosphate driven H + pump gene operably linked to a double tandem enhancer of the 35S promoter and further operative ly linked to a multiple cloning site, and an expression vector containing a polynucleotide sequence comprising a exogenous tonoplast pyrophosphate driven H + pump gene operably linked to a double tandem enhancer of the 35S promoter and further operatively linked to a heterologous coding sequence.
  • the disclosed invention may have application to any plant, including, without limitation, crop plants, ornamental plants, grasses, shrubs, or any other plant found useful or pleasing to man.
  • Fig. 1A is an overhead view of representative (out of 10 plants each) wild type (WT) and two independent transgenic lines (1 ' and 2') grown hydroponically for seven weeks on a 10 hour light/dark cycle;
  • Figs. 1B(1), 1B(2) and 1B(3) are a photomicrographs of the root and root hairs of representative five day old seedlings obtained from representative WT, 1' and 2' of Fig. 1A grown parallel to the surface on vertical plant nutrient agar plates;
  • Fig. 1 C is an immunoblot of membrane fractions isolated from wild type (WT) and two independent transgenic lines (1' and 2') overexpressing AVP-1;
  • Fig. 2 is an overhead view of a representative wild type plant (WT) versus representative transgenic plants overexpressing AVP-1 (1 ' and 2') after exposure to 7 days of water deficit stress.
  • Fig. 3 is a perspective view of wild-type plants (WT) versus representative transgenic plants overexpressing AVP-1 (1' and 2') grown in salty soil.
  • Fig. 4 A is a schematic representation of a working model of the transporters involved in sodium sequestration at the yeast pre-vacuolar compartment; Nhxl (Na + /FT antiporter), Vmal (vacuolar membrane tT-ATPAse), Gefl (yeast CLC chloride channel), Enal (plasma membrane Na + -ATPase).
  • Fig. 4B is a schematic representation of a working model of the transporters involved in sodium sequestration at the yeast pre-vacuolar compartment shown in Fig. 4A, which also includes Avpl (A. thaliana vacuolar pyrophosphate- energized proton pump).
  • Fig. 5 A and Fig. 5B are bar graphs showing the intracellular Na + and K + contents of wild-type yeast strains and of yeast strains carrying various mutations affecting sodium tolerance wherein the values are the mean of two determinations, and the bars represent the standard deviations.
  • Figs. 6 A, 6B, 6C when joined by matchlines A-A and B-B, is an alignment of the deduced amino acid sequences of NhXl homologue from Arabidopsis AtNHXl (SEQ ID NO: 1), human HsNHE-6 (SEQ ID NO: 2) and yeast ScNHXl (SEQ ID NO:3); identical residues are in black boxes, and dashes indicate gaps in the sequence, * above alignment denote putative amiloride binding site from human NHE1 ( 163 DVF- FLFLLPPI 173 ) (SEQ ID NO: 4).
  • Fig. 7 is a bar graph of Na + and K + content of wild-type plants (WT) versus representative transgenic plants overexpressing AVP-1 (1' and 2') grown in salty soil.
  • Fig. 8 is a graph of the uptake of calcium into the 35SAVP-1 transgenic vacuolar membrane vesicles (squares) of 2' of Fig. 3 versus calcium uptake into vesicles obtained from wild type (WT) of Fig. 3.
  • Figs. 9 A and 9B are illustrations demonstrating the theorized mechanism for a higher accumulation of solids into vacuoles via a proton driven function versus that of WT vacuoles.
  • vacuoles constitute 40 to 99% of the total intracellular volume of a mature plant cell, changes in the size of the vacuole have dramatic effects upon cell size (R. G. Zhen, E. J. Kim, P. A. Rea, in The Plant Vacuole . (Academic Press Limited, 1997), vol. 25, pp. 298-337).
  • the volume of the vacuole is controlled by ion and water fluxes mediated by pumps and transporters. In plants the driving force that triggers the movement of ions, solutes and water across membranes is a proton gradient.
  • vacuolar FT-pumps results in luminal acidification and the establishment of a T electrochemical potential gradient across the vacuolar membrane, which powers the secondary active transporters of inorganic ions, sugars, and organic acids.
  • the activity of these transporters modulates cellular pH and ion homeostasis and leads to the accumulation of solutes required to generate the osmotic potential that promotes vacuolar expansion (H. Sze, X. Li, M. G. Palmgren, The Plant Cell 11, 677-689 (1999)).
  • the present inventor has recognized that plants have a number of vacuolar FT-translocating pumps, and that by upregulating their activity, increasing their expression, upregulating their transcription and/or translation, or increasing their copy number that one can increase accumulation of solids in the vacuole due to an increase in the availability of protons in the vacuoles.
  • V-PPase encoded by the AVP-1 gene is capable of generating a FT* " gradient across the vacuole membrane (tonoplast) similar in magnitude to that of the vacuolar FT-ATPase (V. Sarafian, Y. Kim, R. J. Poole, P. A. Rea, Proc. Natl Acad. Sci. 89, 1775-1779 (1992)).
  • FT* gradient across the vacuole membrane
  • Similar genes in other plants should function in a similar manner.
  • a construct comprising a vacuolar pyrophosphatase gene operably linked to a promoter designed to overexpress the vacuolar pyrophosphatase (e.g., an expression cassette) is used to produce the transgenic plants of the present invention.
  • a promoter designed to overexpress the vacuolar pyrophosphatase e.g., an expression cassette
  • the term "overexpression” refers to greater expression/activity than occurs in the absence of the construct.
  • a construct comprising an AVPl gene operably linked to a chimeric promoter designed to overexpress AVPl is used to produce the transgenic plants of the present invention. More particularly, the present invention relates to a construct wherein the AVPl gene is operably linked to a double tandem enhancer of a 35S promoter.
  • the transgenic plants of the present invention may find utility other than those associated with the food value or ornamental value.
  • the transgenic plants of the present invention may uptake different or more ions than their wild-type counterparts.
  • studies with mutant yeast strains (enal) demonstrates that FT-translocating pumps at the vacuole plays an important role in cation detoxification in higher plants (the plant components involved in an intracellular cation detoxification system being identified by complementing salt-sensitive mutants of the budding yeast Saccharomyces cerevisiae).
  • Transgenic plants and/or progeny thereof comprising exogenous nucleic acid which alters expression of vacuolar pyrophosphatase in the plant in accord with such studies may be used to bioremediate soil and growth medium.
  • Such plants can be used to remove cations (e.g., monovalent and/or divalent cations) from a medium which can support plant growth (e.g., soil, water).
  • cations e.g., monovalent and/or divalent cations
  • transformed plants of the present invention can be used to remove sodium (Na), lead (Pb), manganese (Mn) and/or calcium (Ca) ions from a medium which supports plant growth.
  • the present inventor generated transgenic plants containing extra copies of a vacuolar proton pump, A VP-1.
  • Arabidopsis thaliana plants were transformed with constructs containing he AVP-1 gene. Transgenic lines containing extra copies of this gene were then isolated.
  • the A VP-1, open reading frame was cloned into the Xmal site of a modified pRT103 [R. Topfer, V. Matzeit, B. Gronenborn, J. Schell and H-H. Steinbiss, Nucleic acid Research 15, 5890 (1987)].
  • This vector contains a tandem repeat of the 35-S promoter.
  • a Hindlll fragment containing the 35-S tandem promoter, AVP-1 ORF and the polyadenylation signal was subcloned into the Hindlll site of the pPZP212 vector [ P. Hajdukiewicz, Z.
  • Agrobacterium- mediated transformation was performed via vacuum infiltration of flowering Arabidopsis thaliana (ecotype Columbia). Transgenic plants were selected by plating seeds of the transformed plants on plant nutrient agar plates supplemented with 25 mg/liter kanamycin. Plants were subsequently selected for two generations to identify transgenic plant homozygous for the transgene.
  • Fig. 1A is an overhead picture of representative (out of 10 plants each) wild type (WT) and two independent transgenic lines (1 ' and 2') grown hydroponically for seven weeks on a 10 hour light/dark cycle.
  • WT wild type
  • a visual comparison of transgenic line 2', which expresses the AVP-1 protein at highest level, transgenic line 1 ', and wild type (WT) demonstrates that the amount of AVP-1 conelates with the size of the plants.
  • the mass of the transgenic plants was found to be greater than that of wild type.
  • WT wild-type root hairs
  • the length of the root hairs is conelated with the size of the vacuole, so the increased size of the root hair is likely to result from increased vacuolar volume.
  • Fig. 1 C is an imrnunoblot of membrane fractions isolated from wild type (WT) and two independent transgenic lines (1' and 2') overexpressing AVP-1.
  • Total membrane fractions were isolated from shoots of eight week old wild type (WT) and AVP-1 transgenic plants (V and 2') grown in a hydroponic media for 6 weeks. Shoots of plants homogenates were sequentially centrifuged for 15 and 30 min at 8 and 100 kg respectively.
  • the 100kg membrane pellet was re-suspend in 10 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 10% glycerol and 1 mM PMSF Protein (10 mg) was separated on a 10% SDS-PAGE, electroblotted and immunostained with antibodies raised against a KLH-conjugated synthetic peptide conesponding to the putative hydrophilic loop IV of the AVP-1 protein (V. Sarafian, Y. Kim, R. J. Poole, P. A. Rea, Proc. Natl Acad. Sci. 89, 1775-1779 (1992)). PPase was detected by chemiluminescence.
  • Fig. 2 is an overhead view of a representative wild type plant (WT) versus representative transgenic plants overexpressing AVP-1 (V and 2') after exposure to 7 days of water deficit stress.
  • Wild type and transgenic plants overexpressing A VP-1 (Fig 3 A) were tested for drought tolerance (24°C).
  • WT water deficit stress wild type
  • l 1 and 2' 35S AVP-1 transgenic lines
  • l 1 and 2' 35S AVP-1 transgenic lines
  • wild type plants died.
  • the relative water content of leaves from wild type and 35SAVP-1 transgenic plants were determined along the water deficit stress, demonstrating increased water retention by the transgenic lines as compared to the WT plants.
  • FIG. 3 is a perspective view of wild type plants (WT) versus representative transgenic plants overexpressing AVP-1 (1' and 2') grown in salty soil.
  • Five wild-type plants (WT) and two AVP-1 overexpressing transgenic lines (1' and 2') were grown on soil in a 10 hour light/dark cycle. Plants were watered with a diluted nutrient solution (1/8 MS salts) for six weeks and subsequently watered with a diluted nutrient solution supplemented with NaCl. The concentration of NaCl began with 100 nM and was increased every four days by 100 mM.
  • the photograph in Fig. 3 conesponds to plants at the tenth day in the presence of 300 mM NaCl.
  • AVP-1 plant types (1 ' and 2') were significantly hardier in salty soil as compared to wild-type plants.
  • a VP1 the pyrophosphate-energized vacuolar membrane proton pump, this work
  • AtNHXl the NaNH + antiporter, (Apse, M., et al, Science, 2S5:1256-1258 (1999)) and this work) are capable of growing in the presence of high NaCl concentrations strongly supports the strategy described herein.
  • a double transgenic plant would be expected to demonstrate a further enhanced salt-tolerant phenotype.
  • These Arabidopsis thaliana transporters or their counterparts may perform similar function in important agricultural crops.
  • the increased size of 35S A VP1 Arabidopsis transgenic plants also contribute to potential yield increases in genetically engineered crops.
  • ET-translocating pumps located at the plasma membrane and tonoplast translocated IT 1" from the cytosol to extracellular and vacuolar compartments, respectively (Rea, P. A., et al, Tonoplast Adenosine Triphosphate and inorganic Pyrophosphatase. In: Methods Plant Biochem., pp. 385-405, Academic Press Limited, London (1990)).
  • the plant tonoplast contains two H ⁇ -translocating pumps; the V-ATPase and the inorganic pyrophosphatase or V-PPase.
  • vacuolar membrane is implicated in a broad spectrum of physiological processes that include cytosolic pH stasis, compartmentation of regulatory Ca 2+ , sequestration of toxic ions such as Na + , turgor regulation, and nutrient storage and retrieval.
  • the vacuole constitute 40 to 99% of the total intracellular volume of a mature plant cell.
  • vacuolar proton pumping pyrophosphatase is a universal and abundant component of plant tonoplast capable of generating a steady-state trans-tonoplast H + electrochemical potential similar or greater than the one generated by the V-ATPase (Rea, P.A., et al, Tonoplast Adenosine Triphosphate and Inorganic Pyrophosphatase. hx.Methods Plant Biochem., pp. 385-405, Academic Press Limited, London (1990)).
  • Pyrophosphate is a by-product in the activation or polymerization steps of a wide range of biosynthetic pathways and in plants serves as an alternative energy donor to ATP for sucrose mobilization via sucrose synthetase, for glycolysis via PPi: fructose-6- phosphate phosphotransferase and for noplast energization via the vacuolar proton pumping pyrophosphatase (Stitt, M., Bot. Acta 111:161-115 (1998)).
  • Fig. 4 A is a schematic representation of a working model of the transporters involved in sodium sequestration at the yeast pre-vacuolar compartment; Nhxl (Na + /H + antiporter), Vmal (vacuolar membrane IT 1" - ATPase), Gefl (yeast CLC chloride channel), Enal (plasma membrane Na + -ATPase).
  • the yeast member of the CLC voltage-gated chloride channel superfamily, Gefl is required for copper loading in late- Golgi vesicles and for cation sequestration in the pre-vacuolar compartment in yeast (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci.
  • FIG. 4B is a schematic representation of a working model of the transporters involved in sodium sequestration at the yeast pre- vacuolar compartment shown in Figure 4A, which also includes Avpl (A. thaliana vacuolar pyrophosphate-energized proton pump).
  • Yeast and plant cells share pathways and signals for the trafficking of vesicles from the Golgi network to the vacuole (Neuhaus, J.M., et al, Plant Mol Biol, 33:127-144 (1998); (Paris, N., e al, Plant Physiol, 775:29-39 (1997); Sato, M.H., e l, J. Biol. Chem., 272:24530-24535 (1997); Vitale, AN., et al, Trends Plant Sci., 4:148-154 (1999)). Studies were therefore undertaken in yeast to identify the role of the vacuole in cation detoxification in higher plants.
  • the yeast vacuolar ATPase is a multisubunit protein, so it is difficult to increase its activity by overexpressing any one of its subunits. Instead the same effect was achieved by increasing the influx of protons by expressing the A. thaliana AVPl gene in yeast.
  • This gene encodes a single polypeptide that, when expressed in yeast, is capable of pumping protons into the lumen of the vacuole (Kim, E.J., et al, Proc. Natl. Acad. Sci. USA, 97:6128-6132 (1994)).
  • Transformation of yeast cells was performed by using the lithium acetate method (Gietz, D., et al, Nucleic Acids Res., 20:1425 (1992)).
  • Double mutants RGY324 (gefl::HIS3 enal::HIS3), RGY326 (nhxl::HIS3 enal::HIS3), and RGY343 (gefl::HIS3 nhxl::HIS3) were obtained by crossing the single-mutant strains.
  • Double mutants were identified among the meiotic progeny by scoring for the phenotypes associated with each of the single mutants. Sporulation, tetrad dissection, and mating types were scored as described (Guthrie C.
  • APG is a synthetic minimal medium containing 10 mM arginine, 8 mM phosphoric acid, 2% glucose, 2 mM MgSO , 1 mM KCl, 0.2 mM CaCl 2 , and trace minerals and vitamins) (Rodriguez-Navano, A. and Ramos, J., J. Bacteriol, 759:940-945 (1984)).
  • MnCl 2 Sigma
  • tetramethyla monium chloride Sigma
  • NaCl NaCl
  • hygromycin-B hygromycin-B
  • Wild type, L5709 (enal::HIS3), RGY324 (gefl::HIS3 enal::HIS3), and RGY326 (nhxl::HIS3 enal::HIS3) strains were transformed with pYES2 vector (Invitrogen) and plasmid pYES2- ⁇ F7 > 7-E229D described in Zhen, R.G., et al., J. Biol. Chem., 272:22340-22348 (1997).
  • the strain RGY343 (gefl::HIS3 nhxl::HIS3), used for histochemical analysis, was transformed with pRG151 (GEF1-GFP) (Gaxiola, R.A., et al. Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998)) and with pRIN73 [NHX1-(HA) 3 ] (Nass, R., and Rao, R., J. Biol. Chem., 273:21054-21060 (1998)).
  • GEF1-GFP Gaxiola, R.A., et al. Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998)
  • pRIN73 [NHX1-(HA) 3 ] Nass, R., and Rao, R., J. Biol. Chem., 273:21054-21060 (1998).
  • RGY296 Wild-type and RGY296 (nhxl::HIS3) strains were transformed with vector pAD4 (Ballester, R., et al, Cell, 59:681-686 (1989)). RGY296 (nhxl::HIS3) was transformed with pRG308 (ADH1:: AtNHXl) (see Cloning of AtNHXl).
  • the amount of Na + and K + in cells was determined at the University of Georgia Chemical Analysis Laboratory by an Inductively Coupled Plasma-MS (see world wide web at rserv/uga.edu/rsnew/chemicalanalysis/). Intracellular cation concentrations were estimated as described (Gaxiola, R.A., et al, EMBO J., 77:3157-3164 (1992)) by using the intracellular water value calculated for cells grown in 1M NaCl.
  • the strain RGY343 (gefl::HIS3 nhxl::HIS3) was grown in SD-ura, -leu medium (Difco; synthetic medium with 2% dextrose without uracil and leucin) to mid- logarithmic phase, 0.1 mg/ml hygromycin B was added, and the culture was incubated for 1 h at 30°C. Cells were fixed with 3.7% formaldehyde (Sigma) for 45 min at room temperature without agitation. Spheroplast formation, permeablization, washing, and antibody incubation was performed as described (Pringle, J., et al, in Immunofluorescence Methods for Yeast, eds. Guthrie, C.
  • MAB HAI 1 used as first antibody was from Babco (Richmond, CA). Cy 3 -conjugated goat anti-mouse IgG was from Jackson Immunoresearch. 4',6-Diamidino-2-phenylindole (Sigma) was added to mounting medium to stain mitochondrial and nuclear DNA.
  • the strain RGY343 (gefl::HIS3 nhxl::HIS3) was grown in APG medium (pH 7.0), and lysates fractionated on a 10-step sucrose density gradient as described (Nass, R. and Rao, R., J Biol Chem., 273:21054-21060 (1998)). Aliquots of individual fractions (100 ⁇ g) were subjected to SDS/PAGE and transfe ⁇ ed to nitrocellulose as described (Nass, R. and Rao, R., J. Biol Chem., 273:21054-21060 (1998)).
  • AtNHXl was cloned from a phage cDNA library of A. thaliana (Kieber, J.J., et al, Cell, 72:427-441 (1993)) (obtained from the Arabidopsis Biological Resource Center) by probing with an expressed sequence tag (Arabidopsis Biological Resources Center, DNA Stock Center) containing a partial clone.
  • a full-length clone (2.1 kB) was ligated into vector pSK2 (Stratagene) at the Notl sit, generating plasmid pRG293.
  • the AtNHXl ORF was amplified via PCR by using pRG293 as template and GGCCCGGGATGGATTCTCTAGTGTCGAAACTGCCTTCG (SEQ ID NO: 5) (italicized bases conespond to nucleotides 1-30 of the ORF) and T7 oligonucleotides.
  • the PCR product was then digested with Xbal and Sail and ligated into pAD4 vector generating plasmid pRG308.
  • the AtNHXl ORF was sequenced to verify the fidelity of the PCR product. The full-length sequence is longer than the ORF reported by the Arabidopsis Genome Initiative (A TM021B04.4), and has been deposited in GenBank (accession no. AF106324).
  • Vector pYES2 (Invitrogen) was introduced into wild-type, enal, enal nhxl, and enal gefl mutants. Plasmid pYes2-AVPl-D (Zhen, R.G., et al, J. Biol. Chem., 272:22340-22348 (1997)) was introduced into enal, enal nhxl, and enal gefl mutants. Five-fold serial dilutions (starting at 10 5 cells) of each strain were plated on YPGAL (1% yeast extract/2% peptone/2% galactose) with or without 0.5 M ⁇ aCl and incubated at 30°C for 2 days.
  • YPGAL 1% yeast extract/2% peptone/2% galactose
  • Exponentially growing cells (wild-type and enal transformed with pYES2 vector and enal, enal nhxl, and enal gefl mutants carrying pYes2-AVPl-D) were exposed to 0.7M ⁇ aCl for 6 hours. Total cell extracts were prepared, and ⁇ a + and K + concentrations were determined. Results
  • the enal mutant of the above construct lacks the plasma membrane sodium efflux pump and therefore must rely on the internal detoxification system to overcome sodium toxicity. Growth of the enal strain is sensitive to low concentrations of sodium (200 mM), concentrations that do not inhibit the growth of wild-type strains. Overexpression of AVPl -D restored salt tolerance to salt-sensitive enal mutants.
  • the restoration of salt tolerance to an enal strain by A VP1-D requires functional NHX1 and GEF1 genes: enalnhxl AVP1-D and enal gefl AVP1-D strains are salt sensitive.
  • Fig. 5 A and Fig. 5B are bar graphs showing the intracellular Na + and K + contents of wild-type yeast strains and of yeast strains carrying various mutations affecting sodium tolerance wherein the values are the mean of two determinations, and the bars represent the standard deviations.
  • the intracellular Na + and K + contents of wild-type strains and of strains carrying various mutations affecting sodium tolerance were determined after 6 h of exposure to media supplemented with 0.7 M NaCl.
  • the intracellular Na + content in the enal mutant was seen to be 8-fold higher than in the wild- type strain. There was seen to be a consistent reduction in total cell Na + in the enal AVP- D strain. The reason for this reduction is unknown.
  • the enal A VP-D strain was found to be salt-resistant, even though its intracellular Na + content was 4-fold higher than that of the wild type.
  • enal AVPI-D strains lacking either ge/7 or nhxl i.e., enal gefl or enal nhxl
  • the Na + content was not reduced to the extent that it was in the GEF1 NHX1 strain.
  • the genetic and physiological data are consistent with the model that Nhxl, Gefl and Avpl cooperate to sequester sodium internally.
  • the Arabidopsis Vacuolar H + -Pyrophosphatase (Avpl) was evidenced to confer salt tolerance to yeast enal mutants.
  • the intracellular K + content was found to conelate with salt tolerance and is inversely conelated with the Na + content of the strains (Fig. 4B).
  • the wild-type K + concentration was at 100 mM, but was reduced to 20 mM in the e « ⁇ 7 mutant.
  • the intracellular concentration of K + was restored almost to wild-type levels (Fig. 4B).
  • AVPl -D overexpression failed to restore wild-type levels of intracellular potassium unless both NHxl and GEF1 were functional (See, the double mutants enal nhxl or enal gefl in Fig. 4B).
  • intracellular Na + detoxification in yeast requires functional Na + /H + exchanger (Nhxl) and chloride channel (Gefl), and they co-localize to a pre-vacuolar compartment (Gaxiola, R.A., et al, Proc. Natl Acad. Sci. USA, 96:1480- 1485 (1999)).
  • Arabidopsis thaliana homologue of the yeast NHX1 gene Arabidopsis thaliana homologue of the yeast NHX1 gene (AtNHXl) was cloned and its function in the nhx 1 yeast mutant tested, the AtNHXl gene was found to be able to suppress partially the cation sensitivity phenotypes of nhxl mutants.
  • NhXl homologue from Arabidopsis AtNHXl (SEQ ID NO:l), human HsNHE-6 (SEQ ID NO: 2) and yeast ScNHXl (SEQ ID NO:3); identical residues are in black boxes, and dashes indicate gaps in the sequence, * above alignment denote putative amiloride binding site from human NHE7 ( I63 DVF-FLFLLPPI 173 ) (SEQ ID NO: 4).
  • Example 2 Functionality of . and Co-localization of Geflp and Nhxlp in Yeast Strains
  • NHX1 and GEF1 genes which have been identified as important in sodium detoxification, are also required for the detoxification of other cations.
  • the sequestration model postulates not only a functional connection between the anion channel Gefl and sodium exchanger Nhxl but also predicts that these two proteins co-localize within a common compartment. Because previous studies indicated that Nhxl localizes to a pre-vacuolar compartment (Nass, R. and Rao, R., J. Biol. Chem., 273:21054-21060 (1998)), experiments were also performed to determine whether Gefl and Nhxl proteins co-localize to this compartment. Materials and Methods
  • the strain RGY419 (gefl nhxl) was transformed with plasmids pRG151; GEF1-GFP and pRIN73; NHX1-(HA) 3 . Transformants were grown in SD (Difco; synthetic medium with 2% dextrose).
  • the migration properties of the Geflp and Nhxlp in sucrose gradients was also determined to provide evidence of co-localization of Nhxl (HA) 3 and GEF1-GFP.
  • the strain RGY419 (gefl nhxl) was transformed with plasmids pRG151; GEFl-GFP and pRTN73; NHX1-(HA) 3 and grown in APG medium (Rodriguez-Navano, A. and Rea, P.A., J. Biol. Chem., 159:940-945 (1984)).
  • Ge/7 mutants were found to be sensitive to 3 mM MnCl , 0.45 M tetramethylammonium chloride and to 0.05 ⁇ g/ml hygromycin-B.
  • the nhxl mutant was also found to be sensitive to tetramethylammonium chloride and hygromycin.
  • the extreme sensitivity of the nhxl mutant to hygromycin may provide an important tool for assaying nhxl function.
  • hemagglutinin (HA)-tagged Nhxl and Gefl-GFP fusion protein co-localize as shown via epifluorescence deconvolution microscope. Persistence of signal coincidence on 90° rotation of the image further supports co-localization of the two transporter proteins in these cells.
  • the co-localization of Nhxl (HA) 3 and GEFl-GFP is also supported by the co-migration of the two proteins in sucrose density gradients of membrane preparations obtained from cells expressing the tagged proteins.
  • the sedimentation behavior of the membrane fraction containing both proteins is consistent with that of a pre-vacuolar compartment (Nass, R. and Rao, R., J. Biol Chem., 273:21054- 21060 (1998)).
  • Gefl-GFP (but not Nhxl) is also present in Golgi fractions, consistent with previous studies (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998), Schwappach, B., et al, J. Biol. Chem., 273:15110-15118 (1998)).
  • Example 3 Capacity of A. thaliana Homolog of NHX1 to Suppress Hygromycin
  • the yeast strain described herein provides an important tool for identifying genes that mediate salt tolerance in other organisms.
  • a sequence from Arabidopsis See Materials and Methods
  • an expressed sequence tag see Materials and Methods
  • An alignment of the amino acid sequences of Nhxl homologues from Arabidopsis (AtNhxl), human (HsNhe ⁇ ), and yeast (ScNhxl) reveals segments of amino acid identity and similarity within predicted transmembrane domains (Fig. 6A-C).
  • Fig. 6A-C it is important to note that despite these relationships, neither the C-terminal regions of AtNhxl and ScNhxl show a high degree of homology (Fig. 6A-C).
  • a characteristic of mammalian Na + /H + antiporters is their inhibition by amiloride.
  • a putative amiloride binding site 163 DVFFLFLLPPI 173 ) (SEQ ID NO: 4) has been defined via point mutants in the human NHE1 antiporter gene (Counillon, L., et al, Proc. Natl. Acad. Sci. USA, 90:4508-4512 (1993)).
  • AtNhxl, HsNhe-6 and ScNhxl have an almost identical sequence (Fig. 6).
  • attempts to inhibit the activity of either Nhxl or AtNhxl in yeast cultures with amiloride were unsuccessful.
  • the At NHX1 gene is capable of suppressing the hygromycin sensitivity of the nhxl mutant.
  • the AtNHXl gene also suppressed the NaCl sensitivity of nhxl mutant but only under conditions in which the K + availability was reduced. However, AtNHXl was not capable of rescuing the Na + " sensitive growth phenotype of the double mutant enal nhxl overexpressing the AVP1-D gene.
  • Gain of function mutants of the AtNHX that enhance salt tolerance were generated in the enal yeast by mutagenizing the cloned gene to make a mutant library.
  • This library was used to transform the salt sensitive yeast mutant enal and clones with an enhanced salt tolerant phenotype.
  • a method for introducing random mutations developed by Stratgene (Epicurian Coli XL 1 -Red competent Cells Cat#200129) was used. The method involves the propagation of a cloned gene into a strain deficient in the three primary DNA repair pathways. The random mutation rate in this strain is about 5000-fold higher than that of wild-type.
  • a library of the mutated AtNHX gene was transformed into the enal yeast mutant and screened for salt tolerance. Yeast transformation was performed as described by Schiestl and coworkers (Gietz, D., et al, Nucl Acid Res. 20:1425 (1992), incorporated by reference in its entirety herein).
  • An alternative to the XL 1 -Red random mutagenesis strategy is a PCR approach described by Fink and coworkers (Madhani, H.D., et al, Cell, 97:673-684 (1997)).
  • AtNHXl homologues To test AtNHXl homologues the same strains and conditions used for AtNHXl (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999)) were used initially. However, if these screening strains and/or conditions did not work, new ones are worked out. When dealing with plasma-membrane AtNHXl homologues pH conditions of the assay media were found to be crucial.
  • yeast studies described above provide evidence for the importance of the pre-vacuolar pH for intracellular Na + sequestration in yeast.
  • Overexpression of the plant H + -pyrophosphatase (Avpl) confers salt tolerance to yeast only in those strains containing a functional chloride channel (Gefl) and the NaNFT exchanger (Nhxl).
  • the yeast system described herein permits the functional assessment of diverse heterologous proteins in salt tolerance: chloride channels, FT 1" pumps, and ⁇ aYFT exchangers and other cation/H + exchangers or cation/bicarbonate symporters.
  • the system is robust and flexible.
  • the function of the Arabidopsis chloride channels (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998), Hechenberger, M., et al, J. Biol. Chem., 277:33632-33638 (1996)), H + pump, and ⁇ aVlT exchanger can be assayed in the conesponding yeast mutant.
  • At NHX1 Despite the inability of At NHX1 to suppress all the phenotypes of the yeast nhxl mutant, the fact that it suppresses some phenotypes, coupled with the D ⁇ A homology between AtNHXl and yeast NHXl, indicates that the plant gene carries out a similar function to that of the yeast homologue.
  • the observation that the AtNHXl gene suppresses the sensitivity of the nhxl mutant to hygromycin but provides only a weak ⁇ a + detoxification phenotype could be a consequence either of differential regulation of the transporters in the two organisms or of distinct cation transport selectivities.
  • vacuolar sodium accumulation in salt-tolerant plants may be mediated by a tonoplast NaNH 1" antiporter that utilizes the proton-motive force generated by the vacuolar H + - ATPase (V-ATPase) and/or H + -translocating pyrophosphatase (V-Ppase; refs. Barkla, B.J., et al, Symp. Soc. Exp.
  • mutants that reduce the FT pumping activity of the plasma membrane H + -ATPase, Pmal, depolarize the plasma membrane potential and confer resistance to hygromycin (McCusker, J.H., et al, Mol Cell Biol, 7:4082-4088 (1987)).
  • mutants such as gefl or nhxl that affect the pH or membrane potential of the vacuolar and pre-vacuolar compartments may be expected to affect hygromycin compartmentation.
  • AtNHXl gene in salt homeostasis is provided by the observation that its expression is induced in salt-stressed plants (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999)).
  • Arabidopsis thaliana in particular, has been used as a host model plant to demonstrate that overexpression of these genes results in salt tolerance in the plant.
  • a recent report shows that the overexpression of AtNHXl gene in transgenic Arabidopsis thaliana promotes sustained growth in soil watered with 200 mM NaCl plus 1/8 M.S.
  • A. thaliana plants (ecotype Columbia) were grown aseptically on unsupplemented plant nutrient agar without sucrose (Haughn, G.W. and Somerville, C, Mol. Gen. Genet., 204:430-434 (1986)) for 15 days at 19°C and under continuous illumination. NaCl or KCl was added to a final concentration of 250 mM, and the plants were incubated for 6 h. Total RNA from tissue of salt-treated and untreated plants was isolated (Niyogi, K.K. and Fink, G.R., Plant Cell, 4:721-733 (1992)), Hybond-N (Amersham) membranes were hybridized with a P-Labeled DNA probe from plasmid pRG308.
  • Hybridization was performed at 65°C overnight. Washes were performed at 65°C with 0.2% standard saline citrate (SSC)/0.1% SDS (Ausebel, F., et al, Curr. Protocols in Mol. Biol. (Wiley, NY) (1988)). 75S probe was used as loading control (Unfried, I., et al, Nucleic Acids Res., 17:7513 (1989)). MACBAS 2.4 program was used to quantify the relative amount of RNA.
  • SSC standard saline citrate
  • 75S probe was used as loading control (Unfried, I., et al, Nucleic Acids Res., 17:7513 (1989)).
  • MACBAS 2.4 program was used to quantify the relative amount of RNA.
  • RNA tissue blot hybridized with AtNHXl Ten micrograms of total RNA from 15-day old plants exposed to 250 mM NaCl or KCl for 6 h and a control grown without salt was subjected to electrophoresis on a denaturing formaldehyde gel. The blot was hybridized with a probe internal to tNFLXl ORF. An 75S ribosomal probe was used as a loading control.
  • Transgenic plants that overexpress the AtNHXl were generated using Agrobacterium-mediated plant transformation.
  • the transgenic AtNHXl was expressed using a double tandem enhancer of the 35S promoter of CaMV (Topfer, R., et ⁇ l, Nucl Acid Res., 75:5890 (1987)).
  • Transgenic plants were found to be significantly less affected than wild type controls when watered with 300 mM NaCl.
  • a transgenic Arabidopsis thaliana plant was engineered to overexpress the AVPl wild-type gene using the double tandem enhancer of the 35 S promoter (Topfer, R., et al, Nucl Acid Res., 75:5890 (1987)).
  • AVPl encodes the pyrophosphate-energized vacuolar membrane proton pump from Arabidopsis (Zhen, R.G., et al, J. Biol Chem., 272:22340-22348 (1997)).
  • a VPl gene is present in a single copy in the genome of Arabidopsis (Kim, Y., et al, Plant Physiol, 106:315- 382 (1994)), however, a sequence homologous, but not identical, to AVPl on chromosome one has been tentatively designated as ORF F9K20.2 on BAC F9K20 by the Arabidopsis Genome Initiative (AGI).
  • AGI Arabidopsis Genome Initiative
  • Transgenic plants that overexpress AVPl were generated using Agrobacterium-mediated plant transformation.
  • the transgenic A VPl was expressed using a double tandem enhancer of the 35S promoter of CaMV (Topfer, R., et ⁇ l, Nucl. Acid Res., 75:5890 (1987)).
  • 15 wild-type plants and 15 35SAVP1 transgenics were grown on a 24 hours-day cycle for 16 days. During this period plants were watered every 4 days with a diluted nutrient solution (1/8 M.S. salts). 200 mM NaCl was added to the watering solution at day 17 and at day 27 plants were watered with nutrient solution containing 250 mM NaCl. Plants were photographed 10 days after the last NaCl treatment. Identical conditions and treatment as described in Example 6 were used.
  • 35SAVP1 plants Five different lines of 35SAVP1 plants showed an enhanced salt tolerance as compared to wild-type plants in the T2 stage. However, the most dramatic phenotype was apparent in the homozygous T3 plants. These transgenic plants are larger than wild- type plants. Furthermore, homozygous 35SAVP1 plants showed sustained growth in the presence of 250 mM NaCl plus 1/8 M.S. salts when grown in a 24 hours light regimen. When 35SAVP1 plants were grown under short-day cycle conditions (12 hour day/light cycle) sustained growth in the presence of 300 mM NaCl plus 1/8 M.S. salts was observed.
  • hydroponic culture has been reported to increase plant growth and provide stress-free root and shoot material (Gibeaut, D.M., et al, Plant Physiol, 317-319 (1997)). Another important advantage of hydroponic culture is that it allows one to alter the ionic composition in a more accurate manner than in soil. These advantages could be important for the physiological studies of salt stress.
  • wild type and 35SAVP1 transgenic plants were grown in solution culture on a 12 hours light cycle for 20 days. Starting at day 21, NaCl concentration was increased in a stepwise fashion by 50 mM increments every 4 days. Plants were photographed after 4 days in the presence of 200 mM NaCl.
  • transgenic plants were challenged with a commercial seawater formula that contains the complete ionic composition present in the oceans.
  • 35SAVP1, 35S AtNHXl single and double transgenics were grown together with wildtype Arabidopsis thaliana plants under hydroponic conditions for four weeks in a short day illumination cycle (Gibeaut, D.M., et al, Plant Physiol, 317-319 (1997)). Then every four days an equivalent to 50mM NaCl of Tropic Marin sea salt (worldwide web at thatpetplace.com) is added.
  • This artificial sea water mix includes all of the other major and trace elements present in real sea water. Growth was monitored and physiological parameters, such as sodium content and distribution was determined.
  • 35SAVP1, 35S AtNHXl single and double transgenics that were grown together with wildtype Arabidopsis thaliana plants under hydroponic conditions for four weeks in a short day illumination cycle (Gibeaut, D.M., et al, Plant Physiol, 317-319 (1997)) and then challenged every four days with an equivalent to 50mM NaCl of Tropic Marin sea salt were found to grow in the sea salt solution. Wildtype Arabidopsis thaliana plants did not.
  • the tomato homologues of AVPl and AtNHXl were isolated and the conesponding chimeras to overexpress them were constructed (Bidone, S., et al, Eur. J. Biochem., 253: 20-26 (1998); Burbidge, A., et al, J Exper. Botany, 45:2111-2112 (1997)).
  • the genes were introduced via Agrobacterium-mediated infection of calli. Tissue culture methods were used to regenerate transformed plants. The plants were assayed for salt tolerance as well as physiological parameters, such as sodium content and distribution.
  • Tomato transformation with 35S AVPl and with 35S AtNHXl constructs was performed as described by McCormick (McCormick, S., Transformation of tomato with Agrobacterium tumefaciens. In: Plant Tissue Culture Manual, pp. 1-9, Lindsey, K. (ed.), Kluwer Academic Publishers, Dordrecht, The Netherlands (1991)).
  • TO and Tl transgenics were analyzed by polymerase chain reaction and DNA gel blotting for the presence and copy number of AVPl and AtNHXl transgenes. Heterozygous and homozygous plants were identified after segregation analysis of each transcend within Tl seeds.
  • Homozygous plants were assayed for salt tolerance and as well as physiological parameters, such as sodium content and distribution.
  • Degenerated oligos based on conserved sequences present in AVPl and AtNHXl homologues were designed. These degenerated primers were used in RT-PCR reactions with cDNAs made from poly(A)+RNA from tomato. The resulting PCR fragments were used as probes to isolate the full length cDNA clones from commercial libraries (i.e. Stratagene Cat#936004).
  • a similar strategy was described by Caboche and coworkers (Quesada, A., et al, Plant Mol. Biol, 34:265-274 (1997)).
  • Fig. 7 is a graph of Na + and K + content of wild-type plants (WT) versus representative transgenic plants overexpressing AVP-1 (1 ' and 2') grown in salty soil.
  • Five wild-type plants (WT) and two AVP-1 overexpressing transgenic lines (1 ' and 2') were grown on soil in a 10 hour light/dark cycle. Plants were watered with a diluted nutrient solution (1/8 MS salts) for six weeks and subsequently watered with a diluted nutrient solution supplemented with NaCl. The concentration of NaCl began with 100 nM and was increased every four days by 100 mM. The photograph conesponds to plants at the tenth day in the presence of 300 mM NaCl.
  • Fig. 5 is a graph of the uptake of calcium into the 35SAVP-1 transgenic vacuolar membrane vesicles (squares) of 2' of Fig. 4 versus calcium uptake into vesicles obtained from wild type (WT) of Fig. 4. Wild-type plants (open circles) and transgenic plants from line 2' of Fig. 4 were grown hydroponically for nine weeks on a 10 hour light cycle. Vacuolar membrane vesicles were added to buffer containing 250 mM sorbitol, 25 mM BTP-Hepes pH 8.0, 50 mM KCl, 1.5 nM MgSO 4 and 10 ⁇ M Ca 4 ⁇ .
  • a model consistent with the enhanced drought and freeze tolerance of the transgenic plants overexpressing the A VP-1 gene is depicted in Figs. 9 A and 9B.
  • the model depicts how an increase in the number of AVP-1 pumps in the vacuole of transgenic plants can provide more H 4" that will permit the secondary transporters to import greater amounts of cations into the lumen of the vacuoles. Higher amounts of cations confer a greater osmotic pressure that leads to a greater water retention capability endowing plants to withstand low soil water potentials.
  • T3 35SAVP1 plants are used as females and T3 35S AtNHXl plants are used as males.
  • Female plants are hand-emasculated and anthers from freshly opened flowers of donor plants are harvested. With these anthers the emasculated plants are pollinated by touching the anthers onto the stigmas. The pollinated flowers are labeled and any remaining opened or unopened flowers from the same female plant are removed to avoid any confusion at harvest.
  • the harvested seeds are sterilized using a 50% sodium hypochloride solution and mixed vigorously for 5 minutes and rinsed with water thoroughly. The sterilized seeds are stored in soft agar over night at 4°C.
  • the 35SAVP1 construct has the neomycin phosphotransferase II gene that confers kanamycin tolerance in plants while the 35S AtNHXl construct has a modified hygromycin B phosphotransferase that confers hygromycin tolerance in plants.
  • the resistant seedlings are transplanted into soil and to the hydroponic media to be tested for their salt-tolerant phenotype.
  • a transgenic Arabidopsis thaliana plant to overexpress the A. thaliana gain-of-function mutant gene AVP1-D (Zhen, et al, J. Biol Chem., 272:22340-22348 (1997)) is engineered using the same double tandem enhancer of the 35 A promoter described above (Topfer, R., et al, Nucl. Acid Res., 75:5890 (1997)). Plants overexpressing the gain of function mutant gene will likely show an enhanced phenotype. These plants are characterized in parallel with the 35SAVP1, 35S AtNHX singles and doubles trangenics. The A.
  • thaliana gain-of-function mutant gene AVPl -D is subcloned into plasmid pRT103 carrying the 35S promoter and the polyadenylation signal of CaMV (Topfer, R., et al, Nucl. Acid Res., 75:5890 (1997)).
  • a Hindlll fragment containing the chimeric 35SAVP-D gene is subcloned into pBIBhyg (Becker, D., Nucl. Acid Res., 75:203 (1990)).
  • the resulting T-DNA vector is transformed into Agrobacterium tumefaciens strain GV3101 via electroporation, and used for subsequent vacuum infiltration of Arabidopsis thaliana ecotype Columbia (Bechtold, N., et al, C.R. Jeances Acad. Sci. Ser. III Sci. Vie, 376:1194-1199 (1993)). Integration is confirmed on Southern blots of T3 plants and expression monitored on Northern blots of positive T3 plants.
  • Example 11 Comparative Transport Study With Vacuoles From The Roots Of Wild-
  • FT* translocation is assayed fluorimetrically using acridine orange (2.5 ⁇ M) as transmembrane pH difference indicator in assay media containing vacuole membrane-enriched vesicles as described by Rea and coworkers (Zhen, R.G., et al, J. Biol Chem., 272:22340-22348 (1997)).
  • the assay media contains 300 ⁇ M Tris-PPi, 50mK KCl, 2.5 ⁇ M acridine orange, 5mM Tris- Mes (pH 8.0).
  • Intravesicular acidification is triggered with the addition of 1.3 mM MgSO4 and terminated with the addition of the protonophore FCCP at 2.5 ⁇ M.
  • Fluorescence is measured at excitation emission wavelengths of 495 and 540 nM, respectively, at a slit width of 5 nM (Zhen, R.G., et al, J. Biol Chem., 269:23342-23350 (1994)).
  • a further test to support that the H 4" translocation is A VPl driven is the addition of the specific inhibitor aminomethylenediphosphonate (Zhen, R.G., et al, Plant Physiol, 704:153-159 (1994)).
  • Example 12 Determination Of The Na + /K + Ratios In Leaves And Stems Of The Transgenic Plants
  • Toxic concentrations of NaCl build up first in the fully expanded leaves where NaCl is compartmentalized in the vacuoles. Exposure to NaCl can disrupt or reduce K + uptake leading to K + deficiency and growth inhibition (Wu, S.J., et al, Plant Cell, 5:617-627 (1996). A cytosolic consequence of reduced K + content and high Na + is the inhibition of important enzymes.
  • An example of such enzymes is the 3'(2'), 5'- bisphosphate nucleotidase of yeast whose activity is more sensitive to Na + when K + content is low (Murguia, JR., et al, Science, 267:232-234 (1995).
  • Measurements may be taken to demonstrate that the transgenic plants described herein have an increased vacuolar capacity to sequester Na + in their leaves cells or elsewhere.
  • To determine the Na + /K + ratios in leaves and stem S wild-type and 35S AVPl /35S AtNHXl double and single transgenics in hydroponic conditions (Gibeaut, D.M., et ⁇ /., Plant Physiol, 317-319 (1997) are grown. NaCl is added to the growth media in a stepwise fashion starting with 50 mM up to 250mM (Apse, M., et al, Science, 255:1256-1258 (199). At every point the rosette and the stems of the treated plants are collected and their weight is determined.
  • the samples are dried out in an oven at 80°C and their dry weight is determined.
  • the dry samples are boiled in a determined volume of water and their Na + and K + contents determined via atomic absorption spectrophotometry (Apse, M., et al, Science, 255:1256-1258 (1999); Gaxiola, R., et al, Embo J, 77:3157- 2164 (1992)).
  • the shoot meristems labeling index is compared with one of the wild-type plants. Morphological and anatomical observations measuring and counting cells of leaves, roots and stems are performed. To determine if 35S AVPl transgenic plants are larger because they have more cells, their shoot meristems labeling index is compared with the one of wild-type plants.
  • 5-Bromo-2'-deoxy- uridine (BrdU) that can be incorporated into DNA in place of thymidine may be used.
  • Cells that have incorporated BrdU into DNA are detected using a monoclonal antibody against BrdU monoclonal antibody and an anti-mouse Ig-alkaline phosphatase as a second antibody.
  • the bound anti-BrdU monoclonal antibody is visualized by light microscopy and the ratio between DAPI stained and BrdU positives established.
  • the protocol is a modification of the one published by Chiatante and coworkers (Levi, M., et al, Physiol Plant.
  • the Arabidopsis Knock-out Facility of the University of Wisconsin Madison (world wide web at biotech.wisc.edu/NewServicesAndResearch /Arabidopsis) is used to search among the 60,480 Arabidopsis (ecotype WS) lines that have been transformed with the T-DNA vector pD991 for the presence of T-DNA inserts within AtCLC-c, AtC C-d, AVPl, AtNHXl and their homologues.
  • the phenotypes of the above knock-outs will shed light towards the understanding of the physiological roles of these transporters in normal and stress conditions.
  • An initial characterization of the knockout plants includes testing for their salt tolerance and their Na + /K + ratios.
  • a pre-vacuolar compartment is a dynamic entity that detoxifies the cytoplasm from toxic cations and delivers its cargo either to the vacuole, or directly to the cell exterior.
  • Both the gefl chloride channel and Nhxl ⁇ a + /H + exchanger have been localized to the yeast pre-vacuolar compartment (Gaxiola, R.A., et al, Proc. Natl Acad. Sci. USA, 96:1480-1485 (1999)).
  • the behavior of the gefl-GFP chimera in yeast cells in vivo have been monitored indicating that its localization varies depending the environmental conditions. Furthermore, it has been shown that two of the four A.
  • thaliana CLC chloride channel genes CLC-c and -d are capable of suppressing gefl mutant phenotypes implying a similar localization (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998)).
  • GFP-chimeras For the constructions of the GFP-chimeras the soluble versions GFP with improved fluorescence in A. thaliana reported by Davis and Viestra (Davies, S.J., Viestra, R.D., "Soluble derivatives of green fluorescent protein (GFP) for use in Arabidopsis thaliana, http:/ / brindabella.mrc-lmb.cam.ac.uk/IndexGFP.html (1998)) are used. Two types of GFP-chimeras are made, namely a set under the regulation of the native promoter and another set under the regulation of the 35S promoter.
  • GFP green fluorescent protein
  • the resulting T-DNA vectors containing the GFP-chimeras are transformed into Agrobacterium tumefaciens strain GV3101 via electroporation, and used for subsequent vacuum infiltration of Arabidopsis thaliana ecotype Columbia (Bechtold, N., et al, C.R. Jeances Acad. Sci. Ser. Ill Sci. Vie, 316: 1194-1199 (1993)).
  • HA hemagglutinin
  • Futcher and coworkers designed vectors containing the URA3 yeast gene flanked by direct repeats of epitope tags (HA) (Schneider, B.L., et al, Yeast, 77:1265-1274 (1995)).
  • HA epitope tags
  • the tag-URA3-tag cassette is amplified such that the resulting PCR fragment possess homology at each end to the gene of interest.
  • In vivo recombination in yeast is then used to direct the integration of the PCR-chimera to the plasmid carrying the plant ORF of interest, transformants are selected by the URA + phenotype.
  • the URA3 gene is "popped out" when positive transformants are grown in the presence of 5-fluoro-orotic acid.
  • the vector carrying the plant gene has a selection marker different than the URA3 gene.
  • vacuolar V-PPases in economically important crops could provide an important avenue for crop improvement.
  • Drought and freeze tolerant cultivars could provide new agricultural approaches in areas lost due to drought or minimal rainfall, as well as to provide farmers with protection from unanticipated frosts (freezing rain etc.). Such crops may also be able to be raised on soils considered too saline for wild type crops.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

A stress resistant, oversized, transgenic plant capable of growing in salinized media comprising a polynucleotide sequence causing upregulated express of vacuolar pyrophosphatase. Further disclosed, is the seed produced by such transgenic plants which comprises such polynucleotide sequence, and progeny plants grown from such seed.

Description

STRESS-RESISTANT OVERSIZED TRANSGENIC PLANTS CAPABLE OF GROWING IN SALINIZED SOIL
RELATED APPLICATION(S
This application claims the benefit of U.S. Provisional Application No. 60/164,808, entitled "Proton Transporters and Uses in Plants" by Roberto Gaxiola, filed November 10, 1999, U.S. Patent Application No. 09/644,039 entitled "Proton Transporters and Uses in Plants" by Roberto Gaxiola, filed August 22, 2000, and U.S. Provisional Application No. 60/226223, entitled "Drought/Freeze Resistant Transgenic Plants" by Roberto Gaxiola, filed August 18, 2000, the entire teachings of all of which are incorporated herein by reference.
GOVERNMENT SUPPORT
The invention described herein was supported, in whole or in part, by grants GM52414, DK54214, DK43495, DK51509, DK34854 and GM35010 from the National Institutes of Health and by grant MCB9317175 from the National Science Foundation. The Government has certain rights in the invention.
BACKGROUND OF THE INVENTION
1. Field of the Invention
The present invention relates to genetically-altered plants that are hardy with respect to environmental stresses, such as drought and/or freezing, oversized with respect to vegetative and/or sexual structure (as compared to their normal phenotypic counterparts), and capable of growing in media of high salinity. 2. Background of the Related Art
The prospects for feeding humanity as we enter the new millennium are formidable. Given the every increasing world population, it remains a major goal of agricultural research to improve crop yield. It also is a major goal of horticultural research to develop non-crop plants which are hardier, such as ornamental plants, grasses, shrubs, and other plants found useful or pleasing to man.
Until recently crop and horticultural improvements depended on selective breeding of plants having desirable characteristics. Such selective breeding techniques, however, were often less than desirable as many plants have within them heterogenous genetic complements that do not result in identical desirable traits of their parents.
Advances in molecular biology have allowed mankind to manipulate the germplasm of animals and plants. Genetic engineering of plants entails the isolation and manipulation of genetic material (typically in the form of DNA or RNA) and the subsequent introduction of that genetic material into a plant. Such technology has led to the development of plants with increased pest resistance, plants that are capable of expressing pharmaceuticals and other chemicals, and plants that express beneficial traits. Advantageously such plants not only contain a gene of interest, but remain fertile.
One particular area of interest of late in plant sciences has been the development of plants with improved stress resistance. In general, plants possess and maintain adaptive mechanisms to ensure survival during periods of adverse environmental conditions. Two commons stresses that plants commonly encounter are freezing and drought, both of which are associated with cellular dehydration. It is known that certain plants contain genes turned on by exposure to cold or prolonged periods of dehydration that encode for products that are directly or indirectly responsible for providing greater resistance to drought and/or freeze than many of their counterparts. A number of genes responsive to heat and water stress have now been characterized (See, e.g., U.S. Pat. Nos. 5,837,545, 5,071,962, 4,707,359). These genes are believed by many to produce certain proteins, such as "Water Stress Proteins", that are postulated to aid the plants survival. For example, certain plants exposed to stress conditions produce a hormone called abcisic acid (ABA) which helps plants close their stromata, thereby reducing the severity of the stress. Unfortunately, ABA is known to inhibit the formation of new leaves, to cause flowers and fruit to drop off, and to lead to a reduction in yield.
Most tropical plants are not believed to have evolved the ability to tolerate prolonged drought and/or freezing. Conversely, many temperate plants are known to have developed at least some ability to tolerate such conditions. The productivity of plant varieties in dry conditions, and after freeze, differ dramatically. For example, tobacco (Nicotiana spp.) produces fresh leaves that are highly sensitive to drought, and cannot be produced commercially in areas with a limited water supply and high degree of evaporation. In contrast to water stress, very little is known about proteins and genes which participate in freezing tolerance. However, it has been hypothesized that a major component of freeze tolerance may involve tolerance to dehydration (See, e.g., Yelenosky, G.C., Guy, L. (1989) Plant Physiol. 89: 444-451).
Another particular area of interest of late has been the development of plants with improved abilities to grow in salinized soil. Salinization of soil occurs when water supplies contain dissolved salt. Upon evaporation of water from such supplies, salts gradually accumulate in the soil. The progressive salinization of irrigated land compromises the future of agriculture in many of the most productive areas of our planet (Senano, R., et al, Crit. Rev. Plant Sci., 73:121-138 (1994)). For example, arid regions offer optimal photoperiod and temperature conditions for the growth of most crops, but suboptimal rainfall. Artificial irrigation has solved the problem only in the short term as it has been found that soils in such environments frequently are rapidly salinized. To grow in salinized environments, plants must maintain a much lower ratio of Na+/K+ in their cytoplasm than that present in the soil, preventing the growth of a number of plants, including food crops.
Physiological studies suggest that salt exclusion in the root, and/or salt sequestration in the leaf cell vacuoles, are critical determinants for salt tolerance (Kirsch, M., et al, Plant Mol. Biol, 32:543-547 (1996)). Toxic concentrations of sodium chloride (NaCl) build up first in the fully expanded leaves where NaCl is compartmentalized in the vacuoles. Only after their loading capacity is surpassed, do the cytosolic and apoplasmic concentrations reach toxic levels, ultimately leading to loss of turgor, ergo plant death. It has been suggested that hyperacidification of the vacuolar lumen via the V-ATPase provides extra protons required for a Na+/H+ exchange-activity leading to the detoxification of the cytosol (Tsiantis, M.S., et al, Plant J., 9:129-136 (1996)). Salt stress is known to increase both ATP- and pyrophosphate (PPi)-dependent H+ transport in tonoplast vesicles of, for example, sunflower seedling roots. Salt treatments also induce an amiloride-sensitive Na+/H+ exchange activity (Ballesteros, E., et al, Physiologia Plantarum, 99:328-334 (1997)). In the halophyte Mesembryanthemum crystallinum, high NaCl stimulates the activities of both the vacuolar H+- ATPase (N-ATPase) and a vacuolar ΝaNH1" antiporter in leaf cells.
Yet another area of agricultural interest is to improve the yield of crop plants and to improve the aesthetic qualities of certain decorative plants. The yield of a plant crop, and the aesthetics of certain decorative plants, may be improved by growing plants that are larger than the wild-type plant in vegetative and/or reproductive structure. It is known in the art that certain growth factors may be used to increase plant and/or plant flower size. Unfortunately, application of such growth factors is costly and time consuming.
A need, therefore, exists for plants having improved stress resistance to drought and/or freeze, possessing larger size attributes than wild-type counterpart varieties, and having increased tolerance to salt in the soil in which they are growing.
SUMMARY OF THE INVENTION
The present invention discloses a transgenic plant having upregulated expression of vacuolar pyrophosphatase. It has been found that plants displaying such upregulated activity are generally larger than wild-type counterparts, demonstrate improved stress resistance to drought and/or freeze, and have increased tolerance to salt in the media in which they are growing.
Any suitable exogenous nucleic acid molecule which alters expression of vacuolar pyrophosphatase in the plant can be used to transform the transgenic plants in accord with the present invention. The exogenous nucleic acid can comprise nucleic acid that encodes a vacuolar pyrophosphatase protein (an exogenous vacuolar pyrophosphatase), such as AVPi, a functional portion thereof (peptide, polypeptide), or a homologue thereof, and/or nucleic acid that alters expression of the endogenous vacuolar pyrophosphatase of the plant into which the exogenous nucleic acid is introduced. By "exogenous nucleic acid" it is meant a nucleic acid from a source other than the plant cell into which it is introduced, or into a plant or plant part from which the transgenic part was produced. The exogenous nucleic acid used for transformation can be RNA or DNA, (e.g., cDNA, genomic DNA). In addition, the exogenous nucleic acid can be circular or linear, double-stranded or single-stranded molecules. Single-stranded nucleic acid can be the sense strand or the anti-sense strand. By a "functional portion" of a nucleic acid that encodes a vacuolar pyrophosphatase protein it is meant a portion of the nucleic acid that encodes a protein or polypeptide which retains a functional characteristic of a vacuolar pyrophosphatase protein. In a particular embodiment, the nucleic acid encodes AVP1, a functional portion or a homologue thereof.
Nucleic acid that alters expression of the endogenous vacuolar pyrophosphatase of the plant into which the exogenous nucleic acid is introduced includes regulatory sequences (e.g., inducible, constitutive) which function in plants and antisense nucleic acid. Examples of regulatory sequences include promoters, enhancers and/or suppressors of vacuolar pyrophosphatase. The nucleic acid can also include, for example, polyadenylation site, reporter gene and/or intron sequences and the like whose presence may not be necessary for function or expression of the nucleic acid but can provide improved expression and/or function of the nucleic acid by affecting, for example, transcription and or stability (e.g., of mRNA). Such elements can be included in the nucleic acid molecule to obtain optimal performance of the nucleic acid.
The nucleic acid for use in the present invention can be obtained from a variety of sources using known methods. For example, the nucleic acid encoding a vacuolar pyrophosphatase (e.g., AVP1) for use in the present invention can be derived from a natural source, such as tobacco, bacteria, tomato or corn. In one embodiment, the nucleic acid encodes a vacuolar pyrophosphatase that coπesponds to a wild type of the transgenic plant. In another embodiment, the nucleic acid encodes a vacuolar pyrophosphatase that does not conespond to a wild type of the transgenic plant. Nucleic acid that alters expression of the endogenous vacuolar pyrophosphatase of the plant into which the exogenous nucleic acid is introduced (e.g., regulatory sequence) can also be chemically synthesized, recombinantly produced and/or obtained from commercial sources. A variety of methods for introducing the nucleic acid of the present invention into plants are known to those of skill in the art. For example, Agrobacterium- mediated plant transformation, particle bombardment, microparticle bombardment (e.g., U.S. Patent No. 4,945,050; U.S. Patent No. 5,100,792) protoplast transformation, gene transfer into pollen, injection into reproductive organs and injection into immature embryos can be used. The exogenous nucleic acid can be introduced into any suitable cell(s) of the plant, such a root cell(s), stem cell(s) and or leaf cell(s) of the plant.
Any suitable plant can be used to produce the transgenic plants of the present invention. For example, tomato, corn, tobacco, rice, sorghum, cucumber, lettuce, turf grass, ornamental (e.g., larger flowers, larger leaves) and legume plants can be transformed as described herein to produce the transgenic plants of the present invention. In addition, the transgenic plants of the present invention can be grown in any medium which supports plant growth such as soil or water (hydroponically).
A transgenic plant of the present invention is preferably tolerant to high salt concentrations in soil. By the term "salt" it is meant to include any salt, that is a compound formed when hydrogen of an acid is replaced by a metal or its equivalent, and includes, without limitation, salts comprising monovalent and divalent toxic cations, NaCl, KC1, CaCl2, MgCl, CdCl, ZnCl, and sulfide salts.
Salt tolerance may be introduced into a plant of the present invention by transforming plant cells with exogenous nucleic acid which alters the expression of vacuolar pyrophosphatase in the plant such that expression is upregulated. Any suitable vacuolar pyrophosphatase, several of which have been cloned, can be used in the compositions and methods of the present invention (e.g., Sarasian, Z., et al, Proc. Natl. Acad. Sci., USA, 89:1115-1119 (1992); Jenslerchl, et al, Molec. Biol, 29: 833-840 (1995); Kim, Y., et al, Plant Physiol, 106:315-382 (1994)). In a particular embodiment, the present invention relates to a transgenic plant which is tolerant to salt comprising an exogenous nucleic acid construct which is designed to overexpress AVPl (Sarasian, Z., et al, Proc. Natl. Acad. Sci., USA, 89:1115-1119 (1992)). Transformation of the plant cells may be carried out in a whole plant, seeds, leaves, roots or any other plant part. Such transgenic plants are preferably altered such that they grow in a concentration of salt that inhibits growth of a conesponding non-transgenic plant. Transgenic progeny of the transgenic plants, seeds produced by the transgenic plant and progeny transgenic plants grown from the transgenic seed, which are also the subject of the present invention, advantageously carry such salt tolerant trait. Plants may be regenerated from transformed cells to yield transgenic plants, which may be screened for certain levels of salt tolerance. In a prefened embodiment, the exogenous nucleic acid encodes AVPl, or a homologue thereof. Preferably expression of the vacuolar pyrophosphatase in the plant is enhanced to an extent that the transgenic plant is tolerant to sodium chloride (NaCl) when the NaCl concentration is from about 0.2M to about 0.3M. A transgenic plant capable of growing in salt water may also be produced by introducing into one or more cells of a plant nucleic acid which upregulates expression of vacuolar pyrophosphatase in the plant to yield transformed cells. As used herein, "salt water" includes water characterized by the presence of salt, and preferably wherein the concentration of salt in the water is from about 0.2M to about 0.4M. In one embodiment, salt water refers to sea water.
The transgenic plants of the present invention can also be used to produce double transgenic plants which are tolerant to salt (about 0.2M to about 0.4M salt concentration). In one embodiment, the present invention relates to a double transgenic plant which is tolerant to salt comprising one or more plant cells transformed with exogenous nucleic acid which alters expression of a vacuolar pyrophosphatase and an Na+/H+ antiporter in the plant. The vacuolar pyrophosphatase in an advantageous construct is AVPl, or a homologue thereof, and the NaVH+ antiporter is AtNHXl, or a homologue thereof. The present invention also encompasses transgenic progeny of the double transgenic plant, as well as seeds produced by the transgenic plant and a progeny transgenic plant grown from the seed.
Drought and/or freeze tolerance may also be introduced into plants by transforming plant cells with exogenous nucleic acid which alters the expression of vacuolar pyrophosphatase in the plant such that such expression is upregulated. In a prefened embodiment there is provided a substantially drought and/or freeze resistant transgenic plant which comprises a genome having one or more exogenously introduced vacuolar H+-translocating pump genes. A particularly prefened fertile transgenic plant eliciting drought and/or freeze tolerance, as well as the ability to grow in saline soils, comprises an isolated exogenous chimeric DNA construct encoding vacuolar Yf- translocating pump, preferably operably linked to a promoter, such as the 35-S promoter or any other strong promoter, including, without limitation, tissue specific promoters. The transgenic plant may contain a polynucleotide sequence comprising an exogenous tonoplast pyrophosphate FT pump gene operably linked to a promoter. In yet another particularly prefened drought and/or freeze resistant transgenic plant having the capacity to grow in saline soils, the polynucleotide sequence comprises an exogenous tonoplast pyrophosphate FT1" pump gene operably linked to a double tandem enhancer of the 35S promoter. A particularly prefened tonoplast pyrophosphate IT1" pump gene is the AVPl gene.
Upregulation of expression of vacuolar pyrophosphatase by the methods described above may also be used to provide a plant having larger vegetative and/or sexual organs than wild type counterpart plants. That is, the present invention provides for a method of increasing the yield of a plant comprising introducing into one or more cells of a plant nucleic acid which alters expression of vacuolar pyrophosphatase in the plant to yield transformed cells, thereby increasing the yield of the plant. The method can further comprise regenerating plants from the transformed cells to yield transgenic plants and selecting a transgenic plant which is larger than its conesponding wild type plant, thereby producing a transgenic plant which is larger than its conesponding wild type plant. Also encompassed by the present invention is a method of making a transgenic plant (e.g., an ornamental plant) having increased flower size compared to its conesponding wild type plant comprising introducing into one or more cells of a plant nucleic acid which alters expression of vacuolar pyrophosphatase in the plant to yield transformed cells.
There is also disclosed in the present invention novel gene cassettes including cassettes comprising a tonoplast pyrophosphate driven T pump gene operably linked to a chimeric promoter, a novel gene cassette comprising a exogenous tonoplast pyrophosphate driven H* pump gene operably linked to a promoter, as well as novel coding sequences comprising an exogenous tonoplast pyrophosphate driven H+ pump gene operably linked to a double tandem enhancer of the 35S promoter. Preferably such coding sequence is designed to overexpress AVPl.
There is also disclosed in the present invention novel expression vectors including an expression vector containing a polynucleotide sequence comprising a exogenous tonoplast pyrophosphate driven H+ pump gene operably linked to a double tandem enhancer of the 35S promoter and further operative ly linked to a multiple cloning site, and an expression vector containing a polynucleotide sequence comprising a exogenous tonoplast pyrophosphate driven H+ pump gene operably linked to a double tandem enhancer of the 35S promoter and further operatively linked to a heterologous coding sequence.
It is recognized by the present inventor, that the disclosed invention may have application to any plant, including, without limitation, crop plants, ornamental plants, grasses, shrubs, or any other plant found useful or pleasing to man.
BRIEF DESCRIPTION OF THE DRAWINGS
The above description, as well as further objects, features and advantages of the present invention will be more fully understood with reference to the following detailed description when taken in conjunction with the accompanying drawings, wherein:
Fig. 1A is an overhead view of representative (out of 10 plants each) wild type (WT) and two independent transgenic lines (1 ' and 2') grown hydroponically for seven weeks on a 10 hour light/dark cycle;
Figs. 1B(1), 1B(2) and 1B(3) are a photomicrographs of the root and root hairs of representative five day old seedlings obtained from representative WT, 1' and 2' of Fig. 1A grown parallel to the surface on vertical plant nutrient agar plates;
Fig. 1 C is an immunoblot of membrane fractions isolated from wild type (WT) and two independent transgenic lines (1' and 2') overexpressing AVP-1;
Fig. 2 is an overhead view of a representative wild type plant (WT) versus representative transgenic plants overexpressing AVP-1 (1 ' and 2') after exposure to 7 days of water deficit stress.
Fig. 3 is a perspective view of wild-type plants (WT) versus representative transgenic plants overexpressing AVP-1 (1' and 2') grown in salty soil.
Fig. 4 A is a schematic representation of a working model of the transporters involved in sodium sequestration at the yeast pre-vacuolar compartment; Nhxl (Na+/FT antiporter), Vmal (vacuolar membrane tT-ATPAse), Gefl (yeast CLC chloride channel), Enal (plasma membrane Na+-ATPase).
Fig. 4B is a schematic representation of a working model of the transporters involved in sodium sequestration at the yeast pre-vacuolar compartment shown in Fig. 4A, which also includes Avpl (A. thaliana vacuolar pyrophosphate- energized proton pump). Fig. 5 A and Fig. 5B are bar graphs showing the intracellular Na+ and K+ contents of wild-type yeast strains and of yeast strains carrying various mutations affecting sodium tolerance wherein the values are the mean of two determinations, and the bars represent the standard deviations.
Figs. 6 A, 6B, 6C, when joined by matchlines A-A and B-B, is an alignment of the deduced amino acid sequences of NhXl homologue from Arabidopsis AtNHXl (SEQ ID NO: 1), human HsNHE-6 (SEQ ID NO: 2) and yeast ScNHXl (SEQ ID NO:3); identical residues are in black boxes, and dashes indicate gaps in the sequence, * above alignment denote putative amiloride binding site from human NHE1 (163DVF- FLFLLPPI173) (SEQ ID NO: 4).
Fig. 7 is a bar graph of Na+ and K+ content of wild-type plants (WT) versus representative transgenic plants overexpressing AVP-1 (1' and 2') grown in salty soil.
Fig. 8 is a graph of the uptake of calcium into the 35SAVP-1 transgenic vacuolar membrane vesicles (squares) of 2' of Fig. 3 versus calcium uptake into vesicles obtained from wild type (WT) of Fig. 3.
Figs. 9 A and 9B are illustrations demonstrating the theorized mechanism for a higher accumulation of solids into vacuoles via a proton driven function versus that of WT vacuoles.
DETAILED DESCRIPTION OF THE INVENTION
Since plant vacuoles constitute 40 to 99% of the total intracellular volume of a mature plant cell, changes in the size of the vacuole have dramatic effects upon cell size (R. G. Zhen, E. J. Kim, P. A. Rea, in The Plant Vacuole . (Academic Press Limited, 1997), vol. 25, pp. 298-337). The volume of the vacuole is controlled by ion and water fluxes mediated by pumps and transporters. In plants the driving force that triggers the movement of ions, solutes and water across membranes is a proton gradient. The activity of the vacuolar FT-pumps results in luminal acidification and the establishment of a T electrochemical potential gradient across the vacuolar membrane, which powers the secondary active transporters of inorganic ions, sugars, and organic acids. The activity of these transporters modulates cellular pH and ion homeostasis and leads to the accumulation of solutes required to generate the osmotic potential that promotes vacuolar expansion (H. Sze, X. Li, M. G. Palmgren, The Plant Cell 11, 677-689 (1999)). There are three distinct pumps that generate proton electrochemical gradients. One at the plasma membrane that extrudes IF1" from the cell (PM H+- ATPase) and two at the vacuolar membrane or other endomembrane compartments that acidify their lumen (the vacuolar type FT-ATPase and FT-PPase) (R. A. Leigh, in The Plant Vacuole L. a. Sanders, Ed. (Academic Press, San Diego, California, 1997), vol. 25, pp. 171-194.).
Previous work has shown that a decrease in the levels of the A subunit of the vacuolar FT- ATPase of canot, using an antisense construct, resulted in a plant with reduced cell expansion and altered leaf morphology (J. P. Gogarten, et al., 77ιe Plant Cell 4, 851-864 (1992)). The present inventor has hypothesized that an increased supply of FT into the vacuole could cause cell expansion. Recently, based on the theory that as the availability of protons in the vacuolar function of ion accumulation, it has been hypothesized by the same inventor that accumulation of solids in the vacuoles might be useful to protect against draught and to provide for a more freeze resistant plants.
The present inventor has recognized that plants have a number of vacuolar FT-translocating pumps, and that by upregulating their activity, increasing their expression, upregulating their transcription and/or translation, or increasing their copy number that one can increase accumulation of solids in the vacuole due to an increase in the availability of protons in the vacuoles. The inventor tested this hypothesis by increasing the copy number of the vacuolar H+-translocating pump, the inorganic pyrophosphatase or V-PPase that consists of a single polypeptide (R. G. Zhen, E. J. Kim, P. A. Rea, in The Plant Vacuole . (Academic Press Limited, 1997), vol. 25, pp. 298-337). In Arabidopsis the V-PPase encoded by the AVP-1 gene is capable of generating a FT*" gradient across the vacuole membrane (tonoplast) similar in magnitude to that of the vacuolar FT-ATPase (V. Sarafian, Y. Kim, R. J. Poole, P. A. Rea, Proc. Natl Acad. Sci. 89, 1775-1779 (1992)). As would be understood by one of ordinary skill in the art, similar genes in other plants should function in a similar manner.
In one embodiment, a construct comprising a vacuolar pyrophosphatase gene operably linked to a promoter designed to overexpress the vacuolar pyrophosphatase (e.g., an expression cassette) is used to produce the transgenic plants of the present invention. As used herein the term "overexpression" refers to greater expression/activity than occurs in the absence of the construct. In a particular embodiment, a construct comprising an AVPl gene operably linked to a chimeric promoter designed to overexpress AVPl is used to produce the transgenic plants of the present invention. More particularly, the present invention relates to a construct wherein the AVPl gene is operably linked to a double tandem enhancer of a 35S promoter.
The transgenic plants of the present invention may find utility other than those associated with the food value or ornamental value. For example, the transgenic plants of the present invention may uptake different or more ions than their wild-type counterparts. As discussed below, studies with mutant yeast strains (enal) demonstrates that FT-translocating pumps at the vacuole plays an important role in cation detoxification in higher plants (the plant components involved in an intracellular cation detoxification system being identified by complementing salt-sensitive mutants of the budding yeast Saccharomyces cerevisiae). Transgenic plants and/or progeny thereof comprising exogenous nucleic acid which alters expression of vacuolar pyrophosphatase in the plant in accord with such studies may be used to bioremediate soil and growth medium. Such plants can be used to remove cations (e.g., monovalent and/or divalent cations) from a medium which can support plant growth (e.g., soil, water). For example, transformed plants of the present invention can be used to remove sodium (Na), lead (Pb), manganese (Mn) and/or calcium (Ca) ions from a medium which supports plant growth.
To demonstrate the effect that an increased supply of IF1" into the vacuole would have on resistance to drought and or freeze, and tolerance to salt growth, as well as size of the plants, the present inventor generated transgenic plants containing extra copies of a vacuolar proton pump, A VP-1.
Arabidopsis thaliana plants were transformed with constructs containing he AVP-1 gene. Transgenic lines containing extra copies of this gene were then isolated. The A VP-1, open reading frame was cloned into the Xmal site of a modified pRT103 [R. Topfer, V. Matzeit, B. Gronenborn, J. Schell and H-H. Steinbiss, Nucleic acid Research 15, 5890 (1987)]. This vector contains a tandem repeat of the 35-S promoter. A Hindlll fragment containing the 35-S tandem promoter, AVP-1 ORF and the polyadenylation signal was subcloned into the Hindlll site of the pPZP212 vector [ P. Hajdukiewicz, Z. Svab and P. Maliga, Plant Molecular Biology 25, 989-994 (1994)]. Agrobacterium- mediated transformation was performed via vacuum infiltration of flowering Arabidopsis thaliana (ecotype Columbia). Transgenic plants were selected by plating seeds of the transformed plants on plant nutrient agar plates supplemented with 25 mg/liter kanamycin. Plants were subsequently selected for two generations to identify transgenic plant homozygous for the transgene.
Fig. 1A is an overhead picture of representative (out of 10 plants each) wild type (WT) and two independent transgenic lines (1 ' and 2') grown hydroponically for seven weeks on a 10 hour light/dark cycle. As can be seen in Fig. 1 A, a visual comparison of transgenic line 2', which expresses the AVP-1 protein at highest level, transgenic line 1 ', and wild type (WT), demonstrates that the amount of AVP-1 conelates with the size of the plants. The mass of the transgenic plants was found to be greater than that of wild type. The dry weight of the entire transgenic plants, measured after 24 hours at 75°C (n = 4), for transgenic lines 1' and 2' was found to be 1.5 and 3 times greater then that of wild-type (WT).
Fig. 1B(1), Fig. 1B(2) and Fig. 1B(3) are photomicrographs (magnification: times 40; bar length on photograph = 2mm) of the root and root hairs of representative five day old seedlings obtained from representative WT, 1 'transgenic and 2' transgenic of Fig. 1A grown parallel to the surface on vertical plant nutrient agar plates. Seedlings of both transgenic lines 1' and 2' showed root hairs with an average length 40 and 70% larger than wild-type (WT) root hairs (Fig. IB) (Root hair length along the whole root was determined from five members of each set of seedlings. An average of 80 root hairs per plant were measured). The length of the root hairs is conelated with the size of the vacuole, so the increased size of the root hair is likely to result from increased vacuolar volume. This compares with the Arabidopsis mutant rdh3 which has been reported to have reduced vacuolar volume and is a short plant with abnormally short root hairs (M. E. Galway, J. W. J. Heckman, J. W. Schiefelbein, Planta 201, 209-218 (1997)). It is recognized that the increased root structure will have a positive impact on soil erosion, nitrogen fixation in legumes, and will aid in water uptake by the plant.
Fig. 1 C is an imrnunoblot of membrane fractions isolated from wild type (WT) and two independent transgenic lines (1' and 2') overexpressing AVP-1. Total membrane fractions were isolated from shoots of eight week old wild type (WT) and AVP-1 transgenic plants (V and 2') grown in a hydroponic media for 6 weeks. Shoots of plants homogenates were sequentially centrifuged for 15 and 30 min at 8 and 100 kg respectively. The 100kg membrane pellet was re-suspend in 10 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 10% glycerol and 1 mM PMSF Protein (10 mg) was separated on a 10% SDS-PAGE, electroblotted and immunostained with antibodies raised against a KLH-conjugated synthetic peptide conesponding to the putative hydrophilic loop IV of the AVP-1 protein (V. Sarafian, Y. Kim, R. J. Poole, P. A. Rea, Proc. Natl Acad. Sci. 89, 1775-1779 (1992)). PPase was detected by chemiluminescence. Fig. 1 C illustrates that the transgenic lines (1 ' and 2') express AVP-1 protein at higher levels than the wild type (WT) (that is, 1' = 15% and 2' =50% more than WT).
As wheat that has been deprived of water is rendered more drought tolerant by an increase in cell K+ content (from 100 mM to 300 mM) (S. Gupta, G. Berkowitz, P. Pier, Plant Physiol 89, 1358-1365 (1989)), it is hypothesized (but the invention is not hereby limited by such theory) that the increased drought resistance of the AVP-1 transgenic plants may be a consequence of their higher vacuolar concentration of potassium that results in a increased water retention capability. Laboratory tests appear to confirm this.
Fig. 2 is an overhead view of a representative wild type plant (WT) versus representative transgenic plants overexpressing AVP-1 (V and 2') after exposure to 7 days of water deficit stress. Wild type and transgenic plants overexpressing A VP-1 (Fig 3 A) were tested for drought tolerance (24°C). After 7 days of water deficit stress wild type (WT) plants withered, whereas plants from both 35S AVP-1 transgenic lines (l1 and 2') were turgid and alive. Furthermore, when the drought stressed plants were then watered, transgenic plants pursued normal growth, bolted and set seeds, whereas wild type plants died. The relative water content of leaves from wild type and 35SAVP-1 transgenic plants were determined along the water deficit stress, demonstrating increased water retention by the transgenic lines as compared to the WT plants.
While not illustrated in the accompanying illustrations, similar results may be seen with respect to freeze challenge (< 0°C) over a 24 hour or more period for a number of plant species. While not limited to such hypothesis, transgenic plants overexpressing AVP-1 (1' and 2') are believed to provide enhanced protection from freeze as compared to wild type (WT) plants due to the higher amounts of cations in the vacuoles. Higher amounts of cations confer a greater osmotic pressure that leads to a greater water retention capability endowing the plants not only with the ability to withstand low soil water potentials, but also providing greater protection from freezing that leads to significant desiccation of the plants. Fig. 3 is a perspective view of wild type plants (WT) versus representative transgenic plants overexpressing AVP-1 (1' and 2') grown in salty soil. Five wild-type plants (WT) and two AVP-1 overexpressing transgenic lines (1' and 2') were grown on soil in a 10 hour light/dark cycle. Plants were watered with a diluted nutrient solution (1/8 MS salts) for six weeks and subsequently watered with a diluted nutrient solution supplemented with NaCl. The concentration of NaCl began with 100 nM and was increased every four days by 100 mM. The photograph in Fig. 3 conesponds to plants at the tenth day in the presence of 300 mM NaCl. Fig. 3 illustrates that the two AVP-1 plant types (1 ' and 2') were significantly hardier in salty soil as compared to wild-type plants. The fact that genetically engineered Arabidopsis thaliana plants that overexpress either A VP1 (the pyrophosphate-energized vacuolar membrane proton pump, this work) or AtNHXl (the NaNH+ antiporter, (Apse, M., et al, Science, 2S5:1256-1258 (1999)) and this work) are capable of growing in the presence of high NaCl concentrations strongly supports the strategy described herein. A double transgenic plant would be expected to demonstrate a further enhanced salt-tolerant phenotype. These Arabidopsis thaliana transporters or their counterparts may perform similar function in important agricultural crops. The increased size of 35S A VP1 Arabidopsis transgenic plants also contribute to potential yield increases in genetically engineered crops.
A Working Model of Cation Homeostasis in Plant Organdies
While the present invention is not limited to any particular hypothesis, the present inventors have developed a working model for cation homeostasis in plant organelles which may explain the unexpected results discovered with respect to the transgenic plants disclosed herein.
In plants, most of the transport processes are energized by the primary translocation of protons. ET-translocating pumps located at the plasma membrane and tonoplast translocated IT1" from the cytosol to extracellular and vacuolar compartments, respectively (Rea, P. A., et al, Tonoplast Adenosine Triphosphate and inorganic Pyrophosphatase. In: Methods Plant Biochem., pp. 385-405, Academic Press Limited, London (1990)). The plant tonoplast contains two H^-translocating pumps; the V-ATPase and the inorganic pyrophosphatase or V-PPase. Their action results in luminal acidification and the establishment of a H+ electrochemical potential gradient across the tonoplast (Davies, J.M., et al, The Bioenergetics of Vacuolar FT Pumps. In: Plant Vacuole, pp. 340-363, Leigh, R.A., Sanders, D. (eds.), Academic Press, San Diego (1997)). The vacuolar membrane is implicated in a broad spectrum of physiological processes that include cytosolic pH stasis, compartmentation of regulatory Ca2+, sequestration of toxic ions such as Na+, turgor regulation, and nutrient storage and retrieval. The vacuole constitute 40 to 99% of the total intracellular volume of a mature plant cell. The vacuolar proton pumping pyrophosphatase is a universal and abundant component of plant tonoplast capable of generating a steady-state trans-tonoplast H+ electrochemical potential similar or greater than the one generated by the V-ATPase (Rea, P.A., et al, Tonoplast Adenosine Triphosphate and Inorganic Pyrophosphatase. hx.Methods Plant Biochem., pp. 385-405, Academic Press Limited, London (1990)). Pyrophosphate (PPi) is a by-product in the activation or polymerization steps of a wide range of biosynthetic pathways and in plants serves as an alternative energy donor to ATP for sucrose mobilization via sucrose synthetase, for glycolysis via PPi: fructose-6- phosphate phosphotransferase and for noplast energization via the vacuolar proton pumping pyrophosphatase (Stitt, M., Bot. Acta 111:161-115 (1998)).
Most of intracellular organelles, including clathrin-coated vesicles, endosomes, Golgi membranes and vacuoles have acidic interiors (Xie, X. S., et al, J. Biol. Chem., 264:18870-18873 (1989)). This acidification is mediated by a proton-translocating electrogenic ATPase and in plant vacuoles also via a pyrophosphate-driven proton pump V-PPase (Davies, J.M., et al, The Bioenergetics of Vacuolar H+ Pumps. In: Leigh R.A., Sanders, D., (eds) The Plant Vacuole, pp. 340-363, Academic Press, San Diego (1997); Zhen, R.G., et al, "The Molecular and Biochemical Basis of Pyrophosphate-Energized Proton Translocation at the Vacuolar Membrane Academic Press Limited (1997)). There exists a requirement of anion transport to maintain net electroneutrality (al-Awqati, A., Curr. Opin. Cell. Biol, 7:504-508 (1995)).
Fig. 4 A is a schematic representation of a working model of the transporters involved in sodium sequestration at the yeast pre-vacuolar compartment; Nhxl (Na+/H+ antiporter), Vmal (vacuolar membrane IT1"- ATPase), Gefl (yeast CLC chloride channel), Enal (plasma membrane Na+-ATPase). The yeast member of the CLC voltage-gated chloride channel superfamily, Gefl , is required for copper loading in late- Golgi vesicles and for cation sequestration in the pre-vacuolar compartment in yeast (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998); Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999); Example 1). Furthermore, it has been shown that the defects of gefl mutants can be suppressed by the introduction of the prototype member of the CLC superfamily, the Torpedo marmorata CLC-0 or by the introduction of Arabidobsis thaliana CLC-c and CLC-d chloride channel genes (Hechenberger, M., et al, J. Biol Chem., 277:33632-33638 (1996); Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998)). Fig. 4B is a schematic representation of a working model of the transporters involved in sodium sequestration at the yeast pre- vacuolar compartment shown in Figure 4A, which also includes Avpl (A. thaliana vacuolar pyrophosphate-energized proton pump).
While not wishing to be bound by theory, two observations led to the proposal of the model for Na+ sequestration in yeast illustrated in Figs. 4 A and 4B. First, gefl mutants are sensitive to high NaCl concentrations. Second, the Na+/H+ exchanger Nhxl is localized to the pre-vacuolar compartment (Nass, R., et al, J. Biol. Chem., 273:21054-21060 (1998)). The model proposed in Figs. 4A and 4B posits that Na+ sequestration by Nhxl depends on the vacuolar H+- ATPase and Gefl, the chloride channel. Gefl -mediated anion influx allows the establishment by the vacuolar FT1"- ATPase of a proton gradient sufficient in magnitude to drive the uphill accumulation of Na+ via Na+/H+ exchange.
Based on such models, it was theorized that increasing the influx of protons into the postulated endosomal compartment should improve Na+ sequestration via the Nhxl exchanger. In order to increase the H+ availability the A. thaliana gain-of-function mutant gene AVPl -D that codes for the vacuolar pyrophosphate-energized proton pump was expressed (Figure 3B) (Zhen, R.G., et al, J. Biol. Chem., 272:22340-22348 (1997)). This plant pump expressed in yeast restored the Na+ resistance of the test strain, but only if the strain had functional NHX1 and GEF1 genes. Furthermore, Geflp and Nhxlp co- localize within a common organelle, the pre-vacuolar compartment (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999)). These results strongly support the model in Figs. 4A and 4B and indicate that the yeast pre-vacuolar compartment can be used to identify the elusive plant transporters involved intracellular sodium detoxification.
The model set forth in Figs. 4 A and 4B is entirely consistent with the physiological data on the role of the vacuole in cation detoxification in higher plants. Yeast and plant cells share pathways and signals for the trafficking of vesicles from the Golgi network to the vacuole (Neuhaus, J.M., et al, Plant Mol Biol, 33:127-144 (1998); (Paris, N., e al, Plant Physiol, 775:29-39 (1997); Sato, M.H., e l, J. Biol. Chem., 272:24530-24535 (1997); Vitale, AN., et al, Trends Plant Sci., 4:148-154 (1999)). Studies were therefore undertaken in yeast to identify the role of the vacuole in cation detoxification in higher plants.
Studies of Cation Sequestration Mechanism in Yeast Example 1 : Functionality of AtΝhxl and Avpl in Yeast Strains
To test the sequestration models set forth in Figs. 4 A and 4B, mutant yeast strains (enal) lacking the plasma membrane sodium efflux pump, which therefore must rely on the internal detoxification system in order to grow on high salt, were constructed. The sequestration model (Νass, R. and Rao, R., J. Biol Chem., 273:21054-21060 (1998) and, Gaxiola, R.A., et al, Proc. Natl Acad. Sci. USA, 95:4046-4050 (1998)) of Figs. 4A and 4B predicts that the enal strain would become salt tolerant if one could enhance the availability of protons in the postulated endosomal compartment, that is with increased influx of protons, cytoplasmic Νa+ would be sequestered via the Nhxl exchanger.
The yeast vacuolar ATPase is a multisubunit protein, so it is difficult to increase its activity by overexpressing any one of its subunits. Instead the same effect was achieved by increasing the influx of protons by expressing the A. thaliana AVPl gene in yeast. This gene encodes a single polypeptide that, when expressed in yeast, is capable of pumping protons into the lumen of the vacuole (Kim, E.J., et al, Proc. Natl. Acad. Sci. USA, 97:6128-6132 (1994)). To ensure maximum activity of this proton pump, the E229D gain-of-function mutant of the A VP1 gene (A VP1-D) that has enhanced H+ pumping capability was expressed (Zhen, R.G., et al, J. Biol. Chem., 272:22340-22348 (1997)). Intracellular sodium and potassium content was determined for mutant and wild- type cells after growth on SD-ura medium with high NaCl content. Materials and Methods
Yeast strains and Plasmids
Strains isogenic to W303 (ura3-l canl-100 leu2-3, 112trpl-l his3-ll, (Gaxiola, R.A., et al, EMBOJ., 77:3157-3164 (1992)) were employed. Plasmids pRG52 ( -gefl::HIS3) (Gaxiola, R.A., et al, Proc. Natl Acad. Sci. USA, 95:4046-4050 (1998)) and pRG197 ( ■ nhxl::HIS3) were used to construct the deletions of GEF1 and NHX1 genes, yielding strains RGY85 and RGY296, respectively. The enal::HIS3 mutant was obtained from Fink Lab collection (L5709).
Method of Transformation
Transformation of yeast cells was performed by using the lithium acetate method (Gietz, D., et al, Nucleic Acids Res., 20:1425 (1992)). Double mutants RGY324 (gefl::HIS3 enal::HIS3), RGY326 (nhxl::HIS3 enal::HIS3), and RGY343 (gefl::HIS3 nhxl::HIS3) were obtained by crossing the single-mutant strains. Double mutants were identified among the meiotic progeny by scoring for the phenotypes associated with each of the single mutants. Sporulation, tetrad dissection, and mating types were scored as described (Guthrie C. and Fink, G.R., Guide to Yeast Genetics and Molecular Biology (Academic, San Diego (1991)). Cells were grown in YPD (1% yeast/2%peptone/2% dextrose; Difco), YPGAL (1% yeast/2%peptone/2% galactose; Difco), SD (Difco; Synthetic medium with 2% Dextrose), or APG (APG is a synthetic minimal medium containing 10 mM arginine, 8 mM phosphoric acid, 2% glucose, 2 mM MgSO , 1 mM KCl, 0.2 mM CaCl2, and trace minerals and vitamins) (Rodriguez-Navano, A. and Ramos, J., J. Bacteriol, 759:940-945 (1984)). MnCl2 (Sigma), tetramethyla monium chloride (Sigma), NaCl (Sigma) , or hygromycin-B (Sigma were added as indicated.
Wild type, L5709 (enal::HIS3), RGY324 (gefl::HIS3 enal::HIS3), and RGY326 (nhxl::HIS3 enal::HIS3) strains were transformed with pYES2 vector (Invitrogen) and plasmid pYES2-ΛF7>7-E229D described in Zhen, R.G., et al., J. Biol. Chem., 272:22340-22348 (1997). The strain RGY343 (gefl::HIS3 nhxl::HIS3), used for histochemical analysis, was transformed with pRG151 (GEF1-GFP) (Gaxiola, R.A., et al. Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998)) and with pRIN73 [NHX1-(HA)3] (Nass, R., and Rao, R., J. Biol. Chem., 273:21054-21060 (1998)).
Wild-type and RGY296 (nhxl::HIS3) strains were transformed with vector pAD4 (Ballester, R., et al, Cell, 59:681-686 (1989)). RGY296 (nhxl::HIS3) was transformed with pRG308 (ADH1:: AtNHXl) (see Cloning of AtNHXl).
Determination of Intracellular Sodium and Potassium Content
Cells were grown overnight in SD-ura medium (Difco; synthetic medium with 2% dextrose without uracil). YPGAL (1% yeast extract/2% peptone/2% galactose; Difco) media was inoculated with the overnight stocks and grow to an A6oo of 0.6. At this OD, NaCl was added to a final concentration of 0.7 M. The cells were incubated for 6 h, harvested by centrifugation, washed two times with 1.1 M sorbitol and 20 mM MgCl2, and entracted with water for 30 min at 95°C.
The amount of Na+ and K+ in cells was determined at the University of Georgia Chemical Analysis Laboratory by an Inductively Coupled Plasma-MS (see world wide web at rserv/uga.edu/rsnew/chemicalanalysis/). Intracellular cation concentrations were estimated as described (Gaxiola, R.A., et al, EMBO J., 77:3157-3164 (1992)) by using the intracellular water value calculated for cells grown in 1M NaCl.
Immunofluorescence
The strain RGY343 (gefl::HIS3 nhxl::HIS3) was grown in SD-ura, -leu medium (Difco; synthetic medium with 2% dextrose without uracil and leucin) to mid- logarithmic phase, 0.1 mg/ml hygromycin B was added, and the culture was incubated for 1 h at 30°C. Cells were fixed with 3.7% formaldehyde (Sigma) for 45 min at room temperature without agitation. Spheroplast formation, permeablization, washing, and antibody incubation was performed as described (Pringle, J., et al, in Immunofluorescence Methods for Yeast, eds. Guthrie, C. And Fink, G.F. (Academic, Sand Diego), Vol. 194 pp.565-602 (1991)). MAB HAI 1 used as first antibody was from Babco (Richmond, CA). Cy 3 -conjugated goat anti-mouse IgG was from Jackson Immunoresearch. 4',6-Diamidino-2-phenylindole (Sigma) was added to mounting medium to stain mitochondrial and nuclear DNA.
Subcellular Fractionation and Western Analysis
The strain RGY343 (gefl::HIS3 nhxl::HIS3) was grown in APG medium (pH 7.0), and lysates fractionated on a 10-step sucrose density gradient as described (Nass, R. and Rao, R., J Biol Chem., 273:21054-21060 (1998)). Aliquots of individual fractions (100 μg) were subjected to SDS/PAGE and transfeπed to nitrocellulose as described (Nass, R. and Rao, R., J. Biol Chem., 273:21054-21060 (1998)). Western blots were probed with monoclonal anti-GFP (green fluorescent protein) antibody (1 : 10,000 dilution; CLONTECH), anti-hemagglutinin antibody (1 :10,000 dilution: Boehringer Mannheim), and peroxidase-coupled goat anti-mouse antibody (1 :5,000;) and developed by using the ECL enhanced chemiluminescence system (Amersham Pharmacia).
Cloning of AtNHXl
AtNHXl was cloned from a phage cDNA library of A. thaliana (Kieber, J.J., et al, Cell, 72:427-441 (1993)) (obtained from the Arabidopsis Biological Resource Center) by probing with an expressed sequence tag (Arabidopsis Biological Resources Center, DNA Stock Center) containing a partial clone. A full-length clone (2.1 kB) was ligated into vector pSK2 (Stratagene) at the Notl sit, generating plasmid pRG293. The AtNHXl ORF was amplified via PCR by using pRG293 as template and GGCCCGGGATGGATTCTCTAGTGTCGAAACTGCCTTCG (SEQ ID NO: 5) (italicized bases conespond to nucleotides 1-30 of the ORF) and T7 oligonucleotides. The PCR product was then digested with Xbal and Sail and ligated into pAD4 vector generating plasmid pRG308. The AtNHXl ORF was sequenced to verify the fidelity of the PCR product. The full-length sequence is longer than the ORF reported by the Arabidopsis Genome Initiative (A TM021B04.4), and has been deposited in GenBank (accession no. AF106324).
Cloning of ANP1-D
Vector pYES2 (Invitrogen) was introduced into wild-type, enal, enal nhxl, and enal gefl mutants. Plasmid pYes2-AVPl-D (Zhen, R.G., et al, J. Biol. Chem., 272:22340-22348 (1997)) was introduced into enal, enal nhxl, and enal gefl mutants. Five-fold serial dilutions (starting at 105 cells) of each strain were plated on YPGAL (1% yeast extract/2% peptone/2% galactose) with or without 0.5 M ΝaCl and incubated at 30°C for 2 days. Exponentially growing cells (wild-type and enal transformed with pYES2 vector and enal, enal nhxl, and enal gefl mutants carrying pYes2-AVPl-D) were exposed to 0.7M ΝaCl for 6 hours. Total cell extracts were prepared, and Νa+ and K+ concentrations were determined. Results
The enal mutant of the above construct lacks the plasma membrane sodium efflux pump and therefore must rely on the internal detoxification system to overcome sodium toxicity. Growth of the enal strain is sensitive to low concentrations of sodium (200 mM), concentrations that do not inhibit the growth of wild-type strains. Overexpression of AVPl -D restored salt tolerance to salt-sensitive enal mutants. The restoration of salt tolerance to an enal strain by A VP1-D requires functional NHX1 and GEF1 genes: enalnhxl AVP1-D and enal gefl AVP1-D strains are salt sensitive.
Fig. 5 A and Fig. 5B are bar graphs showing the intracellular Na+ and K+ contents of wild-type yeast strains and of yeast strains carrying various mutations affecting sodium tolerance wherein the values are the mean of two determinations, and the bars represent the standard deviations. The intracellular Na+ and K+ contents of wild-type strains and of strains carrying various mutations affecting sodium tolerance were determined after 6 h of exposure to media supplemented with 0.7 M NaCl. The intracellular Na+ content in the enal mutant was seen to be 8-fold higher than in the wild- type strain. There was seen to be a consistent reduction in total cell Na+ in the enal AVP- D strain. The reason for this reduction is unknown. The enal A VP-D strain was found to be salt-resistant, even though its intracellular Na+ content was 4-fold higher than that of the wild type. In enal AVPI-D strains lacking either ge/7 or nhxl (i.e., enal gefl or enal nhxl), the Na+ content was not reduced to the extent that it was in the GEF1 NHX1 strain. Taken together, the genetic and physiological data are consistent with the model that Nhxl, Gefl and Avpl cooperate to sequester sodium internally. As can be seen in the graphs, the Arabidopsis Vacuolar H+ -Pyrophosphatase (Avpl) was evidenced to confer salt tolerance to yeast enal mutants.
The intracellular K+ content was found to conelate with salt tolerance and is inversely conelated with the Na+ content of the strains (Fig. 4B). The wild-type K+ concentration was at 100 mM, but was reduced to 20 mM in the e«α7 mutant. Interestingly, in an enal strain that overexpresses the A VP1-D gene, the intracellular concentration of K+ was restored almost to wild-type levels (Fig. 4B). However, AVPl -D overexpression failed to restore wild-type levels of intracellular potassium unless both NHxl and GEF1 were functional (See, the double mutants enal nhxl or enal gefl in Fig. 4B).
As shown herein, intracellular Na+ detoxification in yeast requires functional Na+/H+ exchanger (Nhxl) and chloride channel (Gefl), and they co-localize to a pre-vacuolar compartment (Gaxiola, R.A., et al, Proc. Natl Acad. Sci. USA, 96:1480- 1485 (1999)). When the Arabidopsis thaliana homologue of the yeast NHX1 gene (AtNHXl) was cloned and its function in the nhx 1 yeast mutant tested, the AtNHXl gene was found to be able to suppress partially the cation sensitivity phenotypes of nhxl mutants. Fig. 6 is alignment of the deduced amino acid sequences of NhXl homologue from Arabidopsis AtNHXl (SEQ ID NO:l), human HsNHE-6 (SEQ ID NO: 2) and yeast ScNHXl (SEQ ID NO:3); identical residues are in black boxes, and dashes indicate gaps in the sequence, * above alignment denote putative amiloride binding site from human NHE7 (I63DVF-FLFLLPPI173) (SEQ ID NO: 4). Example 2: Functionality of . and Co-localization of Geflp and Nhxlp in Yeast Strains
The NHX1 and GEF1 genes, which have been identified as important in sodium detoxification, are also required for the detoxification of other cations. An investigation was made with respect to the viability of yeast strains mutant with respect to gefl and nhxl (enal) in the presence of toxic cations, in light of the model set forth in Figs. 4A and 4B.
The sequestration model postulates not only a functional connection between the anion channel Gefl and sodium exchanger Nhxl but also predicts that these two proteins co-localize within a common compartment. Because previous studies indicated that Nhxl localizes to a pre-vacuolar compartment (Nass, R. and Rao, R., J. Biol. Chem., 273:21054-21060 (1998)), experiments were also performed to determine whether Gefl and Nhxl proteins co-localize to this compartment. Materials and Methods
The strain RGY419 (gefl nhxl) was transformed with plasmids pRG151; GEF1-GFP and pRIN73; NHX1-(HA)3. Transformants were grown in SD (Difco; synthetic medium with 2% dextrose). To determine the sensitivity of such transformants to toxic cations, five-fold serial dilutions (starting at 105 cells) of the indicated strains were grown at 30 ■ C for 2 days on YPD (1% yeast extract/2% peptone/2% dextrose) with the addition of either 3 mM MnCl2, 0.45 M tetramethylammonium (TMA), or 0.05 mg/ml hygromycin B (HYG) as indicated.
Two studies were undertaken to demonstrate co-localization of Geflp and Nhxlp.
Distribution of fluorescence and immunodetection of subcellular fractions in ge/7 nhxl cells transformed with two constructs: a GEF1-GFP fusion and a NHX1- (HA)ι-tagged fusion were determined. When the cells reached OD600 = 0.5, hygromycin B (Sigma) was added to a final concentration of 0.1 mg/ml and the cells were incubated for 40 min at 30 ■ C. Cells were fixed and stained with antibodies to HA epitope and 4',6- diamidino-2-phenylindole (DAPI). Cells were viewed by charge-coupled device microscopy and optically sectioned by using a deconvolution algorithm (Scanalytics, Billerica, MA) (Kennedy, B.K., et αl, Cell, 59:381-391 (1997)); (Bar = 1 - m.).
The migration properties of the Geflp and Nhxlp in sucrose gradients was also determined to provide evidence of co-localization of Nhxl (HA)3 and GEF1-GFP. The strain RGY419 (gefl nhxl) was transformed with plasmids pRG151; GEFl-GFP and pRTN73; NHX1-(HA)3 and grown in APG medium (Rodriguez-Navano, A. and Rea, P.A., J. Biol. Chem., 159:940-945 (1984)). Such was converted to spheroplasts, lysed, and fractionated on a 10-step sucrose gradient (18-54%) as described (Sorin, A., et al, J. Biol Chem., 272:9895-9901 (1997) and Antebi, A. and Fink, G.R., Mol. Biol. Cell, 3:633-654 (1992)). Western blots showed the distribution of Gefl-GFP and Nhxl -HA. Results
Ge/7 mutants were found to be sensitive to 3 mM MnCl , 0.45 M tetramethylammonium chloride and to 0.05 ■ g/ml hygromycin-B. The nhxl mutant was also found to be sensitive to tetramethylammonium chloride and hygromycin. The extreme sensitivity of the nhxl mutant to hygromycin may provide an important tool for assaying nhxl function.
It was found that hemagglutinin (HA)-tagged Nhxl and Gefl-GFP fusion protein co-localize as shown via epifluorescence deconvolution microscope. Persistence of signal coincidence on 90° rotation of the image further supports co-localization of the two transporter proteins in these cells. The co-localization of Nhxl (HA)3 and GEFl-GFP is also supported by the co-migration of the two proteins in sucrose density gradients of membrane preparations obtained from cells expressing the tagged proteins. The sedimentation behavior of the membrane fraction containing both proteins is consistent with that of a pre-vacuolar compartment (Nass, R. and Rao, R., J. Biol Chem., 273:21054- 21060 (1998)). Gefl-GFP (but not Nhxl) is also present in Golgi fractions, consistent with previous studies (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998), Schwappach, B., et al, J. Biol. Chem., 273:15110-15118 (1998)).
Example 3: Capacity of A. thaliana Homolog of NHX1 to Suppress Hygromycin
Sensitivity of Mutant Yeast
The yeast strain described herein provides an important tool for identifying genes that mediate salt tolerance in other organisms. To test the utility of this system, a sequence from Arabidopsis (See Materials and Methods) with very high homology to the S cerevisiae NHX1 ORF was identified and used an expressed sequence tag (see Materials and Methods) to obtain a full-length clone of this Arabidopsis gene. An alignment of the amino acid sequences of Nhxl homologues from Arabidopsis (AtNhxl), human (HsNheό), and yeast (ScNhxl) reveals segments of amino acid identity and similarity within predicted transmembrane domains (Fig. 6A-C). However, it is important to note that despite these relationships, neither the C-terminal regions of AtNhxl and ScNhxl show a high degree of homology (Fig. 6A-C).
A characteristic of mammalian Na+/H+ antiporters is their inhibition by amiloride. A putative amiloride binding site (163DVFFLFLLPPI173) (SEQ ID NO: 4) has been defined via point mutants in the human NHE1 antiporter gene (Counillon, L., et al, Proc. Natl. Acad. Sci. USA, 90:4508-4512 (1993)). AtNhxl, HsNhe-6 and ScNhxl have an almost identical sequence (Fig. 6). However, attempts to inhibit the activity of either Nhxl or AtNhxl in yeast cultures with amiloride were unsuccessful.
The extreme sensitivity of yeast nhxl mutants to hygromycin permitted the testing of whether the cloned Arabidopsis AtNHXl ORF could provide Na+/FT exchange function in yeast. Vector pAD4 (Ballester, R., et al, Cell, 59:681-686 (1989) was introduced into wild-type and nhxl strains. Plasmid pRG308; ADH; AtNHXl was introduced into nhxl mutants as indicated. Five-fold serial dilutions (starting at 105 cells) of the indicated strains were grown at 30 ■ C for 2 days on YPD (-) or on YPD supplemented with 0.05 mg/ml hygromycin (+). Serial dilutions of the same strains were grown on APG medium (see Materials and Methods) (-) or on APG supplemented with 0.4 M NaCl (Rodriguez-Navano, A. and Ramos, J., J. Bacteriol, 759:940-945 (1984).
The At NHX1 gene is capable of suppressing the hygromycin sensitivity of the nhxl mutant. The AtNHXl gene also suppressed the NaCl sensitivity of nhxl mutant but only under conditions in which the K+ availability was reduced. However, AtNHXl was not capable of rescuing the Na+ " sensitive growth phenotype of the double mutant enal nhxl overexpressing the AVP1-D gene.
Example 4: Generation of Gain-of-Function Yeast AtNHX Mutants
Materials and Methods
Gain of function mutants of the AtNHX that enhance salt tolerance were generated in the enal yeast by mutagenizing the cloned gene to make a mutant library. This library was used to transform the salt sensitive yeast mutant enal and clones with an enhanced salt tolerant phenotype. Other genes that show similarity to the AtNHXl gene, as reported by the Arabidopsis Genome Initiative (AGI), were also expressed in the mutant yeast to form gain-of-function mutants. It is believed that some of these AtNHXl homologues are plasma membrane transporters, so their function in yeast are frequently pH dependent, requiring precise composition and pH of the medium used for screening for success. Identification of plasma membrane transporters helps to engineer plants with an enhanced salt tolerance due to a reduced sodium uptake. In addition, plant cDNA expression libraries in yeast are used to identify other families of transporters involved in NaCl detoxification.
To generate gain of function mutants of the AtNHX a method for introducing random mutations developed by Stratgene (Epicurian Coli XL 1 -Red competent Cells Cat#200129) was used. The method involves the propagation of a cloned gene into a strain deficient in the three primary DNA repair pathways. The random mutation rate in this strain is about 5000-fold higher than that of wild-type. A library of the mutated AtNHX gene was transformed into the enal yeast mutant and screened for salt tolerance. Yeast transformation was performed as described by Schiestl and coworkers (Gietz, D., et al, Nucl Acid Res. 20:1425 (1992), incorporated by reference in its entirety herein). An alternative to the XL 1 -Red random mutagenesis strategy is a PCR approach described by Fink and coworkers (Madhani, H.D., et al, Cell, 97:673-684 (1997)).
To test AtNHXl homologues the same strains and conditions used for AtNHXl (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999)) were used initially. However, if these screening strains and/or conditions did not work, new ones are worked out. When dealing with plasma-membrane AtNHXl homologues pH conditions of the assay media were found to be crucial.
Results
The overexpression of the A. Thaliana gain-of-function mutant gene A VP1- D increases the intracellular detoxification capability in yeast (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999)). It is hypothesized (although the inventors are not limited by such hypothesis) that the latter is due to an increased influx of H+ into the vacuolar compartment thereby improving Na+ sequestration via the Nhxl exchanger. Conclusions from Yeast Cation Sequestration Studies
The yeast studies described above provide evidence for the importance of the pre-vacuolar pH for intracellular Na+ sequestration in yeast. Overexpression of the plant H+ -pyrophosphatase (Avpl) confers salt tolerance to yeast only in those strains containing a functional chloride channel (Gefl) and the NaNFT exchanger (Nhxl).
These data support a model in which the Nhxl NaNFT exchanger acts in concert with the vacuolar ATPase and the GEF1 anion channel to sequester cations in a pre-vacuolar compartment. Several studies suggest that the pre-vacuolar compartment may be derived both from the plasma membrane and the late Golgi. These vesicles are likely involved in the assembly of the vacuole or delivery of cargo to this organelle. It is reasonable to expect that these pre-vacuolar vesicles detoxify cations by sequestration, thereby lowering their concentrations in the cytoplasm and in other organelles.
The yeast system described herein permits the functional assessment of diverse heterologous proteins in salt tolerance: chloride channels, FT1" pumps, and ΝaYFT exchangers and other cation/H+ exchangers or cation/bicarbonate symporters. The system is robust and flexible. The function of the Arabidopsis chloride channels (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998), Hechenberger, M., et al, J. Biol. Chem., 277:33632-33638 (1996)), H+ pump, and ΝaVlT exchanger can be assayed in the conesponding yeast mutant. Despite the inability of At NHX1 to suppress all the phenotypes of the yeast nhxl mutant, the fact that it suppresses some phenotypes, coupled with the DΝA homology between AtNHXl and yeast NHXl, indicates that the plant gene carries out a similar function to that of the yeast homologue. The observation that the AtNHXl gene suppresses the sensitivity of the nhxl mutant to hygromycin but provides only a weak Νa+ detoxification phenotype could be a consequence either of differential regulation of the transporters in the two organisms or of distinct cation transport selectivities.
The regulation of AtNHXl by salt and the ability of the plant gene to suppress the yeast nhxl mutant suggest that the mechanism by which cations are detoxified in yeast and plants may be similar. Indeed, previous work suggested that vacuolar sodium accumulation in salt-tolerant plants may be mediated by a tonoplast NaNH1" antiporter that utilizes the proton-motive force generated by the vacuolar H+- ATPase (V-ATPase) and/or H+ -translocating pyrophosphatase (V-Ppase; refs. Barkla, B.J., et al, Symp. Soc. Exp. Biol, 45:141-153 (1994), Zhen, R.G., et al, The Molecular and Biochemical Basis of Pyrophosphate-Energized Proton Translocation at the Vacuolar Membrane (Academic, San Diego), Kirsh, M, et al, Plant Mol Biol, 32:543-547 (1996)).
The finding described herein that both gefl and nhxl mutants are hypersensitive to hygromycin indicate that the level of resistance to hygromycin depends on the function of the vacuolar and pre-vacuolar organelles. Yeast mutants impaired in K+ uptake (trkl) are hypersensitive to hygromycin (Madrid, R., et al, J. Biol. Chem., 273:14838-14844 (1998)); reduced K+ uptake hyperpolarizes the plasma membrane potential and drives the uptake of alkali cations such as hygromycin. Mutations that reduce the FT pumping activity of the plasma membrane H+ -ATPase, Pmal, depolarize the plasma membrane potential and confer resistance to hygromycin (McCusker, J.H., et al, Mol Cell Biol, 7:4082-4088 (1987)). Thus, mutants such as gefl or nhxl that affect the pH or membrane potential of the vacuolar and pre-vacuolar compartments may be expected to affect hygromycin compartmentation.
Transgenic Plants With Upregulated Vacuolar ET-translocating Pump Activity
Further support for the role of the Arabidopsis AtNHXl gene in salt homeostasis is provided by the observation that its expression is induced in salt-stressed plants (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999)). Arabidopsis thaliana, in particular, has been used as a host model plant to demonstrate that overexpression of these genes results in salt tolerance in the plant. A recent report shows that the overexpression of AtNHXl gene in transgenic Arabidopsis thaliana promotes sustained growth in soil watered with 200 mM NaCl plus 1/8 M.S. salts under short-day cycle conditions (Apse, M., et al, Science, 255:1256-1258 (1999)). It is worth noting that every addition of 1/8 M.S. salts provides 2.5 mM potassium reducing the stringency of the NaCl stress, and that a short-day cycle reduces oxidative stress.
Example 5: Enhanced Expression of At NHX1 Gene in Salt-Stressed Plants
Materials and Methods
A. thaliana plants (ecotype Columbia) were grown aseptically on unsupplemented plant nutrient agar without sucrose (Haughn, G.W. and Somerville, C, Mol. Gen. Genet., 204:430-434 (1986)) for 15 days at 19°C and under continuous illumination. NaCl or KCl was added to a final concentration of 250 mM, and the plants were incubated for 6 h. Total RNA from tissue of salt-treated and untreated plants was isolated (Niyogi, K.K. and Fink, G.R., Plant Cell, 4:721-733 (1992)), Hybond-N (Amersham) membranes were hybridized with a P-Labeled DNA probe from plasmid pRG308. Hybridization was performed at 65°C overnight. Washes were performed at 65°C with 0.2% standard saline citrate (SSC)/0.1% SDS (Ausebel, F., et al, Curr. Protocols in Mol. Biol. (Wiley, NY) (1988)). 75S probe was used as loading control (Unfried, I., et al, Nucleic Acids Res., 17:7513 (1989)). MACBAS 2.4 program was used to quantify the relative amount of RNA.
Results
The NaCl stress increased AtNHXl mRNA levels 4.2-fold, whereas KCl promoted only a 2.8-fold increase. This increase in mRNA level produced by sodium resembles that described for the yeast NHXl gene (Nass, R. and Rao, R., J. Biol. Chem., 273:21054-21060 (1998)). RNA tissue blot hybridized with AtNHXl. Ten micrograms of total RNA from 15-day old plants exposed to 250 mM NaCl or KCl for 6 h and a control grown without salt was subjected to electrophoresis on a denaturing formaldehyde gel. The blot was hybridized with a probe internal to tNFLXl ORF. An 75S ribosomal probe was used as a loading control.
Example 6: Salt tolerance of Transgenic plants overexpressing AtNHXl
Materials and Methods
Transgenic plants that overexpress the AtNHXl were generated using Agrobacterium-mediated plant transformation. The transgenic AtNHXl was expressed using a double tandem enhancer of the 35S promoter of CaMV (Topfer, R., et αl, Nucl Acid Res., 75:5890 (1987)).
15 wild-type plants and 15 35SAtNHXl transgenic were grown on a 12 hours-day cycle for 20 days. During this period plants were watered every 5 days with a diluted nutrient solution (1/8 M.S. salts). 200 mM NaCl was added to the watering solution at day 21 and at day 33 plants were watered with a nutrient solution containing 300 mM NaCl. Plants were photographed 10 days after the last NaCl treatment. Results
Transgenic plants were found to be significantly less affected than wild type controls when watered with 300 mM NaCl.
Example 7: Salt tolerance of Transgenic plants overexpressing 35SAVP1
Materials and Methods
A transgenic Arabidopsis thaliana plant was engineered to overexpress the AVPl wild-type gene using the double tandem enhancer of the 35 S promoter (Topfer, R., et al, Nucl Acid Res., 75:5890 (1987)). AVPl encodes the pyrophosphate-energized vacuolar membrane proton pump from Arabidopsis (Zhen, R.G., et al, J. Biol Chem., 272:22340-22348 (1997)). Previous investigations suggest that the A VPl gene is present in a single copy in the genome of Arabidopsis (Kim, Y., et al, Plant Physiol, 106:315- 382 (1994)), however, a sequence homologous, but not identical, to AVPl on chromosome one has been tentatively designated as ORF F9K20.2 on BAC F9K20 by the Arabidopsis Genome Initiative (AGI).
Transgenic plants that overexpress AVPl were generated using Agrobacterium-mediated plant transformation. The transgenic A VPl was expressed using a double tandem enhancer of the 35S promoter of CaMV (Topfer, R., et αl, Nucl. Acid Res., 75:5890 (1987)). 15 wild-type plants and 15 35SAVP1 transgenics were grown on a 24 hours-day cycle for 16 days. During this period plants were watered every 4 days with a diluted nutrient solution (1/8 M.S. salts). 200 mM NaCl was added to the watering solution at day 17 and at day 27 plants were watered with nutrient solution containing 250 mM NaCl. Plants were photographed 10 days after the last NaCl treatment. Identical conditions and treatment as described in Example 6 were used.
Results
Five different lines of 35SAVP1 plants showed an enhanced salt tolerance as compared to wild-type plants in the T2 stage. However, the most dramatic phenotype was apparent in the homozygous T3 plants. These transgenic plants are larger than wild- type plants. Furthermore, homozygous 35SAVP1 plants showed sustained growth in the presence of 250 mM NaCl plus 1/8 M.S. salts when grown in a 24 hours light regimen. When 35SAVP1 plants were grown under short-day cycle conditions (12 hour day/light cycle) sustained growth in the presence of 300 mM NaCl plus 1/8 M.S. salts was observed.
Example 8: Growth of Wild Type Plants and 35SAVP1 Transgenic Plants in
Hydroponic Solution
The reduced availability of fresh water for standard agriculture may force the use of alternative agricultural arts. It is conceivable that with salt tolerant crops the use of hydroponics with seawater will create a new era in crop production. Hydroponic culture has been reported to increase plant growth and provide stress-free root and shoot material (Gibeaut, D.M., et al, Plant Physiol, 317-319 (1997)). Another important advantage of hydroponic culture is that it allows one to alter the ionic composition in a more accurate manner than in soil. These advantages could be important for the physiological studies of salt stress.
Conditions for hydroponics culture of Arabidopsis plants were established and their performance in increasing concentrations of NaCl in their media were tested.
Materials and Methods
In one test, hydroponically grown wild type and 35SA VPl transgenic plants were generated. Wild type and 35SA VPl transgenic plants were grown in solution culture on a 12 hour light cycle for 65 days.
In another test, wild type and 35SAVP1 transgenic plants were grown in solution culture on a 12 hours light cycle for 20 days. Starting at day 21, NaCl concentration was increased in a stepwise fashion by 50 mM increments every 4 days. Plants were photographed after 4 days in the presence of 200 mM NaCl.
And yet in another hydroponic test, transgenic plants were challenged with a commercial seawater formula that contains the complete ionic composition present in the oceans. 35SAVP1, 35S AtNHXl single and double transgenics were grown together with wildtype Arabidopsis thaliana plants under hydroponic conditions for four weeks in a short day illumination cycle (Gibeaut, D.M., et al, Plant Physiol, 317-319 (1997)). Then every four days an equivalent to 50mM NaCl of Tropic Marin sea salt (worldwide web at thatpetplace.com) is added. This artificial sea water mix includes all of the other major and trace elements present in real sea water. Growth was monitored and physiological parameters, such as sodium content and distribution was determined. Results
When wild type and 35SAVP1 transgenic plants were grown hydroponically the size differences in root, leaves and stems among wild type and 35SAVP1 transgenic plants were found to be dramatic, with 35SAVP1 transgenic plant parts being much larger.
When NaCl concentration were increased stepwise by 50 mM every 4 days (Apse, M., et al, Science, 255:1256-1258 (1999), 35SAVP1 transgenic plants appeared healthy in the presence of 200 mM NaCl while wild type controls showed severe deleterious effects in their leaves and stems.
35SAVP1, 35S AtNHXl single and double transgenics that were grown together with wildtype Arabidopsis thaliana plants under hydroponic conditions for four weeks in a short day illumination cycle (Gibeaut, D.M., et al, Plant Physiol, 317-319 (1997)) and then challenged every four days with an equivalent to 50mM NaCl of Tropic Marin sea salt were found to grow in the sea salt solution. Wildtype Arabidopsis thaliana plants did not.
Example 9: Effect of Overexpression of Arabidopsis thaliana Proton Transporters in
Tomato Plants
The effects of the overexpression of these Arabidopsis thaliana proton transporters (AVPl and AtNHXl) in a more agriculturally important plant, the tomato plant, was examined. It is believed that increasing the salt-tolerance of tomato plants will likely have important economic repercussions.
The tomato homologues of AVPl and AtNHXl were isolated and the conesponding chimeras to overexpress them were constructed (Bidone, S., et al, Eur. J. Biochem., 253: 20-26 (1998); Burbidge, A., et al, J Exper. Botany, 45:2111-2112 (1997)). The genes were introduced via Agrobacterium-mediated infection of calli. Tissue culture methods were used to regenerate transformed plants. The plants were assayed for salt tolerance as well as physiological parameters, such as sodium content and distribution.
Tomato transformation with 35S AVPl and with 35S AtNHXl constructs was performed as described by McCormick (McCormick, S., Transformation of tomato with Agrobacterium tumefaciens. In: Plant Tissue Culture Manual, pp. 1-9, Lindsey, K. (ed.), Kluwer Academic Publishers, Dordrecht, The Netherlands (1991)). TO and Tl transgenics were analyzed by polymerase chain reaction and DNA gel blotting for the presence and copy number of AVPl and AtNHXl transgenes. Heterozygous and homozygous plants were identified after segregation analysis of each transcend within Tl seeds. Homozygous plants were assayed for salt tolerance and as well as physiological parameters, such as sodium content and distribution. Degenerated oligos based on conserved sequences present in AVPl and AtNHXl homologues were designed. These degenerated primers were used in RT-PCR reactions with cDNAs made from poly(A)+RNA from tomato. The resulting PCR fragments were used as probes to isolate the full length cDNA clones from commercial libraries (i.e. Stratagene Cat#936004). A similar strategy was described by Caboche and coworkers (Quesada, A., et al, Plant Mol. Biol, 34:265-274 (1997)).
Results
Positive test results indicate that the sequestration model described herein is also applicable to an important crop.
Fig. 7 is a graph of Na+ and K+ content of wild-type plants (WT) versus representative transgenic plants overexpressing AVP-1 (1 ' and 2') grown in salty soil. Five wild-type plants (WT) and two AVP-1 overexpressing transgenic lines (1 ' and 2') were grown on soil in a 10 hour light/dark cycle. Plants were watered with a diluted nutrient solution (1/8 MS salts) for six weeks and subsequently watered with a diluted nutrient solution supplemented with NaCl. The concentration of NaCl began with 100 nM and was increased every four days by 100 mM. The photograph conesponds to plants at the tenth day in the presence of 300 mM NaCl. Parts of the plant above ground were harvested after 24 hours in the presence of 200 mM NaCl and their fresh weigh measured. After 48 hours at 75°C, the dry weight was measured. Na+ and K+ content was determined by atomic absorption. Values in the graphs of Fig. 4 are the mean +/- SE (n = 4). As can be seen from the graphs Na+ and K+ content in the transgenic lines (1 ' and 2') was significantly higher than that of wild-type counterparts.
Fig. 5 is a graph of the uptake of calcium into the 35SAVP-1 transgenic vacuolar membrane vesicles (squares) of 2' of Fig. 4 versus calcium uptake into vesicles obtained from wild type (WT) of Fig. 4. Wild-type plants (open circles) and transgenic plants from line 2' of Fig. 4 were grown hydroponically for nine weeks on a 10 hour light cycle. Vacuolar membrane vesicles were added to buffer containing 250 mM sorbitol, 25 mM BTP-Hepes pH 8.0, 50 mM KCl, 1.5 nM MgSO4 and 10 μM Ca4^. This mix was incubated at 20°C for 10 minutes before adding 200 μM PPi to trigger the reaction. Ca4"1" ionophore A23187 was added to a final concentration of 5 μg/ml to dissipate the Ca4-1" gradient. Aliquot (200 μl) were filtered at the indicated times and washed with cold buffer as described (11). As is evidenced by the graphs, the transgenic plants from line 2' have greater calcium uptake than wild-type plants.
The above data is consistent with the hypothesis that transgenic plants overexpressing A VP-1 have an enhanced FT1" pumping capability at their tonoplast and that an enhanced FT supply results in greater ion accumulation in the vacuole through the action of FT-driven ion transporters. To further support this theory, Ca4-1" uptake capability of wild type and transgenic vacuolar membrane vesicles was determined.
It is well documented that Ca ^ enters the plant vacuole via a Ca++fH+ antiporter (K. S. Schumaker, H. Sze, Plant Physiol. 79, 1111-1117 (1985)). Furthermore, the genes encoding the Arabidopsis thaliana Ca^/FT antiporters CAX1 and CAX2 have been isolated and characterized (K. D. Hirschi, R.-G. Zhen, K. W. Cunningham, P. A. Rea, G. R. Fink, Proc. Natl. Acad. Sci. USA 93, 8782-8786 (1996)). Fig. 8 shows that Ca4"1" uptake in the 35SA VP-1 transgenic vacuolar membrane vesicles is 36% higher than it is in vesicles obtained from wild type. Application of the Ca4-1" ionophore A23 lowered the 45Ca++ counts to background levels demonstrating the tightness of the vesicles (Fig 8) (K. S. Schumaker, H. Sze, Plant Physiol 79, 1111-1117 (1985)).
While not limited by such theory, a model consistent with the enhanced drought and freeze tolerance of the transgenic plants overexpressing the A VP-1 gene is depicted in Figs. 9 A and 9B. The model depicts how an increase in the number of AVP-1 pumps in the vacuole of transgenic plants can provide more H4" that will permit the secondary transporters to import greater amounts of cations into the lumen of the vacuoles. Higher amounts of cations confer a greater osmotic pressure that leads to a greater water retention capability endowing plants to withstand low soil water potentials.
Example 10: Double Transgenic Plant with 35SAVP1 and 35S AtNHXl
Overexpression of the pyrophosphate-energized vacuolar membrane proton pump AVPl likely increases the availability of H4" in the lumen of the vacuole, and the AtNHXl NaNH4" antiporter uses these H+ to sequester Na+ cations into the vacuole. Therefore, higher expression of these transporters likely maximizes the sequestration capability of the vacuole.
To generate transgenic Arabidopsis plants that overexpress both genes AVPl and AtNHXl, T3 35SAVP1 plants are used as females and T3 35S AtNHXl plants are used as males. Female plants are hand-emasculated and anthers from freshly opened flowers of donor plants are harvested. With these anthers the emasculated plants are pollinated by touching the anthers onto the stigmas. The pollinated flowers are labeled and any remaining opened or unopened flowers from the same female plant are removed to avoid any confusion at harvest. The harvested seeds are sterilized using a 50% sodium hypochloride solution and mixed vigorously for 5 minutes and rinsed with water thoroughly. The sterilized seeds are stored in soft agar over night at 4°C. Then they are sprinkled onto solidified kanamycin-hygromycin selective medium. The 35SAVP1 construct has the neomycin phosphotransferase II gene that confers kanamycin tolerance in plants while the 35S AtNHXl construct has a modified hygromycin B phosphotransferase that confers hygromycin tolerance in plants. The resistant seedlings are transplanted into soil and to the hydroponic media to be tested for their salt-tolerant phenotype.
A transgenic Arabidopsis thaliana plant to overexpress the A. thaliana gain-of-function mutant gene AVP1-D (Zhen, et al, J. Biol Chem., 272:22340-22348 (1997)) is engineered using the same double tandem enhancer of the 35 A promoter described above (Topfer, R., et al, Nucl. Acid Res., 75:5890 (1997)). Plants overexpressing the gain of function mutant gene will likely show an enhanced phenotype. These plants are characterized in parallel with the 35SAVP1, 35S AtNHX singles and doubles trangenics. The A. thaliana gain-of-function mutant gene AVPl -D is subcloned into plasmid pRT103 carrying the 35S promoter and the polyadenylation signal of CaMV (Topfer, R., et al, Nucl. Acid Res., 75:5890 (1997)). A Hindlll fragment containing the chimeric 35SAVP-D gene is subcloned into pBIBhyg (Becker, D., Nucl. Acid Res., 75:203 (1990)). The resulting T-DNA vector is transformed into Agrobacterium tumefaciens strain GV3101 via electroporation, and used for subsequent vacuum infiltration of Arabidopsis thaliana ecotype Columbia (Bechtold, N., et al, C.R. Jeances Acad. Sci. Ser. III Sci. Vie, 376:1194-1199 (1993)). Integration is confirmed on Southern blots of T3 plants and expression monitored on Northern blots of positive T3 plants.
Example 11 : Comparative Transport Study With Vacuoles From The Roots Of Wild-
Type and 35SAVP1 Transgenic Plants
A study was undertaken to determine if the vacuoles of 35S AVPl transgenic plants show a higher proton transport activity dependent on pyrophosphate. These determinations were done with root and shoot tissues separately from plants grown hydroponically. The transgene could show a tissue-specific regulation despite the 35S promoter.
In order to compare the PPI-dependent H+ translocation activities of wild- type and 35SAVP1 transgenic plants sealed tonoplast-enriched vesicles from roots and leaves of the above plants are prepared. The homogenization and differential centrifugation procedure described by Rea and Turner (Rea, P. A., et al, Tonoplast Adenosine Triphosphate and Inorganic Pyrophosphatase. In: Meth. Plant Biochem., pp. 385-405, Academic Press limited, London (1990)) is followed. FT*" translocation is assayed fluorimetrically using acridine orange (2.5 μM) as transmembrane pH difference indicator in assay media containing vacuole membrane-enriched vesicles as described by Rea and coworkers (Zhen, R.G., et al, J. Biol Chem., 272:22340-22348 (1997)). The assay media contains 300 ■ M Tris-PPi, 50mK KCl, 2.5 μM acridine orange, 5mM Tris- Mes (pH 8.0). Intravesicular acidification is triggered with the addition of 1.3 mM MgSO4 and terminated with the addition of the protonophore FCCP at 2.5 μM. Fluorescence is measured at excitation emission wavelengths of 495 and 540 nM, respectively, at a slit width of 5 nM (Zhen, R.G., et al, J. Biol Chem., 269:23342-23350 (1994)). A further test to support that the H4" translocation is A VPl driven is the addition of the specific inhibitor aminomethylenediphosphonate (Zhen, R.G., et al, Plant Physiol, 704:153-159 (1994)).
Example 12: Determination Of The Na+/K+ Ratios In Leaves And Stems Of The Transgenic Plants
Toxic concentrations of NaCl build up first in the fully expanded leaves where NaCl is compartmentalized in the vacuoles. Exposure to NaCl can disrupt or reduce K+ uptake leading to K+ deficiency and growth inhibition (Wu, S.J., et al, Plant Cell, 5:617-627 (1996). A cytosolic consequence of reduced K+ content and high Na+ is the inhibition of important enzymes. An example of such enzymes is the 3'(2'), 5'- bisphosphate nucleotidase of yeast whose activity is more sensitive to Na+ when K+ content is low (Murguia, JR., et al, Science, 267:232-234 (1995).
Measurements may be taken to demonstrate that the transgenic plants described herein have an increased vacuolar capacity to sequester Na+ in their leaves cells or elsewhere. To determine the Na+/K+ ratios in leaves and stem S wild-type and 35S AVPl /35S AtNHXl double and single transgenics in hydroponic conditions (Gibeaut, D.M., et α/., Plant Physiol, 317-319 (1997) are grown. NaCl is added to the growth media in a stepwise fashion starting with 50 mM up to 250mM (Apse, M., et al, Science, 255:1256-1258 (199). At every point the rosette and the stems of the treated plants are collected and their weight is determined. The samples are dried out in an oven at 80°C and their dry weight is determined. The dry samples are boiled in a determined volume of water and their Na+ and K+ contents determined via atomic absorption spectrophotometry (Apse, M., et al, Science, 255:1256-1258 (1999); Gaxiola, R., et al, Embo J, 77:3157- 2164 (1992)).
Example 13 : Determination Of Whether 35SA VPl Transgenic Plants Are Larger
Because Their Cells Are Larger Or Because They Have More Cells,
Or Both
The shoot meristems labeling index is compared with one of the wild-type plants. Morphological and anatomical observations measuring and counting cells of leaves, roots and stems are performed. To determine if 35S AVPl transgenic plants are larger because they have more cells, their shoot meristems labeling index is compared with the one of wild-type plants.
To measure the DNA synthesis or cell proliferation 5-Bromo-2'-deoxy- uridine (BrdU) that can be incorporated into DNA in place of thymidine may be used. Cells that have incorporated BrdU into DNA are detected using a monoclonal antibody against BrdU monoclonal antibody and an anti-mouse Ig-alkaline phosphatase as a second antibody. The bound anti-BrdU monoclonal antibody is visualized by light microscopy and the ratio between DAPI stained and BrdU positives established. The protocol is a modification of the one published by Chiatante and coworkers (Levi, M., et al, Physiol Plant. 77:68-72 (1987)) and the BrdU labeling and detection kit II from Boehringer Mannheim. The plants are exposed for different times to the BrdU labeling medium and then fixation, paraffin embedding and sectioning is performed as described by Meyerowitz and coworkers (Drews, G., et al, Plant Mol. Biol Rep., 5:242-250 (1988)).
For observation of leaf tissue, fresh tissues are embedded in 5% agarose and slice them with a microslicer. For primary root observation, seedlings are fixed for 4hr in 50% ethanol, 5% acetic acid, and 3.7% formaldehyde at room temperature, dehydrate them in graded ethanol series, permeate them with xylene, and infiltrate them with paraffin. Eight-micrometer sections are stained with 0.05% toluidine blue and cells are counted under a microscope. As an alternative for the visualization and determination of cell size the method described by Greenberg and coworkers (Rate, et al, The Plant Cell, 77:1695-1708 (1999)) is followed.
Example 14: Isolation Of Mutants In The Transporters
Genetic approaches are very powerful in analyzing complex biological traits (Senano, R., Crit. Rev. Plant Sci., 73:121-138 (1994)) Reverse genetics is a very important new tool for plant biologists. The generation of a good collection of tagged knockouts by Sussman and coworkers (Krysan, P., et al., Proc. Natl. Acad. Sci. USA, 93:8145-8150 (1996)) has open a very important avenue for the analysis of gene disruptions in Arabidopsis.
The Arabidopsis Knock-out Facility of the University of Wisconsin Madison (world wide web at biotech.wisc.edu/NewServicesAndResearch /Arabidopsis) is used to search among the 60,480 Arabidopsis (ecotype WS) lines that have been transformed with the T-DNA vector pD991 for the presence of T-DNA inserts within AtCLC-c, AtC C-d, AVPl, AtNHXl and their homologues. The phenotypes of the above knock-outs will shed light towards the understanding of the physiological roles of these transporters in normal and stress conditions. An initial characterization of the knockout plants includes testing for their salt tolerance and their Na+/K+ ratios. The generation of double knock-outs via crosses help to further understand the interaction among the transporters as well as the crosses with the 35SAVP1 and the 35S AtNHXl transgenic plants. To search for Arabidopsis knock-out PCR primers are designed following the guidelines detailed in the University of Wisconsin web site. Tested primers are sent to UW-Madison, where 62 PCR reactions that are sent to us for Southern blot analysis are performed. Positive PCR products are sequenced. If the sequence reveals that there is a T-DNA inserted within the gene the gene specific primers are sent for another set of PCR reactions in order to determine which of the 9 possible pools of 225 contains the knockout. After identifying the pool of interest, 25 tubes of seeds are screened for the individual plant carrying the T-DNA knock-out.
Example 15: Cation Detoxification In Plant Cells
The studies described herein together with other evidence strongly indicate that yeast and plants share pathways and signals for the trafficking of vesicles from Golgi network to the vacuole (Gaxiola, R., et al, Proc. Natl. Acad. Sci. USA, 96:1480-1485 (1999); Marty, F., "The Biogenesis of Vacuoles: Insights from Microscopy. In: The Plant Vacuole, 1-42, Leigh, R.A. and Sanders, D., Academic Press, San Diego (1997); Bassham, D.C., et al, Plant Physiol, 777:407-415 (1998)).
Without wishing to be bound by theory, it is believe likely by the present inventor that in both systems a pre-vacuolar compartment is a dynamic entity that detoxifies the cytoplasm from toxic cations and delivers its cargo either to the vacuole, or directly to the cell exterior. Both the gefl chloride channel and Nhxl Νa+/H+ exchanger have been localized to the yeast pre-vacuolar compartment (Gaxiola, R.A., et al, Proc. Natl Acad. Sci. USA, 96:1480-1485 (1999)). The behavior of the gefl-GFP chimera in yeast cells in vivo have been monitored indicating that its localization varies depending the environmental conditions. Furthermore, it has been shown that two of the four A. thaliana CLC chloride channel genes CLC-c and -d are capable of suppressing gefl mutant phenotypes implying a similar localization (Gaxiola, R.A., et al, Proc. Natl. Acad. Sci. USA, 95:4046-4050 (1998)).
In order to understand how and where this cation detoxification takes place in plant cells the intracellular localization of GFP chimeras of AVPl, AtNHXl and AtCLC-c and -d (Hong, B., et al, Plant Physiol, 779:1165-1175 (1999)) is monitored in vivo. Confocal microscopy is also used to address co-localization of the different transporters. For this purpose HA-tagged versions or antibodies of the transporters under study are required (Guiltinan, M.J., et al, Meth. Cell Biol, 49:143-151 (1995); Jauh, G. - Y., et al, Plant Cell, 77:1867-1882 (1999); Mullen, R.T., et al., Plant. J., 72:313-322 (1997)).
For the constructions of the GFP-chimeras the soluble versions GFP with improved fluorescence in A. thaliana reported by Davis and Viestra (Davies, S.J., Viestra, R.D., "Soluble derivatives of green fluorescent protein (GFP) for use in Arabidopsis thaliana, http:/ / brindabella.mrc-lmb.cam.ac.uk/IndexGFP.html (1998)) are used. Two types of GFP-chimeras are made, namely a set under the regulation of the native promoter and another set under the regulation of the 35S promoter. The resulting T-DNA vectors containing the GFP-chimeras are transformed into Agrobacterium tumefaciens strain GV3101 via electroporation, and used for subsequent vacuum infiltration of Arabidopsis thaliana ecotype Columbia (Bechtold, N., et al, C.R. Jeances Acad. Sci. Ser. Ill Sci. Vie, 316: 1194-1199 (1993)). For the hemagglutinin (HA) epitope tagging a PCR strategy designed for yeast but modified to tag plant genes expressed in yeast vectors is used. Futcher and coworkers designed vectors containing the URA3 yeast gene flanked by direct repeats of epitope tags (HA) (Schneider, B.L., et al, Yeast, 77:1265-1274 (1995)). Via PCR the tag-URA3-tag cassette is amplified such that the resulting PCR fragment possess homology at each end to the gene of interest. In vivo recombination in yeast is then used to direct the integration of the PCR-chimera to the plasmid carrying the plant ORF of interest, transformants are selected by the URA+ phenotype. The URA3 gene is "popped out" when positive transformants are grown in the presence of 5-fluoro-orotic acid. The vector carrying the plant gene has a selection marker different than the URA3 gene.
In conclusion, the manipulation of vacuolar V-PPases in economically important crops could provide an important avenue for crop improvement. Drought and freeze tolerant cultivars could provide new agricultural approaches in areas lost due to drought or minimal rainfall, as well as to provide farmers with protection from unanticipated frosts (freezing rain etc.). Such crops may also be able to be raised on soils considered too saline for wild type crops.
While the invention has been described with respect to prefened embodiments, those skilled in the art will readily appreciate that various changes and/or modifications can be made to the invention without departing from the spirit or scope of the invention as defined by the appended claims. All references cited in this specification are herein incorporated by reference to the same extent as if each individual reference was specifically and individually indicated to be incorporated by reference.

Claims

What is claimed is:
1. A gene cassette comprising a tonoplast pyrophosphate driven H+ pump gene operably linked to a chimeric promoter.
2. A gene cassette of claim 1 wherein the tonoplast pyrophosphate driven H+ pump gene is exogenous.
3. A coding sequence comprising a exogenous tonoplast pyrophosphate driven H+ pump gene operably linked to a double tandem enhancer of the 35S promoter.
4. An expression vector containing a polynucleotide sequence comprising a exogenous tonoplast pyrophosphate driven H+ pump gene operably linked to a double tandem enhancer of the 35 S promoter and further operatively linked to a multiple cloning site.
5. A drought and freeze resistant transgenic plant comprising a polynucleotide sequence comprising a exogenous tonoplast pyrophosphate driven H+ pump gene operably linked to a promoter.
6. A seed produced by the drought and freeze resistant transgenic plant of claim 5.
7. A progeny plant from the seed of claim 6.
8. A drought and freeze resistant transgenic plant containing a polynucleotide sequence comprising a exogenous tonoplast pyrophosphate driven H+ pump gene operably linked to a double tandem enhancer of the 35S promoter.
9. A transgenic plant containing a polynucleotide sequence comprising a multiplicity of exogenous tonoplast pyrophosphate driven H+ pump genes operably linked to a double tandem enhancer of the 35S promoter, wherein the number of pyrophosphate driven H+ pump genes is sufficient to express a sufficient number of pyrophosphate driven H+ pumps on the vacuolar membranes to produce drought and freeze resistance as compared to wild-type plants.
10. A transgenic plant which is tolerant to a salt, comprising one or more plant cells transformed with exogenous nucleic acid which alters expression of vacuolar pyrophosphatase in the plant.
11. The transgenic plant of Claim 10 wherein the exogenous nucleic acid encodes AVPl.
12. The transgenic plant of Claim 11 wherein the exogenous nucleic acid encodes a homologue of AVP 1.
13. The transgenic plant of Claim 12 wherein the homologue of AVPl is obtained from tobacco, bacteria, tomato or corn.
14. The transgenic plant of Claim 12 wherein the AVPl is present in a construct designed to overexpress AVPl or designed to down regulate endogenous pyrophosphatase.
15. The transgenic plant of Claim 14 wherein the construct comprises AVPl operably linked to a double tandem enhancer of a 35S promoter.
16. The transgenic plant of Claim 12 wherein the AVPl is derived from a wild type plant that conesponds to a wild type of the transgenic plant.
17. The transgenic plant of Claim 12 wherein the AVPl is derived from a wild type plant that does not conespond to a wild type of the transgenic plant .
18. A transgenic plant which grows in a concentration of a salt that inhibits growth of a conesponding non-transgenic plant.
19. The transgenic plant of Claim 18 wherein the concentration of salt is about 0.2M to about 0.3M.
20. The transgenic plant of Claim 11 wherein the plant is larger than a conesponding non-transgenic plant.
21. A transgenic progeny of the transgenic plant of Claim 11.
22. Seeds produced by the transgenic plant of Claim 11.
23. A progeny transgenic plant grown from seed of Claim 22.
24. A transgenic plant which is tolerant to a salt comprising an exogenous nucleic acid construct which is designed to overexpresses AVPl or designed to down regulate endogenous pyrophosphatase.
25. A transgenic progeny of the transgenic plant of Claim 24.
26. Seeds produced by the transgenic plant of Claim 24.
27. A progeny transgenic plant grown from seed of Claim 26.
28. The transgenic plant of Claim 14 wherein the construct comprises an AVPl gene operably linked to a double tandem enhancer of a 35S promoter.
29. A construct comprising an AVPl gene operably linked to a chimeric promoter designed to overexpress AVPl or designed to down regulate endogenous pyrophosphatase.
30. The construct of Claim 29 wherein the AVPl gene is operably linked to a double tandem enhancer of a 35S promoter.
31. A transgenic plant obtained by introducing into a plant exogenous nucleic acid which alters expression of vacuolar pyrophosphatase in the plant.
32. Plant cells comprising exogenous nucleic acid which alters expression of vacuolar pyrophosphatase in the plant cell.
33. The plant cells of Claim 32 wherein the plant cells are root cells or stem cells.
34. The plant cells of Claim 32 wherein the exogenous nucleic acid encodes AVPl . 45
35. The plant cells of Claim 34 wherein the AVPl is present in a construct designed to overexpress AVPl or designed to down regulate endogenous pyrophosphatase.
36. The plant cells of Claim 35 wherein the construct comprises the AVPl gene operably linked to a chimeric promoter designed to overexpress AVPl.
37. The plant cells of Claim 36 wherein the AVPl gene is operably linked to a double tandem enhancer of a 35S promoter.
38. The plant cells of Claim 34 wherein the AVPl is derived from a wild type plant that conesponds to a wild type of the transgenic plant.
39. The plant cells of Claim 34 wherein the AVPl is derived from a wild type plant that does not conespond to a wild type of the transgenic plant.
40. A method of making a transgenic plant which is tolerant to a salt comprising introducing into one or more cells of a plant exogenous nucleic acid which alters expression of vacuolar pyrophosphatase in the plant to yield transformed cells in the plant, thereby producing a transgenic plant which is tolerant to the salt.
41. The method of Claim 40 further comprising regenerating plants from the transformed cells to yield transgenic plants and selecting a transgenic plant which is tolerant to the salt, thereby producing a transgenic plant which is tolerant to the salt.
42. The method of Claim 40 wherein the exogenous nucleic acid encodes AVPl .
43. The method of Claim 42 wherein the AVPl is present in a construct designed to overexpress AVPl or designed to down regulate endogenous pyrophosphatase.
44. The method of Claim 43 wherein the construct comprises the AVPl gene operably linked to a chimeric promoter designed to overexpress AVPl .
45. The method of Claim 44 wherein the AVPl gene is operably linked to a double tandem enhancer of a 35S promoter.
46. The method of Claim 42 wherein the AVPl is derived from a wild type plant that conesponds to a wild type of the transgenic plant.
47. The method of Claim 42 wherein the AVPl is derived from a wild type plant that does not conespond to a wild type of the transgenic plant.
48. The method of Claim 40 wherein the plant is tolerant to a concentration of salt that inhibits growth of a conesponding non-transgenic plant.
49. The transgenic plant of Claim 48 wherein the concentration of salt is about 0.2M to about 0.3M.
50. A transgenic plant produced by the method of Claim 40.
51. A method of making a transgenic plant which is tolerant to a salt comprising introducing into one or more cells of a plant a nucleic acid construct which is designed to overexpress AVPl to yield transformed cells thereby producing a transgenic plant which is tolerant to the salt.
52. The method of Claim 51 further comprising regenerating plants from the transformed cells to yield transgenic plants and selecting a transgenic plant which is tolerant to the salt, thereby producing a transgenic plant which is tolerant to the salt.
53. A transgenic plant produced by the method of Claim 51.
54. A method of making a transgenic plant which is larger than its conesponding wild type plant comprising introducing into one or more cells of a plant nucleic acid which alters expression of vacuolar pyrophosphatase in the plant to yield transformed cells, thereby producing a transgenic plant which is larger than its conesponding wild type plant.
55. The method of Claim 54 further comprising regenerating plants from the transformed cells to yield transgenic plants and selecting a transgenic plant which is larger than its conesponding wild type plant, thereby producing a transgenic plant which is larger than its conesponding wild type plant.
56. The method of Claim 54 wherein the exogenous nucleic acid encodes AVP 1.
57. The method of Claim 56 wherein the AVPl is present in a construct designed to overexpress AVPl or designed to down regulate endogenous pyrophosphatase.
58. The method of Claim 57 wherein the construct comprises the AVPl gene operably linked to a chimeric promoter designed to overexpress AVPl.
59. The method of Claim 48 wherein the AVPl gene is operably linked to a double tandem enhancer of a 35S promoter.
60. The method of Claim 56 wherein the AVP 1 is derived from a wild type plant that conesponds to a wild type of the transgenic plant.
61. The method of Claim 56 wherein the AVP 1 is derived from a wild type plant that does not conespond to a wild type of the transgenic plant.
62. The method of Claim 54 wherein the transgenic plant is grown in soil.
63. The method of Claim 54 wherein the transgenic plant is grown hydroponically.
64. A transgenic plant produced by the method of Claim 54.
65. A method of bioremediating soil comprising growing one or more transgenic plants and/or progeny thereof in the soil, wherein the transgenic plants and/or progeny thereof comprise exogenous nucleic acid which alters expression of vacuolar pyrophosphatase in the plant.
66. A method of increasing the yield of a plant comprising introducing into one or more cells of a plant nucleic acid which alters expression of vacuolar pyrophosphatase in the plant to yield transformed cells, thereby increasing the yield of the plant.
67. The method of Claim 66 further comprising regenerating plants from the transformed cells to yield transgenic plants and selecting a transgenic plant which is larger than its conesponding wild type plant, thereby increasing the yield of the plant.
68. A method of removing cations from a medium which can support plant growth comprising growing one or more transgenic plants and/or progeny thereof in the medium, wherein the transgenic plants and/or progeny thereof comprise exogenous nucleic acid which alters expression of vacuolar pyrophosphatase in the plant.
69. The method of Claim 68 wherein the medium is selected from the group consisting of: soil and water.
70. The method of Claim 68 wherein the cations are selected from the group consisting of: sodium, calcium, manganese and lead.
71. A method of producing a transgemc plant which grows in salt water comprising introducing into one or more cells of a plant exogenous nucleic acid which alters expression of vacuolar pyrophosphatase in the plant to yield transformed cells, thereby producing a transgenic plant which can grow in salt water.
72. The method of Claim 71 further comprising regenerating plants from the transformed cells to yield transgenic plants and selecting a transgenic plant which grow in salt water, thereby producing a transgenic plant which can grow in salt water.
73. The method of Claim 71 wherein the concentration of the salt water is from about 0.2M to about 0.3M.
74. The method of Claim 73 wherein the salt water is seawater.
75. A transgenic plant which is tolerant to a salt, comprising one or more plant cells transformed with exogenous nucleic acid which alters expression of a vacuolar pyrophosphatase and an NaNH4" antiporter in the plant.
76. The transgenic plant of Claim 75 wherein the vacuolar pyrophosphatase is AVPl or a homologue thereof.
77. The transgenic plant of Claim 76 wherein the homologue of AVPl is from tobacco, bacteria, tomato or corn.
78. The transgenic plant of Claim 76 wherein the AVPl is present in a construct designed to overexpress AVPl or designed to down regulate endogenous pyrophosphatase.
79. The transgenic plant of Claim 78 wherein the construct comprises AVPl operably linked to a double tandem enhancer of a 35S promoter.
80. The transgenic plant of Claim 75 wherein the Na+/H+ antiporter is AtNHXl or a homologue thereof.
81. A transgenic progeny of the transgenic plant of Claim 75.
82. Seeds produced by the transgenic plant of Claim 75.
83. A progeny transgenic plant grown from the seed of Claim 72.
84. A method of making a transgenic plant having increased flower size compared to its conesponding wild type plant comprising introducing into one or more cells of a plant nucleic acid which alters expression of vacuolar pyrophosphatase in the plant to yield transformed cells, thereby producing a transgenic plant having increased flower size compared to its conesponding wild type plant.
85. The method of Claim 84 wherein the exogenous nucleic acid encodes AVPl .
86. A transgenic plant produced by the method of Claim 84.
EP00980337A 1999-11-10 2000-11-10 Stress-resistant oversized transgenic plants capable of growing in salinized soil Withdrawn EP1231831A4 (en)

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
US16480899P 1999-11-10 1999-11-10
US164808P 1999-11-10
US22622300P 2000-08-18 2000-08-18
US226223P 2000-08-18
US64403900A 2000-08-22 2000-08-22
US644039 2000-08-22
PCT/US2000/030955 WO2001033945A1 (en) 1999-11-10 2000-11-10 Stress-resistant oversized transgenic plants capable of growing in salinized soil

Publications (2)

Publication Number Publication Date
EP1231831A1 true EP1231831A1 (en) 2002-08-21
EP1231831A4 EP1231831A4 (en) 2004-06-30

Family

ID=27389067

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00980337A Withdrawn EP1231831A4 (en) 1999-11-10 2000-11-10 Stress-resistant oversized transgenic plants capable of growing in salinized soil

Country Status (10)

Country Link
EP (1) EP1231831A4 (en)
JP (1) JP2003516727A (en)
CN (1) CN1399512A (en)
AU (1) AU782483B2 (en)
BR (1) BR0015636A (en)
CA (1) CA2390719C (en)
HK (1) HK1052274A1 (en)
MX (1) MXPA02004713A (en)
NZ (1) NZ519362A (en)
WO (1) WO2001033945A1 (en)

Families Citing this family (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020178464A1 (en) 1999-11-10 2002-11-28 Whitehead Institute For Biomedical Research Proton transporters and uses in plants
US8697950B2 (en) 1999-11-10 2014-04-15 University Of Connecticut Vacuolar pyrophosphatases and uses in plants
US7534933B2 (en) 2000-08-18 2009-05-19 University Of Connecticut Transgenic plants overexpressing a plant vacuolar H + -ATPase
ES2258489T3 (en) * 1999-12-22 2006-09-01 Basf Plant Science Gmbh PROTEINS RELATED TO STRESS BY PYROPHOSPHATES AND METHODS OF USE IN PLANTS.
JP3488910B2 (en) 2000-04-27 2004-01-19 奈良先端科学技術大学院大学長 Transformed plant cell having lithium ion or sodium ion excretion function
US7186561B2 (en) 2000-08-25 2007-03-06 Basf Plant Science Gmbh Plant polynucleotides encoding novel Na+/H+ antiporters
ATE429502T1 (en) * 2001-05-31 2009-05-15 Performance Plants Inc COMPOSITIONS AND METHODS FOR INCREASE STRESS TOLERANCE IN PLANTS
AU2003248923B2 (en) * 2002-07-12 2008-09-25 The Regents Of The University Of California Improved transporters and their uses
WO2005019462A1 (en) * 2003-08-18 2005-03-03 Ceres, Inc. Nucleotide sequences and polypeptides encoded thereby useful for increasing plant size and increasing the number and size of leaves
EP2500433A3 (en) * 2006-06-29 2013-02-20 Mendel Biotechnology, Inc. Improved yield and stress tolerance in transgenic plants
CN101490079B (en) * 2006-07-17 2012-08-22 北京北方杰士生物科技有限责任公司 Isozymes related to plant growth and stress tolerance and their coding genes and applications
CN101643745B (en) * 2009-09-09 2011-11-23 山东大学 The Promoter Sequence of Salmus V-pyrophosphatase Gene and the Application of Its Deletion Mutant
DE112010003738T5 (en) * 2009-10-22 2013-08-14 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
WO2013181802A1 (en) * 2012-06-06 2013-12-12 创世纪转基因技术有限公司 Cotton avp1 protein and coding gene and application thereof
CN105073773B (en) * 2013-04-22 2018-06-22 创世纪种业有限公司 A kind of small salt mustard tonoplast pyrophosphatase VP1 and its encoding gene and application
WO2015042734A1 (en) * 2013-09-25 2015-04-02 创世纪种业有限公司 Bruguiera gymnorhiza vacuolar pyrophosphatase vp2, coding gene of same, and application thereof
WO2015042736A1 (en) * 2013-09-26 2015-04-02 创世纪转基因技术有限公司 Vacuole pyrophosphatase vp1 from bruguiera gymnorhiza, and coding gene and use thereof
CN105830763A (en) * 2016-04-12 2016-08-10 扬州大学 Application of hygromycin serving as selective agent in wheat transformation
CN108728478B (en) * 2017-04-20 2021-08-27 中国科学院分子植物科学卓越创新中心 Method for improving yield and starch property by using hydrogen ion pyrophosphorylase
CN111675757B (en) * 2020-07-16 2022-04-12 南京农业大学 Du pear vacuole type proton pump PbVHA-B1 and application thereof in plant salt-resistant genetic improvement

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5780709A (en) * 1993-08-25 1998-07-14 Dekalb Genetics Corporation Transgenic maize with increased mannitol content
AU8604898A (en) * 1997-07-30 1999-02-22 Purdue Research Foundation Transgenic plants tolerant of salinity stress
CA2323756C (en) * 1998-03-18 2010-09-21 Eduardo Blumwald Genetic engineering salt tolerance in crop plants

Also Published As

Publication number Publication date
WO2001033945A1 (en) 2001-05-17
CA2390719A1 (en) 2001-05-17
JP2003516727A (en) 2003-05-20
NZ519362A (en) 2004-05-28
EP1231831A4 (en) 2004-06-30
BR0015636A (en) 2002-07-09
CA2390719C (en) 2018-11-27
WO2001033945A8 (en) 2002-07-25
AU782483B2 (en) 2005-08-04
AU1761301A (en) 2001-06-06
CN1399512A (en) 2003-02-26
HK1052274A1 (en) 2003-09-11
MXPA02004713A (en) 2004-09-10

Similar Documents

Publication Publication Date Title
US8003852B2 (en) Transgenic plants overexpressing a plant vacuolar pyrophosphatase
US8058515B2 (en) Plant cells and plants overexpressing vacuolar proton pyrophosphatases
CA2390719C (en) Method of transforming plants with vacuolar pyrophosphatase and stress-resistant oversized plants produced by the method
US7041875B1 (en) Genetic engineering salt tolerance in crop plants
US8697950B2 (en) Vacuolar pyrophosphatases and uses in plants
CA2323756C (en) Genetic engineering salt tolerance in crop plants
KR20010104316A (en) Sodium/proton countertransporter gene
CN107105627B (en) Methods for monocot plant improvement
KR20080048368A (en) Genes that change the resistance of heavy metals or salts, or resistance to heavy metals, salts, or drying, and transformants prepared using the same
AU2001250974B2 (en) Enhanced meristematic activity and competence by overexpression of tonoplast pyrophosphatase
WO2002015674A1 (en) Enhanced meristematic activity and competence by overexpression of tonoplast pyrophosphatase
US7442852B2 (en) High salt plants and uses for bioremediation
AU2001250974A1 (en) Enhanced meristematic activity and competence by overexpression of tonoplast pyrophosphatase
NZ524616A (en) Enhanced meristematic activity and competence by overexpression of tonoplast pyrophosphatase
US20110016579A1 (en) Gene of transporter selective to mugineic acid-iron complex
AU2001285459B9 (en) Methods for imparting desirable phenotypic traits, including drought, freeze, and high salt tolerance and methods for increasing seed production
CA2492099A1 (en) Improved transporters and their uses
CA2648516A1 (en) Abiotic stress tolerant gene from avicennia marina encoding a protein

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020610

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

A4 Supplementary search report drawn up and despatched

Effective date: 20040513

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20040702