EP1224284A1 - Gene regule positivement dans les cancers de la prostate - Google Patents
Gene regule positivement dans les cancers de la prostateInfo
- Publication number
- EP1224284A1 EP1224284A1 EP00975396A EP00975396A EP1224284A1 EP 1224284 A1 EP1224284 A1 EP 1224284A1 EP 00975396 A EP00975396 A EP 00975396A EP 00975396 A EP00975396 A EP 00975396A EP 1224284 A1 EP1224284 A1 EP 1224284A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- seq
- polynucleotide
- residues
- cancer
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2799/00—Uses of viruses
- C12N2799/02—Uses of viruses as vector
- C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
- C12N2799/026—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus
Definitions
- the invention described herein relates to a novel gene and its encoded protein, termed 20P2H8, and to diagnostic and therapeutic methods and compositions useful in the management of various cancers which express 20P2H8, particularly including cancers of the bladder, prostate, colon and pancreas.
- Cancer is the second leading cause of human death next to coronary disease. Worldwide, millions of people die from cancer every year. In the United States alone, cancer causes the death of well over a half-million people each year, with some 1.4 million new cases diagnosed per year. While deaths from heart disease have been declining significandy, those resulting from cancer generally are on the rise. In the early part of the next century, cancer is predicted to become the leading cause of death.
- carcinomas of the lung, prostate, breast, colon, pancreas, and ovary represent the primary causes of cancer death. These and virtually all other carcinomas share a common lethal feature. With very few exceptions, metastatic disease from a carcinoma is fatal. Moreover, even for those cancer patients who initially survive their primary cancers, common experience has shown that their lives are dramatically altered. Many cancer patients experience strong anxieties driven by the awareness of the potential for recurrence or treatment failure. Many cancer patients experience physical debilitations following treatment. Many cancer patients experience a recurrence.
- prostate cancer As discussed below, the management of prostate cancer serves as a good example of the limited extent to which molecular biology has translated into real progress in the clinic. With limited exceptions, the situation is more or less the same for the other major carcinomas mentioned above. Worldwide, prostate cancer is the fourth most prevalent cancer in men. In North
- prostate tumor marker that can accurately detect early-stage, located tumors remains a significant limitation in the management of this disease.
- serum PSA assay has been a very useful tool, its specificity and general utility is widely regarded as lacking in several important respects, as further discussed below.
- DRE digital rectal examinations
- PSA prostate specific antigen
- TRUS transrectal ultrasonography
- TRNB transrectal needle biopsy
- PSA is the most widely used tumor marker for screening, diagnosis, and monitoring prostate cancer today.
- several immunoassays for the detection of serum PSA are in widespread clinical use.
- RT-PCR reverse transcnptase-polymerase chain reaction
- PSA is not a disease-specific marker, as elevated levels of PSA are detectable in a large percentage of patients with BPH and prostatitis (25-86%)(Gao et al, 1997, Prostate 31: 264-281), as well as in other nonmalignant disorders and in some normal men, a factor which significandy limits the diagnostic specificity of this marker.
- PSM prostate specific membrane antigen
- PCTA-1 a novel galectin
- PSCA a GPI-linked cell surface molecule
- the present invention relates to the gene designated 20P2H8, which is over- expressed in cancers including cancer of the prostate.
- Northern blot expression analysis of 20P2H8 gene expression in normal tissues shows a predominant transcript of about 4.4 Kb that is highly expressed in pancreas, and is also expressed in prostate, colon and placenta.
- the predicted molecular weight of the 20P2H8 protein is 57.4 kD and its' pi is 7.7.
- expression analysis demonstrates high levels of 20P2H8 expression in several prostate and other cancer cell lines as well as prostate, bladder, kidney and breast cancer patient samples and tumor xenografts.
- the expression profile of 20P2H8 in normal adult tissues, combined with the over-expression observed in cancer cells such as pancreas, bladder, testis, lung, ovary and prostate cancer cell lines and/or cancer patient samples, provides evidence that 20P2H8 is aberrandy expressed in at least some cancers, and can serve as a useful diagnostic and/or therapeutic target for such cancers.
- the invention provides polynucleotides corresponding or complementary to all or part of the 20P2H8 genes, mRNAs, and/or coding sequences, preferably in isolated form, including polynucleotides encoding 20P2H8 proteins and fragments thereof, DNA, RNA, DNA/RNA hybrid, and related molecules, polynucleotides or oligonucleotides complementary to the 20P2H8 genes or mRNA sequences or parts thereof, and polynucleotides or oligonucleotides that hybridize to the 20P2H8 genes, mRNAs, or to 20P2H8-encoding polynucleotides.
- Recombinant DNA molecules containing 20P2H8 polynucleotides, cells transformed or transduced with such molecules, and host-vector systems for the expression of 20P2H8 gene products are also provided.
- the invention further provides 20P2H8 proteins and polypeptide fragments thereof.
- the invention further provides antibodies that bind to 20P2H8 proteins and polypeptide fragments thereof, including polyclonal and monoclonal antibodies, murine and other mammalian antibodies, chimeric antibodies, humanized and fully human antibodies, and antibodies labeled with a detectable marker.
- the invention further provides methods for detecting the presence and status of 20P2H8 polynucleotides and proteins in various biological samples, as well as methods for identifying cells that express 20P2H8.
- a typical embodiment of this invention provides methods for monitoring 20P2H8 gene products in a tissue sample having or suspected of having some form of growth dysregulation such as cancer.
- the invention further provides various therapeutic compositions and strategies for treating cancers that express 20P2H8 such as prostate cancers, including therapies aimed at inhibiting the transcription, translation, processing or function of 20P2H8 as well as cancer vaccines.
- Figures 1A-1E show the nucleotide (SEQ ID NO: 1) and deduced amino acid (SEQ ID NO: 2) sequences of 20P2H8 cDNA. The start methionine and putative Kozak sequence are indicated in bold, RNA -binding domains RNP1 and RNP2 (shaded) are boxed, 3 Proline-rich regions are in bold.
- Figures 2A-2C show a semi-quantitative RT-PCR analysis of 20P2H8 gene expression in a panel of 16 normal human tissues (Panels B and C) and several prostate cancer xenografts (Panel A).
- Lanes 1-8 in panel A correspond to RT-PCR analysis of 20P2H8 gene expression in brain, prostate, LAPC-4 AD, LAPC-4 Al, LAPC-9 AD, HeLa, mouse mix and a negative control respectively.
- Lanes 1-8 in panel B correspond to RT-PCR analysis of 20P2H8 gene expression in brain, heart, kidney, liver, lung, pancreas, placenta and skeletal muscle respectively.
- Lanes 1-8 in panel C correspond to RT-PCR analysis of 20P2H8 gene expression in colon, ovary, leukocytes, prostate, small intestine, spleen, testis and thymus respectively.
- Figures 3A-3C show a Northern blot analysis of human 20P2H8 expression in various normal tissues showing predominant expression in pancreas with significant expression also detected in prostate and colon.
- Lanes 1-8 in panel A correspond to Nothern analysis of 20P2H8 gene expression in heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas respectively.
- Lanes 1-8 in panel B correspond to Nothern analysis of 20P2H8 gene expression in spleen, thymus, prostate, testis, ovary, small intestine, colon and leukocytes respectively.
- Lanes 1 -5 in panel C correspond to Nothern analysis of 20P2H8 gene expression in prostate, LAPC-4 AD, LAPC-4 Al, LAPC-9AD and LAPC-9 Al respectively.
- Figure 4 shows a Northern blot analysis of human 20P2H8 mRNA expression in a panel of human colon and pancreatic cancer cell lines.
- Figures 5A-5B show a Northern expression analysis of 20P2H8 mRNA in many cancer lines including bladder, lung, breast, testicular cervical and ovarian cancers.
- Figure 6 illustrates an RT-PCR analysis showing expression of the of 20P2H8 mRNA in bladder cancer, colon cancer, and lung cancer patients.
- Figures 7A-7B show expression of recombinant 20P2H8 protein.
- A. 293T cells were transiendy transfected with either pCDNA3.1 MycHis tagged 20P2H8 plasmid or with empty control vector and harvested 2 days later. Cells were lysed in SDS-PAGE sample buffer and lysates were separated on a 10-20% SDS-PAGE gel and then transferred to nitrocellulose.
- the blot was blocked in Tris-buffered saline (TBS)+ 2% non-fat milk and then probed with a 1:3,000 dilution of rabbit anti-His pAb (Santa Cruz Biotechnology Inc.) in TBS+0.15% Tween-20+ 1% milk. The blot was washed and then incubated with a 1:4,000 dilution of anti-rabbit HRP conjugate secondary antibody. Following washing, anti-His immunoreactive bands were developed by enhanced chemiluminescence and visualized by exposure to autoradiographic film.
- anti-20P2H8 immunoreactive bands of approximately 58 kD and 30 kD that appear in 20P2H8 mRNA positive Colo 205 cells but not in 20P2H8 mRNA negative 293T cells.
- Figure 8 shows a Northern analysis from tissues from patients with bladder cancer and unaffected individuals. Northern analysis was performed on bladder cancer and their adjacent normal matched tissues obtained from four bladder cancer patients. For this experiment, lO ⁇ g of total RNA was loaded for each sample. Overexpression of 20P2H8 was seen in 3 out of 4 tumor samples tested. No expression was observed in any of the 3 normal matched tissues tested, nor in bladder isolated from a normal individual. The data demonstrate specific expression of 20P2H8 in cancer but not in normal bladder tissues.
- Figure 9 shows a RNA dot blot analysis from tissues from patients with various cancers. Expression of 20P2H8 was assayed in a panel of human cancers T) and their respective matched normal tissues (N) on RNA dot blots. 20P2H8 overexpression was detected in 4 out of 14 kidney cancers, 7 out of 9 breast cancers 1 out of 3 prostate cancers, 2 out of 3 ovarian cancers, 1 out of 1 cervical cancer, and 4 out of 8 stomach cancers. 20P2H8 was also found to be highly expressed in the melanoma cell line G361 and the colorectal adenocarcinoma line SW480.
- the terms "advanced prostate cancer”, “locally advanced prostate cancer”, “advanced disease” and “locally advanced disease” mean prostate cancers which have extended through the prostate capsule, and are meant to include stage C disease under the American Urological Association (AUA) system, stage CI - C2 disease under the Whitmore-Jewett system, and stage T3 - T4 and N+ disease under the TNM (tumor, node, metastasis) system.
- AUA American Urological Association
- stage CI - C2 disease under the Whitmore-Jewett system
- TNM tumor, node, metastasis
- Locally advanced disease is clinically identified by palpable evidence of induration beyond the lateral border of the prostate, or asymmetry or induration above the prostate base.
- Locally advanced prostate cancer is presendy diagnosed pathologically following radical prostatectomy if the tumor invades or penetrates the prostatic capsule, extends into the surgical margin, or invades the seminal vesicles.
- metastatic prostate cancer and “metastatic disease” mean prostate cancers which have spread to regional lymph nodes or to distant sites, and are meant to include stage D disease under the AUA system and stage TxNxM+ under the TNM system.
- surgery is generally not indicated for patients with metastatic disease, and hormonal (androgen ablation) therapy is the preferred treatment modality.
- Patients with metastatic prostate cancer eventually develop an androgen-refractory state within 12 to 18 months of treatment initiation, and approximately half of these patients die within 6 months thereafter.
- the most common site for prostate cancer metastasis is bone.
- Prostate cancer bone metastases are, on balance, characteristically osteoblastic rather than osteolytic (i.e., resulting in net bone formation).
- Bone metastases are found most frequendy in the spine, followed by the femur, pelvis, rib cage, skull and humerus. Other common sites for metastasis include lymph nodes, lung, liver and brain. Metastatic prostate cancer is typically diagnosed by open or laparoscopic pelvic lymphadenectomy, whole body radionuclide scans, skeletal radiography, and/or bone lesion biopsy.
- polynucleotide means a polymeric form of nucleotides of at least about 10 bases or base pairs in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide, and is meant to include single and double stranded forms of DNA.
- polypeptide means a polymer of at least about 6 amino acids. Throughout the specification, standard three letter or single letter designations for amino acids are used.
- hybridize As used herein, the terms “hybridize”, “hybridizing”, “hybridizes” and the like, used in the context of polynucleotides, are meant to refer to conventional hybridization conditions, preferably such as hybridization in 50% formamide/6XSSC/0.1% SDS/ 100 ⁇ g/ml ssDNA, in which temperatures for hybridization are above 37 degrees C and temperatures for washing in 0.1X SSC/0.1% SDS are above 55 degrees C, and most preferably to stringent hybridization conditions.
- “Stringency” of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature that can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).
- “Stringent conditions” or “high stringency conditions”, as defined herein, may be identified by those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50°C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 ⁇ g/ml), 0.1% SDS, and 10% dextran sul
- Modely stringent conditions may be identified as described by Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, and include the use of washing solution and hybridization conditions (e.g., temperature, ionic strength and %SDS) less stringent than those described above.
- washing solution and hybridization conditions e.g., temperature, ionic strength and %SDS
- moderately stringent conditions is overnight incubation at 37°C in a solution comprising: 20% formamide, 5 x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution, 10% dextran sulfate, and 20 mg/mL denatured sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at about 37-50°C.
- 5 x SSC 150 mM NaCl, 15 mM trisodium citrate
- 50 mM sodium phosphate pH 7.6
- 5 x Denhardt's solution 10% dextran sulfate
- 20 mg/mL denatured sheared salmon sperm DNA followed by washing the filters in 1 x SSC at about 37-50°C.
- the skilled artisan will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length and the like.
- identity is used to express the percentage of amino acid residues at the same relative positions that are the same.
- homoology is used to express the percentage of amino acid residues at the same relative positions that are either identical or are similar, using the conserved amino acid criteria of BLAST analysis, as is generally understood in the art. For example, % identity values may be generated by WU-BLAST-2 (Altschul et al, 1996, Methods in Enzymology 266:460-480; http://blast.wusd/edu/blast/README.html). Further details regarding amino acid substitutions, which are considered conservative under such criteria, are provided below. Additional definitions are provided throughout the subsections that follow.
- the present invention relates to a novel protein designated 20P2H8 which shares homology with several heterogenous nuclear ribonucleoproteins (hnRNPs).
- hnRNPs heterogenous nuclear ribonucleoproteins
- the predicted 20P2H8 protein exhibits five RNA binding sequences, two of which correspond to ribonucleoprotein- 1 (RNP1) consensus sites, and three of which correspond to RNP2 sites.
- RNP1 ribonucleoprotein- 1
- 20P2H8 contains three regions with significant proline content (30-42%), which lie outside regions of homology with hnRNPs.
- the 20P2H8 protein structure shows highest homology with a protein identified in C. elegans (Genbank CAA92704), and significant homology is also seen with various hnRNPs involved in mRNA splicing (ROF, ROH1 and ROH2; Honore et al., 1995, J. Biol. Chem. 270: 28780). Accordingly, based on these structural features and homologies, it is likely that the 20P2H8 protein is involved in RNA splicing.
- Expression analysis by northern blot shows highest expression levels of a single 4.4 kb 20P2H8 transcript in pancreas, and is also expressed in prostate, colon and placenta. No other normal tissues in this panel show detectable expression.
- Expression of 20P2H8 is up-regulated in human prostate tumor xenografts derived from metastatic prostate cancer (compared to normal prostate). Further, analysis of 20P2H8 expression in multiple cancer cell lines reveals high levels of expression in several pancreatic (BxPC- 3, HPAC, Capan-1) and colon (CaCo-2, T84, Colo-205) cancer cell lines.
- the up- regulated expression of 20P2H8 in cancers including cancers of the bladder, kidney, prostate, pancreas and colon indicates that the 20P2H8 gene, message and protein allows 20P2H8 to be used as a diagnostic, staging and/or prognostic marker for cancers of the prostate, colon and pancreas, and/or may also serve as a target for various approaches to the treatment of these cancers.
- the invention provides polynucleotides corresponding or complementary to all or part of the 20P2H8 genes, mRNAs, and/or coding sequences, preferably in isolated form, including polynucleotides encoding 20P2H8 proteins and fragments thereof, DNA, RNA, DNA/RNA hybrid, and related molecules, polynucleotides or oligonucleotides complementary to the 20P2H8 genes or mRNA sequences or parts thereof, and polynucleotides or oligonucleotides which hybridize to the 20P2H8 genes, mRNAs, or to 20P2H8-encoding polynucleotides.
- Recombinant DNA molecules containing 20P2H8 polynucleotides, cells transformed or transduced with such molecules, and host-vector systems for the expression of 20P2H8 gene products are also provided.
- the invention further provides 20P2H8 proteins and polypeptide fragments thereof.
- the invention further provides antibodies that bind to 20P2H8 proteins and polypeptide fragments thereof, including polyclonal and monoclonal antibodies, murine and other mammalian antibodies, chimeric antibodies, humanized and fully human antibodies, antibodies labeled with a detectable marker, and antibodies conjugated to radionuclides, toxins or other therapeutic compositions.
- the invention further provides methods for detecting the presence of 20P2H8 polynucleotides and proteins in various biological samples, as well as methods for identifying cells that express a 20P2H8.
- the invention further provides various therapeutic compositions and strategies for treating cancers which express 20P2H8 such as prostate and bladder cancers, including antibody, vaccine and small molecule therapy, and therapies aimed at inhibiting the transcription, translation, processing or function of 20P2H8.
- the isolated 20P2H8 cDNA (SEQ ID NO: 1) provided herein (FIG. 1) and corresponding gene are predicted to encode a 517 amino acid protein (SEQ ID NO: 2) with various structural features common to heterogenous nuclear ribonucleoproteins (hnRNPs) involved in RNA splicing, including five RNA binding sequences (two corresponding to ribonucleoprotein-1 (RNP1) and 3 corresponding to ribonucleoprotein-2 (RNP2).
- the protein exhibits significant homology to a C. elegans protein, designated CAA92704 (approximately 52.4% identity in a 311 residues overlap beginning with 20P2H8 amino acid residue 63 as shown in FIG.
- hnRNPs involved in RNA splicing
- the 20P2H8 protein contains three regions with significant proline content (30-42%), which lie outside its regions of homology with hnRNPs. These proline rich regions may be involved in protein-protein interactions as has been observed in other proteins (Schlessenger et al., 1994, Curr. Opin. Genet. Dev. 4: 25).
- the 20P2H8 gene is normally expressed predominandy in pancreas, with lower levels of expression occurring in prostate, colon and placenta (FIGS. 2 and. 3), but is also expressed or over-expressed in a number of human cancers, including cancers of the prostate, kidney, skin, stomach, cervix, bladder, testis, ovaries, breast, pancreas, colon and lung (see e.g. FIGS. 4-8).
- 20P2H8 function can be assessed in mammalian cells using a variety of techniques that arc well known in the art.
- 20P2H8 can be cloned into several vectors, including pcDNA 3.1 myc-His-tag (Invitrogen)and the retroviral vector pSR ⁇ tkneo (Muller et al., 1991, MCB 11:1785).
- pcDNA 3.1 myc-His-tag Invitrogen
- pSR ⁇ tkneo Muller et al., 1991, MCB 11:1785
- 20P2H8 can be expressed in several cell lines, including PC-3, NIH 3T3, LNCaP and 293T. Expression of 20P2H8 can be monitored using northern blot analysis.
- the mammalian cell lines expressing 20P2H8 can be tested in several in vitro and in vivo assays, including cell proliferation in tissue culture, activation of apoptotic signals, tumor formation in SCID mice, and in vitro invasion using a membrane invasion culture system (MICS) (Welch et al. ,Int. J. Cancer 43: 449-457).
- the 20P2H8 ceU phenotype can be compared to the phenotype of cells that lack expression of 20P2H8.
- 20P2H8 exhibits specific properties that are analogous to those found in a family of genes whose polynucleotides, polypeptides and anti- polypeptide antibodies are used in well known diagnostic assays directed to examining conditions associated with dysregulated cell growth such as cancer, in particular prostate cancer (see e.g. both its highly specific pattern of tissue expression as well as its overexpression in prostate cancers as described for example in Example 3).
- PSA the archetypal marker that has been used by medical practitioners for years to identify and monitor the presence of prostate cancer (see e.g. Merrill et al., J. Urol. 163(2): 503-5120 (2000); Polascik et al, J. Urol.
- this disclosure of the 20P2H8 polynucleotides and polypeptides allows skilled artisans to utilize these molecules in methods that are analogous to those used, for example, in a variety of diagnostic assays directed to examining conditions associated with cancer.
- Typical embodiments of diagnostic methods which utilize the 20P2H8 polynucleotides, polypeptides and antibodies described herein are analogous to those methods from well established diagnostic assays which employ PSA polynucleotides, polypeptides and antibodies.
- PSA polynucleotides are used as probes (for example in Northern analysis, see e.g. Sharief et al, Biochem. Mol. Biol. Int. 33(3):567-74(1994)) and primers (for example in PCR analysis, see e.g. Okegawa et al, J. Urol.
- the 20P2H8 polynucleotides described herein can be utilized in the same way to detect 20P2H8 overexpression or the metastasis of prostate and other cancers expressing this gene.
- PSA polypeptides are used to generate antibodies specific for PSA which can then be used to observe the presence and/or the level of PSA proteins in methods of monitoring PSA protein overexpression (see e.g. Stephan et al. Urology 55(4):560-3 (2000)) or the metastasis of prostate cells (see e.g. Alanen et al. Pathol.
- the 20P2H8 polypeptides described herein can be utilized to generate antibodies for use in detecting 20P2H8 overexpression or the metastasis of prostate cells and cells of other cancers expressing this gene.
- metastases involves the movement of cancer cells from an organ of origin (such as the bladder, kidney or prostate gland etc.) to a different area of the body (such as a lymph node)
- assays which examine a biological sample for the presence of cells expressing 20P2H8 polynucleotides and/or polypeptides can be used to provide evidence of metastasis, for example, when a biological sample from tissue that does not normally contain 20P2H8 expressing cells (lymph node) is found to contain 20P2H8 expressing cells such as the 20P2H8 expression seen in LAPC4 and LAPC9, xenografts isolated from lymph node and bone metastasis respectively.
- 20P2H8 polynucleotides and/or polypeptides can be used to provide evidence of cancer, for example, when a cells in biological sample that do not normally express 20P2H8 or express 20P2H8 at a different level (such as kidney, bladder, lung and prostate cells etc.) are found to express 20P2H8 or have an increased expression of 20P2H8.
- artisans may further wish to generate supplementary evidence of metastasis by testing the biological sample for the presence of a second tissue restricted marker (in addition to 20P2H8) such as PSA, PSCA etc. (see e.g. Alanen et al, Pathol. Res. Pract. 192(3): 233-237 (1996)).
- PSA polynucleotide fragments and polynucleotide variants are employed by skilled artisans for use in methods of monitoring this molecule
- 20P2H8 polynucleotide fragments and polynucleotide variants can also be used in an analogous manner.
- typical PSA polynucleotides used in methods of monitoring this molecule are probes or primers which consist of fragments of the PSA cDNA sequence.
- primers used to PCR amplify a PSA polynucleotide must include less than the whole PSA sequence to function in the polymerase chain reaction.
- variant polynucleotide sequences are typically used as primers and probes for the corresponding mRNAs in PCR and Northern analyses (see e.g. Sawai et al. Fetal Diagn. Ther. 1996 Nov-Dec;ll(6):407-13 and Current Protocols In Molecular Biology, Volume 2, Unit 2, Frederick M. Ausubul et al. eds, 1995)).
- Polynucleotide fragments and variants are typically useful in this context as long as they have the common attribute or characteristic of being capable of binding to a target polynucleotide sequence (e.g. the 20P2H8 polynucleotide shown in SEQ ID NO: 1) under conditions of high stringency.
- PSA polypeptide fragments and polypeptide variants are employed by skilled artisans for use in methods of monitoring this molecule
- 20P2H8 polypeptide fragments and polypeptide variants can also be used in an analogous manner.
- typical PSA polypeptides used in methods of monitoring this molecule are fragments of the PSA protein which contain an epitope that can be recognized by an antibody which will specifically bind to the PSA protein.
- This practice of using polypeptide fragments or polypeptide variants used to generate antibodies is typical in the art with a wide variety of systems such as fusion proteins being used by practitioners (see e.g. Current Protocols In Molecular Biology, Volume 2, Unit 16, Frederick M. Ausubul et al. eds, 1995).
- each of the variety of epitopes in a protein of interest functions to provide the architecture upon which the antibody is generated.
- skilled artisans generally create a variety of different polypeptide fragments that can be used in order to generate antibodies specific for different portions of a polypeptide of interest (see e.g. U.S. Patent No. 5,840,501 and U.S. Patent No. 5,939,533).
- a polypeptide comprising one of the 20P2H8 biological motifs discussed below.
- Polypeptide fragments and variants are typically useful in this context as long as they have the common attribute or characteristic of having an epitope capable of generating an antibody specific for a target polypeptide sequence (e.g. the 20P2H8 polypeptide shown in SEQ ID NO: 2).
- the 20P2H8 polynucleotides and polypeptides exhibit specific properties that make them useful in diagnosing cancers of the prostate.
- the described diagnostic assays that measures the presence of 20P2H8 gene products, in order to evaluate the presence or onset of the particular disease conditions described herein such as prostate cancer are particularly useful in identifying potential candidates for preventive measures or further monitoring, as has been done so successfully with PSA.
- these materials satisfy a need in the art for molecules having similar characteristics to PSA in situations where, for example, a definite diagnosis of metastasis of prostatic origin cannot be made on the basis of a testing for PSA alone (see e.g. Alanen et al, Pathol. Res. Pract. 192(3): 233-237 (1996)), and consequendy, materials such as 20P2H8 polynucleotides and polypeptides (as well as the 20P2H8 polynucleotide probes and anti-20P2H8 antibodies used to identify the presence of these molecules) must be employed to confirm metastases of prostatic origin.
- the 20P2H8 polynucleotides disclosed herein have a number of other specific utilities such as their use in the identification of oncogenetic associated chromosomal abnormalities in 15q22.
- the 20P2H8 polypeptides and polynucleotides disclosed herein have other utilities such as their use in the forensic analysis of tissues of unknown origin (see e.g. Takahama K Forensic Sci Int 1996 Jun 28;80(l-2): 63-9).
- 20P2H8 POLYNUCLEOTIDES One aspect of the invention provides polynucleotides corresponding or complementary to all or part of a 20P2H8 gene, mRNA, and/or coding sequence, preferably in isolated form, including polynucleotides encoding a 20P2H8 protein and fragments thereof, DNA, RNA, DNA/RNA hybrid, and related molecules, polynucleotides or oligonucleotides complementary to a 20P2H8 gene or mRNA sequence or a part thereof, and polynucleotides or oUgonucleotides that hybridize to a 20P2H8 gene, mRNA, or to a 20P2H8 encoding polynucleotide (collectively, "20P2H8 polynucleotides").
- the 20P2H8 gene and protein is meant to include the 20P2H8 genes and proteins specifically described herein and the genes and proteins corresponding to other 20P2H8 proteins and structurally similar variants of the foregoing.
- Such other 20P2H8 proteins and variants will generally have coding sequences that are highly homologous to the 20P2H8 coding sequence, and preferably will share at least about 50% amino acid identity and at least about 60% amino acid homology (using BLAST criteria), more preferably sharing 70% or greater homology (using BLAST criteria).
- a 20P2H8 polynucleotide may comprise a polynucleotide having the nucleotide sequence of human 20P2H8 as shown in FIG. 1, wherein T can also be U; a polynucleotide which encodes all or part of the 20P2H8 protein; a sequence complementary to the foregoing; or a polynucleotide fragment of any of the foregoing.
- Another embodiment comprises a polynucleotide encoding a 20P2H8 polypeptide whose sequence is encoded by the cDNA contained in the plasmid as deposited on March 10, 1999 with American Type Culture Collection 10801 University Boulevard, Manassas, Virginia, USA (ATCC) as Accession No. 207151.
- Another embodiment comprises a polynucleotide which is capable of hybridizing under stringent hybridization conditions to the human 20P2H8 cDNA shown in FIG. 1.
- Typical embodiments of the invention disclosed herein include 20P2H8 polynucleotides containing specific portions of the 20P2H8 mRNA sequence (and those which are complementary to such sequences) such as those that encode the protein and fragments thereof.
- representative embodiments of the invention disclosed herein include: polynucleotides encoding about amino acid 1 to about amino acid 10 of the 20P2H8 protem shown in SEQ ID NO: 2, polynucleotides encoding about am o acid 20 to about ammo acid 30 of the 20P2H8 protem shown in SEQ ID NO: 2, polynucleotides encoding about ammo acid 30 to about amtno acid 40 of the 20P2H8 protem shown m SEQ ID NO: 2, polynucleotides encoding about amino acid 40 to about am o acid 50 of the 20P2H8 protem shown in SEQ ID NO: 2, polynucleotides encoding about amino acid 50 to about amtno acid 60 of the
- polynucleotides encodmg portions of the ammo acid sequence of ammo acids 100-517 of the 20P2H8 protem are typical embodiments of the invention.
- Polynucleotides encoding larger portions of the 20P2H8 protem are also contemplated.
- polynucleotides encodmg from about ammo acid 1 (or 20 or 30 or 40 etc ) to about ammo acid 20, (or 30, or 40 or 50 etc.) of the 20P2H8 protem shown in SEQ ID NO: 2 may be generated by a variety of techniques well known m the art.
- Additional illustrative embodiments of 20P2H8 polynucleotides mclude embodiments consisting of a polynucleotide having the sequence as shown m FIG. 1 (SEQ ID NO: 1) from about nucleotide residue number 1 through about nucleotide residue number 500, from about nucleotide residue number 500 through about nucleotide residue number 1000 and from about nucleotide residue number 1000 through about nucleotide residue number 3600.
- SEQ ID NO: 1 polynucleotide having the sequence as shown m FIG. 1 (SEQ ID NO: 1) from about nucleotide residue number 1 through about nucleotide residue number 500, from about nucleotide residue number 500 through about nucleotide residue number 1000 and from about nucleotide residue number 1000 through about nucleotide residue number 3600.
- SEQ ID NO: 1 for example a polynucleotide having the 517 ammo acid ORF within the polynucleotide sequence as shown m FIG. 1 (SEQ ID NO: 1), e.g. from about nucleotide residue number 450 through about nucleotide residue number 2000.
- a polynucleotide may mclude portions of both the coding and non-coding regions of the 20P2H8 protem such as a polynucleotide fragment consisting of the sequence from about residue 600 through about residue 3600 etc.
- Additional illustrative embodiments of the invention disclosed herein mclude 20P2H8 polynucleotide fragments encoding one or more of the biological motifs contamed within the 20P2H8 protem sequence.
- Typical polynucleotide fragments of the invention include those that encode one or more of the 20P2H8 N-glycosylation sites, casern kinase II phosphorylation sites, the RNA binding sequences such as the ribonucleoprotein- 1 and ⁇ bonucleoprote ⁇ n-2 consensus sites, the proline rich regions or N-myristoylation sites as disclosed in greater detail m the text discussing the 20P2H8 protem and polypeptides below
- polynucleotides of the preceding paragraphs have a number of different specific uses.
- polynucleotides encodmg different regions of the 20P2H8 protem can be used to characterize cytogenetic abnormalities on chromosome 15, bands ql3.2-ql4 that have been identified as bemg associated with various cancers.
- a variety of chromosomal abnormalities in 15q22.32-23 have been identified as frequent cytogenetic abnormalities m a number of different cancers (see, e.g, Goffman et al. Cancer Genet.
- polynucleotides encoding specific regions of the 20P2H8 protem provide new tools that can be used to delineate with a greater precision than previously possible, the specific nature of the cytogenetic abnormalities in this region of chromosome 15 that may contribute to the malignant phenotype
- these polynucleotides satisfy a need m the art for expanding the sensitivity of chromosomal screening in order to identify more subtie and less common chromosomal abnormalities (see, e.g, Evans et al, 1994, Am. J. Obstet. Gynecol. 171 (4):1055-1057).
- these polynucleotides may be used m methods assessmg the status of 20P2H8 gene products in normal versus cancerous tissues.
- polynucleotides encoding specific regions of the 20P2H8 protem may be used to assess the presence of perturbations (such as deletions, insertions, pomt mutations etc.) m specific regions (such as regions containing the RNA binding sequences) of the 20P2H8 gene products.
- Exemplary assays m include both RT-PCR assays as well as single-strand conformation polymorphism (SSCP) analysis (see, e.g, Marrogi et al, 1999, J. Cutan. Pathol. 26(8): 369- 378), both of which utilize polynucleotides encodmg specific regions of a protem to examine these regions within the protem.
- SSCP single-strand conformation polymorphism
- antisense molecules can be RNAs or other molecules, including peptide nucleic acids (PNAs) or non-nucleic acid molecules such as phosphorothioate derivatives, that specifically bmd DNA or RNA m a base pair- dependent manner.
- PNAs peptide nucleic acids
- non-nucleic acid molecules such as phosphorothioate derivatives
- Antisense technology entails the administration of exogenous oligonucleotides that bmd to a target polynucleotide located within the cells.
- the term "antisense” refers to the fact that such oligonucleotides are complementary to their intracellular targets, e.g, 20P2H8. See for example, Jack Cohen, 1988, OLIGODEOXYNUCLEOTIDES, Antisense Inhibitors of Gene Expression, CRC Press; and Synthesis 1:1-5 (1988).
- the 20P2H8 antisense oligonucleotides of the present invention include derivatives such as S- oligonucleotides (phosphorothioate derivatives or S-oligos, see, Jack Cohen, supra), which exhibit enhanced cancer cell growth inhibitory action.
- S-oligos are isoelectronic analogs of an oligonucleotide (O-oligo) in which a nonbridging oxygen atom of the phosphate group is replaced by a sulfur atom.
- the S- oligos of the present invention may be prepared by treatment of the corresponding O- oligos with 3H-l,2-benzodithiol-3-one-l,l -dioxide, which is a sulfur transfer reagent. See Iyer, R. P. et al, 1990, J. Org. Chem. 55:4693-4698; and Iyer, R. P. et al, 1990, J. Am. Chem. Soc. 112:1253-1254, the disclosures of which are fully incorporated by reference herein. Additional 20P2H8 antisense oUgonucleotides of the present invention include morpholino antisense oUgonucleotides known in the art (see e.g. Partridge et al, 1996, Antisense & Nucleic Acid Drug Development 6: 169-175).
- the 20P2H8 antisense oUgonucleotides of the present invention typically may be RNA or DNA that is complementary to and stably hybridizes with the first 100 N- terminal codons or last 100 C-terminal codons of the 20P2H8 genomic sequence or the corresponding mRNA. While absolute complementarity is not required, high degrees of complementarity are preferred. Use of an oUgonucleotide complementary to this region allows for the selective hybridization to 20P2H8 mRNA and not to mRNA specifying other regulatory subunits of protein kinase.
- the 20P2H8 antisense oUgonucleotides of the present invention are a 15 to 30-mer fragment of the antisense DNA molecule having a sequence that hybridizes to 20P2H8 mRNA.
- 20P2H8 antisense oUgonucleotide is a 30-mer oUgonucleotide that is complementary to a region in the first 10 N-terminal codons and last 10 C-terminal codons of 20P2H8.
- the antisense molecules are modified to employ ribozymes in the inhibition of 20P2H8 expression (L. A. Couture & D. T. Stinchcomb, 1996, Trends Genet. 12: 510-515).
- probes and primer pairs which aUow the specific ampUfication of the polynucleotides of the invention or of any specific parts thereof, and probes that selectively or specificaUy hybridize to nucleic acid molecules of the invention or to any part thereof.
- Probes may be labeled with a detectable marker, such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator or enzyme.
- a detectable marker such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator or enzyme.
- Such probes and primers can be used to detect the presence of a 20P2H8 polynucleotide in a sample and as a means for detecting a ceU expressing a 20P2H8 protein.
- probes include polypeptides comprising aU or part of the human 20P2H8 cDNA sequences shown in SEQ ID NO: 1.
- primer pairs capable of specificaUy ampUfying 20P2H8 mRNAs are also described in the Examples that foUow. As wiU be understood by the skiUed artisan, a great many different primers and probes may be prepared based on the sequences provided herein and used effectively to ampUfy and/or detect a 20P2H8 mRNA.
- a polynucleotide is said to be "isolated” when it is substantiaUy separated from contaminant polynucleotides that correspond or are complementary to genes other than the 20P2H8 gene or that encode polypeptides other than 20P2H8 gene product or fragments thereof.
- a skilled artisan can readily employ nucleic acid isolation procedures to obtain an isolated 20P2H8 polynucleotide.
- the 20P2H8 polynucleotides of the invention are useful for a variety of purposes, including but not limited to their use as probes and primers for the ampUfication and/or detection of the 20P2H8 gene(s), mRNA(s), or fragments thereof; as reagents for the diagnosis and/or prognosis of prostate cancer and other cancers; as coding sequences capable of directing the expression of 20P2H8 polypeptides; as tools for modulating or inhibiting the expression of the 20P2H8 gene(s) and/or translation of the 20P2H8 transcript(s); and as therapeutic agents.
- the 20P2H8 cDNA sequences described herein enable the isolation of other polynucleotides encoding 20P2H8 gene product(s), as weU as the isolation of polynucleotides encoding 20P2H8 gene product homologs, alternatively spUced isoforms, aUeUc variants, and mutant forms of the 20P2H8 gene product.
- Various molecular cloning methods that can be employed to isolate full length cDNAs encoding a 20P2H8 gene are weU known (See, e.g, Sambrook, J. et al, 1989, Molecular Cloning: A Laboratory Manual, 2d ed.
- Phage clones containing 20P2H8 gene cDNAs may be identified by probing with a labeled 20P2H8 cDNA or a fragment thereof.
- the 20P2H8 cDNA (SEQ ID NO: 1) or a portion thereof can be synthesized and used as a probe to retrieve overlapping and fuU length cDNAs corresponding to a 20P2H8 gene.
- the 20P2H8 gene itself may be isolated by screening genomic DNA Ubraries, bacterial artificial chromosome Hbraries (BACs), yeast artificial chromosome Ubraries (YACs), and the like, with 20P2H8 DNA probes or primers.
- BACs bacterial artificial chromosome Hbraries
- YACs yeast artificial chromosome Ubraries
- the invention also provides recombinant DNA or RNA molecules containing a 20P2H8 polynucleotide, including but not limited to phages, plasmids, phagemids, cosmids, YACs, BACs, as weU as various viral and non-viral vectors weU known in the art, and ceUs transformed or transfected with such recombinant DNA or RNA molecules.
- a recombinant DNA or RNA molecule is a DNA or RNA molecule that has been subjected to molecular manipulation in vitro. Methods for generating such molecules are weU known (see, e.g, Sambrook et al, 1989, supra).
- the invention further provides a host-vector system comprising a recombinant DNA molecule containing a 20P2H8 polynucleotide within a suitable prokaryotic or eukaryotic host ceU.
- suitable eukaryotic host ceUs include a yeast ceU, a plant ceU, or an animal ceU, such as a mammaUan ceU or an insect ceU (e.g, a baculovirus- infectible ceU such as an Sf9 or HighFive ceU).
- mammaUan ceUs examples include various prostate cancer ceU Lines such as PrEC, LNCaP and TsuPrl, other transfectable or transducible prostate cancer ceU lines, as weU as a number of mammaUan ceUs routinely used for the expression of recombinant proteins (e.g, COS, CHO, 293, 293T ceUs). More particularly, a polynucleotide comprising the coding sequence of 20P2H8 may be used to generate 20P2H8 proteins or fragments thereof using any number of host-vector systems routinely used and widely known in the art.
- recombinant proteins e.g, COS, CHO, 293, 293T ceUs
- Preferred vectors for mammaUan expression include but are not limited to pcDNA 3.1 myc-His-tag (Invitrogen) and the retroviral vector pSR ⁇ tkneo (Muller et al, 1991, MCB 11:1785).
- 20P2H8 may be preferably expressed m several prostate cancer and non-prostate ceU lines, including for example 293, 293T, rat-1, NIH 3T3 and TsuPrl.
- the host- vector systems of the invention are useful for the production of a 20P2H8 protem or fragment thereof. Such host-vector systems may be employed to study the functional properties of 20P2H8 and 20P2H8 mutations.
- Recombmant human 20P2H8 protem may be produced by mammaUan ceUs transfected with a construct encodmg 20P2H8.
- 293T ceUs can be transfected with an expression plasmid encoding 20P2H8, the 20P2H8 protem is expressed m the 293T ceUs, and the recombmant 20P2H8 protem can be isolated usmg standard purification methods (e.g, affinity purification us g anti-20P2H8 antibodies).
- the 20P2H8 coding sequence is subcloned mto the retroviral vector pSR ⁇ MSVtkneo and used to infect va ⁇ ous mammaUan ceU lines, such as NIH 3T3, TsuPrl, 293 and rat-1 in order to estabUsh 20P2H8 expressmg ceU lines.
- Various other expression systems weU known m the art may also be employed Expression constructs encoding a leader peptide joined m frame to the 20P2H8 coding sequence may be used for the generation of a secreted form of recombmant 20P2H8 protem.
- Protems encoded by the 20P2H8 genes, or by fragments thereof, wiU have a variety of uses, including but not limited to generating antibodies and in methods for identifymg ligands and other agents and ceUular constituents that bmd to a 20P2H8 gene product.
- Antibodies raised agamst a 20P2H8 protem may be useful m diagnostic and prognostic assays, and imaging methodologies in the management of human cancers characterized by expression of 20P2H8 protem, including but not limited to cancers of the kidney, skin, cervix, prostate, bra , bladder, pancreas, ovaries, lung, testis and breast (see e.g. Figs. 4-8).
- Such antibodies may be expressed intraceUularly and used m methods of treating patients with such cancers.
- immunological assays useful for the detection of 20P2H8 protems are contemplated, including but not limited to va ⁇ ous types of radioimmunoassays, enzyme- linked lmmunosorbent assays (ELISA), enzyme-linked lmmunofluorescent assays (ELIFA), immunocytochemical methods, and the like.
- ELISA enzyme- linked lmmunosorbent assays
- ELIFA enzyme-linked lmmunofluorescent assays
- Such antibodies may be labeled and used as immunological imaging reagents capable of detecting 20P2H8 expressmg ceUs (e.g., m radioscintigraphic imaging methods).
- 20P2H8 protems may also be particularly useful m generating cancer vaccmes, as further desc ⁇ bed below.
- 20P2H8 POLYPEPTIDES Another aspect of the present invention provides 20P2H8 protems and polypeptide fragments thereof.
- the 20P2H8 protems of the invention mclude those specifically identified herein, as well as aUeUc va ⁇ ants, conservative substitution variants and homologs that can be isolated/generated and characterized without undue experimentation foUowing the methods outlined below Fusion protems that combine parts of different 20P2H8 protems or fragments thereof, as well as fusion protems of a 20P2H8 protem and a heterologous polypeptide are also mcluded.
- 20P2H8 protems wiU be coUectively referred to as the 20P2H8 protems, the protems of the invention, or 20P2H8.
- the term "20P2H8 polypeptide” refers to a polypeptide fragment or a 20P2H8 protem of at least 6 ammo acids, preferably at least 15 amino acids.
- Specific embodiments of 20P2H8 protems comp ⁇ se a polypeptide having the ammo acid sequence of human 20P2H8 as shown m SEQ ID NO: 2.
- embodiments of 20P2H8 protems compnse variant polypeptides having alterations m the amtno acid sequence of human 20P2H8 as shown in SEQ ID NO: 2.
- alleUc va ⁇ ants of human 20P2H8 wiU share a high degree of structural identity and homology (e.g, 90% or more identity).
- TypicaUy, aUeUc va ⁇ ants of the 20P2H8 protems wiU contam conservative ammo acid substitutions within the 20P2H8 sequences descnbed herem or will contam a substitution of an ammo acid from a corresponding position m a 20P2H8 homologue.
- One class of 20P2H8 aUeUc va ⁇ ants wiU be protems that share a high degree of homology with at least a smaU region of a particular 20P2H8 ammo acid sequence, but wiU further contam a radical departure from the sequence, such as a non-conservative substitution, truncation, insertion or frame shift.
- Conservative ammo acid substitutions can frequendy be made m a protem without altermg either the conformation or the function of the protem. Such changes mclude substituting any of isoleucine (I), valine (V), and leucme (L) for any other of these hydrophobic ammo acids; aspartic acid (D) for glutamic acid (E) and vice versa; glutamine (Q) for asparagine (N) and vice versa; and serme (S) for threonine (T) and vice versa Other substitutions can also be considered conservative, depending on the environment of the particular amino acid and its role m the three-dimensional structure of the protem.
- glycme (G) and alanme (A) can frequendy be mterchangeable, as can alanine (A) and valine (V).
- Methionine (M) which is relatively hydrophobic, can frequendy be mterchanged with leucme and isoleucine, and sometimes with valine.
- Lysme (K) and arginine (R) are frequently mterchangeable m locations m which the significant feature of the amino acid residue is its charge and the differing pK's of these two ammo acid residues are not significant. StiU other changes can be considered "conservative" in particular environments.
- Embodiments of the invention disclosed herem m clude a wide vanety of art accepted va ⁇ ants of 20P2H8 protems such as polypeptides havmg amino acid insertions, deletions and substitutions.
- 20P2H8 variants can be made usmg methods known m the art such as site-directed mutagenesis, alanme scannmg, and PCR mutagenesis.
- Site- directed mutagenesis (Carter et al, 1986, Nucl. Acids Res. 13:4331; ZoUer et al, 1987, Nucl. Acids Res.
- Alanme is typicaUy a preferred scannmg ammo acid among this group because it eliminates the side-chain beyond the beta-carbon and is less likely to alter the mam-chain conformation of the variant. Alanme is also typicaUy preferred because it is the most common am o acid. Further, it is frequendy found m both buried and exposed positions (Creighton, The Protems, (W H. Freeman & Co, N.Y.); Chothia, 1976, J. Mol. Biol, 150:1). If alanme substitution does not yield adequate amounts of variant, an isoste ⁇ c amino acid can be used.
- 20P2H8 variants have the distinguishing attribute of havmg at least one epitope m common with a 20P2H8 protem havmg the amino acid sequence of SEQ ID NO: 2, such that an antibody that specificaUy bmds to a 20P2H8 variant wiU also specificaUy bmd to the 20P2H8 protem havmg the amino acid sequence of SEQ ID NO.
- a polypeptide ceases to be a variant of the protein shown m SEQ ID NO 2 when it no longer contains an epitope capable of bemg recognized by an antibody that specificaUy bmds to a 20P2H8 protem
- antibodies that recognize proteins bmd to epitopes of varying size, and a grouping of the order of about six ammo acids, contiguous or not, is regarded as a typical number of ammo acids in a minimal epitope See e.g. Hebbes et al, Mol Immunol (1989) 26(9):865-73; Schwartz et al, J Immunol (1985) 135(4):2598-608.
- Another specific class of 20P2H8 protem variants shares 90% or more identity with the ammo acid sequence of SEQ ID NO: 2.
- Another specific class of 20P2H8 protem variants comprises one or more of the 20P2H8 biological motifs described below
- embodiments of the claimed mvention include polypeptides containing less than the 517 amino acid sequence of the 20P2H8 protem shown in SEQ ID NO: 2 (and the polynucleotides encodmg such polypeptides).
- representative embodiments of the mvention disclosed herem include polypeptides consisting of about ammo acid 1 to about ammo acid 10 of the 20P2H8 protem shown m SEQ ID NO: 2, polypeptides consisting of about ammo acid 20 to about ammo acid 30 of the 20P2H8 protem shown m SEQ ID NO: 2, polypeptides consisting of about ammo acid 30 to about ammo acid 40 of the 20P2H8 protem shown m SEQ ID NO: 2, polypeptides consisting of about ammo acid 40 to about ammo acid 50 of the 20P2H8 protem shown m SEQ ID NO.
- polypeptides consisting of about ammo acid 50 to about ammo acid 60 of the 20P2H8 protem shown in SEQ ID NO: 2 polypeptides consisting of about ammo acid 60 to about ammo acid 70 of the 20P2H8 protem shown m SEQ ID NO: 2
- polypeptides consisting of about amino acid 70 to about amino acid 80 of the 20P2H8 protem shown m SEQ ID NO: 2 polypeptides consisting of about ammo acid 80 to about ammo acid 90 of the 20P2H8 protem shown m SEQ ID NO: 2
- polypeptides consisting of about amino acid 90 to about ammo acid 100 of the 20P2H8 protem shown m SEQ ID NO: 2 etc.
- polypeptides consisting of portions of the ammo acid sequence of ammo acids 100-517 of the 20P2H8 protem are typical embodiments of the mvention.
- Polypeptides consisting of larger portions of the 20P2H8 protem are also contemplated
- polypeptides consisting of about ammo acid 1 (or 20 or 30 or 40 etc.) to about amino acid 20, (or 30, or 40 or 50 etc.) of the 20P2H8 protein shown in SEQ ID NO: 2 may be generated by a variety of techniques weU known in the art.
- Additional iUustrative embodiments of the invention disclosed herein include 20P2H8 polypeptides containing the amino acid residues of one or more of the biological motifs contained within the 20P2H8 polypeptide sequence as shown in SEQ ID NO: 2.
- typical polypeptides of the invention can contain one or more of the 20P2H8 N-glycosylation sites such as NYTA at residues 436-439 and/or NLSG at residues 459-462 (SEQ ID NO: 2).
- typical polypeptides of the invention can contain one or more of the 20P2H8 casein kinase II phosphorylation sites such as SQVE at residues 19-22, SDPE at residues 41-44, SKME at residues 56-59, SDQD at residues 77-80, TGED at residues 141-144, TSNE at residues 152-155, TAEE at residues 178-181, TYPD at residues 203-206, TAAE at residues 245-248, TIED at residues 297-300 and/or SAEE at residues 364-367 (SEQ ID NO: 2).
- SQVE casein kinase II phosphorylation sites
- typical polypeptides of the invention can contain one or more of the N-myristoylation sites such as GLNIAK at residues 87-92, GAALCL at residues 94-99, GGTSNE at residues 150-155, GLPFTA at residues 172-177, GGKEGI at residues 194-199, GLPYAA at residues 291-296, GGTLNR at residues 374-379, GSPNSL at residues 446-451, GLAYNT at residues 475-480 and/or GLIHTN at residues 499-504 (SEQ ID NO: 2).
- N-myristoylation sites such as GLNIAK at residues 87-92, GAALCL at residues 94-99, GGTSNE at residues 150-155, GLPFTA at residues 172-177, GGKEGI at residues 194-199, GLPYAA at residues 291-296, GGTLNR at residues 374-379, GSPNSL at residues 446-451, GLAYNT at residue
- typical polypeptides of the invention can contain the one or more of the amidation sites such as QGRR at residues 102-105 and/or LGKR at residues 234-237 (SEQ ID NO: 2).
- typical polypeptides of the invention can contain one or more of the RNA-binding domains such as those shown in Figure 1.
- typical polypeptides of the invention can contain one or more of the proUne rich regions such as those shown in Figure 1.
- typical polypeptides of the invention can contain one or more of the immunoreactive epitopes identified by a process described herein such as such as those shown in Table 1.
- inventions include polypeptides containing combinations of the different motifs discussed above with preferable embodiments being those which contain no insertions, deletions or substitutions either within the motifs or the intervening sequences of these polypeptides.
- embodiments which include a number of either N-terminal and/or C- terminal amino acid residues on either side of these motifs may be desirable (to, for example, include a greater portion of the polypeptide architecture in which the motif is located).
- TypicaUy the number of N-terminal and/or C-terminal amino acid residues on either side of a motif is between about 5 to about 50 amino acid residues.
- IUusttative examples of such embodiments includes a polypeptide having one or more motifs selected from the group consisting of SDPE and/or SKME and/or TGED (SEQ ID NO: 2).
- polypeptides having other combinations of the biological motifs disclosed herein are also contemplated such as a polypeptide having GLIHN and any one of the other biological motifs such as SKME or a polypeptide having GLIHN and any one of the other biological motifs such as GGKEGI etc. (SEQ ID NO: 2).
- Polypeptides consisting of one or more of the 20P2H8 motifs discussed above are useful in elucidating the specific characteristics of a maUgnant phenotype in view of the observation that the 20P2H8 motifs discussed above are associated with growth dysregulation and because 20P2H8 is overexpressed in cancers (FIGS. 4 and 5).
- Casein kinase II and protein kinase C for example are enzymes known to be associated with the development of the maUgnant phenotype (see e.g.
- RNA recognition motifs and proline rich regions are also associated with oncogenic processes (see e.g. Kennedy et al. Nat. Genet. 12(3): 329-331 (1996): Li et al, J. Biol. Chem. 275(30): 23053-23058 (2000) and Xiao et al. Blood. 2000 Jul 15;96(2):699-704).
- the polypeptides of the preceding paragraphs have a number of different specific uses.
- 20P2H8 is shown to be expressed in a variety of cancers including kidney, prostate, bladder, testicular, ovarian, breast, pancreas, colon, skin, cervical, stomach and lung cancer ceU lines and/or patient samples (see e.g. FIGS. 4-8), these polypeptides may be used in methods assessing the status of 20P2H8 gene products in normal versus cancerous tissues and elucidating the maUgnant phenotype.
- polypeptides encoding specific regions of the 20P2H8 protein may be used to assess the presence of perturbations (such as deletions, insertions, point mutations etc.) in specific regions of the 20P2H8 gene products (such as regions containing the RNA binding motifs).
- Exemplary assays can utilize antibodies targeting a 20P2H8 polypeptide containing the amino acid residues of one or more of the biological motifs contained within the 20P2H8 polypeptide sequence in order to evaluate the characteristics of this region in normal versus cancerous tissues.
- 20P2H8 polypeptides containing the amino acid residues of one or more of the biological motifs contained within the 20P2H8 polypeptide sequence can be used to screen for factors that interact with that region of 20P2H8.
- codon preferences for a specific host species can adapt the disclosed sequence as preferred for a desired host.
- preferred codon sequences typicaUy have rare codons (i.e, codons having a usage frequency of less than about 20% in known sequences of the desired host) replaced with higher frequency codons.
- Codon preferences for a specific organism may be calculated, for example, by utilizing codon usage tables available on the Internet at the foUowing address: http://www.dna.affrc.go.jp/ ⁇ nakamura/codon.html.
- Nucleotide sequences that have been optimized for a particular host species by replacing any codons having a usage frequency of less than about 20% are referred to herein as "codon optimized sequences.” Additional sequence modifications are known to enhance protein expression in a ceUular host. These include elimination of sequences encoding spurious polyadenylation signals, exon/intron spUce site signals, transposon-like repeats, and/or other such weU- characterized sequences that may be deleterious to gene expression.
- the GC content of the sequence may be adjusted to levels average for a given ceUular host, as calculated by reference to known genes expressed in the host ceU. Where possible, the sequence may also be modified to avoid predicted hairpin secondary mRNA structures.
- 20P2H8 protems may be embodied m many forms, preferably in isolated form As used herem, a protem is said to be "isolated” when physical, mechanical or chemical methods are employed to remove the 20P2H8 protem from ceUular constituents that are normaUy associated with the protem. A skdled artisan can readily employ standard purification methods to obtam an isolated 20P2H8 protem. A purified 20P2H8 protem molecule wiU be substantiaUy free of other protems or molecules that impair the binding of 20P2H8 to antibody or other Ugand. The nature and degree of isolation and purification wiU depend on the mtended use.
- Embodiments of a 20P2H8 protem m include a purified 20P2H8 protein and a functional, soluble 20P2H8 protem.
- such functional, soluble 20P2H8 protems or fragments thereof retam the abiUty to bmd antibody or other Ugand.
- the mvention also provides 20P2H8 polypeptides comprising biologicaUy active fragments of the 20P2H8 ammo acid sequence, such as a polypeptide corresponding to part of the ammo acid sequence for 20P2H8 as shown in SEQ ID NO: 2.
- Such polypeptides of the invention exhibit properties of the 20P2H8 protem, such as the ability to ehcit the generation of antibodies that specificaUy bmd an epitope associated with the 20P2H8 protem.
- 20P2H8 polypeptides can be generated usmg standard peptide synthesis technology or usmg chemical cleavage methods weU known in the art based on the ammo acid sequences of the human 20P2H8 protems disclosed herem.
- recombmant methods can be used to generate nucleic acid molecules that encode a polypeptide fragment of a 20P2H8 protem.
- the 20P2H8-encod ⁇ ng nucleic acid molecules descnbed herem provide means for generating defined fragments of 20P2H8 protems.
- 20P2H8 polypeptides are particularly useful m generating and characterizing domain specific antibodies (e g, antibodies recognizing an extraceUular or mtraceUular epitope of a 20P2H8 protem), m identifying agents or ceUular factors that bmd to 20P2H8 or a particular structural domain thereof, and m va ⁇ ous therapeutic contexts, mcluc ng but not limited to cancer vaccines
- 20P2H8 polypeptides containing particulariy interesting structures can be predicted and/or identified usmg va ⁇ ous analytical techniques well known m the art, including, for example, the methods of Chou-Fasman, Garnier-Robson, Kyte-DooUttle, Eisenberg, Karplus-Schultz or Jameson- Wolf analysis, or on the basis of immunogenicity. Fragments containing such structures are particularly useful in generating subunit specific anti-20P2H8 antibodies or in identifying ceUular factors that bind to 20P2H8.
- 20P2H8 can be conveniendy expressed in ceUs (such as 293T ceUs) transfected with a commerciaUy avaUable expression vector such as a CMV-driven expression vector encoding 20P2H8 with a C-terminal 6XHis and MYC tag (pcDNA3.1/mycHIS, Invitrogen or Tag5, GenHunter Corporation, Nashvi e TN).
- the Tag5 vector provides an IgGK secretion signal that can be used to faciUtate the production of a secreted 20P2H8 protein in transfected ceUs.
- the secreted HIS-tagged 20P2H8 in the culture media may be purified using a nickel column using standard techniques.
- Modifications of 20P2H8 such as covalent modifications are included within the scope of this invention.
- One type of covalent modification includes reacting targeted amino acid residues of a 20P2H8 polypeptide with an organic derivatizing agent that is capable of reacting with selected side chains or the N- or C- terminal residues of the 20P2H8.
- Another type of covalent modification of the 20P2H8 polypeptide included within the scope of this invention comprises altering the native glycosylation pattern of the polypeptide.
- “Altering the native glycosylation pattern” is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence 20P2H8 (either by removing the underlying glycosylation site or by deleting the glycosylation by chemical and/or enzymatic means), and/or adding one or more glycosylation sites that are not present in the native sequence 20P2H8.
- the phrase includes quaUtative changes in the glycosylation of the native proteins, involving a change in the nature and proportions of the various carbohydrate moieties present.
- Another type of covalent modification of 20P2H8 comprises Unking the 20P2H8 polypeptide to one of a variety of nonproteinaceous polymers, e.g, polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Patent Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337.
- the 20P2H8 of the present invention may also be modified in a way to form a chimeric molecule comprising 20P2H8 fused to another, heterologous polypeptide or amino acid sequence.
- such a chimeric molecule comprises a fusion of the 20P2H8 with a polyhistidine epitope tag, which provides an epitope to which immobiUzed nickel can selectively bind.
- the epitope tag is generaUy placed at the amino- or carboxyl- terminus of the 20P2H8.
- the chimeric molecule may comprise a fusion of the 20P2H8 with an immunoglobuUn or a particular region of an immunoglobuUn.
- an immunoglobuUn or a particular region of an immunoglobuUn.
- a bivalent form of the chimeric molecule also referred to as an "immunoadhesin”
- such a fusion could be to the Fc region of an IgG molecule.
- the Ig fusions preferably include the substitution of a soluble (transmembrane domain deleted or inactivated) form of a 20P2H8 polypeptide in place of at least one variable region within an Ig molecule.
- the immunoglobuUn fusion includes the hinge, CH2 and CH3, or the hinge, CHI, CH2 and CH3 regions of an IgGl molecule.
- 20P2H8 monoclonal antibodies including agonist, antagonist and neutralizing antibodies
- anti-20P2H8 antibody compositions with polyepitopic specificity refers to an antibody obtained from a population of substantiaUy homogeneous antibodies, i.e. the antibodies comprising the individual population are identical except for possible naturaUy-occurring mutations that may be present in minor amounts.
- Another aspect of the invention provides antibodies that bind to 20P2H8 proteins and polypeptides.
- the most preferred antibodies will specificaUy bind to a 20P2H8 protein and wiU not bind (or wiU bind weakly) to non-20P2H8 proteins and polypeptides.
- Anti- 20P2H8 antibodies that are particularly contemplated include monoclonal and polyclonal antibodies as weU as fragments containing the antigen binding domain and/ or one or more complementarity determining regions of these antibodies.
- an antibody fragment is defined as at least a portion of the variable region of the immunoglobulin molecule that binds to its target, i.e, the antigen binding region.
- 20P2H8 antibodies of the invention may be particularly useful in prostate cancer diagnostic and prognostic assays, and imaging methodologies.
- IntraceUularly expressed antibodies e.g, single chain antibodies
- Such antibodies may be useful m the treatment, diagnosis, and/or prognosis of other cancers, to the extent 20P2H8 is also expressed or overexpressed m other types of cancers such as prostate, kidney, bladder, cervical, skin, stomach, testicular, ovarian, breast, pancreas, colon and lung cancers.
- the mvention also provides va ⁇ ous immunological assays useful for the detection and quantification of 20P2H8 and mutant 20P2H8 protems and polypeptides.
- Such assays generaUy comp ⁇ se one or more 20P2H8 antibodies capable of recognizing and binding a 20P2H8 or mutant 20P2H8 protem, as appropriate, and may be performed within va ⁇ ous immunological assay formats weU known m the art, mcludmg but not limited to va ⁇ ous types of radioimmunoassays, enzyme-linked immunosorbent assays (ELISA), enzyme- Unked rmmunofluorescent assays (ELIFA), and the like.
- ELISA enzyme-linked immunosorbent assays
- ELIFA enzyme- Unked rmmunofluorescent assays
- immunological imaging methods capable of detecting prostate cancer and other cancers expressmg 20P2H8 are also provided by the mvention, mcludmg but limited to radioscintigraphic imaging methods usmg labeled 20P2H8 antibodies.
- Such assays may be clinicaUy useful m the detection, monito ⁇ ng, and prognosis of 20P2H8 expressmg cancers such as prostate, bladder, testicular, ovarian, breast, pancreas, colon and lung cancer ceU lines.
- 20P2H8 antibodies may also be used m methods for pu ⁇ fymg 20P2H8 and mutant 20P2H8 protems and polypeptides and for isolating 20P2H8 homologues and related molecules.
- Other uses of the 20P2H8 antibodies of the mvention clude generating anti-idiotypic antibodies that mimic the 20P2H8 protem.
- antibodies may be prepared by immunizing a suitable mammaUan host usmg a 20P2H8 protem, peptide, or fragment, in isolated or lmmunocon j ugated form (Hariow, and Lane, eds, 1988, Antibodies: A Laboratory Manual, CSH Press; Harlow, 1989, Antibodies, Cold Sp ⁇ ng Harbor Press, NY)
- fusion protems of 20P2H8 may also be used, such as a 20P2H8 GST-fusion protem
- a GST fusion protem comp ⁇ smg aU or most of the open reading frame ammo acid sequence of SEQ ID NO: 2 may be produced and used as an immunogen to generate appropriate antibodies.
- a 20P2H8 peptide may be synthesized and used as an immunogen.
- naked DNA immunization techniques known in the art may be used (with or without purified 20P2H8 protein or 20P2H8 expressing ceUs) to generate an immune response to the encoded immunogen (for review, see DonneUy et al, 1997, Ann. Rev. Immunol. 15:617-648).
- the amino acid sequence of the 20P2H8 as shown in SEQ ID NO: 2 may be used to select specific regions of the 20P2H8 protein for generating antibodies.
- hydrophobicity and hydrophilicity analyses of the 20P2H8 amino acid sequence may be used to identify hydrophiUc regions in the 20P2H8 structure.
- Regions of the 20P2H8 protein that show immunogenic structure, as weU as other regions and domains, can readily be identified using various other methods known in the art, such as Chou-Fasman, Garnier- Robson, Kyte-DooUtde, Eisenberg, Karplus-Schultz or Jameson-Wolf analysis.
- HLA-A2 binding peptides are 9-mers favorably containing a leucine (L) at position 2 and a valine (V) or leucine (L) at position 9 (Parker et al, J. Immunol. 149:3580-7 (1992)).
- the results of 20P2H8 predicted binding peptides are shown in Table 1 below.
- Table 1 the top 10 ranking candidates for each family member are shown along with their location, the amino acid sequence of each specific peptide, and an estimated binding score.
- the binding score corresponds to the estimated half-time of dissociation of complexes containing the peptide at 37°C at pH 6.5.
- Peptides with the highest binding score are predicted to be the most tighdy bound to HLA Class I on the ceU surface and thus represent the best immunogenic targets for T-ceU recognition.
- Actual binding of peptides to HLA-A2 can be evaluated by stabiUzation of HLA-A2 expression on the antigen-processing defective ceU line T2 (see e.g.
- Immunogenicity of specific peptides can be evaluated in vitro by stimulation of CD8+ cytotoxic T lymphocytes (CTL) m the presence of dendritic ceUs.
- CTL cytotoxic T lymphocytes
- a protem or polypeptide for use as an immunogen and for prepa ⁇ ng immunogenic conjugates of a protem with a earner such as BSA, KLH, or other earner protems are weU known in the art.
- direct conjugation usmg for example, carbodiimide reagents may be used; m other mstances linking reagents such as those suppUed by Pierce Chemical Co, Rockford, IL, may be effective.
- Adtninistration of a 20P2H8 immunogen is conducted generaUy by injection over a suitable time pe ⁇ od and with use of a suitable adjuvant, as is generaUy understood m the art. Du ⁇ ng the immunization schedule, titers of antibodies can be taken to determine adequacy of antibody formation.
- 20P2H8 monoclonal antibodies are preferred and may be produced by va ⁇ ous means weU known m the art.
- immortalized ceU lines that secrete a desired monoclonal antibody may be prepared usmg the standard hybndoma technology of Kohler and Milstein or modifications that immortalize producing B ceUs, as is generaUy known.
- the immortalized ceU Unes secreting the desired antibodies are screened by immunoassay m which the antigen is the 20P2H8 protem or a 20P2H8 fragment.
- the ceUs may be expanded and antibodies produced either from m vitro cultures or from ascites fluid.
- the antibodies or fragments may also be produced, usmg current technology, by recombinant means. Regions that bmd specificaUy to the desired regions of the 20P2H8 protem can also be produced in the context of chimenc or CDR grafted antibodies of multiple species origin. Humanized or human 20P2H8 antibodies may also be produced and are preferred for use m therapeutic contexts.
- Fully human 20P2H8 monoclonal antibodies may be generated using cloning technologies employing large human Ig gene combinatorial Ubraries (i.e, phage display) (Griffiths and Hoogenboom, Building an in vitro immune system: human antibodies from phage display Ubraries. In: Clark, M, ed, 1993, Protein Engineering of Antibody Molecules for Prophylactic and Therapeutic AppUcations in Man, Nottingham Academic, pp 45-64; Burton and Barbas, Human Antibodies from combinatorial Ubraries. Id, pp 65-82).
- FuUy human 20P2H8 monoclonal antibodies may also be produced using transgenic mice engineered to contain human immunoglobulin gene loci as described in PCT Patent AppUcation W098/24893, Kucherlapati and Jakobovits et al, pubUshed December 3, 1997 (see also, Jakobovits, 1998, Exp. Opin. Invest. Drugs 7(4):607-614). This method avoids the in vitro manipulation required with phage display technology and efficientiy produces high affinity authentic human antibodies.
- Reactivity of 20P2H8 antibodies with a 20P2H8 protein may be estabUshed by a number of weU known means, including western blot, immunoprecipitation, ELISA, and FACS analyses using, as appropriate, 20P2H8 proteins, peptides, 20P2H8-expressing ceUs or extracts thereof.
- a 20P2H8 antibody or fragment thereof of the invention may be labeled with a detectable marker or conjugated to a second molecule. Suitable detectable markers include, but are not limited to, a radioisotope, a fluorescent compound, a bioluminescent compound, chemUuminescent compound, a metal chelator or an enzyme.
- a second molecule for conjugation to the 20P2H8 antibody can be selected in accordance with the intended use.
- the second molecule can be a toxin or therapeutic agent.
- bi-specific antibodies specific for two or more 20P2H8 epitopes may be generated using methods generaUy known in the art. Homodimeric antibodies may also be generated by cross-Unking techniques known in the art (e.g, Wolff et al, 1993, Cancer Res. 53: 2560-2565).
- Nucleic acids that encode 20P2H8 or its modified forms can also be used to generate either transgenic animals or "knock out" animals which, in turn, are useful in the development and screening of therapeuticaUy useful reagents.
- a transgenic animal e.g., a mouse or rat
- ceUs that contain a transgene, which transgene was introduced into the animal or an ancestor of the animal at a prenatal, e.g, an embryonic stage.
- a transgene is a DNA that is integrated into the genome of a ceU from which a transgenic animal develops.
- cDNA encoding 20P2H8 can be used to clone genomic DNA encoding 20P2H8 in accordance with estabUshed techniques and the genomic sequences used to generate transgenic animals that contain ceUs that express DNA encoding 20P2H8.
- Methods for generating transgenic animals, particularly animals such as mice or rats, have become conventional in the art and are described, for example, in U.S. Patent Nos. 4,736,866 and 4,870,009.
- TypicaUy particular ceUs would be targeted for 20P2H8 transgene incorporation with tissue-specific enhancers.
- Transgenic animals that include a copy of a transgene encoding 20P2H8 introduced into the germ line of the animal at an embryonic stage can be used to examine the effect of increased expression of DNA encoding 20P2H8.
- Such animals can be used as tester animals for reagents thought to confer protection from, for example, pathological conditions associated with its overexpression.
- an animal is treated with the reagent and a reduced incidence of the pathological condition, compared to untreated animals bearing the transgene, would indicate a potential therapeutic intervention for the pathological condition.
- non-human homologues of 20P2H8 can be used to construct a 20P2H8 "knock out" animal that has a defective or altered gene encoding 20P2H8 as a result of homologous recombination between the endogenous gene encoding 20P2H8 and altered genomic DNA encoding 20P2H8 introduced into an embryonic ceU of the animal.
- cDNA encoding 20P2H8 can be used to clone genomic DNA encoding 20P2H8 in accordance with estabUshed techniques.
- a portion of the genomic DNA encoding 20P2H8 can be deleted or replaced with another gene, such as a gene encoding a selectable marker that can be used to monitor integration.
- the selected ceUs are then injected into a blastocyst of an animal (e-g, a mouse or rat) to form aggregation chimeras (see e.g, Bradley, in Robertson, ed, 1987, Teratocarcinomas and Embryonic Stem CeUs: A Practical Approach, (IRL, Oxford), pp. 113-152).
- a chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term to create a "knock out" animal.
- Progeny harboring the homologously recombined DNA in their germ ceUs can be identified by standard techniques and used to breed animals in which aU ceUs of the animal contain the homologously recombined DNA.
- Knockout animals can be characterized for instance, for their abiUty to defend against certain pathological conditions and for their development of pathological conditions due to absence of the 20P2H8 polypeptide.
- Another aspect of the present invention relates to methods for detecting 20P2H8 polynucleotides and 20P2H8 proteins and variants thereof, as weU as methods for identifying a ceU that expresses 20P2H8.
- the expression profile of 20P2H8 makes it a potential diagnostic marker for local and/or metastasized disease.
- Northern blot analysis suggests that different tissues express different isoforms of 20P2H8.
- the 20P2H8 isoforms in prostate cancer appear to be different from the isoform expressed in normal prostate.
- the status of 20P2H8 gene products may provide information useful for predicting a variety of factors including susceptibiUty to advanced stage disease, rate of progression, and/or tumor aggressiveness.
- the status of 20P2H8 gene products in patient samples may be analyzed by a variety protocols that are weU known in the art including imrnunohistochemical analysis, the variety of Northern blotting techniques including in situ hybridization, RT-PCR analysis (for example on laser capture micro-dissected samples), western blot analysis and tissue array analysis. More particularly, the invention provides assays for the detection of 20P2H8 polynucleotides in a biological sample, such as serum, bone, prostate, and other tissues, urine, semen, ceU preparations, and the like.
- a biological sample such as serum, bone, prostate, and other tissues, urine, semen, ceU preparations, and the like.
- Detectable 20P2H8 polynucleotides include, for example, a 20P2H8 gene or fragments thereof, 20P2H8 mRNA, alternative spUce variant 20P2H8 mRNAs, and recombinant DNA or RNA molecules containing a 20P2H8 polynucleotide.
- a number of methods for ampUfying and/or detecting the presence of 20P2H8 polynucleotides are weU known in the art and may be employed in the practice of this aspect of the invention.
- a method for detecting a 20P2H8 mRNA in a biological sample comprises producing cDNA from the sample by reverse transcription using at least one primer; ampUfying the cDNA so produced using a 20P2H8 polynucleotides as sense and antisense primers to ampUfy 20P2H8 cDNAs therein; and detecting the presence of the ampUfied 20P2H8 cDNA.
- the sequence of the ampUfied 20P2H8 cDNA can be determined.
- a method of detecting a 20P2H8 gene in a biological sample comprises first isolating genomic DNA from the sample; ampUfying the isolated genomic DNA using 20P2H8 polynucleotides as sense and antisense primers to ampUfy the 20P2H8 gene therein; and detecting the presence of the ampUfied 20P2H8 gene.
- Any number of appropriate sense and antisense probe combinations may be designed from the nucleotide sequences provided for the 20P2H8 (SEQ ID NO: 1) and used for this purpose.
- the invention also provides assays for detecting the presence of a 20P2H8 protein in a tissue of other biological sample such as serum, bone, prostate, and other tissues, urine, ceU preparations, and the like.
- Methods for detecting a 20P2H8 protein are also weU known and include, for example, immunoprecipitation, iminunohistochemical analysis, Western Blot analysis, molecular binding assays, ELISA, ELIFA and the like.
- a method of detecting the presence of a 20P2H8 protein in a biological sample comprises first contacting the sample with a 20P2H8 antibody, a 20P2H8- reactive fragment thereof, or a recombinant protein containing an antigen binding region of a 20P2H8 antibody; and then detecting the binding of 20P2H8 protein in the sample thereto.
- an assay for identifying a ceU that expresses a 20P2H8 gene comprises detecting the presence of 20P2H8 mRNA in the ceU.
- Methods for the detection of particular mRNAs in ceUs include, for example, hybridization assays using complementary DNA probes (such as in situ hybridization using labeled 20P2H8 riboprobes, Northern blot and related techniques) and various nucleic acid ampUfication assays (such as RT-PCR using complementary primers specific for 20P2H8, and other ampUfication type detection methods, such as, for example, branched DNA, SISBA, TMA and the like).
- an assay for identifying a ceU that expresses a 20P2H8 gene comprises detecting the presence of 20P2H8 protein in the ceU or secreted by the ceU.
- Various methods for the detection of proteins are weU known in the art and may be employed for the detection of 20P2H8 proteins and 20P2H8 expressing ceUs.
- 20P2H8 expression analysis may also be useful as a tool for identifying and evaluating agents that modulate 20P2H8 gene expression.
- 20P2H8 expression is significandy upregulated in prostate cancer, and may also be expressed in other cancers. Identification of a molecule or biological agent that could inhibit 20P2H8 expression or over-expression in cancer ceUs may be of therapeutic value. Such an agent may be identified by using a screen that quantifies 20P2H8 expression by RT-PCR, nucleic acid hybridization or antibody binding.
- Assays that evaluate the status of the 20P2H8 gene and 20P2H8 gene products in an individual may provide information on the growth or oncogenic potential of a biological sample from this individual. For example, because 20P2H8 mRNA is so highly expressed in prostate cancers as compared to normal prostate tissue, assays that evaluate the relative levels of 20P2H8 mRNA transcripts or proteins in a biological sample may be used to diagnose a disease associated with 20P2H8 dysregulation such as cancer and may provide prognostic information useful in defining appropriate therapeutic options.
- 20P2H8 is expressed, for example, in various prostate cancer xenograft tissues and cancer ceU Unes, and cancer patient samples
- the expression status of 20P2H8 can provide information useful for determining information including the presence, stage and location of displasic, precancerous and cancerous ceUs, predicting susceptibiUty to various stages of disease, and/or for gauging tumor aggressiveness.
- the expression profile makes it a potential imaging reagent for metastasized disease.
- an important aspect of the invention is directed to the various molecular prognostic and diagnostic methods for examining the status of 20P2H8 in biological samples such as those from individuals suffering from, or suspected of suffering from a pathology characterized by dysregulated ceUular growth such as cancer.
- Oncogenesis is known to be a multistep process where ceUular growth becomes progressively dysregulated and ceUs progress from a normal physiological state to precancerous and then cancerous states (see e.g. Alers et al. Lab Invest. 77(5): 437-438 (1997) and Isaacs et al. Cancer Surv. 23: 19-32 (1995)).
- examining a biological sample for evidence of dysregulated ceU growth can aUow the early detection of such aberrant ceUular physiology before a pathology such as cancer has progressed to a stage at which therapeutic options are more limited.
- the status of 20P2H8 in a biological sample of interest can be compared, for example, to the status of 20P2H8 in a corresponding normal sample (e.g. a sample from that individual (or alternatively another individual) that is not effected by a pathology, for example one not suspected of having dysregulated ceU growth) with alterations in the status of 20P2H8 in the biological sample of interest (as compared to the normal sample) providing evidence of dysregulated ceUular growth.
- a corresponding normal sample e.g. a sample from that individual (or alternatively another individual) that is not effected by a pathology, for example one not suspected of having dysregulated ceU growth
- a predetermined normative value such as a predetermined normal level of mRNA expression (see e.g. Grever et al, J. Comp. Neurol. 1996 Dec 9;376(2):306-14 and U.S. patent No. 5,837,501) to compare 20P2H8 in normal versus suspect samples.
- the term "status" in this context is used according to its art accepted meaning and refers to the condition or state of a gene and its products. As specificaUy described herein, the status of 20P2H8 can be evaluated by a number of parameters known in the art. TypicaUy an alteration in the status of 20P2H8 comprises a change in the location of 20P2H8 expressing ceUs and/or an increase in 20P2H8 mRNA and/or protein expression.
- TypicaUy skiUed artisans use a number of parameters to evaluate the condition or state of a gene and its products. These include, but are not limited to the location of expressed gene products (including the location of 20P2H8 expressing ceUs) as weU as the, level, and biological activity of expressed gene products (such as 20P2H8 mRNA polynucleotides and polypeptides). Alterations in the status of 20P2H8 can be evaluated by a wide variety of methodologies weU known in the art, typicaUy those discussed below.
- an alteration m the status of 20P2H8 comprises a change m the location of 20P2H8 and/or 20P2H8 expressmg ceUs and/or an mcrease m 20P2H8 mRNA and/or protein expression.
- the status of 20P2H8 m a biological sample may be evaluated by a number of methods utilized by skiUed artisans mcludmg, but not limited to genomic Southern analysis (to examine, for example perturbations m the 20P2H8 gene), northerns and/or PCR analysis of 20P2H8 mRNA (to examine, for example alterations m the polynucleotide sequences or expression levels of 20P2H8 mRNAs), and western and/ or immunohistochemical analysis (to examine, for example alterations m polypeptide sequences, alterations m polypeptide localization within a sample, alterations m expression levels of 20P2H8 protems and/or associations of 20P2H8 protems with polypeptide binding partners).
- genomic Southern analysis to examine, for example perturbations m the 20P2H8 gene
- northerns and/or PCR analysis of 20P2H8 mRNA to examine, for example alterations m the polynucleotide sequences or expression levels of 20P2
- Detectable 20P2H8 polynucleotides mclude, for example, a 20P2H8 gene or fragments thereof, 20P2H8 mRNA, alternative spUce va ⁇ ants 20P2H8 mRNAs, and recombmant DNA or RNA molecules containing a 20P2H8 polynucleotide.
- the expression profile of 20P2H8 makes it a potential diagnostic marker for local and/or metastasized disease.
- the status of 20P2H8 may provide mformation useful for predicting susceptibiUty to particular disease stages, progression, and/or tumor aggressiveness.
- the mvention provides methods and assays for determining 20P2H8 status and diagnosing cancers that express 20P2H8, such as cancers of the prostate, bladder, testis, ovaries, breast, pancreas, colon and lung.
- 20P2H8 status m patient samples may be analyzed by a number of means weU known m the art, mcludmg without limitation, immunohistochemical analysis, m situ hyb ⁇ dization, RT-PCR analysis on laser capture micro-dissected samples, western blot analysis of clinical samples and ceU Unes, and tissue array analysis.
- Typical protocols for evaluating the status of the 20P2H8 gene and gene products can be found, for example m Ausubul et al. eds, 1995, Current Protocols In Molecular Biology, Units 2 [Northern Blotting], 4 [Southern Blotting], 15 [Immunoblotting] and 18 [PCR Analysis]
- the status of 20P2H8 in a biological sample can be examined by a number of weU known procedures in the art.
- the status of 20P2H8 m a biological sample taken from a specific location m the body can be examined by evaluating the sample for the presence or absence of 20P2H8 expressmg ceUs (e.g. those that express 20P2H8 mRNAs or protems).
- This examination can provide evidence of dysregulated ceUular growth for example, when 20P2H8 expressmg ceUs are found m a biological sample that does not normaUy contam such ceUs (such as a lymph node).
- dysregulated ceUular growth Such alterations m the status of 20P2H8 m a biological sample are often associated with dysregulated ceUular growth.
- one indicator of dysregulated ceUular growth is the metastases of cancer ceUs from an organ of origin (such as the testis or prostate gland) to a different area of the body (such as a lymph node).
- evidence of dysregulated ceUular growth is important for example because occult lymph node metastases can be detected in a substantial proportion of patients with prostate cancer, and such metastases are associated with known predictors of disease progression (see e.g. J Urol 1995 Aug;154(2 Pt l):474-8).
- the mvention provides methods for monitoring 20P2H8 gene products by determining the status of 20P2H8 gene products expressed by ceUs m a test tissue sample from an individual suspected of having a disease associated with dysregulated ceU growth (such as hyperplasia or cancer) and then comparing the status so determined to the status of 20P2H8 gene products m a corresponding normal sample, the presence of aberrant 20P2H8 gene products m the test sample relative to the normal sample providmg an indication of the presence of dysregulated ceU growth within the ceUs of the individual.
- a disease associated with dysregulated ceU growth such as hyperplasia or cancer
- the mvention provides assays useful m determining the presence of cancer in an individual, comprising detecting a significant mcrease m 20P2H8 mRNA or protem expression m a test ceU or tissue sample relative to expression levels m the corresponding normal ceU or tissue.
- the presence of 20P2H8 mRNA may, for example, be evaluated m tissue samples mcludmg but not limited to prostate, kidney, bladder, cervical, skin, stomach, testicular, ovarian, breast, pancreas, colon and lung issues (see e.g. FIGS. 4-8).
- 20P2H8 status may be determined at the protein level rather than at the nucleic acid level.
- a method or assay would comprise determining the level of 20P2H8 protein expressed by ceUs in a test tissue sample and comparing the level so determined to the level of 20P2H8 expressed in a corresponding normal sample.
- the presence of 20P2H8 protein is evaluated, for example, using immunohistochemical methods.
- 20P2H8 antibodies or binding partners capable of detecting 20P2H8 protein expression may be used in a variety of assay formats weU known in the art for this purpose.
- Such embodiments are useful because perturbations in the nucleotide and amino acid sequences are observed in a large number of proteins associated with a growth dysregulated phenotype (see, e.g, Marrogi et al, 1999, J. Cutan. Pathol. 26(8):369-378).
- assays for observing perturbations in nucleotide and amino acid sequences are weU known in the art.
- nucleic acid or amino acid sequences of 20P2H8 gene products may be observed by the Northern, Southern, Western, PCR and DNA sequencing protocols discussed herein.
- other methods for observing perturbations in nucleotide and amino acid sequences such as single strand conformation polymorphism analysis are weU known in the art (see, e.g, U.S. Patent Nos. 5,382,510 and 5,952,170).
- Aberrant demethylation and/ or hypermethylation of CpG islands in gene 5' regulatory regions frequendy occurs in immortalized and transformed ceUs and can result in altered expression of various genes.
- promoter hypermethylation of the pi-class glutathione S-transferase (a protein expressed in normal prostate but not expressed in >90% of prostate carcinomas) appears to permanendy sUence transcription of this gene and is the most frequendy detected genomic alteration in prostate carcinomas (De Marzo et al. Am. J. Pathol. 155(6): 1985-1992 (1999)).
- methylation- sensitive restriction enzymes which can not cleave sequences that contain methylated CpG sites in order to assess the overaU methylation status of CpG islands.
- MSP methylation specific PCR
- This procedure involves initial modification of DNA by sodium bisulfite (which wiU convert aU unmethylated cytosines to uradl) foUowed by ampUfication using primers specific for methylated versus unmethylated DNA. Protocols involving methylation interference can also be found for example in Current Protocols In Molecular Biology, Units 12, Frederick M. Ausubul et al. eds, 1995.
- Gene ampUfication provides an additional method of assessing the status of 20P2H8, a locus that maps to 15q22.32-23, a region shown to be perturbed in a variety of cancers.
- Gene ampUfication may be measured in a sample direcdy, for example, by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA (Thomas, 1980, Proc. Natl. Acad. Sci. USA, 77:5201-5205), dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequences provided herein.
- antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes.
- the antibodies in turn may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.
- biopsied tissue or peripheral blood may be conveniendy assayed for the presence of cancer ceUs, including but not limited to prostate, kidney, bladder, cervical, skin, stomach, testicular, ovarian, breast, pancreas, colon and lung cancers using for example, Northern, dot blot or RT-PCR analysis to detect 20P2H8 expression (see e.g. FIGS 4-8).
- the presence of RT-PCR ampUfiable 20P2H8 mRNA provides an indication of the presence of the cancer.
- RT-PCR detection assays for tumor ceUs in peripheral blood are currendy being evaluated for use in the diagnosis and management of a number of human soUd tumors.
- RT-PCR assays for the detection of ceUs expressing PSA and PSM (Verkaik et al, 1997, Urol. Res. 25:373-384; Ghossein et al, 1995, J. Clin. Oncol. 13:1195-2000; Heston et al, 1995, Clin. Chem. 41:1687-1688).
- RT-PCR assays are weU known in the art.
- a related aspect of the invention is directed to predicting susceptibiUty to developing cancer in an individual.
- a method for predicting susceptibiUty to cancer comprises detecting 20P2H8 mRNA or 20P2H8 protein in a tissue sample, its presence indicating susceptibiUty to cancer, wherein the degree of 20P2H8 mRNA expression present is proportional to the degree of susceptibiUty.
- the presence of 20P2H8 in prostate tissue is examined, with the presence of 20P2H8 in the sample providing an indication of prostate cancer susceptibiUty (or the emergence or existence of a prostate tumor).
- the presence of 20P2H8 in tissue is examined, with the presence of 20P2H8 in the sample providing an indication of cancer susceptibiUty (or the emergence or existence of a tumor).
- Yet another related aspect of the invention is directed to methods for gauging tumor aggressiveness.
- a method for gauging aggressiveness of a tumor comprises determining the level of 20P2H8 mRNA or 20P2H8 protein expressed by ceUs in a sample of the tumor, comparing the level so determined to the level of 20P2H8 mRNA or 20P2H8 protein expressed in a corresponding normal tissue taken from the same individual or a normal tissue reference sample, wherein the degree of 20P2H8 mRNA or 20P2H8 protein expression in the tumor sample relative to the normal sample indicates the degree of aggressiveness.
- aggressiveness of a tumor is evaluated by determining the extent to which 20P2H8 is expressed in the tumor ceUs, with higher expression levels indicating more aggressive tumors.
- Yet another related aspect of the invention is directed to methods for observing the progression of a maUgnancy in an individual over time.
- methods for observing the progression of a maUgnancy in an individual over time comprise deteimining the level of 20P2H8 mRNA or 20P2H8 protein expressed by ceUs in a sample of the tumor, comparing the level so determined to the level of 20P2H8 mRNA or 20P2H8 protein expressed in an equivalent tissue sample taken from the same individual at a different time, wherein the degree of 20P2H8 mRNA or 20P2H8 protein expression in the tumor sample over time provides information on the progression of the cancer.
- the progression of a cancer is evaluated by determining the extent to which 20P2H8 expression in the tumor ceUs alters over time, with higher expression levels indicating a progression of the cancer.
- Another embodiment of the invention disclosed herein is directed to methods for observing a coincidence between the expression of 20P2H8 gene and 20P2H8 gene products (or perturbations in 20P2H8 gene and 20P2H8 gene products) and a factor that is associated with maUgnancy as a means of diagnosing and prognosticating the status of a tissue sample.
- factors associated with maUgnancy may be utilized such as the expression of genes otherwise associated with maUgnancy (including PSA, PSCA and PSM expression) as weU as gross cytological observations (see e.g. Bocking et al, 1984, Anal.
- methods for observing a coincidence between the expression of 20P2H8 gene and 20P2H8 gene products (or perturbations in 20P2H8 gene and 20P2H8 gene products) and a factor that is associated with maUgnancy entaUs detecting the overexpression of 20P2H8 mRNA or protein in a tissue sample, detecting the overexpression of PSA mRNA or protein in a tissue sample, and observing a coincidence of 20P2H8 mRNA or protein and PSA mRNA or protein overexpression.
- the expression of 20P2H8 and PSA mRNA in prostate tissue is examined.
- the coincidence of 20P2H8 and PSA mRNA overexpression in the sample provides an indication of prostate cancer, prostate cancer susceptibiUty or the emergence or existence of a prostate tumor.
- Standard methods for the detection and quantification of 20P2H8 mRNA include in situ hybridization using labeled 20P2H8 riboprobes, Northern blot and related techniques using 20P2H8 polynucleotide probes, RT- PCR analysis using primers specific for 20P2H8, and other ampUfication type detection methods, such as, for example, branched DNA, SISBA, TMA and the like.
- semi-quantitative RT-PCR may be used to detect and quantify 20P2H8 mRNA expression as described in the Examples that foUow. Any number of primers capable of ampUfying 20P2H8 may be used for this purpose, including but not limited to the various primer sets specificaUy described herein. Standard methods for the detection and quantification of protein may be used for this purpose.
- polyclonal or monoclonal antibodies specificaUy reactive with the wild-type 20P2H8 protein may be used in an immunohistochemical assay of biopsied tissue.
- the 20P2H8 protein sequences disclosed herein aUow the skiUed artisan to identify proteins, smaU molecules and other agents that interact with 20P2H8 and pathways activated by 20P2H8 via any one of a variety of art accepted protocols.
- so-caUed interaction trap systems also referred to as the "two-hybrid assay”
- molecules that interact reconstitute a transcription factor and direct expression of a reporter gene, the expression of which is then assayed.
- Typical systems identify protein-protein interactions in vivo through reconstitution of a eukaryotic transcriptional activator and are disclosed for example in U.S. Patent Nos. 5,955,280, 5,925,523, 5,846,722 and 6,004,746.
- peptides that bind to selected receptor molecules such as 20P2H8 are identified by screening Ubraries that encode a random or controUed coUection of amino acids.
- Peptides encoded by the Ubraries are expressed as fusion proteins of bacteriophage coat proteins, and bacteriophage particles are then screened against the receptors of interest.
- Peptides having a wide variety of uses such as therapeutic or diagnostic reagents, may thus be identified without any prior information on the structure of the expected Ugand or receptor molecule.
- Typical peptide Ubraries and screening methods that can be used to identify molecules that interact with 20P2H8 protein sequences are disclosed for example in U.S. Patent Nos. 5,723,286 and 5,733,731.
- ceU Unes expressing 20P2H8 can be used to identify protein-protein interactions mediated by 20P2H8.
- This possibiUty can be examined using immunoprecipitation techniques as shown by others (Hamilton BJ, et al. Biochem. Biophys. Res. Commun. 1999, 261:646-51).
- TypicaUy 20P2H8 protein can be immunoprecipitated from 20P2H8 expressing prostate cancer ceU Unes using anti- 20P2H8 antibodies.
- antibodies against His-tag can be used in a ceU line engineered to express 20P2H8 (vectors mentioned above).
- the immunoprecipitated complex can be examined for protein association by procedures such as western blotting, 35 S-tt ethionine labeling of proteins, protein microsequencing, sUver staining and two dimensional gel electrophoresis.
- SmaU molecules that interact with 20P2H8 can be identified through related embodiments of such screening assays.
- smaU molecules can be identified that interfere with protein function, including molecules that interfere with 20P2H8's abiUty to mediate phosphorylation and de-phosphorylation, second messenger signaling and tumorigenesis.
- Typical methods are discussed for example in U.S. Patent No. 5,928,868 and include methods for forming hybrid Ugands in which at least one Ugand is a smaU molecule.
- the hybrid Ugand is introduced into ceUs that in turn contain a first and a second expression vector.
- Each expression vector includes DNA for expressing a hybrid protein that encodes a target protein linked to a coding sequence for a transcriptional module.
- the ceUs further contains a reporter gene, the expression of which is conditioned on the proximity of the first and second hybrid proteins to each other, an event that occurs only if the hybrid Ugand binds to target sites on both hybrid proteins. Those ceUs that express the reporter gene are selected and the unknown smaU molecule or the unknown hybrid protein is identified.
- a typical embodiment of this invention consists of a method of screening for a molecule that interacts with a 20P2H8 amino acid sequence shown in FIG. 1 (SEQ ID NO: 2), comprising the steps of contacting a population of molecules with the 20P2H8 amino acid sequence, aUowing the population of molecules and the 20P2H8 amino acid sequence to interact under conditions that faciUtate an interaction, determining the presence of a molecule that interacts with the 20P2H8 amino acid sequence and then separating molecules that do not interact with the 20P2H8 amino acid sequence from molecules that do interact with the 20P2H8 amino acid sequence.
- the method further includes purifying a molecule that interacts with the 20P2H8 amino acid sequence.
- the 20P2H8 amino acid sequence is contacted with a Ubrary of peptides.
- 20P2H8 as a gene that is highly expressed in cancers of the prostate (and possibly other cancers), opens a number of therapeutic approaches to the treatment of such cancers. As discussed above, it is possible that 20P2H8 is secreted from cancer ceUs and in this way modulates proUferation signals. Its potential role as a transcription factor and its high expression in prostate cancer makes it a potential target for smaU molecule-mediated therapy.
- therapeutic approaches aimed at inhibiting the activity of the 20P2H8 protein are expected to be useful for patients suffering from prostate cancer, testicular cancer, and other cancers expressing 20P2H8.
- One class comprises various methods for inhibiting the binding or association of the 20P2H8 protem with its binding partner or with other protems
- Another class comprises a vanety of methods for inhibiting the transcription of the 20P2H8 gene or translation of 20P2H8 mRNA.
- 20P2H8 The structural features of 20P2H8 indicate that this molecule is an attractive target for antibody-based therapeutic strategies.
- a number of typical antibody strategies are known m the art for targeting both extraceUular and mtraceUular molecules (see e.g. complement and ADCC mediated killing as weU as the use of lntrabodies discussed below)
- 20P2H8 is expressed by cancer ceUs of various Uneages and not by correspondmg normal ceUs
- systemic administration of 20P2H8- ⁇ mmunoreactive compositions would be expected to exhibit exceUent sensitivity without toxic, nonspecific and/or non-target effects caused by binding of the lmmunotherapeutic molecule to non-target organs and tissues.
- Antibodies specificaUy reactive with domams of 20P2H8 can be useful to treat 20P2H8-express ⁇ ng cancers systemicaUy, either as con j ugates with a toxin or therapeutic agent, or as naked antibodies capable of inhibiting ceU proUferation or function.
- 20P2H8 antibodies can be introduced mto a patient such that the antibody bmds to 20P2H8 and modulates or perturbs a function such as an interaction with a binding partoer and consequentiy mediates the growth mhibition and/or destruction of the ceUs and the tumor and/or inhibits the growth of the ceUs or the tumor.
- Mechanisms by which such antibodies exert a therapeutic effect may mclude complement-mediated cytolysis, antibody-dependent ceUular cytotoxicity, modulating the physiological function of 20P2H8, inhibiting Ugand binding or signal transduction pathways, modulating tumor ceU differentiation, altermg tumor angiogenesis factor profiles, and/or by mducing apoptosis.
- 20P2H8 antibodies can be con j ugated to toxic or therapeutic agents and used to deUver the toxic or therapeutic agent direcdy to 20P2H8-bea ⁇ ng tumor ceUs.
- toxic agents mclude, but are not limited to, calchemicin, maytansmoids, radioisotopes such as I, yt ⁇ um, and bismuth.
- Cancer immunotherapy usmg anti-20P2H8 antibodies may foUow the teachings generated from various approaches that have been successfuUy employed m the treatment of other types of cancer, mcludmg but not limited to colon cancer (Arlen et al. 1998, Crit. Rev. Immunol.
- Some therapeutic approaches mvolve conjugation of naked antibody to a toxin, such as the conjugation of 131 I to anti-CD20 antibodies (e.g, RituxanTM, IDEC Pharmaceuticals Corp ), while others mvolve co-administration of antibodies and other therapeutic agents, such as HerceptmTM (trastuzumab) with pacUtaxel (Genentech, Inc.)
- 20P2H8 antibodies can be administered m conjunction with radiation, chemotherapy or hormone ablation.
- antibody therapy may be particularly appropriate m advanced or metastatic cancers.
- Treatment with the antibody therapy of the mvention may be indicated for patients who have received previously one or more chemotherapy, while combining the antibody therapy of the mvention with a chemotherapeutic or radiation regimen may be preferred for patients who have not received chemotherapeutic treatment.
- antibody therapy may enable the use of reduced dosages of concomitant chemotherapy, particularly for patients who do not tolerate the toxicity of the chemotherapeutic agent very weU.
- Immunohistochemical analysis of tumor biopsies or surgical specimens may be preferred for this purpose. Methods for immunohistochemical analysis of tumor tissues are weU known m the art.
- Anti-20P2H8 monoclonal antibodies useful m treating prostate and other cancers mclude those that are capable of initiating a potent immune response agamst the tumor and those that are capable of direct cytotoxicity.
- anti-20P2H8 monoclonal antibodies may eUcit tumor ceU lysis by either complement-mediated or antibody-dependent ceU cytotoxicity (ADCC) mechanisms, both of which require an intact Fc portion of the immunoglobulin molecule for interaction with effector ceU Fc receptor sites or complement proteins.
- ADCC antibody-dependent ceU cytotoxicity
- anti-20P2H8 mAbs that exert a direct biological effect on tumor growth are useful in the practice of the invention.
- preferred monoclonal antibodies used in the practice of the therapeutic methods of the invention are those that are either fuUy human or humanized and that bind specificaUy to the target 20P2H8 antigen with high affinity but exhibit low or no antigenicity in the patient.
- Therapeutic methods of the invention contemplate the administration of single anti-20P2H8 mAbs as weU as combinations, or cocktaUs, of different mAbs.
- Such mAb cocktaUs may have certain advantages inasmuch as they contain mAbs that target different epitopes, exploit different effector mechanisms or combine direcdy cytotoxic mAbs with mAbs that rely on immune effector functionaUty.
- Such mAbs in combination may exhibit synergistic therapeutic effects.
- the administration of anti-20P2H8 mAbs may be combined with other therapeutic agents, including but not limited to various chemotherapeutic agents, androgen-blockers, and immune modulators (e.g, IL-2, GM-CSF).
- the anti-20P2H8 mAbs may be administered in their "naked” or unconjugated form, or may have therapeutic agents conjugated to them.
- the anti-20P2H8 antibody formulations may be administered via any route capable of deUvering the antibodies to the tumor site. PotentiaUy effective routes of administration include, but are not limited to, intravenous, intraperitoneal, intramuscular, intratumor, intradermal, and the like.
- Treatment wiU generaUy involve the repeated administration of the anti-20P2H8 antibody preparation via an acceptable route of administration such as intravenous injection (IV), typicaUy at a dose in the range of about 0.1 to about 10 mg/kg body weight. Doses in the range of 10-500 mg mAb per week may be effective and weU tolerated.
- IV intravenous injection
- an initial loading dose of approximately 4 mg/kg patient body weight IV foUowed by weekly doses of about 2 mg/kg IV of the anti- 20P2H8 mAb preparation may represent an acceptable dosing regimen.
- the initial loading dose is administered as a 90 minute or longer infusion.
- the periodic maintenance dose may be administered as a 30 minute or longer infusion, provided the initial dose was weU tolerated.
- various factors wiU influence the ideal dose regimen in a particular case.
- Such factors may include, for example, the binding affinity and half Ufe of the Ab or mAbs used, the degree of 20P2H8 expression in the patient, the extent of circulating shed 20P2H8 antigen, the desired steady-state antibody concentration level, frequency of treatment, and the influence of chemotherapeutic agents used in combination with the treatment method of the invention.
- patients should be evaluated for the level of circulating shed 20P2H8 antigen in serum in order to assist in the determination of the most effective dosing regimen and related factors. Such evaluations may also be used for monitoring purposes throughout therapy, and may be useful to gauge therapeutic success in combination with evaluating other parameters (such as serum PSA levels in prostate cancer therapy).
- the invention includes various methods and compositions for inhibiting the binding of 20P2H8 to its binding partoer or Ugand, or its association with other protein(s) as weU as methods for inhibiting 20P2H8 function. Inhibition of 20P2H8 With IntraceUular Antibodies
- recombinant vectors encoding single chain antibodies that specificaUy bind to 20P2H8 may be introduced into 20P2H8 expressing ceUs via gene transfer technologies, wherein the encoded single chain anti-20P2H8 antibody is expressed intraceUularly, binds to 20P2H8 protein, and thereby inhibits its function.
- Methods for engineering such intraceUular single chain antibodies are weU known.
- Such intraceUular antibodies also known as "inttabodies” may be specificaUy targeted to a particular compartment within the ceU, providing control over where the inhibitory activity of the treatment wiU be focused.
- single chain antibodies may be expressed as a single chain variable region fragment joined to the Ught chain constant region.
- WeU known intraceUular trafficking signals may be engineered into recombinant polynucleotide vectors encoding such single chain antibodies in order to precisely target the expressed intiabody to the desired intraceUular compartment.
- inttabodies targeted to the endoplasmic reticulum (ER) may be engineered to incorporate a leader peptide and, optionaUy, a C- terminal ER retention signal, such as the KDEL amino acid motif.
- Inttabodies intended to exert activity in the nucleus may be engineered to include a nuclear locaUzation signal.
- Lipid moieties may be joined to inttabodies in order to tether the intiabody to the cytosoUc side of the plasma membrane.
- Inttabodies may also be targeted to exert function in the cytosol.
- cytosoUc inttabodies may be used to sequester factors within the cytosol, thereby preventing them from being transported to their natural ceUular destination.
- inttabodies may be used to capture 20P2H8 in the nucleus, thereby preventing its activity within the nucleus.
- Nuclear targeting signals may be engineered into such 20P2H8 inttabodies in order to achieve the desired targeting.
- Such 20P2H8 inttabodies may be designed to bind specificaUy to a particular 20P2H8 domain.
- cytosoUc inttabodies that specificaUy bind to the 20P2H8 protein may be used to prevent 20P2H8 from gaining access to the nucleus, thereby preventing it from exerting any biological activity within the nucleus (e.g, preventing 20P2H8 from forming transcription complexes with other factors).
- the transcription of the inteabody may be placed under the regulatory control of an appropriate tumor-specific promoter and/or enhancer.
- the PSA promoter and/or promoter/enhancer may be utilized (See, for example, U.S. Patent No. 5,919,652).
- recombinant molecules that are capable of binding to 20P2H8 thereby preventing 20P2H8 from accessing/binding to its binding partoer(s) or associating with other protein(s) are used to inhibit 20P2H8 function.
- Such recombinant molecules may, for example, contain the reactive part(s) of a 20P2H8 specific antibody molecule.
- the 20P2H8 binding domain of a 20P2H8 binding partner may be engineered into a dimeric fusion protein comprising two 20P2H8 Ugand binding domains linked to the Fc portion of a human IgG, such as human IgGl .
- Such IgG portion may contain, for example, the C H 2 and C,,3 domains and the hinge region, but not the C H 1 domain.
- dimeric fusion proteins may be administered in soluble form to patients suffering from a cancer associated with the expression of 20P2H8, including but not limited to prostate, bladder, testicular, ovarian, breast, pancreas, colon and lung cancers, where the dimeric fusion protein specificaUy binds to 20P2H8 thereby blocking 20P2H8 interaction with a binding partoer.
- Such dimeric fusion proteins may be further combined into multimeric proteins using known antibody linking technologies.
- the invention provides various methods and compositions for inhibiting the transcription of the 20P2H8 gene. Similarly, the invention also provides methods and compositions for inhibiting the translation of 20P2H8 mRNA into protein.
- a method of inhibiting the ttanscription of the 20P2H8 gene comprises contacting the 20P2H8 gene with a 20P2H8 antisense polynucleotide.
- a method of inhibiting 20P2H8 mRNA translation comprises contacting the 20P2H8 mRNA with an antisense polynucleotide.
- a 20P2H8 specific ribozyme may be used to cleave the 20P2H8 message, thereby inhibiting translation.
- Such antisense and ribozyme based methods may also be directed to the regulatory regions of the 20P2H8 gene, such as the 20P2H8 promoter and/or enhancer elements.
- proteins capable of inhibiting a 20P2H8 gene ttanscription factor may be used to inhibit 20P2H8 mRNA transcription.
- the various polynucleotides and compositions useful in the aforementioned methods have been described above.
- the use of antisense and ribozyme molecules to inhibit ttanscription and translation is weU known in the art.
- 20P2H8 transcriptional activation may also be useful for the treatment of cancers expressing 20P2H8.
- factors that are capable of interfering with 20P2H8 processing may be useful for the treatment of cancers expressing 20P2H8. Cancer treatment methods utilizing such factors are also within the scope of the invention.
- Gene transfer and gene therapy technologies may be used for deUvering therapeutic polynucleotide molecules to tumor ceUs synthesizing 20P2H8 (i.e, antisense, ribozyme, polynucleotides encoding inttabodies and other 20P2H8 inhibitory molecules).
- 20P2H8 antisense, ribozyme polynucleotides encoding inttabodies and other 20P2H8 inhibitory molecules.
- Recombinant vectors encoding 20P2H8 antisense polynucleotides, ribozymes, factors capable of interfering with 20P2H8 ttanscription, and so forth, may be deUvered to target tumor ceUs using such gene therapy approaches.
- the above therapeutic approaches may be combined with any one of a wide variety of chemotherapy or radiation therapy regimens. These therapeutic approaches may also enable the use of reduced dosages of chemotherapy and/ or less frequent administration, particularly in patients that do not tolerate the toxicity of the chemotherapeutic agent weU.
- the anti-tumor activity of a particular composition e.g, antisense, ribozyme, intrabody, or a combination of such compositions, may be evaluated using various in vitro and in vivo assay systems.
- In vitro assays for evaluating therapeutic potential include ceU growth assays, soft agar assays and other assays indicative of tumor promoting activity, binding assays capable of detenriining the extent to which a therapeutic composition wiU inhibit the binding of 20P2H8 to a binding partoer, etc.
- a 20P2H8 therapeutic composition may be evaluated in a suitable animal model.
- xenogenic prostate cancer models wherein human prostate cancer explants or passaged xenograft tissues are introduced into immune compromised animals, such as nude or SCID mice, are appropriate in relation to prostate cancer and have been described (Klein et al, 1997, Nature Medicine 3:402-408).
- PCT Patent AppUcation W098/16628, Sawyers et al, pubUshed April 23, 1998 describes various xenograft models of human prostate cancer capable of recapitulating the development of primary tumors, micrometastasis, and the formation of osteoblastic metastases characteristic of late stage disease. Efficacy may be predicted using assays that measure inhibition of tumor formation, tumor regression or metastasis, and the Uke. See, also, the Examples below.
- xenografts from bearing mice treated with the therapeutic composition may be examined for the presence of apoptotic foci and compared to untreated control xenograft-bearing mice. The extent to which apoptotic foci are found in the tumors of the tteated mice provides an indication of the therapeutic efficacy of the composition.
- the therapeutic compositions used in the practice of the foregoing methods may be formulated into pharmaceutical compositions comprising a carrier suitable for the desired deUvery method.
- Suitable carriers include any material that when combined with the therapeutic composition retains the anti-tumor function of the therapeutic composition and is non-reactive with the patient's immune system. Examples include, but are not limited to, any of a number of standard pharmaceutical carriers such as sterile phosphate buffered saline solutions, bacteriostatic water, and the Uke (see, generaUy, Remington's Pharmaceutical Sciences 16 th Ed, A. Osal, Ed, 1980).
- Therapeutic formulations may be solubiUzed and administered via any route capable of deUvering the therapeutic composition to the tumor site.
- PotentiaUy effective routes of aclrninisttation include, but are not Limited to, intravenous, parenteral, intraperitoneal, intramuscular, inttatumor, intradermal, inttaorgan, orthotopic, and the Uke.
- a preferred formulation for intravenous injection comprises the therapeutic composition in a solution of preserved bacteriostatic water, sterile unpreserved water, and/or cUluted in polyvinylchloride or polyethylene bags containing 0.9% sterile Sodium Chloride for Injection, USP.
- Therapeutic protein preparations may be lyophiUzed and stored as sterile powders, preferably under vacuum, and then reconstituted in bacteriostatic water containing, for example, benzyl alcohol preservative, or in sterile water prior to injection.
- the expression profile of 20P2H8 shows that it highly expressed in advanced and metastasized prostate cancer.
- This expression pattern is reminiscent of the Cancer-Testis (CT) antigens or MAGEs, which are testis-specific genes that are up- regulated in melanomas and other cancers (Van den Eynde and Boon, Int J Clin Lab Res. 27:81-86, 1997). Due to their tissue-specific expression and high expression levels in cancer, the MAGEs are currendy being investigated as targets for cancer vaccines (Durrant, Anticancer Drugs 8:727-733, 1997; Reynolds et al, Int J Cancer 72:972-976, 1997).
- CT Cancer-Testis
- the invention further provides cancer vaccines comprising a 20P2H8 protein or fragment thereof, as weU as DNA based vaccines.
- 20P2H8 cancer vaccines are expected to be effective at specificaUy preventing and/or treating 20P2H8 expressing cancers without creating non-specific effects on non-target tissues.
- the use of a tumor antigen in a vaccine for generating humoral and ceU-mediated immunity for use in anti-cancer therapy is weU known in the art and has been employed in prostate cancer using human PSMA and rodent PAP immunogens (Hodge et al, 1995, Int. J. Cancer 63:231-237; Fong et al, 1997, J. Immunol. 159:3113-3117).
- Such methods can be read y practiced by employing a 20P2H8 protein, or fragment thereof, or a 20P2H8-encoding nucleic acid molecule and recombinant vectors capable of expressing and appropriately presenting the 20P2H8 immunogen.
- An iUusttative example of a typical technique consists of a method of generating an immune response (e.g. a humoral response) in a mammal comprising the steps exposing the mammal's immune system to an immunoreactive epitope (e.g. an epitope of the 20P2H8 protein shown in SEQ ID NO: 2) so that the mammal generates an immune response that is specific for that epitope is generated (e.g. antibodies that specificaUy recognize that epitope).
- an immunoreactive epitope e.g. an epitope of the 20P2H8 protein shown in SEQ ID NO: 2
- viral gene deUvery systems may be used to deUver a 20P2H8-encoding nucleic acid molecule.
- Various viral gene deUvery systems that can be used in the practice of this aspect of the invention include, but are not limited to, vaccinia, fowlpox, canarypox, adenovirus, influenza, poUovirus, adeno-associated virus, lentivirus, and Sindbus virus (Restifo, 1996, Curr. Opin. Immunol. 8:658-663).
- Non-viral deUvery systems may also be employed by using naked DNA encoding a 20P2H8 protein or fragment thereof introduced into the patient (e.g, intramuscularly) to induce an anti-tumor response.
- the fuU-length human 20P2H8 cDNA may be employed.
- 20P2H8 nucleic acid molecules encoding specific cytotoxic T lymphocyte (CTL) epitopes may be employed.
- CTL epitopes can be determined using specific algorithms (e.g, Epimer, Brown University) to identify peptides within a 20P2H8 protein that are capable of optimaUy binding to specified HLA aUeles.
- Dendritic ceUs to present 20P2H8 antigen to a patient's immune system.
- Dendritic ceUs express MHC class I and II, B7 co-stimulator, and IL-12, and are thus highly specialized antigen presenting ceUs.
- PSMA prostate-specific membrane antigen
- Dendritic ceUs can be used to present 20P2H8 peptides to T ceUs in the context of MHC class I and II molecules.
- autologous dendritic ceUs are pulsed with 20P2H8 peptides capable of binding to MHC molecules.
- dendritic ceUs are pulsed with the complete 20P2H8 protein.
- Yet another embodiment involves engineering the overexpression of the 20P2H8 gene in dendritic ceUs using various implementing vectors known in the art, such as adenovirus (Arthur et al, 1997, Cancer Gene Ther. 4:17-25), rettovirus (Henderson et al, 1996, Cancer Res.
- CeUs expressing 20P2H8 may also be engineered to express immune modulators, such as GM-CSF, and used as immunizing agents.
- Anti-idiotypic anti-20P2H8 antibodies can also be used in anti-cancer therapy as a vaccine for inducing an immune response to ceUs expressing a 20P2H8 protein.
- SpecificaUy the generation of anti-idiotypic antibodies is weU known in the art and can reacUly be adapted to generate anti-idiotypic anti-20P2H8 antibodies that mimic an epitope on a 20P2H8 protein (see, for example, Wagner et al, 1997, Hybridoma 16: 33-40; Foon et al, 1995, J. Clin. Invest. 96:334-342; Herlyn et al, 1996, Cancer Immunol. Immunother. 43:65-76).
- Such an anti-idiotypic antibody can be used in cancer vaccine strategies.
- Genetic immunization methods may be employed to generate prophylactic or therapeutic humoral and ceUular immune responses directed against cancer ceUs expressing 20P2H8.
- Constructs comprising DNA encoding a 20P2H8 protein/immunogen and appropriate regulatory sequences may be injected direcdy into muscle or skin of an individual, such that the ceUs of the muscle or skin take-up the construct and express the encoded 20P2H8 protein/immunogen.
- Expression of the 20P2H8 protein immunogen results in the generation of prophylactic or therapeutic humoral and ceUular immunity against bone, colon, pancreatic, testicular, cervical and ovarian cancers.
- Various prophylactic and therapeutic genetic immunization techniques known in the art may be used (for review, see information and references pubUshed at Internet address www.genweb.com).
- kits are also provided by the invention.
- Such kits may comprise a carrier means being compartmentalized to receive in close confinement one or more container means such as vials, tubes, and the Uke, each of the container means comprising one of the separate elements to be used in the method.
- one of the container means may comprise a probe that is or can be detectably labeled.
- probe may be an antibody or polynucleotide specific for a 20P2H8 protein or a 20P2H8 gene or message, respectively.
- the kit may also have containers containing nucleotide(s) for ampUfication of the target nucleic acid sequence and/or a container comprising a reporter-means, such as a biotin-binding protein, such as avidin or streptavidin, bound to a reporter molecule, such as an enzymatic, florescent, or radioisotope label.
- a reporter-means such as a biotin-binding protein, such as avidin or streptavidin
- the kit of the invention wiU typicaUy comprise the container described above and one or more other containers comprising materials desirable from a commercial and user standpoint, including buffers, cUluents, filters, needles, syringes, and package inserts with instructions for use.
- a label may be present on the container to indicate that the composition is used for a specific therapy or non-therapeutic appUcation, and may also indicate directions for either in vivo or in vitro use, such as those described above.
- LAPC Xenografts and Human Tissues MATERIALS AND METHODS: LAPC Xenografts and Human Tissues:
- LAPC xenografts were obtained from Dr. Charles Sawyers (UCLA) and generated as described (Klein et al, 1997, Nature Med. 3: 402-408). Androgen dependent and independent LAPC-4 xenografts LAPC-4 AD and Al, respectively) and LAPC-9 AD and Al xenografts were grown in male SCID mice and were passaged as smaU tissue chunks in recipient males. LAPC-4 and —9 Al xenografts were derived from LAPC-4 or -9 AD tumors, respectively. Male mice bearing AD tumors were castrated and maintained for 2-3 months. After the tumors re-grew, the tumors were harvested and passaged in castrated males or in female SCID mice. Human tissues for RNA and protein analyses were obtained from the Human Tissue Resource Center (HTRC) at the UCLA (Los Angeles, CA) and from QualTek, Inc. (Santa Barbara, CA). A benign prostatic hyperplasia tissue sample was patient-derived.
- HTRC Human
- Human ceU Unes (e.g, HeLa) were obtained from the ATCC and were maintained in DMEM with 5% fetal calf serum.
- Tumor tissue and ceU Unes were homogenized in Trizol reagent (Life Technologies, Gibco BRL) using 10 ml/ g tissue or 10 ml/ 10 8 ceUs to isolate total RNA.
- RNA was purified from total RNA using Qiagen's OUgotex mRNA Mini and
- Oligonucleotides The foUowing HPLC purified oUgonucleotides were used.
- DPNCDN fcDNA synthesis primer 5'TTTTGATCAAGCTT 30 3' (SEQ ID NO: 3)
- Nested primer (NP)1 5'TCGAGCGGCCGCCCGGGCAGGA3' (SEQ ID NO: 9)
- Nested primer (NP)2 5'TCGAGCGGCCGCCCGGGCAGGA3' (SEQ ID NO: 9)
- SSH Suppression Subtractive Hybridization
- Double stranded cDNAs corresponding to tester and driver cDNAs were synthesized from 2 ⁇ g of poly(A) + RNA isolated from the relevant xenograft tissue, as described above, using CLONTECH's PCR-Select cDNA Subtraction Kit and 1 ng of oUgonucleotide DPNCDN as primer. First- and second-strand synthesis were carried out as described in the Kit's user manual protocol (CLONTECH Protocol No. PT1117- 1, Catalog No. Kl 804-1). The resulting cDNA was digested with Dpn II for 3 hrs. at 37°C. Digested cDNA was exttacted with phenol/chloroform (1:1) and ethanol precipitated.
- Driver cDNA was generated by combining Dpn II digested cDNA from BPH with a mix of digested cDNAs derived from the human ceU Unes HeLa, 293, A431, Colo205, and mouse Uver.
- Tester cDNA was generated by diluting 1 ⁇ l of Dpn II digested cDNA from the relevant xenograft source (see above) (400 ng) in 5 ⁇ l of water.
- the diluted cDNA (2 ⁇ l, 160 ng) was then Ugated to 2 ⁇ l of Adaptor 1 and Adaptor 2 (10 ⁇ M), in separate Ugation reactions, in a total volume of 10 ⁇ l at 16°C overnight, using 400 u of T4 DNA Ugase (CLONTECH). Ligation was terminated with 1 ⁇ l of 0.2 M EDTA and heating at 72°C for 5 min.
- the first hybridization was performed by adding 1.5 ⁇ l (600 ng) of driver cDNA to each of two tubes containing 1.5 ⁇ l (20 ng) Adaptor 1- and Adaptor 2- Ugated tester cDNA. In a final volume of 4 ⁇ l, the samples were overlaid with mineral oU, denatured in an MJ Research thermal cycler at 98°C for 1.5 minutes, and then were aUowed to hybridize for 8 hrs at 68°C. The two hybridizations were then mixed together with an additional 1 ⁇ l of fresh denatured driver cDNA and were aUowed to hybridize overnight at 68°C. The second hybridization was then diluted in 200 ⁇ l of 20 mM Hepes, pH 8.3, 50 mM NaCl, 0.2 mM EDTA, heated at 70°C for 7 min. and stored at -20°C.
- PCR ampUfications were performed in the primary PCR reaction 1 ⁇ l of the diluted final hybridization mix was added to 1 ⁇ l of PCR primer 1 (10 ⁇ M), 0.5 ⁇ l dNTP mix (10 ⁇ M), 2.5 ⁇ l 10 x reaction buffer (CLONTECH) and 0.5 ⁇ l 50 x Advantage cDNA polymerase Mix (CLONTECH) in a final volume of 25 ⁇ l.
- PCR 1 was conducted using the foUowing conditions: 75°C for 5 min, 94°C for 25 sec, then 27 cycles of 94 ⁇ C for 10 sec, 66°C for 30 sec, 72°C for 1.5 min. Five separate primary PCR reactions were performed for each experiment.
- PCR 2 was performed using 10-12 cycles of 94°C for 10 sec, 68°C for 30 sec, 72°C for 1.5 minutes. The PCR products were analyzed using 2% agarose gel electrophoresis.
- PCR products were inserted into pCR2.1 using the T/A vector cloning kit (Invittogen). Transformed E. coU were subjected to blue/white and ampiciUin selection. White colonies were picked and arrayed into 96 weU plates and were grown in Uquid culture overnight. To identify inserts, PCR ampUfication was performed on 1 ml of bacterial culture using the conditions of PCR1 and NPl and NP2 as primers. PCR products were analyzed using 2% agarose gel electrophoresis. Bacterial clones were stored in 20% glycerol in a 96 weU format. Plasmid DNA was prepared, sequenced, and subjected to nucleic acid homology searches of the GenBank, dBest, and NCI-CGAP databases.
- First strand cDNAs were generated from 1 ⁇ g of mRNA with oUgo (dT)12-18 priming using the Gibco-BRL Superscript PreampUfication system. The manufacturers protocol was used and included an incubation for 50 min at 42°C with reverse ttanscriptase foUowed by RNAse H treatment at 37°C for 20 min. After completing the reaction, the volume was increased to 200 ⁇ l with water prior to normaUzation. First strand cDNAs from 16 different normal human tissues were obtained from Clontech.
- NormaUzation of the first strand cDNAs from multiple tissues was performed by using the primers 5'atatcgccgcgctcgtcgtcgacaa3' (SEQ ID NO: 11) and 5'agccacacgcagctcattgtagaagg 3' (SEQ ID NO: 12) to ampUfy ⁇ -actin.
- First strand cDNA (5 ⁇ l) was ampUfied in a total volume of 50 ⁇ l containing 0.4 ⁇ M primers, 0.2 ⁇ M each dNTPs, 1XPCR buffer (Clontech, 10 mM Tris-HCL, 1.5 mM MgCl 2 , 50 mM KC1, pH8.3) and IX Klentaq DNA polymerase (Clontech). Five ⁇ l of the PCR reaction was removed at 18, 20, and 22 cycles and used for agarose gel electrophoresis.
- PCR was performed using an MJ Research thermal cycler under the foUowing conditions: initial denaturation was at 94°C for 15 sec, foUowed by a 18, 20, and 22 cycles of 94°C for 15, 65°C for 2 min, 72°C for 5 sec. A final extension at 72°C was carried out for 2 min.
- agarose gel electrophoresis the band intensities of the 283 bp ⁇ -actin bands from multiple tissues were compared by visual inspection.
- DUution factors for the first strand cDNAs were calculated to result in equal ⁇ -actin band intensities in aU tissues after 22 cycles of PCR. Three rounds of normaUzation were required to achieve equal band intensities in aU tissues after 22 cycles of PCR.
- 5 ⁇ l of normalized first strand cDNA was analyzed by PCR using 25, 30, and 35 cycles of ampUfication using the foUowing primer pairs:
- SSH clones candidate gene fragment clones
- AU candidate clones were sequenced and subjected to homology analysis against aU sequences in the major pubUc gene and EST databases in order to provide information on the identity of the corresponding gene and to help guide the decision to analyze a particular gene for differential expression.
- gene fragments which had no homology to any known sequence in any of the searched databases, and thus considered to represent novel genes, as weU as gene fragments showing homology to previously sequenced expressed sequence tags (ESTs) were subjected to differential expression analysis by RT-PCR and/ or Northern analysis.
- the isolated 20P2H8 gene fragment of 442 bp was used as a probe to identify the full length cDNA for 20P2H8 in a human prostate cDNA Ubrary.
- the nucleotide and deduced amino acid sequences encoded by this cDNA are shown in FIG. 1. The highest homology is with a protein identified in C. elegans (CAA92704).
- hnRNPs involved in mRNA spUcing ROF, ROH1 and ROH2.
- 20P2H8 exhibits five RNA binding sequences, two corresponding to ribonucleoprotein- 1 (RNP1) consensus sites and three corresponding to RNP2 sites (designated in FIG. 1).
- RNP1 ribonucleoprotein- 1
- 20P2H8 contains three regions with significant proline content (30-42%), which Ue outside regions of homology with hnRNPs (designated in FIG. 1).
- 20P2H8 mRNA expression in normal human tissues was first analyzed by Northern blotting two multiple tissue blots obtained from Clontech (Palo Alto, CaUfornia), comprising a total of 16 different normal human tissues, using labeled 20P2H8 cDNA as a probe. RNA samples were quantitatively normalized with a ⁇ -actin probe. The results are shown in FIG. 3, Panels A and B, and indicate that, within the 16 tissues tested, the 20P2H8 gene is predominandy expressed as a single 4.4 kb transcript in pancreas, with lower level expression detected in prostate and colon, and lower level expression in placenta (FIG. 3; Panels A and B). No other normal tissues in the panel showed detectable expression.
- RNAs derived from LAPC human prostate cancer xenografts and several cancer ceU Unes were analyzed by Northern blot using the 20P2H8 cDNA as probe.
- AU RNA samples were quantitatively normaUzed by ethidium bromide staining and subsequent analysis with a labeled ⁇ — actin probe.
- FIG. 3 Panel C (LAPC xenografts) and FIG. 4 (colon and pancreatic cancer ceU Unes).
- a partial or the fuU length cDNA can cloned into any one of a variety of expression vectors such as those that provide a 6His tag at the carboxyl-terminus (e.g. pCDNA 3.1 myc-his, InVittogen).
- an expression vectors construct with a 6His tag at the carboxyl-terminus is transfected into 293T ceUs which are then labeled for one hour with 35 S-methionine.
- ceUs are then washed and incubated in non-radioactive media to chase the labeled proteins for various time points.
- 20P2H8-His tagged protein is then immunoprecipitated using anti-His antibodies (Santa Cruz) from ceU extracts and from ceU supernatant (media) at various time points after the chase.
- the immunoprecipitates are analyzed by SDS-PAGE with subsequent autoradiography to visualize 35 S-methionine labeled protein.
- 20P2H8 cDNA was cloned into the mammaUan expression vector pCDNA 3.1 (Invittogen) that contains a 6X His COOH-terminal epitope tag that aUows protein expression analysis using an anti-His pAb reagent. This construct was used to ttansfect 293T human embryonic kidney ceUs to assess 20P2H8 protein expression.
- an anti-His immunoreactive band of approximately 60 kD is seen in 293T ceUs transiendy transfected with the 20P2H8 vector but not in ceUs transfected with a control empty vector.
- the molecular weight corresponds to the predicted 57 kD molecular weight of 20P2H8 cDNA plus the additional amino acids coded by the His and Myc epitope tags.
- GST Glutathione S-transferase
- the ampiciUin resistance gene and pBR322 origin permits selection and maintenance of the plasmid in E. coU.
- the foUowing fragment of 20P2H8 was cloned into pGEX-6P-l: Amino acids 1 to 126 (SEQ ID NO: 2).
- Additional constructs can be made in pGEX-6P-l spanning any one of a variety of regions within the 20P2H8 protein including, for example a region containing one or more of the specified biological motifs discussed above or the foUowing regions of the 20P2H8 protein: amino acids 1 to 517; amino acids 126 to 252 and; amino acids 252 to 517 (SEQ ID NO: 2).
- portions of 20P2H8 can be fused to the maltose-binding protein (MBP) gene by cloning into pMAL-c2X and pMAL-p2X (New England Biolabs, MA).
- MBP maltose-binding protein
- AU constructs can be made to generate recombinant 20P2H8 protein sequences with MBP fused at the N-terminus and a six histidine epitope at the C- terminus.
- the six histidine epitope tag was generated by adding the histidine codons to the 3' cloning primer.
- a Factor Xa recognition site permits cleavage of the GST tag from 20P2H8.
- the pMAL-c2X and pMAL-p2X vectors are optimized to express the recombinant protein in the cytoplasm or periplasm respectively. Periplasm expression enhances folding of proteins with disulfide bonds. These constructs can be made in pMAL-c2X and pMAL-p2X and span the foUowing regions of the 20P2H8 protein: amino acids 1 to 126; amino acids 1 to 517; amino acids 126 to 252; amino acids 252 to 517 (SEQ ID NO: 2).
- the 1551 bp (517 amino acid) 20P2H8 ORF was cloned into pcDNA3.1/MycHis_Version A (Invittogen, Carlsbad, CA). Protein expression is driven from the cytomegalovirus (CMV) promoter. The recombinant protein has the myc and six histidines fused to the C-terminus.
- CMV cytomegalovirus
- the pcDNA3.1/MycHis vector also contains the bovine growth hormone (BGH) polyadenylation signal and ttanscription termination sequence to enhance mRNA stabiUty along with the SV40 origin for episomal repUcation and simple vector rescue in ceU Unes expressmg the large T antigen.
- BGH bovine growth hormone
- the Neomycm resistance gene aUows for selection of mammaUan ceUs expressmg the protem and the ampicillin resistance gene and CoLEl origin permits selection and maintenance of the plasmid m E. coU.
- the 1551 bp (517 ammo acid) ORF was cloned mto pSRa constructs.
- Amphottopic and ecotropic retroviruses are generated by transfection of pSRa constructs into the 293T-10A1 packaging line or co-transfection of pSRa and a helper plasmid ( pD ) m 293 ceUs, respectively.
- the rettovirus can be used to mfect a va ⁇ ety of mammaUan ceU Unes, resulting m the integration of the cloned gene, 20P2H8, mto the host ceU-hnes.
- Protem expression is driven from a long terminal repeat (LTR).
- LTR long terminal repeat
- the Neomycm resistance gene aUows for selection of mammaUan ceUs expressmg the protem and the ampiciUin resistance gene and ColEl origin permits selection and maintenance of the plasmid in E. coU.
- An additional pSRa construct was made that fused the FLAG tag to the C-terminus to aUow detection usmg anti-FLAG antibodies.
- the FLAG sequence 5' gat tac aag gat gac gac gat aag 3' were added to cloning primer at the 3' end of the ORF.
- Additional pSRa constructs can be made to produce both N-terminal and C- terminal GFP and myc/6 HIS fusion protems of the fuU length 20P2H8 protem.
- 20P2H8 cDNA is cloned mto the baculovirus transfer vector pBlueBac 4.5 (Invittogen) which provides a His-tag at the N-terminus.
- pBlueBac-20P2H8 is co- transfected with helper plasmid pBac-N-Blue (Invittogen) mto SF9 (Spodoptera frugiperda) msect ceUs to generate recombmant baculovirus (see Invittogen instruction manual for details). Baculovirus is then coUected from ceU supernatant and punfied by plaque assay.
- Recombmant 20P2H8 protem is then generated by infection of HighFive msect ceUs (InVittogen) with the purified baculovirus.
- Recombinant 20P2H8 protein may be detected usmg 20P2H8-spec ⁇ fic antibody 20P2H8 protein may be punfied and used in various ceU based assays or as immunogen to generate polyclonal and monoclonal antibodies specific for 20P2H8.
- a glutathione- S-ttansferase (GST) fusion protein encompassing the 20P2H8 protein is synthesized and used as immunogen.
- GST glutathione- S-ttansferase
- Balb C mice are initiaUy immunized inttaperitoneaUy with 200 ⁇ g of the GST-20P2H8 fusion protein mixed in complete Freund's adjuvant.
- Mice are subsequendy immunized every 2 weeks with 75 ⁇ g of GST-20P2H8 protein mixed in Freund's incomplete adjuvant for a total of 3 immunizations.
- Reactivity of serum from immunized mice to fuU length 20P2H8 protein is monitored by ELISA using a partiaUy purified preparation of HIS-tagged 20P2H8 protein expressed from 293T ceUs. Mice showing the strongest reactivity are rested for 3 weeks and given a final injection of fusion protein in PBS and then sacrificed 4 days later. The spleens of the sacrificed mice are then harvested and fused to SPO/2 myeloma ceUs using standard procedures (Harlow and Lane, 1988). Supernatants from growth weUs foUowing HAT selection are screened by ELISA and Western blot to identify 20P2H8 specific antibody producing clones.
- the binding affinity of a 20P2H8 monoclonal antibody may be determined using standard technology. Affinity measurements quantify the strength of antibody to epitope binding and may be used to help define which 20P2H8 monoclonal antibodies are preferred for diagnostic or therapeutic use.
- the BIAcore system (Uppsala, Sweden) is a preferred method for determining binding affinity.
- the BIAcore system uses surface plasmon resonance (SPR, Welford K. 1991, Opt. Quant. Elect. 23:1; Morton and Myszka, 1998, Methods in Enzymology 295: 268) to monitor biomolecular interactions in real time.
- BIAcore analysis conveniendy generates association rate constants, dissociation rate constants, equiUbrium dissociation constants, and affinity constants. Generation of polyclonal antibodies (pAbs)
- a peptide was synthesized corresponding to ammo acids 224-237 (QNALRKHKDLLGKR) of 20P2H8 protem sequence.
- the peptide was coupled to Keyhole limpet hemacyarun (KLH) and used to immunize a rabbit as foUows.
- KLH Keyhole limpet hemacyarun
- the rabbit was mitiaUy immunized with 200 ug of peptide-KLH mixed m complete Freund's ad j uvant.
- the rabbit was then in j ected every two weeks with 200 ug of peptide-KLH m mcomplete Freund's adjuvant. Bleeds were taken approximately 7- 10 days foUowing each immunization.
- ELISA and Western blotting analyses were used to determine specificity and titer of the rabbit serum to the immunizing peptide and the 20P2H8 protem respectively.
- Affinity purified 20P2H8 polyclonal antibodies were prepared by passage of crude serum from immunized rabbit over an affinity matrix comprised of 20P2H8 peptide covalendy coupled to Affigel 10 (BioRad). After extensive washing of the matrix with PBS, antibodies specific to 20P2H8 peptide were eluted with low pH glycme buffer (0.1M, pH 2.5).
- luciferase (Luc) based ttanscriptionaL reporter assays are earned out in ceUs expressmg 20P2H8.
- These transcriptional reporters contam consensus bmdmg sites for known ttanscription factors which Ue downstteam of weU characterized signal transduction pathways.
- the reporters and examples of there associated ttanscription factors, signal transduction pathways, and activation stimuU are Usted below.
- NFkB-luc NFkB/Rel
- Ik-kinase SAPK
- 20P2H8-mediated effects may be assayed in ceUs showing mRNA expression, such as the 20P2H8-expressing cancer ceU Unes shown in FIG. 4.
- Luciferase reporter plasmids may be introduced by Upid mediated transfection (TFX-50, Promega). Luciferase activity, an indicator of relative ttanscriptional activity, is measured by incubation of ceUs extracts with luciferin substrate and luminescence of the reaction is monitored in a luminometer.
- the transcriptional activity of 20P2H8 may be confirmed using electtomobiUty shift assays (EMSA).
- ESA electtomobiUty shift assays
- CeUs expressing 20P2H8 wiU be evaluated for their abiUty to bind known response elements and compared to control 20P2H8 negative ceUs.
- Whole ceU and nuclear extracts wiU be used in this assay, and wiU be analyzed in the presence and absence of potential (i) 20P2H8 inhibitors and ( ) 20P2H8 interacting proteins.
- These assays wiU provide us with valuable information regarding gene candidates and biologic pathways regulated by 20P2H8 and the mechanism by which 20P2H8 controls gene expression.
- SubceUular Localization of 20P2H8 Sequence analysis of 20P2H8 revealed the presence of RNP like domains and suggests that 20P2H8 may have an RNA spUcing function. This, in turn, indicates that 20P2H8 may have a nuclear localization.
- the ceUular location of 20P2H8 can be assessed using subceUular fractionation techniques widely used in ceUular biology (Storrie B, et al. Methods Enzymol. 1990;182:203-25).
- Prostate, colon or pancreatic ceUs can be lysed and separated into nuclear, cytosoUc and membrane fractions.
- the expression of 20P2H8 in the different fractions can be tested using western blotting techniques.
- 20P2H8 function can be assessed m mammaUan ceUs usmg m vitro approaches.
- 20P2H8 can be cloned mto a number of appropriate vectors, including pcDNA 3.1 myc- His-tag and the retroviral vector pSR ⁇ tkneo (MuUer et al , 1991, MCB 11:1785).
- 20P2H8 can be expressed m several cancer ceU Unes, mcludmg for example PC- 3, NIH 3T3, LNCaP and 293T Expression of 20P2H8 can be monitored usmg anti- 20P2H8 antibodies.
- MammaUan ceU Unes expressmg 20P2H8 can be tested m several m vitro and m vivo assays, mcludmg ceU proUferation m tissue culture, activation of apoptotic signals, primary and metastatic tumor formation m SCID mice, and m vitro mvasion usmg a membrane mvasion culture system (MICS) (Welch et al. ,Int. J. Cancer 43: 449-457).
- 20P2H8 ceU phenotype is compared to the phenotype of ceUs that lack expression of 20P2H8.
- CeU Unes expressmg 20P2H8 can also be assayed for alteration of mvasive and migratory properties by measurmg passage of ceUs through a mateigel coated porous membrane chamber (Becton Dickinson). Passage of ceUs through the membrane to the opposite side is monitored usmg a fluorescent assay (Becton Dickinson Technical Bulletin #428) usmg calcem-Am (Molecular Probes) loaded indicator ceUs.
- parental indicator ceUs are monitored for passage through the porous membrane toward a gradient of 20P2H8 conditioned media compared to control media. This assay may also be used to quaUfy and quantify specific neuttaUzation of the 20P2H8 mduced effect by candidate cancer therapeutic compositions.
- the function of 20P2H8 can be evaluated usmg anti-sense RNA technology coupled to the various functional assays described within this section, e.g. growth, mvasion and migration.
- Anti-sense RNA oUgonucleotides can be introduced mto 20P2H8 expressmg ceUs, thereby preventing the expression of 20P2H8.
- Control and anti-sense contammg ceUs can be analyzed for proUferation, mvasion, migration, apoptotic and ttanscriptional potential.
- the local as weU as systemic effect of the loss of 20P2H8 expression can be evaluated.
- anti-sense oUgonucleotides may be used as a therapeutic agent.
- the effect of the 20P2H8 protein on tumor ceU growth may be evaluated in vivo by gene overexpression in tumor-bearing mice.
- SCID mice can be injected SQ on each flank with 1 x 10 6 of a number of prostate, colon or pancreatic ceU Unes containing tkNeo empty vector or 20P2H8.
- At least two strategies may be used: (1) Constitutive 20P2H8 expression under regulation of an LTR promoter, and (2) Regulated expression under control of an inducible vector system, such as ecdysone, tet, etc.
- Tumor volume is then monitored at the appearance of palpable tumors and foUowed over time to determine if 20P2H8 expressing ceUs grow at a faster rate.
- mice may be implanted with 1 x 10 5 of the same ceUs orthotopicaUy to determine if 20P2H8 has an effect on local growth in the target tissue (i.e, prostate) or on the abiUty of the ceUs to metastasize, specificaUy to lungs, lymph nodes, Uver, bone marrow, etc.
- target tissue i.e, prostate
- the effect of 20P2H8 on bone tumor formation and growth may be assessed by injecting prostate tumor ceUs intratibiaUy, as described in WO98/16628.
- candidate therapeutic compositions such as for example, 20P2H8 antibodies, 20P2H8 antisense molecules and ribozymes
- EXAMPLE 11 IN VITRO ASSAY OF 20P2H8 PROTEIN INTERACTION.
- CeU Unes expressing 20P2H8 can also be used to identify protein-protein interactions mediated by 20P2H8.
- the presence of proline-rich regions and homology to RNP in the ORF suggest that 20P2H8 may interact with other RNPs.
- This possibiUty can be examined using immunoprecipitation techniques as shown by others (Hamilton BJ, et al. Biochem. Biophys. Res. Commun. 1999, 261:646-51).
- 20P2H8 protein can be immunoprecipitated from 20P2H8 expressing prostate cancer ceU Unes and examined for protein association by western blotting.
- Protein interaction may be also studied by a two yeast hybrid system, as described by Shnyreva et. Al. (Shnyreva M et al, J Biol Chem. 2000. 19;275 ;15498-503). These assays may also be used to analyze the effect of potential cancer therapeutics on 20P2H8 function.
- 20P2H8 mutants can be generated lacking one or more domains.
- CeU Unes expressing mutant 20P2H8 protein wiU be evaluated for alteration in proUferation, invasion, migration, ttanscriptional activation and protein- protein interaction.
- Example 12 Chromosomal Localization of 20P2H8 The chromosomal localization of 20P2H8 was determined using the
- mapping vector for the 93 radiation hybrid panel DNAs was: 0000001001001010000200001101000000010100101011100010000101011010000210111 00000001101010000001
- mapping program which can be found at internet address http://www- genome.wi.rriit.edu/cgi-bin/contig/rhmapper.pl maps 85P1B3 to chromosome 8q22.2- 23.1/ 15q22.32-23. As HTGS hits show PACs on chromosome 15 therefore this is the most likely mapping location.
- the present invention is not to be Limited in scope by the embodiments disciosed herein, which are intended as single iUustrations of individuai aspects of the invention, and any which are functionaUy equivalent are within the scope of the invention.
- Various modifications to the models and methods of the invention, in addition to those described herein, wiU become apparent to those skiUed in the art from the foregoing description and teachings, and are similarly intended to faU within the scope of the invention. Such modifications or other embodiments can be practiced without departing from the true scope and spirit of the invention.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US16236499P | 1999-10-28 | 1999-10-28 | |
US162364P | 1999-10-28 | ||
PCT/US2000/029477 WO2001031012A1 (fr) | 1999-10-28 | 2000-10-26 | Gene regule positivement dans les cancers de la prostate |
Publications (1)
Publication Number | Publication Date |
---|---|
EP1224284A1 true EP1224284A1 (fr) | 2002-07-24 |
Family
ID=22585312
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP00975396A Withdrawn EP1224284A1 (fr) | 1999-10-28 | 2000-10-26 | Gene regule positivement dans les cancers de la prostate |
Country Status (4)
Country | Link |
---|---|
EP (1) | EP1224284A1 (fr) |
AU (1) | AU1345301A (fr) |
CA (1) | CA2388709C (fr) |
WO (1) | WO2001031012A1 (fr) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6893818B1 (en) | 1999-10-28 | 2005-05-17 | Agensys, Inc. | Gene upregulated in cancers of the prostate |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000015799A2 (fr) * | 1998-09-17 | 2000-03-23 | Incyte Pharmaceuticals, Inc. | Proteines associees a l'arn |
AU3395900A (en) * | 1999-03-12 | 2000-10-04 | Human Genome Sciences, Inc. | Human lung cancer associated gene sequences and polypeptides |
-
2000
- 2000-10-26 EP EP00975396A patent/EP1224284A1/fr not_active Withdrawn
- 2000-10-26 WO PCT/US2000/029477 patent/WO2001031012A1/fr active Application Filing
- 2000-10-26 AU AU13453/01A patent/AU1345301A/en not_active Abandoned
- 2000-10-26 CA CA2388709A patent/CA2388709C/fr not_active Expired - Fee Related
Non-Patent Citations (1)
Title |
---|
See references of WO0131012A1 * |
Also Published As
Publication number | Publication date |
---|---|
WO2001031012A1 (fr) | 2001-05-03 |
AU1345301A (en) | 2001-05-08 |
CA2388709C (fr) | 2012-03-13 |
CA2388709A1 (fr) | 2001-05-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6566078B1 (en) | 36P6D5: secreted tumor antigen | |
US7928212B2 (en) | Gene upregulated in cancers of the prostate | |
US20080178308A1 (en) | Novel 13-transmembrane protein expressed in prostate cancer | |
AU2005202143B2 (en) | Transmembrane protein expressed in prostate and other cancers | |
US8013126B2 (en) | 84P2A9: a prostate and testis specific protein highly expressed in prostate cancer | |
AU2001237973A1 (en) | 84p2a9: a prostate and testis specific protein highly expressed in prostate cancer | |
CA2388709C (fr) | Gene regule positivement dans les cancers de la prostate | |
AU2007203592B2 (en) | 36P6D5: Secreted tumor antigen |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20020422 |
|
AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE |
|
AX | Request for extension of the european patent |
Free format text: AL;LT;LV;MK;RO;SI |
|
RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: AGENSYS, INC. |
|
17Q | First examination report despatched |
Effective date: 20050308 |
|
17Q | First examination report despatched |
Effective date: 20050308 |
|
GRAP | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOSNIGR1 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20091020 |