EP1224303A2 - Tms1 compositions and methods of use - Google Patents

Tms1 compositions and methods of use

Info

Publication number
EP1224303A2
EP1224303A2 EP00973614A EP00973614A EP1224303A2 EP 1224303 A2 EP1224303 A2 EP 1224303A2 EP 00973614 A EP00973614 A EP 00973614A EP 00973614 A EP00973614 A EP 00973614A EP 1224303 A2 EP1224303 A2 EP 1224303A2
Authority
EP
European Patent Office
Prior art keywords
tmsl
seq
nucleic acid
polypeptide
molecule
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00973614A
Other languages
German (de)
French (fr)
Inventor
Paula M. Vertino
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Emory University
Original Assignee
Emory University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Emory University filed Critical Emory University
Publication of EP1224303A2 publication Critical patent/EP1224303A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/154Methylation markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • This invention relates to nucleic acid molecules and polypeptides of TMS 1 , a novel apoptotic regulatory gene silenced as a result of abnormal methylation, and their use in diagnosis and treatment regimens.
  • Methylation of bases in DNA serves a number of cellular functions. In bacteria, methylation of cytosine and adenine residues plays a role in the regulation of DNA replication and DNA repair. DNA methylation also constitutes part of a immune mechanism that allows these organisms to distinguish between self and non-self DNA. In mammalian species, DNA methylation occurs only at cytosine residues, and specifically at cytosine residues that lie next to a guanosine residue, i.e., within the sequence CG. Methylation of DNA is carried out by methyltransferases (sometimes called methylases). Generally both DNA strands can accept methyl groups at opposing CG sites.
  • methyltransferases sometimes called methylases
  • CpG 'islands' are rich in CG sites and are often found near coding regions within the genome (i.e., genes). About half of the genes in the human genome are associated with CpG islands. Importantly, the vast majority of CpG islands in the genome remain unmethylated in normal adult cells and tissues.
  • Methylation of CpG islands is normally seen only on the inactive X-chromosome in females and at imprinted genes where it functions in the stable silencing of such genes. Strict control over the levels and distribution of DNA methylation are essential to normal animal development.
  • Alterations in DNA methylation are one manifestation of the genome instability characteristic of human tumors.
  • a hallmark of human carcinogenesis is the loss of normal constraints on cell growth resulting from genetic alterations in the genes that control cell growth.
  • the consequences of such mutations include the activation of positive growth signals and the inactivation of growth inhibitory signals.
  • Gene function can be lost through mutation or deletion.
  • An alternative mechanism by which gene function can be lost is aberrant DNA methylation. Accordingly, such methylation events can be viewed as key steps in both the initiation and progression of neoplastic disease.
  • the invention relates to the diagnosis and treatment, both prophylactically and therapeutical ly, of disorders characterized by abnormal expression profiles of TMS 1.
  • Abnormal expression profiles of TMSl include decreased or absent expression of wild-type TMSl mRNA and/or polypeptides, as well as expression of mutant TMS 1 mRNA or polypeptides.
  • the net result of such abnormal TMS 1 expression profiles is a reduction in TMSl activity, which can be accomplished by, among other things, reduced transcription from the TMSl genomic locus, reduced translation of TMSl mRNA, reduced production of functional TMSl polypeptides, and increased production of mutant, including dominant negative, forms of TMSl polypeptides.
  • the invention is directed at diagnosing and treating disorders characterized by abnormally low levels of TMSl expression products, such as TMSl mRNA and polypeptides.
  • TMSl mRNA and polypeptides One preferred subset of such disorders intended for treatment are those characterized by abnormal methylation of the TMSl genomic locus (i.e., a CpG island containing TMSl nucleic acid molecule).
  • the invention involves, in one aspect, the molecular cloning and characterization of TMSl, a novel polypeptide believed important for normal cell growth.
  • TMS 1 polypeptides exert their normal effects by inducing apoptosis in cells, when and where appropriate. It has been discovered that malignant cells manifest increased methylation of TMSl genomic DNA sequences and corresponding decreased expression of TMSl mRNA and polypeptides relative to normal counterparts. It follows that in order for a malignant cell to ensure survival and propagation, inactivation of a cell death mediator, such as TMSl, may be required. In this regard, TMS 1 may be considered a tumor-suppressor, since it may be normally involved in the negative selection of pre-malignant and malignant cells in vivo.
  • the invention provides isolated nucleic acid molecules, unique fragments of those molecules, expression vectors containing the foregoing, and host cells transfected with those molecules.
  • the invention also provides agents which bind TMSl polypeptides, including antibodies.
  • the foregoing can be used in the diagnosis or treatment of conditions characterized by a decreased expression level and/or an absence of TMSl mRNA or polypeptides.
  • One particularly important subset of disorders is those in which the decreased levels of TMSl expression products result from an abnormal methylation of the CpG island in the TMSl genomic locus.
  • the invention also provides methods for identifying pharmacological agents useful in the diagnosis or treatment of such conditions.
  • isolated nucleic acid molecules that code for a native polypeptide include: (a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule consisting of a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24, and which code for a native polypeptide, (b) deletions, additions and substitutions of (a) which code for an apoptosis-inducing polypeptide, (c) nucleic acid molecules that differ from the nucleic acid molecules of (a) or (b) in codon sequence due to the degeneracy of the genetic code, and (d) complements of (a), (b) or (c).
  • the isolated nucleic acid hybridizes to a complement of a molecule consisting of a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:2, and SEQ ID NO:24. In other embodiments, the isolated nucleic acid hybridizes to a complement of a molecule consisting of a nucleotide sequence selected from the group consisting of SEQ ID NO:20, SEQ ID NO:22. In yet further embodiments, the isolated nucleic acid hybridizes to a complement of a molecule consisting of a nucleotide sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:9.
  • the isolated nucleic acid molecule comprises a nucleotide sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24. In other embodiments, the isolated nucleic acid molecule comprises a nucleotide sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:9. In still other embodiments, the isolated nucleic acid molecule comprises a nucleotide sequence of SEQ ID NO:26.
  • the isolated nucleic acid molecules are those which code for a polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25.
  • the native polypeptide is a native TMSl polypeptide.
  • a native TMSl polypeptide is one which possesses a native TMSl function or activity, such as apoptosis induction. Sequence homoiogy has revealed that TMS 1 contains a caspase recruiting domain (i.e., a CARD).
  • a CARD caspase recruiting domain
  • another function of a native TMSl polypeptide is the ability to bind to either itself or to other CARD containing proteins, specifically through the CARD.
  • the invention in another aspect provides an isolated nucleic acid molecule selected from the group consisting of (a) a unique fragment of nucleic acid molecule of SEQ ID NO: l, of sufficient length to represent a sequence unique within the human genome, and (b) complements of (a), provided that the fragment includes a sequence of contiguous nucleotides which is not identical to a sequence selected from the sequence group consisting of (1) sequences having the GenBank and EMBL accession numbers of Table I, and having been published prior to the priority date or filing date, and (2) complements of (1).
  • the sequence of contiguous nucleotides is selected from the group consisting of (1) at least two contiguous nucleotides nonidentical to the sequence group, (2) at least three contiguous nucleotides nonidentical to the sequence group, (3) at least four contiguous nucleotides nonidentical to the sequence group, (4) at least six contiguous nucleotides nonidentical to the sequence group, (5) at least eight contiguous nucleotides nonidentical to the sequence group, (6) at least ten contiguous nucleotides nonidentical to the sequence group.
  • the unique fragment has a size selected from the group consisting of at least: 8 nucleotides, 10 nucleotides, 12 nucleotides, 14 nucleotides, 16 nucleotides, 18 nucleotides, 20, nucleotides, 22 nucleotides, 24 nucleotides, 26 nucleotides, 28 nucleotides, 30 nucleotides, 40 nucleotides, 50 nucleotides, 75 nucleotides, 100 nucleotides, 200 nucleotides, 1000 nucleotides and every integer length therebetween as if fully recited herein.
  • the unique fragment encodes a peptide which is a fragment of a polypeptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NO:3 and SEQ ID NO:25.
  • the invention provides expression vectors, and host cells transformed or transfected with such expression vectors, comprising the nucleic acid molecules described above.
  • the invention provides an isolated nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:4.
  • SEQ ID NO:4 represents the nucleotide sequence of nucleotides 1 100-1725 of SEQ ID NO: 1, corresponding to a CpG island in the TMSl genomic sequence.
  • an expression vector comprising the isolated nucleic acid molecule comprising a nucleotide sequence of SEQ ID NO:4, or a regulatory fragment thereof, operably linked to a reporter coding sequence.
  • the reporter coding sequence comprises a promoter.
  • TMS 1 regulatory sequences of TMS 1 are provided including those of introns 1 and 2 in SEQ ID NO: 1.
  • Intron 1 in SEQ ID NO: 1 corresponds to nucleotides 1530- 1742 and intron 2 in SEQ ID NO:2 corresponds to nucleotides 1800-2104.
  • an isolated polypeptide is provided.
  • the isolated polypeptide is encoded by the foregoing isolated nucleic acid molecules of the invention.
  • Preferably the isolated polypeptide is a native TMSl polypeptide.
  • the isolated polypeptide consists of an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25.
  • an isolated peptide which comprises a fragment or variant of a polypeptide (such as one consisting of an amino acid sequence of SEQ ID NO:3 or SEQ ID NO:25) of sufficient length to represent a sequence unique within the human genome, and to identify a native TMSl polypeptide.
  • the isolated peptide may comprise at least 6, at least 8, at least 9, at least 10, at least 11, at least 12, at least 14, at least 16, at least 18 or at least 20 contiguous amino acids having a sequence of a fragment of SEQ ID NO:3 or SEQ ID NO:25.
  • Isolated peptides which are immunogenic are also provided.
  • compositions which comprise an isolated agent that binds selectively to a native TMSl polypeptide encoded by the foregoing isolated nucleic acid molecules of the invention.
  • the isolated agent binds selectively to a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21 , SEQ ID NO:23 and SEQ ID NO:25, or a fragment thereof.
  • the isolated agent may selectively bind to a polypeptide comprising an amino acid sequence of SEQ ID NO:21 or SEQ ID NO:23 or SEQ ID NO:25.
  • the isolated agent is a peptide.
  • the peptide is an antibody or a fragment thereof (e.g., Fab, F(ab) 2 , Fd and antibody fragments which include a CDR3 region which binds selectively to the native TMSl polypeptide).
  • the antibody is a humanized antibody or a chimeric antibody.
  • the isolated agent may be conjugated to a detectable label.
  • the detectable label may be selected from the group consisting of a radioactive label, an enzyme, a biotin molecule, an avidin molecule or a fluorochrome.
  • a method for identifying a subject at risk of developing a disorder characterized by abnormal methylation of a CpG island containing TMSl nucleic acid molecule.
  • the method involves determining a level of methylation of a CpG island containing TMSl nucleic acid molecule in a biological sample from a subject, and comparing the level of methylation of the CpG island containing TMSl nucleic acid molecule in the biological sample to a control.
  • the CpG island containing TMSl nucleic acid molecule is selected from the group consisting of (a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule consisting of SEQ ID NO:4 and which code for a native TMSl polypeptide, and (b) complements of (a).
  • an increase in the level of methylation of the CpG island containing TMS 1 nucleic acid molecule in the biological sample compared to the control identifies a subject at risk of developing the disorder.
  • the disorder may be a tumor.
  • the level of methylation is determined using a technique selected from the group consisting of methylation-sensitive restriction analysis, methylation specific polymerase chain reaction (MSP), sequencing of bisulfite-modified DNA, methylation-sensitive single nucleotide primer extension (Ms-SNuPE), and combined bisulfite restriction analysis (COBRA) .
  • MSP methylation specific polymerase chain reaction
  • Ms-SNuPE methylation-sensitive single nucleotide primer extension
  • COBRA combined bisulfite restriction analysis
  • the biological sample may be selected from the group consisting of breast tissue, ovarian tissue, prostatic tissue, cervical tissue, peripheral blood and bone marrow.
  • the biological sample is breast tissue.
  • the control comprises a normal tissue from a normal subject, or normal appearing tissue adjacent to a tumor.
  • the invention provides a method for determining a risk of developing a disorder characterized by abnormal methylation of a CpG island containing TMSl nucleic acid molecule.
  • the method in this latter aspect involves measuring a level of an expression product of a CpG island containing TMSl nucleic acid molecule, by contacting a biological sample isolated from a subject with an agent that selectively binds to a target expression product, determining a level of interaction between the agent and the target expression product, and comparing the level of interaction between the agent and the target expression product with a control.
  • the target expression product is selected from the group consisting of (a) nucleic acid expression products which hybridize under stringent conditions to a complement of a molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NO:2 and SEQ ID NO:24 and which code for a native TMSl polypeptide, and (b) polypeptide expression products, and fragments thereof, of (a).
  • the control comprises a normal tissue from a normal subject.
  • a decrease in the level of interaction between the agent and the target expression molecule in the biological sample compared to the control indicates a risk of developing the disorder.
  • the disorder is a proliferative disorder.
  • the disorder is cancer.
  • the cancer is breast cancer.
  • the agent in one embodiment, is a nucleic acid molecule.
  • the agent is a peptide.
  • the peptide is an antibody or a fragment thereof.
  • various methods can be used to measure expression, including Northern analysis, reverse-transcriptase polymerase chain reaction (RT-PCR), immunohistochemistry and Western analysis.
  • the invention in yet another aspect provides a method for treating a subject having, or at risk of developing, a disorder characterized by abnormal methylation of a CpG island containing TMSl nucleic acid molecule.
  • a method for treating a subject having, or at risk of developing, a disorder, perhaps in a tissue, characterized by abnormally low levels of a TMSl expression product. Both methods comprise administering a demethylating agent to a subject in need of such treatment in an amount effective. The effective amount is dependent upon the subject to be treated.
  • the demethylating agent is administered in an amount effective to maintain a normal level of methylation in a CpG island containing TMSl nucleic acid molecule in a tissue of the subject. If, on the other hand, the subject has the disorder, then preferably the demethylating agent is administered in an amount effective to reduce the level of methylation in a CpG island containing TMSl nucleic acid molecule in a tissue of the subject. In an important embodiment, the level of methylation in the CpG island containing TMSl nucleic acid molecule is reduced compared to a pre-treatment level of methylation.
  • the method further comprises first selecting a subject in need of such treatment.
  • the disorder is cancer.
  • the cancer is breast cancer.
  • the method further comprises administering a disorder-specific therapy to a subject so identified as at risk of developing the disorder.
  • the disorder is a cancer
  • the subject is administered an anti-cancer therapy.
  • the anti-cancer therapy is administered once the level of methylation in a CpG island containing TMSl nucleic acid molecule in a tissue of the subject is reduced.
  • the CpG island containing TMSl nucleic acid molecule is selected from the group consisting of (a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule comprising SEQ ID NO:4, and which code for a native TMSl polypeptide, and (b) complements of (a).
  • the demethylating agent is administered to a tissue at risk of developing a tumor.
  • the demethylating agent is administered locally within a subject in the area of the tissue.
  • the demethylating agent may be an inhibitor of methyltransferase.
  • the inhibitor of methyltransferase is selected from the group consisting of 5- azacytidine, 5-aza-2'deoxycytidine (also known as Decitabine in Europe), 5, 6-dihydro-5-azacytidine, 5, 6-dihydro-5-aza-2'deoxycytidine, 5-fluorocytidine, 5-fluoro-2'deoxycytidine, and short oligonucleotides containing 5-aza-2'deoxycytosine, 5, 6-dihydro-5-aza-2'deoxycytosine, and 5-fIuoro- 2'deoxycytosine.
  • the demethylating agent may be conjugated to, or more preferably incorporated into, a nucleic acid molecule.
  • the nucleic acid molecule may be selected from the group consisting of (a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule comprising SEQ ID NO: 1, and (b) complements of (a). Alternatively, the sequence may be unrelated to SEQ ID NO: 1 or complements thereof.
  • the invention provides another method for treating a subject having, or at risk of developing, a disorder characterized by abnormal methylation of a CpG island containing TMSl nucleic acid molecule.
  • another method is provided for treating a subject having, or at risk of having, a disorder characterized by abnormally low levels of a TMS 1 expression product.
  • the methods involve administering a CARD containing molecule to a subject in need of such treatment in an amount effective to increase CARD polypeptide level in a tissue of the subject.
  • the methods involve administering a CARD containing molecule to a subject in need of such treatment, preferably in an amount effective to establish or maintain a normal level of CARD polypeptide in a tissue of the subject.
  • the method may further comprise first selecting a subject having or at risk of developing the disorder.
  • the disorder is cancer.
  • the cancer is breast cancer.
  • the level of the CARD polypeptide is increased relative to a pre-treatment level.
  • the CARD containing molecule is selected from the group consisting of a CARD containing nucleic acid molecule and CARD containing polypeptide.
  • the CARD containing molecule is a TMSl molecule.
  • the TMSl molecule may be selected from the group consisting of a TMSl nucleic acid molecule or a TMSl polypeptide.
  • the CARD containing nucleic acid molecule comprises an nucleotide sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:2, SEQ ID NO:9, SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24.
  • the CARD containing polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25, and is preferably selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25.
  • the CARD containing molecule is administered to a tissue having, or at risk of developing, the disorder (e.g., a tumor).
  • the disorder is cancer.
  • the cancer may be breast cancer, but is not so limited.
  • the invention in another aspect involves a method for increasing TMSl expression in a subject that fails to express a normal level of wild-type TMS 1 or expresses a mutant TMS 1.
  • An isolated TMSl nucleic acid molecule of the invention or an expression product thereof, including mRNA and/or polypeptide, is administered to such a subject, in an amount effective to increase wild- type TMSl expression in the subject.
  • the invention provides a method for determining the risk of a subject being non-responsive to a disorder-specific therapy and a method for identifying a subject who is at risk of being non-responsive to disorder-specific therapy.
  • the subject has cancer
  • the disorder-specific therapy is an anti-cancer therapy or an anti-proliferative therapy.
  • the methods involve determining a level of methylation of a CpG island containing TMSl nucleic acid molecule in a biological sample from a subject having a disorder (e.g., cancer), and comparing the level of methylation of the CpG island containing TMSl nucleic acid molecule in the biological sample to a control.
  • the CpG island containing TMSl nucleic acid molecule is as described herein according to other aspects of the invention.
  • an increase in the level of methylation of the CpG island containing TMSl nucleic acid molecule in the biological sample compared to the control identifies a subject who is at risk of being non- responsive to the disorder-specific therapy (e.g., anti-cancer therapy).
  • the level of methylation is determined using techniques such as those listed above for other aspects of the invention.
  • methods for determining the risk of a subject being non- responsive to a disorder-specific therapy and identifying a subject who is at risk of being non- responsive to a disorder-specific therapy by measuring a level of an expression product of a CpG island containing TMSl nucleic acid molecule in a tissue in a subject.
  • the subject has the disorder and the disorder exists in the tissue being tested.
  • the methods involve contacting a biological sample isolated from a subject with an agent that selectively binds to a target expression product, determining a level of interaction between the agent and the target expression product, and comparing the level of interaction between the agent and the target expression product with a control.
  • the target expression product can be selected from the group consisting of (a) nucleic acid expression products which hybridize under stringent conditions to a complement of a molecule comprising SEQ ID NO:2 and which code for a native TMSl polypeptide, and (b) polypeptide expression products, and fragments of (a) or (b).
  • the control comprises a normal tissue from a normal subject.
  • the control is normal tissue from the subject having cancer.
  • a decrease in the level of interaction between the agent and the target expression molecule in the biological sample compared to the control indicates a risk of developing the disorder.
  • the disorder is a proliferative disorder.
  • the disorder is cancer.
  • the cancer may be breast cancer, but is not so limited.
  • the biological sample is a breast cancer tumor.
  • the agent in one embodiment, is a nucleic acid molecule.
  • the agent is a peptide.
  • the peptide is an antibody or a fragment thereof.
  • various methods can be used to measure expression, including Northern analysis, reverse-transcriptase polymerase chain reaction (RT-PCR), immunohistochemistry, and Western analysis.
  • the disorder-specific therapy may be anti-cancer therapy. In some embodiments, it is a DNA- damaging anti-cancer therapy.
  • a DNA damaging anti-cancer therapy is a therapy that is effective due to its ability to induce DNA damage and, thus ultimately, lead to the death of the cell via apoptosis.
  • the DNA damaging anti-cancer therapy is radiation therapy or some form of chemotherapy.
  • the method may further comprise administering to the subject an anti-cancer therapy which is not dependent upon DNA damage or alternatively an anti-cancer therapy which is not dependent upon apoptosis.
  • the subject is administered an anti-cancer therapy selected from the group consisting of biological response modifying therapy, immunotherapy, cancer vaccine therapy, hormone therapy and angiogenesis inhibiting therapy.
  • the method may further comprise administering to the subject at risk of being non-responsive to an anti-cancer therapy, a demethylating agent and an anti-cancer therapy.
  • the method may further comprise administering to the subject at risk of being non-responsive to an anti-cancer therapy, a TMSl molecule selected from the group consisting of a TMSl nucleic acid molecule and a TMSl polypeptide, and an anti-cancer therapy.
  • the preferred TMSl nucleic acid molecule comprises an nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24.
  • the preferred TMSl polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25.
  • the invention further provides, in yet another aspect, a method for treating a subject having a cancer comprising administering a demethylating agent and an anti-cancer therapy to a subject in need of such treatment in an amount effective to treat the cancer.
  • the invention provides another method for treating a subject having a cancer comprising administering a TMS 1 molecule and an anti-cancer therapy to a subject in need of such treatment in an amount effective to treat the cancer.
  • the cancer may be one which is characterized by abnormal methylation of a CpG island containing TMSl nucleic acid molecule (as described for preceding aspects).
  • the cancer may be characterized by an abnormally low levels of a TMSl expression product.
  • the disorder may be characterized by the presence of a mutant TMS 1 molecule, in which case, treatment with a TMSl molecule alone or with an anti-cancer therapy may be suitable.
  • the demethylating agent or the TMSl molecule may be administered prior to, or concurrently with, the anti-cancer therapy.
  • the TMSl molecule is selected from the group consisting of a TMSl nucleic acid molecule and a TMSl polypeptide.
  • the preferred TMSl nucleic acid molecule comprises an nucleotide sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24.
  • the preferred TMSl polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO:3 and SEQ ID NO:25, while in other embodiments, the amino acid sequence may be SEQ ID NO: 10, SEQ ID NO:21 or SEQ ID NO:23.
  • the demethylating agent or the TMSl molecule may be administered to the subject in an amount effective to sensitize the cancer to the anti-cancer therapy (e.g., an amount of demethylating agent or TMS 1 molecule effective to make the cancer responsive to the anti-cancer therapy, or to decrease the dose of anti-cancer therapy required to treat the cancer).
  • the invention provides a method for treating a subject having a disorder characterized by abnormal cell proliferation.
  • the abnormal cell proliferation is a cancer.
  • the method involves administering a TMSl molecule to a tissue having the disorder in an amount effective to increase the level of TMSl polypeptide to an above-normal level.
  • the above-normal level may be at least 10%, at least 20%, at least 30%, at least 50%, at least 100% or at least 150% above normal levels.
  • the level of TMSl polypeptide is one which induces the apoptosis of the cells in which it is expressed.
  • the disorder may or may not be one characterized by abnormal methylation of a CpG island containing TMSl nucleic acid molecule or by an abnormally low level of a TMSl expression product.
  • the disorder is breast cancer.
  • the invention further provides a method for identifying other nucleic acid molecules that are silenced as a result of methylation and which may be involved in cancer.
  • a method for identifying a nucleic acid molecule transcriptionally down- regulated following methylation.
  • the method comprises overexpressing a methyltransferase molecule in an experimental cell, and identifying a differentially expressed molecule which has a lower level of expression in the experimental cell than in a control.
  • the methyltransferase is a human DNA methyltransferase.
  • the experimental cell is one which overexpresses a DNA methyltransferase.
  • the cell may be a primary cell or a cell from an established cell line.
  • the experimental cell is HMT.1E1.
  • the control may be an immortalized fibroblast cell line.
  • the control is an SV40 immortalized variant of the IMR90 fibroblast cell line.
  • the expression product is an mRNA.
  • the differentially expressed molecule may be identified using a technique selected, for example, from the group consisting of subtractive hybridization, differential display, representational difference analysis and cDNA microarray analysis.
  • the invention also provides screening assays for identifying binding partners (e.g., ligands) of TMSl.
  • the binding partners may be naturally occurring (e.g., natural ligands of TMSl) or they may be synthetic.
  • the invention provides a method for identifying a TMSl polypeptide binding partner comprising obtaining a binding assay result from a binding assay between a library member and a TMSl polypeptide, and comparing the binding assay result to a control binding assay result.
  • a binding assay result that is greater than a control binding assay result indicates that the library member is a TMSl polypeptide binding partner.
  • the preferred TMSl polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25.
  • the library member is derived from a natural source library.
  • the invention provides a method for identifying a TMS 1 N-terminal polypeptide binding partner comprising obtaining a binding assay result from a binding assay between a library member and a TMSl N-terminal polypeptide, and comparing the binding assay result to a control binding assay result.
  • a binding assay result that is greater than a control binding assay result indicates that the library member is a TMS 1 N-terminal polypeptide binding partner.
  • the TMS 1 N-terminal polypeptide may comprise an amino acid sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:27, but it is not so limited.
  • the TMSl N-terminal polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25, and the control binding assay result is obtained from a control binding assay between a library member and a polypeptide consisting of an amino acid sequence of SEQ ID NO: 10.
  • the library member is derived from a natural source library. Another aspect of the invention provides compositions comprising any of the foregoing isolated nucleic acid molecules of the invention, or expression products thereof, in amounts effective to increase levels of wild-type TMSl expression products, and a pharmaceutically acceptable carrier.
  • kits comprising a package including assays for TMS 1 epitopes, TMSl nucleic acids or TMSl methylation.
  • the kit further comprises instructions and optionally related materials such as controls, for example, a number, color chart, or an epitope of the expression product of the foregoing isolated nucleic acid molecules of the invention, for comparing the level of wild-type and/or mutant TMSl polypeptides, wild-type or mutant TMSl nucleic acid forms or the level of TMSl methylation in a test sample to the level in the control.
  • This comparison can be used to assess a risk of developing a disorder characterized by abnormally low levels of wild- type TMSl expression products or a risk of developing a disorder characterized by abnormal methylation of CpG island containing TMSl nucleic acid molecules.
  • the present invention thus involves, in several aspects, TMSl polypeptides, genes encoding such polypeptides, functional modifications and variants of the foregoing, useful fragments of the foregoing, as well as therapeutics and diagnostics relating thereto.
  • Figure 1A is a representation of a Southern blot analysis of cell lines 90SV and HMT.lEl .
  • Hybridization shows clone RDA-2.15 is differentially represented in cDNA derived from 90SV and HMT.lEl cells
  • Figure IB is a representation of a Northern blot analysis of TMSl and ⁇ -actin expression in cell lines 90SV and HMT.lEl.
  • Figure 1C is a representation of an RT-PCR analysis of TMSl and ⁇ -actin expression in cell lines IMR90, 90SV and HMT.lEl, showing down-regulation of TMSl in fibroblasts overexpressing DNMTl (i.e., HMT.lEl) relative to control cells (i.e., 90SV and IMR90). Control reactions in which reverse transcriptase was omitted (-RT) were amplified under the same conditions.
  • Figure 2A shows the genomic structure of the TMSl locus.
  • Figure 2B shows the methylation status of the TMSl CpG island as determined by Southern analysis following methylation-sensitive restriction analysis.
  • Figure 2C shows the results of methylation-specific PCR of DNA from HMT.lEl, 90SV and IMR90 cell lines.
  • Figure 3 A shows methylation specific PCR analysis of bisulfite-modif ⁇ ed DNA from primary human mammary epithelial cells (HMEC) and two immortal, non-tumorigenic breast epithelial cell lines (MCF10A, Hs578Bst) compared to that of nine breast cancer cell lines (MCF-7, T47-D, ZR-75- 1, Hs578t, MDA MB231, MDA MB468, SKBR3, CAMAl, BT-20).
  • Parallel amplifications reactions were performed using primers specific to methylated (M) and unmethylated (U) DNA.
  • Figure 3B shows the TMSl mRNA expression profile of breast epithelial cells and breast cancer cells using reverse transcribed RNA amplified with primers to TMSl (top panel) and ⁇ -actin (bottom panel). Control reactions in which reverse transcriptase was omitted (-RT) were amplified under the same conditions.
  • Figures 3C and 3D show the effect of a demethylating agent (5-aza-2'deoxycytidine) on
  • Figure 4A shows the methylation status of TMSl in normal breast tissue from reduction mammoplasty using methylation-specific PCR analysis.
  • Figure 4B shows the methylation status of TMSl in primary breast tissues from reduction mammoplasty using methylation-specific PCR analysis.
  • Figure 4C shows the methylation status of TMSl in paired normal-appearing tissue (N) adjacent to breast tumors (T). Shown are 12 representative pairs out of a total of 18 analyzed.
  • Figure 5 A shows the expression of TMSl and ⁇ -actin in normal human tissues and human tumor-derived cell lines.
  • Figure 5B illustrates the amino acid alignment of TMS 1 with the CARD motif of other apoptotic signaling proteins. Numbers in parentheses indicate the position in the amino acid sequence. Reverse type indicate >50% amino acid identity; gray shading indicates >50% similarity through conserved amino acid substitutions.
  • Figure 5C shows the apoptosis inducing ability of TMSl and TMSl variants. Where indicated, zVAD was added immediately following transfection. Data are presented as the percentage of ⁇ -galactosidase positive cells exhibiting apoptosis (mean ⁇ SD) from three independent transfection experiments.
  • Figure 5D shows the effect TMS land TMSl variants on colony forming activity of transfected breast cancer cell lines.
  • Data mean ⁇ SD
  • FIG. 6A illustrates induction of caspase-dependent apoptosis by TMSl using an ecdysone- inducible expression system to express myc-tagged TMS 1.
  • MTMS22 cells were treated with pon A for the indicated times, and TMS 1 expression was examined by immunoblotting with a monoclonal myc (9E 10) antibody.
  • Figure 6B shows MTMS22 cell proliferation as determined in the presence or absence of 5 ⁇ M pon A to induce TMS 1 expression and with or without 40 ⁇ M Z-VAD. Data represent the mean ⁇ SD of triplicate determinations from a representative growth experiment.
  • Figure 6C shows the induction of apoptosis of MTMS22 cells treated with pon A and/or Z- VAD for the indicated times. DNA fragmentation was visualized by EtBr/agarose gel electrophoresis.
  • Figure 7 A shows the result of transient transfection of 293 cells with pcDNA-TMSl, with pcDNA-TMSl plus DN-caspases-8 or -9, or with pcDNA-TMSl in the presence of 40 ⁇ M Z-VAD. Forty-eight hours after transfection, the percentage of transfected ( ⁇ -gal positive) cells exhibiting morphologic features of apoptosis was determined. At least 200 transfected cells were counted per transfection. Data represent the mean ⁇ SD of three separate experiments.
  • Figure 7B shows that transient transfection of 293 cells with the indicated amounts of pcDNA- mycTMSl has no effect on NF- ⁇ B activation, using a CAT activity assay.
  • 293 cells were transfected with an NF-kB CAT reporter construct (pJECAT2.6).
  • pJECAT2.6 A CAT reporter construct containing a mutated NF- ⁇ B site, (p2.6m ⁇ Bl) was used as a negative control.
  • TNF ⁇ (20 ⁇ M) was added a positive control. Lysates used for CAT assays were subjected to immunoblot analysis for TMSl.
  • Figure 8A shows the subcellular localization of TMSl in MTMS22 cells induced to express myc-tagged TMSl by addition of pon A for the indicated times and prepared for visualization of TMSl by immunofluorescence using a myc (9E10) monoclonal antibody. Nuclei were visualized by staining with Hoescht 33258 dye. Cells were viewed at 400X magnification.
  • FIG 8B shows the localization of TMSl in 293 cells transiently transfected with pcDNA- mycTMSl and processed to visualize TMSl and nuclei by immunofluorescence. Images are at 1000X magnification.
  • Figure 9A shows that TMSl-induced apoptosis and localization are dependent on the CARD.
  • Percentages of 293 apoptotic cells were determined 48 h after transient transfection with pcDNA3.1, pcDNA-mycTMS 1 or pcDNA-mycTMSl ⁇ 100-195. At least 200 transfected cells were counted per transfection, and results represent the mean ⁇ SD of 3 separate experiments.
  • Figure 9B is a representation of a Western immunoblot analysis of lysates from transfected 293 cells showing expression of full-length or truncated TMSl (top) and ⁇ -gal (bottom).
  • Figure 9C is a representation of photographs of 293 cells transiently transfected with pcDNA- mycTMSl or pcDNA-mycTMSl ⁇ 100-195 and prepared for visualization of TMSl by immunofluorescence. At least 500 TMSl -positive cells were scored for subcellular localization of TMSl .
  • SEQ ID NO: 1 is the nucleotide sequence of human TMSl genomic DNA (Accession No. AF 184072).
  • SEQ ID NO:2 is the nucleotide sequence of human TMSl cDNA (Accession No. AF184073).
  • SEQ ID NO:3 is the amino acid sequence of human TMSl polypeptide.
  • SEQ ID NO:4 is the nucleotide sequence of nucleotides 1100- 1725 of SEQ ID NO: 1 , corresponding to the TMSl CpG island.
  • SEQ ID NO:5 is the nucleotide sequence of nucleotides 1190-1529 of SEQ ID NO: l, corresponding to TMSl exon 1.
  • SEQ ID NO:6 is the amino acid sequence encoded by nucleotides 1 190-1529 of SEQ ID NO: 1 , corresponding to TMS 1 exon 1.
  • SEQ ID NO:7 is the nucleotide sequence of nucleotides 1743-1799 of SEQ ID NO: 1, corresponding to TMSl exon 2.
  • SEQ ID NO:8 is the amino acid sequence encoded by nucleotides 1743- 1799 of SEQ ID NO: l, corresponding to TMSl exon 2.
  • SEQ ID NO:9 is the nucleotide sequence of nucleotides 2105-2460 of SEQ ID NO: 1, corresponding to TMSl exon 3.
  • SEQ ID NO: 10 is the amino acid sequence encoded by nucleotides 2105-2460 of SEQ ID NO: 1, corresponding to TMSl exon 3.
  • SEQ ID NO: 1 1 is the nucleotide sequence of a TMS 1 specific forward primer.
  • SEQ ID NO: 12 is the nucleotide sequence of a TMSl specific reverse primer.
  • SEQ ID NO: 13 is the nucleotide sequence of a TMSl specific forward RT-PCR primer.
  • SEQ ID NO: 14 is the nucleotide sequence of a ⁇ -actin specific forward RT-PCR primer.
  • SEQ ID NO: 15 is the nucleotide sequence of a ⁇ -actin specific reverse RT-PCR primer.
  • SEQ ID NO: 16 is the nucleotide sequence of a unmethylated TMS 1 specific forward primer.
  • SEQ ID NO: 17 is the nucleotide sequence of a unmethylated TMS 1 specific reverse primer.
  • SEQ ID NO: 18 is the nucleotide sequence of a methylated TMS 1 specific forward primer.
  • SEQ ID NO: 19 is the nucleotide sequence of a methylated TMS 1 specific reverse primer.
  • SEQ ID NO:20 is the nucleotide sequence of mouse TMSl cDNA.
  • SEQ ID NO:21 is the amino acid sequence of mouse TMSl polypeptide.
  • SEQ ID NO:22 is the partial nucleotide sequence of rat TMSl cDNA.
  • SEQ ID NO:23 is the partial amino acid sequence of rat TMS 1 polypeptide.
  • SEQ ID NO:24 is the nucleotide sequence of an alternatively spliced form of human TMSl cDNA (Accession No. AF255794) which is missing exon 2.
  • SEQ ID NO:25 is the amino acid sequence of an alternatively spliced form of human TMSl polypeptide which is missing exon 2.
  • SEQ ID NO:26 is the nucleotide sequence of an alternatively spliced form of TMSl cDNA which is missing exon 3.
  • SEQ ID NO:27 is the amino acid sequence of an alternatively spliced form of TMSl cDNA which is missing exon 3.
  • Cancers arise from any number of cellular perturbations in a cell. Most of these perturbations take the form of a genetic mutation at the genomic DNA level. Genetic mutations can in turn manifest their effects in a number of ways including alterations in expression levels and/or function of an mRNA or a polypeptide. The end result is always an uncontrolled growth of the mutated population of cells as a result of either increased proliferative rates, decreased apoptotic rates and/or failure to respond to normal growth control signals.
  • Gene loci which are altered in the progression of such disorders are not always the primary or direct target of the initial mutation however. Rather, a mutation may exist in a genomic locus which codes for an "upstream” factor. Mutation of the upstream factor may not produce a malignant phenotype to a cell by itself. However, the mutation of the upstream factor does impact upon "downstream" factors, the genomic locus of which remains essentially wild- type.
  • One such upstream factor is a factor capable of methylating genomic sequences. Abnormal methylation of genomic loci has been reported to cause altered expression levels from that genomic locus.
  • the mammalian genome is widely methylated except for regions rich in CG dinucleotides (e.g., CpG islands) which are undermethylated as compared to the rest of the genome, in normal cells.
  • Aberrant methylation, particularly at CpG islands, is reportedly accompanied by gene silencing and is reportedly one mechanism responsible for the inactivation of several tumor suppressor genes in human cancers.
  • the invention described herein is premised, in part, on the finding that cells overexpressing methyltransferase can be used to identify genomic loci susceptible to abnormal methylation. The discovery was thus made that a cell overexpressing a methyltransferase exhibited abnormal methylation of CpG island in particular loci, thereby leading to the silencing of these loci.
  • TMSl Target of Methylation- induced Silencing-1
  • SEQ ID NO:2 The human TMSl polypeptide is predicted to be a 25 kDa protein, believed to function in the regulation of cell death.
  • the predicted amino acid sequence of the encoded human protein product is presented as SEQ ID NO:3.
  • TMSl activity intends, at least, an apoptosis inducing activity.
  • the human TMSl genomic sequence comprises the sequence of SEQ ID NO: 1.
  • SEQ ID NO:20 represents the nucleotide sequence of the mouse TMS 1 cDNA, with the amino acid sequence of the polypeptide it is predicted to encode shown in SEQ ID NO:21.
  • SEQ ID NO:22 represents the partial nucleotide sequence of the rat TMSl cDNA, with the partial amino acid sequence of the polypeptide it is predicted to encode shown in SEQ ID NO:23.
  • SEQ ID NO:24 is the nucleotide sequence of an alternatively spliced form of TMSl which lacks exon 2.
  • SEQ ID NO:25 represents the nucleotide sequence of an alternatively spliced form of TMSl that lacks exon 3, with the amino acid sequence it is predicted to encode shown in SEQ ID NO:27.
  • Apoptosis is a programmed cell death available to almost every normal non-malignant cell and is triggered in such a cell when cell age or integrity dictate. It is an active process often mo ⁇ hologically characterized by cleavage of the genomic DNA into fragments, giving rise to a DNA "ladder" pattern upon gel electrophoresis. "Blebbing" of the plasma membrane is also a common feature of apoptosing cells. Apoptotic pathways are believed to play an integral role in ensuring the elimination of cells which have undergone mutation and have failed to repair such mutation. Thus, apoptosis is a normal process by which normal cells are selected for and potentially mutant cells are selected against.
  • cancer cells de-activate apoptotic pathways, and therefore are capable of propagating themselves in spite, and perhaps as a result, of the mutation they have acquired. Mutation which prohibits or reduces the likelihood of apoptosis suffices as one of the several mutations necessary for cancer development.
  • mutation is used broadly to encompass both mutation (i.e., change) at the genetic level and overall alteration of a cell profile which may or may not be due to a recognized mutation at the genetic level. Abnormal methylation, particularly when accompanied by inappropriate gene silencing, may also suffice as one such mutation in the development of a malignancy.
  • TMSl nucleic acid sequences e.g., SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:22 or SEQ ID NO:24
  • CARD carboxy terminal caspase-recruiting domain
  • the CARD is a homotypic protein interaction domain found in proteins that function in the regulation and execution of apoptosis.
  • CARD-containing proteins with known roles in apoptosis include the C. elegans CED-3 and CED-4, the human homolog of CED-4, Apafl, the cellular and viral inhibitors of apoptosis (cIAPs), the cellular homolog of herpesvirus EHV2 E10, Bcll O/mElO/CIPER CLAP/CARMEN, and several proteins involved in the activation ofNF- ⁇ B. (Hofmann, K. Cell Mol.Life Sci.
  • TMSl CARD was most similar to that of the serine/threonine kinase RICK/CARDIAK/RIP2 (25% identity, 51% similarity) and CARD4/Nodl (24% identity, 44% similarity), a CED-4/ Apafl family member that binds to RICK as well as procaspase 9.
  • TMSl polypeptides one function of native TMSl polypeptides is apoptosis induction. Induction of apoptosis can be assayed in a number of ways. Commonly, a TMSl nucleic acid molecule or a polypeptide would be introduced into a cell. The cell can then be observed for any number of phenotypic changes such as DNA ladder formation, blebbing of the plasma membrane, and for adherent cells particularly, condensation, rounding up and detachment from a growth substratum. Functional measurements can also be used to assess apoptosis.
  • TMSl molecules are capable of decreasing, or halt altogether, the proliferation of cells which lack endogenous TMSl, such as some breast cancer cells (e.g., ZR75-1, Hs578t and MB231).
  • Cell proliferation can be measured by inco ⁇ oration of tritiated thymidine or in vitro cell growth as indicated by cell count and/or colony forming ability.
  • Compounds which have an apoptotic function should inhibit or reduce colony forming activity, or prevent increases in cell counts and/or tritiated thymidine inco ⁇ oration.
  • TMSl and variants of TMSl retaining the CARD are able to promote apoptosis and inhibit colony formation when ectopically expressed.
  • overexpression of TMSl nucleic acid molecules induces apoptosis of cells, regardless of whether they express TMS 1 expression products prior to treatment.
  • the invention thus involves in one aspect an isolated TMSl polypeptide, the genomic DNA (including the promoter region and the CpG island) and cDNA encoding this polypeptide, the genomic locus necessary for assessment of CpG island methylation, functional modifications and variants of the foregoing, useful fragments of the foregoing, as well as diagnostics and therapeutics relating thereto.
  • isolated means: (i) amplified in vitro by, for example, polymerase chain reaction (PCR); (ii) recombinantly produced by cloning; (iii) purified, as by cleavage and gel separation; or (iv) synthesized by, for example, chemical synthesis.
  • An isolated nucleic acid is one which is readily manipulable by recombinant DNA techniques well known in the art.
  • a nucleotide sequence contained in a vector in which 5' and 3' restriction sites are known or for which polymerase chain reaction (PCR) primer sequences have been disclosed is considered isolated but a nucleic acid sequence existing in its native state in its natural host is not.
  • An isolated nucleic acid may be substantially purified, but need not be.
  • a nucleic acid that is isolated within a cloning or expression vector is not pure in that it may comprise only a tiny percentage of the material in the cell in which it resides. Such a nucleic acid is isolated, however, as the term is used herein because it is readily manipulable by standard techniques known to those of ordinary skill in the art.
  • isolated means separated from its native environment in sufficiently pure form so that it can be manipulated or used for any one of the pu ⁇ oses of the invention.
  • isolated means sufficiently pure to be used (i) to raise and/or isolate antibodies, (ii) as a reagent in an assay, or (iii) for sequencing, etc.
  • isolated TMSl nucleic acid molecules include: (a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule consisting a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:2, SEQ ID NO: 5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24 and SEQ ID NO:26 and which code for a native TMSl polypeptide, (b) deletions, additions and substitutions of (a) which code for an apoptosis-inducing polypeptide, (c) nucleic acid molecules that differ from the nucleic acid molecules of (a) or (b) in codon sequence due to the degeneracy of the genetic code, and (d) complements of (a), (b) or (c).
  • the nucleotide sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24, while in others it is SEQ ID NO:26.
  • Homologs and alleles of the TMSl nucleic acids of the invention can be identified by conventional techniques.
  • an aspect of the invention is those nucleic acid sequences which code for TMSl polypeptides and which hybridize to a nucleic acid molecule consisting of the coding region of preferably SEQ ID NO:l, SEQ ID NO:2 or SEQ ID NO:24, or in other embodiments SEQ ID NO:20, SEQ ID NO:22, or in still other embodiments SEQ ID NO:26, and in yet other embodiments SEQ ID NO:5, SEQ ID NO:7 or SEQ ID NO:9, under stringent conditions.
  • stringent conditions refers to parameters with which the art is familiar. Nucleic acid hybridization parameters may be found in references which compile such methods, e.g. Molecular Cloning: A Laboratory Manual. J.
  • stringent conditions refers, for example, to hybridization at 65°C in hybridization buffer (3.5 x SSC, 0.02% Ficoll, 0.02% polyvinyl pyrolidone, 0.02% Bovine Serum Albumin, 2.5mM NaH 2 P0 4 (pH7), 0.5% SDS, 2mM EDTA).
  • SSC 0.15M sodium chloride/0.15M sodium citrate, pH7; SDS is sodium dodecyl sulphate; and EDTA is ethylenediaminetetracetic acid.
  • SSC 0.15M sodium chloride/0.15M sodium citrate, pH7; SDS is sodium dodecyl sulphate; and EDTA is ethylenediaminetetracetic acid.
  • homologs and alleles will share at least 85% nucleotide identity and/or at least 95% ⁇ amino acid identity and, even more preferably, at least 95% nucleotide identity and/or at least 99%o amino acid identity will be shared.
  • the homoiogy can be calculated using various, publicly available software tools developed by NCBI (Bethesda, Maryland) that can be obtained through the NCBI website on the internet. Exemplary software tools include the BLAST system (available on the internet at the NIH website) using default settings.
  • Pairwise and ClustalW alignments (BLOSUM30 and/or BLOSUM62 matrix settings) as well as Kyte-Doolittle hydropathic analysis can be obtained using the MacVetor sequence analysis software (Oxford Molecular Group). Watson-Crick complements of the foregoing nucleic acids also are embraced by the invention.
  • a Southern blot may be performed using the foregoing conditions, together with a radioactive probe. After washing the membrane to which the DNA is finally transferred, the membrane can be placed against X-ray film or a phosphoimager plate to detect the radioactive signal.
  • sequences from other mammalian species corresponding to the TMSl gene can be isolated from a cDNA library prepared from one or more of the tissues in which TMSl expression is abundant, using standard colony hybridization techniques.
  • the invention also includes degenerate nucleic acids which include alternative codons to those present in the native materials.
  • serine residues are encoded by the codons TCA, AGT, TCC, TCG, TCT and AGC.
  • Each of the six codons is equivalent for the pu ⁇ oses of encoding a serine residue.
  • any of the serine-encoding nucleotide triplets may be employed to direct the protein synthesis apparatus, in vitro or in vivo, to inco ⁇ orate a serine residue into an elongating TMSl polypeptide.
  • nucleotide sequence triplets which encode other amino acid residues include, but are not limited to: CCA, CCC, CCG and CCT (proline codons); CGA, CGC, CGG, CGT, AGA and AGG (arginine codons); ACA, ACC, ACG and ACT (threonine codons); AAC and AAT (asparagine codons); and ATA, ATC and ATT (isoleucine codons).
  • Other amino acid residues may be encoded similarly by multiple nucleotide sequences.
  • the invention embraces degenerate nucleic acids that differ from the biologically isolated nucleic acids in codon sequence due to the degeneracy of the genetic code.
  • the invention provides a genomic nucleic acid sequence of TMSl (i.e., SEQ
  • This sequence contains at least one native regulatory sequence of TMS 1.
  • One such native regulatory sequence or element of TMSl is a CpG island located at nucleotides 1100-1725 of SEQ ID NO:l and surrounding exon 1.
  • the nucleotide sequence of this CpG island is herein referred to as SEQ ID NO:4.
  • CpG islands become methylated at the cytosine residue by a host of methylating enzymes, including methylases and methyltransferases.
  • Methyltransferases are enzymes which add methyl groups from S-adenosyl methionine to bases in DNA strands.
  • This region of SEQ ID NO: l possesses at least one CpG island, the methylation of which induces TMSl silencing.
  • Nucleic acid sequences and expression vectors comprising the CpG island are useful for studying the mechanism of TMSl methylation and identifying methylases or methyltransferases which act upon this CpG island and therapeutic agents which block such methylation.
  • Examples of methylating enzymes capable of CpG methylation include human DNA methyltransferases such as DNMTl (e.g., Accession numbers X63692 and NM 001379; Yen, R.W., NucAcids Res.
  • DNMT2, DNMT3a and DNMT3a variants, DNMT3b and DNMT3b variants as well as corresponding murine DNA methyltransferases such as Dnmtl, Dnmt2, Dnmt3a and Dnmt3b (e.g., Accession number U70051 ; Tucker, K.L., Proc.Natl. Acad.Sci.U.S.A. 93: 12920-12925, 1996).
  • the methylation events with which the invention is most concerned are methylation of cytosines, specifically, events leading to the formation of 5-methylcytosine.
  • the genomic sequence (i.e., SEQ ID NO: 1) is useful in elucidating the mechanisms through which TMSl is silenced.
  • the sequence facilitates the identification of (a) methylating agents which target the CpG island, (b) inhibitors of such methylating agents, (c) mutations within the sequence which would render it less susceptible to methylation induced silencing, (d) other regulatory sequences within nucleic acid sequences comprising SEQ ID NO:l which control the transcription or translation of TMS 1 expression products, and (e) factors which bind to such regulatory sequences.
  • Regulatory sequences, other than the CpG islands, which are present within genomic TMSl nucleic acids include, are not limited to, promoters, enhancers and still other repressors sequences. Agents which bind to these sequences can be readily identified using standard nucleic acid binding assays that are well known in the art.
  • the invention also provides isolated unique fragments of SEQ ID NO:l, SEQ ID NO:2 and SEQ ID NO:24 or complements thereof.
  • a unique fragment is one that is a 'signature' for the larger nucleic acid.
  • the unique fragment is long enough to assure that its precise sequence is not found in molecules within the human genome outside of the TMSl nucleic acids defined above (and human alleles). Those of ordinary skill in the art may apply no more than routine procedures to determine if a fragment is unique within the human genome.
  • a fragment which is completely composed of the sequence described in the foregoing GenBank deposits is one which does not include any of the nucleotides unique to the sequences of the invention.
  • a unique fragment must contain a nucleotide sequence other than the exact sequence of those in GenBank or fragments thereof, provided that the GenBank or fragment sequences were published prior to the priority or filing date of the present application, depending on the sequence disclosed herein. The difference may be an addition, deletion or substitution with respect to all or part of the GenBank sequence or it may be a sequence wholly separate from the GenBank sequence.
  • Unique fragments can be used as probes in Southern and Northern blot assays to identify such nucleic acids, or can be used in amplification assays such as those employing PCR.
  • the size of the unique fragment will depend upon its conservancy in the genetic code.
  • some regions of SEQ ID NO:l, SEQ ID NO:2, or SEQ ID NO:24, or complements thereof will require longer segments to be unique while others will require only short segments, typically between 12 and 32 nucleotides long (e.g. 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 and 32 bases) or more, up to the entire length of the disclosed sequence.
  • this disclosure intends to embrace each and every fragment of each sequence listed, beginning at the first nucleotide, the second nucleotide and so on, up to 8 nucleotides short of the end, and ending anywhere from nucleotide number 8, 9, 10 and so on for each sequence listed, up to the very last nucleotide, provided the sequence is unique as described above.
  • virtually any segment of the region of SEQ ID NO:l beginning at nucleotide 1 and ending at nucleotide 2821, or SEQ ID NO:2 beginning at nucleotide 1 and ending at nucleotide 770, or complements thereof, that is 20 or more nucleotides in length will be unique.
  • the invention also involves expression vectors coding for TMSl proteins and fragments and variants thereof and host cells containing those expression vectors.
  • tissue types including mast cells, fibroblasts, oocytes and lymphocytes, and they may be primary cells or cell lines. Specific examples include CHO cells and COS cells. Cell-free transcription systems also may be used in lieu of cells.
  • a "vector" may be any of a number of nucleic acids into which a desired sequence may be inserted by restriction and ligation for transport between different genetic environments or for expression in a host cell.
  • Vectors are typically composed of DNA although RNA vectors are also available.
  • Vectors include, but are not limited to, plasmids, phagemids and virus genomes.
  • a cloning vector is one which is able to replicate in a host cell, and which is further characterized by one or more endonuclease restriction sites at which the vector may be cut in a determinable fashion and into which a desired DNA sequence may be ligated such that the new recombinant vector retains its ability to replicate in the host cell.
  • replication of the desired sequence may occur many times as the plasmid increases in copy number within the host bacterium or just a single time per host before the host reproduces by mitosis.
  • replication may occur actively during a lytic phase or passively during a lysogenic phase.
  • An expression vector is one into which a desired DNA sequence may be inserted by restriction and ligation such that it is operably joined to regulatory sequences and may be expressed as an RNA transcript.
  • Vectors may further contain one or more marker sequences suitable for use in the identification of cells which have or have not been transformed or transfected with the vector. Markers include, for example, genes encoding proteins which increase or decrease either resistance or sensitivity to antibiotics or other compounds, genes which encode enzymes whose activities are detectable by standard assays known in the art (e.g., ⁇ -galactosidase or alkaline phosphatase), and genes which visibly affect the phenotype of transformed or transfected cells, hosts, colonies or plaques (e.g., green fluorescent protein).
  • Preferred vectors are those capable of autonomous replication and expression of the structural gene products present in the DNA segments to which they are operably joined.
  • useful expression vectors are those which comprise a reporter coding sequence.
  • Intronic sequences of TMSl correspond to nucleotides 1530-1742 of SEQ ID NO:l (intron 1) and nucleotides 1800-2104 of SEQ ID NO: 1 (intron 2).
  • a reporter coding sequence as used herein refers to at least a marker sequence, the expression of which when it is operably linked to a foreign regulatory sequence reflects the transcriptional function of the foreign sequence.
  • the regulatory potential of such a foreign sequence can be deduced by assaying for the presence of an expression product of the marker sequence.
  • Foreign regulatory sequences which can be tested in this manner include, but are not limited to, promoters, and other elements which although capable of affecting transcriptional levels are not, in and of themselves, sufficient for such transcription. Examples of these latter elements include enhancers and repressor elements.
  • the reporter coding sequence In order to assess the activity of enhancers and repressors, it may be necessary for the reporter coding sequence to consist of a regulatory sequence, such as a minimal promoter element, as well as the requisite marker sequence.
  • Minimal promoter elements have been recognized in the art and include sequences such as a CCAAT box or a TATA sequence. Suitable marker sequences for these pu ⁇ oses are similar to those described above. As used herein, a marker or coding sequence and regulatory sequences are said to be
  • telomere sequences are said to be operably joined if induction of a promoter in the 5' regulatory sequences results in the transcription of the coding sequence and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region to direct the transcription of the coding sequences, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein.
  • a promoter region would be operably joined to a coding sequence if the promoter region were capable of effecting transcription of that DNA sequence such that the resulting transcript might be translated into the desired protein or polypeptide.
  • regulatory sequences needed for gene expression may vary between species or cell types, but shall in general include, as necessary, 5' non-transcribed and 5' non- translated sequences involved with the initiation of transcription and translation respectively, such as a TATA box, capping sequence, CCAAT sequence, and the like.
  • 5 ' non-transcribed regulatory sequences will include a promoter region which includes a promoter sequence for transcriptional control of the operably joined coding sequence.
  • Regulatory sequences may also include enhancer sequences or upstream activator sequences as desired.
  • the vectors of the invention may optionally include 5' leader or signal sequences. The choice and design of an appropriate vector is within the ability and discretion of one of ordinary skill in the art.
  • Expression vectors containing all the necessary elements for expression are commercially available and known to those skilled in the art. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989.
  • Cells are genetically engineered by the introduction into the cells of heterologous nucleic acid, usually DNA, molecules, encoding a TMSl polypeptide or fragment or a variant thereof.
  • the heterologous nucleic acid molecules are placed under operable control of transcriptional elements to permit the expression of the heterologous nucleic acid molecules in the host cell.
  • Preferred systems for mRNA expression in mammalian cells are those such as pcDNA3.1 (available from Invitrogen, Carlsbad, CA) that contain a selectable marker such as a gene that confers G418 resistance (which facilitates the selection of stably transfected cell lines) and the human cytomegalovirus (CMV) enhancer-promoter sequences.
  • pcDNA3.1 available from Invitrogen, Carlsbad, CA
  • CMV human cytomegalovirus
  • suitable for expression in primate or canine cell lines is the pCEP4 vector (Invitrogen, Carlsbad, CA), which contains an Epstein Barr virus (EBV) origin of replication, facilitating the maintenance of plasmid as a multicopy extrachromosomal element.
  • EBV Epstein Barr virus
  • Another expression vector is the pEF-BOS plasmid containing the promoter of polypeptide Elongation Factor l ⁇ , which stimulates efficiently transcription in vitro.
  • the plasmid is described by Mishizuma and Nagata (Nuc. Acids Res. 18:5322, 1990), and its use in transfection experiments is disclosed by, for example, Demoulin (Mol. Cell. Biol. 16:4710-4716, 1996).
  • Still another preferred expression vector is an adenovirus, described by Stratford-Perricaudet, which is defective for El and E3 proteins (J. Clin. Invest. 90:626-630, 1992).
  • the use of the adenovirus as an Adeno.PlA recombinant is disclosed by Warnier et al., in intradermal injection in mice for immunization against P1A (Int. J. Cancer, 67:303-310, 1996).
  • the invention also embraces so-called expression kits, which allow the artisan to prepare a desired expression vector or vectors.
  • expression kits include at least separate portions of each of the previously discussed coding sequences. Other components may be added, as desired, as long as the previously mentioned sequences, which are required, are included.
  • the invention embraces the use of the above described, TMSl cDNA sequence containing expression vectors, to transfect host cells and cell lines, be these prokaryotic (e.g., E. coli), or eukaryotic (e.g., CHO cells, COS cells, yeast expression systems and recombinant baculovirus expression in insect cells).
  • prokaryotic e.g., E. coli
  • eukaryotic e.g., CHO cells, COS cells, yeast expression systems and recombinant baculovirus expression in insect cells.
  • mammalian cells such as human, mouse, hamster, pig, goat, primate, etc.
  • specific examples include mammalian epithelial cells, fibroblast cells and kidney epithelial cells, either as primary cells or cell lines.
  • cells which can be easily induced to apoptose such as epithelial cells.
  • the invention also provides isolated polypeptides (including whole proteins and partial proteins), encoded by the foregoing TMS 1 nucleic acids, and include the polypeptides having amino acids sequences selected from the group consisting of SEQ ID NO:3, SEQ ID:21, SEQ ID NO:23, and SEQ ID NO:25 and in some instances, unique fragments thereof.
  • Such polypeptides are useful, for example, alone or as fusion proteins that retain at least one TMSl activity (e.g., apoptosis induction), in the generation of antibodies, as components of an immunoassay, or as a binding partner in a binding assay.
  • Polypeptides can be isolated from biological samples including tissue or cell homogenates, and can also be expressed recombinantly in a variety of prokaryotic and eukaryotic expression systems by constructing an expression vector appropriate to the expression system, introducing the expression vector into the expression system, and isolating the recombinantly expressed protein.
  • Short - polypeptides including antigenic peptides (such as those presented by MHC molecules on the surface of a cell for immune recognition) also can be synthesized chemically using well-established methods of peptide synthesis.
  • a unique fragment of a TMSl polypeptide in general, has the features and characteristics of unique fragments of nucleic acids as discussed above. As will be recognized by those skilled in the art, the size of the unique fragment will depend upon factors such as whether the fragment constitutes a portion of a conserved protein domain. Thus, some regions of SEQ ID NO:3 or SEQ ID NO:24, for example, will require longer segments to be unique while others will require only short segments, typically between 5 and 12 amino acids (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, and 150 amino acids long or more, including each integer from 15 up to the full length, 195 amino acids long).
  • 5 and 12 amino acids e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, and 150 amino acids long or more, including each integer from 15 up to the full length, 195 amino
  • Unique fragments of a polypeptide preferably are those fragments which retain at least one distinct functional capability of the native TMSl polypeptide. Functional capabilities which can be retained in a unique fragment of a polypeptide include interaction with antibodies and/or other polypeptides or fragments thereof (including other TMSl polypeptides, or other CARD containing polypeptides, or fragments thereof), as well as, for a subset of unique fragments, the ability to induce apoptosis.
  • One important activity is the ability to act as a signature for identifying the polypeptide.
  • the unique fragment is unique in humans, i.e., it is long enough to assure that its precise sequence is not found in molecules encoded by the human genome outside of TMSl polypeptides including alleles.
  • a "variant" of a TMSl polypeptide is a polypeptide which contains one or more modifications to the primary amino acid sequence of a TMSl polypeptide.
  • Modifications which create a TMSl polypeptide variant are typically made to the nucleic acid which encodes the TMSl polypeptide, and can include deletions, point mutations, truncations, amino acid substitutions and addition of amino acids or non-amino acid moieties to: 1) reduce or eliminate an activity of a TMSl polypeptide; 2) enhance a property of a TMSl polypeptide, such as protein stability in an expression system or the stability of protein-protein binding; 3) provide a novel activity or property to a TMSl polypeptide, such as addition of an antigenic epitope or addition of a detectable moiety; or 4) to provide equivalent or better binding to a TMSl polypeptide receptor or other molecule.
  • modifications can be made directly to the polypeptide, such as by cleavage, addition of a linker molecule, addition of a detectable moiety, such as biotin, addition of a fatty acid, and the like.
  • Variants which reduce or eliminate TMSl activity are useful, for example, as experimental tools to study the effects of progressively reduced TMSl expression product levels.
  • Therapeutic tools might employ variants which provide an enhanced TMSl activity (e.g., enhanced apoptosis induction).
  • Modifications also embrace fusion proteins comprising all or part of the TMSl amino acid sequence.
  • Variants can include TMSl polypeptides which are modified specifically to alter a feature of the polypeptide unrelated to its physiological activity. For example, cysteine residues can be substituted or deleted to prevent unwanted disulfide linkages. Similarly, certain amino acids can be changed to enhance expression of a TMSl polypeptide by eliminating proteolysis by proteases in an expression system (e.g., dibasic amino acid residues in yeast expression systems in which KEX2 protease activity is present).
  • an expression system e.g., dibasic amino acid residues in yeast expression systems in which KEX2 protease activity is present.
  • Mutations of a nucleic acid which encodes a TMSl polypeptide preferably preserve the amino acid reading frame of the coding sequence, and preferably do not create regions in the nucleic acid which are likely to hybridize to form secondary structures, such a hai ⁇ ins or loops, which can be deleterious to expression of the variant polypeptide.
  • Mutations can be made by selecting an amino acid substitution, or by random mutagenesis of a selected site in a nucleic acid which encodes the polypeptide. Variant polypeptides are then expressed and tested for one or more activities to determine which mutation provides a variant polypeptide with the desired properties. Further mutations can be made to variants (or to non-variant TMSl polypeptides) which are silent as to the amino acid sequence of the polypeptide, but which provide preferred codons for translation in a particular host. The preferred codons for translation of a nucleic acid in, e.g., E. coli, are well known to those of ordinary skill in the art. Still other mutations can be made to the noncoding sequences of a TMSl gene or cDNA clone to enhance expression of the polypeptide.
  • conservative amino acid substitutions may be made in TMSl polypeptides to provide functionally equivalent variants of the foregoing polypeptides, i.e., the variants retain the functional capabilities of the TMSl polypeptides.
  • a "conservative amino acid substitution” refers to an amino acid substitution which does not alter the relative charge or size characteristics of the protein in which the amino acid substitution is made.
  • Variants can be prepared according to methods for altering polypeptide sequence known to one of ordinary skill in the art such as are found in references which compile such methods, e.g. Molecular Cloning: A Laboratory Manual. J.
  • TMSl polypeptides include conservative amino acid substitutions of SEQ ID NO:3.
  • Conservative substitutions of amino acids include substitutions made amongst amino acids within the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D.
  • TMSl polypeptides i.e., variants of TMSl polypeptides which retain the function of the natural TMSl polypeptides
  • Conservative amino-acid substitutions in the amino acid sequence of TMSl polypeptides to produce functionally equivalent variants of TMSl polypeptides typically are made by alteration of a nucleic acid encoding TMS 1 polypeptides (e.g., SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:22, and SEQ ID NO:24). Such substitutions can be made by a variety of methods known to one of ordinary skill in the art.
  • amino acid substitutions may be made by PCR-directed mutation, site-directed mutagenesis according to the method of Kunkel (Kunkel, Proc. Nat. Acad. Sci. U.S.A. 82: 488-492, 1985), or by chemical synthesis of a nucleic acid molecule encoding a TMSl polypeptide.
  • the activity of functionally equivalent fragments of TMSl polypeptides can be tested by cloning the gene encoding the altered TMSl polypeptide into a bacterial or mammalian expression vector, introducing the vector into an appropriate host cell, expressing the altered TMSl polypeptide, and testing for a functional capability of the TMSl polypeptides as disclosed herein.
  • the invention as described herein has a number of uses, some of which are described elsewhere herein.
  • the invention permits isolation of TMSl nucleic acid molecules which code for a TMSl polypeptide.
  • nucleic acid isolation can be performed using hybridization under stringent conditions.
  • a second use of the invention is the isolation of TMSl polypeptides, using a variety of methodologies well-known to the skilled practitioner.
  • the TMS 1 polypeptide may be purified from cells which naturally produce it by chromatographic means or immunological recognition.
  • an expression vector which incorporates a coding TMS 1 nucleic acid molecule such as SEQ ID NO: 1 and perhaps preferably SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24, may be introduced into cells to cause production of the TMSl polypeptide.
  • expression vectors which inco ⁇ orate SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 or SEQ ID NO:26 may be introduced into cells as well.
  • mRNA transcripts may be microinjected or otherwise introduced into cells to cause production of the encoded polypeptide.
  • TMSl mRNA in cell-free extracts such as the reticulocyte lysate system
  • TMSl polypeptides may be produced in cell-free extracts such as the reticulocyte lysate system.
  • Those skilled in the art also can readily follow known methods for isolating TMSl polypeptides. These include, but are not limited to, immunochromatography, HPLC, size-exclusion chromatography, ion-exchange chromatography and immune-affinity chromatography.
  • the invention further provides efficient methods of identifying agents or lead compounds for agents active at the level of a TMSl or TMSl fragment dependent cellular function.
  • the screening methods involve assaying for compounds which enhance TMSl activity.
  • Such methods are adaptable to automated, high throughput screening of compounds.
  • the invention provides TMSl -specific binding agents, methods of identifying and making such agents, and their use in diagnosis, therapy and pharmaceutical development.
  • TMSl -specific pharmacological agents are useful in a variety of diagnostic and therapeutic applications, especially where disease or disease prognosis is associated with altered TMSl binding characteristics.
  • Novel TMSl -specific binding agents include TMS 1 -specific antibodies, cell surface receptors, and other natural intracellular binding agents identified with assays such as two hybrid screens, and non-natural intracellular and extracellular binding agents identified in screens of chemical libraries and the like.
  • the invention also embraces agents that bind to the TMSl polypeptides.
  • isolated peptide binding agents which, for example, can be antibodies or fragments of antibodies ("binding polypeptides"), having the ability to selectively bind to TMS 1 polypeptides.
  • binding polypeptides include polyclonal and monoclonal antibodies and can be prepared according to conventional methodology. Such antibodies can be further manipulated to create chimeric or humanized antibodies as will be discussed in greater detail below.
  • the pFc' and Fc regions are effectors of the complement cascade but are not involved in antigen binding.
  • an antibody from which the Fc region has been enzymatically cleaved, or which has been produced without the Fc region designated an Fab fragment
  • Fab fragments consist of a covalently bound antibody light chain and a portion of the antibody heavy chain denoted Fd.
  • the Fd fragments are the major determinant of antibody specificity (a single Fd fragment may be associated with up to ten different light chains without altering antibody specificity) and Fd fragments retain epitope- binding ability in isolation.
  • CDRs complementarity determining regions
  • FRs framework regions
  • CDR1 through CDR3 complementarity determining regions
  • the present invention also provides for F(ab') 2 , Fab, Fv and Fd fragments; chimeric antibodies in which the Fc and/or FR and/or CDRl and/or CDR2 and/or light chain CDR3 regions have been replaced by homologous human or non- human sequences; chimeric F(ab') 2 fragment antibodies in which the FR and/or CDRl and/or CDR2 and/or light chain CDR3 regions have been replaced by homologous human or non-human sequences; chimeric Fab fragment antibodies in which the FR and/or CDRl and/or CDR2 and/or light chain
  • the invention provides a variety of polypeptides of varying size and type that bind specifically to TMS 1 polypeptides, and complexes of both TMS 1 polypeptides and their binding partners. These polypeptides may be derived also from sources other than antibody technology.
  • polypeptide binding agents can be provided by degenerate peptide libraries which can be readily prepared in solution, in immobilized form, as bacterial flagella peptide display libraries or as phage display libraries. Combinatorial libraries of peptides containing one or more amino acids also can be synthesized.
  • libraries of peptides and non-peptide synthetic moieties can be synthesized.
  • Phage display can be particularly effective in identifying binding peptides useful according to the invention. Briefly, one prepares a phage library (using e.g. ml3, fd, or lambda phage), displaying inserts from 4 to about 80 amino acid residues using conventional procedures.
  • the inserts may represent, for example, a completely degenerate or biased array.
  • One then can select phage-bearing inserts which bind to the TMSl polypeptide or a complex of a TMSl polypeptide and a binding partner. This process can be repeated through several cycles of reselection of phage that bind to the TMSl polypeptide or complex. Repeated rounds lead to enrichment of phage bearing particular sequences.
  • DNA sequence analysis can be performed to identify the sequences of the expressed polypeptides.
  • the minimal linear portion of the sequence that binds to the TMSl polypeptide or complex can be determined.
  • Yeast two-hybrid screening methods also may be used to identify polypeptides that bind to the TMSl polypeptides.
  • the TMSl polypeptides of the invention can be used to screen peptide libraries, including phage display libraries, to identify and select peptide binding partners of the TMSl polypeptides of the invention.
  • Such molecules can be used, as described, for screening assays, for purification protocols, for interfering directly with the functioning of TMSl polypeptides and for other pu ⁇ oses apparent to those of ordinary skill in the art.
  • a TMSl polypeptide, or a fragment thereof also can be used to isolate their native binding partners, according to one aspect of the invention. Isolation of binding partners may be performed according to well-known methods.
  • isolated TMSl polypeptides can be attached to a substrate, and then a solution suspected of containing a TMSl binding partner may be applied to the substrate. If the binding partner for TMSl polypeptides is present in the solution, then it will bind to the substrate-bound TMS 1 polypeptide. The binding partner then may be isolated. Other proteins capable of binding to TMSl polypeptides may be similarly isolated using no more than routine experimentation.
  • the invention provides a method for identifying a TMS 1 polypeptide binding partner.
  • the method involves performing a test binding assay between a TMSl polypeptide and a library member and comparing the extent of binding between the TMS 1 polypeptide and the library member with a control.
  • the control binding assay can be performed using the same environment as the test binding assay but lacking the TMSl molecule.
  • the test binding assay result indicates the extent of binding between the TMSl molecule and the library member.
  • the method further involves comparing the test binding assay result with the control binding assay result. A test binding assay result that is greater than a control binding assay result indicates that the library member is a TMS 1 polypeptide binding partner.
  • the TMSl polypeptide to be used in the test binding assay will depend upon the type of specific binding partner desired. For example, if a binding partner for the CARD of TMSl polypeptide was desired, polypeptides useful in the test binding assay would preferably be those that comprise a CARD. Even more preferably, the polypeptides may derive from the TMS 1 genomic locus. Examples include polypeptides which comprise an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25.
  • the library member may be pre-selected by prior exposure to polypeptides which lack the CARD such as polypeptides consisting of an amino acid sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:7, and SEQ ID NO:27.
  • This preselection step is most appropriate where the CARD-containing polypeptide used in the test binding assay also includes regions and/or domains of TMSl other than the CARD domain.
  • An agent that is capable of binding to the CARD of TMSl polypeptide is referred to herein as a TMSl CARD binding partner.
  • TMSl N-terminal polypeptide as used herein is a polypeptide that comprises at a minimum the N-terminal domain of TMSl, including either or both exon 1 and exon 2.
  • the TMSl N-terminal polypeptide comprises at a minimum exon 1 from a TMSl nucleic acid molecule. It should be understood that some but not necessarily all TMSl molecules are TMSl N-terminal molecules.
  • a test binding assay is performed between a TMSl N-terminal polypeptide and a library member and compared to a control binding assay.
  • a test binding assay result that is greater than the control binding assay result is indicative of a library member that is a TMSl N-terminal binding partner.
  • the TMSl N-terminal polypeptide preferably has an amino acid sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:27, but is not so limited.
  • the TMSI ⁇ I 00- 195 construct described in the Examples may be used as a TMSl N-terminal molecule.
  • the TMSl N- terminal polypeptide used in the test binding assay may have an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21 , SEQ ID NO:23 or SEQ ID NO:25. However, in these instances it may be preferably that the control binding assay is performed between a library member and a polypeptide having an amino acid sequence of SEQ ID NO: 10. In this way, library members that are specific for the CARD rather than the N-terminal domain of TMSl can be identified based on the comparison of the test result with the control.
  • the library members may be undergo a round of negative pre-selection in which they are allowed to contact and bind to a polypeptide having an amino acid sequence of SEQ ID NO: 10, prior to exposure to a TMS 1 N- terminal polypeptide.
  • Library members which bind to the CARD of TMSl will be removed and those that bind to the N-terminal domain of TMSl will be enriched.
  • TMSl N-terminal polypeptides can be used as dominant negative forms of TMSl which potentially bind to wild-type TMSl (e.g., polypeptides having an amino acid sequence comprising SEQ ID NO:3 or SEQ ID NO:25) and thereby prevent the normal interactions of TMSl with naturally occurring TMSl binding partners.
  • the TMSl N-terminal polypeptides may function as dominant negatives by complexing with wild-type TMSl polypeptides and thereby inhibiting their normal function (i.e., apoptosis induction).
  • TMSl N-terminal binding partners can be used to inhibit a potential dominant negative function of TMSl N-terminal polypeptides, if and where this is required for therapeutic benefit.
  • Candidate binding partners are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides, synthetic organic combinatorial libraries, phage display libraries of random peptides, and the like. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural and synthetically produced libraries and compounds can be readily modified through conventional chemical, physical, and biochemical means. Further, known pharmacological agents may be subjected to directed or random chemical modifications such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs of the agents.
  • the library member may be synthesized or it may be derived from natural sources (e.g., a cell or tissue lysate).
  • the TMSl polypeptide binding partner is naturally occurring. Binding partners identified according to the above methods may be further screened for their ability to either inhibit or promote the function of TMSl using apoptosis assay described in the Examples and those known in the art.
  • An agent that binds TMS 1 polypeptides may be conjugated to a detectable label. Conjugation of the agent to a detectable label facilitates, among other things, the use of such agents in diagnostic assays.
  • a detectable label is a moiety, the presence of which can be ascertained directly or indirectly. Generally, detection of the label involves an emission of energy by the label. The label can be detected directly by its ability to emit and/or absorb light of a particular wavelength. A label can be detected indirectly by its ability to bind, recruit and, in some cases, cleave another moiety which itself may emit or absorb light of a particular wavelength.
  • An example of indirect detection is the use of a first enzyme label which cleaves a substrate into visible products.
  • the label may be of a chemical, peptide or nucleic acid nature although it is not so limited.
  • Other detectable labels include radioactive isotopes such as P 32 or H 3 , luminescent markers such as fluorochromes, optical or electron density markers, etc., or epitope tags such as the FLAG epitope or the HA epitope, biotin, avidin and enzyme tags such as horseradish peroxidase, ⁇ -galactosidase, etc.
  • assays for binding partners are provided, including, labeled in vitro protein- protein binding assays, electrophoretic mobility shift assays, immunoassays, cell-based assays such as two- or three-hybrid screens, expression assays, etc.
  • transfected nucleic acids can encode, for example, combinatorial peptide libraries or cDNA libraries.
  • Convenient reagents for such assays e.g., GAL4 fusion proteins, are known in the art.
  • An exemplary cell-based assay involves transfecting a cell with a nucleic acid encoding a TMSl polypeptide fused to a GAL4 DNA binding domain and a nucleic acid encoding a reporter gene operably linked to a gene expression regulatory region, such as one or more GAL4 binding sites.
  • Activation of reporter gene transcription occurs when the TMSl and reporter fusion polypeptides bind such as to enable transcription of the reporter gene.
  • Agents which modulate a TMS 1 polypeptide mediated cell function are then detected through a change in the expression of reporter gene. Methods for determining changes in the expression of a reporter gene are known in the art.
  • TMS 1 fragments used in the methods, when not produced by a transfected nucleic acid are added to an assay mixture as an isolated polypeptide.
  • TMSl polypeptides preferably are produced recombinantly, although such polypeptides may be isolated from biological extracts.
  • Recombinantly produced TMSl polypeptides include chimeric proteins comprising a fusion of a TMSl protein with another polypeptide, e.g., a polypeptide capable of providing or enhancing protein-protein binding, sequence specific nucleic acid binding (such as GAL4), enhancing stability of the TMSl polypeptide under assay conditions, or providing a detectable moiety, such as green fluorescent protein or Flag epitope.
  • the invention also provides novel kits which could be used to measure the levels of the nucleic acids of the invention, expression products of the invention, anti-TMSl antibodies, or levels of methylation of genomic TMS 1 nucleic acid molecules.
  • pairs of primers for amplifying TMSl nucleic acids can be included.
  • the preferred kits would include controls such as known amounts of nucleic acid probes, TMS 1 epitopes (such as TMS 1 expression products), anti-TMSl antibodies, or TMSl genomic nucleic acid molecules with known amounts of methylation, as well as instructions or other printed material.
  • the printed material can characterize a risk of developing a disorder based upon the outcome of the assay.
  • kits may include standard materials such as labeled immunological reagents (such as labeled anti-IgG antibodies) and the like.
  • labeled immunological reagents such as labeled anti-IgG antibodies
  • one kit may contain a packaged polystyrene microtiter plate coated with TMSl protein and a container housing labeled anti-human IgG antibodies. A well of the plate is contacted with, for example, serum, washed and then contacted with the anti-IgG antibody. The label is then detected.
  • kit components are described below in connection with performing the various assays of the invention.
  • the invention also provides a method for identifying nucleic acid molecules which are transcriptionally down-regulated following methylation.
  • the method first involves overexpressing a methyltransferase molecule in an experimental cell.
  • a differentially expressed molecule can then be identified as one which has a lower level of expression in the experimental cell than in a control.
  • the control can be a cell, a tissue, a lysate of either, or a predetermined quantity of expression products present in a cell which does not overexpress a methyltransferase.
  • the control corresponds to the amount of expression products present in a parent cell from which the experimental cell was derived.
  • the differentially expressed molecules are essentially expression products (i.e., mRNA and/or polypeptides) which are differentially expressed in the experimental cell overexpressing a methyltransferase, as compared to a control.
  • the differentially expressed molecule can be identified in a number of ways. If the expression product is a nucleic acid (i.e., an mRNA), then it may be identified using techniques such as subtractive hybridization, differential display or representational difference analysis. Virtually all approaches aimed at identifying differentially expressed transcripts require the conversion of RNA to at least a first strand cDNA. Moreover, since these strategies intend to capture as many difference sequences as possible, some of which may be known and some of which may be novel, a global cDNA synthesis is performed.
  • a global cDNA synthesis is one in which an attempt is made to convert all RNA transcripts to cDNA.
  • One way of doing this involves the reverse- transcription of RNA molecules with an oligo-dT primer, which hybridizes to the polyadenylated tail of RNA transcripts and primes the first strand synthesis reaction.
  • the vast majority of mRNA transcripts are polyadenylated and thus can be captured in this way.
  • One way of achieving this is to limit the size of the first strand cDNA to about 700 bp.
  • the first strand synthesis is then followed by the addition of a nucleic acid tract of known sequence onto the 3' end of the first cDNA strand.
  • a homopolymer dA tract can be added to the 3' end using terminal transferase.
  • the first strand cDNA having a dT stretch at its 5' end and a dA stretch at its 3' end can be used as a template for the second cDNA strand using an oligo-dT primer. All subsequent amplifications require only oligo-dT as a primer.
  • cDNA should be amplified equivalently due to their common priming ends.
  • Another approach for synthesizing first strand cDNA involves the use of random hexamers which hybridize to mRNA transcripts with complementary sequences.
  • Subtractive hybridization generally involves the melting, combining and subsequent re- annealing of cDNA pools from a tester population and a driver population.
  • the tester population is the population which expresses the transcript and the driver is the population which does not.
  • the aim is to identify transcripts which as a result of methylation at the genomic level are down-regulated or silenced
  • the tester will be the population which expresses the transcript, i.e., the control
  • the driver will be the experimental cell overexpressing the methyltransferase.
  • Driver cDNA is generally used in vast excess as compared to tester cDNA, in order to effect as much of a subtraction as possible.
  • the driver population commonly carries a marker which allows it to be removed after the hybridization, such as a biotin molecule.
  • Biotin molecules can be easily added to nucleic acid using photobiotinylation as described by Barr et al. in Anal Biochem 186:369-373, 1990.
  • the single stranded tester and biotinylated driver are then combined and allowed to hybridize under suitable salt and temperature conditions. Once annealing is complete, streptavidin is added and the entire mixture is phenol extracted.
  • the phenol extraction serves to remove any nucleic acids to which the streptavidin has bound, including pure driver sequences and driver/tester hybrids.
  • the only nucleic acid sequences which remain in the aqueous phase are those which are expressed by the tester and not the driver populations.
  • this is rarely accomplished with only one round of subtraction, and as a result, several rounds of subtraction must be performed to arrive at true difference sequences.
  • a modification of this technique described by Diatchenko et al. and called suppression subtractive hybridization incorporates a normalization step to equalize cDNA abundance, and thereby reportedly requires only one cycle of hybridization.
  • RDA differentially expressed transcripts
  • Adapters are ligated to the digested cDNA and 'tester' (i.e., the control untreated cells) and 'driver' (i.e., DNMT overexpressing cells) cDNA pools are amplified using primers specific for the adapter. After removal of the adapter by re-digestion with DpnII, a second adapter is added only to the tester DNA. By using an unphosphorylated adapter only the top 24-mer is ligated to the 5' phosphate of the digested DNA. Tester and driver amplicons are then mixed, melted and reannealed using an excess of driver DNA.
  • the resulting hybrids are then amplified using a primer specific for the adapter sequence present only on tester DNA.
  • drive ⁇ driver hybrids will not amplify and tester:driver hybrids (i.e., sequences common between driver and tester pools) amplify linearly
  • teste ⁇ tester hybrids i.e., those messages present only in the control cell population
  • an enrichment for sequences present only in the tester population is achieved.
  • Final difference products are then subcloned and sequenced.
  • the RDA technique has been successfully applied by others to the isolation of target genes of transcriptional activators and differentially expressed genes during organ development.
  • the cloned difference products resulting from RDA are then used as probes on Northern blots to confirm down-regulation of expression resulting from DNMT overexpression.
  • As a control newly transfected or infected experimental cells are prepared along with their normal, control (i.e., untransfected, uninfected, or mock transfected or mock infected) counte ⁇ arts.
  • Expression of the newly identified difference clone is studied by Northern blot analysis using the subcloned difference product as the probe or by reverse transcriptase PCR using primers designed from sequence analysis of the difference product.
  • genes that are specifically down-regulated as a result of overexpression of DNMT are those difference products representing mRNAs that are consistently down-regulated in response to DNMT overexpression in independently generated experimental cells are reasonable candidates.
  • Sequences isolated in this manner that display DNMT-dependent silencing are then sequenced and compared to the GenBank non-redundant and EST databases using the BLAST algorithm.
  • Subclones derived from the RDA technique will be small (200-300bp) and could be derived from any part of the mRNA (i.e., the 3' end). Consequently, sequences may lie quite far on a genomic scale from the potential promoter and CpG island. Since CpG islands often surround exon 1 (for example, the CpG island of the TMSl genomic locus), isolation of the 5' end of the cDNA will allow analysis of the methylation status of the CpG island.
  • cDNA clones and genomic promoter region clones/sequence information are likely to be available. If a novel gene is isolated, the 5' end of the corresponding cDNA is isolated using a variation of 5' RACE (rapid amplification of cDNA ends) developed and commercially available from Clontech. This procedure can be used to amplify the 5' end of the differentially expressed cDNAs from the 'tester' cDNA pool (i.e., the cDNA pool from which it was isolated ).
  • 5' RACE rapid amplification of cDNA ends
  • a blunt-ended double-stranded adapter is ligated to either end without prior restriction such that the cDNA remains 'full-length'.
  • a primer derived from the isolated sequence is paired with a primer specific to the adapter to yield either a product extending to the 5' or 3' end of the cDNA which can be distinguished based on the inclusion of the poly(A) tail in the 3' end product. Amplified product containing the 5' end is then subcloned.
  • differential display involves the amplification of two cDNA pools using arbitrary primers and visual comparison of the amplified pools in toto after separation on polyacrylamide gels.
  • this technique is relatively simple to perform and somewhat less time consuming than RDA, the addition of a 'subtractive' component in the RDA technique greatly enriches for differentially expressed products and reduces the risk of false positives, a common pitfall of the differential display technique.
  • the expression product is a polypeptide, then it may be identified using, for example, gel electrophoresis separation followed by Coomassie Blue staining. In this latter approach, differences between the experimental cell and a control may be revealed by the presence or absence of stained protein bands. Further separation, sequencing and cloning of these "difference band" would then be required, all of which are within the realm of the ordinary artisan.
  • the methyltransferase molecule may be a nucleic acid molecule or a polypeptide, as long as sufficient and sustained levels of methyltransferase activity can be effected in the experimental cell.
  • Methyltransferase activity as used herein refers to the ability to methylate nucleic acid residues, particularly cytosines. Any type of methyltransferase can be used provided it is able to methylate cytosine residues in the experimental cell.
  • methyltransferases useful in the invention include human DNA methyltransferases such as DNMTl, DNMT2, DNMT3a and variants thereof, and DNMT3b and variants thereof, as well as murine DNA methyltransferases such as Dnmtl , Dnmt2, Dnmt3a and Dnmt3b.
  • the experimental cell can be chosen from any number of cells, including primary cells and established cell lines. The use of established cell lines is more convenient in some instances. Examples of suitable experimental cells are epithelial cells and fibroblasts.
  • the experimental cell is an SV40 immortalized version of a fibroblast cell line such as IMR90, which has been engineered to overexpress a DNA methyltransferase nucleic acid. Where primary cells are used, a breast epithelial cell or a fibroblast are suitable choices.
  • the control cell is usually the non-DNMT expressing version of the experimental cell. As an example, if the experimental cell is an SV40 immortalized version of IMR90 overexpressing DNMT, the control would be an untreated SV40 immortalized version of IMR90 cells.
  • the DNA methyltransferase (DNMT) nucleic acid can be introduced into experimental cells in any number of ways including calcium phosphate transfection, DEAE transfection, Lipofectamine® transfection, as well as infection methods using retro- or adenoviruses as an example.
  • Suitable promoters for the constitutive expression of a coding sequence in a mammalian cell include the retro viral promoters contained in long-terminal repeats and the promoter and enhancer elements of CMV.
  • the DNA methyltransferase can be constitutively overexpressed in the experimental cell as a result of being operably linked to a constitutive promoter.
  • DNMT can be inducibly expressed through the use of inducible systems which are commercially available.
  • inducible expression systems include zinc-inducible metallothionein promoters, tetracycline-inducible promoters and tetracycline-sensitive transcriptional repressors, RU 486-inducible promoters, ecdysone-inducible promoters and FK506 inducible promoters together with new rapamycin analogues
  • the invention also provides a number of diagnostic and therapeutic methods and tools relating to disorders broadly characterized by decreased or absent TMSl activity such as apoptotic induction activity. Such disorders can result from a decrease or an absence of TMSl expression products, or a mutation in TMSl nucleic acid molecules which thereby encode a mutant rather than wild-type TMSl polypeptide.
  • a TMS 1 expression product is meant to embrace TMS 1 mRNA and
  • TMSl polypeptides are characterized by, or associated with, an abnormal methylation of CpG island containing TMSl nucleic acid molecules.
  • CpG island containing TMSl nucleic acid molecules are defined as those nucleic acid molecules inherently integrated in the genome of the subject. That is, CpG island containing TMSl nucleic acid molecules represent the genomic TMS 1 nucleic acid molecule. In some instances, the CpG island containing molecules also encode a TMSl polypeptide.
  • the CpG island region of TMSl i.e., SEQ ID NO:4 or fragments thereof could also be used to study methylation patterns apart from any coding region contained therein.
  • the disorder is defined as the presence of a cell or a tissue which, compared to a normal cell population, exhibits increased methylation of the genomic locus of TMSl, decreased levels of TMS 1 expression products and/or the presence of TMS 1 nucleic acid or polypeptide mutants, including dominant negative mutants.
  • decreased levels intend to encompass a complete absence of, or a reduction relative to normal.
  • a subset of these disorders is defined as those in which the nucleotide sequence of SEQ ID NO: 1 , particularly the CpG island located at nucleotides 1100- 1725, is methylated to a greater extent than that which is observed in normal tissue counterparts.
  • the invention seeks to diagnose and treat, prophylactically and/or therapeutical ly, disorders characterized by abnormal levels of TMSl expression products or abnormal levels of methylation.
  • disorders characterized by abnormal levels of TMSl expression products or abnormal levels of methylation.
  • a "normal" level as used herein in reference to the level of TMSl expression, TMSl polypeptide, or TMSl methylation, may be a level in a control population, which preferably includes subjects having similar characteristics as the treated individual, such as age and sex.
  • the "normal" level can also be a range, for example, where a population is used to obtain a baseline range for a particular group into which the subject falls.
  • the "normal” value can depend upon a particular population selected.
  • the normal levels are those of apparently healthy subjects who have no prior history of methylation- or TMSl-mediated disorders. More preferably, the normal level is that level in a tissue of a normal subject corresponding to the tissue sampled for the test subject.
  • the normal levels can also be determined by measuring expression, translation and/or methylation levels in a sample of normal tissue adjacent to the suspected diseased tissue in the subject.
  • breast tumors are, in some cases, sufficiently delineated to the extent that such tissue can be distinguished from the surrounding normal breast tissue.
  • This delineation facilitates selective removal of diseased breast tissue, such as occurs in non-radical mastectomies (e.g., lumpectomy).
  • delineation can be used in the present invention to harvest both suspected diseased tissue and normal tissue from a given subject.
  • Such normal levels then can be established as preselected values, taking into account the category in which an individual falls.
  • Appropriate ranges and categories can be selected with no more than routine experimentation by those of ordinary skill in the art. Either the mean or another preselected number within the range can be established as the normal preselected value.
  • Abnormally low levels of a TMSl molecule are defined as levels lower than those observed in a control population itself defined as a normal as described herein.
  • the control is preferably a tissue which corresponds to the tissue analyzed in the subject at risk or the subject having the disorder.
  • the control is preferably breast tissue from a normal subject, or more specifically levels of TMSl molecules in breast tissue from normal subjects.
  • the TMS 1 molecules may be administered directly to a tissue, particularly one which is at risk of developing a tumor.
  • native TMSl nucleic acid molecules is meant a subset of TMSl nucleic acid molecules which are naturally occurring in a cell or tissue.
  • Naturally occurring means those present or coded for in the genome of a cell which has not been the recipient of gene transfer by transfection, transformation, electroporation or any other gene transfer method known in the art.
  • the disorder being diagnosed or treated is a proliferative disorder such as cancer.
  • a cancer is defined as an uncontrolled, abnormal growth of cells, which can either remain localized or may disseminate throughout the body via the bloodstream or the lymphatic system, and thereby seed a secondary site (i.e., a metastasis).
  • Diagnosis and treatment as used herein are directed to a cancer at its primary site and/or at a metastatic site.
  • cancers to be diagnosed or treated include: biliary tract cancer; brain cancer, including glioblastomas and medulloblastomas; breast cancer; cervical cancer; choriocarcinoma; colon cancer; endometrial cancer; esophageal cancer; gastric cancer; hematological neoplasms, including acute lymphocytic and myelogenous leukemia; chronic lymphocytic and myelogenous leukemia, multiple myeloma; AIDS associated leukemias and adult T- cell leukemia lymphoma; intraepithelial neoplasms, including Bowen's disease and Paget's disease; liver cancer; lung cancer; lymphomas, including Hodgkin's disease and lymphocytic lymphomas; neuroblastomas; oral cancer, including squamous cell carcinoma; ovarian cancer, including those arising from epithelial cells, stromal cells, germ cells and mesenchymal cells; pancreas cancer; prostate cancer;
  • the invention seeks to diagnose and treat breast cancer, cervical cancer, leukemia, ovarian cancer and prostate cancer. Even more preferably, the invention is directed at breast cancer.
  • the invention is directed to a method for identifying a subject at risk of developing a disorder, such as a tumor, characterized by methylation of a CpG island containing TMSl nucleic acid molecule. The method involves determining a level of methylation of a CpG island containing TMSl nucleic acid molecule and comparing such level of methylation to a control.
  • the CpG island containing TMS 1 nucleic acid molecule in this embodiment, is selected from the group consisting of (a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule consisting of SEQ ID NO:4 (i.e., nucleotides 1100-1725 of SEQ ID NO: l) and which code for a native TMSl polypeptide, and (b) complements of (a).
  • SEQ ID NO:4 i.e., nucleotides 1100-1725 of SEQ ID NO: l
  • a complements of (a).
  • an increase in the level of methylation of the CpG island containing TMSl nucleic acid molecules in the biological sample compared to the control identifies a subject at risk of developing, for example, the tumor.
  • Subjects having a disorder characterized by methylation of a CpG island containing TMSl nucleic acid molecule can also be identified using a similar approach.
  • the level of methylation of a CpG island can be determined using a number of techniques available in the art. These include methylation-sensitive restriction analysis, methylation-specific polymerase chain reaction (MSP), sequencing of bisulfite-modified DNA, Ms-SnuPE, and COBRA.
  • Methylation-sensitive restriction analysis is derived from the existence in nature of restriction enzymes which are methylation sensitive (i.e., these enzymes do not recognize restriction sites which contain methylated residues). For example, the restriction enzyme Notl recognizes the sequence containing 2 'CG' dinucleotides. If either of the CG sites is methylated, the enzyme will not digest DNA. This fact has been heavily utilized in the analysis of DNA methylation in genomic DNA.
  • DNA is digested with a methylation-sensitive restriction enzyme and then electrophoresed on an agarose gel which separates DNA based on its size.
  • the DNA is then transferred to a membrane and hybridized to a radiolabeled probe, as is routinely done in a Southern analysis. Based on the sizes of the bands which hybridize to the probe, the digested, and therefore unmethylated, DNA can be distinguished from the undigested, and therefore methylated, DNA.
  • Other methylation-sensitive enzymes include SacII, Eagl, Smal, Thai, Hpall, all of which are commercially available.
  • MSP methylation specific PCR
  • Reaction vessels contain either methylation specific primers or primers specific for the unmethylated sequence, and thus an amplified product is formed only if the appropriate primers are present. It is preferred that two reactions are performed for each sample, one with methylation specific primers, and one with non-methylation specific primers. This technique allows the methylation status of virtually any CG dinucleotide to be known. Moreover, it requires minute amounts of DNA, on the order of nanograms or less. The nucleotide sequence of SEQ ID NO: 1 can be used to design appropriate primers for use in this technique.
  • Genomic sequencing of bisulfite modified DNA is another method for determining methylation level of TMSl genomic DNA. Like the methods described above, this method is also based on the differential reactivity of cytosine and 5-methylcytosine with sodium bisulfite. In this approach however, primers are designed to avoid potential methylation sites (e.g., CG dinucleotides) and a non-specific PCR is performed in order to amplify all alleles equally. Following amplification, the PCR product is sequenced directly, or can be subcloned into a plasmid and individual subclones sequenced. The sequence of amplified products is compared to that of non-bisulfite treated DNA.
  • primers are designed to avoid potential methylation sites (e.g., CG dinucleotides) and a non-specific PCR is performed in order to amplify all alleles equally.
  • the PCR product is sequenced directly, or can be subcloned into a plasmid and
  • COBRA is a quantitative technique described by Xiong and Laird for determining DNA methylation levels at specific genetic loci in small amounts of genomic DNA. (Nucleic Acids Res 25:2532-4, 1997) The technique uses restriction enzyme digestion to reveal methylation-dependent sequence differences in PCR products of sodium bisulfite-treated DNA.
  • methylation levels in a original DNA sample are represented by the relative amounts of digested and undigested PCR product. This ratio has been shown to be linearly quantitative over a broad range of DNA methylation levels.
  • the method has also been applied to DNA sample harvested from microdissected paraffin-embedded tissue samples, thus facilitating the analysis of tissue from a subject by eliminating the need for immediate processing of such samples.
  • Ms-SNuPE has been reported by Gonzalgo and Jones as a method for rapid quantitation of altered methylation patterns at specific sites, particularly CpG sites, in the genome. (Nucl. Acids Res. 25:2529-31, 1997)
  • the approach relies on methylation sensitive single nucleotide primer extension and involves bisulfite treatment of DNA followed by single nucleotide primer extension. It does not involve restriction enzyme analysis. Briefly, genomic DNA is first reacted with sodium bisulfite to convert unmethylated cytosine to uracil without modification of 5-methylcytosine, as in other approaches described above. The bisulfite treated DNA is then amplified using PCR primers specific for bisulfite-converted DNA.
  • the amplified product is then used as a template for methylation analysis at the CpG site(s) of interest.
  • the method is amenable to the analysis of small amounts of DNA.
  • Ms-SNuPE can be used in the analysis of microdissected pathology sections.
  • Cytosine methylation can also be measured using a approach which combines automated genomic DNA sequencing and GENESCAN analysis. This approach has been reported by Paul and Clark in Biotechniques 21: 126-133, 1996. Similarly to the aforementioned approaches, this technique requires bisulfite treatment and PCR amplification of DNA. Cloning and sequencing of the modified and amplified products is then performed to determine the methylation of individual DNA molecules. The sequencing of the entire population of amplified products provides the average methylation status over the population, and thus may not be appropriate if the methylation status of individual molecules is desired. By employing fluorescence-based automated genomic sequencing, Paul and Clark were able to directly quantitate methylation status of any cytosine residue in a DNA molecule.
  • the technique involves sequencing only.cytosine and thymine residues of modified and amplified DNA and using fluorescent dyes to identify and visualize signals from these residues. GENESCAN analysis is then performed to estimate methylation at every cytosine in a rapid and accurate manner.
  • the approach permits a rapid overview of DNA methylation profiles for a number of DNA molecules.
  • Yet another approach for quantitating genomic methylation was reported by McGrew and Rosenthal and involves the use of ligation-mediated PCR. (Biotechniques 15:722-9, 1993) This technique, like others described herein, is particularly suited to the measurement of CpG methylation. It involves the measurement of conversion of large genomic DNA fragments to shorter DNA fragments as a function of demethylation.
  • the cleavage of large genomic DNA is accomplished using pairs of non-isoschizometic enzymes, one of which is methylation specific.
  • the digestion products are then amplified with ligation-mediated, radiolabeled PCR, and used as a measure of cleavage with the methylation sensitive restriction enzyme. Specifically, the ratio of the two amplified fragments is related to the degree of methylation at the particular restriction site. Internal control of the amplification reaction confers the quantitative aspect of the approach.
  • the biological sample can be a tissue or a biological fluid.
  • tissue refers to both localized and disseminated cell populations including brain, heart, serum, breast, colon, bladder, uterus, prostate, stomach, testis, ovary, pancreas, pituitary gland, adrenal gland, thyroid gland, salivary gland, mammary gland, kidney, liver, intestine, spleen, thymus, bone marrow, blood, trachea, and lung.
  • test samples originate from colon, breast and prostate tissues.
  • Biological fluids include saliva and urine, but are not so limited.
  • the tissue is breast tissue. Both invasive and non-invasive techniques can be used to obtain such samples and are well documented in the art.
  • control in some embodiments, is a normal tissue from a normal subject. In certain embodiments, the control is normal tissue from a subject having the disorder. As an example, the control may be normal breast tissue from a subject having breast cancer.
  • the invention provides a method for determining a risk of developing a disorder characterized by methylation of a CpG island containing TMS 1 nucleic acid molecule.
  • the method involves measuring a level of a TMSl expression product (e.g., an expression product of a CpG island containing TMS 1 nucleic acid molecule) in a biological sample by contacting the biological sample isolated from a subject with an agent that selectively binds to a TMS 1 expression product.
  • a TMSl expression product e.g., an expression product of a CpG island containing TMS 1 nucleic acid molecule
  • the TMSl expression product can be a nucleic acid expression product which hybridizes under stringent conditions to a complement of a molecule comprising a nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:24, for example, and which codes for a native TMSl polypeptide.
  • Such nucleic acid expression products include mRNA species and 2nd strand cDNA species synthesized from the mRNA.
  • the TMSl expression product can also be a polypeptide expression product, or a fragment thereof, of the TMSl nucleic acid expression products. The level of interaction between the agent and the TMSl expression product is determined and compared with a control. If the level of
  • TMSl nucleic acid expression products is being measured, such a determination can be carried out via any standard nucleic acid determination assay, including the polymerase chain reaction, or assaying with labeled hybridization probes, as in a Northern analysis.
  • the agent is preferably a nucleic acid molecule. If the level of TMSl polypeptide expression products is being measured, such a determination can be carried out via any standard immunological assay using, for example, polyclonal or monoclonal antibodies or antisera which bind to the secreted TMSl protein.
  • the agent is preferably a peptide, such as an antibody or antibody fragment, but it is not so limited.
  • a decrease in the level of interaction between the agent and the target expression product in the biological sample compared to the control indicates a risk of developing the disorder.
  • a control can include a known amount of a nucleic acid probe or a TMSl epitope (such as a
  • control is a similar tissue sample from a subject with a control or 'normal' level of TMSl expression, or with a control or normal level of methylation in the TMSl locus.
  • the invention intends to embrace similar approaches for determining the risk of developing, or identifying subjects at risk of developing, a disorder characterized by abnormally low levels of TMSl expression products.
  • the invention embraces a method of diagnosing in a subject a disorder characterized by the presence of a mutant TMSl molecule.
  • a TMSl molecule as used herein includes a nucleic acid molecule and a polypeptide.
  • a mutant TMSl molecule may be a mutant TMSl nucleic acid molecule, which in turn encompasses both genomic and cDNA TMSl nucleic acid molecules, or alternatively, it may be a mutant TMS 1 polypeptide or a fragment thereof.
  • the method involves (a) characterizing TMSl molecules in a biological sample and (b) comparing the TMSl molecules of the biological sample to TMSl molecules of a control. An observed alteration or match, as the case may be, in a TMSl molecule in the biological sample as compared to TMSl molecules in the control, is indicative of a disorder characterized by the presence of a mutant TMSl molecule.
  • mutant TMSl molecules are defined as those which account for a diminished or absent native TMSl activity (e.g., apoptosis induction).
  • the control may contain wild-type TMSl molecules, while in others, it may contain mutant TMS 1 molecules.
  • alteration it is meant that a TMS 1 molecule in the biological sample is different from the normal TMSl molecule contained in the normal control.
  • an observed "match” occurs when the TMSl molecule in the biological sample is identical to a mutant TMSl sequence in a mutant control. Appropriate differences and/or matches in the sequences can be determined with no more than routine experimentation by those of ordinary skill in the art.
  • a subject is a human, non-human primate, cow, horse, pig, sheep, goat, dog, cat or rodent. In all embodiments, human subjects are preferred.
  • the invention provides various methods for the treatment of subjects having a variety of disorders.
  • the term "treat” encompasses both prophylactic and therapeutic treatment, and it embraces the prevention of disorders, inhibition and/or amelioration of pre-existing disorders.
  • the subject may be at risk of developing a disorder, or alternatively, the subject may have such a disorder.
  • a treatment may reduce or eliminate a disorder altogether or prevent it from becoming worse.
  • the invention provides prophylactic and therapeutic methods for increasing levels of TMSl nucleic acid molecules and/or their expression products.
  • Expression products as used herein is intended to embrace both transcriptional expression products (i.e., RNA species) and translational expression products (i.e., peptides and polypeptides).
  • the invention in one aspect, embraces the treatment of subjects that express abnormal levels of TMSl expression products in a tissue or a cell, preferably the tissue or cell suspected of having the disorder.
  • a tissue or a cell preferably the tissue or cell suspected of having the disorder.
  • the abnormal levels of TMS 1 expression products can be the result of, among other things, abnormal, preferably increased, methylation of the TMSl genomic locus, and/or production of mutant rather than wild-type TMS 1 expression products. Mutations to TMS 1 nucleic acid molecules or polypeptides which prohibit normal functioning of the polypeptide can also serve to cause or predispose a malignant phenotype to a cell.
  • the invention provides a method for treating a subject having, or at risk of developing, a disorder characterized by abnormal methylation of a CpG island containing TMSl nucleic acid molecule.
  • a subject at risk of developing is administered a demethylating agent in an amount effective to maintain a normal level of methylation in a CpG island containing TMSl nucleic acid molecule in a tissue of the subject.
  • the effective amount is that amount required to reduce the level of methylation, preferably to normal or to below normal levels.
  • a demethylating agent is agent which directly or indirectly causes a reduction in the level of methylation of a nucleic acid molecule.
  • Demethylating agents include inhibitors of methylating enzymes such as methylases and methyltransferases.
  • Examples of demethylating agents useful in the invention include 5-azacytidine, 5-aza-2'deoxycytidine (also known as Decitabine in Europe), 5, 6- dihydro-5-azacytidine, 5, 6-dihydro-5-aza-2'deoxycytidine, 5-fluorocytidine, 5-fluoro- 2'deoxycytidine, and short oligonucleotides containing 5-aza-2'deoxycytosine, 5, 6-dihydro-5-aza- 2'deoxycytosine, and 5-fluoro-2'deoxycytosine.
  • DNA methyltransferase inhibitors act as DNA methyltransferase inhibitors. Agents like these, such as the derivatives mentioned, are most effective if capable of being inco ⁇ orated into a nucleic acid, preferably, DNA. Other agents reported to inhibit DNA methyltransferases and/or cause demethylation in vitro include procanamide and S-adenosyl homocysteine. Several candidate small molecule demethylating agents, including inhibitors of methyltransferase, which do not require nucleic acid inco ⁇ oration to manifest their effects, are currently being developed.
  • the demethylating agent is an agent which is inherently specific for a particular tissue or tumor type or alternatively, the agent is one which is modified in such a manner to achieve the desired specificity.
  • these latter modifications may include the coupling of the agent to a cell- specific or tissue-specific targeting moiety, as described herein.
  • the demethylating agent may be coupled to a nucleic acid molecule which is specific for the TMSl genomic locus.
  • a targeting nucleic acid molecule can be a nucleic acid molecule which hybridizes under stringent conditions to a complement of a molecule consisting of SEQ ID NO: 1 , or it may be a complement of such a molecule.
  • the demethylating agent may be administered to a tissue at risk of developing or already having the disorder.
  • the disorder is a cancer, such as tumor.
  • Such tissues are preferably selected from breast tissue, prostate tissue, ovarian tissue, cervical tissue and bone marrow.
  • the prophylactic method may further comprise, in another embodiment, the selection of a subject at risk of developing a disorder prior to the administration of the demethylating agent.
  • a subject may be identified using the diagnostic methods provided herein. Namely, a subject at risk may be one who exhibits an abnormal level of TMS 1 expression products or one who exhibits an abnormal level of methylation in the TMSl genomic locus.
  • subjects to be administered a demethylating agent are selected on the basis of an abnormal level of methylation in the TMSl genomic locus.
  • Other subjects at risk of developing such a disorder may be those with a family history of such disorders.
  • subjects with a family history of breast cancer and/or abnormal TMSl methylation may be considered subjects for prophylactic treatment regardless of whether the TMSl genomic locus in the specific subject is methylated.
  • the method may also involve the prior selection of a subject having the disorder, either using the diagnostic methods described herein, or other procedures known in the art.
  • subjects intended to be treated according to the present invention include those diagnosed with breast cancer. This diagnosis may use the methods described herein, including the analysis of the level of methylation of TMSl nucleic acid molecules or the level of TMSl expression products.
  • the subject may be diagnosed according to well known procedures such as mammography and cytological analysis following biopsy. Regardless of the form of diagnosis, the subject is intended to be treated for such a disorder according to the methods of the invention.
  • the invention provides a method for treating a subject having or at risk of developing, a disorder, perhaps in a tissue, characterized by abnormally low levels of a TMSl expression product. If the subject has the disorder, the method involves administering to such a subject a demethylating agent in an amount effective to reduce the level of methylation in the TMSl genomic locus (i.e., the CpG island containing TMSl nucleic acid molecule) in a tissue (which has the disorder) of the subject.
  • An effective amount of the demethylating agent may be defined as that amount necessary to reduce the level of methylation in the TMSl genomic locus to below pre- treatment levels.
  • the effective amount may that amount necessary to reduce the level of methylation to a normal level of methylation. If the subject is at risk of having the disorder, the effective amount is that amount effective to maintain methylation levels in the TMSl genomic locus at normal levels or to reduce the level of methylation to normal or below normal levels.
  • An anticipated and measurable outcome of any suitable reduction in methylation of the TMSl genomic locus is an increase in the level of TMSl expression products as compared to pre-treatment levels.
  • the invention also embraces a method for treating subjects expressing a mutant TMSl.
  • wild-type refers generally to a molecule which is ordinary, common, without defect or affect, and not mutant.
  • An ordinary molecule also refers generally to sequences or structures that, while they may vary from a canonical sequence or structure, comprise neutral polymo ⁇ hisms and do not vary in function from a molecule having a non-mutant sequence or structure.
  • a wild-type TMSl is, for example, a nucleic acid molecule of SEQ ID NO:2 and its encoded wild-type polypeptide presented as SEQ ID NO:3.
  • Another example of a wild-type TMSl nucleic acid molecule is one having the nucleotide sequence of SEQ ID NO:24, and another wild-type TMSl polypeptide is one having the amino acid sequence of SEQ ID NO:25.
  • Wild-type TMSl polypeptide i.e., native TMSl polypeptide is capable of apoptosis induction, as described herein.
  • a "mutant" TMSl typically has undergone a nucleic acid substitution that results in a non-conservative amino acid substitution at the polypeptide level that changes the functional characteristics of TMSl, thus rendering, for example, a proliferative or drug-resistant phenotype to the cell.
  • TMSl mutants may function as dominant negatives which interact, in a non-productive manner, with other TMS 1 polypeptides or with other binding partners of wild-type TMSl, to prevent the normal functioning of TMSl polypeptides.
  • the dominant negative TMSl mutants remove, or titrate out, functional wild-type TMSl polypeptides or their wild-type binding partners, from the intracellular environment.
  • the mutant TMSl polypeptides may interfere with or inhibit normal TMSl polypeptides and their naturally occurring binding partners (i.e., TMSl ligands), and by doing so ultimately decrease the apoptotic capacity of a cell (i.e., the ability of a cell to undergo apoptosis in response to normally inducing apoptotic signals).
  • An example of a mutant TMSl molecule may be one having only exon 1 or exon 2 or one lacking exon 3.
  • the invention also intends to treat subjects having disorders characterized by expression of a mutant TMSl, or abnormally low levels of TMSl expression products, or abnormal methylation level of a TMS 1 nucleic acid, by administering an effective amount of a CARD-containing molecule to, preferably a tissue of the subject having the disorder.
  • the effective amount is generally that amount , effective to increase the level of CARD-containing polypeptides in the affected tissue (or cells or cell population) of the subject.
  • Methods directed at treating such subjects using CARD-containing molecules may also include the prior selection of a subject in need of such treatment (i.e., a subject having or at risk of developing a disorder characterized as above).
  • a CARD-containing molecule is a molecule that contains either the nucleotide sequence or the amino acid sequence of a CARD and is able to induce apoptosis in a manner similar to that of native TMSl polypeptides, as described herein.
  • the CARD-containing molecule includes both CARD- containing nucleic acid molecules and CARD-containing polypeptides.
  • a CARD is found in exon 3 of SEQ ID NO: 1 and SEQ ID NO:2 which code for TMSl polypeptide.
  • the CARD molecule is a nucleic acid molecule it is one having a nucleotide sequence selected from the group consisting of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:9, SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24, while if it is a polypeptide it is one having an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25.
  • the CARD- containing molecule be a TMSl molecule, it is not so limited.
  • a TMSl molecule as used herein embraces TMSl nucleic acid molecules (e.g., genomic, cDNA and mRNA species) and functional TMSl peptides and polypeptides.
  • the invention embraces the molecules described in this paragraph.
  • the TMS 1 molecule may also be a TMS 1 polypeptide.
  • the TMS 1 molecule is a polypeptide which comprises SEQ ID NO:3.
  • the TMSl nucleic acid molecule can be SEQ ID NO:20 or SEQ ID NO:22
  • the TMS 1 polypeptide can be SEQ ID NO:21 or SEQ ID NO:23.
  • the invention also embraces fragments of TMSl molecules that include a CARD. Such fragments may be of various lengths, as described previously herein.
  • Methods of the invention that embrace the use of CARD-containing or TMSl nucleic acid molecules may be performed using embraces gene therapy.
  • the procedure for performing ex vivo gene therapy is outlined in U.S. Patent 5, 399, 346 and in exhibits submitted in the file history of that patent, all of which are publicly available documents. In general, it involves introduction in vitro of a functional copy of a gene into a cell(s) of a subject which contains a defective copy of the gene, and returning the genetically engineered cell(s) to the subject.
  • the functional copy of the gene is under operable control of regulatory elements which permit expression of the gene in the genetically engineered cell(s).
  • the invention provides a method for treating a subject having a disorder characterized by abnormal cell proliferation.
  • This aspect of the invention is premised, in part, on the unexpected finding that overexpression of a TMSl nucleic acid molecule in a cell induces the cell to undergo apoptosis, regardless of whether the cell expresses TMSl expression products prior to treatment.
  • the method involves administering a TMSl molecule to a tissue having the disorder in an amount effective to increase the level of TMSl polypeptide to an above-normal level.
  • the above-normal level may be at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, at least 150%, at lest 200% or at least 300% above normal levels.
  • the level of TMSl polypeptide is one which is sufficient to induce apoptosis of the cell in which it is expressed.
  • abnormal cell proliferation refers to a population of cells which exhibit an abnormal (e.g., increased) rate of division or an abnormal response or dependency on growth stimuli, as compared to their normal tissue counte ⁇ arts.
  • the population of cells may be localized (e.g., a tumor) or they may be disseminated (e.g., a leukemia).
  • Disorders characterized by an abnormal cell proliferation include but are not limited to conditions involving solid tumor masses of benign, pre-malignant or malignant character.
  • some of these solid tumor masses arise from at least one genetic mutation, some may display an increased rate of cellular proliferation as compared to the normal tissue counte ⁇ art, and still others may display factor independent cellular proliferation.
  • Factor independent cellular proliferation is an example of a manifestation of loss of growth control signals which some, if not all, tumors or cancers undergo.
  • the disorder need not be one characterized by abnormal methylation of a CpG island containing TMS 1 nucleic acid molecule or by an abnormally low level of a TMS 1 expression product, or by the presence of a mutant TMS 1.
  • the method may be used to treat a subject having a cancer which is not related to deregulation of the TMS 1 genomic locus.
  • the TMS 1 nucleic acid molecule useful in gene therapy may be selected from the group consisting of (a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule comprising a nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO:24, for example, and which code for a functional TMSl polypeptide, (b) deletions, additions and substitutions of (a) which code for a functional TMSl polypeptide, (c) nucleic acid molecules that differ from the nucleic acid molecules of (a) or (b) in codon sequence due to the degeneracy of the genetic code, and (d) complements of (a), (b) or (c).
  • the TMSl nucleic acid molecule comprises SEQ ID NO:2 or SEQ ID NO:24. In a more preferred embodiment, the TMSl nucleic acid molecule encodes a polypeptide, or a fragment of a polypeptide, comprising an amino acid sequence of SEQ ID NO:3, or SEQ ID NO:25.
  • the gene therapy envisioned by the invention includes the use of TMSl polypeptide encoding nucleic acid vectors which are regulated by tissue specific regulatory elements.
  • Suitable vectors include adenovirus and retroviruses, both of which have been approved for human gene therapy trials.
  • the retroviruses are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle).
  • Such genetically altered retroviral expression vectors have general utility for the high-efficiency transduction of genes in vivo.
  • the promoter element may be one which is ubiquitously expressed (e.g., a promoter within the LTR of a retrovirus) and specificity of expression can be imparted by the selective delivery of the vector within the subject. Methods and compositions for specific targeting of tissues within a subject are described herein.
  • the invention relates to the administration of a CpG island containing TMSl nucleic acid molecule to a subject at risk of developing such disorders.
  • the molecule comprises nucleotides 1100-1725 of SEQ ID NO: 1 (i.e., SEQ ID NO:4).
  • SEQ ID NO:4 nucleotides 1100-1725 of SEQ ID NO: 4
  • the pu ⁇ ose of administering a CpG island containing nucleic acid molecule to such a subject is to redirect, and in some instances saturate, the methylating activity which would otherwise be directed at the genomic TMSl locus.
  • the invention is also useful in the generation of knock-out and/or transgenic non-human animals.
  • knock-out non-human animals include animals in which the endogenous TMSl genomic locus has been mutated to an extent that it either can no longer be transcribed to produce mRNA, or any mRNA so produced does not lead to the production of wild-type TMSl polypeptide. Such knock-outs are generally referred to as nulls, since neither wild-type nor mutant TMSl polypeptides are detectably produced by the cells after mutation.
  • Other "knock-out" animals embraced by the invention are those in which mutation and/or deletion of one or more coding regions within a genomic locus still results in the production of a protein species, albeit one which is mutant usually in the form of a truncation.
  • TMSl polypeptides which are mutants which still possess function, usually in the form of a negative function.
  • An example of a dominant negative mutation is one which promotes the binding of mutant TMSl polypeptide to its natural wild-type binding partners but prevents the natural disassociation of this interaction and/or prevents the wild-type binding partner from functioning as would normally under such association.
  • Such animals are useful since they can simulate varying degrees of null mutations, based on the proportion of wild-type TMSl polypeptides which exist in the cell unassociated with the dominant negative forms of the TMSl polypeptide.
  • transgenic non-human animals includes non-human animals having one or more exogenous nucleic acid molecules inco ⁇ orated in germ line cells and/or somatic cells.
  • transgenic animals include “knockout” animals having a homozygous or heterozygous gene disruption by homologous recombination, animals having episomal or chromosomally inco ⁇ orated expression vectors, etc.
  • Knockout animals can be prepared by homologous recombination using embryonic stem cells as is well known in the art. The recombination may be facilitated using, for example, the cre/lox system or other recombinase systems known to one of ordinary skill in the art.
  • the recombinase system itself is expressed conditionally, for example, in certain tissues or cell types, at certain embryonic or post-embryonic developmental stages, inducibly by the addition of a compound which increases or decreases expression, and the like.
  • conditional expression vectors used in such systems use a variety of promoters which confer the desired gene expression pattern (e.g., temporal or spatial).
  • Conditional promoters also can be operably linked to TMS 1 nucleic acid molecules to increase expression of TMS 1 in a regulated or conditional manner.
  • Trans-acting negative regulators of TMSl activity or expression also can be operably linked to a conditional promoter as described above.
  • trans-acting regulators include antisense TMSl nucleic acids molecules, nucleic acid molecules which encode dominant negative TMS 1 molecules, ribozyme molecules specific for TMS 1 nucleic acids, and the like.
  • the transgenic non-human animals are useful in experiments directed toward testing biochemical or physiological effects of diagnostics or therapeutics for conditions characterized by increased or decreased TMSl expression. Other uses will be apparent to one of ordinary skill in the art.
  • the agent of the invention can be administered with a disorder-specific therapy.
  • a disorder-specific therapy is a therapy, other than the administration of demethylating agents and/or TMSl molecules of the invention, which has been reported to possess therapeutic effectiveness toward the disorder being treated.
  • a disorder-specific therapy may include chemotherapy (i.e., treatment using chemical substances referred to herein as disorder-specific agents), as well as interventional therapies including surgery and radiation, but is not so limited.
  • the demethylating agents or TMSl molecules may be administered substantially simultaneously with the disorder-specific therapy including the disorder-specific agents.
  • a demethylating agent or TMSl molecule of the invention is administered to a subject close enough in time with the administration of, for example, the disorder-specific agent so that the two compounds may exert an additive or even synergistic effect, (e.g., reducing a tumor mass).
  • the agents of the invention may be administered prior to, concurrent with, or following the disorder-specific therapy, although in some embodiments it is preferred that the agents of the invention (i.e., the demethylating agents or the TMSl molecules) be administered prior to or concurrently with the disorder-specific therapy.
  • the administration schedule may involve administering the different agents in an alternating fashion.
  • the agent may be delivered before and during, or during and after, or before and after treatment with other therapies. In some cases, the agent is administered more than 24 hours before the administration of the other therapy.
  • disorder-specific therapy is that intended for proliferative disorders such as cancer.
  • the subject may be administered an agent of the invention and an anti-cancer therapy.
  • an anti-cancer therapy is a therapeutic regimen which is intended to inhibit or stabilize the growth of a primary cancer or tumor and/or prevent the growth of a secondary cancer or tumor such as a metastatic lesion.
  • Anti-cancer therapy embraces a number of therapies including but not limited to radiation therapy and chemotherapy (i.e., chemical mediated therapy).
  • the anti-cancer therapy may include more than one therapy (e.g., radiation and chemotherapy both administered to the subject).
  • the subject may receive the agents of the invention, in combination with both radiation and at least one chemotherapeutic agent.
  • the agent may be administered in combination with more than one chemotherapeutic agent.
  • the invention provides in another aspect a method for treating a subject having a cancer which involves administering an agent of the invention (i.e., a demethylating agent or a TMSl molecule) and an anti-cancer therapy to a subject in need of such treatment in a combined amount effective to treat the cancer.
  • an agent of the invention i.e., a demethylating agent or a TMSl molecule
  • an anti-cancer therapy to a subject in need of such treatment in a combined amount effective to treat the cancer.
  • the cancer is selected from the group consisting of a cancer characterized by abnormal methylation of a CpG island containing TMS 1 nucleic acid molecule, and a cancer characterized by an abnormally low level of a TMSl expression product, or a cancer characterized by the expression or presence of a mutant TMSl molecule.
  • the agent of the invention and the anti-cancer therapy are administered in a manner that allows for a synergistic response.
  • a synergistic response is one in which the combined administration of the two or more agents or therapies yield a result that is greater than the additive effects of either of the agents or therapies alone.
  • one or both the agent of the invention and the anti-cancer therapy may be administered in a sub-therapeutic dose.
  • a sub-therapeutic dose is one which alone would not result in a therapeutic benefit to the subject but which may be combined with another agent in order to effectuate therapeutic benefit.
  • the agent of the invention may be administered prior to or concurrently with the anti-cancer therapy.
  • the agent of the invention is administered prior to or concurrently with an anti-cancer therapy, in an amount effective to sensitize the cancer to the anti-cancer therapy.
  • An amount of agent that sensitizes a cancer means that amount that renders the cancer (which would be non-responsive otherwise) responsive to anti-cancer therapy.
  • the amount of demethylating agent which is effective to sensitize a cancer may be less than that amount effective to restore or maintain a normal level of methylation in a CpG island containing TMSl nucleic acid molecule.
  • a disorder such as a cancer that is characterized by abnormal methylation of a TMSl nucleic acid molecule either by the use of a demethylating agent alone, or with a demethylating agent coupled with an anti-cancer therapy.
  • a demethylating agent when used alone, a higher dose of a demethylating agent may be required to effect a beneficial outcome in the subject.
  • the combined use of a demethylating agent and an anti-cancer therapy is expected to require a lower dose of the anti-cancer therapy for a beneficial outcome. This latter result is desirable given the side-effects of most anti-cancer therapies.
  • the invention provides similar methods of treatment of subjects having cancer using CARD-containing molecules, and preferably TMSl molecules, and an anti-cancer therapy.
  • TMSl is an upstream factor of the caspase-9 dependent apoptosis pathway.
  • the invention provides methods for identifying a subject who is at risk of being non-responsive to a particular disorder-specific therapy.
  • the subject has the particular disorder which is sought to be treated with the therapy.
  • the subject may be one who has been diagnosed with cancer using standard diagnostic procedures known in the art.
  • such a subject may be administered conventional (e.g., DNA damaging) anti-cancer therapy such as radiation therapy and some forms of chemotherapy. It is well known however that some patients so treated with radiation therapy, and more commonly some forms of chemotherapy, become unresponsive (i.e., refractory) to the therapeutic regimen.
  • the invention provides a method for individually tailoring a therapeutic regimen for a particular subject.
  • Subjects at risk of being non-responsive to a particular anti-cancer therapy are identified, according to the invention, in a number of ways. In one instance, the subject is identified by analyzing the methylation of a TMSl nucleic acid molecule.
  • the method involves determining the level of methylation of a CpG island containing TMSl nucleic acid molecule in a biological sample from a subject having cancer and comparing the level of methylation with a control.
  • An increase in the level of methylation in the biological sample from the subject having cancer when compared to the control is indicative of a subject who is at risk of being non-responsive to an anti-cancer therapy.
  • the level of methylation may be measured according to any of the appropriate methods described herein.
  • a non-responsive subject is identified by measuring the level of a TMSl expression product in a biological sample from the subject having cancer.
  • the biological sample is of a tissue or a cell or a cell population in which the disorder exists.
  • the control may be normal tissue from a normal subject, or alternatively it may be normal tissue from the subject having cancer. In some preferred embodiments, the control is normal tissue taken from the same tissue in which the disorder exists (e.g., normal breast tissue from a subject with breast cancer). Subjects identified in this manner can subsequently be administered an agent of the invention (e.g., a demethylating agent or a TMSl molecule) in an amount effective to ultimately increase the level of TMSl expression products, most preferably TMSl polypeptides.
  • an agent of the invention e.g., a demethylating agent or a TMSl molecule
  • subjects who are diagnosed as described herein as having abnormal methylation at the TMS 1 locus, or who have an abnormally low level of TMS 1 expression products, or who express mutant forms of TMSl are more likely to be resistant to anti- cancer therapies which require apoptosis to be effective (e.g., DNA damaging treatment regimens).
  • subjects so identified may be more preferably treated with forms of anti-cancer therapy which are not wholly dependent upon apoptosis (e.g., those that are not primarily DNA damaging agents).
  • Such anti-cancer therapies may include biological response modifying therapy, hormonal therapies, immunomodulating therapies (e.g., immunotherapeutic agents and cancer vaccines), angiogenesis inhibitors, metalloproteinase inhibitors and the like.
  • DNA damaging anti-cancer therapies include topoisomerase inhibitors (e.g., etoposide, ramptothecin, topotecan, teniposide, mitoxantrone), anti-microtubule agents (e.g., vincristine, vinblastine), anti-metabolic agents (e.g., cytarabine, methotrexate, hydroxyurea, 5-fluorouracil, floxuridine, 6-thioguanine, 6-mercaptopurine, fludarabine, pentostatin, chlorodeoxyadenosine), DNA alkylating agents (e.g., cisplatin, mechlorethamine, cyclophosphamide, ifosfamide, melphalan, choram
  • Immunotherapeutic agents which may be administered to such subjects include Ributaxin, Herceptin (trastuzumab), Quadramet, Panorex, IDEC-Y2B8, BEC2, C225, Oncolym, SMART M195, ATRAGEN, Ovarex, Bexxar, LDP-03 , ior t6, MDX-210, MDX- 11 , MDX-22, OV 103 , 3622 W94, anti- VEGF, Zenapax, MDX-220, MDX-447, MELIMMUNE-2, MELIMMUNE-1, CEACIDE, Pretarget, NovoMAb-G2, TNT, Gliomab-H, GNI-250, EMD-72000, LymphoCide, CMA 676, Monopharm-C, 4B5, ior egf.r3, ior c5, BABS, anti-FLK-2, MDX-260, ANA Ab, SMART 1D10 Ab, SMART ABL 364 Ab, Imm
  • Cancer vaccines may be selected from the group consisting of EGF, Anti-idiotypic cancer vaccines, Gp75 antigen, GMK melanoma vaccine, MGV ganglioside conjugate vaccine, Her2/neu, Ovarex, M-Vax, O-Vax, L-Vax, STn-KHL theratope, BLP25 (MUC-1), liposomal idiotypic vaccine, Melacine, peptide antigen vaccines, toxin/antigen vaccines, MVA-based vaccine, PACIS, BCG vaccine, TA-HPV, TA-CIN, DISC-virus and ImmuCyst/TheraCys.
  • Biological response modifiers include cytokines such as interferon, interleukins and lymphokines (e.g., IL-2), interferon agonists, hemopoietic growth factors (e.g., erythropoietin, GM- CSF, G-CSF), bFGF inhibitor, insulin-like growth factor- 1 receptor inhibitor.
  • cytokines such as interferon, interleukins and lymphokines (e.g., IL-2), interferon agonists, hemopoietic growth factors (e.g., erythropoietin, GM- CSF, G-CSF), bFGF inhibitor, insulin-like growth factor- 1 receptor inhibitor.
  • Hormone therapy includes adrenocorticosteriods (e.g., prednisone, methylprednisolone, dexamethasone), androgens (e.g., fluoxymesterone), anti-androgens (e.g., flutamide), estrogens (e.g., diethylstilbestrol, ethinyl estradiol), anti-estrogens (e.g., tamoxifen), progestins (e.g., medroxyprogesterone, megestrol acetate), aromatase (aminoglutethimide), gonadotropin-releasing hormone agonists (e.g., leuprolide), somatostatin analogues (e.g., octreotide).
  • adrenocorticosteriods e.g., prednisone, methylprednisolone, dexamethasone
  • Angiogenesis inhibitors include basic FGF, VEGF, angiopoietins, angiostatin, endostatin, TNF ⁇ , TNP-470, thrombospondin- 1 , platelet factor 4, CAI, and certain members of the integrin family of proteins.
  • an agent of the invention e.g., a demethylating agent or a TMSl molecule
  • the agent of the invention may be administered substantially simultaneously with the disorder-specific therapy or alternatively, the agent may be administered prior to the administration of the disorder-specific therapy.
  • the disorder-specific therapy (e.g., an anti-cancer therapy) is administered with a demethylating agent and not a TMSl molecule.
  • the anti- cancer therapy may be DNA damaging anti-cancer therapy or not.
  • the intention is these latter embodiments is to make cancers sensitive to the anti-cancer therapy but increasing the level of TMSl expression products in the tissue (preferably the malignant tissue) of the subject.
  • One category of anti-cancer therapy is chemotherapy.
  • chemotherapeutic agents include Acivicin; Aclarubicin; Acodazole Hydrochloride; Acronine; Adozelesin; Aldesleukin; Altretamine; Ambomycin; Ametantrone Acetate; Aminoglutethimide; Amsacrine; Anastrozole; Anthramycin; Asparaginase; Asperlin; Azacitidine; Azetepa; Azotomycin; Batimastat; Benzodepa; Bicalutamide; Bisantrene Hydrochloride; Bisnafide Dimesylate; Bizelesin; Bleomycin Sulfate; Brequinar Sodium; Bropirimine; Busulfan; Cactinomycin; Calusterone; Caracemide; Carbetimer; Carboplatin; Carmustine; Carubicin Hydrochloride; Carzelesin; Cedefingol; Chlorambucil; Cirolemycin; Cisplatin; Cladribine;
  • Droloxifene Citrate Dromostanolone Propionate
  • Duazomycin Edatrexate
  • Eflornithine Hydrochloride Elsamitrucin
  • Enloplatin Enpromate
  • Epipropidine Epirubicin Hydrochloride
  • Etoposide Etoposide Phosphate; Etoprine; Fadrozole Hydrochloride; Fazarabine; Fenretinide;
  • Floxuridine Fludarabine Phosphate; Fluorouracil; Flurocitabine; Fosquidone; Fostriecin Sodium;
  • Gemcitabine ; Gemcitabine Hydrochloride; Hydroxyurea; Idarubicin Hydrochloride; Ifosfamide; Ilmofosine; Iproplatin; Irinotecan Hydrochloride; Lanreotide Acetate; Letrozole; Liarozole
  • Mitindomide Mitocarcin; Mitocromin; Mitogillin; Mitomalcin; Mitomycin; Mitosper; Mitotane; Mitoxantrone Hydrochloride; Mycophenolic Acid; Nocodazole; Nogalamycin; Ormaplatin; Oxisuran;
  • Riboprine Rogletimide; Safingol; Safingol Hydrochloride; Semustine; Simtrazene; Sparfosate Sodium; Sparsomycin; Spirogermanium Hydrochloride; Spiromustine; Spiroplatin; Streptonigrin;
  • Taxotere Temoporfin; Teniposide; Teroxirone; Testolactone; Thiamiprine; Thioguanine; Thiotepa;
  • Tiazofurin Tirapazamine; Toremifene Citrate; Trestolone Acetate; Triciribine Phosphate;
  • Trimetrexate Trimetrexate Glucuronate; Triptorelin; Tubulozole Hydrochloride; Uracil Mustard; Uredepa; Vapreotide; Verteporfin; Vinblastine Sulfate; Vincristine Sulfate; Vindesine; Vindesine
  • chemotherapies include methotrexate, vincristine, adriamycin, cisplatin, non-sugar containing chloroethylnitrosoureas, mitomycin C, dacarbazine, fragyline, Meglamine GLA, valrubicin, carmustaine and polife ⁇ osan, MMI270, BAY 12-9566, RAS famesyl transferase inhibitor, famesyl transferase inhibitor, MMP, MTA/LY231514, LY264618 Lometexol, Glamolec, CI-994, TNP-470,
  • chemotherapeutic agents include: 20-epi-l,25 dihydroxyvitamin D3; 5-ethynyluracil; abiraterone; aclarubicin; acylfulvene; adecypenol; adozelesin; aldesleukin; ALL-TK antagonists; altretamine; ambamustine; amidox; amifostine; aminolevulinic acid; amrubicin; amsacrine; anagrelide; anastrozole; andrographolide; antagonist D; antagonist G; antarelix; anti-dorsalizing mo ⁇ hogenetic protein- 1; antineoplaston; antisense oligonucleotides; aphidicolin glycinate; apoptosis gene modulators; apoptosis regulators; apurinic acid; ara-CDP-DL-PTBA; arginine deaminase; asulacrine; atamestane
  • Another anti-cancer therapy that can be used with the agents of the invention include anti- cancer supplementary potentiating chemotherapeutic agents.
  • Tricyclic anti-depressant drugs e.g., imipramine, desipramine, amitryptyline, clomipramine, trimipramine, doxepin, nortriptyline, protriptyline, amoxapine and maprotiline
  • non-tricyclic anti-depressant drugs e.g., sertraline, trazodone and citalopram
  • Ca ⁇ antagonists e.g., verapamil, nifedipine, nitrendipine and caroverine
  • Calmodulin inhibitors e.g., prenylamine, trifluoroperazine and clomipramine
  • Amphotericin B Triparanol analogues (e.g., tamoxifen); antiarrhythmic drugs (e.g., quinidine); antihyper
  • Piritrexim Isethionate the antiprostatic hypertrophy compound, Sitogluside; the benign prostatic hype ⁇ lasia therapy compound, Tamsulosin Hydrochloride; the prostate growth inhibitor, Pentomone; radioactive compounds such as Fibrinogen 1 125, Fludeoxyglucose F 18, Fluorodopa F 18, Insulin I 125, Insulin I 131, Iobenguane I 123, Iodipamide Sodium I 131, Iodoantipyrine I 131, Iodocholesterol I 131, Iodohippurate Sodium I 123, Iodohippurate Sodium I 125, Iodohippurate Sodium I 131, lodopyracet I 125, lodopyracet I 131, lofetamine Hydrochloride I 123, lomethin I 125, lomethin I 131, lothalamate Sodium I 125, lothalamate Sodium I 125, lothalamate Sodium I 125
  • the invention further embraces pharmaceutical preparations or compositions useful for treating subjects having or at risk of having the disorders described herein.
  • a pharmaceutical preparation comprising a demethylating agent and a pharmaceutically acceptable carrier is provided. It is to be understood that one or more different demethylating agents may be present in a given pharmaceutical preparation.
  • the pharmaceutical preparation comprising a TMSl molecule and a pharmaceutically acceptable carrier is provided.
  • the pharmaceutical preparation may contain one or more different forms of TMSl molecules.
  • the invention provides a pharmaceutical preparation comprising both demethylating agents and TMSl molecules along with a pharmaceutically acceptable carrier.
  • Each and every pharmaceutical preparation described herein may also optionally contain one or more disorder-specific therapeutic agents, as described herein.
  • the invention further provides a medicament and a method of making a medicament.
  • the medicament comprises an agent and a pharmaceutically acceptable carrier.
  • the method involves placing an agent in a pharmaceutically acceptable carrier.
  • the agent may be a demethylating agent or a TMSl molecule.
  • the medicament may contain both a demethylating agent and a
  • any of the foregoing medicaments may also contain a disorder-specific agent, other than the demethylating agents and the TMSl molecules of the invention.
  • the medicament is formulated in a dose and/or a delivery formulation particularly tailored to the treatment of breast cancer.
  • the pharmaceutical preparations, as described above, are administered in effective amounts.
  • the effective amount will depend upon the mode of administration, the particular condition being treated and the desired outcome. It will also depend upon, as discussed above, the stage of the condition, the age and physical condition of the subject, the nature of concurrent therapy, if any, and like factors well known to the medical practitioner. For therapeutic applications, it is that amount sufficient to achieve a medically desirable result. In some cases this is a decrease in cell proliferation or an increase in apoptosis induction. Generally, doses of active compounds of the present invention would be from about 0.0001 mg/kg per day to 1000 mg/kg per day. It is expected that doses ranging from 50-500 mg/kg will be suitable. A variety of administration routes are available.
  • the methods of the invention may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of the active compounds without causing clinically unacceptable adverse effects.
  • modes of administration include oral, rectal, topical, nasal, interdermal, or parenteral routes.
  • parenteral includes subcutaneous, intravenous, intramuscular, or infusion.
  • Intravenous or intramuscular routes are not particularly suitable for long- term therapy and prophylaxis. They could, however, be preferred in emergency situations.
  • Oral administration will be preferred for prophylactic treatment because of the convenience to the patient as well as the dosing schedule.
  • a desirable route of administration is by pulmonary aerosol.
  • the mode of administration and dosage of the agent will vary with the particular stage of the condition being treated, the age and physical condition of the subject being treated, the duration of the treatment, the nature of the concurrent therapy (if any), the specific route of administration, and the like factors within the knowledge and expertise of the health practitioner.
  • compositions suitable for oral administration may be presented as discrete units, such as capsules, tablets, lozenges, in both immediate release or controlled release formulations, each containing a predetermined amount of the active agent,.
  • Other compositions include suspensions in aqueous liquids or non-aqueous liquids such as a syrup, elixir or an emulsion.
  • Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
  • non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti- oxidants, chelating agents, and inert gases and the like. Lower doses will result from other forms of administration, such as intravenous administration. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits. Multiple doses per day are contemplated to achieve appropriate systemic levels of compounds.
  • the TMSl molecules including but not limited to polypeptides or fragments thereof may be combined, optionally, with a pharmaceutically-acceptable carrier.
  • pharmaceutically-acceptable carrier means one or more compatible solid or liquid filler, diluents or encapsulating substances which are suitable for administration into a human.
  • carrier denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.
  • the components of the pharmaceutical compositions also are capable of being co-mingled with the molecules of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy.
  • the pharmaceutical preparations of the invention are applied in pharmaceutically-acceptable amounts and in pharmaceutically-acceptably compositions.
  • Such preparations may routinely contain salt, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents.
  • the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically-acceptable salts thereof and are not excluded from the scope of the invention.
  • Such pharmacologically and pharmaceutically-acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic, and the like.
  • pharmaceutically-acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts.
  • nucleic acids of the invention may be introduced in vitro or in vivo in a host.
  • Such techniques include transfection of nucleic acid-CaP0 4 precipitates, transfection of nucleic acids associated with DEAE, transfection with a retrovirus including the nucleic acid of interest, liposome mediated transfection, and the like.
  • a vehicle used for delivering a nucleic acid of the invention into a cell e.g., a retrovirus, or other virus; a liposome
  • a molecule such as an antibody specific for a surface membrane protein on the target cell or a ligand for a receptor on the target cell can be bound to or inco ⁇ orated within the nucleic acid delivery vehicle.
  • proteins which bind to a surface membrane protein associated with endocytosis may be inco ⁇ orated into the liposome formulation for targeting and/or to facilitate uptake.
  • proteins include capsid proteins or fragments thereof tropic for a particular cell type, antibodies for proteins which undergo internalization in cycling, proteins that target intracellular localization and enhance intracellular half life, and the like.
  • Polymeric delivery systems also have been used successfully to deliver nucleic acids into cells, as is known by those skilled in the art. Such systems even permit oral delivery of nucleic acids.
  • Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the anti-inflammatory agent, increasing convenience to the subject and the physician.
  • Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer base systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides and non-polymer systems such as melted and recrystallized sterols including cholesterol.
  • Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Patent 5,075,109.
  • Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono- di- and tri-glycerides; hydrogel release systems; silastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like.
  • Specific examples include, but are not limited to: (a) erosional systems in which an agent of the invention is contained in a form within a matrix such as those described in U.S. Patent Nos. 4,452,775, 4,675,189, and 5,736,152, and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Patent Nos. 3,854,480, 5,133,974 and 5,407,686.
  • pump-based hardware delivery systems can be used, some of which are adapted for implantation.
  • Long-term sustained release means that the implant is constructed and arranged to delivery therapeutic levels of the active ingredient for at least 30 days, and preferably 60 days.
  • Long-term sustained release implants are well-known to those of ordinary skill in the art and include some of the release systems described above.
  • the agent of the invention e.g., the demethylating agent or the TMSl molecule
  • the agent of the invention is targeted to a cell, a cell population or a tissue that has, or is at risk of having (i.e., developing), the disorder sought to be prevented or treated through the use of a targeting compound specific for a particular cell or tissue.
  • a targeting compound specific for a particular cell or tissue if the tissue has developed a tumor, the targeting compound may be specific for the tumor type.
  • the agents of the invention may be targeted to primary or in some instances, secondary (i.e., metastatic) lesions through the use of targeting compounds which preferentially recognize a cell surface marker.
  • the targeting compound may be directly conjugated to the agents of the invention via a covalent linkage.
  • the agent may be indirectly conjugated to a targeting compound via a linker.
  • the targeting compound may be conjugated or associated with an intermediary compound such as, for example, a liposome within which the agent is encapsulated.
  • Liposomes are artificial membrane vessels which are useful as a delivery vector in vivo or in vitro. It has been shown that large unilamellar vessels (LUV), which range in size from 0.2 - 4.0 ⁇ m can encapsulate large macromolecules.
  • LUV large unilamellar vessels
  • Liposomes may be targeted to a particular tissue, such as the vascular cell wall, by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein.
  • Liposomes are commercially available from Gibco BRL, for example, as LIPOFECTINTM and LIPOFECTACETM, which are formed of cationic lipids such as N-[l-(2, 3 dioleyloxy)-propyl]-N, N, N-trimethylammonium chloride (DOTMA) and dimethyl dioctadecylammonium bromide (DDAB).
  • LIPOFECTINTM and LIPOFECTACETM are formed of cationic lipids such as N-[l-(2, 3 dioleyloxy)-propyl]-N, N, N-trimethylammonium chloride (DOTMA) and dimethyl dioctadecylammonium bromide (DDAB).
  • DOTMA N-[l-(2, 3 dioleyloxy)-propyl]-N, N, N-trimethylammonium chloride
  • DDAB dimethyl dioctadecylammonium bromide
  • Targeting compounds useful according to the methods of the invention are those which direct the agent to a site having a disorder or at risk of developing a disorder such as a tumor site.
  • the targeting compound of choice will depend upon the nature of the tumor or the tissue origin of the metastasis. In some instances it may be desirable to target the agent to the tissue in which the tumor is located.
  • agents can be delivered to breast epithelium by using a targeting compound specific for breast tissue.
  • the target is specific for malignant breast epithelium. Examples of compounds which may localize to malignant breast epithelium include, but are not limited to, estrogen and progesterone, epithelial growth factor (EGF) and HER-2/neu ligand, among others.
  • EGF epithelial growth factor
  • HER-2/neu ligand among others.
  • the HER-2/neu ligand may also be used to target agents to ovarian cancers.
  • Ovarian cancers are also known to express EGFR and c-fms, and thus could be targeted through the use of ligands for either receptor.
  • c-fms which is also expressed by macrophages and monocytes
  • targeted delivery to an ovarian cancer may require a combination of local administration such as a vaginal suppository as well as a targeting compound.
  • Prostate cancers can be targeted using compounds such as peptides (e.g., antibodies or antibody fragments) which bind to prostate specific antigen (PSA) or prostate specific membrane antigen (PSMA).
  • PSA prostate specific antigen
  • PSMA prostate specific membrane antigen
  • markers which may be used for targeting of the agent to specific tissues include, for example, in liver: HGF, insulin-like growth factor I, II, insulin, OV-6, HEA-125, hyaluronic acid, collagen, N-terminal propeptide of collagen type III, mannose/N-acetylglucosamine, asialoglycoprotein, tissue plasminogen activator, low density lipoprotein, carcinoembryonic antigen; in kidney cells: angiotensin II, vasopressin, antibodies to
  • CD44v6 in keratinocytes and skin fibroblasts: KGF, very low density lipoprotein, RGD-containing peptides, collagen, laminin; in melanocytes: kit ligand; in gut: cobalamin-intrinsic factor, heat stable enterotoxin of E. Coli; in breast epithelium: heregulin, prolactin, transferrin, cadherin-11.
  • FGF fibroblast growth factors
  • PDGF platelet derived growth factor
  • IMR90 normal human diploid fibroblasts and SV40 immortalized IMR90 cells (called here '90SV') were obtained from the National Institute on Aging Cell Repository and were maintained in EMEM containing 2 mM glutamine and 10%) FCS.
  • the isolation and maintenance of 90SV derivative cell lines stably overexpressing human DNMTl (HMT.lEl) has been reported. (Vertino, P.M. et al., Mol.Cell Biol. 16:4555-4565, 1996) HMT.lEl, expresses 50-fold increased levels of human DNA methyltransferase relative to the parental 90SV fibroblasts.
  • HMT.lEl cells were maintained in EMEM plus 2mM glutamine, 10% fetal calf serum and 400 ⁇ g/ml G418 (Life Technologies).
  • the human breast epithelial cell line MCF10A was obtained from the Karmanos Cancer Institute, Detroit, MI, and were maintained in DMEM/F12 plus 5% fetal calf serum, 20 ng/ml epidermal growth factor, 0.5 ⁇ g/ml hydrocortisone, 100 ng/ml cholera toxin, 10 ⁇ g/ml insulin and 2 mM glutamine.
  • Hs578Bst, Hs578t, MCF7, MDA MB435 and T47D cells medium was supplemented with 10 ⁇ g/ml insulin.
  • Passage seven HMEC primary breast epithelial cells were obtained from Clonetics (Walkersville, MD) and were cultured according to the recommendations of the supplier.
  • SKBR3 cells were maintained in McCoys 5 A medium plus 10% > fetal calf serum and 2 mM glutamine. All cells were maintained at 37°C and 5% C0 2 .
  • RNA was selected on oligo-dT cellulose and used to synthesize double-stranded cDNA using the cDNA CHOICE system (Life Technologies) and a modified oligo-dT primer according to the manufacturer's recommendations. Double stranded cDNA was digested with Dpnl, ligated to linkers, and amplified by PCR using linker-specific primers to generate the tester (90SV) and driver (HMT.lEl) amplicons. The cDNA pools were then subjected to representational difference analysis as described. (Hubank, M. et al., Nucleic Acid Res.
  • TMSl expression constructs The TMSl cDNA derived from EST yl28a06 (Accession No. HI 6108) was subcloned into pcDNA3.1 (Invitrogen) to generate pcDNA-TMSl . A myc-epitope tag was fused to amino acid 2 of TMSl was generated by PCR and subcloned into pcDNA3.1 to create pcDNAmycTMS 1. A COOH-terminal truncation mutant (mycTMS 1 ⁇ 100- 195) was created from pcDNAmycTMSl by Klenow fill-in of an internal BamHI site causing a frame, shift at amino acid 100 followed by an in-frame stop codon.
  • An NH 2 -terminal mutant (pmycTMSl ⁇ 2-99) was derived from pcDNAmycTMSl by deletion of sequences between the myc tag and an internal BamHI site of TMSl, resulting in deletion of amino acids 2-99.
  • Bac Isolation and Radiation Hybrid Mapping A pooled human BAC library (Release III, Research Genetics) was screened by PCR using TMSl -specific primers in the 3' untranslated region of TMSl 5'-GCACTTTATAGACCAGCA-3' (SEQ ID NO:8) and 5'-ATTTGGTGGGATTGCCAG-3' (SEQ ID NO:9) and four positive BACs were identified.
  • a TMSl positive BAC was digested with Hindlll, cloned into pBluescript SK+, and TMSl positive subclones were identified by colony hybridization to an 175 bp fragment of the TMSl cDNA.
  • a 6 kb genomic Hindlll subclone containing the TMSl gene was identified.
  • Sequence analysis was performed by the Emory University Sequencing Core Facility. The same primers were used in a PCR-based screen of the human/rodent somatic cell hybrid mapping panel 2 (Coriell Cell Repository) to localize TMSl to human chromosome 16. Fine mapping was carried out using radiation hybrid panels (Stanford RH Panel G3 and Stanford RH panel TNG4; Research Genetics). Results were analyzed using the Stanford Human Genome Center RHserver (available at the Stanford University website on the internet) and indicated linkage to markers
  • Blots were washed to a final stringency of 0.1 x SSC, 0.1 % SDS at 65°C and exposed to X-ray film using intensifying screens (BioMAX-MS, Kodak).
  • Northern Blot Analysis One ⁇ g poly A+ selected RNA was fractionated on a 1.5% agarose/formaldehyde gel, transferred to nylon filters, and hybridized with a random-prime labeled full length TMS 1 cDNA fragment. Blots were washed to a final stringency of 0.1 x SSC, 0.1 % SDS at room temperature and exposed to X-ray film using an intensifying screen (BioMAX-MS, Kodak). Blots were stripped and re-hybridized with a human ⁇ -actin cDNA probe.
  • RT-PCR Six ⁇ g total RNA was pretreated with DNAse I (Life Technologies) and reverse transcribed using random hexamer primers and MMLV-reverse transcriptase according to the manufacturers instructions (Life Technologies). One/30th of the reverse transcriptase reaction equivalent to 200 ng starting RNA was used directly in a PCR reaction.
  • the PCR reaction conditions were: 67 mM Tris- HC1, pH 8.8, 16.6mM H 4 SO 4 , 6.7 ⁇ M EDTA, lOmM ⁇ -mercaptoethanol, 4.7 mM MgCl 2 , 10% DMSO, 400 nM each primer in a 25 ⁇ l reaction.
  • Hot start PCR was performed using an initial 5 minute incubation at 95°C followed by the addition of 0.5 U Taq polymerase and 35 cycles of PCR (95°C, 30 s; 50-55°C, 60 s; 72°C, 60 s). Primers used for analysis of TMSl were 5'-
  • Bisulfite Modification and Methylation-specific PCR were performed as previously described. (Herman, J.G., et al., Proc. Natl. Acad. Sci. U.S.A. 93:9821-9826, 1996) Briefly, 2 ⁇ g genomic DNA was denatured by incubation at 37°C in 0.2N NaOH for 10 min. then treated with 3M sodium metabisulfite and 0.5 M hydroquinone at 50°C for 16 h. DNA was desalted using Wizard DNA Clean-Ups (Promega). Modification was completed by the addition of NaOH to a final concentration of 0.3M and DNA was recovered by ethanol precipitation.
  • Reaction products were separated by electrophoresis on a 5% or 6% polyacrylamide gel, stained with ethidium bromide and photographed.
  • Primers were designed from the interpolated sequence following bisulfite conversion assuming the DNA was either methylated or unmethylated at CpG sites within the primer sequence. To ensure maximal discrimination of unmethylated and methylated DNA, each primer was designed to overlap three potential methylation sites, one of which occurred at the 3' end of each primer.
  • AACGTCCATAAACAACAACGCG -3* (SEQ ID NO: 19) for the methylated reaction.
  • Colony Formation Assays Breast cancer cells, including Hs57 8t, (3 x 10 5 ) were seeded into six well dishes and transfected with 1 ⁇ g pcDNA3.1 or the TMSl expression constructs using 5 ⁇ l Lipofectamine reagent (Life Technologies). Twenty-four hours after transfection, cells were diluted 1 : 100-1:500 and seeded into 100 mm dishes in medium containing 400 ⁇ g/ml G418. After 14 days of selection, stable G418-resistant colonies were fixed and stained with 50% methanol, 0.25%) crystal violet, and counted. The total number of colonies recovered per transfection cells was extrapolated from counting at least 300 G418 r colonies per experiment. The number of colonies recovered from cells transfected with pcDNA3.1 in each experiment was considered to be 100%. Three independent transfection experiments were performed.
  • Apoptosis Assays 293 human embryonic kidney cells were plated on glass coverslips in 24 well dishes at 1 x 10 5 cells per well, and were transfected with 0.4 ⁇ g of pcDNA3.1 or the TMSl expression constructs plus 0.1 ⁇ g ⁇ -galactosidase expression vector (pCMV ⁇ gal, Clonetech) using the calcium phosphate precipitation method. Where indicated, 40 ⁇ M zVADftnk (Enzyme System Product, Livermore, CA) was included during the recovery period.
  • coverslips were fixed in 4% paraformaldehyde and stained for ⁇ -galactosidase activity, using X-gal, and for nuclear mo ⁇ hology, using Hoecsht 33528 dye. Cells were visualized by phase contrast microscopy. At least 200 ⁇ -galactosidase positive cells from randomly selected fields were counted from each transfection. Apoptotic cells were distinguished based on mo ⁇ hologic features typical of adherent cells undergoing apoptosis, including becoming condensed, rounded and detached from the growth surface as described. (McCarthy, J.V. et al., J.Biol.Chem. 273:16968-16975, 1998). At least 200 ⁇ -galactosidase positive cells from randomly selected fields were counted from each transfection. Each transfection experiment was repeated three times.
  • RDA-2.15 was derived from a novel gene represented by multiple human ESTs that defined a tentative human consensus (THC253346 , TIGR Human Gene Index) as well as a unique Unigene cluster (Hs. 71869, NCBI Unigene project).
  • a 770 bp cDNA was assembled from the complete sequence of two EST clones (yl28a06 and qwl 3b06) that overlapped the entire Unigene cluster.
  • the assembled cDNA sequence contains a 588 bp ORF with 5' and 3' UTRs of 74 bp and 97 bp, respectively, and includes the poly(A) tail. No additional 5' sequence was obtained using a 5' rapid amplification of cDNA ends protocol indicating that the cDNA sequence was full-length.
  • the TMSl cDNA probe hybridized to a ⁇ 0.8 kb message which was expressed at low, but clearly detectable levels in IMR90 normal human diploid fibroblasts and their immortalized derivatives, the 90SV cells ( Figure lb).
  • the same message was undetectable by Northern blot analysis in the DNMTl overexpressing cell line, HMT.lEl, confirming that the gene identified by RDA was silenced in HMT.lEl cells.( Figure lb).
  • the TMSl locus is composed of a coding region of- 1.8 kb including three exons of 449 bp (SEQ ID NO:5), 58 bp (SEQ ID NO:7), and 355 bp (SEQ ID NO:9) size ( Figure 2a).
  • the first and third exons also contain 5 'and 3' untranslated regions at their beginning and end, respectively.
  • a -600 bp CpG island was identified in the 5' end of TMSl surrounding exon 1.
  • This region showed a high C + G content (69%), a CpG/GpC ratio of 0.82, and the presence of multiple sites for methylation-sensitive, CpG-recognizing restriction enzymes that often cluster within CpG islands (SacII, Eagl, BssHII, Smal) ( Figure 2a).
  • Other restriction sites located in this locus include 2 Hindlll sites and 2 EcoRI sites.
  • the 5' most SacII site (*Sa, see Figure 2a) was found to lie outside the CpG island and was methylated in all normal tissue samples tested. Absence of methylation at the Eagl site is indicated by bands of 1.2 kb and 4.8 kb. Hindlll plus SacII digestion of IMR90 DNA resulted in three bands of 4.4 kb, 1.4 kb and 0.23 kb size. Similar digestion of DNA from 90SV cells revealed bands of 6 kb, 4.4 kb, 1.6 kb, 1.4 kb and 0.23 kb. HMT.lEl DNA digestion with Hindlll and SacII resulted only in the 6 kb band.
  • HMT.lEl cells exhibited complete methylation of SacII and Eagl sites in the TMSl CpG island, as observed from its complete protection from digestion with these enzymes ( Figure 2b).
  • the methylation status of the TMSl CpG island was further analyzed by a more sensitive methylation-specific PCR (MSP) technique in which methylated and unmethylated alleles in the population can be specifically amplified following chemical modification of the DNA with sodium bisulfite.
  • MSP methylation-specific PCR
  • DNA was used as a template for parallel PCR amplification reactions using primers designed to anneal specifically to unmethylated (U) or methylated (M) DNA.
  • the product of the methylated reaction was 191 bp, and that of the unmethylated reaction was 196 bp due to differences in the length of the primers.
  • the primers used for the reactions were located in the first exon. IMR90 DNA was amplified only in the unmethylated reaction, HMT.1E1 DNA was amplified only in the methylated reaction and DNA from 90SV was amplified in both.
  • the CpG islands of the E- cadherin, estrogen receptor and HIC1 genes are progressively de novo methylated in the DNMTl overexpressors (although not expressed in fibroblasts), and are methylated and silenced in human breast and other tumors.
  • TMSl was also a target for methylation-associated silencing in human cancer
  • HMEC primary human mammary epithelial cells
  • Hs578Bst and MCF10A two immortal, non- tumorigenic breast epithelial cell lines
  • MCF-7 six breast cancer cell lines
  • Parallel amplifications were performed as described above. Expression levels were determined by RT-PCR with ⁇ -actin controls.
  • TMSl was predominantly unmethylated and expressed in HMEC cells and the two immortalized, non-tumorigenic breast epithelial cell lines ( Figure 3a and b).
  • 3 of 6 breast carcinoma cell lines (ZR75-1, Hs578t and MB231) were completely methylated at the TMSl CpG island locus and similarly did not express TMSl ( Figure 3a and b).
  • breast cancer cell lines that were either completely unmethylated (MCF-7) or only partially methylated (T47D, MDA MB468) at the TMSl CpG island retained expression of TMSl ( Figure 3a and b).
  • the ZR75-1 , Hs578t and MDA MB231 breast cancer cell lines exhibited complete methylation of TMSl and failed to express TMSl message. If loss of TMSl expression is directly related to methylation of the CpG island, then expression of TMSl should be restored following treatment with a demethylating agent.
  • Treatment of ZR75-1, Hs578t and MDA MB231 cells with the DNA methyltransferase inhibitor 5-aza-2'-deoxycytidine at 0.5 ⁇ M concentration for 3 days resulted in the partial demethylation of the TMSl CpG island and re-expression of TMSl transcript (Figure 3C and D).
  • TMSl CpG island Methylation of the TMSl CpG island was analyzed by methylation specific PCR and expression of TMSl was analyzed by RT-PCR with ⁇ -actin controls. Control cultures in which the inhibitor was absent did not re-express TMSl. The absence of TMSl expression in these cell lines is therefore not due to abnormalities at the gene level or the inability to express TMSl, for example, due to a lack of necessary transcription factors, but rather is directly related to the methylation of TMSl. That TMSl was abnormally methylated and silenced in a substantial proportion of human breast cancer cells suggested that TMSl provides a novel tumor suppressor function.
  • TMSl exhibited widespread low level expression in human tissues, with the greatest expression in colon, spleen, small intestine, lung and peripheral blood leukocytes (Figure 4a). TMSl transcripts were also observed in heart, thymus, kidney, liver and placenta. Interestingly, TMSl was silent in other human tumor cell lines, including Molt 4 lymphocytic leukemia cells and HeLa cervical carcinoma cells ( Figure 4b). Cell lines HL60, K562, Raji, SW480, A549 and G361 all expressed varying degrees of TMSl.
  • TMSl encodes a predicted protein of 195 amino acids and 25 kDa.
  • CARD carboxy-terminal caspase recruitment domain
  • TMS 1 can play a role in apoptosis.
  • 293 cells were transfected with 0.4 ⁇ g of the indicated TMSl expression construct and 0.1 ⁇ g pCMV ⁇ -gal. Forty-eight hours after transfection cells were stained with X-gal and at least 200 ⁇ -galactosidase cells were counted for each condition. Data (mean ⁇ SD) represent the percentage of ⁇ -galactosidase positive cells exhibiting mo ⁇ hologic apoptosis. Three independent transfection experiments were performed.
  • TMSl negative breast cancer cells stably transfected with TMSl expression constructs was analyzed in the following manner. Hs578t cells were transfected with the pcDNA3.1 vector or the indicated TMSl expression construct. Twenty-four hours after transfection, cells were plated at limiting dilution in G418 selection medium. Stable G418-resistant colonies remaining after 14 days were fixed and stained with crystal violet. Data (mean + SD) represent the percentage of surviving colonies relative to the vector control from three independent transfection experiments. The total number of colonies in the controls ranged from 2967-3700 between experiments.
  • TMSl is abnormally methylated and silenced in response to overexpression of DNMTl is interesting for two reasons.
  • methylation can drive gene silencing in vivo, perhaps through the binding of methylated DNA binding proteins and the recruitment of histone deacetylase complexes.
  • increased expression of DNMTl is transforming, and was recently shown to be an early downstream effector of oncogene- induced transformation.
  • EXAMPLE 2 Methods and Materials Plasmids: pcDNA-TMSl and pcDNA-mycTMS 1 have been described previously. (Salvesen, G. S. and Dixit, V. M. Cell. 91: 443-446, 1997) The TMSl COOH-terminal truncation mutant (mycTMSl ⁇ 100-195) was created from pcDNA-mycTMS 1 by Klenow fill-in of an internal BamHI site, resulting in a frame-shift at amino acid 100 followed by an in-frame stop codon. DN-caspase-8 and DN-caspase-9 constructs were gifts from K. Bhalla. (Muzio, M., et al. Cell. 85: 817-827, 1996; Li, P., et al. Cell. 91: 479-489, 1997) The NF-kB CAT (pJECAT2.6) and mutant NF-kB CAT
  • TMSl Inducible Expression Cells The Ecdysone-Inducible Mammalian Expression System (Invitrogen, Carlsbad, CA) was used to create clones of 293 cells that inducibly express mycTMSl .
  • the mycTMSl cDNA was cloned into the Hindlll/Xhol sites of the pIND expression vector (pIND-mycTMSl).
  • EcR-293 cells (Invitrogen, Carlsbad, CA) containing the pVgRXR vector were transfected with pIND-mycTMSl or pIND using Lipofectamine Reagent (Life Technologies, Grand Island, NY). Cells were maintained in selection medium containing 600 ⁇ g/ml G418 for 3 weeks to isolate stably transfected colonies. Clonal populations transfected with pIND-mycTMSl were then tested for inducible expression by western blot analysis after addition of 5 ⁇ M pon A. Cell Culture and Transfection: Human embryonic kidney 293 cells and EcR-293 derivatives (MTMS22 and PIND 1 ) were cultured in DMEM (Life Technologies, Inc.
  • MTMS22 and PIND1 cells were maintained in the presence of 400 ⁇ g/ml zeocin and 600 ⁇ g/ml G418.
  • Transfections of 293 cells were carried out in 24- well dishes with 1X10 5 cells and 0.5 ⁇ g total DNA per well using the calcium phosphate method.
  • a ⁇ -gal expression vector ( ⁇ -gal CMV) was included at a 1 :4 ratio with the indicated cDNA constructs.
  • 0.2 ⁇ g of pcDNA-TMSl was transfected with 0.2 ⁇ g of pcDNA3.1 or DN-caspase-8 or -9 along with 0.1 ⁇ g of ⁇ -gal CMV as a transfection control.
  • Morpholosical Apoptosis Assay 48 h after transfection, 293 cells were fixed on coverslips and stained for ⁇ -gal activity. Nuclei were stained using Hoechst 33258 dye (Sigma, St. Louis, MO). Transfected (blue) cells were examined for mo ⁇ hologic changes indicative of adherent cells undergoing apoptosis including cell rounding and reduction in size, nuclear fragmentation and membrane blebbing.
  • DNA Fragmentation Where indicated, MTMS22 cells were treated with 5 ⁇ M pon A (Invitrogen) or 40 ⁇ M Z-VAD-fmk (Enzyme System Products, Livermore, CA ). DNA was collected from 2X10 6 cells as previously described. (Burow, M. E., et al. Cancer Research. 58: 4940-4946, 1998) 5 ⁇ g of DNA from each sample was visualized by separation on a 2% agarose gel containing ethidium bromide.
  • CAT Assay for NF- ⁇ B Activation 293 cells plated at 60%) confluence in 6 well dishes were transfected with 0.2 ⁇ g of the NF- ⁇ B CAT reporter construct (pJECAT2.6) and increasing amounts of pcDNA-mycTMS 1 by the calcium phosphate method. 0.2 ⁇ g of ⁇ -gal CMV was included as a transfection control, and the total amount of DNA transfected was kept constant at 2 ⁇ g with pcDNA3.1.
  • Cell lysates were collected 36 h after transfection in ⁇ -gal lysis buffer (Promega, Madison, WI) and assayed for ⁇ -gal activity using the ⁇ -Galactosidase Enzyme Assay System (Promega, Madison, WI) per manufacturer's instructions.
  • CAT assays were performed basically as described. (Ausubel, F. M., et al. Curr. Prot. Mol. Biol., Vol. 2, pp. 9.7.5-9.7.6: John Wiley & Sons, Inc, 1997) In brief, cell lysates were incubated with [ 14 C]chloramphenicol and n-butyryl CoA.
  • ecdysone-regulated expression system was used to create a 293 cell line that inducibly expresses TMSl.
  • a clonal population (called MTMS22) that exhibited no detectable background expression of TMSl and high inducible expression in the presence of the ecdysone analog, pon A, was isolated and used for the following studies.
  • a clonal population of cells stably transfected with the empty expression vector was isolated as a control (PIND1).
  • pon A Upon addition of pon A to the MTMS22 cells, mycTMSl was detectable by western blotting as early as 6 hours after treatment and continued to accumulate in the cells over 48 hours (Figure 6A).
  • MTMS22 cells were counted over a 96-hour period in the presence or absence of pon A. By 48 hours after induction of TMSl, cells had begun to round up and lift off the plates (data not shown) and cell growth was significantly inhibited ( Figure 6B). By 96 hours, pon A- treated cells were declining in number, confirming cell death. As a biochemical marker for apoptosis, MTMS22 cells were examined for DNA fragmentation in the presence or absence of TMSl expression. Upon induced expression of TMSl, DNA laddering was observed as early as 16 hours and was most evident at 48 hours (Figure 6C).
  • TMSl To determine the subcellular localization of TMSl, MTMS22 cells induced to express TMSl were examined by immunofluorescence. Sixteen hours after induction, TMSl showed diffuse cytoplasmic staining ( Figure 8A). However, by 24 h, a fraction of the cells showed a punctate fluorescent pattern, and by 48 h, a majority of the cells contained the punctate staining and lacked diffuse cytoplasmic staining. Under high power, the TMSl aggregates appeared as hollow, spherical structures made up of many smaller balls ( Figure 8B). For a majority of the cells, there appeared to be only one structure per cell, located in close proximity to the nucleus.
  • TMS1 is a novel CARD-containing protein that, with the exception of the CARD, is structurally unrelated to other known CARD adaptor and regulatory proteins. Ectopic expression of TMSl alone was able to trigger apoptosis in 293 cells, and cell death correlated with relocalization of TMSl from the cytoplasm to perinuclear, ball-like structures.
  • TMSl redistribution of TMSl is an intermediate step in a TMS 1 -triggered apoptotic pathway.
  • the aggregate structures were formed in the absence of caspase activity, implying that TMS 1 aggregation is not a consequence of apoptosis, but rather is an event that occurs upstream of caspase activation.
  • deletion of the CARD region of TMSl inhibited aggregate formation and abolished the proapoptotic activity of TMSl, suggesting that aggregation and the CARD is necessary for TMSl-induced apoptosis.
  • aggregation of TMSl appears to be a causative event in TMS1- triggered cell death.
  • FADD and caspase-8 have been shown to redistribute into ordered, subcellular filaments in cells transfected with FADD. (Siegel, R. M., et al. J. Cell Biol.. 141: 1243-1253, 1998; Perez, D. and White, E. J. Cell Biol. 141: 1255-1266, 1998) Localization of FADD and caspase-8 was dependent on their death effector domains, and disruption of the filaments blocked FADD- induced apoptosis.
  • TMSl results in CARD-mediated clustering of the protein, and the structures that are formed may include other proteins whose association can trigger caspase activation and apoptosis.
  • the data presented herein show that the proapoptotic activity of TMSl was caspase- dependent, and in particular required the activity of caspase-9.
  • Caspase-9 is involved in the activation of apoptosis following release of cytochrome c from the mitochondria, an almost universal phenomenon during apoptosis triggered by numerous stimuli, including DNA damage and various chemotherapeutic agents.
  • TMSl acts as part of a signaling cascade for initiating activation of caspase-9 in response to certain external stimuli.
  • NF- ⁇ B Activation of NF- ⁇ B by DNA damaging agents or TNF-cc can act as part of a regulatory feedback loop that operates to prevent cell death, most likely by inducing expression of anti-apoptotic genes.
  • NF- ⁇ B target gene products including cIAP-1, cIAP-2, TRAF1 and TRAF2 have been shown to protect cells from apoptosis induced by TNF- ⁇ .
  • TMSl had no effect on the activation of NF- ⁇ B.
  • TMSl gene locus has been shown herein to be silenced by aberrant DNA methylation in human breast cancers.
  • loss of expression of this CARD-containing protein through epigenetic alterations can provide cancer cells with a means to escape apoptosis. Since the effects of TMSl are caspase-9- dependent, loss of TMS 1 expression may disrupt normal apoptotic responses to DNA damage or cellular stress, thus providing resistance to some anti-cancer therapies including some forms of irradiation as well as select chemotherapeutic agents.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Pathology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Hospice & Palliative Care (AREA)
  • Toxicology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Oncology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention relates to the identification of a novel gene, TMS1, which is transcriptionally silenced as a result of methylation. Nucleic acids and polypeptides are provided as are methods and tools for diagnosing and treating disorders characterized by such methylation, and/or abnormally low levels of TMS1 expression products.

Description

TMS1 COMPOSITIONS AND METHODS OF USE Government Support
This invention was made in part with government support under grant number CA77337 from the National Institutes of Health. The Government may retain certain rights in the invention. Field of the Invention
This invention relates to nucleic acid molecules and polypeptides of TMS 1 , a novel apoptotic regulatory gene silenced as a result of abnormal methylation, and their use in diagnosis and treatment regimens.
Background of the Invention Methylation of bases in DNA serves a number of cellular functions. In bacteria, methylation of cytosine and adenine residues plays a role in the regulation of DNA replication and DNA repair. DNA methylation also constitutes part of a immune mechanism that allows these organisms to distinguish between self and non-self DNA. In mammalian species, DNA methylation occurs only at cytosine residues, and specifically at cytosine residues that lie next to a guanosine residue, i.e., within the sequence CG. Methylation of DNA is carried out by methyltransferases (sometimes called methylases). Generally both DNA strands can accept methyl groups at opposing CG sites. Replication of these strands yields a hemi-methylated state which is recognized by a class of maintenance methyltransferases capable of restoring full methylation to both strands. Most CG sites in the genome are methylated except for those in CpG 'islands' which remain methylation-free. CpG 'islands' are rich in CG sites and are often found near coding regions within the genome (i.e., genes). About half of the genes in the human genome are associated with CpG islands. Importantly, the vast majority of CpG islands in the genome remain unmethylated in normal adult cells and tissues. Methylation of CpG islands is normally seen only on the inactive X-chromosome in females and at imprinted genes where it functions in the stable silencing of such genes. Strict control over the levels and distribution of DNA methylation are essential to normal animal development.
Alterations in DNA methylation are one manifestation of the genome instability characteristic of human tumors. A hallmark of human carcinogenesis is the loss of normal constraints on cell growth resulting from genetic alterations in the genes that control cell growth. The consequences of such mutations include the activation of positive growth signals and the inactivation of growth inhibitory signals. Gene function can be lost through mutation or deletion. An alternative mechanism by which gene function can be lost is aberrant DNA methylation. Accordingly, such methylation events can be viewed as key steps in both the initiation and progression of neoplastic disease.
Identification of gene targets which when methylated lead to the loss of normal cell responses, as well as identification of agents which desirably prevent or at least control such methylation events would be valuable. Such gene targets and agents will facilitate the diagnosis and treatment of disorders associated with abnormal methylation and any downstream events resulting therefrom. Summarv of the Invention
The invention relates to the diagnosis and treatment, both prophylactically and therapeutical ly, of disorders characterized by abnormal expression profiles of TMS 1. Abnormal expression profiles of TMSl include decreased or absent expression of wild-type TMSl mRNA and/or polypeptides, as well as expression of mutant TMS 1 mRNA or polypeptides. The net result of such abnormal TMS 1 expression profiles is a reduction in TMSl activity, which can be accomplished by, among other things, reduced transcription from the TMSl genomic locus, reduced translation of TMSl mRNA, reduced production of functional TMSl polypeptides, and increased production of mutant, including dominant negative, forms of TMSl polypeptides. In some preferred aspects, the invention is directed at diagnosing and treating disorders characterized by abnormally low levels of TMSl expression products, such as TMSl mRNA and polypeptides. One preferred subset of such disorders intended for treatment are those characterized by abnormal methylation of the TMSl genomic locus (i.e., a CpG island containing TMSl nucleic acid molecule).
The invention involves, in one aspect, the molecular cloning and characterization of TMSl, a novel polypeptide believed important for normal cell growth. Although not intending to be bound by any particular theory, it is proposed that TMS 1 polypeptides exert their normal effects by inducing apoptosis in cells, when and where appropriate. It has been discovered that malignant cells manifest increased methylation of TMSl genomic DNA sequences and corresponding decreased expression of TMSl mRNA and polypeptides relative to normal counterparts. It follows that in order for a malignant cell to ensure survival and propagation, inactivation of a cell death mediator, such as TMSl, may be required. In this regard, TMS 1 may be considered a tumor-suppressor, since it may be normally involved in the negative selection of pre-malignant and malignant cells in vivo.
The invention provides isolated nucleic acid molecules, unique fragments of those molecules, expression vectors containing the foregoing, and host cells transfected with those molecules. The invention also provides agents which bind TMSl polypeptides, including antibodies. The foregoing can be used in the diagnosis or treatment of conditions characterized by a decreased expression level and/or an absence of TMSl mRNA or polypeptides. One particularly important subset of disorders is those in which the decreased levels of TMSl expression products result from an abnormal methylation of the CpG island in the TMSl genomic locus. The invention also provides methods for identifying pharmacological agents useful in the diagnosis or treatment of such conditions.
According to one aspect of the invention, isolated nucleic acid molecules that code for a native polypeptide are provided and include: (a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule consisting of a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24, and which code for a native polypeptide, (b) deletions, additions and substitutions of (a) which code for an apoptosis-inducing polypeptide, (c) nucleic acid molecules that differ from the nucleic acid molecules of (a) or (b) in codon sequence due to the degeneracy of the genetic code, and (d) complements of (a), (b) or (c). In certain embodiments, the isolated nucleic acid hybridizes to a complement of a molecule consisting of a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:2, and SEQ ID NO:24. In other embodiments, the isolated nucleic acid hybridizes to a complement of a molecule consisting of a nucleotide sequence selected from the group consisting of SEQ ID NO:20, SEQ ID NO:22. In yet further embodiments, the isolated nucleic acid hybridizes to a complement of a molecule consisting of a nucleotide sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:9. In certain embodiments, the isolated nucleic acid molecule comprises a nucleotide sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24. In other embodiments, the isolated nucleic acid molecule comprises a nucleotide sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:9. In still other embodiments, the isolated nucleic acid molecule comprises a nucleotide sequence of SEQ ID NO:26. In some embodiments the isolated nucleic acid molecules are those which code for a polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25. In an important embodiment, the native polypeptide is a native TMSl polypeptide. A native TMSl polypeptide is one which possesses a native TMSl function or activity, such as apoptosis induction. Sequence homoiogy has revealed that TMS 1 contains a caspase recruiting domain (i.e., a CARD). Thus, another function of a native TMSl polypeptide is the ability to bind to either itself or to other CARD containing proteins, specifically through the CARD.
The invention in another aspect provides an isolated nucleic acid molecule selected from the group consisting of (a) a unique fragment of nucleic acid molecule of SEQ ID NO: l, of sufficient length to represent a sequence unique within the human genome, and (b) complements of (a), provided that the fragment includes a sequence of contiguous nucleotides which is not identical to a sequence selected from the sequence group consisting of (1) sequences having the GenBank and EMBL accession numbers of Table I, and having been published prior to the priority date or filing date, and (2) complements of (1).
In one embodiment, the sequence of contiguous nucleotides is selected from the group consisting of (1) at least two contiguous nucleotides nonidentical to the sequence group, (2) at least three contiguous nucleotides nonidentical to the sequence group, (3) at least four contiguous nucleotides nonidentical to the sequence group, (4) at least six contiguous nucleotides nonidentical to the sequence group, (5) at least eight contiguous nucleotides nonidentical to the sequence group, (6) at least ten contiguous nucleotides nonidentical to the sequence group. In another embodiment, the unique fragment has a size selected from the group consisting of at least: 8 nucleotides, 10 nucleotides, 12 nucleotides, 14 nucleotides, 16 nucleotides, 18 nucleotides, 20, nucleotides, 22 nucleotides, 24 nucleotides, 26 nucleotides, 28 nucleotides, 30 nucleotides, 40 nucleotides, 50 nucleotides, 75 nucleotides, 100 nucleotides, 200 nucleotides, 1000 nucleotides and every integer length therebetween as if fully recited herein.
In other embodiments, the unique fragment encodes a peptide which is a fragment of a polypeptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NO:3 and SEQ ID NO:25.
According to another aspect, the invention provides expression vectors, and host cells transformed or transfected with such expression vectors, comprising the nucleic acid molecules described above. In yet another aspect, the invention provides an isolated nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:4. SEQ ID NO:4 represents the nucleotide sequence of nucleotides 1 100-1725 of SEQ ID NO: 1, corresponding to a CpG island in the TMSl genomic sequence. Also provided is an expression vector comprising the isolated nucleic acid molecule comprising a nucleotide sequence of SEQ ID NO:4, or a regulatory fragment thereof, operably linked to a reporter coding sequence. In one embodiment, the reporter coding sequence comprises a promoter.
In yet another embodiment, other regulatory sequences of TMS 1 are provided including those of introns 1 and 2 in SEQ ID NO: 1. Intron 1 in SEQ ID NO: 1 corresponds to nucleotides 1530- 1742 and intron 2 in SEQ ID NO:2 corresponds to nucleotides 1800-2104. According to another aspect of the invention, an isolated polypeptide is provided. The isolated polypeptide is encoded by the foregoing isolated nucleic acid molecules of the invention. Preferably the isolated polypeptide is a native TMSl polypeptide. In important embodiments, the isolated polypeptide consists of an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25. In other embodiments, an isolated peptide is provided which comprises a fragment or variant of a polypeptide (such as one consisting of an amino acid sequence of SEQ ID NO:3 or SEQ ID NO:25) of sufficient length to represent a sequence unique within the human genome, and to identify a native TMSl polypeptide. The isolated peptide may comprise at least 6, at least 8, at least 9, at least 10, at least 11, at least 12, at least 14, at least 16, at least 18 or at least 20 contiguous amino acids having a sequence of a fragment of SEQ ID NO:3 or SEQ ID NO:25. Isolated peptides which are immunogenic are also provided.
According to another aspect of the invention, compositions are provided which comprise an isolated agent that binds selectively to a native TMSl polypeptide encoded by the foregoing isolated nucleic acid molecules of the invention. Preferably, the isolated agent binds selectively to a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21 , SEQ ID NO:23 and SEQ ID NO:25, or a fragment thereof. The isolated agent may selectively bind to a polypeptide comprising an amino acid sequence of SEQ ID NO:21 or SEQ ID NO:23 or SEQ ID NO:25. In important embodiments, the isolated agent is a peptide. In a further embodiment, the peptide is an antibody or a fragment thereof (e.g., Fab, F(ab)2, Fd and antibody fragments which include a CDR3 region which binds selectively to the native TMSl polypeptide). In even more preferred embodiments, the antibody is a humanized antibody or a chimeric antibody. The isolated agent may be conjugated to a detectable label. The detectable label may be selected from the group consisting of a radioactive label, an enzyme, a biotin molecule, an avidin molecule or a fluorochrome.
According to another aspect of the invention, a method is provided for identifying a subject at risk of developing a disorder characterized by abnormal methylation of a CpG island containing TMSl nucleic acid molecule. The method involves determining a level of methylation of a CpG island containing TMSl nucleic acid molecule in a biological sample from a subject, and comparing the level of methylation of the CpG island containing TMSl nucleic acid molecule in the biological sample to a control. The CpG island containing TMSl nucleic acid molecule is selected from the group consisting of (a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule consisting of SEQ ID NO:4 and which code for a native TMSl polypeptide, and (b) complements of (a). According to the method provided, an increase in the level of methylation of the CpG island containing TMS 1 nucleic acid molecule in the biological sample compared to the control identifies a subject at risk of developing the disorder. The disorder may be a tumor. In one embodiment, the level of methylation is determined using a technique selected from the group consisting of methylation-sensitive restriction analysis, methylation specific polymerase chain reaction (MSP), sequencing of bisulfite-modified DNA, methylation-sensitive single nucleotide primer extension (Ms-SNuPE), and combined bisulfite restriction analysis (COBRA) .
The biological sample may be selected from the group consisting of breast tissue, ovarian tissue, prostatic tissue, cervical tissue, peripheral blood and bone marrow. In a preferred embodiment, the biological sample is breast tissue. In important embodiments, the control comprises a normal tissue from a normal subject, or normal appearing tissue adjacent to a tumor.
In another aspect, the invention provides a method for determining a risk of developing a disorder characterized by abnormal methylation of a CpG island containing TMSl nucleic acid molecule. The method in this latter aspect involves measuring a level of an expression product of a CpG island containing TMSl nucleic acid molecule, by contacting a biological sample isolated from a subject with an agent that selectively binds to a target expression product, determining a level of interaction between the agent and the target expression product, and comparing the level of interaction between the agent and the target expression product with a control. The target expression product is selected from the group consisting of (a) nucleic acid expression products which hybridize under stringent conditions to a complement of a molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NO:2 and SEQ ID NO:24 and which code for a native TMSl polypeptide, and (b) polypeptide expression products, and fragments thereof, of (a).
In preferred embodiments, the control comprises a normal tissue from a normal subject. In important embodiments, a decrease in the level of interaction between the agent and the target expression molecule in the biological sample compared to the control indicates a risk of developing the disorder. In one embodiment, the disorder is a proliferative disorder. In a preferred embodiment, the disorder is cancer. In an even more preferred embodiment, the cancer is breast cancer. The agent, in one embodiment, is a nucleic acid molecule. In another embodiment, the agent is a peptide. In still a further embodiment, the peptide is an antibody or a fragment thereof. In the foregoing embodiments, various methods can be used to measure expression, including Northern analysis, reverse-transcriptase polymerase chain reaction (RT-PCR), immunohistochemistry and Western analysis.
The invention in yet another aspect provides a method for treating a subject having, or at risk of developing, a disorder characterized by abnormal methylation of a CpG island containing TMSl nucleic acid molecule. In another related aspect, a method is provided for treating a subject having, or at risk of developing, a disorder, perhaps in a tissue, characterized by abnormally low levels of a TMSl expression product. Both methods comprise administering a demethylating agent to a subject in need of such treatment in an amount effective. The effective amount is dependent upon the subject to be treated. If the subject is at risk of developing the disorder, then preferably the demethylating agent is administered in an amount effective to maintain a normal level of methylation in a CpG island containing TMSl nucleic acid molecule in a tissue of the subject. If, on the other hand, the subject has the disorder, then preferably the demethylating agent is administered in an amount effective to reduce the level of methylation in a CpG island containing TMSl nucleic acid molecule in a tissue of the subject. In an important embodiment, the level of methylation in the CpG island containing TMSl nucleic acid molecule is reduced compared to a pre-treatment level of methylation.
In one embodiment, the method further comprises first selecting a subject in need of such treatment. In certain embodiments, the disorder is cancer. In important embodiments, the cancer is breast cancer. In one embodiment of the preceding aspect, the method further comprises administering a disorder-specific therapy to a subject so identified as at risk of developing the disorder. In embodiments in which the disorder is a cancer, the subject is administered an anti-cancer therapy. In one embodiment, the anti-cancer therapy is administered once the level of methylation in a CpG island containing TMSl nucleic acid molecule in a tissue of the subject is reduced.
The CpG island containing TMSl nucleic acid molecule is selected from the group consisting of (a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule comprising SEQ ID NO:4, and which code for a native TMSl polypeptide, and (b) complements of (a). In some embodiments of the foregoing, the demethylating agent is administered to a tissue at risk of developing a tumor. Preferably the demethylating agent is administered locally within a subject in the area of the tissue. The demethylating agent may be an inhibitor of methyltransferase. In preferred embodiments, the inhibitor of methyltransferase is selected from the group consisting of 5- azacytidine, 5-aza-2'deoxycytidine (also known as Decitabine in Europe), 5, 6-dihydro-5-azacytidine, 5, 6-dihydro-5-aza-2'deoxycytidine, 5-fluorocytidine, 5-fluoro-2'deoxycytidine, and short oligonucleotides containing 5-aza-2'deoxycytosine, 5, 6-dihydro-5-aza-2'deoxycytosine, and 5-fIuoro- 2'deoxycytosine. The demethylating agent may be conjugated to, or more preferably incorporated into, a nucleic acid molecule. The nucleic acid molecule may be selected from the group consisting of (a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule comprising SEQ ID NO: 1, and (b) complements of (a). Alternatively, the sequence may be unrelated to SEQ ID NO: 1 or complements thereof.
In another aspect, the invention provides another method for treating a subject having, or at risk of developing, a disorder characterized by abnormal methylation of a CpG island containing TMSl nucleic acid molecule. In a related aspect, another method is provided for treating a subject having, or at risk of having, a disorder characterized by abnormally low levels of a TMS 1 expression product. When used therapeutically in subjects having the disorder, the methods involve administering a CARD containing molecule to a subject in need of such treatment in an amount effective to increase CARD polypeptide level in a tissue of the subject. When used prophylactically in subjects at risk of developing the disorder, the methods involve administering a CARD containing molecule to a subject in need of such treatment, preferably in an amount effective to establish or maintain a normal level of CARD polypeptide in a tissue of the subject. The method may further comprise first selecting a subject having or at risk of developing the disorder. In important embodiments, the disorder is cancer. According to one embodiment, the cancer is breast cancer. In important embodiments, the level of the CARD polypeptide is increased relative to a pre-treatment level.
In one embodiment, the CARD containing molecule is selected from the group consisting of a CARD containing nucleic acid molecule and CARD containing polypeptide. In an important embodiment, the CARD containing molecule is a TMSl molecule. The TMSl molecule may be selected from the group consisting of a TMSl nucleic acid molecule or a TMSl polypeptide. In one embodiment, the CARD containing nucleic acid molecule comprises an nucleotide sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:2, SEQ ID NO:9, SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24. In another embodiment, the CARD containing polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25, and is preferably selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25. In one embodiment, the CARD containing molecule is administered to a tissue having, or at risk of developing, the disorder (e.g., a tumor). In one embodiment, the disorder is cancer. The cancer may be breast cancer, but is not so limited.
The invention in another aspect involves a method for increasing TMSl expression in a subject that fails to express a normal level of wild-type TMS 1 or expresses a mutant TMS 1. An isolated TMSl nucleic acid molecule of the invention or an expression product thereof, including mRNA and/or polypeptide, is administered to such a subject, in an amount effective to increase wild- type TMSl expression in the subject.
In other aspects, the invention provides a method for determining the risk of a subject being non-responsive to a disorder-specific therapy and a method for identifying a subject who is at risk of being non-responsive to disorder-specific therapy. In important embodiments of the immediately foregoing methods, the subject has cancer, and the disorder-specific therapy is an anti-cancer therapy or an anti-proliferative therapy. The methods involve determining a level of methylation of a CpG island containing TMSl nucleic acid molecule in a biological sample from a subject having a disorder (e.g., cancer), and comparing the level of methylation of the CpG island containing TMSl nucleic acid molecule in the biological sample to a control. The CpG island containing TMSl nucleic acid molecule is as described herein according to other aspects of the invention. According to the method, an increase in the level of methylation of the CpG island containing TMSl nucleic acid molecule in the biological sample compared to the control identifies a subject who is at risk of being non- responsive to the disorder-specific therapy (e.g., anti-cancer therapy). The level of methylation is determined using techniques such as those listed above for other aspects of the invention.
In related aspects, methods are provided for determining the risk of a subject being non- responsive to a disorder-specific therapy and identifying a subject who is at risk of being non- responsive to a disorder-specific therapy by measuring a level of an expression product of a CpG island containing TMSl nucleic acid molecule in a tissue in a subject. Preferably, the subject has the disorder and the disorder exists in the tissue being tested. The methods involve contacting a biological sample isolated from a subject with an agent that selectively binds to a target expression product, determining a level of interaction between the agent and the target expression product, and comparing the level of interaction between the agent and the target expression product with a control. The target expression product can be selected from the group consisting of (a) nucleic acid expression products which hybridize under stringent conditions to a complement of a molecule comprising SEQ ID NO:2 and which code for a native TMSl polypeptide, and (b) polypeptide expression products, and fragments of (a) or (b).
In preferred embodiments, the control comprises a normal tissue from a normal subject. In a related embodiment, the control is normal tissue from the subject having cancer. In important embodiments, a decrease in the level of interaction between the agent and the target expression molecule in the biological sample compared to the control indicates a risk of developing the disorder. In one embodiment, the disorder is a proliferative disorder. In a preferred embodiment, the disorder is cancer. The cancer may be breast cancer, but is not so limited. In one embodiment, the biological sample is a breast cancer tumor. The agent, in one embodiment, is a nucleic acid molecule. In another embodiment, the agent is a peptide. In still a further embodiment, the peptide is an antibody or a fragment thereof. In the foregoing embodiments, various methods can be used to measure expression, including Northern analysis, reverse-transcriptase polymerase chain reaction (RT-PCR), immunohistochemistry, and Western analysis.
The disorder-specific therapy may be anti-cancer therapy. In some embodiments, it is a DNA- damaging anti-cancer therapy. A DNA damaging anti-cancer therapy is a therapy that is effective due to its ability to induce DNA damage and, thus ultimately, lead to the death of the cell via apoptosis. In one embodiment, the DNA damaging anti-cancer therapy is radiation therapy or some form of chemotherapy. The method may further comprise administering to the subject an anti-cancer therapy which is not dependent upon DNA damage or alternatively an anti-cancer therapy which is not dependent upon apoptosis. In important embodiments, the subject is administered an anti-cancer therapy selected from the group consisting of biological response modifying therapy, immunotherapy, cancer vaccine therapy, hormone therapy and angiogenesis inhibiting therapy.
The method may further comprise administering to the subject at risk of being non-responsive to an anti-cancer therapy, a demethylating agent and an anti-cancer therapy. Alternatively, the method may further comprise administering to the subject at risk of being non-responsive to an anti-cancer therapy, a TMSl molecule selected from the group consisting of a TMSl nucleic acid molecule and a TMSl polypeptide, and an anti-cancer therapy. In one embodiment, the preferred TMSl nucleic acid molecule comprises an nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24. In another embodiment, the preferred TMSl polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25.
The invention further provides, in yet another aspect, a method for treating a subject having a cancer comprising administering a demethylating agent and an anti-cancer therapy to a subject in need of such treatment in an amount effective to treat the cancer. In a related aspect, the invention provides another method for treating a subject having a cancer comprising administering a TMS 1 molecule and an anti-cancer therapy to a subject in need of such treatment in an amount effective to treat the cancer. The cancer may be one which is characterized by abnormal methylation of a CpG island containing TMSl nucleic acid molecule (as described for preceding aspects). Alternatively, the cancer may be characterized by an abnormally low levels of a TMSl expression product. In yet another embodiment, the disorder may be characterized by the presence of a mutant TMS 1 molecule, in which case, treatment with a TMSl molecule alone or with an anti-cancer therapy may be suitable. The demethylating agent or the TMSl molecule may be administered prior to, or concurrently with, the anti-cancer therapy.
In one embodiment, the TMSl molecule is selected from the group consisting of a TMSl nucleic acid molecule and a TMSl polypeptide. In another embodiment, the preferred TMSl nucleic acid molecule comprises an nucleotide sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24. The preferred TMSl polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO:3 and SEQ ID NO:25, while in other embodiments, the amino acid sequence may be SEQ ID NO: 10, SEQ ID NO:21 or SEQ ID NO:23. In related aspects, the demethylating agent or the TMSl molecule may be administered to the subject in an amount effective to sensitize the cancer to the anti-cancer therapy (e.g., an amount of demethylating agent or TMS 1 molecule effective to make the cancer responsive to the anti-cancer therapy, or to decrease the dose of anti-cancer therapy required to treat the cancer).
In yet a further aspect, the invention provides a method for treating a subject having a disorder characterized by abnormal cell proliferation. In a preferred embodiment, the abnormal cell proliferation is a cancer. The method involves administering a TMSl molecule to a tissue having the disorder in an amount effective to increase the level of TMSl polypeptide to an above-normal level. The above-normal level may be at least 10%, at least 20%, at least 30%, at least 50%, at least 100% or at least 150% above normal levels. Preferably, the level of TMSl polypeptide is one which induces the apoptosis of the cells in which it is expressed. The disorder may or may not be one characterized by abnormal methylation of a CpG island containing TMSl nucleic acid molecule or by an abnormally low level of a TMSl expression product. In one embodiment, the disorder is breast cancer.
The invention further provides a method for identifying other nucleic acid molecules that are silenced as a result of methylation and which may be involved in cancer. Thus, in another aspect of the invention, a method is provided for identifying a nucleic acid molecule transcriptionally down- regulated following methylation. The method comprises overexpressing a methyltransferase molecule in an experimental cell, and identifying a differentially expressed molecule which has a lower level of expression in the experimental cell than in a control. In a preferred embodiment, the methyltransferase is a human DNA methyltransferase. In important embodiments, the experimental cell is one which overexpresses a DNA methyltransferase. The cell may be a primary cell or a cell from an established cell line. In a preferred embodiment, the experimental cell is HMT.1E1. The control may be an immortalized fibroblast cell line. In a preferred embodiment, the control is an SV40 immortalized variant of the IMR90 fibroblast cell line. In one embodiment, the expression product is an mRNA. The differentially expressed molecule may be identified using a technique selected, for example, from the group consisting of subtractive hybridization, differential display, representational difference analysis and cDNA microarray analysis. The invention also provides screening assays for identifying binding partners (e.g., ligands) of TMSl. The binding partners may be naturally occurring (e.g., natural ligands of TMSl) or they may be synthetic. Additionally, they may be activating (i.e., capable of promoting apoptosis in the context of TMSl) or inhibiting (i.e., capable of interfering with apoptosis in the context of TMSl). In one aspect, the invention provides a method for identifying a TMSl polypeptide binding partner comprising obtaining a binding assay result from a binding assay between a library member and a TMSl polypeptide, and comparing the binding assay result to a control binding assay result. According to one method, a binding assay result that is greater than a control binding assay result indicates that the library member is a TMSl polypeptide binding partner. In one embodiment, the preferred TMSl polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25. In one embodiment, the library member is derived from a natural source library.
In a related aspect, the invention provides a method for identifying a TMS 1 N-terminal polypeptide binding partner comprising obtaining a binding assay result from a binding assay between a library member and a TMSl N-terminal polypeptide, and comparing the binding assay result to a control binding assay result. According to one method, a binding assay result that is greater than a control binding assay result indicates that the library member is a TMS 1 N-terminal polypeptide binding partner. The TMS 1 N-terminal polypeptide may comprise an amino acid sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:27, but it is not so limited. In another embodiment, the TMSl N-terminal polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25, and the control binding assay result is obtained from a control binding assay between a library member and a polypeptide consisting of an amino acid sequence of SEQ ID NO: 10. In one embodiment, the library member is derived from a natural source library. Another aspect of the invention provides compositions comprising any of the foregoing isolated nucleic acid molecules of the invention, or expression products thereof, in amounts effective to increase levels of wild-type TMSl expression products, and a pharmaceutically acceptable carrier.
The invention also contemplates kits comprising a package including assays for TMS 1 epitopes, TMSl nucleic acids or TMSl methylation. The kit further comprises instructions and optionally related materials such as controls, for example, a number, color chart, or an epitope of the expression product of the foregoing isolated nucleic acid molecules of the invention, for comparing the level of wild-type and/or mutant TMSl polypeptides, wild-type or mutant TMSl nucleic acid forms or the level of TMSl methylation in a test sample to the level in the control. This comparison can be used to assess a risk of developing a disorder characterized by abnormally low levels of wild- type TMSl expression products or a risk of developing a disorder characterized by abnormal methylation of CpG island containing TMSl nucleic acid molecules. Thus, the present invention thus involves, in several aspects, TMSl polypeptides, genes encoding such polypeptides, functional modifications and variants of the foregoing, useful fragments of the foregoing, as well as therapeutics and diagnostics relating thereto.
These and other objects of the invention will be described in further detail in connection with the detailed description of the invention.
Brief Description of the Figures Figure 1A is a representation of a Southern blot analysis of cell lines 90SV and HMT.lEl . Hybridization shows clone RDA-2.15 is differentially represented in cDNA derived from 90SV and HMT.lEl cells Figure IB is a representation of a Northern blot analysis of TMSl and β-actin expression in cell lines 90SV and HMT.lEl.
Figure 1C is a representation of an RT-PCR analysis of TMSl and β-actin expression in cell lines IMR90, 90SV and HMT.lEl, showing down-regulation of TMSl in fibroblasts overexpressing DNMTl (i.e., HMT.lEl) relative to control cells (i.e., 90SV and IMR90). Control reactions in which reverse transcriptase was omitted (-RT) were amplified under the same conditions. Figure 2A shows the genomic structure of the TMSl locus.
Figure 2B shows the methylation status of the TMSl CpG island as determined by Southern analysis following methylation-sensitive restriction analysis.
Figure 2C shows the results of methylation-specific PCR of DNA from HMT.lEl, 90SV and IMR90 cell lines.
Figure 3 A shows methylation specific PCR analysis of bisulfite-modifϊed DNA from primary human mammary epithelial cells (HMEC) and two immortal, non-tumorigenic breast epithelial cell lines (MCF10A, Hs578Bst) compared to that of nine breast cancer cell lines (MCF-7, T47-D, ZR-75- 1, Hs578t, MDA MB231, MDA MB468, SKBR3, CAMAl, BT-20). Parallel amplifications reactions were performed using primers specific to methylated (M) and unmethylated (U) DNA.
Figure 3B shows the TMSl mRNA expression profile of breast epithelial cells and breast cancer cells using reverse transcribed RNA amplified with primers to TMSl (top panel) and β-actin (bottom panel). Control reactions in which reverse transcriptase was omitted (-RT) were amplified under the same conditions. Figures 3C and 3D show the effect of a demethylating agent (5-aza-2'deoxycytidine) on
TMSl methylation and re-expression in normal and breast cancer cell lines.
Figure 4A shows the methylation status of TMSl in normal breast tissue from reduction mammoplasty using methylation-specific PCR analysis.
Figure 4B shows the methylation status of TMSl in primary breast tissues from reduction mammoplasty using methylation-specific PCR analysis. Figure 4C shows the methylation status of TMSl in paired normal-appearing tissue (N) adjacent to breast tumors (T). Shown are 12 representative pairs out of a total of 18 analyzed.
Figure 5 A shows the expression of TMSl and β-actin in normal human tissues and human tumor-derived cell lines. Figure 5B illustrates the amino acid alignment of TMS 1 with the CARD motif of other apoptotic signaling proteins. Numbers in parentheses indicate the position in the amino acid sequence. Reverse type indicate >50% amino acid identity; gray shading indicates >50% similarity through conserved amino acid substitutions.
Figure 5C shows the apoptosis inducing ability of TMSl and TMSl variants. Where indicated, zVAD was added immediately following transfection. Data are presented as the percentage of β-galactosidase positive cells exhibiting apoptosis (mean ± SD) from three independent transfection experiments.
Figure 5D shows the effect TMS land TMSl variants on colony forming activity of transfected breast cancer cell lines. Data (mean ± SD) represent the number of G418r colonies recovered for each test construct relative to that of the vector. At least three independent transfection experiments were performed.
Figure 6A illustrates induction of caspase-dependent apoptosis by TMSl using an ecdysone- inducible expression system to express myc-tagged TMS 1. MTMS22 cells were treated with pon A for the indicated times, and TMS 1 expression was examined by immunoblotting with a monoclonal myc (9E 10) antibody.
Figure 6B shows MTMS22 cell proliferation as determined in the presence or absence of 5 μM pon A to induce TMS 1 expression and with or without 40 μM Z-VAD. Data represent the mean ± SD of triplicate determinations from a representative growth experiment.
Figure 6C shows the induction of apoptosis of MTMS22 cells treated with pon A and/or Z- VAD for the indicated times. DNA fragmentation was visualized by EtBr/agarose gel electrophoresis. Figure 7 A shows the result of transient transfection of 293 cells with pcDNA-TMSl, with pcDNA-TMSl plus DN-caspases-8 or -9, or with pcDNA-TMSl in the presence of 40 μM Z-VAD. Forty-eight hours after transfection, the percentage of transfected (β-gal positive) cells exhibiting morphologic features of apoptosis was determined. At least 200 transfected cells were counted per transfection. Data represent the mean ± SD of three separate experiments.
Figure 7B shows that transient transfection of 293 cells with the indicated amounts of pcDNA- mycTMSl has no effect on NF-κB activation, using a CAT activity assay. As a control, 293 cells were transfected with an NF-kB CAT reporter construct (pJECAT2.6). A CAT reporter construct containing a mutated NF-κB site, (p2.6mκBl) was used as a negative control. TNFα (20 μM) was added a positive control. Lysates used for CAT assays were subjected to immunoblot analysis for TMSl.
Figure 8A shows the subcellular localization of TMSl in MTMS22 cells induced to express myc-tagged TMSl by addition of pon A for the indicated times and prepared for visualization of TMSl by immunofluorescence using a myc (9E10) monoclonal antibody. Nuclei were visualized by staining with Hoescht 33258 dye. Cells were viewed at 400X magnification.
Figure 8B shows the localization of TMSl in 293 cells transiently transfected with pcDNA- mycTMSl and processed to visualize TMSl and nuclei by immunofluorescence. Images are at 1000X magnification. Figure 9A shows that TMSl-induced apoptosis and localization are dependent on the CARD.
Percentages of 293 apoptotic cells were determined 48 h after transient transfection with pcDNA3.1, pcDNA-mycTMS 1 or pcDNA-mycTMSlΔ100-195. At least 200 transfected cells were counted per transfection, and results represent the mean ± SD of 3 separate experiments.
Figure 9B is a representation of a Western immunoblot analysis of lysates from transfected 293 cells showing expression of full-length or truncated TMSl (top) and β-gal (bottom).
Figure 9C is a representation of photographs of 293 cells transiently transfected with pcDNA- mycTMSl or pcDNA-mycTMSlΔ100-195 and prepared for visualization of TMSl by immunofluorescence. At least 500 TMSl -positive cells were scored for subcellular localization of TMSl . Brief Description of the Sequence Listing
SEQ ID NO: 1 is the nucleotide sequence of human TMSl genomic DNA (Accession No. AF 184072).
SEQ ID NO:2 is the nucleotide sequence of human TMSl cDNA (Accession No. AF184073).
SEQ ID NO:3 is the amino acid sequence of human TMSl polypeptide. SEQ ID NO:4 is the nucleotide sequence of nucleotides 1100- 1725 of SEQ ID NO: 1 , corresponding to the TMSl CpG island.
SEQ ID NO:5 is the nucleotide sequence of nucleotides 1190-1529 of SEQ ID NO: l, corresponding to TMSl exon 1.
SEQ ID NO:6 is the amino acid sequence encoded by nucleotides 1 190-1529 of SEQ ID NO: 1 , corresponding to TMS 1 exon 1.
SEQ ID NO:7 is the nucleotide sequence of nucleotides 1743-1799 of SEQ ID NO: 1, corresponding to TMSl exon 2.
SEQ ID NO:8 is the amino acid sequence encoded by nucleotides 1743- 1799 of SEQ ID NO: l, corresponding to TMSl exon 2. SEQ ID NO:9 is the nucleotide sequence of nucleotides 2105-2460 of SEQ ID NO: 1, corresponding to TMSl exon 3. SEQ ID NO: 10 is the amino acid sequence encoded by nucleotides 2105-2460 of SEQ ID NO: 1, corresponding to TMSl exon 3.
SEQ ID NO: 1 1 is the nucleotide sequence of a TMS 1 specific forward primer. SEQ ID NO: 12 is the nucleotide sequence of a TMSl specific reverse primer. SEQ ID NO: 13 is the nucleotide sequence of a TMSl specific forward RT-PCR primer. SEQ ID NO: 14 is the nucleotide sequence of a β-actin specific forward RT-PCR primer. SEQ ID NO: 15 is the nucleotide sequence of a β-actin specific reverse RT-PCR primer. SEQ ID NO: 16 is the nucleotide sequence of a unmethylated TMS 1 specific forward primer. SEQ ID NO: 17 is the nucleotide sequence of a unmethylated TMS 1 specific reverse primer. SEQ ID NO: 18 is the nucleotide sequence of a methylated TMS 1 specific forward primer. SEQ ID NO: 19 is the nucleotide sequence of a methylated TMS 1 specific reverse primer. SEQ ID NO:20 is the nucleotide sequence of mouse TMSl cDNA. SEQ ID NO:21 is the amino acid sequence of mouse TMSl polypeptide. SEQ ID NO:22 is the partial nucleotide sequence of rat TMSl cDNA. SEQ ID NO:23 is the partial amino acid sequence of rat TMS 1 polypeptide. SEQ ID NO:24 is the nucleotide sequence of an alternatively spliced form of human TMSl cDNA (Accession No. AF255794) which is missing exon 2.
SEQ ID NO:25 is the amino acid sequence of an alternatively spliced form of human TMSl polypeptide which is missing exon 2.
SEQ ID NO:26 is the nucleotide sequence of an alternatively spliced form of TMSl cDNA which is missing exon 3.
SEQ ID NO:27 is the amino acid sequence of an alternatively spliced form of TMSl cDNA which is missing exon 3.
Detailed Description of the Invention Cancers arise from any number of cellular perturbations in a cell. Most of these perturbations take the form of a genetic mutation at the genomic DNA level. Genetic mutations can in turn manifest their effects in a number of ways including alterations in expression levels and/or function of an mRNA or a polypeptide. The end result is always an uncontrolled growth of the mutated population of cells as a result of either increased proliferative rates, decreased apoptotic rates and/or failure to respond to normal growth control signals.
Gene loci which are altered in the progression of such disorders are not always the primary or direct target of the initial mutation however. Rather, a mutation may exist in a genomic locus which codes for an "upstream" factor. Mutation of the upstream factor may not produce a malignant phenotype to a cell by itself. However, the mutation of the upstream factor does impact upon "downstream" factors, the genomic locus of which remains essentially wild- type. One such upstream factor is a factor capable of methylating genomic sequences. Abnormal methylation of genomic loci has been reported to cause altered expression levels from that genomic locus. The mammalian genome is widely methylated except for regions rich in CG dinucleotides (e.g., CpG islands) which are undermethylated as compared to the rest of the genome, in normal cells. Aberrant methylation, particularly at CpG islands, is reportedly accompanied by gene silencing and is reportedly one mechanism responsible for the inactivation of several tumor suppressor genes in human cancers. The invention described herein is premised, in part, on the finding that cells overexpressing methyltransferase can be used to identify genomic loci susceptible to abnormal methylation. The discovery was thus made that a cell overexpressing a methyltransferase exhibited abnormal methylation of CpG island in particular loci, thereby leading to the silencing of these loci. More specifically, the TMSl (Target of Methylation- induced Silencing-1) gene was identified as one such genomic locus which is silenced in the presence of methyltransferase overexpression due to abnormal methylation of a CpG island in its 5' regulatory region. It was further discovered that TMSl is a target of methylation associated silencing in human cancer. Thus, one aspect of the invention involves the cloning of a human cDNA, 770 bp in size, encoding TMSl, represented by SEQ ID NO:2. The human TMSl polypeptide is predicted to be a 25 kDa protein, believed to function in the regulation of cell death. The predicted amino acid sequence of the encoded human protein product is presented as SEQ ID NO:3. "TMSl activity" intends, at least, an apoptosis inducing activity. The human TMSl genomic sequence comprises the sequence of SEQ ID NO: 1. SEQ ID NO:20 represents the nucleotide sequence of the mouse TMS 1 cDNA, with the amino acid sequence of the polypeptide it is predicted to encode shown in SEQ ID NO:21. SEQ ID NO:22 represents the partial nucleotide sequence of the rat TMSl cDNA, with the partial amino acid sequence of the polypeptide it is predicted to encode shown in SEQ ID NO:23. SEQ ID NO:24 is the nucleotide sequence of an alternatively spliced form of TMSl which lacks exon 2. This latter nucleic acid encodes the polypeptide having amino acid sequence of SEQ ID NO:25. SEQ ID NO:26 represents the nucleotide sequence of an alternatively spliced form of TMSl that lacks exon 3, with the amino acid sequence it is predicted to encode shown in SEQ ID NO:27.
Apoptosis is a programmed cell death available to almost every normal non-malignant cell and is triggered in such a cell when cell age or integrity dictate. It is an active process often moφhologically characterized by cleavage of the genomic DNA into fragments, giving rise to a DNA "ladder" pattern upon gel electrophoresis. "Blebbing" of the plasma membrane is also a common feature of apoptosing cells. Apoptotic pathways are believed to play an integral role in ensuring the elimination of cells which have undergone mutation and have failed to repair such mutation. Thus, apoptosis is a normal process by which normal cells are selected for and potentially mutant cells are selected against. Commonly, cancer cells de-activate apoptotic pathways, and therefore are capable of propagating themselves in spite, and perhaps as a result, of the mutation they have acquired. Mutation which prohibits or reduces the likelihood of apoptosis suffices as one of the several mutations necessary for cancer development. As used herein, the term mutation is used broadly to encompass both mutation (i.e., change) at the genetic level and overall alteration of a cell profile which may or may not be due to a recognized mutation at the genetic level. Abnormal methylation, particularly when accompanied by inappropriate gene silencing, may also suffice as one such mutation in the development of a malignancy.
Comparison of TMSl nucleic acid sequences (e.g., SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:22 or SEQ ID NO:24) to nucleic acid and protein databases show that TMSl possesses a carboxy terminal caspase-recruiting domain (CARD), a recently described interaction motif common to some apoptotic signaling molecules and reported to mediate homophilic interactions between such molecules. Similar in structure and function to the death domain and the death effector domain, the CARD is a homotypic protein interaction domain found in proteins that function in the regulation and execution of apoptosis. (Hofmann, K., et al., Trends.Biochem.Sci. 22: 155-156, 1997) The CARD exists within the prodomain of several caspases, and homotypic oligomerization with upstream CARD signaling proteins mediates their cleavage and activation. (Hofmann, K. Cell
Mol.Life Sci. 55: 1113-1128, 1999) Other CARD-containing proteins with known roles in apoptosis include the C. elegans CED-3 and CED-4, the human homolog of CED-4, Apafl, the cellular and viral inhibitors of apoptosis (cIAPs), the cellular homolog of herpesvirus EHV2 E10, Bcll O/mElO/CIPER CLAP/CARMEN, and several proteins involved in the activation ofNF-κB. (Hofmann, K. Cell Mol.Life Sci. 55:1113-1128, 1999) An alignment of TMSl with other known human CARDs indicated that the TMSl CARD was most similar to that of the serine/threonine kinase RICK/CARDIAK/RIP2 (25% identity, 51% similarity) and CARD4/Nodl (24% identity, 44% similarity), a CED-4/ Apafl family member that binds to RICK as well as procaspase 9. (Inohara, N. et al., J.Biol.Chem. 273:12296-12300, 1998; McCarthy, J.V. et al., J.Biol.Chem. 273: 16968-16975, 1998; Thome, M., et al., Curr.Biol. 8:885-888, 1998; Bertin, J., et al., J.Biol.Chem. 274: 12955-12958, 1999; Inohara, N., et al., J.Biol.Chem. 274:14560-14567, 1999)
Thus, one function of native TMSl polypeptides is apoptosis induction. Induction of apoptosis can be assayed in a number of ways. Commonly, a TMSl nucleic acid molecule or a polypeptide would be introduced into a cell. The cell can then be observed for any number of phenotypic changes such as DNA ladder formation, blebbing of the plasma membrane, and for adherent cells particularly, condensation, rounding up and detachment from a growth substratum. Functional measurements can also be used to assess apoptosis. One example of a functional assay is the ability of TMSl molecules to decrease, or halt altogether, the proliferation of cells which lack endogenous TMSl, such as some breast cancer cells (e.g., ZR75-1, Hs578t and MB231). Cell proliferation can be measured by incoφoration of tritiated thymidine or in vitro cell growth as indicated by cell count and/or colony forming ability. Compounds which have an apoptotic function should inhibit or reduce colony forming activity, or prevent increases in cell counts and/or tritiated thymidine incoφoration. As the Examples will show, TMSl and variants of TMSl retaining the CARD are able to promote apoptosis and inhibit colony formation when ectopically expressed. As also shown in the Examples, overexpression of TMSl nucleic acid molecules induces apoptosis of cells, regardless of whether they express TMS 1 expression products prior to treatment.
The invention thus involves in one aspect an isolated TMSl polypeptide, the genomic DNA (including the promoter region and the CpG island) and cDNA encoding this polypeptide, the genomic locus necessary for assessment of CpG island methylation, functional modifications and variants of the foregoing, useful fragments of the foregoing, as well as diagnostics and therapeutics relating thereto. As used herein with respect to nucleic acids, the term "isolated" means: (i) amplified in vitro by, for example, polymerase chain reaction (PCR); (ii) recombinantly produced by cloning; (iii) purified, as by cleavage and gel separation; or (iv) synthesized by, for example, chemical synthesis. An isolated nucleic acid is one which is readily manipulable by recombinant DNA techniques well known in the art. Thus, a nucleotide sequence contained in a vector in which 5' and 3' restriction sites are known or for which polymerase chain reaction (PCR) primer sequences have been disclosed is considered isolated but a nucleic acid sequence existing in its native state in its natural host is not. An isolated nucleic acid may be substantially purified, but need not be. For example, a nucleic acid that is isolated within a cloning or expression vector is not pure in that it may comprise only a tiny percentage of the material in the cell in which it resides. Such a nucleic acid is isolated, however, as the term is used herein because it is readily manipulable by standard techniques known to those of ordinary skill in the art.
As used herein with respect to polypeptides, the term "isolated" means separated from its native environment in sufficiently pure form so that it can be manipulated or used for any one of the puφoses of the invention. Thus, isolated means sufficiently pure to be used (i) to raise and/or isolate antibodies, (ii) as a reagent in an assay, or (iii) for sequencing, etc.
According to the invention, isolated TMSl nucleic acid molecules include: (a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule consisting a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:2, SEQ ID NO: 5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24 and SEQ ID NO:26 and which code for a native TMSl polypeptide, (b) deletions, additions and substitutions of (a) which code for an apoptosis-inducing polypeptide, (c) nucleic acid molecules that differ from the nucleic acid molecules of (a) or (b) in codon sequence due to the degeneracy of the genetic code, and (d) complements of (a), (b) or (c). In one embodiment, the nucleotide sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24, while in others it is SEQ ID NO:26. Homologs and alleles of the TMSl nucleic acids of the invention can be identified by conventional techniques. Thus, an aspect of the invention is those nucleic acid sequences which code for TMSl polypeptides and which hybridize to a nucleic acid molecule consisting of the coding region of preferably SEQ ID NO:l, SEQ ID NO:2 or SEQ ID NO:24, or in other embodiments SEQ ID NO:20, SEQ ID NO:22, or in still other embodiments SEQ ID NO:26, and in yet other embodiments SEQ ID NO:5, SEQ ID NO:7 or SEQ ID NO:9, under stringent conditions. The term "stringent conditions" as used herein refers to parameters with which the art is familiar. Nucleic acid hybridization parameters may be found in references which compile such methods, e.g. Molecular Cloning: A Laboratory Manual. J. Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, or Current Protocols in Molecular Biology, F.M. Ausubel, et al., eds., John Wiley & Sons, Inc., New York. More specifically, stringent conditions, as used herein, refers, for example, to hybridization at 65°C in hybridization buffer (3.5 x SSC, 0.02% Ficoll, 0.02% polyvinyl pyrolidone, 0.02% Bovine Serum Albumin, 2.5mM NaH2P04(pH7), 0.5% SDS, 2mM EDTA). SSC is 0.15M sodium chloride/0.15M sodium citrate, pH7; SDS is sodium dodecyl sulphate; and EDTA is ethylenediaminetetracetic acid. After hybridization, the membrane upon which the DNA is transferred is washed at 2x SSC at room temperature and then at O.lx SSC/0.1% SDS at temperatures up to 68°C.
There are other conditions, reagents, and so forth which can be used, and would result in a similar degree of stringency. The skilled artisan will be familiar with such conditions, and thus they are not given here. It will be understood, however, that the skilled artisan will be able to manipulate the conditions in a manner to permit the clear identification of homologs and alleles of TMSl nucleic acids of the invention. The skilled artisan also is familiar with the methodology for screening cells and libraries for expression of such molecules which then are routinely isolated, followed by isolation of the pertinent nucleic acid molecule and sequencing. In general homologs and alleles typically will share at least 75% nucleotide identity to SEQ ID
NO: 1, SEQ ID NO:2 or SEQ ID NO:24, and/or at least 90% amino acid identity to SEQ ID NO:3 or SEQ ID NO:25. Preferably, homologs and alleles will share at least 85% nucleotide identity and/or at least 95%ι amino acid identity and, even more preferably, at least 95% nucleotide identity and/or at least 99%o amino acid identity will be shared. The homoiogy can be calculated using various, publicly available software tools developed by NCBI (Bethesda, Maryland) that can be obtained through the NCBI website on the internet. Exemplary software tools include the BLAST system (available on the internet at the NIH website) using default settings. Pairwise and ClustalW alignments (BLOSUM30 and/or BLOSUM62 matrix settings) as well as Kyte-Doolittle hydropathic analysis can be obtained using the MacVetor sequence analysis software (Oxford Molecular Group). Watson-Crick complements of the foregoing nucleic acids also are embraced by the invention. Homologs and alleles having nucleotide identity as stated above to SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:20, SEQ ID NO:22 or SEQ ID NO:26, or having amino acid identity to SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID N0.21, SEQ ID NO:23 or SEQ ID NO:27 are also embraced by the invention.
In screening for TMSl related genes, such as homologs and alleles of TMSl, a Southern blot may be performed using the foregoing conditions, together with a radioactive probe. After washing the membrane to which the DNA is finally transferred, the membrane can be placed against X-ray film or a phosphoimager plate to detect the radioactive signal.
Given that the TMSl gene is expressed in certain tissues, and given the teachings herein of a full-length human, murine and partial rat TMS 1 cDNA clone, sequences from other mammalian species corresponding to the TMSl gene can be isolated from a cDNA library prepared from one or more of the tissues in which TMSl expression is abundant, using standard colony hybridization techniques.
The invention also includes degenerate nucleic acids which include alternative codons to those present in the native materials. For example, serine residues are encoded by the codons TCA, AGT, TCC, TCG, TCT and AGC. Each of the six codons is equivalent for the puφoses of encoding a serine residue. Thus, it will be apparent to one of ordinary skill in the art that any of the serine-encoding nucleotide triplets may be employed to direct the protein synthesis apparatus, in vitro or in vivo, to incoφorate a serine residue into an elongating TMSl polypeptide. Similarly, nucleotide sequence triplets which encode other amino acid residues include, but are not limited to: CCA, CCC, CCG and CCT (proline codons); CGA, CGC, CGG, CGT, AGA and AGG (arginine codons); ACA, ACC, ACG and ACT (threonine codons); AAC and AAT (asparagine codons); and ATA, ATC and ATT (isoleucine codons). Other amino acid residues may be encoded similarly by multiple nucleotide sequences. Thus, the invention embraces degenerate nucleic acids that differ from the biologically isolated nucleic acids in codon sequence due to the degeneracy of the genetic code. In another aspect, the invention provides a genomic nucleic acid sequence of TMSl (i.e., SEQ
ID NO: 1 ). This sequence contains at least one native regulatory sequence of TMS 1. One such native regulatory sequence or element of TMSl is a CpG island located at nucleotides 1100-1725 of SEQ ID NO:l and surrounding exon 1. The nucleotide sequence of this CpG island is herein referred to as SEQ ID NO:4. In some abnormal cells, CpG islands become methylated at the cytosine residue by a host of methylating enzymes, including methylases and methyltransferases. Methyltransferases are enzymes which add methyl groups from S-adenosyl methionine to bases in DNA strands. This region of SEQ ID NO: l possesses at least one CpG island, the methylation of which induces TMSl silencing. Nucleic acid sequences and expression vectors comprising the CpG island are useful for studying the mechanism of TMSl methylation and identifying methylases or methyltransferases which act upon this CpG island and therapeutic agents which block such methylation. Examples of methylating enzymes capable of CpG methylation include human DNA methyltransferases such as DNMTl (e.g., Accession numbers X63692 and NM 001379; Yen, R.W., NucAcids Res. 20:2287-2291, 1992), DNMT2, DNMT3a and DNMT3a variants, DNMT3b and DNMT3b variants, as well as corresponding murine DNA methyltransferases such as Dnmtl, Dnmt2, Dnmt3a and Dnmt3b (e.g., Accession number U70051 ; Tucker, K.L., Proc.Natl. Acad.Sci.U.S.A. 93: 12920-12925, 1996). The methylation events with which the invention is most concerned are methylation of cytosines, specifically, events leading to the formation of 5-methylcytosine. The genomic sequence (i.e., SEQ ID NO: 1) is useful in elucidating the mechanisms through which TMSl is silenced. The sequence facilitates the identification of (a) methylating agents which target the CpG island, (b) inhibitors of such methylating agents, (c) mutations within the sequence which would render it less susceptible to methylation induced silencing, (d) other regulatory sequences within nucleic acid sequences comprising SEQ ID NO:l which control the transcription or translation of TMS 1 expression products, and (e) factors which bind to such regulatory sequences. Regulatory sequences, other than the CpG islands, which are present within genomic TMSl nucleic acids include, are not limited to, promoters, enhancers and still other repressors sequences. Agents which bind to these sequences can be readily identified using standard nucleic acid binding assays that are well known in the art.
The invention also provides isolated unique fragments of SEQ ID NO:l, SEQ ID NO:2 and SEQ ID NO:24 or complements thereof. A unique fragment is one that is a 'signature' for the larger nucleic acid. For example, the unique fragment is long enough to assure that its precise sequence is not found in molecules within the human genome outside of the TMSl nucleic acids defined above (and human alleles). Those of ordinary skill in the art may apply no more than routine procedures to determine if a fragment is unique within the human genome. Unique fragments, however, exclude fragments completely composed of the nucleotide sequences of any of GenBank accession numbers listed in Table I which were published prior to the priority or filing date of the present invention (see below), or other previously published sequences as of the priority date or filing date of this application.
A fragment which is completely composed of the sequence described in the foregoing GenBank deposits is one which does not include any of the nucleotides unique to the sequences of the invention. Thus, a unique fragment must contain a nucleotide sequence other than the exact sequence of those in GenBank or fragments thereof, provided that the GenBank or fragment sequences were published prior to the priority or filing date of the present application, depending on the sequence disclosed herein. The difference may be an addition, deletion or substitution with respect to all or part of the GenBank sequence or it may be a sequence wholly separate from the GenBank sequence. Unique fragments can be used as probes in Southern and Northern blot assays to identify such nucleic acids, or can be used in amplification assays such as those employing PCR. As known to those skilled in the art, large probes such as 200, 250, 300 or more nucleotides are preferred for certain uses such as Southern and Northern blots, while smaller fragments will be preferred for uses such as PCR. Unique fragments also can be used to produce fusion proteins for generating antibodies or determining binding of the polypeptide fragments or for generating immunoassay components. Likewise, unique fragments can be employed to produce nonfused fragments of the TMSl polypeptides, useful, for example, in the preparation of antibodies, immunoassays or therapeutic applications.
As will be recognized by those skilled in the art, the size of the unique fragment will depend upon its conservancy in the genetic code. Thus, some regions of SEQ ID NO:l, SEQ ID NO:2, or SEQ ID NO:24, or complements thereof will require longer segments to be unique while others will require only short segments, typically between 12 and 32 nucleotides long (e.g. 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 and 32 bases) or more, up to the entire length of the disclosed sequence. As mentioned above, this disclosure intends to embrace each and every fragment of each sequence listed, beginning at the first nucleotide, the second nucleotide and so on, up to 8 nucleotides short of the end, and ending anywhere from nucleotide number 8, 9, 10 and so on for each sequence listed, up to the very last nucleotide, provided the sequence is unique as described above. Taking into account the exclusion described above, virtually any segment of the region of SEQ ID NO:l beginning at nucleotide 1 and ending at nucleotide 2821, or SEQ ID NO:2 beginning at nucleotide 1 and ending at nucleotide 770, or complements thereof, that is 20 or more nucleotides in length will be unique. Those skilled in the art are well versed in methods for selecting such sequences, typically on the basis of the ability of the unique fragment to selectively distinguish the sequence of interest from other sequences in the human genome. Comparison of the fragment to those on known databases typically is all that is necessary, although in vitro confirmatory hybridization and sequencing analysis may be performed. The invention also involves expression vectors coding for TMSl proteins and fragments and variants thereof and host cells containing those expression vectors. Virtually any cells, prokaryotic or eukaryotic, which can be transformed with heterologous DNA or RNA and which can be grown or maintained in culture, may be used in the practice of the invention. Examples include bacterial cells such as E.coli and mammalian cells such as mouse, hamster, pig, goat, primate, etc. They may be of a wide variety of tissue types, including mast cells, fibroblasts, oocytes and lymphocytes, and they may be primary cells or cell lines. Specific examples include CHO cells and COS cells. Cell-free transcription systems also may be used in lieu of cells.
As used herein, a "vector" may be any of a number of nucleic acids into which a desired sequence may be inserted by restriction and ligation for transport between different genetic environments or for expression in a host cell. Vectors are typically composed of DNA although RNA vectors are also available. Vectors include, but are not limited to, plasmids, phagemids and virus genomes. A cloning vector is one which is able to replicate in a host cell, and which is further characterized by one or more endonuclease restriction sites at which the vector may be cut in a determinable fashion and into which a desired DNA sequence may be ligated such that the new recombinant vector retains its ability to replicate in the host cell. In the case of plasmids, replication of the desired sequence may occur many times as the plasmid increases in copy number within the host bacterium or just a single time per host before the host reproduces by mitosis. In the case of phage, replication may occur actively during a lytic phase or passively during a lysogenic phase.
An expression vector is one into which a desired DNA sequence may be inserted by restriction and ligation such that it is operably joined to regulatory sequences and may be expressed as an RNA transcript. Vectors may further contain one or more marker sequences suitable for use in the identification of cells which have or have not been transformed or transfected with the vector. Markers include, for example, genes encoding proteins which increase or decrease either resistance or sensitivity to antibiotics or other compounds, genes which encode enzymes whose activities are detectable by standard assays known in the art (e.g., β-galactosidase or alkaline phosphatase), and genes which visibly affect the phenotype of transformed or transfected cells, hosts, colonies or plaques (e.g., green fluorescent protein). Preferred vectors are those capable of autonomous replication and expression of the structural gene products present in the DNA segments to which they are operably joined.
In aspects involving the native regulatory sequences of TMSl, for example, the CpG island located at nucleotides 1100-1725 of SEQ ID NO: 1 (i.e., SEQ ID NO:4) or the intronic sequences of TMSl, useful expression vectors are those which comprise a reporter coding sequence. Intronic sequences of TMSl correspond to nucleotides 1530-1742 of SEQ ID NO:l (intron 1) and nucleotides 1800-2104 of SEQ ID NO: 1 (intron 2). A reporter coding sequence as used herein refers to at least a marker sequence, the expression of which when it is operably linked to a foreign regulatory sequence reflects the transcriptional function of the foreign sequence. The regulatory potential of such a foreign sequence can be deduced by assaying for the presence of an expression product of the marker sequence. Foreign regulatory sequences which can be tested in this manner include, but are not limited to, promoters, and other elements which although capable of affecting transcriptional levels are not, in and of themselves, sufficient for such transcription. Examples of these latter elements include enhancers and repressor elements. In order to assess the activity of enhancers and repressors, it may be necessary for the reporter coding sequence to consist of a regulatory sequence, such as a minimal promoter element, as well as the requisite marker sequence. Minimal promoter elements have been recognized in the art and include sequences such as a CCAAT box or a TATA sequence. Suitable marker sequences for these puφoses are similar to those described above. As used herein, a marker or coding sequence and regulatory sequences are said to be
"operably" joined when they are covalently linked in such a way as to place the expression or transcription of the coding sequence under the influence or control of the regulatory sequences. If it is desired that the coding sequences be translated into a functional protein, two DNA sequences are said to be operably joined if induction of a promoter in the 5' regulatory sequences results in the transcription of the coding sequence and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region to direct the transcription of the coding sequences, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein. Thus, a promoter region would be operably joined to a coding sequence if the promoter region were capable of effecting transcription of that DNA sequence such that the resulting transcript might be translated into the desired protein or polypeptide.
The precise nature of the regulatory sequences needed for gene expression may vary between species or cell types, but shall in general include, as necessary, 5' non-transcribed and 5' non- translated sequences involved with the initiation of transcription and translation respectively, such as a TATA box, capping sequence, CCAAT sequence, and the like. Especially, such 5 ' non-transcribed regulatory sequences will include a promoter region which includes a promoter sequence for transcriptional control of the operably joined coding sequence. Regulatory sequences may also include enhancer sequences or upstream activator sequences as desired. The vectors of the invention may optionally include 5' leader or signal sequences. The choice and design of an appropriate vector is within the ability and discretion of one of ordinary skill in the art. Expression vectors containing all the necessary elements for expression are commercially available and known to those skilled in the art. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989. Cells are genetically engineered by the introduction into the cells of heterologous nucleic acid, usually DNA, molecules, encoding a TMSl polypeptide or fragment or a variant thereof. The heterologous nucleic acid molecules are placed under operable control of transcriptional elements to permit the expression of the heterologous nucleic acid molecules in the host cell.
Preferred systems for mRNA expression in mammalian cells are those such as pcDNA3.1 (available from Invitrogen, Carlsbad, CA) that contain a selectable marker such as a gene that confers G418 resistance (which facilitates the selection of stably transfected cell lines) and the human cytomegalovirus (CMV) enhancer-promoter sequences. Additionally, suitable for expression in primate or canine cell lines is the pCEP4 vector (Invitrogen, Carlsbad, CA), which contains an Epstein Barr virus (EBV) origin of replication, facilitating the maintenance of plasmid as a multicopy extrachromosomal element. Another expression vector is the pEF-BOS plasmid containing the promoter of polypeptide Elongation Factor lα, which stimulates efficiently transcription in vitro. The plasmid is described by Mishizuma and Nagata (Nuc. Acids Res. 18:5322, 1990), and its use in transfection experiments is disclosed by, for example, Demoulin (Mol. Cell. Biol. 16:4710-4716, 1996). Still another preferred expression vector is an adenovirus, described by Stratford-Perricaudet, which is defective for El and E3 proteins (J. Clin. Invest. 90:626-630, 1992). The use of the adenovirus as an Adeno.PlA recombinant is disclosed by Warnier et al., in intradermal injection in mice for immunization against P1A (Int. J. Cancer, 67:303-310, 1996). The invention also embraces so-called expression kits, which allow the artisan to prepare a desired expression vector or vectors. Such expression kits include at least separate portions of each of the previously discussed coding sequences. Other components may be added, as desired, as long as the previously mentioned sequences, which are required, are included.
It will also be recognized that the invention embraces the use of the above described, TMSl cDNA sequence containing expression vectors, to transfect host cells and cell lines, be these prokaryotic (e.g., E. coli), or eukaryotic (e.g., CHO cells, COS cells, yeast expression systems and recombinant baculovirus expression in insect cells). Especially useful are mammalian cells such as human, mouse, hamster, pig, goat, primate, etc., from a wide variety of tissue types including primary cells and established cell lines. Specific examples include mammalian epithelial cells, fibroblast cells and kidney epithelial cells, either as primary cells or cell lines. Of particularly importance according to some of the embodiments of the invention are cells which can be easily induced to apoptose such as epithelial cells.
The invention also provides isolated polypeptides (including whole proteins and partial proteins), encoded by the foregoing TMS 1 nucleic acids, and include the polypeptides having amino acids sequences selected from the group consisting of SEQ ID NO:3, SEQ ID:21, SEQ ID NO:23, and SEQ ID NO:25 and in some instances, unique fragments thereof. Such polypeptides are useful, for example, alone or as fusion proteins that retain at least one TMSl activity (e.g., apoptosis induction), in the generation of antibodies, as components of an immunoassay, or as a binding partner in a binding assay. Polypeptides can be isolated from biological samples including tissue or cell homogenates, and can also be expressed recombinantly in a variety of prokaryotic and eukaryotic expression systems by constructing an expression vector appropriate to the expression system, introducing the expression vector into the expression system, and isolating the recombinantly expressed protein. Short - polypeptides, including antigenic peptides (such as those presented by MHC molecules on the surface of a cell for immune recognition) also can be synthesized chemically using well-established methods of peptide synthesis.
A unique fragment of a TMSl polypeptide, in general, has the features and characteristics of unique fragments of nucleic acids as discussed above. As will be recognized by those skilled in the art, the size of the unique fragment will depend upon factors such as whether the fragment constitutes a portion of a conserved protein domain. Thus, some regions of SEQ ID NO:3 or SEQ ID NO:24, for example, will require longer segments to be unique while others will require only short segments, typically between 5 and 12 amino acids (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, and 150 amino acids long or more, including each integer from 15 up to the full length, 195 amino acids long). Virtually any segment of, for example, SEQ ID NO:3 that is 9 or more amino acids in length will be unique. A similar rationale applies to the unique fragments of SEQ ID NO:24. Unique fragments of a polypeptide preferably are those fragments which retain at least one distinct functional capability of the native TMSl polypeptide. Functional capabilities which can be retained in a unique fragment of a polypeptide include interaction with antibodies and/or other polypeptides or fragments thereof (including other TMSl polypeptides, or other CARD containing polypeptides, or fragments thereof), as well as, for a subset of unique fragments, the ability to induce apoptosis. One important activity is the ability to act as a signature for identifying the polypeptide. Those skilled in the art are well versed in methods for selecting unique amino acid sequences, typically on the basis of the ability of the unique fragment to selectively distinguish the sequence of interest from non-family members. A comparison of the sequence of the fragment to those in known databases is all that is typically required. Preferably, the unique fragment is unique in humans, i.e., it is long enough to assure that its precise sequence is not found in molecules encoded by the human genome outside of TMSl polypeptides including alleles.
The invention embraces variants of the TMSl polypeptides described above. As used herein, a "variant" of a TMSl polypeptide is a polypeptide which contains one or more modifications to the primary amino acid sequence of a TMSl polypeptide. Modifications which create a TMSl polypeptide variant are typically made to the nucleic acid which encodes the TMSl polypeptide, and can include deletions, point mutations, truncations, amino acid substitutions and addition of amino acids or non-amino acid moieties to: 1) reduce or eliminate an activity of a TMSl polypeptide; 2) enhance a property of a TMSl polypeptide, such as protein stability in an expression system or the stability of protein-protein binding; 3) provide a novel activity or property to a TMSl polypeptide, such as addition of an antigenic epitope or addition of a detectable moiety; or 4) to provide equivalent or better binding to a TMSl polypeptide receptor or other molecule. Alternatively, modifications can be made directly to the polypeptide, such as by cleavage, addition of a linker molecule, addition of a detectable moiety, such as biotin, addition of a fatty acid, and the like. Variants which reduce or eliminate TMSl activity are useful, for example, as experimental tools to study the effects of progressively reduced TMSl expression product levels. Therapeutic tools, on the other hand, might employ variants which provide an enhanced TMSl activity (e.g., enhanced apoptosis induction). Modifications also embrace fusion proteins comprising all or part of the TMSl amino acid sequence.
One of skill in the art will be familiar with methods for predicting the effect on protein conformation of a change in protein sequence, and can thus "design" a variant TMS 1 polypeptide according to known methods. One example of such a method is described by Dahiyat and Mayo in Science 278:82-87, 1997, whereby proteins can be designed de novo. The method can be applied to a known protein to vary only a portion of the polypeptide sequence. By applying the computational methods of Dahiyat and Mayo, specific variants of a TMSl polypeptide can be proposed and tested to determine whether the variant retains a desired conformation.
Variants can include TMSl polypeptides which are modified specifically to alter a feature of the polypeptide unrelated to its physiological activity. For example, cysteine residues can be substituted or deleted to prevent unwanted disulfide linkages. Similarly, certain amino acids can be changed to enhance expression of a TMSl polypeptide by eliminating proteolysis by proteases in an expression system (e.g., dibasic amino acid residues in yeast expression systems in which KEX2 protease activity is present). Mutations of a nucleic acid which encodes a TMSl polypeptide preferably preserve the amino acid reading frame of the coding sequence, and preferably do not create regions in the nucleic acid which are likely to hybridize to form secondary structures, such a haiφins or loops, which can be deleterious to expression of the variant polypeptide.
Mutations can be made by selecting an amino acid substitution, or by random mutagenesis of a selected site in a nucleic acid which encodes the polypeptide. Variant polypeptides are then expressed and tested for one or more activities to determine which mutation provides a variant polypeptide with the desired properties. Further mutations can be made to variants (or to non-variant TMSl polypeptides) which are silent as to the amino acid sequence of the polypeptide, but which provide preferred codons for translation in a particular host. The preferred codons for translation of a nucleic acid in, e.g., E. coli, are well known to those of ordinary skill in the art. Still other mutations can be made to the noncoding sequences of a TMSl gene or cDNA clone to enhance expression of the polypeptide.
The skilled artisan will realize that conservative amino acid substitutions may be made in TMSl polypeptides to provide functionally equivalent variants of the foregoing polypeptides, i.e., the variants retain the functional capabilities of the TMSl polypeptides. As used herein, a "conservative amino acid substitution" refers to an amino acid substitution which does not alter the relative charge or size characteristics of the protein in which the amino acid substitution is made. Variants can be prepared according to methods for altering polypeptide sequence known to one of ordinary skill in the art such as are found in references which compile such methods, e.g. Molecular Cloning: A Laboratory Manual. J. Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, or Current Protocols in Molecular Biology. F.M. Ausubel, et al., eds., John Wiley & Sons, Inc., New York. Exemplary functionally equivalent variants of the TMSl polypeptides include conservative amino acid substitutions of SEQ ID NO:3. Conservative substitutions of amino acids include substitutions made amongst amino acids within the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D. Thus, functionally equivalent variants of TMSl polypeptides, i.e., variants of TMSl polypeptides which retain the function of the natural TMSl polypeptides, are contemplated by the invention. Conservative amino-acid substitutions in the amino acid sequence of TMSl polypeptides to produce functionally equivalent variants of TMSl polypeptides typically are made by alteration of a nucleic acid encoding TMS 1 polypeptides (e.g., SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:22, and SEQ ID NO:24). Such substitutions can be made by a variety of methods known to one of ordinary skill in the art. For example, amino acid substitutions may be made by PCR-directed mutation, site-directed mutagenesis according to the method of Kunkel (Kunkel, Proc. Nat. Acad. Sci. U.S.A. 82: 488-492, 1985), or by chemical synthesis of a nucleic acid molecule encoding a TMSl polypeptide. The activity of functionally equivalent fragments of TMSl polypeptides can be tested by cloning the gene encoding the altered TMSl polypeptide into a bacterial or mammalian expression vector, introducing the vector into an appropriate host cell, expressing the altered TMSl polypeptide, and testing for a functional capability of the TMSl polypeptides as disclosed herein.
The invention as described herein has a number of uses, some of which are described elsewhere herein. First, the invention permits isolation of TMSl nucleic acid molecules which code for a TMSl polypeptide. As described above, nucleic acid isolation can be performed using hybridization under stringent conditions. A second use of the invention is the isolation of TMSl polypeptides, using a variety of methodologies well-known to the skilled practitioner. The TMS 1 polypeptide may be purified from cells which naturally produce it by chromatographic means or immunological recognition. Alternatively, an expression vector which incorporates a coding TMS 1 nucleic acid molecule, such as SEQ ID NO: 1 and perhaps preferably SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24, may be introduced into cells to cause production of the TMSl polypeptide. In still other embodiments, expression vectors which incoφorate SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 or SEQ ID NO:26 may be introduced into cells as well. In another method, mRNA transcripts may be microinjected or otherwise introduced into cells to cause production of the encoded polypeptide. Translation of TMSl mRNA in cell-free extracts such as the reticulocyte lysate system also may be used to produce TMSl polypeptides. Those skilled in the art also can readily follow known methods for isolating TMSl polypeptides. These include, but are not limited to, immunochromatography, HPLC, size-exclusion chromatography, ion-exchange chromatography and immune-affinity chromatography.
The invention further provides efficient methods of identifying agents or lead compounds for agents active at the level of a TMSl or TMSl fragment dependent cellular function. Generally, the screening methods involve assaying for compounds which enhance TMSl activity. Such methods are adaptable to automated, high throughput screening of compounds. The invention provides TMSl -specific binding agents, methods of identifying and making such agents, and their use in diagnosis, therapy and pharmaceutical development. For example, TMSl -specific pharmacological agents are useful in a variety of diagnostic and therapeutic applications, especially where disease or disease prognosis is associated with altered TMSl binding characteristics. Novel TMSl -specific binding agents include TMS 1 -specific antibodies, cell surface receptors, and other natural intracellular binding agents identified with assays such as two hybrid screens, and non-natural intracellular and extracellular binding agents identified in screens of chemical libraries and the like.
Accordingly, the invention also embraces agents that bind to the TMSl polypeptides. One category of such agents is isolated peptide binding agents which, for example, can be antibodies or fragments of antibodies ("binding polypeptides"), having the ability to selectively bind to TMS 1 polypeptides. Antibodies include polyclonal and monoclonal antibodies and can be prepared according to conventional methodology. Such antibodies can be further manipulated to create chimeric or humanized antibodies as will be discussed in greater detail below. Significantly, as is well-known in the art, only a small portion of an antibody molecule, the paratope, is involved in the binding of the antibody to its epitope (see, in general, Clark, W.R. (1986) The Experimental Foundations of Modern Immunology Wiley & Sons, Inc., New York; Roitt, I. (1991) Essential Immunology. 7th Ed., Blackwell Scientific Publications, Oxford). The pFc' and Fc regions, for example, are effectors of the complement cascade but are not involved in antigen binding. An antibody from which the pFc' region has been enzymatically cleaved, or which has been produced without the pFc' region, designated an F(ab')2 fragment, retains both of the antigen binding sites of an intact antibody. Similarly, an antibody from which the Fc region has been enzymatically cleaved, or which has been produced without the Fc region, designated an Fab fragment, retains one of the antigen binding sites of an intact antibody molecule. Proceeding further, Fab fragments consist of a covalently bound antibody light chain and a portion of the antibody heavy chain denoted Fd. The Fd fragments are the major determinant of antibody specificity (a single Fd fragment may be associated with up to ten different light chains without altering antibody specificity) and Fd fragments retain epitope- binding ability in isolation.
Within the antigen-binding portion of an antibody, as is well-known in the art, there are complementarity determining regions (CDRs), which directly interact with the epitope of the antigen, and framework regions (FRs), which maintain the tertiary structure of the paratope (see, in general, Clark, 1986; Roitt, 1991). In both the heavy chain Fd fragment and the light chain of IgG immunoglobulins, there are four framework regions (FR1 through FR4) separated respectively by three complementarity determining regions (CDR1 through CDR3). The CDRs, and in particular the CDR3 regions, and more particularly the heavy chain CDR3, are largely responsible for antibody specificity. It is now well-established in the art that the non-CDR regions of a mammalian antibody may be replaced with similar regions of co-specific or heterospecific antibodies while retaining the epitopic specificity of the original antibody. This is most clearly manifested in the development and use of "humanized" antibodies in which non-human CDRs are covalently joined to human FR and/or Fc/pFc' regions to produce a functional antibody. Thus, for example, PCT International Publication Number WO 92/04381 teaches the production and use of humanized murine RSV antibodies in which at least a portion of the murine FR regions has been replaced by FR regions of human origin. Such antibodies, including fragments of intact antibodies with antigen-binding ability, are often referred to as "chimeric" antibodies. Thus, as will be apparent to one of ordinary skill in the art, the present invention also provides for F(ab')2, Fab, Fv and Fd fragments; chimeric antibodies in which the Fc and/or FR and/or CDRl and/or CDR2 and/or light chain CDR3 regions have been replaced by homologous human or non- human sequences; chimeric F(ab')2 fragment antibodies in which the FR and/or CDRl and/or CDR2 and/or light chain CDR3 regions have been replaced by homologous human or non-human sequences; chimeric Fab fragment antibodies in which the FR and/or CDRl and/or CDR2 and/or light chain
CDR3 regions have been replaced by homologous human or non-human sequences; and chimeric Fd fragment antibodies in which the FR and/or CDRl and/or CDR2 regions have been replaced by homologous human or non-human sequences. The present invention also includes so-called single chain antibodies. Thus, the invention provides a variety of polypeptides of varying size and type that bind specifically to TMS 1 polypeptides, and complexes of both TMS 1 polypeptides and their binding partners. These polypeptides may be derived also from sources other than antibody technology. For example, such polypeptide binding agents can be provided by degenerate peptide libraries which can be readily prepared in solution, in immobilized form, as bacterial flagella peptide display libraries or as phage display libraries. Combinatorial libraries of peptides containing one or more amino acids also can be synthesized. Similarly, libraries of peptides and non-peptide synthetic moieties can be synthesized.
Phage display can be particularly effective in identifying binding peptides useful according to the invention. Briefly, one prepares a phage library (using e.g. ml3, fd, or lambda phage), displaying inserts from 4 to about 80 amino acid residues using conventional procedures. The inserts may represent, for example, a completely degenerate or biased array. One then can select phage-bearing inserts which bind to the TMSl polypeptide or a complex of a TMSl polypeptide and a binding partner. This process can be repeated through several cycles of reselection of phage that bind to the TMSl polypeptide or complex. Repeated rounds lead to enrichment of phage bearing particular sequences. DNA sequence analysis can be performed to identify the sequences of the expressed polypeptides. The minimal linear portion of the sequence that binds to the TMSl polypeptide or complex can be determined. One can repeat the procedure using a biased library containing inserts containing part or all of the minimal linear portion plus one or more additional degenerate residues upstream or downstream thereof. Yeast two-hybrid screening methods also may be used to identify polypeptides that bind to the TMSl polypeptides. Thus, the TMSl polypeptides of the invention, or a fragment thereof, or complexes of TMSl polypeptides and a binding partner can be used to screen peptide libraries, including phage display libraries, to identify and select peptide binding partners of the TMSl polypeptides of the invention. Such molecules can be used, as described, for screening assays, for purification protocols, for interfering directly with the functioning of TMSl polypeptides and for other puφoses apparent to those of ordinary skill in the art. A TMSl polypeptide, or a fragment thereof, also can be used to isolate their native binding partners, according to one aspect of the invention. Isolation of binding partners may be performed according to well-known methods. For example, isolated TMSl polypeptides can be attached to a substrate, and then a solution suspected of containing a TMSl binding partner may be applied to the substrate. If the binding partner for TMSl polypeptides is present in the solution, then it will bind to the substrate-bound TMS 1 polypeptide. The binding partner then may be isolated. Other proteins capable of binding to TMSl polypeptides may be similarly isolated using no more than routine experimentation.
As an example of one such method, the invention provides a method for identifying a TMS 1 polypeptide binding partner. The method involves performing a test binding assay between a TMSl polypeptide and a library member and comparing the extent of binding between the TMS 1 polypeptide and the library member with a control. The control binding assay can be performed using the same environment as the test binding assay but lacking the TMSl molecule. The test binding assay result indicates the extent of binding between the TMSl molecule and the library member. The method further involves comparing the test binding assay result with the control binding assay result. A test binding assay result that is greater than a control binding assay result indicates that the library member is a TMS 1 polypeptide binding partner.
The TMSl polypeptide to be used in the test binding assay will depend upon the type of specific binding partner desired. For example, if a binding partner for the CARD of TMSl polypeptide was desired, polypeptides useful in the test binding assay would preferably be those that comprise a CARD. Even more preferably, the polypeptides may derive from the TMS 1 genomic locus. Examples include polypeptides which comprise an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25. In this latter example, the library member may be pre-selected by prior exposure to polypeptides which lack the CARD such as polypeptides consisting of an amino acid sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:7, and SEQ ID NO:27. This preselection step is most appropriate where the CARD-containing polypeptide used in the test binding assay also includes regions and/or domains of TMSl other than the CARD domain. An agent that is capable of binding to the CARD of TMSl polypeptide is referred to herein as a TMSl CARD binding partner.
As another example, a similar assay can be used to identify binding partners of the N-terminal domain of TMSl (i.e., TMSl N-terminal binding partners). Such assays and terminal domains are an aspect of the present invention. A TMSl N-terminal polypeptide as used herein is a polypeptide that comprises at a minimum the N-terminal domain of TMSl, including either or both exon 1 and exon 2. In preferred embodiments, the TMSl N-terminal polypeptide comprises at a minimum exon 1 from a TMSl nucleic acid molecule. It should be understood that some but not necessarily all TMSl molecules are TMSl N-terminal molecules. In this screening method, a test binding assay is performed between a TMSl N-terminal polypeptide and a library member and compared to a control binding assay. A test binding assay result that is greater than the control binding assay result is indicative of a library member that is a TMSl N-terminal binding partner. The TMSl N-terminal polypeptide preferably has an amino acid sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:27, but is not so limited. In one embodiment, the TMSIΔI 00- 195 construct described in the Examples may be used as a TMSl N-terminal molecule. The TMSl N- terminal polypeptide used in the test binding assay may have an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21 , SEQ ID NO:23 or SEQ ID NO:25. However, in these instances it may be preferably that the control binding assay is performed between a library member and a polypeptide having an amino acid sequence of SEQ ID NO: 10. In this way, library members that are specific for the CARD rather than the N-terminal domain of TMSl can be identified based on the comparison of the test result with the control. Alternatively, the library members may be undergo a round of negative pre-selection in which they are allowed to contact and bind to a polypeptide having an amino acid sequence of SEQ ID NO: 10, prior to exposure to a TMS 1 N- terminal polypeptide. Library members which bind to the CARD of TMSl will be removed and those that bind to the N-terminal domain of TMSl will be enriched.
TMSl N-terminal polypeptides can be used as dominant negative forms of TMSl which potentially bind to wild-type TMSl (e.g., polypeptides having an amino acid sequence comprising SEQ ID NO:3 or SEQ ID NO:25) and thereby prevent the normal interactions of TMSl with naturally occurring TMSl binding partners. Alternatively, the TMSl N-terminal polypeptides may function as dominant negatives by complexing with wild-type TMSl polypeptides and thereby inhibiting their normal function (i.e., apoptosis induction). Accordingly, TMSl N-terminal binding partners can be used to inhibit a potential dominant negative function of TMSl N-terminal polypeptides, if and where this is required for therapeutic benefit. Candidate binding partners are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides, synthetic organic combinatorial libraries, phage display libraries of random peptides, and the like. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural and synthetically produced libraries and compounds can be readily modified through conventional chemical, physical, and biochemical means. Further, known pharmacological agents may be subjected to directed or random chemical modifications such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs of the agents.
The library member may be synthesized or it may be derived from natural sources (e.g., a cell or tissue lysate). In some important embodiments, the TMSl polypeptide binding partner is naturally occurring. Binding partners identified according to the above methods may be further screened for their ability to either inhibit or promote the function of TMSl using apoptosis assay described in the Examples and those known in the art.
An agent that binds TMS 1 polypeptides, such as an antibody, may be conjugated to a detectable label. Conjugation of the agent to a detectable label facilitates, among other things, the use of such agents in diagnostic assays. A detectable label is a moiety, the presence of which can be ascertained directly or indirectly. Generally, detection of the label involves an emission of energy by the label. The label can be detected directly by its ability to emit and/or absorb light of a particular wavelength. A label can be detected indirectly by its ability to bind, recruit and, in some cases, cleave another moiety which itself may emit or absorb light of a particular wavelength. An example of indirect detection is the use of a first enzyme label which cleaves a substrate into visible products. The label may be of a chemical, peptide or nucleic acid nature although it is not so limited. Other detectable labels include radioactive isotopes such as P32 or H3, luminescent markers such as fluorochromes, optical or electron density markers, etc., or epitope tags such as the FLAG epitope or the HA epitope, biotin, avidin and enzyme tags such as horseradish peroxidase, β-galactosidase, etc. A wide variety of assays for binding partners are provided, including, labeled in vitro protein- protein binding assays, electrophoretic mobility shift assays, immunoassays, cell-based assays such as two- or three-hybrid screens, expression assays, etc. For example, two-hybrid screens are used to rapidly examine the effect of transfected nucleic acids on the intracellular binding of TMSl or TMSl fragments to intracellular targets. The transfected nucleic acids can encode, for example, combinatorial peptide libraries or cDNA libraries. Convenient reagents for such assays, e.g., GAL4 fusion proteins, are known in the art. An exemplary cell-based assay involves transfecting a cell with a nucleic acid encoding a TMSl polypeptide fused to a GAL4 DNA binding domain and a nucleic acid encoding a reporter gene operably linked to a gene expression regulatory region, such as one or more GAL4 binding sites. Activation of reporter gene transcription occurs when the TMSl and reporter fusion polypeptides bind such as to enable transcription of the reporter gene. Agents which modulate a TMS 1 polypeptide mediated cell function are then detected through a change in the expression of reporter gene. Methods for determining changes in the expression of a reporter gene are known in the art.
TMS 1 fragments used in the methods, when not produced by a transfected nucleic acid are added to an assay mixture as an isolated polypeptide. TMSl polypeptides preferably are produced recombinantly, although such polypeptides may be isolated from biological extracts. Recombinantly produced TMSl polypeptides include chimeric proteins comprising a fusion of a TMSl protein with another polypeptide, e.g., a polypeptide capable of providing or enhancing protein-protein binding, sequence specific nucleic acid binding (such as GAL4), enhancing stability of the TMSl polypeptide under assay conditions, or providing a detectable moiety, such as green fluorescent protein or Flag epitope.
The invention also provides novel kits which could be used to measure the levels of the nucleic acids of the invention, expression products of the invention, anti-TMSl antibodies, or levels of methylation of genomic TMS 1 nucleic acid molecules. In the case of nucleic acid detection, pairs of primers for amplifying TMSl nucleic acids can be included. The preferred kits would include controls such as known amounts of nucleic acid probes, TMS 1 epitopes (such as TMS 1 expression products), anti-TMSl antibodies, or TMSl genomic nucleic acid molecules with known amounts of methylation, as well as instructions or other printed material. In certain embodiments the printed material can characterize a risk of developing a disorder based upon the outcome of the assay. The reagents may be packaged in containers and/or coated on wells in predetermined amounts, and the kits may include standard materials such as labeled immunological reagents (such as labeled anti-IgG antibodies) and the like. As an example, one kit may contain a packaged polystyrene microtiter plate coated with TMSl protein and a container housing labeled anti-human IgG antibodies. A well of the plate is contacted with, for example, serum, washed and then contacted with the anti-IgG antibody. The label is then detected. Various other kit components are described below in connection with performing the various assays of the invention.
The invention also provides a method for identifying nucleic acid molecules which are transcriptionally down-regulated following methylation. The method first involves overexpressing a methyltransferase molecule in an experimental cell. A differentially expressed molecule can then be identified as one which has a lower level of expression in the experimental cell than in a control. The control can be a cell, a tissue, a lysate of either, or a predetermined quantity of expression products present in a cell which does not overexpress a methyltransferase. Preferably, the control corresponds to the amount of expression products present in a parent cell from which the experimental cell was derived. The differentially expressed molecules are essentially expression products (i.e., mRNA and/or polypeptides) which are differentially expressed in the experimental cell overexpressing a methyltransferase, as compared to a control. The differentially expressed molecule can be identified in a number of ways. If the expression product is a nucleic acid (i.e., an mRNA), then it may be identified using techniques such as subtractive hybridization, differential display or representational difference analysis. Virtually all approaches aimed at identifying differentially expressed transcripts require the conversion of RNA to at least a first strand cDNA. Moreover, since these strategies intend to capture as many difference sequences as possible, some of which may be known and some of which may be novel, a global cDNA synthesis is performed. A global cDNA synthesis is one in which an attempt is made to convert all RNA transcripts to cDNA. One way of doing this involves the reverse- transcription of RNA molecules with an oligo-dT primer, which hybridizes to the polyadenylated tail of RNA transcripts and primes the first strand synthesis reaction. The vast majority of mRNA transcripts are polyadenylated and thus can be captured in this way. In some instances, it is desirable that the proportional representation of mRNA transcripts be maintained through the cDNA synthesis and subsequent amplification. One way of achieving this is to limit the size of the first strand cDNA to about 700 bp. In so doing, the over-representation of shorter transcripts and under-representation of longer sequences, which would normally otherwise occur, is minimized. The first strand synthesis is then followed by the addition of a nucleic acid tract of known sequence onto the 3' end of the first cDNA strand. As an example, a homopolymer dA tract can be added to the 3' end using terminal transferase. At this point, the first strand cDNA having a dT stretch at its 5' end and a dA stretch at its 3' end, can be used as a template for the second cDNA strand using an oligo-dT primer. All subsequent amplifications require only oligo-dT as a primer. cDNA should be amplified equivalently due to their common priming ends. Another approach for synthesizing first strand cDNA involves the use of random hexamers which hybridize to mRNA transcripts with complementary sequences. Subtractive hybridization generally involves the melting, combining and subsequent re- annealing of cDNA pools from a tester population and a driver population. Usually, when the aim of the subtractive hybridization is to identify a transcript which is expressed, the tester population is the population which expresses the transcript and the driver is the population which does not. In the present invention, the aim is to identify transcripts which as a result of methylation at the genomic level are down-regulated or silenced, the tester will be the population which expresses the transcript, i.e., the control, and the driver will be the experimental cell overexpressing the methyltransferase. Driver cDNA is generally used in vast excess as compared to tester cDNA, in order to effect as much of a subtraction as possible. In some instances, it is desirable to self-subtract each population (i.e., the tester and the driver) prior to performing the subtraction. This serves to remove as many of the common, sometimes called housekeeping, genes which represent in some cell types the vast majority of transcripts. It is also desirable to convert each population into a single stranded form and to use these single stranded forms for the hybridization. The driver population commonly carries a marker which allows it to be removed after the hybridization, such as a biotin molecule. Biotin molecules can be easily added to nucleic acid using photobiotinylation as described by Barr et al. in Anal Biochem 186:369-373, 1990. The single stranded tester and biotinylated driver are then combined and allowed to hybridize under suitable salt and temperature conditions. Once annealing is complete, streptavidin is added and the entire mixture is phenol extracted. The phenol extraction serves to remove any nucleic acids to which the streptavidin has bound, including pure driver sequences and driver/tester hybrids. Ideally, the only nucleic acid sequences which remain in the aqueous phase are those which are expressed by the tester and not the driver populations. However, this is rarely accomplished with only one round of subtraction, and as a result, several rounds of subtraction must be performed to arrive at true difference sequences. A modification of this technique described by Diatchenko et al. and called suppression subtractive hybridization, incorporates a normalization step to equalize cDNA abundance, and thereby reportedly requires only one cycle of hybridization. (Methods Enzymol 303:349-380, 1999) This latter approach was reported to increase the probability of obtaining low-abundance differentially expressed cDNA, a feature which may be desirable in the method of the invention, particularly if the gene which is silenced due to methylation is not expressed at high levels in the control. Difference sequences so identified can then be cloned, amplified, sequenced and used to isolate full-length transcripts.
Still other modifications of a basic subtractive hybridization have been reported. One of these includes the use of covalent bonding between specific complementary nucleotides. This approach, described by Ying and Lin in Biotechniques 26:966-8, 1999, chemically carboxylates pyrimidines in the driver population in order to achieve covalent affinity to the purines of the tester DNA. Still other methods aim to directly clone a full length differentially expressed sequence using multiple rounds of long-distance PCR, combined with a magnetic bead based subtraction. (Zhao et al., J Biotechnol 73:35-41, 1999) The experimentation required to achieve the foregoing is well within the realm of the ordinary artisan, and is reviewed by Blumberg and Belmonte in Methods Mol Biol 97:555-574, 1999.
Another important method in the analysis of differentially expressed transcripts is RDA. RDA was developed as a PCR-based subtraction method for cloning the 'difference' between two complex genomes. The technique has been adapted as a method to clone the differences between mRNA pools. Briefly, mRNA is converted to double stranded cDNA which is then digested with a four-base cutter like DpnII. With an average cutting length of -250 base pairs, most cDNA species will have at least one amplifiable fragment. Adapters are ligated to the digested cDNA and 'tester' (i.e., the control untreated cells) and 'driver' (i.e., DNMT overexpressing cells) cDNA pools are amplified using primers specific for the adapter. After removal of the adapter by re-digestion with DpnII, a second adapter is added only to the tester DNA. By using an unphosphorylated adapter only the top 24-mer is ligated to the 5' phosphate of the digested DNA. Tester and driver amplicons are then mixed, melted and reannealed using an excess of driver DNA. After filling in the overhangs, the resulting hybrids are then amplified using a primer specific for the adapter sequence present only on tester DNA. Whereas driveπdriver hybrids will not amplify and tester:driver hybrids (i.e., sequences common between driver and tester pools) amplify linearly, testeπtester hybrids (i.e., those messages present only in the control cell population) will be amplified exponentially. By then subjecting the difference product to 1-2 further rounds of subtraction with successively higher driver:tester ratios, an enrichment for sequences present only in the tester population is achieved. Final difference products are then subcloned and sequenced. The RDA technique has been successfully applied by others to the isolation of target genes of transcriptional activators and differentially expressed genes during organ development.
The cloned difference products resulting from RDA are then used as probes on Northern blots to confirm down-regulation of expression resulting from DNMT overexpression. As a control, newly transfected or infected experimental cells are prepared along with their normal, control (i.e., untransfected, uninfected, or mock transfected or mock infected) counteφarts. Expression of the newly identified difference clone is studied by Northern blot analysis using the subcloned difference product as the probe or by reverse transcriptase PCR using primers designed from sequence analysis of the difference product. Of particular interest are those genes that are specifically down-regulated as a result of overexpression of DNMT. Those difference products representing mRNAs that are consistently down-regulated in response to DNMT overexpression in independently generated experimental cells are reasonable candidates.
Sequences isolated in this manner that display DNMT-dependent silencing are then sequenced and compared to the GenBank non-redundant and EST databases using the BLAST algorithm. Subclones derived from the RDA technique will be small (200-300bp) and could be derived from any part of the mRNA (i.e., the 3' end). Consequently, sequences may lie quite far on a genomic scale from the potential promoter and CpG island. Since CpG islands often surround exon 1 (for example, the CpG island of the TMSl genomic locus), isolation of the 5' end of the cDNA will allow analysis of the methylation status of the CpG island.
If the database search reveals a known gene, cDNA clones and genomic promoter region clones/sequence information are likely to be available. If a novel gene is isolated, the 5' end of the corresponding cDNA is isolated using a variation of 5' RACE (rapid amplification of cDNA ends) developed and commercially available from Clontech. This procedure can be used to amplify the 5' end of the differentially expressed cDNAs from the 'tester' cDNA pool (i.e., the cDNA pool from which it was isolated ). Briefly, using the same full length oligo-dT primed double-stranded cDNA that was used to generate the 'tester' cDNA amplicon, a blunt-ended double-stranded adapter is ligated to either end without prior restriction such that the cDNA remains 'full-length'. Finally, a primer derived from the isolated sequence is paired with a primer specific to the adapter to yield either a product extending to the 5' or 3' end of the cDNA which can be distinguished based on the inclusion of the poly(A) tail in the 3' end product. Amplified product containing the 5' end is then subcloned.
Another commonly used technique includes differential display, which involves the amplification of two cDNA pools using arbitrary primers and visual comparison of the amplified pools in toto after separation on polyacrylamide gels. Although this technique is relatively simple to perform and somewhat less time consuming than RDA, the addition of a 'subtractive' component in the RDA technique greatly enriches for differentially expressed products and reduces the risk of false positives, a common pitfall of the differential display technique.
Another important technique for identifying differentially expressed transcripts involves DNA chip technology and cDNA microarray hybridization. This technique is gaining wide acceptance in the art due to its ability to analyze hundreds if not thousands of coding sequences at a time. Standard and custom-made DNA chips are now commercially available from manufacturers such as Affymetrix and InCyte. These approaches have evolved to the extent that high throughput screening for difference sequences can be readily accomplished. (Von Stein, et al., Nucleic Acids Res 25:2598-602, 1997; Carulli, et al., J Cell Biochem Suppl 30-31 :286-96, 1998)
If the expression product is a polypeptide, then it may be identified using, for example, gel electrophoresis separation followed by Coomassie Blue staining. In this latter approach, differences between the experimental cell and a control may be revealed by the presence or absence of stained protein bands. Further separation, sequencing and cloning of these "difference band" would then be required, all of which are within the realm of the ordinary artisan.
The methyltransferase molecule may be a nucleic acid molecule or a polypeptide, as long as sufficient and sustained levels of methyltransferase activity can be effected in the experimental cell. Methyltransferase activity as used herein refers to the ability to methylate nucleic acid residues, particularly cytosines. Any type of methyltransferase can be used provided it is able to methylate cytosine residues in the experimental cell. Examples of methyltransferases useful in the invention include human DNA methyltransferases such as DNMTl, DNMT2, DNMT3a and variants thereof, and DNMT3b and variants thereof, as well as murine DNA methyltransferases such as Dnmtl , Dnmt2, Dnmt3a and Dnmt3b.
The experimental cell can be chosen from any number of cells, including primary cells and established cell lines. The use of established cell lines is more convenient in some instances. Examples of suitable experimental cells are epithelial cells and fibroblasts. In an important embodiment, the experimental cell is an SV40 immortalized version of a fibroblast cell line such as IMR90, which has been engineered to overexpress a DNA methyltransferase nucleic acid. Where primary cells are used, a breast epithelial cell or a fibroblast are suitable choices. The control cell is usually the non-DNMT expressing version of the experimental cell. As an example, if the experimental cell is an SV40 immortalized version of IMR90 overexpressing DNMT, the control would be an untreated SV40 immortalized version of IMR90 cells. SV40 immortalized versions of IMR90 cells are available from the National Institute on Aging Mutant Cell Repository (AG02804C). The DNA methyltransferase (DNMT) nucleic acid can be introduced into experimental cells in any number of ways including calcium phosphate transfection, DEAE transfection, Lipofectamine® transfection, as well as infection methods using retro- or adenoviruses as an example. Suitable promoters for the constitutive expression of a coding sequence in a mammalian cell include the retro viral promoters contained in long-terminal repeats and the promoter and enhancer elements of CMV. The DNA methyltransferase can be constitutively overexpressed in the experimental cell as a result of being operably linked to a constitutive promoter. A preferred method for generating cells which overexpress DNMT is described in more detail in Vertino, P.M. et al., Mol.Cell Biol. 16:4555- 4565, 1996. Alternatively, DNMT can be inducibly expressed through the use of inducible systems which are commercially available. Examples of inducible expression systems include zinc-inducible metallothionein promoters, tetracycline-inducible promoters and tetracycline-sensitive transcriptional repressors, RU 486-inducible promoters, ecdysone-inducible promoters and FK506 inducible promoters together with new rapamycin analogues
The invention also provides a number of diagnostic and therapeutic methods and tools relating to disorders broadly characterized by decreased or absent TMSl activity such as apoptotic induction activity. Such disorders can result from a decrease or an absence of TMSl expression products, or a mutation in TMSl nucleic acid molecules which thereby encode a mutant rather than wild-type TMSl polypeptide. As used herein, a TMS 1 expression product is meant to embrace TMS 1 mRNA and
TMSl polypeptides. A particular subset of such disorders are characterized by, or associated with, an abnormal methylation of CpG island containing TMSl nucleic acid molecules. CpG island containing TMSl nucleic acid molecules are defined as those nucleic acid molecules inherently integrated in the genome of the subject. That is, CpG island containing TMSl nucleic acid molecules represent the genomic TMS 1 nucleic acid molecule. In some instances, the CpG island containing molecules also encode a TMSl polypeptide. The CpG island region of TMSl (i.e., SEQ ID NO:4) or fragments thereof could also be used to study methylation patterns apart from any coding region contained therein. Thus, the disorder is defined as the presence of a cell or a tissue which, compared to a normal cell population, exhibits increased methylation of the genomic locus of TMSl, decreased levels of TMS 1 expression products and/or the presence of TMS 1 nucleic acid or polypeptide mutants, including dominant negative mutants. As used throughout this specification, decreased levels, of for example expression, intend to encompass a complete absence of, or a reduction relative to normal. A subset of these disorders is defined as those in which the nucleotide sequence of SEQ ID NO: 1 , particularly the CpG island located at nucleotides 1100- 1725, is methylated to a greater extent than that which is observed in normal tissue counterparts. Thus, the invention seeks to diagnose and treat, prophylactically and/or therapeutical ly, disorders characterized by abnormal levels of TMSl expression products or abnormal levels of methylation. Within an otherwise CpG-poor, heavily methylated genome, about one half of human genes are characterized by unmethylated, CpG-dense islands. (Bird, A.P., Nature 321, 209-213, 1986) A "normal" level, as used herein in reference to the level of TMSl expression, TMSl polypeptide, or TMSl methylation, may be a level in a control population, which preferably includes subjects having similar characteristics as the treated individual, such as age and sex. The "normal" level can also be a range, for example, where a population is used to obtain a baseline range for a particular group into which the subject falls. Thus, the "normal" value can depend upon a particular population selected. Preferably, the normal levels are those of apparently healthy subjects who have no prior history of methylation- or TMSl-mediated disorders. More preferably, the normal level is that level in a tissue of a normal subject corresponding to the tissue sampled for the test subject. In other instances, the normal levels can also be determined by measuring expression, translation and/or methylation levels in a sample of normal tissue adjacent to the suspected diseased tissue in the subject. As an example, breast tumors are, in some cases, sufficiently delineated to the extent that such tissue can be distinguished from the surrounding normal breast tissue. This delineation facilitates selective removal of diseased breast tissue, such as occurs in non-radical mastectomies (e.g., lumpectomy). Similarly, such delineation can be used in the present invention to harvest both suspected diseased tissue and normal tissue from a given subject. Such normal levels, then can be established as preselected values, taking into account the category in which an individual falls. Appropriate ranges and categories can be selected with no more than routine experimentation by those of ordinary skill in the art. Either the mean or another preselected number within the range can be established as the normal preselected value.
Abnormally low levels of a TMSl molecule are defined as levels lower than those observed in a control population itself defined as a normal as described herein. The control is preferably a tissue which corresponds to the tissue analyzed in the subject at risk or the subject having the disorder. Thus, as an example, if the subject is at risk of developing a breast tumor, then the control is preferably breast tissue from a normal subject, or more specifically levels of TMSl molecules in breast tissue from normal subjects. The TMS 1 molecules may be administered directly to a tissue, particularly one which is at risk of developing a tumor. By native TMSl nucleic acid molecules is meant a subset of TMSl nucleic acid molecules which are naturally occurring in a cell or tissue. Naturally occurring means those present or coded for in the genome of a cell which has not been the recipient of gene transfer by transfection, transformation, electroporation or any other gene transfer method known in the art. Preferably, the disorder being diagnosed or treated is a proliferative disorder such as cancer.
A cancer is defined as an uncontrolled, abnormal growth of cells, which can either remain localized or may disseminate throughout the body via the bloodstream or the lymphatic system, and thereby seed a secondary site (i.e., a metastasis). Diagnosis and treatment as used herein are directed to a cancer at its primary site and/or at a metastatic site. Examples of cancers to be diagnosed or treated include: biliary tract cancer; brain cancer, including glioblastomas and medulloblastomas; breast cancer; cervical cancer; choriocarcinoma; colon cancer; endometrial cancer; esophageal cancer; gastric cancer; hematological neoplasms, including acute lymphocytic and myelogenous leukemia; chronic lymphocytic and myelogenous leukemia, multiple myeloma; AIDS associated leukemias and adult T- cell leukemia lymphoma; intraepithelial neoplasms, including Bowen's disease and Paget's disease; liver cancer; lung cancer; lymphomas, including Hodgkin's disease and lymphocytic lymphomas; neuroblastomas; oral cancer, including squamous cell carcinoma; ovarian cancer, including those arising from epithelial cells, stromal cells, germ cells and mesenchymal cells; pancreas cancer; prostate cancer; colorectal cancer; sarcomas, including leiomyosarcoma, rhabdomyosarcoma, liposarcoma, fibrosarcoma and osteosarcoma; skin cancer, including melanoma, Kaposi's sarcoma, basocellular cancer and squamous cell cancer; testicular cancer, including germinal tumors (seminoma, non-seminoma teratomas and choriocarcinomas), stromal tumors and germ cell tumors; thyroid cancer, including thyroid adenocarcinoma and medullar carcinoma; and renal cancer including adenocarcinoma and Wilms' tumor. Preferably, the invention seeks to diagnose and treat breast cancer, cervical cancer, leukemia, ovarian cancer and prostate cancer. Even more preferably, the invention is directed at breast cancer. In one aspect, the invention is directed to a method for identifying a subject at risk of developing a disorder, such as a tumor, characterized by methylation of a CpG island containing TMSl nucleic acid molecule. The method involves determining a level of methylation of a CpG island containing TMSl nucleic acid molecule and comparing such level of methylation to a control. The CpG island containing TMS 1 nucleic acid molecule, in this embodiment, is selected from the group consisting of (a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule consisting of SEQ ID NO:4 (i.e., nucleotides 1100-1725 of SEQ ID NO: l) and which code for a native TMSl polypeptide, and (b) complements of (a). According to this method, an increase in the level of methylation of the CpG island containing TMSl nucleic acid molecules in the biological sample compared to the control identifies a subject at risk of developing, for example, the tumor. Subjects having a disorder characterized by methylation of a CpG island containing TMSl nucleic acid molecule can also be identified using a similar approach.
The level of methylation of a CpG island can be determined using a number of techniques available in the art. These include methylation-sensitive restriction analysis, methylation-specific polymerase chain reaction (MSP), sequencing of bisulfite-modified DNA, Ms-SnuPE, and COBRA. Methylation-sensitive restriction analysis is derived from the existence in nature of restriction enzymes which are methylation sensitive (i.e., these enzymes do not recognize restriction sites which contain methylated residues). For example, the restriction enzyme Notl recognizes the sequence containing 2 'CG' dinucleotides. If either of the CG sites is methylated, the enzyme will not digest DNA. This fact has been heavily utilized in the analysis of DNA methylation in genomic DNA. In this approach, DNA is digested with a methylation-sensitive restriction enzyme and then electrophoresed on an agarose gel which separates DNA based on its size. The DNA is then transferred to a membrane and hybridized to a radiolabeled probe, as is routinely done in a Southern analysis. Based on the sizes of the bands which hybridize to the probe, the digested, and therefore unmethylated, DNA can be distinguished from the undigested, and therefore methylated, DNA. Other methylation-sensitive enzymes include SacII, Eagl, Smal, Thai, Hpall, all of which are commercially available.
Another method useful for measuring methylation status of a nucleic acid is methylation specific PCR (i.e., MSP) which is disclosed in USP 5,786,146. This method is based on the differential reactivity of cytosine and 5-methylcytosine with sodium bisulfite. In the presence of sodium bisulfite, cytosines are deaminated to uracils and 5-methylcytosines remain as cytosines. Primers used to amplify such bisulfite treated nucleic acid molecules are able to hybridize specifically either to the 'unmethylated' or the 'methylated sequences. A multitude of parallel PCR reactions can be performed and analyzed on a gel simultaneously. Reaction vessels contain either methylation specific primers or primers specific for the unmethylated sequence, and thus an amplified product is formed only if the appropriate primers are present. It is preferred that two reactions are performed for each sample, one with methylation specific primers, and one with non-methylation specific primers. This technique allows the methylation status of virtually any CG dinucleotide to be known. Moreover, it requires minute amounts of DNA, on the order of nanograms or less. The nucleotide sequence of SEQ ID NO: 1 can be used to design appropriate primers for use in this technique.
Genomic sequencing of bisulfite modified DNA is another method for determining methylation level of TMSl genomic DNA. Like the methods described above, this method is also based on the differential reactivity of cytosine and 5-methylcytosine with sodium bisulfite. In this approach however, primers are designed to avoid potential methylation sites (e.g., CG dinucleotides) and a non-specific PCR is performed in order to amplify all alleles equally. Following amplification, the PCR product is sequenced directly, or can be subcloned into a plasmid and individual subclones sequenced. The sequence of amplified products is compared to that of non-bisulfite treated DNA. CG dinucleotides present in the non-bisulfite treated sample that read as TG as a result of bisulfite treatment were unmethylated in the original sample, while those which continue to read as CG even after bisulfite treatment were originally methylated. This approach is quantitative to the extent that it provides an absolute number of methylated residues in a particular nucleic acid sequence. COBRA is a quantitative technique described by Xiong and Laird for determining DNA methylation levels at specific genetic loci in small amounts of genomic DNA. (Nucleic Acids Res 25:2532-4, 1997) The technique uses restriction enzyme digestion to reveal methylation-dependent sequence differences in PCR products of sodium bisulfite-treated DNA. Xiong and Laird reported that methylation levels in a original DNA sample are represented by the relative amounts of digested and undigested PCR product. This ratio has been shown to be linearly quantitative over a broad range of DNA methylation levels. The method has also been applied to DNA sample harvested from microdissected paraffin-embedded tissue samples, thus facilitating the analysis of tissue from a subject by eliminating the need for immediate processing of such samples.
Ms-SNuPE has been reported by Gonzalgo and Jones as a method for rapid quantitation of altered methylation patterns at specific sites, particularly CpG sites, in the genome. (Nucl. Acids Res. 25:2529-31, 1997) The approach relies on methylation sensitive single nucleotide primer extension and involves bisulfite treatment of DNA followed by single nucleotide primer extension. It does not involve restriction enzyme analysis. Briefly, genomic DNA is first reacted with sodium bisulfite to convert unmethylated cytosine to uracil without modification of 5-methylcytosine, as in other approaches described above. The bisulfite treated DNA is then amplified using PCR primers specific for bisulfite-converted DNA. The amplified product is then used as a template for methylation analysis at the CpG site(s) of interest. The method is amenable to the analysis of small amounts of DNA. Like MSP, bisulfite sequencing, COBRA and most all other PCR based strategies, Ms-SNuPE can be used in the analysis of microdissected pathology sections.
Cytosine methylation can also be measured using a approach which combines automated genomic DNA sequencing and GENESCAN analysis. This approach has been reported by Paul and Clark in Biotechniques 21: 126-133, 1996. Similarly to the aforementioned approaches, this technique requires bisulfite treatment and PCR amplification of DNA. Cloning and sequencing of the modified and amplified products is then performed to determine the methylation of individual DNA molecules. The sequencing of the entire population of amplified products provides the average methylation status over the population, and thus may not be appropriate if the methylation status of individual molecules is desired. By employing fluorescence-based automated genomic sequencing, Paul and Clark were able to directly quantitate methylation status of any cytosine residue in a DNA molecule. The technique involves sequencing only.cytosine and thymine residues of modified and amplified DNA and using fluorescent dyes to identify and visualize signals from these residues. GENESCAN analysis is then performed to estimate methylation at every cytosine in a rapid and accurate manner. The approach permits a rapid overview of DNA methylation profiles for a number of DNA molecules. Yet another approach for quantitating genomic methylation was reported by McGrew and Rosenthal and involves the use of ligation-mediated PCR. (Biotechniques 15:722-9, 1993) This technique, like others described herein, is particularly suited to the measurement of CpG methylation. It involves the measurement of conversion of large genomic DNA fragments to shorter DNA fragments as a function of demethylation. The cleavage of large genomic DNA is accomplished using pairs of non-isoschizometic enzymes, one of which is methylation specific. The digestion products are then amplified with ligation-mediated, radiolabeled PCR, and used as a measure of cleavage with the methylation sensitive restriction enzyme. Specifically, the ratio of the two amplified fragments is related to the degree of methylation at the particular restriction site. Internal control of the amplification reaction confers the quantitative aspect of the approach.
The biological sample can be a tissue or a biological fluid. The term tissue as used herein refers to both localized and disseminated cell populations including brain, heart, serum, breast, colon, bladder, uterus, prostate, stomach, testis, ovary, pancreas, pituitary gland, adrenal gland, thyroid gland, salivary gland, mammary gland, kidney, liver, intestine, spleen, thymus, bone marrow, blood, trachea, and lung. In certain embodiments, test samples originate from colon, breast and prostate tissues.
Biological fluids include saliva and urine, but are not so limited. In preferred embodiments, the tissue is breast tissue. Both invasive and non-invasive techniques can be used to obtain such samples and are well documented in the art.
As described herein, the level of methylation of a CpG island containing TMSl nucleic acid molecule present in the biological sample is compared to a control. The control in some embodiments, is a normal tissue from a normal subject. In certain embodiments, the control is normal tissue from a subject having the disorder. As an example, the control may be normal breast tissue from a subject having breast cancer.
In another aspect, the invention provides a method for determining a risk of developing a disorder characterized by methylation of a CpG island containing TMS 1 nucleic acid molecule. The method involves measuring a level of a TMSl expression product (e.g., an expression product of a CpG island containing TMS 1 nucleic acid molecule) in a biological sample by contacting the biological sample isolated from a subject with an agent that selectively binds to a TMS 1 expression product. The TMSl expression product can be a nucleic acid expression product which hybridizes under stringent conditions to a complement of a molecule comprising a nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:24, for example, and which codes for a native TMSl polypeptide. Such nucleic acid expression products include mRNA species and 2nd strand cDNA species synthesized from the mRNA. The TMSl expression product can also be a polypeptide expression product, or a fragment thereof, of the TMSl nucleic acid expression products. The level of interaction between the agent and the TMSl expression product is determined and compared with a control. If the level of
TMSl nucleic acid expression products is being measured, such a determination can be carried out via any standard nucleic acid determination assay, including the polymerase chain reaction, or assaying with labeled hybridization probes, as in a Northern analysis. In these latter embodiments, the agent is preferably a nucleic acid molecule. If the level of TMSl polypeptide expression products is being measured, such a determination can be carried out via any standard immunological assay using, for example, polyclonal or monoclonal antibodies or antisera which bind to the secreted TMSl protein. In these latter embodiments, the agent is preferably a peptide, such as an antibody or antibody fragment, but it is not so limited. A decrease in the level of interaction between the agent and the target expression product in the biological sample compared to the control indicates a risk of developing the disorder. A control can include a known amount of a nucleic acid probe or a TMSl epitope (such as a
TMSl expression product). In preferred embodiments the control is a similar tissue sample from a subject with a control or 'normal' level of TMSl expression, or with a control or normal level of methylation in the TMSl locus.
It should be understood that the invention intends to embrace similar approaches for determining the risk of developing, or identifying subjects at risk of developing, a disorder characterized by abnormally low levels of TMSl expression products.
Alternatively, the invention embraces a method of diagnosing in a subject a disorder characterized by the presence of a mutant TMSl molecule. A TMSl molecule as used herein includes a nucleic acid molecule and a polypeptide. Thus a mutant TMSl molecule may be a mutant TMSl nucleic acid molecule, which in turn encompasses both genomic and cDNA TMSl nucleic acid molecules, or alternatively, it may be a mutant TMS 1 polypeptide or a fragment thereof. The method involves (a) characterizing TMSl molecules in a biological sample and (b) comparing the TMSl molecules of the biological sample to TMSl molecules of a control. An observed alteration or match, as the case may be, in a TMSl molecule in the biological sample as compared to TMSl molecules in the control, is indicative of a disorder characterized by the presence of a mutant TMSl molecule.
Preferably, the mutant TMSl molecules are defined as those which account for a diminished or absent native TMSl activity (e.g., apoptosis induction).
In some embodiments, the control may contain wild-type TMSl molecules, while in others, it may contain mutant TMS 1 molecules. By observed "alteration", it is meant that a TMS 1 molecule in the biological sample is different from the normal TMSl molecule contained in the normal control. Alternatively, an observed "match" occurs when the TMSl molecule in the biological sample is identical to a mutant TMSl sequence in a mutant control. Appropriate differences and/or matches in the sequences can be determined with no more than routine experimentation by those of ordinary skill in the art. As used herein, a subject is a human, non-human primate, cow, horse, pig, sheep, goat, dog, cat or rodent. In all embodiments, human subjects are preferred.
The invention provides various methods for the treatment of subjects having a variety of disorders. As used herein, the term "treat" encompasses both prophylactic and therapeutic treatment, and it embraces the prevention of disorders, inhibition and/or amelioration of pre-existing disorders. The subject may be at risk of developing a disorder, or alternatively, the subject may have such a disorder. Thus, a treatment may reduce or eliminate a disorder altogether or prevent it from becoming worse.
The invention provides prophylactic and therapeutic methods for increasing levels of TMSl nucleic acid molecules and/or their expression products. Expression products as used herein is intended to embrace both transcriptional expression products (i.e., RNA species) and translational expression products (i.e., peptides and polypeptides).
The invention, in one aspect, embraces the treatment of subjects that express abnormal levels of TMSl expression products in a tissue or a cell, preferably the tissue or cell suspected of having the disorder. Although not intending to be bound by any particular theory, it is postulated that down- modulation or absence of TMSl polypeptides results in or predisposes a malignant phenotype to a cell. The abnormal levels of TMS 1 expression products can be the result of, among other things, abnormal, preferably increased, methylation of the TMSl genomic locus, and/or production of mutant rather than wild-type TMS 1 expression products. Mutations to TMS 1 nucleic acid molecules or polypeptides which prohibit normal functioning of the polypeptide can also serve to cause or predispose a malignant phenotype to a cell.
In one aspect, the invention provides a method for treating a subject having, or at risk of developing, a disorder characterized by abnormal methylation of a CpG island containing TMSl nucleic acid molecule. According to the method, a subject at risk of developing is administered a demethylating agent in an amount effective to maintain a normal level of methylation in a CpG island containing TMSl nucleic acid molecule in a tissue of the subject. In embodiments involving the treatment of subjects having the disorder, the effective amount is that amount required to reduce the level of methylation, preferably to normal or to below normal levels.
A demethylating agent is agent which directly or indirectly causes a reduction in the level of methylation of a nucleic acid molecule. Demethylating agents include inhibitors of methylating enzymes such as methylases and methyltransferases. Examples of demethylating agents useful in the invention include 5-azacytidine, 5-aza-2'deoxycytidine (also known as Decitabine in Europe), 5, 6- dihydro-5-azacytidine, 5, 6-dihydro-5-aza-2'deoxycytidine, 5-fluorocytidine, 5-fluoro- 2'deoxycytidine, and short oligonucleotides containing 5-aza-2'deoxycytosine, 5, 6-dihydro-5-aza- 2'deoxycytosine, and 5-fluoro-2'deoxycytosine. All of the foregoing agents act as DNA methyltransferase inhibitors. Agents like these, such as the derivatives mentioned, are most effective if capable of being incoφorated into a nucleic acid, preferably, DNA. Other agents reported to inhibit DNA methyltransferases and/or cause demethylation in vitro include procanamide and S-adenosyl homocysteine. Several candidate small molecule demethylating agents, including inhibitors of methyltransferase, which do not require nucleic acid incoφoration to manifest their effects, are currently being developed. Preferably, the demethylating agent is an agent which is inherently specific for a particular tissue or tumor type or alternatively, the agent is one which is modified in such a manner to achieve the desired specificity. These latter modifications may include the coupling of the agent to a cell- specific or tissue-specific targeting moiety, as described herein. In still a further embodiment, the demethylating agent may be coupled to a nucleic acid molecule which is specific for the TMSl genomic locus. Such a targeting nucleic acid molecule can be a nucleic acid molecule which hybridizes under stringent conditions to a complement of a molecule consisting of SEQ ID NO: 1 , or it may be a complement of such a molecule.
The demethylating agent may be administered to a tissue at risk of developing or already having the disorder. In some important embodiments, the disorder is a cancer, such as tumor. Such tissues are preferably selected from breast tissue, prostate tissue, ovarian tissue, cervical tissue and bone marrow.
The prophylactic method may further comprise, in another embodiment, the selection of a subject at risk of developing a disorder prior to the administration of the demethylating agent. Such a subject may be identified using the diagnostic methods provided herein. Namely, a subject at risk may be one who exhibits an abnormal level of TMS 1 expression products or one who exhibits an abnormal level of methylation in the TMSl genomic locus. Preferably, subjects to be administered a demethylating agent are selected on the basis of an abnormal level of methylation in the TMSl genomic locus. Other subjects at risk of developing such a disorder may be those with a family history of such disorders. As an example, subjects with a family history of breast cancer and/or abnormal TMSl methylation may be considered subjects for prophylactic treatment regardless of whether the TMSl genomic locus in the specific subject is methylated. Similarly, when used therapeutically, the method may also involve the prior selection of a subject having the disorder, either using the diagnostic methods described herein, or other procedures known in the art. For example, subjects intended to be treated according to the present invention include those diagnosed with breast cancer. This diagnosis may use the methods described herein, including the analysis of the level of methylation of TMSl nucleic acid molecules or the level of TMSl expression products. Alternatively, the subject may be diagnosed according to well known procedures such as mammography and cytological analysis following biopsy. Regardless of the form of diagnosis, the subject is intended to be treated for such a disorder according to the methods of the invention.
In another aspect, the invention provides a method for treating a subject having or at risk of developing, a disorder, perhaps in a tissue, characterized by abnormally low levels of a TMSl expression product. If the subject has the disorder, the method involves administering to such a subject a demethylating agent in an amount effective to reduce the level of methylation in the TMSl genomic locus (i.e., the CpG island containing TMSl nucleic acid molecule) in a tissue (which has the disorder) of the subject. An effective amount of the demethylating agent may be defined as that amount necessary to reduce the level of methylation in the TMSl genomic locus to below pre- treatment levels. In other embodiments, the effective amount may that amount necessary to reduce the level of methylation to a normal level of methylation. If the subject is at risk of having the disorder, the effective amount is that amount effective to maintain methylation levels in the TMSl genomic locus at normal levels or to reduce the level of methylation to normal or below normal levels. An anticipated and measurable outcome of any suitable reduction in methylation of the TMSl genomic locus is an increase in the level of TMSl expression products as compared to pre-treatment levels. In a further aspect, the invention also embraces a method for treating subjects expressing a mutant TMSl. These methods involve an initial determination of whether the subject, and in particular a specific tissue of the subject, expresses a wild-type or a mutant TMSl, and if wild-type is expressed, the level of its expression. As used herein, "wild-type" refers generally to a molecule which is ordinary, common, without defect or affect, and not mutant. An ordinary molecule, also refers generally to sequences or structures that, while they may vary from a canonical sequence or structure, comprise neutral polymoφhisms and do not vary in function from a molecule having a non-mutant sequence or structure. According to the invention, a wild-type TMSl is, for example, a nucleic acid molecule of SEQ ID NO:2 and its encoded wild-type polypeptide presented as SEQ ID NO:3. Another example of a wild-type TMSl nucleic acid molecule is one having the nucleotide sequence of SEQ ID NO:24, and another wild-type TMSl polypeptide is one having the amino acid sequence of SEQ ID NO:25. Wild-type TMSl polypeptide (i.e., native TMSl polypeptide) is capable of apoptosis induction, as described herein. Conversely, a "mutant" TMSl typically has undergone a nucleic acid substitution that results in a non-conservative amino acid substitution at the polypeptide level that changes the functional characteristics of TMSl, thus rendering, for example, a proliferative or drug-resistant phenotype to the cell. In particular, TMSl mutants may function as dominant negatives which interact, in a non-productive manner, with other TMS 1 polypeptides or with other binding partners of wild-type TMSl, to prevent the normal functioning of TMSl polypeptides. In other words, the dominant negative TMSl mutants remove, or titrate out, functional wild-type TMSl polypeptides or their wild-type binding partners, from the intracellular environment. The mutant TMSl polypeptides may interfere with or inhibit normal TMSl polypeptides and their naturally occurring binding partners (i.e., TMSl ligands), and by doing so ultimately decrease the apoptotic capacity of a cell (i.e., the ability of a cell to undergo apoptosis in response to normally inducing apoptotic signals). An example of a mutant TMSl molecule may be one having only exon 1 or exon 2 or one lacking exon 3.
The invention also intends to treat subjects having disorders characterized by expression of a mutant TMSl, or abnormally low levels of TMSl expression products, or abnormal methylation level of a TMS 1 nucleic acid, by administering an effective amount of a CARD-containing molecule to, preferably a tissue of the subject having the disorder. The effective amount is generally that amount , effective to increase the level of CARD-containing polypeptides in the affected tissue (or cells or cell population) of the subject. Methods directed at treating such subjects using CARD-containing molecules may also include the prior selection of a subject in need of such treatment (i.e., a subject having or at risk of developing a disorder characterized as above). A CARD-containing molecule is a molecule that contains either the nucleotide sequence or the amino acid sequence of a CARD and is able to induce apoptosis in a manner similar to that of native TMSl polypeptides, as described herein. The CARD-containing molecule includes both CARD- containing nucleic acid molecules and CARD-containing polypeptides. A CARD is found in exon 3 of SEQ ID NO: 1 and SEQ ID NO:2 which code for TMSl polypeptide. In particularly preferred embodiments, if the CARD molecule is a nucleic acid molecule it is one having a nucleotide sequence selected from the group consisting of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:9, SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24, while if it is a polypeptide it is one having an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25. Although it is preferred in some embodiments that the CARD- containing molecule be a TMSl molecule, it is not so limited. A TMSl molecule as used herein embraces TMSl nucleic acid molecules (e.g., genomic, cDNA and mRNA species) and functional TMSl peptides and polypeptides. The invention embraces the molecules described in this paragraph.
The TMS 1 molecule may also be a TMS 1 polypeptide. Preferably, the TMS 1 molecule is a polypeptide which comprises SEQ ID NO:3. In other embodiments, the TMSl nucleic acid molecule can be SEQ ID NO:20 or SEQ ID NO:22, and the TMS 1 polypeptide can be SEQ ID NO:21 or SEQ ID NO:23. The invention also embraces fragments of TMSl molecules that include a CARD. Such fragments may be of various lengths, as described previously herein.
Methods of the invention that embrace the use of CARD-containing or TMSl nucleic acid molecules may be performed using embraces gene therapy. The procedure for performing ex vivo gene therapy is outlined in U.S. Patent 5, 399, 346 and in exhibits submitted in the file history of that patent, all of which are publicly available documents. In general, it involves introduction in vitro of a functional copy of a gene into a cell(s) of a subject which contains a defective copy of the gene, and returning the genetically engineered cell(s) to the subject. The functional copy of the gene is under operable control of regulatory elements which permit expression of the gene in the genetically engineered cell(s). Numerous transfection and transduction techniques as well as appropriate expression vectors are well known to those of ordinary skill in the art, some of which are described in PCT application WO95/00654. In vivo gene therapy using vectors such as adenovirus, retroviruses, heφes virus, and targeted liposomes also is contemplated according to the invention.
In another aspect, the invention provides a method for treating a subject having a disorder characterized by abnormal cell proliferation. This aspect of the invention is premised, in part, on the unexpected finding that overexpression of a TMSl nucleic acid molecule in a cell induces the cell to undergo apoptosis, regardless of whether the cell expresses TMSl expression products prior to treatment. Thus, the method involves administering a TMSl molecule to a tissue having the disorder in an amount effective to increase the level of TMSl polypeptide to an above-normal level. The above-normal level may be at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, at least 150%, at lest 200% or at least 300% above normal levels. Preferably, the level of TMSl polypeptide is one which is sufficient to induce apoptosis of the cell in which it is expressed.
As used herein abnormal cell proliferation refers to a population of cells which exhibit an abnormal (e.g., increased) rate of division or an abnormal response or dependency on growth stimuli, as compared to their normal tissue counteφarts. The population of cells may be localized (e.g., a tumor) or they may be disseminated (e.g., a leukemia). Disorders characterized by an abnormal cell proliferation, as used herein, include but are not limited to conditions involving solid tumor masses of benign, pre-malignant or malignant character. Although not wishing to be bound by a particular theory or mechanism, some of these solid tumor masses arise from at least one genetic mutation, some may display an increased rate of cellular proliferation as compared to the normal tissue counteφart, and still others may display factor independent cellular proliferation. Factor independent cellular proliferation is an example of a manifestation of loss of growth control signals which some, if not all, tumors or cancers undergo. The disorder need not be one characterized by abnormal methylation of a CpG island containing TMS 1 nucleic acid molecule or by an abnormally low level of a TMS 1 expression product, or by the presence of a mutant TMS 1. Thus, the method may be used to treat a subject having a cancer which is not related to deregulation of the TMS 1 genomic locus.
The TMS 1 nucleic acid molecule useful in gene therapy may be selected from the group consisting of (a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule comprising a nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO:24, for example, and which code for a functional TMSl polypeptide, (b) deletions, additions and substitutions of (a) which code for a functional TMSl polypeptide, (c) nucleic acid molecules that differ from the nucleic acid molecules of (a) or (b) in codon sequence due to the degeneracy of the genetic code, and (d) complements of (a), (b) or (c). In a preferred embodiment, the TMSl nucleic acid molecule comprises SEQ ID NO:2 or SEQ ID NO:24. In a more preferred embodiment, the TMSl nucleic acid molecule encodes a polypeptide, or a fragment of a polypeptide, comprising an amino acid sequence of SEQ ID NO:3, or SEQ ID NO:25.
In important embodiments, the gene therapy envisioned by the invention includes the use of TMSl polypeptide encoding nucleic acid vectors which are regulated by tissue specific regulatory elements. Suitable vectors include adenovirus and retroviruses, both of which have been approved for human gene therapy trials. In general, the retroviruses are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle). Such genetically altered retroviral expression vectors have general utility for the high-efficiency transduction of genes in vivo. Standard protocols for producing replication-deficient retroviruses (including the steps of incoφoration of exogenous genetic material into a plasmid, transfection of a packaging cell lined with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and infection of the target cells with viral particles) are provided in Kriegler, M., "Gene Transfer and Expression, A Laboratory Manual," W.H. Freeman CO., New York (1990) and Murry, E.J. Ed. "Methods in Molecular Biology," vol. 7, Humana Press, Inc., Cliffton, New Jersey (1991). Suitable promoters for expression in particular tissues are known in the art. Of particular interest are those which direct expression in breast tissue cells and these include estrogen receptor (ER) binding elements and whey acidic protein promoter elements. Alternatively, the promoter element may be one which is ubiquitously expressed (e.g., a promoter within the LTR of a retrovirus) and specificity of expression can be imparted by the selective delivery of the vector within the subject. Methods and compositions for specific targeting of tissues within a subject are described herein.
In another aspect, the invention relates to the administration of a CpG island containing TMSl nucleic acid molecule to a subject at risk of developing such disorders. Preferably, the molecule comprises nucleotides 1100-1725 of SEQ ID NO: 1 (i.e., SEQ ID NO:4). The puφose of administering a CpG island containing nucleic acid molecule to such a subject is to redirect, and in some instances saturate, the methylating activity which would otherwise be directed at the genomic TMSl locus. The invention is also useful in the generation of knock-out and/or transgenic non-human animals. As used herein, "knock-out non-human animals" include animals in which the endogenous TMSl genomic locus has been mutated to an extent that it either can no longer be transcribed to produce mRNA, or any mRNA so produced does not lead to the production of wild-type TMSl polypeptide. Such knock-outs are generally referred to as nulls, since neither wild-type nor mutant TMSl polypeptides are detectably produced by the cells after mutation. Other "knock-out" animals embraced by the invention are those in which mutation and/or deletion of one or more coding regions within a genomic locus still results in the production of a protein species, albeit one which is mutant usually in the form of a truncation. This latter type of mutation, in some instances, results in the production of dominant negative forms of TMSl polypeptide. Dominant negative forms of TMSl polypeptides, as described herein, are mutants which still possess function, usually in the form of a negative function. An example of a dominant negative mutation is one which promotes the binding of mutant TMSl polypeptide to its natural wild-type binding partners but prevents the natural disassociation of this interaction and/or prevents the wild-type binding partner from functioning as would normally under such association. Such animals are useful since they can simulate varying degrees of null mutations, based on the proportion of wild-type TMSl polypeptides which exist in the cell unassociated with the dominant negative forms of the TMSl polypeptide. As used herein, "transgenic non-human animals" includes non-human animals having one or more exogenous nucleic acid molecules incoφorated in germ line cells and/or somatic cells. Thus transgenic animals include "knockout" animals having a homozygous or heterozygous gene disruption by homologous recombination, animals having episomal or chromosomally incoφorated expression vectors, etc. Knockout animals can be prepared by homologous recombination using embryonic stem cells as is well known in the art. The recombination may be facilitated using, for example, the cre/lox system or other recombinase systems known to one of ordinary skill in the art. In certain embodiments, the recombinase system itself is expressed conditionally, for example, in certain tissues or cell types, at certain embryonic or post-embryonic developmental stages, inducibly by the addition of a compound which increases or decreases expression, and the like. In general, the conditional expression vectors used in such systems use a variety of promoters which confer the desired gene expression pattern (e.g., temporal or spatial). Conditional promoters also can be operably linked to TMS 1 nucleic acid molecules to increase expression of TMS 1 in a regulated or conditional manner. Trans-acting negative regulators of TMSl activity or expression also can be operably linked to a conditional promoter as described above. Such trans-acting regulators include antisense TMSl nucleic acids molecules, nucleic acid molecules which encode dominant negative TMS 1 molecules, ribozyme molecules specific for TMS 1 nucleic acids, and the like. The transgenic non-human animals are useful in experiments directed toward testing biochemical or physiological effects of diagnostics or therapeutics for conditions characterized by increased or decreased TMSl expression. Other uses will be apparent to one of ordinary skill in the art.
The agent of the invention can be administered with a disorder-specific therapy. As used herein, a disorder-specific therapy is a therapy, other than the administration of demethylating agents and/or TMSl molecules of the invention, which has been reported to possess therapeutic effectiveness toward the disorder being treated. A disorder-specific therapy may include chemotherapy (i.e., treatment using chemical substances referred to herein as disorder-specific agents), as well as interventional therapies including surgery and radiation, but is not so limited. In some embodiments, the demethylating agents or TMSl molecules may be administered substantially simultaneously with the disorder-specific therapy including the disorder-specific agents. By substantially simultaneously, it is meant that a demethylating agent or TMSl molecule of the invention is administered to a subject close enough in time with the administration of, for example, the disorder-specific agent so that the two compounds may exert an additive or even synergistic effect, (e.g., reducing a tumor mass).
According to other embodiments, the agents of the invention may be administered prior to, concurrent with, or following the disorder-specific therapy, although in some embodiments it is preferred that the agents of the invention (i.e., the demethylating agents or the TMSl molecules) be administered prior to or concurrently with the disorder-specific therapy. The administration schedule may involve administering the different agents in an alternating fashion. In other embodiments, the agent may be delivered before and during, or during and after, or before and after treatment with other therapies. In some cases, the agent is administered more than 24 hours before the administration of the other therapy.
One important category of disorder-specific therapy is that intended for proliferative disorders such as cancer. Thus, in some important embodiments relating to the treatment of subjects who have cancer including both solid mass cancer ((e.g., tumors) and non-solid mass cancers (e.g., leukemia), the subject may be administered an agent of the invention and an anti-cancer therapy. As used herein, an anti-cancer therapy is a therapeutic regimen which is intended to inhibit or stabilize the growth of a primary cancer or tumor and/or prevent the growth of a secondary cancer or tumor such as a metastatic lesion. Anti-cancer therapy embraces a number of therapies including but not limited to radiation therapy and chemotherapy (i.e., chemical mediated therapy). In certain embodiments, the anti-cancer therapy may include more than one therapy (e.g., radiation and chemotherapy both administered to the subject). Thus, as an example, the subject may receive the agents of the invention, in combination with both radiation and at least one chemotherapeutic agent. Alternatively, the agent may be administered in combination with more than one chemotherapeutic agent.
The invention provides in another aspect a method for treating a subject having a cancer which involves administering an agent of the invention (i.e., a demethylating agent or a TMSl molecule) and an anti-cancer therapy to a subject in need of such treatment in a combined amount effective to treat the cancer. Preferably, the cancer is selected from the group consisting of a cancer characterized by abnormal methylation of a CpG island containing TMS 1 nucleic acid molecule, and a cancer characterized by an abnormally low level of a TMSl expression product, or a cancer characterized by the expression or presence of a mutant TMSl molecule. In one aspect, the agent of the invention and the anti-cancer therapy are administered in a manner that allows for a synergistic response. As used herein, a synergistic response is one in which the combined administration of the two or more agents or therapies yield a result that is greater than the additive effects of either of the agents or therapies alone. In some instances, one or both the agent of the invention and the anti-cancer therapy may be administered in a sub-therapeutic dose. A sub-therapeutic dose is one which alone would not result in a therapeutic benefit to the subject but which may be combined with another agent in order to effectuate therapeutic benefit. The agent of the invention may be administered prior to or concurrently with the anti-cancer therapy.
In another aspect, the agent of the invention is administered prior to or concurrently with an anti-cancer therapy, in an amount effective to sensitize the cancer to the anti-cancer therapy. An amount of agent that sensitizes a cancer means that amount that renders the cancer (which would be non-responsive otherwise) responsive to anti-cancer therapy. In some instances, the amount of demethylating agent which is effective to sensitize a cancer may be less than that amount effective to restore or maintain a normal level of methylation in a CpG island containing TMSl nucleic acid molecule. Thus, according to the invention it is possible to treat a disorder such as a cancer that is characterized by abnormal methylation of a TMSl nucleic acid molecule either by the use of a demethylating agent alone, or with a demethylating agent coupled with an anti-cancer therapy. It is conceivable that when used alone, a higher dose of a demethylating agent may be required to effect a beneficial outcome in the subject. Similarly, in some instances, the combined use of a demethylating agent and an anti-cancer therapy is expected to require a lower dose of the anti-cancer therapy for a beneficial outcome. This latter result is desirable given the side-effects of most anti-cancer therapies. It is to be understood that the invention provides similar methods of treatment of subjects having cancer using CARD-containing molecules, and preferably TMSl molecules, and an anti-cancer therapy.
One common therapy for subjects diagnosed with cancer is administration of chemotherapy or exposure to radiation, for the puφose of inducing DNA damage and ultimately apoptosis of cancer cells so treated. The ability of cancer cells with DNA damage to recognize this apoptotic signal and to undergo apoptosis is dependent upon the presence of caspase-9, a pro-apoptotic factor. However, a frequent occurrence in the treatment of some, if not all, forms of cancer is their ability to become resistant to chemotherapy during or following treatment, as well as the non-responsiveness of some subjects even prior to treatment. As described in the Examples, it was unexpectedly found according to the invention that the ability of TMSl to induce apoptosis is dependent upon caspase-9. Furthermore, it was found that TMSl is an upstream factor of the caspase-9 dependent apoptosis pathway. These findings indicate that TMSl can be a controlling factor in determining whether a subject is capable of undergoing apoptosis in response to particular forms of anti-cancer therapy.
Accordingly, in yet a further aspect, the invention provides methods for identifying a subject who is at risk of being non-responsive to a particular disorder-specific therapy. Preferably, the subject has the particular disorder which is sought to be treated with the therapy. As an example, the subject may be one who has been diagnosed with cancer using standard diagnostic procedures known in the art. Generally such a subject may be administered conventional (e.g., DNA damaging) anti-cancer therapy such as radiation therapy and some forms of chemotherapy. It is well known however that some patients so treated with radiation therapy, and more commonly some forms of chemotherapy, become unresponsive (i.e., refractory) to the therapeutic regimen. The ability to identify subjects likely to be non-responsive to particular forms of anti-cancer therapy would be useful since it would prevent the unnecessary administration of the particular anti-cancer therapy and would increase the likelihood that the subject would be administered a therapeutical ly effective therapy. In a similar manner, the invention provides a method for individually tailoring a therapeutic regimen for a particular subject. Subjects at risk of being non-responsive to a particular anti-cancer therapy are identified, according to the invention, in a number of ways. In one instance, the subject is identified by analyzing the methylation of a TMSl nucleic acid molecule. Briefly, the method involves determining the level of methylation of a CpG island containing TMSl nucleic acid molecule in a biological sample from a subject having cancer and comparing the level of methylation with a control. An increase in the level of methylation in the biological sample from the subject having cancer when compared to the control is indicative of a subject who is at risk of being non-responsive to an anti-cancer therapy. The level of methylation may be measured according to any of the appropriate methods described herein. In another instance, a non-responsive subject is identified by measuring the level of a TMSl expression product in a biological sample from the subject having cancer. In both methods, the biological sample is of a tissue or a cell or a cell population in which the disorder exists. The control may be normal tissue from a normal subject, or alternatively it may be normal tissue from the subject having cancer. In some preferred embodiments, the control is normal tissue taken from the same tissue in which the disorder exists (e.g., normal breast tissue from a subject with breast cancer). Subjects identified in this manner can subsequently be administered an agent of the invention (e.g., a demethylating agent or a TMSl molecule) in an amount effective to ultimately increase the level of TMSl expression products, most preferably TMSl polypeptides.
In one embodiment, it is envisioned that subjects who are diagnosed as described herein as having abnormal methylation at the TMS 1 locus, or who have an abnormally low level of TMS 1 expression products, or who express mutant forms of TMSl, are more likely to be resistant to anti- cancer therapies which require apoptosis to be effective (e.g., DNA damaging treatment regimens). Thus, subjects so identified may be more preferably treated with forms of anti-cancer therapy which are not wholly dependent upon apoptosis (e.g., those that are not primarily DNA damaging agents). Such anti-cancer therapies may include biological response modifying therapy, hormonal therapies, immunomodulating therapies (e.g., immunotherapeutic agents and cancer vaccines), angiogenesis inhibitors, metalloproteinase inhibitors and the like. DNA damaging anti-cancer therapies include topoisomerase inhibitors (e.g., etoposide, ramptothecin, topotecan, teniposide, mitoxantrone), anti-microtubule agents (e.g., vincristine, vinblastine), anti-metabolic agents (e.g., cytarabine, methotrexate, hydroxyurea, 5-fluorouracil, floxuridine, 6-thioguanine, 6-mercaptopurine, fludarabine, pentostatin, chlorodeoxyadenosine), DNA alkylating agents (e.g., cisplatin, mechlorethamine, cyclophosphamide, ifosfamide, melphalan, chorambucil, busulfan, thiotepa, carmustine, lomustine, carboplatin, dacarbazine, procarbazine), DNA strand break inducing agents (e.g., bleomycin, doxorubicin, daunorubicin, idarubicin, mitomycin C), and radiation therapy.
Immunotherapeutic agents which may be administered to such subjects include Ributaxin, Herceptin (trastuzumab), Quadramet, Panorex, IDEC-Y2B8, BEC2, C225, Oncolym, SMART M195, ATRAGEN, Ovarex, Bexxar, LDP-03 , ior t6, MDX-210, MDX- 11 , MDX-22, OV 103 , 3622 W94, anti- VEGF, Zenapax, MDX-220, MDX-447, MELIMMUNE-2, MELIMMUNE-1, CEACIDE, Pretarget, NovoMAb-G2, TNT, Gliomab-H, GNI-250, EMD-72000, LymphoCide, CMA 676, Monopharm-C, 4B5, ior egf.r3, ior c5, BABS, anti-FLK-2, MDX-260, ANA Ab, SMART 1D10 Ab, SMART ABL 364 Ab, ImmuRAIT-CEA, immunostimulant peptides, oligonucleotides,.
Cancer vaccines may be selected from the group consisting of EGF, Anti-idiotypic cancer vaccines, Gp75 antigen, GMK melanoma vaccine, MGV ganglioside conjugate vaccine, Her2/neu, Ovarex, M-Vax, O-Vax, L-Vax, STn-KHL theratope, BLP25 (MUC-1), liposomal idiotypic vaccine, Melacine, peptide antigen vaccines, toxin/antigen vaccines, MVA-based vaccine, PACIS, BCG vaccine, TA-HPV, TA-CIN, DISC-virus and ImmuCyst/TheraCys.
Biological response modifiers include cytokines such as interferon, interleukins and lymphokines (e.g., IL-2), interferon agonists, hemopoietic growth factors (e.g., erythropoietin, GM- CSF, G-CSF), bFGF inhibitor, insulin-like growth factor- 1 receptor inhibitor.
Hormone therapy includes adrenocorticosteriods (e.g., prednisone, methylprednisolone, dexamethasone), androgens (e.g., fluoxymesterone), anti-androgens (e.g., flutamide), estrogens (e.g., diethylstilbestrol, ethinyl estradiol), anti-estrogens (e.g., tamoxifen), progestins (e.g., medroxyprogesterone, megestrol acetate), aromatase (aminoglutethimide), gonadotropin-releasing hormone agonists (e.g., leuprolide), somatostatin analogues (e.g., octreotide).
Angiogenesis inhibitors include basic FGF, VEGF, angiopoietins, angiostatin, endostatin, TNFα, TNP-470, thrombospondin- 1 , platelet factor 4, CAI, and certain members of the integrin family of proteins. In a related aspect of the foregoing method, the subjects identified as being at risk of being non-responsive to a disorder-specific therapy may be treated by administering an agent of the invention (e.g., a demethylating agent or a TMSl molecule) and disorder-specific therapy. The agent of the invention may be administered substantially simultaneously with the disorder-specific therapy or alternatively, the agent may be administered prior to the administration of the disorder-specific therapy. In one important embodiment, the disorder-specific therapy (e.g., an anti-cancer therapy) is administered with a demethylating agent and not a TMSl molecule. In these embodiments, the anti- cancer therapy may be DNA damaging anti-cancer therapy or not. The intention is these latter embodiments is to make cancers sensitive to the anti-cancer therapy but increasing the level of TMSl expression products in the tissue (preferably the malignant tissue) of the subject. One category of anti-cancer therapy is chemotherapy. Examples of chemotherapeutic agents include Acivicin; Aclarubicin; Acodazole Hydrochloride; Acronine; Adozelesin; Aldesleukin; Altretamine; Ambomycin; Ametantrone Acetate; Aminoglutethimide; Amsacrine; Anastrozole; Anthramycin; Asparaginase; Asperlin; Azacitidine; Azetepa; Azotomycin; Batimastat; Benzodepa; Bicalutamide; Bisantrene Hydrochloride; Bisnafide Dimesylate; Bizelesin; Bleomycin Sulfate; Brequinar Sodium; Bropirimine; Busulfan; Cactinomycin; Calusterone; Caracemide; Carbetimer; Carboplatin; Carmustine; Carubicin Hydrochloride; Carzelesin; Cedefingol; Chlorambucil; Cirolemycin; Cisplatin; Cladribine; Crisnatol Mesylate; Cyclophosphamide; Cytarabine; Dacarbazine;
Dactinomycin; Daunorubicin Hydrochloride; Decitabine; Dexormaplatin; Dezaguanine; Dezaguanine
Mesylate; Diaziquone; Docetaxel; Doxorubicin; Doxorubicin Hydrochloride; Droloxifene;
Droloxifene Citrate; Dromostanolone Propionate; Duazomycin; Edatrexate; Eflornithine Hydrochloride; Elsamitrucin; Enloplatin; Enpromate; Epipropidine; Epirubicin Hydrochloride;
Erbulozole; Esorubicin Hydrochloride; Estramustine; Estramustine Phosphate Sodium; Etanidazole;
Etoposide; Etoposide Phosphate; Etoprine; Fadrozole Hydrochloride; Fazarabine; Fenretinide;
Floxuridine; Fludarabine Phosphate; Fluorouracil; Flurocitabine; Fosquidone; Fostriecin Sodium;
Gemcitabine; Gemcitabine Hydrochloride; Hydroxyurea; Idarubicin Hydrochloride; Ifosfamide; Ilmofosine; Iproplatin; Irinotecan Hydrochloride; Lanreotide Acetate; Letrozole; Liarozole
Hydrochloride; Lometrexol Sodium; Lomustine; Losoxantrone Hydrochloride; Masoprocol;
Maytansine; Mechlorethamine Hydrochloride; Megestrol Acetate; Melengestrol Acetate; Melphalan;
Menogaril; Mercaptopurine; Methotrexate; Methotrexate Sodium; Metoprine; Meturedepa;
Mitindomide; Mitocarcin; Mitocromin; Mitogillin; Mitomalcin; Mitomycin; Mitosper; Mitotane; Mitoxantrone Hydrochloride; Mycophenolic Acid; Nocodazole; Nogalamycin; Ormaplatin; Oxisuran;
Pegaspargase; Peliomycin; Pentamustine; Peplomycin Sulfate; Perfosfamide; Pipobroman; Piposulfan;
Piroxantrone Hydrochloride; Plicamycin; Plomestane; Porfimer Sodium; Porfiromycin;
Prednimustine; Procarbazine Hydrochloride; Puromycin; Puromycin Hydrochloride; Pyrazofurin;
Riboprine; Rogletimide; Safingol; Safingol Hydrochloride; Semustine; Simtrazene; Sparfosate Sodium; Sparsomycin; Spirogermanium Hydrochloride; Spiromustine; Spiroplatin; Streptonigrin;
Streptozocin; Sulofenur; Talisomycin; Tecogalan Sodium; Tegafur; Teloxantrone Hydrochloride;
Taxotere; Temoporfin; Teniposide; Teroxirone; Testolactone; Thiamiprine; Thioguanine; Thiotepa;
Tiazofurin; Tirapazamine; Toremifene Citrate; Trestolone Acetate; Triciribine Phosphate;
Trimetrexate; Trimetrexate Glucuronate; Triptorelin; Tubulozole Hydrochloride; Uracil Mustard; Uredepa; Vapreotide; Verteporfin; Vinblastine Sulfate; Vincristine Sulfate; Vindesine; Vindesine
Sulfate; Vinepidine Sulfate; Vinglycinate Sulfate; Vinleurosine Sulfate; Vinorelbine Tartrate;
Vinrosidine Sulfate; Vinzolidine Sulfate; Vorozole; Zeniplatin; Zinostatin; Zorubicin Hydrochloride. Other chemotherapies include methotrexate, vincristine, adriamycin, cisplatin, non-sugar containing chloroethylnitrosoureas, mitomycin C, dacarbazine, fragyline, Meglamine GLA, valrubicin, carmustaine and polifeφosan, MMI270, BAY 12-9566, RAS famesyl transferase inhibitor, famesyl transferase inhibitor, MMP, MTA/LY231514, LY264618 Lometexol, Glamolec, CI-994, TNP-470,
PKC412, Valspodar/PSC833, Novantrone/Mitroxantrone, Metaret/Suramin, Batimastat, E7070, BCH-
4556, CS-682, 9-AC, AG3340, AG3433, Incel/VX-710, VX-853, ZD0101, ISI641, ODN 698, TA
2516/Marmistat, BB2516/Marmistat, CDP 845, D2163, PD183805, DX8951f, Lemonal DP 2202, FK 317, Picibanil/OK-432, AD 32/Valrubicin, Metastron/strontium derivative, Temodal/Temozolomide,
Evacet/liposomal doxorubicin, Xeload/Capecitabine, Furtulon/Doxifluridine, Oral Taxoid, SPU- 077/Cisplatin, HMR 1275/Flavopiridol, CP-358 (774)/EGFR, CP-609 (754)/RAS oncogene inhibitor, BMS- 182751 /oral platinum, UFT(Tegafur/Uracil), Ergamisol/Levamisole, Eniluracil/776C85/5FU enhancer, Campto Levamisole, Camptosar/Irinotecan, Tumodex/Ralitrexed, Leustatin/Cladribine, Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin, Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, ZD1839, LU 79553/Bis-Naphtalimide, LU 103793/Dolastain, Caetyx/liposomal doxorubicin, Gemzar/Gemcitabine, ZD 0473/Anormed, YM 1 16, Iodine seeds, CDK4 and CDK2 inhibitors, PARP inhibitors, D4809/Dexifosamide, Ifes/Mesnex/Ifosamide, Vumon/Teniposide, Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, ZD 9331 , Taxotere/Docetaxel, prodrug of guanine arabinoside, nitrosoureas, alkylating agents such as melphelan, cyclophosphamide, Aminoglutethimide, Asparaginase, Busulfan, Carboplatin,
Chlorombucil, Cytarabine HCI, Dactinomycin, Daunorubicin HC1, Estramustine phosphate sodium, Floxuridine, Flutamide, Hydroxyurea (hydroxycarbamide), Ifosfamide, Lomustine (CCNU), Mechlorethamine HCI (nitrogen mustard), Mercaptopurine, Mesna, Mitotane (o.p'-DDD), Mitoxantrone HCI, Octreotide, Plicamycin, Procarbazine HCI, Streptozocin, Thioguanine, Thiotepa, Vinblastine sulfate, Amsacrine (m-AMSA), Azacitidine, Hexamethylmelamine (HMM), Mitoguazone (methyl-GAG; methyl glyoxal bis-guanylhydrazone; MGBG), Pentostatin (2'deoxycoformycin), Semustine (methyl-CCNU), Teniposide (VM-26) and Vindesine sulfate.
Other chemotherapeutic agents include: 20-epi-l,25 dihydroxyvitamin D3; 5-ethynyluracil; abiraterone; aclarubicin; acylfulvene; adecypenol; adozelesin; aldesleukin; ALL-TK antagonists; altretamine; ambamustine; amidox; amifostine; aminolevulinic acid; amrubicin; amsacrine; anagrelide; anastrozole; andrographolide; antagonist D; antagonist G; antarelix; anti-dorsalizing moφhogenetic protein- 1; antineoplaston; antisense oligonucleotides; aphidicolin glycinate; apoptosis gene modulators; apoptosis regulators; apurinic acid; ara-CDP-DL-PTBA; arginine deaminase; asulacrine; atamestane; atrimustine; axinastatin 1; axinastatin 2; axinastatin 3; azasetron; azatoxin; azatyrosine; baccatin III derivatives; balanol; batimastat; BCR/ABL antagonists; benzochlorins; benzoylstaurosporine; beta lactam derivatives; beta-alethine; betaclamycin B; betulinic acid; bicalutamide; bisantrene; bisaziridinylspermine; bisnafide; bistratene A; bizelesin; breflate; bropirimine; budotitane; buthionine sulfoximine; calcipotriol; calphostin C; camptothecin derivatives; canarypox IL-2; capecitabine; carboxamide-amino-triazole; carboxyamidotriazole; CaRest M3; CARN 700; cartilage derived inhibitor; carzelesin; casein kinase inhibitors (ICOS); castanospermine; cecropin B; cetrorelix; chlorins; chloroquinoxaline sulfonamide; cicaprost; cis-poφhyrin; cladribine; clomifene analogues; clotrimazole; collismycin A; collismycin B; combretastatin A4; combretastatin analogue; conagenin; crambescidin 816; crisnatol; cryptophycin 8; cryptophycin A derivatives; curacin A; cyclopentanthraquinones; cycloplatam; cypemycin; cytarabine ocfosfate; cytolytic factor; cytostatin; dacliximab; decitabine; dehydrodidemnin B; deslorelin; dexifosfamide; dexrazoxane; dexverapamil; diaziquone; didemnin B; didox; diethylnorspermine; dihydro-5-azacytidine; dihydrotaxol, 9-; dioxamycin; diphenyl spiromustine; docosanol; dolasetron; doxifluridine; droloxifene; dronabinol; duocarmycin SA; ebselen; ecomustine; edelfosine; edrecolomab; eflornithine; elemene; emitefur; epirubicin; epristeride; estramustine analogue; etanidazole; etoposide phosphate; exemestane; fadrozole; fazarabine; fenretinide; filgrastim; finasteride; flavopiridol; flezelastine; fluasterone; fludarabine; fluorodaunorunicin hydrochloride; forfenimex; formestane; fostriecin; fotemustine; gadolinium texaphyrin; gallium nitrate; galocitabine; ganirelix; gelatinase inhibitors; gemcitabine; glutathione inhibitors; hepsulfam; heregulin; hexamethylene bisacetamide; hypericin; ibandronic acid; idarubicin; idoxifene; idramantone; ilmofosine; ilomastat; imidazoacridones; imiquimod; iobenguane; iododoxorubicin; ipomeanol, 4-; irinotecan; iroplact; irsogladine; isobengazole; isohomohalicondrin B; itasetron; jasplakinolide; kahalalide F; lamellarin-N triacetate; lanreotide; leinamycin; lenograstim; lentinan sulfate; leptolstatin; letrozole; leukemia inhibiting factor; leukocyte alpha interferon; leuprolide + estrogen + progesterone; leuprorelin; levamisole; liarozole; linear polyamine analogue; lipophilic disaccharide peptide; lipophilic platinum compounds; lissoclinamide 7; lobaplatin; lombricine; lometrexol; lonidamine; losoxantrone; lovastatin; loxoribine; lurtotecan; lutetium texaphyrin; lysofylline; lytic peptides; maitansine; mannostatin A; marimastat; masoprocol; maspin; matrilysin inhibitors; menogaril; merbarone; meterelin; methioninase; metoclopramide; MIF inhibitor; mifepristone; miltefosine; mirimostim; mismatched double stranded RNA; mitoguazone; mitolactol; mitomycin analogues; mitonafide; mitotoxin fibroblast growth factor-saporin; mitoxantrone; mofarotene; molgramostim; monoclonal antibody, human chorionic gonadotrophin; monophosphoryl lipid A + myobacterium cell wall sk; mopidamol; multiple drug resistance gene inhibitor; multiple tumor suppressor 1 -based therapy; mustard anti cancer compound; mycaperoxide B; mycobacterial cell wall extract; myriaporone; N-acetyldinaline; N-substituted benzamides; nafarelin; nagrestip; naloxone + pentazocine; napavin; naphteφin; nartograstim; nedaplatin; nemorubicin; neridronic acid; neutral endopeptidase; nilutamide; nisamycin; nitric oxide modulators; nitroxide antioxidant; nitrullyn; 06-benzylguanine; octreotide; okicenone; onapristone; ondansetron; ondansetron; oracin; oral cytokine inducer; ormaplatin; osaterone; oxaliplatin; oxaunomycin; paclitaxel analogues; paclitaxel derivatives; palauamine; palmitoylrhizoxin; pamidronic acid; panaxytriol; panomifene; parabactin; pazelliptine; pegaspargase; peldesine; pentosan polysulfate sodium; pentostatin; pentrozole; perflubron; perfosfamide; perillyl alcohol; phenazinomycin; phenylacetate; phosphatase inhibitors; picibanil; pilocaφine hydrochloride; pirarubicin; piritrexim; placetin A; placetin B; plasminogen activator inhibitor; platinum complex; platinum compounds; platinum-triamine complex; porfimer sodium; porfiromycin; propyl bis-acridone; prostaglandin J2; proteasome inhibitors; protein A-based immune modulator; protein kinase C inhibitor; protein kinase C inhibitors, microalgal; protein tyrosine phosphatase inhibitors; purine nucleoside phosphorylase inhibitors; puφurins; pyrazoloacridine; pyridoxylated hemoglobin polyoxyethylene conjugate; raf antagonists; raltitrexed; ramosetron; ras famesyl protein transferase inhibitors; ras inhibitors; ras-GAP inhibitor; retelliptine demethylated; rhenium Re 186 etidronate; rhizoxin; ribozymes; RII retinamide; rogletimide; rohitukine; romurtide; roquinimex; rubiginone Bl; ruboxyl; safingol; saintopin; SarCNU; sarcophytol A; sargramostim; Sdi 1 mimetics; semustine; senescence derived inhibitor 1; sense oligonucleotides; signal transduction inhibitors; signal transduction modulators; single chain antigen binding protein; sizofiran; sobuzoxane; sodium borocaptate; sodium phenylacetate; solverol; somatomedin binding protein; sonermin; sparfosic acid; spicamycin D; spiromustine; splenopentin; spongistatin 1 ; squalamine; stem cell inhibitor; stem-cell division inhibitors; stipiamide; stromelysin inhibitors; sulfinosine; superactive vasoactive intestinal peptide antagonist; suradista; suramin; swainsonine; synthetic glycosaminoglycans; tallimustine; tamoxifen; tamoxifen methiodide; tauromustine; tazarotene; tecogalan sodium; tegafur; tellurapyrylium; telomerase inhibitors; temoporfin; temozolomide; teniposide; tetrachlorodecaoxide; tetrazomine; thaliblastine; thalidomide; thiocoraline; thrombopoietin; thrombopoietin mimetic; thymalfasin; thymopoietin receptor agonist; thymotrinan; thyroid stimulating hormone; tin ethyl etiopuφurin; tirapazamine; titanocene dichloride; topotecan; topsentin; toremifene; totipotent stem cell factor; translation inhibitors; tretinoin; triacetyluridine; triciribine; trimetrexate; triptorelin; tropisetron; turosteride; tyrosine kinase inhibitors; tyφhostins; UBC inhibitors; ubenimex; urogenital sinus-derived growth inhibitory factor; urokinase receptor antagonists; vapreotide; variolin B; vector system, erythrocyte gene therapy; velaresol; veramine; verdins; verteporfin; vinorelbine; vinxaltine; vitaxin; vorozole; zanoterone; zeniplatin; zilascorb; zinostatin stimalamer. Another anti-cancer therapy that can be used with the agents of the invention include anti- cancer supplementary potentiating chemotherapeutic agents. Examples include Tricyclic anti-depressant drugs (e.g., imipramine, desipramine, amitryptyline, clomipramine, trimipramine, doxepin, nortriptyline, protriptyline, amoxapine and maprotiline); non-tricyclic anti-depressant drugs (e.g., sertraline, trazodone and citalopram); Ca^ antagonists (e.g., verapamil, nifedipine, nitrendipine and caroverine); Calmodulin inhibitors (e.g., prenylamine, trifluoroperazine and clomipramine); Amphotericin B; Triparanol analogues (e.g., tamoxifen); antiarrhythmic drugs (e.g., quinidine); antihypertensive drugs (e.g., reserpine); Thiol depleters (e.g., buthionine and sulfoximine) and multiple drug resistance reducing compounds such as Cremaphor EL.
Other compounds which are useful in combination therapy of the invention include Piritrexim Isethionate; the antiprostatic hypertrophy compound, Sitogluside; the benign prostatic hypeφlasia therapy compound, Tamsulosin Hydrochloride; the prostate growth inhibitor, Pentomone; radioactive compounds such as Fibrinogen 1 125, Fludeoxyglucose F 18, Fluorodopa F 18, Insulin I 125, Insulin I 131, Iobenguane I 123, Iodipamide Sodium I 131, Iodoantipyrine I 131, Iodocholesterol I 131, Iodohippurate Sodium I 123, Iodohippurate Sodium I 125, Iodohippurate Sodium I 131, lodopyracet I 125, lodopyracet I 131, lofetamine Hydrochloride I 123, lomethin I 125, lomethin I 131, lothalamate Sodium I 125, lothalamate Sodium I 131, Iotyrosine 1 131, Liothyronine I 125, Liothyronine I 131, Merisoprol Acetate Hg 197, Merisoprol Acetate Hg 203, Merisoprol Hg 197, Selenomethionine Se 75, Technetium Tc 99m Antimony Trisulfide Colloid, Technetium Tc 99m Bicisate, Technetium Tc 99m Disofenin, Technetium Tc 99m Etidronate, Technetium Tc 99m Exametazime, Technetium Tc 99m Furifosmin, Technetium Tc 99m Gluceptate, Technetium Tc 99m Lidofenin, Technetium Tc 99m Mebrofenin, Technetium Tc 99m Medronate, Technetium Tc 99m Medronate Disodium, Technetium Tc 99m Mertiatide, Technetium Tc 99m Oxidronate, Technetium Tc 99m Pentetate, Technetium Tc 99m Pentetate Calcium Trisodium, Technetium Tc 99m Sestamibi, Technetium Tc 99m Siboroxime, Technetium Tc 99m Succimer, Technetium Tc 99m Sulfur Colloid, Technetium Tc 99m Teboroxime, Technetium Tc 99m Tetrofosmin, Technetium Tc 99m Tiatide, Thyroxine I 125, Thyroxine 1 131, Tolpovidone 1 131, Triolein I 125 and Triolein 1 131.
The invention further embraces pharmaceutical preparations or compositions useful for treating subjects having or at risk of having the disorders described herein. In one aspect of the invention, a pharmaceutical preparation comprising a demethylating agent and a pharmaceutically acceptable carrier is provided. It is to be understood that one or more different demethylating agents may be present in a given pharmaceutical preparation. In another aspect, the pharmaceutical preparation comprising a TMSl molecule and a pharmaceutically acceptable carrier is provided. The pharmaceutical preparation may contain one or more different forms of TMSl molecules. In yet another aspect, the invention provides a pharmaceutical preparation comprising both demethylating agents and TMSl molecules along with a pharmaceutically acceptable carrier. Each and every pharmaceutical preparation described herein may also optionally contain one or more disorder-specific therapeutic agents, as described herein.
The invention further provides a medicament and a method of making a medicament. The medicament comprises an agent and a pharmaceutically acceptable carrier. The method involves placing an agent in a pharmaceutically acceptable carrier. The agent may be a demethylating agent or a TMSl molecule. Alternatively, the medicament may contain both a demethylating agent and a
TMSl molecule. Optionally, any of the foregoing medicaments may also contain a disorder-specific agent, other than the demethylating agents and the TMSl molecules of the invention. In one embodiment, the medicament is formulated in a dose and/or a delivery formulation particularly tailored to the treatment of breast cancer. The pharmaceutical preparations, as described above, are administered in effective amounts.
The effective amount will depend upon the mode of administration, the particular condition being treated and the desired outcome. It will also depend upon, as discussed above, the stage of the condition, the age and physical condition of the subject, the nature of concurrent therapy, if any, and like factors well known to the medical practitioner. For therapeutic applications, it is that amount sufficient to achieve a medically desirable result. In some cases this is a decrease in cell proliferation or an increase in apoptosis induction. Generally, doses of active compounds of the present invention would be from about 0.0001 mg/kg per day to 1000 mg/kg per day. It is expected that doses ranging from 50-500 mg/kg will be suitable. A variety of administration routes are available. The methods of the invention, generally speaking, may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of the active compounds without causing clinically unacceptable adverse effects. Such modes of administration include oral, rectal, topical, nasal, interdermal, or parenteral routes. The term "parenteral" includes subcutaneous, intravenous, intramuscular, or infusion. Intravenous or intramuscular routes are not particularly suitable for long- term therapy and prophylaxis. They could, however, be preferred in emergency situations. Oral administration will be preferred for prophylactic treatment because of the convenience to the patient as well as the dosing schedule. When peptides are used therapeutical ly, in certain embodiments a desirable route of administration is by pulmonary aerosol. Techniques for preparing aerosol delivery systems containing peptides are well known to those of skill in the art. Generally, such systems should utilize components which will not significantly impair the biological properties of the antibodies, such as the paratope binding capacity (see, for example, Sciarra and Cutie, "Aerosols, " in Remington's
Pharmaceutical Sciences, 18th edition, 1990, pp 1694-1712; incoφorated by reference). Those of skill in the art can readily determine the various parameters and conditions for producing antibody or peptide aerosols without resort to undue experimentation.
The mode of administration and dosage of the agent will vary with the particular stage of the condition being treated, the age and physical condition of the subject being treated, the duration of the treatment, the nature of the concurrent therapy (if any), the specific route of administration, and the like factors within the knowledge and expertise of the health practitioner.
Compositions suitable for oral administration may be presented as discrete units, such as capsules, tablets, lozenges, in both immediate release or controlled release formulations, each containing a predetermined amount of the active agent,. Other compositions include suspensions in aqueous liquids or non-aqueous liquids such as a syrup, elixir or an emulsion.
Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti- oxidants, chelating agents, and inert gases and the like. Lower doses will result from other forms of administration, such as intravenous administration. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits. Multiple doses per day are contemplated to achieve appropriate systemic levels of compounds.
The TMSl molecules including but not limited to polypeptides or fragments thereof may be combined, optionally, with a pharmaceutically-acceptable carrier. The term "pharmaceutically- acceptable carrier" as used herein means one or more compatible solid or liquid filler, diluents or encapsulating substances which are suitable for administration into a human. The term "carrier" denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The components of the pharmaceutical compositions also are capable of being co-mingled with the molecules of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy.
When administered, the pharmaceutical preparations of the invention are applied in pharmaceutically-acceptable amounts and in pharmaceutically-acceptably compositions. Such preparations may routinely contain salt, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents. When used in medicine, the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically-acceptable salts thereof and are not excluded from the scope of the invention. Such pharmacologically and pharmaceutically-acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic, and the like. Also, pharmaceutically-acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts.
Various techniques may be employed for introducing nucleic acids of the invention into cells, depending on whether the nucleic acids are introduced in vitro or in vivo in a host. Such techniques include transfection of nucleic acid-CaP04 precipitates, transfection of nucleic acids associated with DEAE, transfection with a retrovirus including the nucleic acid of interest, liposome mediated transfection, and the like. For certain uses, it is preferred to target the nucleic acid to particular cells. In such instances, a vehicle used for delivering a nucleic acid of the invention into a cell (e.g., a retrovirus, or other virus; a liposome) can have a targeting molecule attached thereto. For example, a molecule such as an antibody specific for a surface membrane protein on the target cell or a ligand for a receptor on the target cell can be bound to or incoφorated within the nucleic acid delivery vehicle. For example, where liposomes are employed to deliver the nucleic acids of the invention, proteins which bind to a surface membrane protein associated with endocytosis may be incoφorated into the liposome formulation for targeting and/or to facilitate uptake. Such proteins include capsid proteins or fragments thereof tropic for a particular cell type, antibodies for proteins which undergo internalization in cycling, proteins that target intracellular localization and enhance intracellular half life, and the like. Polymeric delivery systems also have been used successfully to deliver nucleic acids into cells, as is known by those skilled in the art. Such systems even permit oral delivery of nucleic acids.
Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the anti-inflammatory agent, increasing convenience to the subject and the physician. Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer base systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides and non-polymer systems such as melted and recrystallized sterols including cholesterol. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Patent 5,075,109. Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono- di- and tri-glycerides; hydrogel release systems; silastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which an agent of the invention is contained in a form within a matrix such as those described in U.S. Patent Nos. 4,452,775, 4,675,189, and 5,736,152, and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Patent Nos. 3,854,480, 5,133,974 and 5,407,686. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.
Use of a long-term sustained release implant may be particularly suitable for treatment of chronic conditions. Long-term release, are used herein, means that the implant is constructed and arranged to delivery therapeutic levels of the active ingredient for at least 30 days, and preferably 60 days. Long-term sustained release implants are well-known to those of ordinary skill in the art and include some of the release systems described above.
In still other embodiments, the agent of the invention (e.g., the demethylating agent or the TMSl molecule) is targeted to a cell, a cell population or a tissue that has, or is at risk of having (i.e., developing), the disorder sought to be prevented or treated through the use of a targeting compound specific for a particular cell or tissue. As an example, if the tissue has developed a tumor, the targeting compound may be specific for the tumor type. The agents of the invention may be targeted to primary or in some instances, secondary (i.e., metastatic) lesions through the use of targeting compounds which preferentially recognize a cell surface marker. The targeting compound may be directly conjugated to the agents of the invention via a covalent linkage. The agent may be indirectly conjugated to a targeting compound via a linker. Alternatively, the targeting compound may be conjugated or associated with an intermediary compound such as, for example, a liposome within which the agent is encapsulated. Liposomes are artificial membrane vessels which are useful as a delivery vector in vivo or in vitro. It has been shown that large unilamellar vessels (LUV), which range in size from 0.2 - 4.0 μm can encapsulate large macromolecules. Liposomes may be targeted to a particular tissue, such as the vascular cell wall, by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein. Liposomes are commercially available from Gibco BRL, for example, as LIPOFECTIN™ and LIPOFECTACE™, which are formed of cationic lipids such as N-[l-(2, 3 dioleyloxy)-propyl]-N, N, N-trimethylammonium chloride (DOTMA) and dimethyl dioctadecylammonium bromide (DDAB). Methods for making liposomes are well known in the art and have been described in many publications. Liposomes also have been reviewed by Gregoriadis, G. in Trends in Biotechnology, V. 3, p. 235-241 (1985). In still other embodiments, the targeting compound may be loosely associated with the agents of the invention, such as within a microparticle comprising a polymer, the agent of the invention and the targeting compound.
Targeting compounds useful according to the methods of the invention are those which direct the agent to a site having a disorder or at risk of developing a disorder such as a tumor site. The targeting compound of choice will depend upon the nature of the tumor or the tissue origin of the metastasis. In some instances it may be desirable to target the agent to the tissue in which the tumor is located. For example, agents can be delivered to breast epithelium by using a targeting compound specific for breast tissue. In preferred embodiments, the target is specific for malignant breast epithelium. Examples of compounds which may localize to malignant breast epithelium include, but are not limited to, estrogen and progesterone, epithelial growth factor (EGF) and HER-2/neu ligand, among others. The HER-2/neu ligand may also be used to target agents to ovarian cancers. Ovarian cancers are also known to express EGFR and c-fms, and thus could be targeted through the use of ligands for either receptor. In the case of c-fms which is also expressed by macrophages and monocytes, targeted delivery to an ovarian cancer may require a combination of local administration such as a vaginal suppository as well as a targeting compound. Prostate cancers can be targeted using compounds such as peptides (e.g., antibodies or antibody fragments) which bind to prostate specific antigen (PSA) or prostate specific membrane antigen (PSMA). Other markers which may be used for targeting of the agent to specific tissues include, for example, in liver: HGF, insulin-like growth factor I, II, insulin, OV-6, HEA-125, hyaluronic acid, collagen, N-terminal propeptide of collagen type III, mannose/N-acetylglucosamine, asialoglycoprotein, tissue plasminogen activator, low density lipoprotein, carcinoembryonic antigen; in kidney cells: angiotensin II, vasopressin, antibodies to
CD44v6; in keratinocytes and skin fibroblasts: KGF, very low density lipoprotein, RGD-containing peptides, collagen, laminin; in melanocytes: kit ligand; in gut: cobalamin-intrinsic factor, heat stable enterotoxin of E. Coli; in breast epithelium: heregulin, prolactin, transferrin, cadherin-11. Other markers specific to particular tissues are available and would be known to one of ordinary skill in the art. In still other embodiments, the agent of the invention may be targeted to fibroblasts, via ligands or binding partners for fibroblast specific markers. Examples of these markers include, but are not limited to fibroblast growth factors (FGF) and platelet derived growth factor (PDGF).
Table I. Sequences with partial homologies to TMSl
Sequences with GenBank and EMBL (*) accession numbers:
SEQ ID NO:l
AW009953.1, AI991236.1,
AL023575.1, AC005588, AL022313, AC003080, AC003043, AC006023.2, AL031055, AC003009,
AC002449, AL021807.1,
AA516955, AA516629, W64166, AA517646, AI326216, AI503861, AI616330.1, AA823826, AA036192,
AI923691.1, R48326, All 48558, AI262374, AI346818, AW009953.1, AI991236.1, AA278825, AI650407.1,
AI879821.1, AA582937, AA573948, AA528254, AA568456, AA441911, AI277160, AA148254, AI368975,
AA148255, AA928164, W17108, AA442018, AA769741, H16108, AI675866.1, AI910530.1, AI024901,
AA282250, T25032, AA278827,
AI066909, AI145414.1,
A58551.1, A43445.1, A51134.1, AR020909, 125678
AX017270; NM_013258, AK000211, AB023416, AF255794, AF086332,
AI923691, R48326, AI148558, AI262374, AI346818, BE908204, AW337649, BE906296, AW009953,
AI991236, AW973297, AW292443, AA278825, BE909218, AI650407, AI879821, AA582937, AA573948,
AA528254, AA568456, AA441911, AI277160, AA148254, BE560228, AI368975, AW770914, AA148255,
AA928164, BE560247, W17108, AA442018, AA769741, H16108, AI675866, AW799740, AI910530,
BE170951, AI024901, AA282250, T25032, AA278827, BE071843, W73558, AW059668
AA036192, W78666, AA015254, AA616380, AA050695, W13611, AA266479, AA047994,
SEQ ID NO:2
AF086332,
AW009953.1, AI991236.1,
AA036192, AA266479, AA015254, W78666, AA616380, AA050695, AA047994, W13611,
AI148558, AA528254, AA582937, AA573948, AA278825, AI262374, AA148254, AI346818, AW009953.1,
AA148255, AI991236.1, AI879821.1, AA568456, AA441911, AI277160, AI368975, AA928164, W17108,
AI024901, AA442018, AA769741, H16108, AI675866.1, AI910530.1, AA282250, T25032, AA278827,
AI237542, AA944962, AA851245, AI071267.1, AI411217, AB016922.1,
E15920.1, 109517, 107886, E08092, A08832.1, E15921.1, 140161, 191798, A00196.1, A06986.1, A06987.1 ,
161404, 134189,
E05044, AR005279, A42329.1
SEQ ID NO:24:
NM 013258.1, AX017270.1, AK000211.1, AB023416.1, AF086332.1,
BE906296.1, AX017270.1, BE908204.1, BE909218.1, BE753025.1,
AI991236.1, BE906296.1, AI346818.1, AW009953.1, AI262374.1, AI148558.1, BE908204.1, AW337649.1,
AW973297.1, AW292443.1 , AA278825.1, BE909218.1, AI879821.1, AA582937.1, AA573948.1,
AA528254.1, AA568456.1, AA441911.1, AI277160.1, AA148254.1 , BE560228.1, AI368975.1,
AW770914.1, AA928164.1, AA148255.1, AA769741.1, W17108.1, AA442018.1, H16108.1, AI675866.1,
AW799740.1, AI910530.1, BE560247.1, BE170951.1, AI024901.1, AA282250.1, T25032.1, AV664060.1,
AW479270.1, AA278827.1, BE071843.1, AV664059.1, BE753025.1,
G33295.1, G28555.1, AL146304.1, D25453.1, G27934.1, G19810.1, L18488.1, G57929.1, G53082.1,
G50720.1 , G18374.1, AL156359.1, AL151001.1, AL149657.1, AL147151.1, AL146079.1, AL144969.1,
AL141138.1, G34804.1, G11610.1, G10503.1, AB044684.1, Z30389.1, Z70868.1
AA036192.1, BE860311.1, BE627788.1, AW323711.1, AA616380.1, AA266479.1, AA050695.1,
AA047994.1, AA015254.1, W78666.1, W13611.1,
AI991236.1, BE906296.1, AI346818.1, AW009953.1, AI262374.1, AI148558.1, BE908204.1, AW337649.1 , AW973297.1, AW292443.1, AA278825.1, BE909218.1, AI879821.1, AA582937.1, AA573948.1 , AA528254.1 , AA568456.1, AA44191 1.1, AI277160.1, AA148254.1, BE560228.1, AI368975.1, AW770914.1, AA928164.1, AA148255.1, AA769741.1, W17108.1, AA442018.1, H16108.1, AI675866.1,
AW799740.1, AI910530.1, BE560247.1, BE170951.1, AI024901.1, AA282250.1, T25032.1, AA278827.1,
BE071843.1,
AV664060.1, AW479270.1, AV664059.1, BE753025.1,
AR036571.1, AR076110.1, AR070492.1, AR070491.1, AR031690.1, 191798.1, 181460.1, 173184.1,
AQ374921.1, AQ667847.1 , AQ440094.1 ,
AC009088.5,
Examples
EXAMPLE 1: Methods and Materials Example 1:
Cell Lines: IMR90 normal human diploid fibroblasts and SV40 immortalized IMR90 cells (called here '90SV') were obtained from the National Institute on Aging Cell Repository and were maintained in EMEM containing 2 mM glutamine and 10%) FCS. The isolation and maintenance of 90SV derivative cell lines stably overexpressing human DNMTl (HMT.lEl) has been reported. (Vertino, P.M. et al., Mol.Cell Biol. 16:4555-4565, 1996) HMT.lEl, expresses 50-fold increased levels of human DNA methyltransferase relative to the parental 90SV fibroblasts. HMT.lEl cells were maintained in EMEM plus 2mM glutamine, 10% fetal calf serum and 400 μg/ml G418 (Life Technologies). The human breast epithelial cell line MCF10A was obtained from the Karmanos Cancer Institute, Detroit, MI, and were maintained in DMEM/F12 plus 5% fetal calf serum, 20 ng/ml epidermal growth factor, 0.5 μg/ml hydrocortisone, 100 ng/ml cholera toxin, 10 μg/ml insulin and 2 mM glutamine. Other human breast cell lines and 293 human embryonic kidney cells were obtained from the American Type Culture Collection (Manassas, VA) and were maintained in DMEM (4.5g/l glucose) plus 10% fetal calf serum and 2 mM glutamine. For Hs578Bst, Hs578t, MCF7, MDA MB435 and T47D cells, medium was supplemented with 10 μg/ml insulin. Passage seven HMEC primary breast epithelial cells were obtained from Clonetics (Walkersville, MD) and were cultured according to the recommendations of the supplier. SKBR3 cells were maintained in McCoys 5 A medium plus 10%> fetal calf serum and 2 mM glutamine. All cells were maintained at 37°C and 5% C02.
DNA isolated from primary breast tissues and tumors was generously provided by Dr. Sara Sukumar (Johns Hopkins University). Primary breast tissue from reduction mammoplasties or from breast tumors was obtained immediately following surgical resection at Johns Hopkins University Hospital or Duke University and frozen at -80°C. Tumors were estimated to contain at least 50% tumor cells by microscopic examination of representative tissue sections. Representational Difference Analysis: Total RNA was isolated from 90SV cells at PD 144 and HMT.lEl cells at passage 10 by lysis in guanidinium isothiocyanate followed by acid/phenol extraction and isopropanol precipitation. Poly (A)+ RNA was selected on oligo-dT cellulose and used to synthesize double-stranded cDNA using the cDNA CHOICE system (Life Technologies) and a modified oligo-dT primer according to the manufacturer's recommendations. Double stranded cDNA was digested with Dpnl, ligated to linkers, and amplified by PCR using linker-specific primers to generate the tester (90SV) and driver (HMT.lEl) amplicons. The cDNA pools were then subjected to representational difference analysis as described. (Hubank, M. et al., Nucleic Acid Res. 22:5640-5648, 1994) Three rounds of subtraction and amplification of tester-only sequences were performed using tester-to-driver ratios of 1:80, 1:400, and 1 :80, 000. After three rounds, a predominant 350 bp difference product was isolated, digested with Dpnl and subcloned into the BamHI site of pBluescript SK+. Plasmid subclones were screened for differential representation by hybridization to Southern blots of the starting tester and driver amplicons. One of these subclones (RDA 2.15) was selected for further analysis.
TMSl expression constructs: The TMSl cDNA derived from EST yl28a06 (Accession No. HI 6108) was subcloned into pcDNA3.1 (Invitrogen) to generate pcDNA-TMSl . A myc-epitope tag was fused to amino acid 2 of TMSl was generated by PCR and subcloned into pcDNA3.1 to create pcDNAmycTMS 1. A COOH-terminal truncation mutant (mycTMS 1 Δ 100- 195) was created from pcDNAmycTMSl by Klenow fill-in of an internal BamHI site causing a frame, shift at amino acid 100 followed by an in-frame stop codon. An NH2-terminal mutant (pmycTMSlΔ2-99) was derived from pcDNAmycTMSl by deletion of sequences between the myc tag and an internal BamHI site of TMSl, resulting in deletion of amino acids 2-99. Bac Isolation and Radiation Hybrid Mapping: A pooled human BAC library (Release III, Research Genetics) was screened by PCR using TMSl -specific primers in the 3' untranslated region of TMSl 5'-GCACTTTATAGACCAGCA-3' (SEQ ID NO:8) and 5'-ATTTGGTGGGATTGCCAG-3' (SEQ ID NO:9) and four positive BACs were identified. A TMSl positive BAC was digested with Hindlll, cloned into pBluescript SK+, and TMSl positive subclones were identified by colony hybridization to an 175 bp fragment of the TMSl cDNA. A 6 kb genomic Hindlll subclone containing the TMSl gene was identified. Sequence analysis was performed by the Emory University Sequencing Core Facility. The same primers were used in a PCR-based screen of the human/rodent somatic cell hybrid mapping panel 2 (Coriell Cell Repository) to localize TMSl to human chromosome 16. Fine mapping was carried out using radiation hybrid panels (Stanford RH Panel G3 and Stanford RH panel TNG4; Research Genetics). Results were analyzed using the Stanford Human Genome Center RHserver (available at the Stanford University website on the internet) and indicated linkage to markers
SHGC-35326 on the G3 panel (lod score 7.16 ) and SHGC-61092 on the TNG4 panel (lod score 4.91). Methylation-sensitive restriction and Southern blot analysis: Ten μg DNA isolated from 90SV or HMT.lEl cells was digested with 200 units of the methylation-sensitive restriction enzyme Sac II or Eag I for 16 h followed by an additional 16 h digestion with 100 units of the methylation- insensitive enzyme Hindlll. Digested DNA was separated by electrophoresis on a 1% agarose gel, transferred to a nylon filter (Zeta-Probe, BioRAD) and hybridized overnight with a random-prime labeled, 1.8 kb EcoRI TMSl genomic probe. Blots were washed to a final stringency of 0.1 x SSC, 0.1 % SDS at 65°C and exposed to X-ray film using intensifying screens (BioMAX-MS, Kodak). Northern Blot Analysis: One μg poly A+ selected RNA was fractionated on a 1.5% agarose/formaldehyde gel, transferred to nylon filters, and hybridized with a random-prime labeled full length TMS 1 cDNA fragment. Blots were washed to a final stringency of 0.1 x SSC, 0.1 % SDS at room temperature and exposed to X-ray film using an intensifying screen (BioMAX-MS, Kodak). Blots were stripped and re-hybridized with a human β-actin cDNA probe.
RT-PCR: Six μg total RNA was pretreated with DNAse I (Life Technologies) and reverse transcribed using random hexamer primers and MMLV-reverse transcriptase according to the manufacturers instructions (Life Technologies). One/30th of the reverse transcriptase reaction equivalent to 200 ng starting RNA was used directly in a PCR reaction. The PCR reaction conditions were: 67 mM Tris- HC1, pH 8.8, 16.6mM H4SO4, 6.7 μM EDTA, lOmM β-mercaptoethanol, 4.7 mM MgCl2, 10% DMSO, 400 nM each primer in a 25 μl reaction. Hot start PCR was performed using an initial 5 minute incubation at 95°C followed by the addition of 0.5 U Taq polymerase and 35 cycles of PCR (95°C, 30 s; 50-55°C, 60 s; 72°C, 60 s). Primers used for analysis of TMSl were 5'-
TGGGCCTGCAGGAGATG -3' (SEQ ID NO: 13) and 5'-ATTTGGTGGGATTGCCAG -3' (SEQ ID NO:9) with an annealing temperature of 50°C. Primers used for the analysis for β-actin were 5'- CCTTCCTGGGCATGGAGTCCTG -3' (SEQ ID NO: 14) and 5'-GGAGCAATGATCTTGATCTTC - 3' (SEQ ID NO: 15) with an annealing temperature of 55°C. Reaction products were separated by electrophoresis on a 5% or 6% polyacrylamide/Tris-borate-EDTA gel, stained with ethidium bromide and photographed.
Bisulfite Modification and Methylation-specific PCR: Bisulfite modification and methylation- specific PCR were performed as previously described. (Herman, J.G., et al., Proc. Natl. Acad. Sci. U.S.A. 93:9821-9826, 1996) Briefly, 2 μg genomic DNA was denatured by incubation at 37°C in 0.2N NaOH for 10 min. then treated with 3M sodium metabisulfite and 0.5 M hydroquinone at 50°C for 16 h. DNA was desalted using Wizard DNA Clean-Ups (Promega). Modification was completed by the addition of NaOH to a final concentration of 0.3M and DNA was recovered by ethanol precipitation. Approximately 50 ng bisulfite-modified DNA was amplified by PCR with the following reaction conditions: 67 mM Tris-HCl, pH 8.8, 16.6mM NH4S04, 6.7 μM EDTA, lOmM β- mercaptoethanol, 6.7 mM MgCl2, 1 μM each primer in a 25 μl reaction. Hot start PCR was performed using an initial 5 minute incubation at 95°C followed by the addition of 0.5 U Taq polymerase (Life Technologies) and 35 cycles of PCR (95°C, 30 s; 58°C, 30 s; 72°C, 30 s). Reaction products were separated by electrophoresis on a 5% or 6% polyacrylamide gel, stained with ethidium bromide and photographed. Primers were designed from the interpolated sequence following bisulfite conversion assuming the DNA was either methylated or unmethylated at CpG sites within the primer sequence. To ensure maximal discrimination of unmethylated and methylated DNA, each primer was designed to overlap three potential methylation sites, one of which occurred at the 3' end of each primer. Primers utilized in the analysis of TMSl methylation were 5'- GGTTGTAGTGGGGTGAGTGGT -3' (SEQ ID NO: 16) and 5'-CAAAACATCCATAAACAACAACACA -3' SEQ ID NO: 17) for the unmethylated reaction, and 5'- TTGTAGCGGGGTGAGCGGC -3' (SEQ ID NO: 18) and 5'-
AACGTCCATAAACAACAACGCG -3* (SEQ ID NO: 19) for the methylated reaction. Colony Formation Assays: Breast cancer cells, including Hs57 8t, (3 x 105) were seeded into six well dishes and transfected with 1 μg pcDNA3.1 or the TMSl expression constructs using 5 μl Lipofectamine reagent (Life Technologies). Twenty-four hours after transfection, cells were diluted 1 : 100-1:500 and seeded into 100 mm dishes in medium containing 400 μg/ml G418. After 14 days of selection, stable G418-resistant colonies were fixed and stained with 50% methanol, 0.25%) crystal violet, and counted. The total number of colonies recovered per transfection cells was extrapolated from counting at least 300 G418r colonies per experiment. The number of colonies recovered from cells transfected with pcDNA3.1 in each experiment was considered to be 100%. Three independent transfection experiments were performed.
Apoptosis Assays: 293 human embryonic kidney cells were plated on glass coverslips in 24 well dishes at 1 x 105 cells per well, and were transfected with 0.4 μg of pcDNA3.1 or the TMSl expression constructs plus 0.1 μg β-galactosidase expression vector (pCMVβgal, Clonetech) using the calcium phosphate precipitation method. Where indicated, 40 μM zVADftnk (Enzyme System Product, Livermore, CA) was included during the recovery period. Forty-eight hours after transfection, coverslips were fixed in 4% paraformaldehyde and stained for β-galactosidase activity, using X-gal, and for nuclear moφhology, using Hoecsht 33528 dye. Cells were visualized by phase contrast microscopy. At least 200 β-galactosidase positive cells from randomly selected fields were counted from each transfection. Apoptotic cells were distinguished based on moφhologic features typical of adherent cells undergoing apoptosis, including becoming condensed, rounded and detached from the growth surface as described. (McCarthy, J.V. et al., J.Biol.Chem. 273:16968-16975, 1998). At least 200 β-galactosidase positive cells from randomly selected fields were counted from each transfection. Each transfection experiment was repeated three times.
Results
At present, the mechanism in which CpG islands become abnormally methylated is not known, but this event can be induced in human somatic cells by ectopic expression of DNA methyltransferase- 1 (DNMTl). Human fibroblasts overexpressing DNMTl undergo progressive de novo methylation of endogenous CpG island sequences. (Vertino, P.M. et al., Mol.Cell Biol. 16:4555- 4565, 1996) To identify potential downstream targets of methylation-mediated gene silencing, cDNA representational difference analysis was used to isolate genes that were down-regulated in cells overexpressing DNMTl (referred to as HMT.lEl) relative to the immortalized human fibroblasts (90SV) from which they were derived. (Hubank, M. et al., Nucleic Acid Res. 22:5640-5648, 1994) After three rounds of subtraction, a predominant 350 bp fragment (RDA-2.15) was isolated, and shown to be differentially represented in cDNA derived from 90SV and HMT.lEl cells. Figure la shows the presence of the 350 bp fragment in 90SV cells but not HMT.lEl.
Sequence analysis and BLAST homoiogy searches of the Genbank and dbEST databases indicated that RDA-2.15 was derived from a novel gene represented by multiple human ESTs that defined a tentative human consensus (THC253346 , TIGR Human Gene Index) as well as a unique Unigene cluster (Hs. 71869, NCBI Unigene project). A 770 bp cDNA was assembled from the complete sequence of two EST clones (yl28a06 and qwl 3b06) that overlapped the entire Unigene cluster. The assembled cDNA sequence contains a 588 bp ORF with 5' and 3' UTRs of 74 bp and 97 bp, respectively, and includes the poly(A) tail. No additional 5' sequence was obtained using a 5' rapid amplification of cDNA ends protocol indicating that the cDNA sequence was full-length.
The TMSl cDNA probe hybridized to a ~ 0.8 kb message which was expressed at low, but clearly detectable levels in IMR90 normal human diploid fibroblasts and their immortalized derivatives, the 90SV cells (Figure lb). The same message was undetectable by Northern blot analysis in the DNMTl overexpressing cell line, HMT.lEl, confirming that the gene identified by RDA was silenced in HMT.lEl cells.(Figure lb). The same blot was stripped and rehybridized with a β-actin probe, revealing a ~ 2.4 kb band of equal intensity in all cell samples tested and confirming that the absence of TMS 1 in HMT.1E1 was specific to that transcript, and probably not the result of unequal RNA loading. The exposure time for TMSl was 3 days whereas that for β-actin was 4 hours. Reverse-transcriptase polymerase chain reaction (RT-PCR) was also performed with the same cell lines. An amplified band corresponding to TMSl was detected in IMR90 and 90SV but not in HMT.lEl . No band was detected in any sample in the absence of reverse transcriptase, confirming that the amplified band derived from RNA rather than genomic DNA. Again, amplification with β- actin specific primers resulted in an equal intensity band in all samples, indicating that the absence of a TMSl transcript was most probably not the result of unequal sample loading. The differentially expressed gene was named TMSl for target of methylation- induced silencing-1.
Restriction mapping and Southern blot analysis of the TMSl locus confirmed that the absence of TMSl expression in the HMT.lEl cells was not a result of gene deletion or gross chromosomal rearrangement. To determine whether loss of TMSl expression in the HMT.lEl cells was related to methylation of the TMSl gene, the genomic structure of TMSl was first determined by partial sequencing of a human genomic BAC clone. Intron/exon boundaries were determined by comparison of the cDNA and genomic sequence. The TMSl locus is composed of a coding region of- 1.8 kb including three exons of 449 bp (SEQ ID NO:5), 58 bp (SEQ ID NO:7), and 355 bp (SEQ ID NO:9) size (Figure 2a). The first and third exons also contain 5 'and 3' untranslated regions at their beginning and end, respectively. A -600 bp CpG island was identified in the 5' end of TMSl surrounding exon 1. This region showed a high C + G content (69%), a CpG/GpC ratio of 0.82, and the presence of multiple sites for methylation-sensitive, CpG-recognizing restriction enzymes that often cluster within CpG islands (SacII, Eagl, BssHII, Smal) (Figure 2a). (Bird, A.P., Nature 321, 209-213, 1986) Other restriction sites located in this locus include 2 Hindlll sites and 2 EcoRI sites.
Examination of the methylation status of the TMSl CpG island by Southern blot analysis using methylation-sensitive restriction enzymes in the TMSl expressing (IMR90 and 90SV) and non- expressing (HMT.lEl) cells indicated that silencing of TMSl correlated with hypermethylation of the TMSl CpG island (Figure 2b). The probe used was the 1.8 kb EcoRI TMSl genomic fragment, containing the first and second exons. Hindlll digestion alone released a - 6 kb genomic fragment containing the entire TMSl locus. Absence of methylation at SacII sites within the CpG island is indicated by bands of 4.4 kb, 1.4kb and 0.23 kb. The 5' most SacII site (*Sa, see Figure 2a) was found to lie outside the CpG island and was methylated in all normal tissue samples tested. Absence of methylation at the Eagl site is indicated by bands of 1.2 kb and 4.8 kb. Hindlll plus SacII digestion of IMR90 DNA resulted in three bands of 4.4 kb, 1.4 kb and 0.23 kb size. Similar digestion of DNA from 90SV cells revealed bands of 6 kb, 4.4 kb, 1.6 kb, 1.4 kb and 0.23 kb. HMT.lEl DNA digestion with Hindlll and SacII resulted only in the 6 kb band. Digestion of SV90 DNA with Hindlll and Eagl revealed three bands of sizes 6.0 kb, 4.8 kb, and 1.2 kb. Again, HMT.lEl DNA was not further digested with Eagl. These results indicated that IMR90 normal diploid fibroblasts were unmethylated at SacII and Eagl sites within the TMSl CpG island. However, the TMSl CpG island exhibited a partially methylated pattern in the 90SV cells, with both methylated and unmethylated alleles present in the population (Figure 2b). This result is similar to some other CpG islands which have been studied in this model system which have accumulated some methylation as result of immortalization, prior to insertion of DNMTl. (Vertino, P.M. et al., Mol.Cell Biol. 16:4555-4565, 1996) HMT.lEl cells exhibited complete methylation of SacII and Eagl sites in the TMSl CpG island, as observed from its complete protection from digestion with these enzymes (Figure 2b).
The methylation status of the TMSl CpG island was further analyzed by a more sensitive methylation-specific PCR (MSP) technique in which methylated and unmethylated alleles in the population can be specifically amplified following chemical modification of the DNA with sodium bisulfite. (Herman, J.G., et al., Proc.Natl.Acad.Sci.U.S.A. 93:9821-9826, 1996) Bisulfite modified
DNA was used as a template for parallel PCR amplification reactions using primers designed to anneal specifically to unmethylated (U) or methylated (M) DNA. The product of the methylated reaction was 191 bp, and that of the unmethylated reaction was 196 bp due to differences in the length of the primers. The primers used for the reactions were located in the first exon. IMR90 DNA was amplified only in the unmethylated reaction, HMT.1E1 DNA was amplified only in the methylated reaction and DNA from 90SV was amplified in both. These data were consistent with those obtained by methylation-sensitive restriction analysis and confirmed that the IMR90 cells were unmethylated and the 90SV cells were partially methylated whereas the HMT.lEl cells were fully methylated at the TMSl CpG island (Figure 2c). These data indicated that overexpression of DNMTl in the HMT.l El cells promoted both hypermethylation of the TMSl CpG island and silencing of TMSl. Several CpG island loci that are methylated and silenced in human tumors are also subject to de novo methylation in the DNMTl overexpression model. In particular, the CpG islands of the E- cadherin, estrogen receptor and HIC1 genes are progressively de novo methylated in the DNMTl overexpressors (although not expressed in fibroblasts), and are methylated and silenced in human breast and other tumors. (Graff, J.R., et al., Cancer Res. 55:5195-5199, 1995; Vertino, P.M. et al., Mol.Cell Biol. 16:4555-4565, 1996; Fujii, H., et al., Oncogene 16:2159-2164, 1998; Ottaviano, Y.L., et al., Cancer Res. 54:2552-2555, 1994) To determine whether TMSl was also a target for methylation-associated silencing in human cancer, the expression of TMS 1 and the methylation status of the TMSl CpG island in primary human mammary epithelial cells (HMEC), two immortal, non- tumorigenic breast epithelial cell lines, (Hs578Bst and MCF10A) and six breast cancer cell lines (MCF-7, T47-D, ZR-75-1, Hs578t, MDA MB231 and MDA MB468) were determined. Parallel amplifications were performed as described above. Expression levels were determined by RT-PCR with β-actin controls. TMSl was predominantly unmethylated and expressed in HMEC cells and the two immortalized, non-tumorigenic breast epithelial cell lines (Figure 3a and b). In stark contrast, 3 of 6 breast carcinoma cell lines (ZR75-1, Hs578t and MB231) were completely methylated at the TMSl CpG island locus and similarly did not express TMSl (Figure 3a and b). As seen in the fibroblast system, breast cancer cell lines that were either completely unmethylated (MCF-7) or only partially methylated (T47D, MDA MB468) at the TMSl CpG island retained expression of TMSl (Figure 3a and b).
The ZR75-1 , Hs578t and MDA MB231 breast cancer cell lines exhibited complete methylation of TMSl and failed to express TMSl message. If loss of TMSl expression is directly related to methylation of the CpG island, then expression of TMSl should be restored following treatment with a demethylating agent. Treatment of ZR75-1, Hs578t and MDA MB231 cells with the DNA methyltransferase inhibitor 5-aza-2'-deoxycytidine at 0.5 μM concentration for 3 days resulted in the partial demethylation of the TMSl CpG island and re-expression of TMSl transcript (Figure 3C and D). Methylation of the TMSl CpG island was analyzed by methylation specific PCR and expression of TMSl was analyzed by RT-PCR with β-actin controls. Control cultures in which the inhibitor was absent did not re-express TMSl. The absence of TMSl expression in these cell lines is therefore not due to abnormalities at the gene level or the inability to express TMSl, for example, due to a lack of necessary transcription factors, but rather is directly related to the methylation of TMSl. That TMSl was abnormally methylated and silenced in a substantial proportion of human breast cancer cells suggested that TMSl provides a novel tumor suppressor function. TMSl exhibited widespread low level expression in human tissues, with the greatest expression in colon, spleen, small intestine, lung and peripheral blood leukocytes (Figure 4a). TMSl transcripts were also observed in heart, thymus, kidney, liver and placenta. Interestingly, TMSl was silent in other human tumor cell lines, including Molt 4 lymphocytic leukemia cells and HeLa cervical carcinoma cells (Figure 4b). Cell lines HL60, K562, Raji, SW480, A549 and G361 all expressed varying degrees of TMSl.
The cDNA sequence indicated that TMSl encodes a predicted protein of 195 amino acids and 25 kDa. Through a combination of BLAST homoiogy searches of Genbank and the SMART domain recognition database, it was discovered that TMSl contained a carboxy-terminal caspase recruitment domain (CARD). (Schultz, J. et al., Proc.Natl.Acad.Sci.U.S.A. 95:5857-5864, 1998) An amino acid alignment of the TMSl carboxy-terminus with the CARD motif of other apoptotic signaling proteins is shown in Figure 5a. Numbers in parentheses indicate the position in the amino acid sequence. Reverse type indicate >50% amino acid identity; gray shading indicates >50% similarity through conserved amino acid substitutions.
The presence of a CARD indicates that TMS 1 can play a role in apoptosis. To test this hypothesis, the effect of ectopic TMSl expression on apoptosis in 293 cells was analyzed. 293 cells were transfected with 0.4μg of the indicated TMSl expression construct and 0.1 μg pCMVβ-gal. Forty-eight hours after transfection cells were stained with X-gal and at least 200 β-galactosidase cells were counted for each condition. Data (mean ± SD) represent the percentage of β-galactosidase positive cells exhibiting moφhologic apoptosis. Three independent transfection experiments were performed. Expression of wild-type TMSl, a myc tagged TMSl, or a deletion mutant expressing only the CARD (mycTMSlΔ2-99) induced apoptosis when transiently transfected into 293 cells (Figure 5b). Deletion of the CARD (mycTMSlΔ100-195) abolished the proapoptotic activity of TMSl and more closely approximated the level of apoptosis induced by vector alone (Figure 5b). Apoptotic activity was slightly diminished when the CARD was used alone. Given the proapoptotic function of TMS 1 , the consequences of TMS 1 silencing were determined by re-introducing TMSl into breast cancer cells lacking endogenous TMSl expression. Colony forming ability of TMSl negative breast cancer cells stably transfected with TMSl expression constructs was analyzed in the following manner. Hs578t cells were transfected with the pcDNA3.1 vector or the indicated TMSl expression construct. Twenty-four hours after transfection, cells were plated at limiting dilution in G418 selection medium. Stable G418-resistant colonies remaining after 14 days were fixed and stained with crystal violet. Data (mean + SD) represent the percentage of surviving colonies relative to the vector control from three independent transfection experiments. The total number of colonies in the controls ranged from 2967-3700 between experiments. Stable expression of wild-type TMSl, or TMSl derivatives capable of inducing apoptosis, inhibited colony formation in Hs578t cells by about 70% (Figure 5c). In contrast, expression of the apoptosis- incompetent, CARD-deleted TMSl mutant had a much reduced effect, and reduced colony formation by only 40%> (Figure 5c). Therefore, TMSl functions in the promotion of apoptosis and this activity is mediated by the CARD.
Abnormal methylation of gene-associated CpG islands is well recognized as a mechanism associated with loss of tumor suppressor gene expression in human cancers. (Baylin, S.B., et al., Adv.Cancer Res. 72, 141-196, 1998; Jones, P.A. et al., Nat.Genet. 21 : 163-167, 1999) However, it has been unclear whether methylation plays a causative role in carcinogenesis because it is not known whether abnormal methylation is sufficient to precipitate the silencing of an active, endogenous gene. TMSl is the first gene to be identified in a functional screen for such methylation-induced gene silencing events. The finding that TMSl is abnormally methylated and silenced in response to overexpression of DNMTl is interesting for two reasons. First, it suggests that methylation can drive gene silencing in vivo, perhaps through the binding of methylated DNA binding proteins and the recruitment of histone deacetylase complexes. (Jones, P.L., et al. Nat.Genet. 19: 187-191, 1998; Nan, X., et al., Nature 393: 386-389, 1998) Secondly, increased expression of DNMTl is transforming, and was recently shown to be an early downstream effector of oncogene- induced transformation. (Wu, J., et al. Proc.Natl.Acad.Sci.U.S.A. 90:8891-8895, 1993; Bakin, A.V. et al., Science 283:387-390, 1999) Taken together, these data are consistent with a direct role for abnormal methylation in gene silencing and tumorigenesis.
Genetic alterations that lead to cellular resistance to apoptosis, such as mutational inactivation of proapoptotic genes such as TP53 and BAX, or translocation and activation of anti-apoptotic genes like BCL2, promote tumorigenesis by allowing damaged or unnecessary cells to persist and accumulate further genetic insult. (Pan, H., et al., Cancer Surv. 29:305-327, 1997) These data suggest that epigenetic alterations that result in the silencing of a proapoptotic gene such as TMS 1 may provide a similar survival advantage. These data extend the role of abnormal methylation in carcinogenesis to include the silencing of genes that act as positive mediators of cell death. These data support a role for abnormal methylation in the epigenetic silencing of TMSl, and implicate TMSl as a novel tumor suppressor for breast and other cancers.
EXAMPLE 2: Methods and Materials Plasmids: pcDNA-TMSl and pcDNA-mycTMS 1 have been described previously. (Salvesen, G. S. and Dixit, V. M. Cell. 91: 443-446, 1997) The TMSl COOH-terminal truncation mutant (mycTMSlΔ100-195) was created from pcDNA-mycTMS 1 by Klenow fill-in of an internal BamHI site, resulting in a frame-shift at amino acid 100 followed by an in-frame stop codon. DN-caspase-8 and DN-caspase-9 constructs were gifts from K. Bhalla. (Muzio, M., et al. Cell. 85: 817-827, 1996; Li, P., et al. Cell. 91: 479-489, 1997) The NF-kB CAT (pJECAT2.6) and mutant NF-kB CAT
(p2.6mκBl) constructs were gifts from J. Boss. (Ping, D., et al. J. Immunol. 162: 727-734, 1999) Creation of TMSl Inducible Expression Cells: The Ecdysone-Inducible Mammalian Expression System (Invitrogen, Carlsbad, CA) was used to create clones of 293 cells that inducibly express mycTMSl . The mycTMSl cDNA was cloned into the Hindlll/Xhol sites of the pIND expression vector (pIND-mycTMSl). EcR-293 cells (Invitrogen, Carlsbad, CA) containing the pVgRXR vector were transfected with pIND-mycTMSl or pIND using Lipofectamine Reagent (Life Technologies, Grand Island, NY). Cells were maintained in selection medium containing 600 μg/ml G418 for 3 weeks to isolate stably transfected colonies. Clonal populations transfected with pIND-mycTMSl were then tested for inducible expression by western blot analysis after addition of 5 μM pon A. Cell Culture and Transfection: Human embryonic kidney 293 cells and EcR-293 derivatives (MTMS22 and PIND 1 ) were cultured in DMEM (Life Technologies, Inc. Grand Island, NY) supplemented with 10%) fetal bovine serum. MTMS22 and PIND1 cells were maintained in the presence of 400 μg/ml zeocin and 600 μg/ml G418. Transfections of 293 cells were carried out in 24- well dishes with 1X105 cells and 0.5 μg total DNA per well using the calcium phosphate method. As a transfection marker, a β-gal expression vector (β-gal CMV) was included at a 1 :4 ratio with the indicated cDNA constructs. In co-transfections with DN-caspase-8 or DN-caspase-9, 0.2 μg of pcDNA-TMSl was transfected with 0.2 μg of pcDNA3.1 or DN-caspase-8 or -9 along with 0.1 μg of β-gal CMV as a transfection control.
Morpholosical Apoptosis Assay: 48 h after transfection, 293 cells were fixed on coverslips and stained for β-gal activity. Nuclei were stained using Hoechst 33258 dye (Sigma, St. Louis, MO). Transfected (blue) cells were examined for moφhologic changes indicative of adherent cells undergoing apoptosis including cell rounding and reduction in size, nuclear fragmentation and membrane blebbing.
DNA Fragmentation: Where indicated, MTMS22 cells were treated with 5 μM pon A (Invitrogen) or 40 μM Z-VAD-fmk (Enzyme System Products, Livermore, CA ). DNA was collected from 2X106 cells as previously described. (Burow, M. E., et al. Cancer Research. 58: 4940-4946, 1998) 5 μg of DNA from each sample was visualized by separation on a 2% agarose gel containing ethidium bromide.
CAT Assay for NF-κB Activation: 293 cells plated at 60%) confluence in 6 well dishes were transfected with 0.2 μg of the NF-κB CAT reporter construct (pJECAT2.6) and increasing amounts of pcDNA-mycTMS 1 by the calcium phosphate method. 0.2 μg of β-gal CMV was included as a transfection control, and the total amount of DNA transfected was kept constant at 2 μg with pcDNA3.1. Cell lysates were collected 36 h after transfection in β-gal lysis buffer (Promega, Madison, WI) and assayed for β-gal activity using the β-Galactosidase Enzyme Assay System (Promega, Madison, WI) per manufacturer's instructions. CAT assays were performed basically as described. (Ausubel, F. M., et al. Curr. Prot. Mol. Biol., Vol. 2, pp. 9.7.5-9.7.6: John Wiley & Sons, Inc, 1997) In brief, cell lysates were incubated with [14C]chloramphenicol and n-butyryl CoA. [14C]- labeled acetylated chloramphenicol was then separated from the nonacetylated form by organic phase extraction, and radioactive counts were determined using a scintillation counter. Fluorescence Microscopy: Cells were fixed in 4% formaldehyde, per eabilized in 0.2% triton X-100 in PBS and blocked with 3% BSA/.02% triton X-100 in PBS. Coverslips were incubated with myc antibody (9E10) (Santa Cruz Biotechnology, Santa Cruz, CA) at a 1:500 dilution, washed 4 times in PBS/.02% triton X-100 and incubated with a secondary FITC antibody at a 1 :2000 dilution. After 3 more washes, cells were stained with Hoechst 33258 dye to visualize nuclei, washed twice in PBS and mounted on slides. Cells were viewed at 400X or 1000X using the Olympus BX60 microscope. Digital images were captured using IP Lab Spectrum v.3.1 software (Scanalytics, Inc., Fairfax, VA).
Results
An ecdysone-regulated expression system was used to create a 293 cell line that inducibly expresses TMSl. A clonal population (called MTMS22) that exhibited no detectable background expression of TMSl and high inducible expression in the presence of the ecdysone analog, pon A, was isolated and used for the following studies. In addition, a clonal population of cells stably transfected with the empty expression vector was isolated as a control (PIND1). Upon addition of pon A to the MTMS22 cells, mycTMSl was detectable by western blotting as early as 6 hours after treatment and continued to accumulate in the cells over 48 hours (Figure 6A). To determine whether TMSl had an effect on cellular proliferation, MTMS22 cells were counted over a 96-hour period in the presence or absence of pon A. By 48 hours after induction of TMSl, cells had begun to round up and lift off the plates (data not shown) and cell growth was significantly inhibited (Figure 6B). By 96 hours, pon A- treated cells were declining in number, confirming cell death. As a biochemical marker for apoptosis, MTMS22 cells were examined for DNA fragmentation in the presence or absence of TMSl expression. Upon induced expression of TMSl, DNA laddering was observed as early as 16 hours and was most evident at 48 hours (Figure 6C). To address whether the death- inducing effects of TMSl were caspase-dependent, these experiments were also carried out in the presence of the general caspase inhibitor, Z-VAD-fmk. Addition of Z-VAD blocked both TMSl-induced cell death (Figure 6B) and DNA fragmentation (Figure 6C). Neither pon A or Z-VAD had any effect on the growth of pINDl control cells (data not shown). These data indicate that TMSl expression induces apoptosis, and this activity is dependent on caspase activation.
To identify candidate caspase pathways in which TMSl functions, the ability of dominant negative (DN) forms of the initiator caspases, caspase-8 and -9 to block TMSl-induced apoptosis was tested. 293 cells were transiently transfected with TMSl alone or TMSl plus DN-caspases-8 or DN- caspase-9 and examined for moφhological changes associated with apoptosis. Ectopic expression of TMSl resulted in a 6-fold increase in cell death (Figure 7A). The apoptotic activity of TMSl was not affected by DN-caspase-8; in contrast, DN-caspase-9 significantly inhibited TMSl-induced apoptosis. The ability of DN-caspase-9 to block cell death induced by TMSl was similar to the effect seen with the general caspase inhibitor, Z-VAD. These data show that the proapoptotic activity of TMSl is mediated at least in part through the activation of caspase-9. In addition to the ability to trigger or enhance apoptosis, several CARD-containing proteins have been shown to activate the transcription factor, NF-κB. To test whether TMSl was able to induce NF-κB activated transcription, 293 cells were co-transfected with an NF-kB-responsive CAT reporter construct along with increasing amounts of TMSl. TMSl expression had no effect on NF- κB-dependent transcriptional activation (Figure 7B). In contrast, the addition of TNF3-α induced a 15- fold increase in activation.
To determine the subcellular localization of TMSl, MTMS22 cells induced to express TMSl were examined by immunofluorescence. Sixteen hours after induction, TMSl showed diffuse cytoplasmic staining (Figure 8A). However, by 24 h, a fraction of the cells showed a punctate fluorescent pattern, and by 48 h, a majority of the cells contained the punctate staining and lacked diffuse cytoplasmic staining. Under high power, the TMSl aggregates appeared as hollow, spherical structures made up of many smaller balls (Figure 8B). For a majority of the cells, there appeared to be only one structure per cell, located in close proximity to the nucleus. Redistribution of TMSl from the cytoplasm to the aggregates correlated with partial detachment of the cells from the growth surface, resulting in increased refraction of light when viewed by phase contrast microscopy (Figure 8A). The timing of TMSl relocalization following induction coincided with TMSl-induced cell death and the appearance of DNA fragmentation (compare Figure 8A to Figure 6B, 6C). An intriguing result was observed in cells expressing TMSl in the presence of Z-VAD. Although Z-VAD was able to block the apoptotic effects of TMSl (Figure 6B, 6C), it had no effect on the formation of the TMS1- containing spherical aggregates (Figure 8B). Therefore, TMSl aggregate formation is not a downstream effect of apoptosis, but rather appears to be an intermediate event that lies upstream of caspase activation.
To test the importance of the CARD region for the function and localization of TMSl, a truncated form of TMSl lacking the C-terminal CARD was compared to full length TMSl in its ability to induce apoptosis and to localize to the spherical structures. Transient expression of mycTMSl induced apoptosis in 293 cells, whereas deletion of the CARD (mycTMSlΔlOO-195) abolished the proapoptotic activity (Figure 9A). Western blot analysis confirmed that both TMSl proteins were expressed at equal levels (Figure 9B). Deletion of the CARD also affected subcellular localization of TMSl. Whereas wild-type TMSl localized to the aggregates, TMSl lacking the CARD remained almost exclusively cytoplasmic (Figure 9C). Thus, both the proapoptotic activity and the localization of TMSl to spherical structures are dependent on the CARD. TMS1 is a novel CARD-containing protein that, with the exception of the CARD, is structurally unrelated to other known CARD adaptor and regulatory proteins. Ectopic expression of TMSl alone was able to trigger apoptosis in 293 cells, and cell death correlated with relocalization of TMSl from the cytoplasm to perinuclear, ball-like structures. Several lines of evidence support the idea that redistribution of TMSl is an intermediate step in a TMS 1 -triggered apoptotic pathway. First, the aggregate structures were formed in the absence of caspase activity, implying that TMS 1 aggregation is not a consequence of apoptosis, but rather is an event that occurs upstream of caspase activation. In addition, deletion of the CARD region of TMSl inhibited aggregate formation and abolished the proapoptotic activity of TMSl, suggesting that aggregation and the CARD is necessary for TMSl-induced apoptosis. Thus, aggregation of TMSl appears to be a causative event in TMS1- triggered cell death.
Relocalization and aggregation of apoptotic signaling proteins appears to be an important step in caspase activation. FADD and caspase-8 have been shown to redistribute into ordered, subcellular filaments in cells transfected with FADD. (Siegel, R. M., et al. J. Cell Biol.. 141: 1243-1253, 1998; Perez, D. and White, E. J. Cell Biol. 141: 1255-1266, 1998) Localization of FADD and caspase-8 was dependent on their death effector domains, and disruption of the filaments blocked FADD- induced apoptosis. Similarly, Apaf-l, procaspase-9 and cytochrome c have been shown to shift into large, multimeric complexes (>1.3xl03 kDa) termed apoptosomes to initiate caspase-9 activation. (Zou, H., et al. J. Biol. Chem. 274: 11549-11556, 1999) Based on these and similar studies is the induced-proximity model which proposes that clustering of receptors and/or adaptor proteins with procaspases leads to caspase activation. (Salvesen, G. S. and Dixit, V. M. Proc. Natl. Acad. Sci. USA. 96: 10964-10967, 1999) Overexpression of TMSl results in CARD-mediated clustering of the protein, and the structures that are formed may include other proteins whose association can trigger caspase activation and apoptosis. The data presented herein show that the proapoptotic activity of TMSl was caspase- dependent, and in particular required the activity of caspase-9. Caspase-9 is involved in the activation of apoptosis following release of cytochrome c from the mitochondria, an almost universal phenomenon during apoptosis triggered by numerous stimuli, including DNA damage and various chemotherapeutic agents. (Kuida, K., et al. Cell. 94: 325-337, 1998; Hakem, R., et al. Cell. 94: 339- 352, 1998) The data therefore indicate that TMSl acts as part of a signaling cascade for initiating activation of caspase-9 in response to certain external stimuli.
Several CARD-containing proteins including RICK/RIP2, CARD4/Nodl and BCL10/CIPER CLAP have been shown to trigger NF-κB-mediated transcription, in addition to playing a role in caspase activation. (Willis, T. G., et al. Cell. 96: 35-45, 1999; Zhang, Q., et al. Nature Genet.. 22: 63-68, 1999; Inohara, N., et al. J. Biol. Chem. 273: 12296-12300, 1998;
McCarthy, J. V., et al. J. Biol. Chem. 273: 16968-16975, 1998; Bertin, J., et al. J. Biol. Chem. 274: 12955-12958, 1999; Inohara, N, et al. J. Biol. Chem. 274: 14560-14567, 1999; Koseki, T, et al. J. Biol. Chem. 274: 9955-9961, 1999; Srinivasula, S. M., et al. J. Biol. Chem. 274: 17946-17954, 1999) Activation of NF-κB by DNA damaging agents or TNF-cc can act as part of a regulatory feedback loop that operates to prevent cell death, most likely by inducing expression of anti-apoptotic genes. (Baichwal, V. R. and Baeuerle, P. A. Current Biology. 7: R94-R96, 1997) Indeed, NF-κB target gene products including cIAP-1, cIAP-2, TRAF1 and TRAF2 have been shown to protect cells from apoptosis induced by TNF-α. (Wang, C.-Y., et al. Science. 281: 1680-1683, 1998) TMSl had no effect on the activation of NF-κB.
Genetic alterations that provide resistance to apoptosis promote tumorigenesis by allowing cancer cells to persist and accumulate further genetic damage. (Pan, H., et al. Cancer Surv. 29: 305- 327, 1997) Genetic changes affecting the function or expression of CARD proteins can provide such a survival advantage. The gene encoding the proapoptotic CARD-containing protein BCL10 is subject to translocation in MALT B cell lymphomas, resulting in a variety of truncation mutations that disrupt the ability of BCL10 to activate apoptosis. (Willis, T. G., et al. Cell. 96: 35-45, 1999; Zhang, Q., et al. Nature Genet. 22: 63-68, 1999) Likewise, the TMSl gene locus has been shown herein to be silenced by aberrant DNA methylation in human breast cancers. Given the proapoptotic function of TMSl described herein, loss of expression of this CARD-containing protein through epigenetic alterations can provide cancer cells with a means to escape apoptosis. Since the effects of TMSl are caspase-9- dependent, loss of TMS 1 expression may disrupt normal apoptotic responses to DNA damage or cellular stress, thus providing resistance to some anti-cancer therapies including some forms of irradiation as well as select chemotherapeutic agents.
Equivalents It should be understood that the preceding is merely a detailed description of certain embodiments. It therefore should be apparent to those of ordinary skill in the art that various modifications and equivalents can be made without departing from the spirit and scope of the invention, and with no more than routine experimentation. It is intended to encompass all such modifications and equivalents within the scope of the appended claims.
All references, patents and patent applications that are recited in this application are incoφorated by reference herein in their entirety. What is claimed is presented below and is followed by a Sequence Listing.
I claim:

Claims

Claims
1. A method for identifying a subject at risk of developing a tumor characterized by abnormal methylation of a CpG island containing TMSl nucleic acid molecule comprising determining a level of methylation of a CpG island containing TMSl nucleic acid molecule in a biological sample from a subject, and comparing the level of methylation of the CpG island containing TMSl nucleic acid molecule in the biological sample to a control wherein the CpG island containing TMSl nucleic acid molecule is selected from the group consisting of (a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule consisting of SEQ ID NO:4 and which code for a native TMSl polypeptide, and (b) complements of (a), and wherein an increase in the level of methylation of the CpG island containing TMSl nucleic acid molecule in the biological sample compared to the control identifies a subject at risk of developing the tumor.
2. The method of claim 1, wherein the level of methylation is determined using a technique selected from the group consisting of methylation sensitive restriction analysis, methylation specific polymerase chain reaction (MSP), sequencing of bisulfite modified DNA, methylation-sensitive single nucleotide primer extension (Ms-SNuPE), and combined bisulfite restriction analysis (COBRA).
3. The method of claim 1, wherein the biological sample is breast tissue.
4. The method of claim 1, wherein the control comprises a normal tissue from a normal subject.
5. A method for determining a risk of developing a disorder characterized by abnormal methylation of a CpG island containing TMSl nucleic acid molecule comprising measuring a level of an expression product of a CpG island containing TMSl nucleic acid molecule, by contacting a biological sample isolated from a subject with an agent that selectively binds to a target expression product selected from the group consisting of
(a) nucleic acid expression products which hybridize under stringent conditions to a complement of a molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NO:2 and SEQ ID NO:24 and which code for a native TMSl polypeptide, and
(b) polypeptide expression products, and fragments thereof, of (a), determining a level of interaction between the agent and the target expression product, and comparing the level of interaction between the agent and the target expression product with a control.
6. The method of claim 5, wherein the control comprises a normal tissue from a normal subject.
7. The method of claim 5, wherein a decrease in the level of interaction between the agent and the target expression product in the biological sample compared to the control indicates a risk of developing the disorder.
8. The method of claim 5, wherein the disorder is cancer.
9. The method of claim 8, wherein the cancer is breast cancer.
10. The method of claim 5, wherein the agent is a nucleic acid molecule.
11. The method of claim 5, wherein the agent is a peptide.
12. The method of claim 11, wherein the peptide is an antibody or a fragment thereof.
13. A method for treating a subject at risk of developing a disorder characterized by abnormal methylation of a CpG island containing TMSl nucleic acid molecule comprising administering a demethylating agent to a subject in need of such treatment in an amount effective to maintain a normal level of methylation in a CpG island containing TMSl nucleic acid molecule in a tissue of the subject, wherein the CpG island containing TMSl nucleic acid molecule is selected from the group consisting of
(a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule comprising SEQ ID NO:4, and which code for a native TMSl polypeptide, and (b) complements of (a).
14. The method of claim 13, wherein the demethylating agent is administered to a tissue at risk of developing a tumor.
15. The method of claim 13, wherein the demethylating agent is an inhibitor of methyltransferase.
16. The method of claim 15, wherein the inhibitor of methyltransferase is selected from the group consisting of 5-azacytidine, 5-aza-2'deoxycytidine, 5, 6-dihydro-5-azacytidine, 5-fluorocytidine and 5-fluoro-2'deoxycytidine.
17. The method of claim 13, wherein the demethylating agent is conjugated to a nucleic acid molecule selected from the group consisting of
(a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule comprising SEQ ID NO: 1, and
(b) complements of (a).
18. The method of claim 13, wherein the disorder is cancer.
19. The method of claim 18, wherein the cancer is breast cancer.
20. The method of claim 13, further comprising first selecting a subject at risk of developing the disorder.
21. A method for treating a subject having or at risk of developing a disorder characterized by abnormal methylation of a CpG island containing TMSl nucleic acid molecule comprising administering a CARD containing molecule to a subject in need of such treatment in an amount effective to increase CARD polypeptide level in a tissue of the subject, wherein the CARD containing molecule is selected from the group consisting of a CARD containing nucleic acid molecule or a CARD containing polypeptide.
22. The method of claim 21, wherein the CARD containing molecule is a TMSl molecule.
23. The method of claim 22, wherein the TMSl molecule is selected from the group consisting of a TMS 1 nucleic acid molecule or a TMS 1 polypeptide.
24. The method of claim 21 , wherein the CARD containing nucleic acid molecule has an nucleotide sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:2, SEQ ID NO:9, SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24.
25. The method of claim 21, wherein the CARD containing polypeptide has an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25.
26. The method of claim 21 , wherein the CARD containing molecule is administered to a tissue having or at risk of developing a tumor.
27. The method of claim 21 , wherein the disorder is cancer.
28. The method of claim 27, wherein the cancer is breast cancer.
29. The method of claim 21 , further comprising first selecting a subject having or at risk of developing the disorder.
30. A method for treating a subject having a disorder characterized by abnormally low levels of a TMS 1 expression product comprising administering a demethylating agent to a subject in need of such treatment in an amount effective to reduce a level of methylation in a CpG island containing TMSl nucleic acid molecule in a cell of the subject, wherein the CpG island containing TMSl molecule is selected from the group consisting of
(a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule comprising SEQ ID NO:4, and which code for a native TMSl polypeptide, and
(b) complements of (a).
31. The method of claim 30, wherein the demethylating agent is administered to a tissue at risk of developing a tumor.
32. The method of claim 30, wherein the demethylating agent is an inhibitor of methyltransferase.
33. The method of claim 32, wherein the inhibitor of methyltransferase is selected from the group consisting of 5-azacytidine, 5-aza-2'deoxycytidine, 5, 6-dihydro-5-azacytidine, 5-fluorocytidine and 5- fluoro-2'deoxycytidine.
34. The method of claim 30, wherein the demethylating agent is conjugated to a nucleic acid molecule selected from the group consisting of
(a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule comprising SEQ ID NO: 1, and
(b) complements of (a).
35. ' The method of claim 30, wherein the disorder is cancer.
36. The method of claim 35, wherein the cancer is breast cancer.
37. The method of claim 30, wherein the level of methylation in the CpG island containing TMSl nucleic acid molecule is reduced compared to a pre-treatment level of methylation.
38. A method for treating a subject having or at risk of having a disorder characterized by abnormally low levels of a TMSl expression product comprising administering a CARD containing molecule to a subject in need of such treatment in an amount effective to increase CARD containing polypeptide level in a tissue of the subject, wherein the CARD containing molecule is selected from the group consisting of a CARD containing nucleic acid molecule and CARD containing polypeptide.
39. The method of claim 38, wherein the CARD containing molecule is a TMSl molecule.
40. The method of claim 39, wherein the TMSl molecule is selected from the group consisting of TMSl nucleic acid molecule and TMSl polypeptide.
41. The method of claim 38, wherein the CARD containing nucleic acid molecule comprises an nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:9, SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24.
42. The method of claim 38, wherein the CARD containing polypeptide has an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO: 10, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25.
43. The method of claim 38, wherein the CARD containing molecule is administered to a tissue having or at risk of developing a tumor.
44. The method of claim 38, wherein the disorder is cancer.
45. The method of claim 44, wherein the cancer is breast cancer.
46. The method of claim 38, further comprising first selecting a subject having or at risk of developing the disorder.
47. A method for identifying a subject having cancer who is at risk of being non-responsive to an anti-cancer therapy comprising: determining a level of methylation of a CpG island containing TMSl nucleic acid molecule in a biological sample from a subject having cancer, and comparing the level of methylation of the CpG island containing TMSl nucleic acid molecule in the biological sample to a control, wherein the CpG island containing TMSl nucleic acid molecule is selected from the group consisting of
(a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule consisting of SEQ ID NO:4 and which code for a native TMSl polypeptide, and
(b) complements of (a), and wherein an increase in the level of methylation of the CpG island containing TMSl nucleic acid molecule in the biological sample compared to the control identifies subject who is at risk of being non-responsive to an anti-cancer therapy.
48. The method of claim 47, wherein the level of methylation is determined using a technique selected from the group consisting of methylation sensitive restriction analysis, methylation specific polymerase chain reaction (MSP), sequencing of bisulfite modified DNA, methylation-sensitive single nucleotide primer extension (Ms-SNuPE), and combined bisulfite restriction analysis (COBRA).
49. The method of claim 47, wherein the cancer is breast cancer.
50. The method of claim 48, wherein the biological sample is a breast cancer tumor.
51. The method of claim 47, wherein the control is normal tissue from a normal subject.
52. The method of claim 51, wherein the control is normal tissue from the subject having cancer.
53. The method of claim 47, wherein the anti-cancer therapy is a DNA damaging anti-cancer therapy.
54. The method of claim 47, wherein the anti-cancer therapy is radiation therapy.
55. The method of claim 47, wherein the anti-cancer therapy is chemotherapy.
56. The method of claim 47, further comprising administering to the subject at risk of being non- responsive to an anti-cancer therapy, a demethylating agent and an anti-cancer therapy.
57. The method of claim 47, further comprising administering to the subject at risk of being non- responsive to an anti-cancer therapy, an anti-cancer therapy selected from the group consisting of biological response modifying therapy, immunotherapy, cancer vaccine therapy, hormone therapy and angiogenesis inhibiting therapy.
10
58. A method for treating a subject having a cancer comprising administering a demethylating agent and an anti-cancer therapy to a subject in need of such treatment in an amount effective to treat the cancer, wherein the cancer is selected from the group consisting of a cancer characterized by 75 abnormal methylation of a CpG island containing TMSl nucleic acid molecule, and a cancer characterized by an abnormally low levels of a TMSl expression product wherein the CpG island containing TMSl nucleic acid molecule is selected from the group consisting of
(a) nucleic acid molecules which hybridize under stringent conditions to a
20 complement of a molecule comprising SEQ ID NO:4, and which code for a native TMSl polypeptide, and
(b) complements of (a).
59. The method of claim 58, wherein demethylating agent is administered prior to the anti-cancer 25 therapy.
60. The method of claim 58, wherein the demethylated agent is administered in amount effective to sensitize the cancer to the anti-cancer therapy.
30 61. A method for treating a subject having a cancer comprising administering a TMSl molecule and an anti-cancer therapy to a subject in need of such treatment in an amount effective to treat the cancer, wherein the cancer is selected from the group consisting of a cancer characterized by abnormal methylation of a CpG island containing TMSl nucleic acid molecule, and a cancer 35 characterized by an abnormally low levels of a TMSl expression product wherein the CpG island containing TMS 1 nucleic acid molecule is selected from the group consisting of
(a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule comprising SEQ ID NO:4, and which code for a native TMSl polypeptide, and
(b) complements of (a).
62. The method of claim 61, wherein the TMSl molecule is administered prior to the anti-cancer therapy.
63. The method of claim 61, wherein the TMSl molecule is administered in an amount effective to sensitize the cancer to the anti-cancer therapy.
64. The method of claim 61, wherein the TMSl molecule is selected from the group consisting of a TMS 1 nucleic acid molecule and a TMS 1 polypeptide.
65. The method of claim 64, wherein the TMSl nucleic acid molecule has an nucleotide sequence selected from the group consisting of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:22 and SEQ ID O:24.
66. The method of claim 64, wherein the TMSl polypeptide has an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25.
67. A method for treating a subject having a disorder characterized by abnormal cell proliferation, comprising administering to a subject in need of such treatment a TMS 1 molecule in an amount effective to increase TMSl polypeptide level to an above normal level.
68. An isolated nucleic acid molecule, comprising (a) nucleic acid molecules which hybridize under stringent conditions to a complement of a molecule having a nucleotide sequence selected from the group consisting of SEQ ID NO:l, SEQ ID NO: 2, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24, and which code for a native TMSl polypeptide,
(b) deletions, additions and substitutions of (a), which code for an apoptosis inducing polypeptide, (c) nucleic acid molecules that differ from the nucleic acid molecules of (a) or (b) in codon sequence due to the degeneracy of the genetic code, and
(d) complements of (a), (b) or (c).
69. The isolated nucleic acid molecule of claim 68, wherein the isolated nucleic acid molecule comprises a nucleotide sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:22, and SEQ ID NO:24.
70. The isolated nucleic acid molecule of claim 68, wherein the isolated nucleic acid molecule codes for a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25.
71. An isolated nucleic acid molecule comprising a nucleotide sequence of SEQ ID NO:4.
72. An isolated nucleic acid molecule selected from the group consisting of
(a) a unique fragment of a nucleic acid molecule comprising a nucleotide sequence of SEQ ID NO: l, and
(b) complements of (a) provided that the unique fragment includes a sequence of contiguous nucleotides which is not identical to any sequence from the sequence group consisting of
(1) sequences having the database accession numbers of Table 1, and
(2) complements of (1).
73. The isolated nucleic acid of claim 72, wherein the sequence of contiguous nucleotides is selected from the group consisting of:
(1) at least two contiguous nucleotides nonidentical to the sequence group,
(2) at least three contiguous nucleotides nonidentical to the sequence group,
(3) at least four contiguous nucleotides nonidentical to the sequence group,
(4) at least six contiguous nucleotides nonidentical to the sequence group, (5) at least eight contiguous nucleotides nonidentical to the sequence group,
(6) at least ten contiguous nucleotides nonidentical to the sequence group.
74. The isolated nucleic acid molecule of claim 72 or 73, wherein the unique fragment has a size selected from the group consisting of at least: 8 nucleotides, 10 nucleotides, 12 nucleotides, 14 nucleotides, 16 nucleotides, 18 nucleotides, 20 nucleotides, 22 nucleotides, 24 nucleotides, 26 nucleotides, 28 nucleotides, 30 nucleotides, 50 nucleotides, 75 nucleotides, 100 nucleotides and 200 nucleotides.
75. The isolated nucleic acid molecule of claim 72 or 73 wherein the unique fragment encodes a peptide which is a fragment of a polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NO:3 and SEQ ID NO:25.
76. The isolated nucleic acid molecule of claim 74, wherein the unique fragment encodes a peptide which is a fragment of a polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NO:3 and SEQ ID NO:25.
77. An expression vector comprising the isolated nucleic acid molecule of claims 68, 69 or 70, operably linked to a promoter.
78. An expression vector comprising the isolated nucleic acid molecule of claim 71, or a regulatory fragment thereof, operably linked to a reporter coding sequence.
79. The expression vector of claim 78, wherein the reporter coding sequence comprises a promoter.
80. An expression vector comprising the isolated nucleic acid molecule of 75, operably linked to a promoter.
81. An expression vector comprising the isolated nucleic acid molecule of claim 76, operably linked to a promoter.
82. A host cell transformed or transfected with the expression vector of claim 77.
83. A host cell transformed or transfected with the expression vector of claim 78, 79, 80 or 81.
84. An isolated polypeptide encoded by the isolated nucleic acid molecule of claim 68, wherein the isolated polypeptide is a native TMSl polypeptide.
85. The isolated polypeptide of claim 84, wherein the isolated polypeptide has an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:23 and
SEQ ID NO:25.
86. An isolated peptide comprising a fragment of the isolated polypeptide of claim A 18, of sufficient length to represent a sequence unique within the human genome and to identify a native TMSl polypeptide.
87. The isolated peptide of claim 86, wherein the fragment is immunogenic.
88. The isolated peptide of claim 86, wherein the peptide comprises at least 6, 8, 9, 10, 1 1, 12, 14, 16, 18 or 20 contiguous amino acids having a sequence of a fragment of SEQ ID NO:3 or SEQ ID NO:25.
89. A composition comprising an isolated agent that binds selectively to a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25, or to a fragment thereof.
90. The composition of claim 89, wherein the isolated agent is a peptide.
91. The composition of claim 92, wherein the peptide is an antibody, or a fragment thereof.
92. The composition of claim 93, wherein the antibody is a humanized antibody or a chimeric antibody.
93. The composition of claim 89, wherein the isolated agent is conjugated to a detectable label.
94. The composition of claim 93, wherein the detectable label is selected from the group consisting of a radioactive label, an enzyme, a biotin molecule, an avidin molecule or a fluorochrome.
95. A method for identifying a nucleic acid molecule transcriptionally down-regulated following methylation, comprising overexpressing a methyltransferase molecule in a experimental cell, and identifying a differentially expressed molecule which has a lower level of expression in the experimental cell than in a control.
96. The method of claim 95, wherein the DNA methyltransferase is a human DNA methyltransferase.
97. The method of claim 96, wherein the experimental cell is HMT.lEl.
98. The method of claim 95, wherein the control is an SV40 immortalized fibroblast cell line.
99. The method of claim 95, wherein the expression product is an mRNA.
100. The method of claim 95, wherein the differentially expressed molecule is identified using a technique selected from the group consisting of subtractive hybridization, differential display, representational difference analysis and cDNA microarray analysis.
101. A method for identifying a TMS 1 polypeptide binding partner comprising obtaining a binding assay result from a binding assay between a library member and a TMS 1 polypeptide, and comparing the binding assay result to a control binding assay result, wherein a binding assay result that is greater than a control binding assay result indicates that the library member is a TMS 1 polypeptide binding partner.
102. The method of claim 101, wherein the TMSl polypeptide has an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25.
103. The method of claim 101, wherein the library member is derived from a natural source library.
104. The method of claim 103, wherein the TMSl polypeptide binding partner is naturally occurring.
105. A method for identifying a TMSl N-terminal polypeptide binding partner comprising obtaining a binding assay result from a binding assay between a library member and a TMS 1
N-terminal polypeptide, and comparing the binding assay result to a control binding assay result, wherein a binding assay result that is greater than a control binding assay result indicates that the library member is a TMSl N-terminal polypeptide binding partner.
106. The method of claim 105, wherein the TMSl N-terminal polypeptide binding partner has an amino acid sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:8, SEQ ID
NO:26.
107. The method of claim 105, wherein the TMSl N-terminal polypeptide binding partner has an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:21, SEQ ID NO:23 and SEQ ID NO:25, and the control binding assay result is obtained from a control binding assay between a library member and a polypeptide consisting of an amino acid sequence of SEQ ID NO: 10.
108. The method of claim 105, wherein the library member is derived from a natural source library.
109. The method of claim 108, wherein the TMSl polypeptide binding partner is naturally occurring.
EP00973614A 1999-10-18 2000-10-18 Tms1 compositions and methods of use Withdrawn EP1224303A2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US15997599P 1999-10-18 1999-10-18
US159975P 1999-10-18
PCT/US2000/028747 WO2001029235A2 (en) 1999-10-18 2000-10-18 Tms1 compositions and methods of use

Publications (1)

Publication Number Publication Date
EP1224303A2 true EP1224303A2 (en) 2002-07-24

Family

ID=22574926

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00973614A Withdrawn EP1224303A2 (en) 1999-10-18 2000-10-18 Tms1 compositions and methods of use

Country Status (4)

Country Link
EP (1) EP1224303A2 (en)
AU (1) AU785115B2 (en)
CA (1) CA2386476A1 (en)
WO (1) WO2001029235A2 (en)

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0011903D0 (en) * 2000-05-18 2000-07-05 Astrazeneca Ab Combination chemotherapy
SE0102627L (en) * 2001-07-27 2002-11-19 Geneinvent Bbl Ab Vectors resistant to methylation
JP4443568B2 (en) * 2003-10-15 2010-03-31 エフ.ホフマン−ラ ロシュ アーゲー Use of protein ASC as a marker for breast cancer
WO2005124360A2 (en) * 2004-06-18 2005-12-29 Roche Diagnostics Gmbh Use of protein tebp as a marker for breast cancer
CA2567987A1 (en) * 2004-06-18 2005-12-29 Gabriele Pestlin Use of protein pdx1 as a marker for breast cancer
US7250416B2 (en) 2005-03-11 2007-07-31 Supergen, Inc. Azacytosine analogs and derivatives
US7700567B2 (en) 2005-09-29 2010-04-20 Supergen, Inc. Oligonucleotide analogues incorporating 5-aza-cytosine therein
EP2128259A1 (en) 2008-05-27 2009-12-02 Koninklijke Philips Electronics N.V. Therapy delivery and monitoring using a gene of interest-reporter fusion protein and optical imaging
CA2728153C (en) 2008-07-03 2015-01-27 F. Hoffmann-La Roche Ag Asc as a marker for lung cancer
US20110229411A1 (en) * 2008-11-27 2011-09-22 Institut Gustave Roussy Use of p2x7 pathway for assessing the sensitivity of a subject to a cancer treatment
EP3431142B1 (en) 2011-08-30 2020-06-17 Astex Pharmaceuticals, Inc. Decitabine derivative formulations
AU2016287585B2 (en) 2015-07-02 2020-12-17 Otsuka Pharmaceutical Co., Ltd. Lyophilized pharmaceutical compositions
RU2020108580A (en) 2017-08-03 2021-09-03 Оцука Фармасьютикал Ко., Лтд. MEDICINAL COMPOUNDS AND METHODS OF ITS PURIFICATION
CN114641315A (en) * 2019-11-14 2022-06-17 博阿济吉大学 ASC spots in cancer immunotherapy

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5856094A (en) * 1995-05-12 1999-01-05 The Johns Hopkins University School Of Medicine Method of detection of neoplastic cells
US6482933B1 (en) * 1998-02-06 2002-11-19 Millennium Pharmaceuticals, Inc. Molecules of the card-related protein family and uses thereof
DE19813839A1 (en) * 1998-03-20 1999-09-23 Metagen Gesellschaft Fuer Genomforschung Mbh Human nucleic acid sequences and protein products from tumor breast tissue, useful for breast cancer therapy

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
[online] 16 August 2000 (2000-08-16), CONWAY K.E. ET AL: "Homo sapiens target of methylation-induced silencing-1 (TMS1) mRNA, complete cds, alternatively spliced.", retrieved from EMBL Database accession no. AF255794 *
DATABASE EMBL [online] 22 August 2000 (2000-08-22), CONWAY K.E. ET AL: "Homo sapiens target of methylation-induced silencing 1 (TMS1) mRNA, complete cds.", Database accession no. AF184073 *
See also references of WO0129235A3 *

Also Published As

Publication number Publication date
AU785115B2 (en) 2006-09-21
WO2001029235A2 (en) 2001-04-26
AU1211001A (en) 2001-04-30
CA2386476A1 (en) 2001-04-26
WO2001029235A3 (en) 2002-05-16

Similar Documents

Publication Publication Date Title
US6911306B1 (en) TMS1 compositions and methods of use
AU785115B2 (en) TMS1 compositions and methods of use
Akatsuka et al. Identification of a polymorphic gene, BCL2A1, encoding two novel hematopoietic lineage-specific minor histocompatibility antigens
US20210337252A1 (en) Means and Methods for Detecting Methylated DNA
EP1402071A2 (en) Methods and products for analyzing nucleic acids based on methylation status
EP1064372B1 (en) Compounds and methods for therapy and diagnosis of lung cancer
EP2688907B1 (en) Dominant negative hsp110 mutant and its use in prognosing and treating cancers
US20110159017A1 (en) Trytophan catabolism in cancer treatment and diagnosis
US11674950B2 (en) Methods determining and treating cellular resistance to ADP-rtbosylating toxin
US20200300859A1 (en) Modulating biomarkers to increase tumor immunity and improve the efficacy of cancer immunotherapy
US20160194718A1 (en) Compositions and Methods for Identification, Assessment, Prevention, and Treatment of Cancer Using Histone H3K27ME3 Biomarkers and Modulators
WO2019014665A1 (en) Modulating biomarkers to increase tumor immunity and improve the efficacy of cancer immunotherapy
JP2002511749A (en) Tumor suppressor gene DBCCR1 at 9q32-33
US20070128593A1 (en) Sga-1m, a cancer associated antigen, and uses thereof
Colleoni et al. Expression of SSX genes in the neoplastic cells of Hodgkin's lymphoma
US20040247555A1 (en) Methods of and compositions for modulating hair growth via P-cadherin modulators
WO2026064370A1 (en) Individualized neoantigen vaccines for the treatment of non-small cell lung cancer
JPH11508767A (en) Isolated nucleic acid molecule encoding mouse tumor rejection antigen precursor SMAGE-3
US20060121476A1 (en) Cancer associated antigens, sga-56m and sga-56mv, and uses thereof
KR20090063921A (en) Colorectal cancer diagnostic composition and use thereof
Hammond et al. Clinical implications of molecular and cytogenetic studies of non-Hodgkin's lymphomas
Carroll et al. p53 zyxwvutsrqponmlkjihgfe

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020517

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

16A New documents despatched to applicant after publication of the search report

Effective date: 20020918

17Q First examination report despatched

Effective date: 20040507

17Q First examination report despatched

Effective date: 20040507

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20061117