EP1220905A2 - Composition and methods for the treatment of immune related diseases - Google Patents

Composition and methods for the treatment of immune related diseases

Info

Publication number
EP1220905A2
EP1220905A2 EP00913764A EP00913764A EP1220905A2 EP 1220905 A2 EP1220905 A2 EP 1220905A2 EP 00913764 A EP00913764 A EP 00913764A EP 00913764 A EP00913764 A EP 00913764A EP 1220905 A2 EP1220905 A2 EP 1220905A2
Authority
EP
European Patent Office
Prior art keywords
seq
antι
prol
pro
polypeptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00913764A
Other languages
German (de)
French (fr)
Inventor
Avi J. Ashkenazi
Kevin P. Baker
Audrey Goddard
Austin L. Gurney
Caroline Hebert
William Henzel
Rhona C. Kabakoff
Yanmei Lu
James Pan
Diane Pennica
David L. Shelton
Victoria Smith
Timothy A. Stewart
Daniel Tumas
Colin K. Watanabe
William I. Wood
Minhong Yan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genentech Inc
Original Assignee
Genentech Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/US1999/005028 external-priority patent/WO1999046281A2/en
Priority claimed from PCT/US1999/008615 external-priority patent/WO1999055868A2/en
Priority claimed from PCT/US1999/012252 external-priority patent/WO1999063088A2/en
Priority claimed from PCT/US1999/020111 external-priority patent/WO2000012708A2/en
Priority claimed from PCT/US1999/020594 external-priority patent/WO2000015666A2/en
Priority claimed from PCT/US1999/020944 external-priority patent/WO2000015792A2/en
Priority claimed from PCT/US1999/021090 external-priority patent/WO2000015796A2/en
Priority claimed from PCT/US1999/021547 external-priority patent/WO2000015797A2/en
Priority claimed from PCT/US1999/023089 external-priority patent/WO2000021996A2/en
Priority claimed from PCT/US1999/028214 external-priority patent/WO2001019987A1/en
Priority claimed from PCT/US1999/028409 external-priority patent/WO2000032778A2/en
Priority claimed from PCT/US1999/028313 external-priority patent/WO2000032221A2/en
Priority claimed from PCT/US1999/028301 external-priority patent/WO2000032776A2/en
Priority claimed from PCT/US1999/028634 external-priority patent/WO2000036102A2/en
Priority claimed from PCT/US1999/028565 external-priority patent/WO2000037638A2/en
Priority claimed from PCT/US1999/028564 external-priority patent/WO2000055319A1/en
Priority claimed from PCT/US1999/028551 external-priority patent/WO2000053750A1/en
Priority claimed from PCT/US1999/030095 external-priority patent/WO2000037640A2/en
Priority claimed from PCT/US1999/030999 external-priority patent/WO2001005836A1/en
Priority claimed from PCT/US1999/031274 external-priority patent/WO2000053752A2/en
Priority claimed from PCT/US2000/000219 external-priority patent/WO2000053753A2/en
Priority claimed from PCT/US2000/000277 external-priority patent/WO2000053754A1/en
Priority claimed from PCT/US2000/000376 external-priority patent/WO2000053755A2/en
Priority claimed from PCT/US2000/003565 external-priority patent/WO2001053486A1/en
Priority claimed from PCT/US2000/004341 external-priority patent/WO2000053756A2/en
Priority claimed from PCT/US2000/004342 external-priority patent/WO2000078961A1/en
Priority claimed from PCT/US2000/004414 external-priority patent/WO2001004311A1/en
Application filed by Genentech Inc filed Critical Genentech Inc
Publication of EP1220905A2 publication Critical patent/EP1220905A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/02Nasal agents, e.g. decongestants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A61P29/02Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID] without antiinflammatory effect
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/14Drugs for disorders of the endocrine system of the thyroid hormones, e.g. T3, T4
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • C07K14/4703Inhibitors; Suppressors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70578NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00Uses of viruses
    • C12N2799/02Uses of viruses as vector
    • C12N2799/021Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/026Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus

Definitions

  • the present invention relates to compositions and methods for the diagnosis and treatment of immune related diseases.
  • Immune reiated and inflammatory diseases are the manifestation or consequence of fairiy complex, often multiple interconnected biological pathways which in normal physiology are c ⁇ tical to respond to insult or in j ury, initiate repair from insult or injury, and mount innate and acquired defense against foreign organisms.
  • Disease or pathology occurs when these normal physiological pathways cause additional insult or injury either as directly related to the intensity of the response, as a consequence of abnormal regulation or excessive stimulation, as a reaction to self, or as a combination of these.
  • the genesis of these diseases often involves multistep pathways and often multiple different biological svstems/pathways. intervention at c ⁇ tical points in one or more of these pathways can have an ameliorative or therapeutic effect.
  • Therapeutic intervention can occur by either antagonism of a det ⁇ mental process/pathway or stimulation of a beneficial process/pathway.
  • immune reiated diseases are known and have been extensively studied. Such diseases include immune-mediated inflammatory diseases, non-immune-mediated inflammatory diseases, infectious diseases, immunodeficiency diseases, neoplasia, etc.
  • T lymphocytes are an important component of a mammalian immune response. T cells recognize antigens which are associated with a self-molecule encoded by genes within the major histocompatibility complex (MHC). The antigen may be displayed together with MHC molecules on the surface of antigen presenting cells, virus infected cells, cancer ceils, grafts, etc. The T cell system elimmates these altered cells which pose a health threat to the host mammal. T cells include helper T cells and cytotoxic T cells. Helper T cells proliferate extensively following recognition of an antigen -MHC complex on an antigen presenting cell. Helper T cells also secrete a variety of cytokines. i.e., lymphokines, which play a central role in the activation of B cells, cytotoxic T cells and a variety of other cells which participate in the immune response.
  • MHC major histocompatibility complex
  • helper T cell activation is initiated by the interaction of the T cell receptor (TCR) - CD3 complex with an antigen-MHC on the surface of an antigen presenting cell. This interaction mediates a cascade of biochemical events that induce the resting helper T cell to enter a cell cycle (the GO to Gl transition) and results in the expression of a high affinity receptor for IL-2 and sometimes IL-4.
  • TCR T cell receptor
  • the activated T cell progresses through the cycie proliferating and differentiating into memory cells or effector cells.
  • T cells In addition to the signals mediated through the TCR, activation of T cells involves additional cos ⁇ mulation induced by cytokines released by the antigen presenting cell or through interactions with membrane bound molecules on the antigen presenting cell and the T cell.
  • the cytokines IL-1 and IL-6 have been shown to provide a costimuiatory signal.
  • T-cell proliferation in a mixed Kmphocvte culture or mixed lymphocyte reaction is an established indication of the ability of a compound to stimulate the immune system In many immune responses inflammatory cells infiltrate the site ot mjurv or infection
  • the migrating cells mav be neutrophihc, eosinophihc monocytic or lymphocvtic as can be determined bv histologic examination of the affected tissues
  • Immune related diseases can be treated bv suppressing the immune response Using neutralizing antibodies that inhibit molecules having immune stimulatory activity would be beneficial in the treatment of immune-mediated and inflammatory diseases Molecules which inhibit the immune response can be utilized
  • the present inv ention concerns compositions and methods tor the diagnosis and treatment ot immune related disease in mammals including humans
  • the present invention is based on the identification of proteins (includinc agonist and antagonist antibodies) which either stimulate or inhibit the immune response in mammals
  • Immune related diseases can be treated by suppressing or enhancing the immune response Molecules that enhance the immune response stimulate or potentiate the immune response to an antigen Molecules w hich stimulate the immune response can be used therapeutically where enhancement of the immune response would be beneficial
  • Such stimulatory molecules can also be inhibited where suppression of the immune response would be of value
  • Neutralizing antibodies are examples of molecules that inhibit molecules having immune stimulatory activity and which would be beneficial in the treatment ot immune related and inflammator y diseases Molecules which inhibit the immune response can also be utilized (proteins directly or via the use ot antibody agonists I to inhibit the immune response and thus ameliorate immune related disease
  • the PRO polypeptides and anti-PRO antibodies and fragments thereof are useful foi the diagnosis and/or treatment (including prevention) of immune related diseases
  • Antibodies which bind to stimulatory proteins are useful to suppress the immune system and the immune response
  • Antibodies which bind to inhibitory proteins are useful to stimulate the immune system and the immune response
  • the PRO polypeptides and anti-PRO antibodies also useful to prepare medicines and medicaments for the treatment of immune related and inflammatory diseases
  • the mvention provides for isolated nucleic acid molecules comp ⁇ sing nucleotide sequences that encodes a PRO polypeptide
  • the isolated nucleic acid molecule comp ⁇ ses a nucleotide sequence having at least about 80% nucleic acid sequence identity, alternatively at least about 81% nucleic acid identity, alternatively at least about 82% nucleic acid sequence identity, alternatively at least about 83% nucleic acid sequence identity, alternatively at least about 84% nucleic acid sequence identity, alternatively at least about 85% nucleic acid sequence identity, alternatively at least about 86% nucleic acid sequence identity, alternatively at least about 87% nucleic acid sequence identity, alternatively at least about 88% nucleic acid sequence identity, alternatively at least about 89% nucleic acid sequence identity, alternatively at least about 90% nucleic acid sequence identity, alternatively at least about 91% nucleic acid sequence identity, alternatively at least about 92% nucleic acid sequence identity, alternatively at least about 93% nucleic acid sequence identity, alternatively at least about 94% nucleic acid sequence identity, alternatively at least about 95% nucleic acid sequence identity, alternatively at least about 96% nucleic acid
  • the isolated nucleic acid molecule comp ⁇ ses a nucleotide sequence having at least about 80% nucleic acid sequence identity, alternatively at least about 81% nucleic acid sequence identity. alternatively at least about 82% nucleic acid sequence identity, alternatively at least about 83% nucleic acid sequence identity, alternatively at least about 84% nucleic acid sequence identity, alternatively at least about 85% nucleic acid sequence identity, alternatively at least about 86% nucleic acid sequence identity, alternatively at least about 87% nucleic acid sequence identity, alternatively at least about 88% nucleic acid sequence identity, alternatively at least about 89% nucleic acid sequence identity, alternatively at least about 90% nucleic acid sequence identity, alternatively at least about 91% nucleic acid sequence identity, alternatively at least about 92% nucleic acid sequence identity, alternatively at least about 93% nucleic acid sequence identity, alternatively at least about 94% nucleic acid sequence identity, alternatively at least about 95% nucleic acid sequence identity, alternatively at least about 96% nucleic
  • the invention concerns an isolated nucleic acid molecule comp ⁇ smg a nucleotide sequence having at least about 80% nucleic acid sequence identity, alternatively at least about 81% nucleic acid sequence identity, alternatively at least about 82% nucleic acid sequence identity, alternatively at least about 83% nucleic acid sequence identity, alternatively at least about 84% nucleic acid sequence identity, alternatively at least about 85% nucleic acid sequence identity, alternatively at least about 86% nucleic acid sequence identity, alternatively at least about 87% nucleic acid sequence identity, alternatively at least about 88% nucleic acid sequence identity, alternatively at least about 89% nucleic acid sequence identity, alternatively at least about 90% nucleic acid sequence identity, alternatively at least about 91% nucleic acid sequence identity, alternatively at least about 92% nucleic acid sequence identity, alternatively at least about 93% nucleic acid sequence identity, alternatively at least about 94% nucleic acid sequence identity, alternatively at least about 95% nucleic acid sequence identity, alternatively at least about
  • the invention provides for isolated nucleic acid molecule comp ⁇ smg a nucleotide sequence encodmg a PRO polypeptide with is either transmembrane domain-deleted or transmembrane domam-inactivated. or is complementary to such encoding nucleotide sequence, wherem the transmembrane doma ⁇ n(s) of such polypeptides are disclosed herein. Therefore, soluble extracellular domains of the herein desc ⁇ bed PRO polypeptides are contemplated.
  • nucleic acid fragments are usually at least about 20 nucleotides in length, alternatively at least about 30 nucleotides in length, alternatively at least about 40 nucleotides m length, alternatively at least about 50 nucleotides in length, alternatively at least about 60 nucleotides in length, alternatively at least about 70 nucleotides in length, alternatively at least about 80 nucleotides in length, alternatively at least about 90 nucleotides in length, alternatively at least about 100 nucleotides in length, alternatively at least about 1 10 nucleotides in length, alternatively at least about 120 nucleo
  • novel fragments of a nucieotide sequence encoding the respective PRO polypeptide may be determmed in a routine manner by alignmg the respective nucleotide encoding a PRO polypeptide with other known nucieotide sequences using any of a number of well known sequence alignment programs and determining which nucleotide sequence fragment(s) are novel. All such nucleotide sequences encoding the respective PRO polypeptides are contemplated herem. Also contemplated are the nucleotide molecules which encode fragments of the PRO polypeptides. preferably those polypeptide fragments that comp ⁇ se a binding site for an anti-PRO polypeptide antibody. In ano t her embodiment, the invention provides isolated PRO polypeptides encoded by any of the isolated nucleic acid sequences heremabove identified.
  • the invention concerns an isolated PRO polypeptide. comp ⁇ sing an am i no ac i d sequence having a t least about 80% ammo acid sequence identity, alternatively at least about 81% ammo ac i d sequence identity, alternatively at least about 82% ammo acid sequence identity, alternatively at least about 83% ammo acid sequence identity, alternatively at least about 84% amino acid sequence identity, alterna ti vely at least about 85% amino acid sequence identity, alternatively at least about 86% ammo acid sequence i dent i ty, al t erna t ively a t leas t about 87% ammo acid sequence identity, alternatively at least about 88% am i no ac i d sequence identity, al t erna t ively at least about 89% ammo acid sequence identity, alternatively at leas t about 90% ammo acid sequence identity, alternatively at least about 91% ammo acid sequence identity, alternatively at leas
  • t he invention concerns an isolated PRO polypeptide comp ⁇ sing an am i no ac i d sequence having a t least about 80% amino acid sequence identity, alternatively at least about 81% ammo ac i d sequence iden t i t y, alterna t ively at least about 82% ammo acid sequence identity, alternatively at leas t about
  • the invention concerns an isolated PRO polypeptide comp ⁇ sing an ammo ac i d sequence sco ⁇ ng at least about 80% positives, alternatively at least about 81% positives, alternatively at least about 82% posi t ives, alternatively at least about 83% positives, alternatively at least about 84% pos i tives, alternatively at least about 85% positives, alternatively at least about 86% positives, alternatively at least about 87% positives, alternatively at least about 88% positives, alternatively at least about 89% pos i t i ves, alterna t ively at least about 90% positives, alternatively at least about 91% positives, alternatively at least about 92% posi t ives, alternatively at least about 93% positives, alternatively at least about 94% positives, alternatively at least about 95% positives, alternatively at least about 96% positives, alternatively at least about 97% positives, alternatively at least about 98% positives, alternatively
  • the invention provides an isolated PRO polypeptide without the N-termmal signal sequence and'or the initiating methionine and is encoded by a nucleotide sequence that encodes such an ammo acid sequence as hereinbefore described Processes tor producing the same are also herein desc ⁇ bed. wherem those processes comp ⁇ se cultunng a host cell comp ⁇ sing a v ector which comp ⁇ ses the approp ⁇ ate encodmg nucleic acid molecule under conditions suitable for expression of the PRO polypeptide and recovermg the same from the cell culture.
  • the invention provides an isolated PRO polypeptide which is either transmembrane- deleted or transmembrane domam-inactivated Processes for producing the same are also herein desc ⁇ bed. wherein those processes comp ⁇ se cultunng a host cell comp ⁇ sing a vector which comp ⁇ ses the approp ⁇ ate encodine nucleic acid molecule under conditions suitable lor expression of the PRO polvpeptide and recovering the PRO polypeptide trom the cell culture
  • the invention provides vectors comp ⁇ sing DNA encoding anv of the PRO polypeptides
  • Host cells comprising any such vector are also provided
  • the host cells may be CHO cells.
  • E coli or yeast A process tor producing any of the herein described polypeptides is further provided and comp ⁇ ses culm ⁇ ng host cells under conditions suitable for expression of the desired polypeptides and recove ⁇ ng the desired polypeptide from the cell culture.
  • the invention provides chimenc molecules comprising any of the herem described polypeptides fused to a heterologous polypeptide or amino acid sequence
  • chimenc molecules comp ⁇ se anv of the herein desc ⁇ bed polypeptides fused to an epitope tag sequence or a Fc region ot an immunoglobulin
  • the invention provides oligonucleotide probes useful for isolating genomic and cDNA nucieotide sequences or as antisense probes, wherem those probes may be de ⁇ ved trom anv of the above or below described nucleotide sequences
  • the invention concerns agonists and antagonists of the PRO polypeptides. that mimic or inhibit one or more functions or activities of the PRO polypeptides
  • the agonist or antagonist is an antibody that bmds to the PRO polypeptides or a small molecule.
  • the invention provides an antibody which specifically binds to any of the above or below desc ⁇ bed polypeptides
  • the antibody is a monoclonal antibody, humanized antibody, antibody fragment or single-chain antibody
  • the present invention concerns an isolated antibody which bmds a PRO polypeptide
  • the antibody mimics the activity of a PRO polypeptide (an agonist antibody) or conversely the antibody inhibits or neutralizes the activity of a PRO polypeptide (an antagonist antibody)
  • the antibody is a monoclonal antibody, which preferably has nonhuman compiementanty determining region (CDR) residues and human framework region (FR) residues.
  • CDR nonhuman compiementanty determining region
  • FR human framework region
  • the antibody may be labeled and may be immobilized on a solid support.
  • the antibody is an antibody fragment, a monoclonal antibody, a smgle-cham antibody, or an anti-idiotypic antibody.
  • the invention concerns a method of identifying agonists or antagonists to a PRO polypeptide which comp ⁇ ses contacting the PRO polypeptide with a candidate molecule and monitoring a biological activity mediated by said PRO polypeptide
  • the PRO polypeptide is a native sequence PRO polypeptide.
  • the invention concerns a composition ot matter containing PRO polypeptide or an agonist or antagonist antibody which binds the polypeptide in admixture with a earner or excipient.
  • the composition contains a therapeutically effective amount of the peptide or antibody.
  • the composition when the composition contains an immune stimulating molecule, the composition is useful for: (a) increasing infiltration of inflammatory cells into a tissue of a mammal in need thereof, (b) stimulating or enhancing an immune response in a mammal in need thereof, or (c) increasing the proliferation of T- lymphocytes in a mammal in need thereof in response to an antigen.
  • the composition when the composition contains an immune inhibiting molecule, the composition is useful for: (a) decreasing infiltration of inflammatory cells into a tissue of a mammal in need thereof, (b) inhibiting or reducing an immune response in a mammal m need thereof or ( c) decreasing the proliferation of T-lymphocvtes in a mammal in need thereof in response to an antigen
  • the composition contains a tu ⁇ her active ingredient, which may. for example, be a fu ⁇ her antioody or a cytotoxic or chemotherapeutic agent
  • the composition is ste ⁇ ie.
  • the invention concerns the use of the polypeptides and antibodies of the invention to prepare a composition or medicament which has the uses descnbed above.
  • the invention concerns nucleic acid encoding an ant ⁇ -PRO200, ant ⁇ -PRO204, ant ⁇ -PR0212. ant ⁇ -PR0216. ant ⁇ -PR0226, ant ⁇ -PRO240, ant ⁇ -PR0235. ant ⁇ -PR0245. ant ⁇ -PR0172. anti- PR0273. ant ⁇ -PR0272, ant ⁇ -PR0332, ant ⁇ -PR0526, ant ⁇ -PRO701. ant ⁇ -PR0361. ant ⁇ -PR0362. ant ⁇ -PR0363, ant ⁇ -PR0364. ant ⁇ -PR0356. ant ⁇ -PR053 1. ant ⁇ -PR0533. ant ⁇ -PRO 1083.
  • the invention concerns a method for producing such an antibody by culm ⁇ ng a host cell transformed with nucleic acid encodmg the antibody under conditions such that the antibody is expressed, and recove ⁇ ng the antibody from the cell culture.
  • the invention concerns an isolated nucleic acid molecule that hybndizes to the a nucleic acid molecule encodmg a PRO polypeptide. or the complement thereof.
  • the nucleic acid preferably is DNA. and hyb ⁇ dization preferably occurs under st ⁇ ngent conditions.
  • Such nucleic acid molecules can act as antisense molecules of the amplified genes identified herem, which, in turn, can find use in the modulation of the respective amplified genes, or as antisense p ⁇ mers in amplification reactions.
  • sequences can be used as part of ⁇ bozyme and/or triple helix sequence which, in turn, may be used in regulation of the amplified genes.
  • the invention concerns a method for determining the presence of a PRO polypeptide comp ⁇ smg exposmg a cell suspected of contammg and or expressing the polypeptide to an anti- PRO200, ant ⁇ -PRO204, ant ⁇ -PR0212. ant ⁇ -PR0216. ant ⁇ -PR0226. ant ⁇ -PRO240. ant ⁇ -PR0235, ant ⁇ -PR0245. ant ⁇ -PR0172, ant ⁇ -PR0273. ant ⁇ -PR0272. ant ⁇ -PR0332. ant ⁇ -PR0526. ant ⁇ -PRO701. ant ⁇ -PR0361, anti- PR0362, ant ⁇ -PR0363, ant ⁇ -PR0364.
  • ant ⁇ -PR0356 ant ⁇ -PR0531 , ant ⁇ -PR0533, ant ⁇ -PRO1083.
  • ant ⁇ -PRO1007 anti-PROl 184.
  • the present invention concerns a method of diagnosmg an immune related disease in a mammal, comp ⁇ sing detecting the level of expression of a gene encodin ⁇ a PRO polypeptide (a) in a test sample ot tissue cells obtained trom the mammal, and (b) in a control sample ot known normal tissue cells of the same cell type, wherein a higher or lower expression level in the test sample as compared to the control sample indicates the presence ot immune related disease in the mammal trom which the test tissue cells were obtained
  • the present invention concerns a method of diagnosing an immune disease in a mammal, comp ⁇ sing (a) contacting an anti-PRO polypeptide antibody with a test sample of tissue cells obtained from the mammal, and (b) detecting the formation of a complex between the antibody and the respective PRO polypeptide.
  • the detection may be qualitative or quantitative, and may be performed in compa ⁇ son with monitoring the complex formation in a control sample of known normal tissue ceils of the same cell type
  • a larger quantity of complexes formed in the test sample indicates the presence or absence ot an immune disease in the mammal from which the test tissue cells were obtained
  • the antibod y prcterablv cames a detectable label Complex formation can be monitored, for example, by light microscopy, flow cytometrv, fluo ⁇ metry. or other techniques known in the art
  • the test sample is usually obtained from an individual suspected of having a deficiency or abnormality of the immune system
  • the present invention concerns a diagnostic kit.
  • ant ⁇ -PRO200 containing an ant ⁇ -PRO200.
  • ant ⁇ -PRO204 ant ⁇ -PR0212.
  • ant ⁇ -PR0216 ant ⁇ -PR0226.
  • ant ⁇ -PRO240 ant ⁇ -PR0235, ant ⁇ -PR0245, anti- PR0172, ant ⁇ -PR0273, ant ⁇ -PR0272.
  • ant ⁇ -PR0332 ant ⁇ -PR0526, ant ⁇ -PRO701. ant ⁇ -PR0361.
  • ant ⁇ -PR0531 ant ⁇ -PRO200.
  • ant ⁇ -PRO204 containing an ant ⁇ -PRO200.
  • ant ⁇ -PR0216 containing an ant ⁇ -PR0212.
  • ant ⁇ -PR0226 containing an ant ⁇ -PR0212.
  • ant ⁇ -PR0226 containing an ant ⁇
  • ant ⁇ -PR01868 anti- PRO205, ant ⁇ -PR021, ant ⁇ -PR0269, ant ⁇ -PR0344, ant ⁇ -PR0333, ant ⁇ -PR0381, ant ⁇ -PRO720, ant ⁇ -PR0866, anti-PRO840.
  • the kit preferably contams instructions for usmg the antibody to detect the PRO polypeptide.
  • the invention concerns an article of manufacture, comp ⁇ sing: a container; an instruction on the container: and a composition comp ⁇ sing an active agent contained withm the container, wherein the composition is effective for stimulating or inhibiting an immune response in a mammal, the instruction on the container indicates that the composition can be used to treat an immune related disease, and the active agent in the composition is an agent stimulating or inhibiting the expression and/or activity of the PRO polypeptide.
  • the active agent is a PRO200. PRO204. PR0212. PR0216. PR0226. PRO240. PR0235. PR0245. PR0172. PR0273, PR0272, PR0332. PR0526. PRO701 , PR0361. PR0362.
  • ant ⁇ -PR0344 ant ⁇ -PR0333.
  • ant ⁇ -PR0866 anti- PRO840.
  • ant ⁇ -PR0836 anti-PROl 159, ant ⁇ -PR01358.
  • a further embodiment is a method for identifying a compound capable of inhibiting the expression and or activity ot a PRO polypeptide bv contacting a candidate compound with a PRO polypeptide under conditions and for a time sufficient to allow these two components to interact
  • either the candidate compound or the PRO polypeptide is immobilized on a solid support
  • the non- lmmobihzed component car ⁇ es a detectable label
  • Another embodiment of the present invention is directed to the use of a PRO polypeptide. or an agonist or antagonist thereof as hereinbefore desc ⁇ bed, or an anti-PRO antibody, for the preparation of a medicament useful m the treatment of a condition which is responsive to the PRO polypeptide. an agonist or antagonist thereof or an anti-PRO antibody.
  • Figure 1 shows DNA29101-1276 (SEQ ID NO: l).
  • Figure 2 shows the native sequence PRO200 polypeptide UNQ174 (SEQ ID NO:2).
  • FIG. 3 shows DNA30871-1157 (SEQ ID NO:l 1)
  • Figure 4 shows the native sequence partial length PRO204 polypeptide UNQ178 (SEQ ID NO: 12) .
  • Figure 5 shows DNA30942-1134 (SEQ ID NO: 13).
  • Figure 6 shows the native sequence PR0212 polypeptide UNQ 186 (SEQ ID NO 14)
  • Figure 7 shows DNA33087-1 158 (SEQ ID NO 18)
  • Figure 8 shows the native sequence PR0216 polypeptide UNQ190 (SEQ ID NO 19)
  • Figure 9 shows DNA33460-1 166 (SEQ ID NO 20)
  • Figure 10 shows the native sequence PR0226 polypeptide UNQ200 (SEQ ID NO 21)
  • Figure 1 1 shows DNA34387- 1 138 (SEQ ID NO 25)
  • Figure 12 shows the native sequence PRO240 polypeptide UNQ214 (SEQ ID NO 26)
  • Figure 13 shows DNA35558-1 167 (SEQ ID NO 30)
  • Figure 14 shows the native sequence PR0235 polypeptide UNQ209 (SEQ ID NO 31)
  • Figure 15 shows DNA35638- 1 141 (SEQ ID NO 35)
  • Figure 16 shows the native sequence PR0245 polypeptide UNQ219 (SEQ ID NO 36)
  • Figure 17 shows DNA35916- 1 161 (SEQ ID NO 40)
  • Figure 18 shows the native sequence PRO 172 polypeptide UNQ146 (SEQ ID NO 41 )
  • Figure 19 shows DNA39523- 1 192 (SEQ ID NO 45)
  • Figure 20 shows the native sequence PR0273 polypeptide UNQ240 (SEQ ID NO 46)
  • Figure 21 shows DNA40620-1 183 (SEQ ID NO 50)
  • Figure 22 shows the native sequence PR0272 polypeptide UNQ239 (SEQ ID NO 51 )
  • Figure 23 shows DNA40982- 1235 (SEQ ID NO 56)
  • Figure 24 shows the native sequence PR0332 polypeptide UNQ293 (SEQ ID NO 57)
  • Figure 25 shows DNA44184- 1319 (SEQ ID NO 61)
  • Figure 26 shows the native sequence PR0526 polypeptide UNQ330 (SEQ ID NO 62)
  • Figure 27 shows DNA44205- I285 (SEQ ID NO 66)
  • Figure 28 shows the native sequence PRO701 polypeptide UNQ365 (SEQ ID NO 67)
  • Figure 29 shows DNA45410- 1250 (SEQ ID NO 71)
  • Figure 30 shows the native sequence PR0361 polypeptide UNQ316 (SEQ ID NO 72)
  • Figure 3 1 shows DN A45416- 1251 (SEQ ID NO 79)
  • Figure 32 shows the native sequence PR0362 polypeptide UNQ317 (SEQ ID NO 80)
  • Figure 33 shows DNA45419- 1252 (SEQ ID NO 86)
  • Figure 34 shows the native sequence PR0363 polypeptide UNQ318 (SEQ ID NO 87)
  • Figure 35 shows DNA47365- 1206 (SEQ ID NO 91)
  • Figure 36 shows the native sequence PR0364 polypeptide UNQ319 (SEQ ID NO 92).
  • Figure 37 shows DNA47470-1 130 (SEQ ID NO 101 )
  • Figure 38 shows the native sequence PR0356 polypeptide UNQ313 (SEQ ID NO 102)
  • Figure 39 shows DNA48314-1320 (SEQ ID NO 106)
  • Figure 40 shows the native sequence PR0531 polypeptide UNQ332 (SEQ ID NO 107)
  • Figure 41 shows DNA49435-1219 (SEQ ID NO 111)
  • Figure 42 shows the native sequence PR0533 polypeptide UNQ334 (SEQ ID NO.112)
  • Figure 43 shows DNA50921-1458 (SEQ ID NO.l 16)
  • Figure 44 shows the native sequence PRO1083 polypeptide UNQ540 (SEQ ID NO 117).
  • Figure 45 shows DNA53974-1401 (SEQ ID NO. I23)
  • Figure 46 shows the native sequence PR0865 polypeptide UNQ434 (SEQ ID NO 124)
  • Figure 47 shows DNA54228- 1366 (SEQ ID NO 133)
  • Figure 48 shows the native sequence PRO770 polypeptide UNQ408 (SEQ ID NO 134)
  • Figure 49 shows DNA54231- 1366 (SEQ ID NO 139)
  • Figure 50 shows the native sequence PR0769 polypeptide UNQ407 (SEQ ID NO 140)
  • Figure 51 shows DNA56405- 1357 (SEQ ID NO 141 )
  • Figure 52 shows the native sequence PR0788 polypeptide UNQ430 (SEQ ID NO 142)
  • Figure 53 shows DNA57033- 1403 (SEQ ID NO 143)
  • Figure 54 shows the native sequence PRO l 1 14 polypeptide UNQ557 (SEQ ID NO 144)
  • Figure 55 shows DNA57690- 1374 (SEQ ID NO 145)
  • Figure 56 shows the native sequence PRO 1007 polypeptide UNQ491 (SEQ ID NO 146)
  • Figure 57 shows DNA59220- 1514 (SEQ ID NO 147)
  • Figure 58 shows the native sequence PRO l 184 polypeptide UNQ598 (SEQ ID NO 148)
  • FIG 59 shows DNA59294- 1381 (SEQ ID NO 149)
  • Tigure 60 shows the native sequence PRO 1031 polypeptide UNQ516 (SEQ ID NO 150 )
  • Figure 61 shows DNA59776- 1600 (SEQ ID NO 151 )
  • Figure 62 shows the native sequence PRO 1346 polypeptide UNQ70I (SEQ ID NO 152)
  • Figure 63 shows DNA59849- 1504 (SEQ ID NO 156)
  • Figure 64 shows the native sequence PROl 155 polypeptide UNQ585 (SEQ ID NO 157)
  • Figure 65 shows DNA60775- 1532 (SEQ ID NO 158)
  • Figure 66 shows the native sequence PRO 1250 polypeptide UNQ633 (SEQ ID NO 159)
  • Figure 67 shows DNA61873- 1574 (SEQ ID NO 160)
  • Figure 68 shows the native sequence PR01312 polypeptide UNQ678 (SEQ ID NO 161 )
  • Figure 69 shows DNA62814- 1521 (SEQ ID NO 162)
  • Figure 70 shows the nativ e sequence PROl 192 polypeptide UNQ606 (SEQ ID NO 163)
  • Figure 71 shows DNA64885- 1529 (SEQ ID NO 167)
  • Figure 72 shows the nativ e sequence PRO 1246 polypeptide UNQ630 (SEQ ID NO 168)
  • Figure 73 shows DNA65404- 1551 (SEQ ID NO 169)
  • Figure 74 shows the native sequence PRO 1283 polypeptide UNQ653 (SEQ ID NO 170)
  • Figure 75 shows DNA65412- 1523 (SEQ ID NO 177)
  • Figure 76 shows the native sequence PRO l 195 polypeptide UNQ608 (SEQ ID NO 178)
  • Figure 77 shows DNA66675- 1587 (SEQ ID NO 179)
  • Figure 78 shows the native sequence PRO 1343 polypeptide UNQ698 (SEQ ID NO 180)
  • Figure 79 shows DNA68864- 1629 (SEQ ID NO 184)
  • Figure 80 shows the native sequence PR01418 polypeptide UNQ732 (SEQ ID NO 185)
  • Figure 81 shows DNA68872- 1620 (SEQ ID NO 186)
  • Figure 82 shows the native sequence PR01387 polypeptide UNQ722 (SEQ ID NO 187)
  • Figure 83 shows DNA68874-1622 (SEQ ID NO 188)
  • Figure 84 shows the native sequence PRO1410 polypeptide UNQ728 (SEQ ID NO 189)
  • Figure 85 shows DNA76400-2528 (SEQ ID NO 190)
  • Figure 86 shows the native sequence PR01917 polypeptide UNQ900 (SEQ ID NO 191)
  • Figure 87 shows DNA77624-2515 (SEQ ID NO 192)
  • Figure 88 shows the nati e sequence PR01868 polypeptide UNQ859 (SEQ ID NO 193)
  • Figure 89 shows DNA30868- 1 156 (SEQ ID NO 228)
  • Figure 90 shows the partial nati e sequence PRO205 polypeptide UNQ 179 (SEQ ID NO 229)
  • Figure 91 shows DNA36638- 1056 (SEQ ID NO 230)
  • Figure 92 shows the native sequence PR021 polypeptide UNQ21 (SEQ ID NO 231)
  • Figure 93 shows DNA38260- 1 180 (SEQ ID NO 232)
  • Figure 94 shows the nativ e sequence PR0269 polypeptide UNQ236 (SEQ ID NO 233)
  • Figure 95 shows DNA40592 1242 (SEQ ID NO 240)
  • Figure 96 shows the native sequence PR0344 polypeptide UNQ303 (SEQ ID NO 241 )
  • Figure 97 shows DNA41374- 1312 (SEQ ID NO 248)
  • Figure 98 shows the partial length native sequence PR0333 polypeptide UNQ294 (SEQ ID NO 249)
  • Figure 99 shows DNA44194- 1317 (SEQ ID NO 250)
  • Figure 00 shows the nativ e sequence PR0381 polypeptide UNQ322 (SEQ ID NO 25 1 )
  • Figure 01 shows DNA53517 1366 (SEQ ID NO 255)
  • Figure 02 shows the nativ e sequence PRO720 polypeptide UNQ388 (SEQ ID NO 256)
  • Figure 03 shows DNA53971 1359 (SEQ ID NO 257)
  • Figure 04 shows the native sequence PRO866 polypeptide UNQ435 (SEQ ID NO 258)
  • Figure 05 shows DNA53987-1438 (SEQ ID NO 266)
  • Figure 06 shows the native sequence PRO840 polypeptide UNQ433 (SEQ ID NO 267)
  • Figure 07 shows DNA57700- 1408 (SEQ ID NO 268)
  • Figure 08 shows the nativ e sequence PR0982 polypeptide UNQ483 (SEQ ID NO 269)
  • Figure 09 shows DNA59620- 1463 (SEQ ID NO 270)
  • Figure 0 shows the nativ e sequence PR0836 polypeptide UNQ545 (SEQ
  • Figure 127 shows DNA98853- I739 (SEQ ID NO:296).
  • Figure 128 shows the native sequence PR05727 polypeptide UNQ2448 (SEQ ID NO:297).
  • PRO polypept ⁇ de(s) and PRO as used herem and when immediately followed by a nume ⁇ cal designation refer to va ⁇ ous polypeptides. wherein the complete designation (i.e.. "PRO/number” or more particularly. PRO200. PRO204. PR0212. PR0216, PR0226. PRO240. PR0235. PR0245. PROl 72, PR0273, PR0272, PR0332. PR0526. PRO701. PR0361. PR0362. PR0363. PR0364, PR0356. PR0531, PR0533.
  • PR04333, PRO4302. PRO4430 or PR05727) refers to particular polypeptide sequences as described herein.
  • PRO/numoer polypeptide and "PRO/number” wherein the term “number” is provided as an actual nume ⁇ cai designation (e g . as desc ⁇ bed above) as used herein encompass native sequence polypeptides and polypeptide variants (which are further defined herein)
  • the PRO polypeptides desc ⁇ bed herein may be isolated from a va ⁇ ety of sources, such as from human tissue types or from another source, or prepared by recombinant or synthetic methods.
  • a "native sequence PRO polypept ⁇ de(s)” comp ⁇ ses a polypeptide having the same amino acid sequence as the corresponding PRO polypeptide derived from nature. Such native sequence PRO/number polypeptides can be isolated from nature or can be produced by recombinant or synthetic means.
  • the term "native sequence PRO polypept ⁇ de(s)” specifically encompasses naturally-occurring truncated or secreted forms ot the specific PRO/number polypeptide (e g., an extracellular domain sequence), namrally-occumng va ⁇ ant forms (e g , alternatively spliced forms) and natural ly-occumng allelic va ⁇ ants of the polypeptide.
  • the native sequence PRO polypeptides disclosed herein are mature or full-length native sequence polypeptides comp ⁇ sing the full-length am o acids sequences shown in the accompanying figures. Start and stop codons are shown in bold font and underlmed in the figures.
  • the PRO/number polypeptides disclosed in the accompanying figures are shown to beg with methionine residues designated herein as ammo acid position 1 m the figures, it is conceivable and possible that other methionine residues located either upstream or downstream from the ammo acid position 1 in the figures may be employed as the starting amino acid residue for the PRO polypeptides.
  • PRO polypept ⁇ de(s) extracellular domam refers to a form of the said polypeptide which is essentially free of the transmembrane and cytoplasmic domams.
  • ECD extracellular domam
  • a PRO polypeptide ECD will have less than 1% of such transmembrane and or cytoplasmic domams and preferably, will have less than 0.5% of such domains. It will be understood that any transmembrane domains identified for the PRO polypeptides of the present mvention are identified pursuant to criteria routinely employed in the art for identifying that type of hydrophobic domain.
  • transmembrane domain may vary but most likely by no more than about 5 ammo acids at either end of the domain as initially identified herem.
  • an extracellular domain of a PRO polypeptide mav contain from about 5 or fewer ammo acids on either side of the transmembrane domain/extracellular domain boundary as identified in the Examples or specification and such polypeptides with or without the associated signal peptide and nucleic acid encodmg them, are contemplated bv the present invention
  • the approximate location of the 'signal peptides" of the vanous PRO/number PRO polypeptides disclosed herein are shown in the present specification and/or the accompanying figures It is noted, however, that the C-terminal boundar y of a signal peptide mav vary but most likely bv no more than about 5 amino acids on either side of the signal peptide C terminal boundary as initially identified herein, wherein the C- termmal boundary of the signal peptide mav be identified pursuant to c ⁇ te ⁇
  • PRO/number variant or PRO va ⁇ ant means an active PRO polypeptide as defined herein (e g below) having at least about 80% amino acid sequence identitv ith a full- length nativ e sequence PRO polypeptide sequence as disclosed herein a PRO polypeptide sequence lacking the signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide with or without the signal peptide as disclosed herem or anv other fragment of a full-length PRO polypeptide sequence as disclosed herein
  • Such PRO polypeptide va ⁇ ants include for instance, polypeptides wherein one or more amino acid residues are added or deleted, at the N- or C-terminus of the full-length native ammo acid sequence
  • Ordina ⁇ K a PRO polypeptide va ⁇ ant will have at least about 80% ammo acid sequence identity alternatively at least about 81 % ammo acid sequence identity alternatively at least about 82% ammo acid sequence identity, alternatively at least about 83% amino acid sequence identity alternativelv at least about 84% amino
  • Percent (%) ammo acid sequence identity with respect to the PRO polypeptide sequences identified herein is defined as the percentage of ammo acid residues in a candidate sequence that are identical with the ammo acid residues m the specific PRO/number polypeptide sequence, after aligning the sequences and introducing gaps, if necessarv. to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part ot the sequence identify Alignment tor purposes of determining percent amino acid sequence identify can be achieved in vanous ways that are within the skill in the art. tor instance, using pub clv available computer software sucn as BLAST, BLAST-2.
  • ALIGN or Megahgn (DNASTAR) software
  • Those skilled in the art can determine approp ⁇ ate parameters for measu ⁇ ng alignment, including any algo ⁇ thms needed to achieve maximal alignment over the full length of the sequences being compared.
  • % amino acid sequence identity values are generated using the sequence comparison computer program ALIGN-2. wherein the complete source code for the ALIGN-2 program is provided in Table 1 below.
  • the ALIGN-2 sequence compa ⁇ son computer program was authored by Genentech. Inc and the source code shown in Tables 1 below has been filed with user documentation in the U.S. Copy ⁇ ght Office. Washington D C, 20559 where it is registered under U S.
  • the ALIGN-2 program is pubhclv available through Genentech. Inc . South San Francisco. California or mav be compiled from the source code provided in Table 1 below
  • the ALIGN-2 program should be compiled tor use on a UNIX operating system, preferably digital UNIX V4 0D. All sequence compa ⁇ son parameters are set by the ALIGN-2 program and do not vary
  • % amino acid sequence identity of a given ammo acid sequence A to, with, or against a given ammo acid sequence B (which can alternatively be phrased as a given ammo acid sequence A that has or comp ⁇ ses a certain % ammo acid sequence identity to, with, or against a given amino acid sequence B) is calculated as follows:
  • Tables 2 and 3 demonstrate how to calculate the % amino acid sequence identity ot the amino acid sequence designated "Compa ⁇ son Protein to the amino acid sequence designated "PRO”, wherein 'PRO” represents the ammo acid sequence of a hypothetical PRO/number polypeptide of interest, Compa ⁇ son Protein” represents the ammo acid sequence of a polypeptide against which the PRO" polypeptide of interest is being compared, and 'X, "Y" and “Z" each represent different hypothetical ammo acid residues
  • % amino acid sequence identify values used herein are obtained as desc ⁇ bed in the immediately preceding paragraph using the ALIGN-2 computer program. However, % amino acid sequence identify values may also be obtained as desc ⁇ bed below by using the WU- BLAST 2 computer program (Altschul et al Methods in 266 460-480 ( 1996)) Most ot the WU- BLAST 2 search parameters are set to the default values Those not set to default values.
  • a % ammo acid sequence identity value is determmed bv dividing (a) the number of matchmg identical ammo acid residues between the amino acid sequence ot the PRO polypeptide of interest having a sequence de ⁇ ved from the native sequence PRO polvpeptide and the compa ⁇ son ammo acid sequence ot interest (i e the sequence against which the PRO polypeptide is being compared hich mav oe a PRO polypeptide a ⁇ ant) as determined bv WU-BLAST-2 by (b) the total number ot amino acid residues ot the PRO polypeptide of interest For example, in the statement 'a polypeptide comp ⁇ sing an amino acid sequence A which has or having at least 80% ammo acid sequence identify to the ammo acid sequence
  • Percent ammo acid sequence identity may also be determined using the sequence comparison program NCBI-BLAST2 (Altschul et al Nucleic Acids Res 25 3389-3402 ( 1997))
  • the % ammo acid sequence identity of a given amino acid sequence A to, with, or against a given am o acid sequence B (which can alternatively be phrased as a giv en amino acid sequence A that has or comp ⁇ ses a certain % ammo acid sequence identity to, with, or agamst a given amino acid sequence B) is calculated as follows
  • PRO va ⁇ ant polynucleotide or "PRO va ⁇ ant nucleic acid sequence means a nucleic acid molecule which encodes an active PRO polypeptide as defined below and which has at least about 80% nucieic acid sequence identity with a nucleotide sequence encoding- ( 1 ) a full-length native sequence PRO polypeptide as disclosed herein, (2) a full-length native sequence PRO polypeptide lacking the signal peptide as disclosed herem; (3) an extracellular domain of a PRO polypeptide, with or without the signal peptide.
  • a PRO polypeptide va ⁇ ant polynucleotide will have at least about 80% nucleic acid sequence identity, alternatively at least about 81% nucleic acid sequence identity, alternatively at least about 82% nucleic acid sequence identity, alternatively at least about 83% nucleic acid sequence identity, alternatively at least about 84% nucleic acid sequence identity, alternatively at least about 85% nucleic acid sequence identity, alternatively at least about 86% nucleic acid sequence identity, alternatively at least about 87% nucleic acid sequence identif y , alternatively at least about 88% nucleic acid sequence identity, alternatively at least about 89%o nucieic acid sequence identity, alternatively at least about 90% nucleic acid sequence identity, alternatively at least about 91 % nucleic acid sequence identity alternatively at least about 92% nucleic acid sequence identit y du ely at least about 93% nucleic acid sequence
  • PRO polypeptide variant polynucleotides are at least about 30 nucleotides in length, alternatively at least about 60 nucleotides in length, alternatively at least about 90 nucleotides in length, alternati el y at least about 120 nucleotides in length, alternati ely at least about 150 nucleotides in length,
  • el y at least about 180 nucleotides in length, alternatively at least about 210 nucleotides in length.
  • alternativel y at least about 240 nucleotides in length, alternatively at least about 270 nucleotides length, alternatively at least about 300 nucleotides in length, alternatively at least about 450 nucleotides in length, alternatively at least about 500 nucleotides in length, alternatively at least about 600 nucleotides in length, alternatively at least about 700 nucleotides in length, alternatively at least about 800 nucieotides in length, alternatively at least about 900 nucleotides in length, alternatively at least about 1000 nucleotides in length, alternatively at least about 1200 nucleotides in length, alternatively at least about 1400 nucleotides in length, alternatively at least about 1600 nucleotides in length, alternatively at least about 1800 nucleotides in length, alternatively at least about 2000 nucleotides in length, alternatively at least about 2500 nucleotides in length, alternatively at least about 3000 nucleotides m length, alternatively at least about 3
  • Percent (%) nucieic acid sequence identity with respect to PRO-encoding nucleic acid sequences identified herem is defined as the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in the PRO nucieic acid sequence of interest, after alignmg the sequences and mtroducmg gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid sequence identity can be achieved in va ⁇ ous ways that are within the skill in the art. for instance, using publicly available computer software such as BLAST. BLAST-2.
  • ALIGN or Mega gn (DNASTAR) software
  • % nucleic acid sequence identity values are generated usmg the sequence compa ⁇ son computer program ALIGN-2, wherem the complete source code for the ALIGN-2 program is provided in Table 1 below
  • the ALIGN-2 sequence compa ⁇ son computer program was authored by Genentech. Inc. and the source code shown in Table 1 below has been filed with user documentation in the U.S. Copy ⁇ ght Office. Washington D.C, 20559. where it is registered under U.S. Copy ⁇ ght Registration No. TXU510087
  • the ALIGN-2 program is pubhclv available through Genentech. Inc.. South San Francisco, California or may be compiled from the source code provided in Table 1 below.
  • the ALIGN-2 program should be compiled for use on a UNIX operating system, preferably digital UNIX V4.0D. All sequence compa ⁇ son parameters are set by the ALIGN-2 program and do not vary
  • the % nucleic acid sequence identify of a given nucleic acid sequence C to. with, or against a given nucleic acid sequence D is calculated as follows'
  • PRO-DNA represents a hypothetical PRO polypeptide - encoding nucleic acid sequence of interest
  • Comparison DNA represents the nucleotide sequence of a nucleic acid molecule against which the "PRO-DNA” nucleic acid molecule of interest is being compared
  • N", “L” and “V” each represent different hypothetical nucleotides.
  • all % nucleic acid sequence identity values used herein are obtained as desc ⁇ bed in the immediately preceding paragraph using the ALIGN-2 computer program. However. % nucleic acid sequence identity values may also be obtained as desc ⁇ bed below by using the WU- BLAST-2 computer program (Altschul et al .
  • a % nucleic acid sequence identity value is determmed by dividing (a) the number of matching identical nucleotides between the nucleic acid sequence of the PRO polypeptide - encoding nucleic acid molecule of interest having a sequence de ⁇ ved from the native sequence PRO polypeptide - encoding nucleic acid (i.e., the reference sequence) and the compa ⁇ son nucleic acid molecule of interest (i e., the sequence agamst which the PRO polypeptide - encodmg nucleic acid molecule of interest is being compared - which mav be a PRO va ⁇ ant polynucleotide) as determmed by WU- BLAST-2 bv (b) the total number of nucleotides of the PRO reference sequence
  • WU-BLAST-2 bv
  • Percent nucleic acid sequence identify may also be determined usmg the sequence compa ⁇ son program NCBI-BLAST2 (Altschul et al Nucleic Acids Res 25 3389-3402 (1997))
  • NCBI-BLAST2 sequence compa ⁇ son program mav be downloaded from http //www ncbi nlm nih gov ' or otherwise obtained from the National Institute of Heath Bethesda MD
  • % nucleic acid sequence identify of a given nucleic acid sequence C to with or acainst a given nucieic acid sequence D is calculated as follows
  • PRO va ⁇ ant polvnucleotides are nucleic acid molecules that encode an active PRO polypeptide and which arc capable of hybridizing, preferably under stringent hv b ⁇ dization and wash conditions, to nucleotide sequences encoding a full-length PRO polypeptides as disclosed herein
  • PRO variant polypeptides mav be those that are encoded by a PRO variant polynucleotide
  • positives in the context of sequence comparison performed as desc ⁇ bed above, mcludes residues in the sequences compared that are not identical but have similar properties (e g , as a result of conservative substitutions, see Table 6 below)
  • the % value of positives is determined by dividing (a) the number of ammo acid residues sco ⁇ ng a positive value between the PRO polypeptide sequence of mterest havmg a sequence de ⁇ ved from a native sequence PRO polypeptide and the compa ⁇ son amino acid sequence of interest (
  • % value of positives is calculated as desc ⁇ bed in the immediately preceding paragraph
  • m cludes ammo acid residues m the sequences compared that are not onlv identical, but also those that have similar properties.
  • Ammo acid residues that score a positive value to an amino acid residue of interest are diose that are either identical to the amino acid residue of interest or are a preferred substitution (as defined in Table 1 below) of the ammo acid residue of mterest. For ammo acid sequence compa ⁇ sons using ALIGN-2 or NCBI-BLAST2.
  • % value of positives of a given ammo acid sequence A to. with, or agamst a given amino acid sequence B (which can alternatively be phrased as a given ammo acid sequence A that has or comp ⁇ ses a certain % positives to. with, or agamst a given ammo acid sequence B) is calculated as follows
  • isolated when used to describe the va ⁇ ous polypeptides disclosed herem. means polypeptide that has been identified and separated and/or recovered from a component of its natural environment Contaminant components of its namral environment are materials that would typically interfere with diagnostic or therapeutic uses for the polypeptide. and may include enzymes, hormones, and other protemaceous or non- prote aceous solutes
  • the polypeptide will be purified (1) to a degree sufficient to obtain at least 15 residues of N-terminal or internal ammo acid sequence by use of a spinning cup sequenator. or (2) to homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or.
  • silver stain Isolated polypeptide includes polypeptide m situ within recombinant cells, since at least one component of the PRO polypeptide in its namral environment will not be present Ordma ⁇ ly. however isolated polypeptide will be prepared bv at least one purification step
  • An "isolated" PRO polypeptide - encodmg nucleic acid or other polypeptide-encoding nucieic acid is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordma ⁇ ly associated in the narurai source of the polypeptide-encoding nucleic acid.
  • An isolated polypeptide-encoding nucleic acid molecule is other than in the context or setting m which it is found in nature Isolated polypeptide - encoding nucleic acids therefore are distinguished from the polypeptide - encodmg nucleic acid molecule existing m natural cells.
  • control sequences refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism
  • the control sequences that are suitable for prokaryotes include a promoter, optionally an operator sequence, and a ⁇ bosome binding site.
  • Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.
  • Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence.
  • DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotem that participates in the secretion of the polypeptide: a promoter or enhancer is operably linked to a coding sequence if it affects the transc ⁇ ption of the sequence: or a ribosome binding sue is operably linked to a coding sequence if it is positioned so as to facilitate translation.
  • "operably linked” means that the DNA sequences being linked are contiguous, and. in the case of a secretory leader, contiguous and in readmg phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice.
  • Hyb ⁇ dization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperamre. The higher the degree of desired homology between the probe and hyb ⁇ dizable sequence, the higher the relative temperamre which can be used.
  • “St ⁇ ngent conditions” or “high stringency conditions. ' as defined herein, may be identified by those that: ( 1 ) employ low ionic strength and high temperamre for washing, for example 0 015 M sodium chloride/0.0015 M sodium c ⁇ trate/0.1% sodium dodecyl sulfate at 50°C; (2) employ du ⁇ ng hyb ⁇ dization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum album ⁇ n/0.1% Ficoll/0.1% polyv ⁇ nylpyrrol ⁇ done/50 mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chlo ⁇ de, 75 mM sodium citrate at 42°C, or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate).
  • formamide for example, 50% (v/v) formamide with 0.1% bovine serum album ⁇ n/0.1% Ficoll/0.1% polyv ⁇
  • Modely st ⁇ ngent conditions may be identified as desc ⁇ bed by Sambrook et al.. Molecular Cloning. A Laboratory Manual. New York: Cold Spring Harbor Press. 1989. and include the use of washmg solution and hyb ⁇ dization conditions ( g., temperamre. ionic strength and %SDS) less st ⁇ ngent that those desc ⁇ bed above.
  • An example of moderately st ⁇ ngent conditions is overnight incubation at 37°C in a solution comp ⁇ sing: 20% formamide. 5 x SSC (150 mM NaCl, 15 mM t ⁇ sodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution.
  • Antibodies are glycoprotems having the same general structural characte ⁇ stics. While antibodies exhibit binding specificity to a specific antigen, immunoglobulins include both antibodies and other antibody-like molecules which lack antigen specificity. Polypeptides of the latter kind are, for example, produced at low levels by the lymph system and at increased levels by yeiomas.
  • antibody is used in the broadest sense and specifically covers, without limitation, mtact monoclonal antibodies (including agonist, antagonist and neutralizing antibodies), polyclonal antibodies, multispecific antibodies (e g , bispecific antibodies) formed trom at least two intact antibodies, s gie cham antibodies binding the epitopes specific to the PRO polypeptide and antibody fragments so long as they exhibit the desired biological activity
  • mtact monoclonal antibodies including agonist, antagonist and neutralizing antibodies
  • polyclonal antibodies include polyclonal antibodies, multispecific antibodies (e g , bispecific antibodies) formed trom at least two intact antibodies, s gie cham antibodies binding the epitopes specific to the PRO polypeptide and antibody fragments so long as they exhibit the desired biological activity
  • ant ⁇ -PR04333, ant ⁇ -PRO4302, ant ⁇ -PRO4430 or ant ⁇ -PR05727 antibody is an antibody which immunologically binds to a PRO200. PRO204. PR0212.
  • PR0356 PR053 1. PR0533.
  • PROl 1 14. PRO 1007 PRO l 184 PRO103 1. PR01346. PRO l 155. PRO 1250. PR01312.
  • the antibody may bind to any domain of the PRO polypeptide which may be contacted by the antibody
  • the antibody may bind to any extracellular domain of the polypeptide and when the entire polypeptide is secreted, to any domain on the polypeptide which is available to the antibody for binding.
  • “Native antibodies” and “native immunoglobulins” are usually heterotetrame ⁇ c glycoproteins of about 150,000 daltons. composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number ot disulfide linkages varies among the heaw chains ot different immunoglobulin isotvpes Each heaw and light cham also has regularl y spaced lntrachain disulfide b ⁇ dges. Each heavy chain has at one end a va ⁇ able domain ( V H ) followed by a number of constant domams.
  • V H va ⁇ able domain
  • Each light cham has a variable domain at one end ( V L ) and a constant domam at its other end: the constant domam of the light chain is aligned with the first constant domain of the heavy chain, and the light-chain va ⁇ able domain is aligned with the va ⁇ able domain of the heavy chain.
  • Particular ammo acid residues are believed to form an mterface between the light- and heavy-chain va ⁇ able domams.
  • va ⁇ abie refers to the fact that certain portions of the va ⁇ able domams differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. However, the variability is not evenly dist ⁇ ubbed throughout the va ⁇ able domams of antibodies. It is concentrated in three or four segments called “compleme ⁇ ta ⁇ ty-determining regions” (CDRs) or “hypervanable regions” in both in the light-chain and the heavy-chain va ⁇ able domams. The more highly conserved portions of va ⁇ able domams are called the framework (FR).
  • CDRs compact ⁇ ta ⁇ ty-determining regions
  • FR framework
  • va ⁇ able domams of native heavy and light chams each comp ⁇ se four or five FR regions, largely adoptmg a ⁇ -sheet configuration, connected by the CDRs, which form loops connecting, and in some cases forming part of, the ⁇ -sheet structure.
  • the CDRs m each cham are held together in close proximity by the FR regions and. with the CDRs from the other cham. conmbute to the formation of the antigen-binding site ot antibodies (see Kabat et al . NIH Publ. No.91-3242, Vol.
  • CDR's can also be defined using a hyb ⁇ d approach incorporating the residues identified by both of the previous techniques
  • the constant domams are not mvoived directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular toxicity
  • Antibody fragments comp ⁇ se a portion of an intact antibody, preferably the antigen binding or va ⁇ able region of the intact antibody
  • Examples of antibody fragments include Fab. Fab'. F(ab') 2 , and Fv fragments, diabodies. linear antibodies (Zapata et al . Protein Eng 8 ( 10) 1057- 1062 [1995]), singie-cham antibody molecules, and multispecific antibodies formed from antibody fragments.
  • Papain digestion of antibodies produces two identical antigen- binding fragments, called "Fab” tragments. each with a single antigen-binding site, and a residual c" fragment, whose name reflects its ability to crystallize readilv Pepsin treatment yields an 1 (ab'b fragment that has two antigen-combining sites and is still capable of cross-linking antigen
  • Fv is the minimum antibody fragment w hich contains a complete antigen-recognition and binding site. This region consists of a dimer of one heavy- and one light-chain variable domam m tight, non-covalent association it is in this configuration that the three CDRs of each va ⁇ able domain interact to define an antigen-binding site on the surface ot the V ⁇ -VJL dimer
  • the six CDRs confer antigen-binding specificity to the antibody
  • a single va ⁇ able domain or half of an Fv comp ⁇ sing only three CDRs specific for an antigen
  • the Fab fragment also contains the constant domain of the light chain and the first constant domain
  • (CH I ) of the heaw chain Fab' fragments differ from Fab fragments bv the addition ot a few residues at the carboxv terminus of the heaw chain CH I domain including one or more cysteines trom the antibody hinge region Fab'-SH is the designation herein for Fab' in which the cysteine res ⁇ due(s) of the constant domains bear a free thiol group.
  • F(ab')2 antibody fragments onginally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.
  • the "light chains" of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa (K) and lambda ( ⁇ ). based on the ammo acid sequences of their constant domams.
  • immunoglobulins can be assigned to different classes. There are five ma j or classes of immunoglobulms: IgA, IgD, IgE. IgG, and IgM, and several of these may be further divided into subclasses (isotypes), e.g., IgGl, IgG2, IgG3, IgG4, IgA, and IgA2.
  • the heavy-chain constant domains that correspond to the different classes of immunoglobulms are called ⁇ , ⁇ , ⁇ , ⁇ , and ⁇ , respectively.
  • the subunit structures and three-dimensional configurations of different classes of immunoglobulms are well known.
  • monoclonal antibody refers to an antibody obtamed from a population of substantially homogeneous antibodies, i.e., the individual antibodies comp ⁇ sing the population are identical except for possible naturally occur ⁇ ng mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed agamst a single antigenic site. Furthermore, in contrast to conventional (polyclonal) antibody preparations which typically include different antibodies directed against different determinants (epitopes). each monoclonal antibody is directed agamst a single determinant on the antigen.
  • the monoclonal antibodies are advantageous in that they are synthesized by the hyb ⁇ doma culture, uncontaminated by other immunoglobulins.
  • the modifier "monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requi ⁇ ng production of the antibody by any particular method.
  • the monoclonal antibodies to be used in accordance with the present invention may be made by the hyb ⁇ doma method first desc ⁇ bed by Kohler et al , Nature, 256: 495 [1975], or may be made by recombinant DNA methods (see, e.g., U.S. Patent No 4,816,567).
  • the "monoclonal antibodies” may also be isolated from phage antibody bra ⁇ es using the techniques desc ⁇ bed in Clackson ct al.. Nature. 352:624-628 [1991 ] and Marks et al , J. Mol Biol.. 222.581 -597 ( 1991 ). tor example. See also U.S Patent Nos 5.750,373. 5,571.698, 5.403.484 and 5.223.409 which desc ⁇ be the preparation of antibodies using phagemid and phage vectors.
  • the monoclonal antibodies herein specifically include "chimenc" antibodies (immunoglobulins) in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies de ⁇ ved from a particular species or belonging to a particular antibody class or subclass, while the remainder of the cha ⁇ n(s) is identical with or homologous to corresponding sequences in antibodies de ⁇ ved from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (U.S. Patent No. 4,816,567: Momson et al., Proc. Natl. Acad. Set. USA. 8 6851 -6855 [ 1984])
  • Humanized forms of non-human (e g , mu ⁇ ne) antibodies are chimenc immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab'. F(ab') 7 or other antigen-binding subsequences of antibodies) which contain minimal sequence de ⁇ ved from non-human immunoglobulin.
  • humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a compiementa ⁇ ty-determining region (CDR) of the recipient are replaced by residues from a CDR of a non- human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity, and capacity. In some instances.
  • humanized antibodies may comp ⁇ se residues which are found neither m the recipient antibody nor m the imported CDR or framework sequences. These modifications are made to further refine and maximize antibody performance.
  • the humanized antibody will comp ⁇ se substantially all of at least one. and typically two, va ⁇ able domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and ail or substantially all of the FR regions are those of a human immunoglobulin sequence.
  • the humanized antibody optimally also will comp ⁇ se at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.
  • Fc immunoglobulin constant region
  • the humanized antibody includes a "primat ⁇ zed"ant ⁇ body where the antigen-bmding region of the antibody is derived from an antibody produced by immunizing macaque monkeys with the antigen ot mterest. Antibodies containmg residues from Old World monkeys are also possible within the invention. See, for example. U.S. Patent Nos. 5,658,570; 5,693,780; 5,681.722, 5,750,105; and 5.756,096.
  • Antibodies and fragments thereof this invention also include "affinity matured" antibodies in which an antibody is altered to change the amino acid sequence of one or more of the CDR regions and/or the framework regions to alter the affinity of the antibody or fragment thereof for the antigen to which it bmds.
  • Affinity maturation may result in an increase or in a decrease m the affinity of the matured antibody for the antigen relative to the starting antibody
  • the starting antibody will be a humanized, human, chimenc or murine antibody and the affinity matured antibody will have a higher affinity than the starting antibody.
  • the ammo acid residues in the CDRs or in the framework regions are changed to a different residue using any standard method.
  • Suitable methods include point mutations using well known cassette mutagenesis methods (Wells et al , 1985. Gene 34.315) or oligonucleotide mediated mutagenesis methods (Zoller et al , 1987, Nucleic Acids Res. J0.6487-6504).
  • Affinity maturation may also be performed using known selection methods in which many mutations are produced and mutants having the desired affinity are selected from a pool or library ot mutants based on improved affinity tor the antigen or ligand.
  • Known phage display techniques can be conveniently used in this approach See. for example, U S 5,750,373, U.S. 5,223,409, etc.
  • Human antibodies are also with in the scope of the antibodies of the invention. Human antibodies can be produced using various techniques known in the art, including phage display hbra ⁇ es [Hoogenboom and Winter. ./ Mol. Biol . 227.381 ( 1991 ), Marks et at , J. Mol. Biol . 222.581 ( 1991)]. The techniques of Cole et al. and Boemer et al. are also available for the preparation of human monoclonal antibodies (Cole et al.. Monoclonal Antibodies and Cancer Therapy, Alan R. Liss. p. 77 ( 1985); Boerner et al.. J Immunol., 147 (L:86-95 (1991 ); U. S.
  • human antibodies can be made by introducing of human immunoglobulin loci into transgenic animals, e g , mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in ail respects, including gene rearrangement, assembly, and antibody repertoire.
  • transgenic animals e g
  • mice in which the endogenous immunoglobulin genes have been partially or completely inactivated.
  • human antibody production is observed, which closely resembles that seen in humans in ail respects, including gene rearrangement, assembly, and antibody repertoire
  • This approach is described, for example, in U.S. Patent Nos 5,545,807, 5.545.806, 5.569,825. 5,625,126. 5,633,425; 5,661,016. and m the following scientific publications: Marks et al., Bio/Technology JO. 779-783 ( 1992); Lonberg et at .
  • Single-chain Fv or “sFv” antibody fragments comp ⁇ se the V H and V L domams of antibody, wherem these domains are present in a single polypeptide chain.
  • the Fv polypeptide further compnses a polypeptide linker between the V ⁇ and V ⁇ domams which enables the sFv to form the desired structure for antigen binding.
  • diabodies refers to small antibody fragments with two antigen-binding sites, which fragments comp ⁇ se a heavy-chain va ⁇ able domam (VJJ) connected to a light-chain va ⁇ able domain (VTJ in the same polypeptide chain (VJJ - VT .
  • VJJ heavy-chain va ⁇ able domam
  • VTJ light-chain va ⁇ able domain
  • VTJ light-chain va ⁇ able domain
  • Diabodies are desc ⁇ bed more tully in. for example, EP 404.097. WO 93/11161. and Holhnger et al . Proc. Natl. Acad. Sci USA. 90 6444-6448 ( 1993).
  • label when used herein refers to a detectable compound or composition which is conjugated directly or indirectly to the compound, e g , antibody or polypeptide. so as to generate a "labelled” compound.
  • the label may be detectable by itself (e g , radioisotope labels or fluorescent labels) or. m the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition which is detectable
  • solid phase is meant a non-aqueous mat ⁇ x to which the compound of the present invention can adhere
  • solid phases encompassed herem include those formed partially or entirely of glass (e g , controlled pore glass), polysacchandes (e g , agarose). polyacrylamides, polystyrene, polyvinyl alcohoi and si cones.
  • the solid phase can comp ⁇ se the well of an assay plate; in others it is a pu ⁇ fication column (e g , an affinity chromatography column) This term also includes a discontinuous solid phase of discrete particles, such as those described in U.S Patent No 4.275.149
  • immune reiated disease means a disease in which a component of the immune system of a mammal causes, mediates or otherwise contributes to a morbidity in the mammal
  • diseases in which stimulation or intervention of the immune response has an ameliorative effect on progression of the disease Included within this term are immune-mediated inflammatory diseases, non-immune-mediated inflammatory diseases, infectious diseases, immunodeficiency diseases, neoplasia. etc
  • T cell mediated disease means a disease in which T cells directly or indirectly mediate or otherwise cont ⁇ bute to a morbidity in a mammal.
  • the T cell mediated disease may be associated with cell mediated effects, lymphokine mediated effects, etc , and even effects associated with B cells if the B cells are stimulated, for example, by the lymphokines secreted by T cells.
  • immune-related and inflammatory diseases examples include systemic lupus ervthematosis. rheumatoid arth ⁇ tis. juvenile chronic arthritis, spondyloarthropathies. systemic sclerosis (scleroderma). idiopathic inflammatory myopathies (dermatomvositis polymyositis). Sjogren's syndrome, systemic v ascu tis, sarcoidosis. autoimmune hemolvtic anemia ( immune pancytopenia. paroxysmal nocturnal hemoglobinu ⁇ a), autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura.
  • systemic lupus ervthematosis examples include systemic lupus ervthematosis. rheumatoid arth ⁇ tis. juvenile chronic arthritis, spondyloarthropathies. systemic sclerosis (scleroderma). idiopathic inflammatory myopathies (derm
  • immune-mediated thrombocytopenia immune-mediated thrombocytopenia
  • thyroiditis GRAve's disease, Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis, atrophic thyroiditis
  • diabetes mel tus immune-mediated renal disease (glomeruloneph ⁇ tis.
  • tubulointerstitial neph ⁇ tis demye nating diseases of the central and pe ⁇ pheral nervous systems such as multiple sclerosis, idiopathic demyelinating polyneuropathy or Guillam-Barre syndrome, and chronic inflammatory demyehnating poiyneuropathy, hepatobi ary diseases such as infectious hepatitis (hepatitis A, B, C, D, E and other non- hepatotropic viruses), autoimmune chronic active hepatitis, p ⁇ mary biliary cirrhosis, granulomatous hepatitis.
  • infectious hepatitis hepatitis A, B, C, D, E and other non- hepatotropic viruses
  • autoimmune chronic active hepatitis p ⁇ mary biliary cirrhosis
  • granulomatous hepatitis granulomatous hepatitis.
  • sclerosmg cholangitis inflammatory bowel disease (ulceranve colitis: Crohn's disease), gluten-sensitive enteropathy, and Whipple's disease, autoimmune or immune-mediated skin diseases mcludmg bullous skin diseases, erythema multiforme and contact dermatitis, pso ⁇ asis, allergic diseases such as asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urtica ⁇ a.
  • lmmunoiogic diseases of the lung such as eosuiophilic pneumonias, idiopathic pulmonary fibrosis and hypersensitivity pneumonitis, transplantation associated diseases including graft rejection and graft -versus-host-disease.
  • Infectious diseases mcludmg viral diseases such as AIDS (HIV infection), hepatitis A. B, C, D. and E. herpes, etc . bacte ⁇ al infections, fungal infections, protozoal infections and parasitic infections.
  • HIV infection HIV infection
  • bacte ⁇ al infections fungal infections, protozoal infections and parasitic infections.
  • Treatment is an intervention performed with the intention of preventing the development or alte ⁇ ng the pathology of a disorder
  • treatment refers to both therapeutic treatment and prophylactic or preventative measures.
  • Those in need of treatment include those already with the disorder as well as those in which the disorder is to be prevented.
  • a therapeutic agent may directly decrease or increase the magnitude of response of a component of the immune response, or render the disease more susceptible to treatment by other therapeutic agents, e g , antibiotics, antifu ⁇ gals, anti- lnflammatory agents, chemotherapeutics.
  • an effective amount is at least the minimum concentration or amount of a PRO polypeptide and or agonist antagonist which causes, induces or results in either a detectable improvement m a component of the immune response in mammals as measured in an in vitro assay. For example, an increase or decrease m the proliferation of T-cells and/or vascular permeability as measured in Examples provided herein.
  • a “therapeutically effective amount” is the minimum concentration or amount of a PRO polypeptide and/or agonist/antagonist which would be effective in at least attenuating a pathology (increasing or decreasing as the case may be) a component ot the immune response in mammals, the results of which effects a treatment as defined in the previous paragraph.
  • Chronic administration refers to administration of the agent(s) in a continuous mode as opposed to an acute mode, so as to mamtain the initial therapeutic effect (activity) for an extended period of time.
  • Intermittent administration is treatment that is not consecutively done without interruption, but rather is cyclic in nature.
  • the "pathology" of an immune related disease includes all phenomena that compromise the well- being of the patient This includes, without limitation, abnormal or uncontrollable cell growth, antibody production, auto-antibody production, complement production and activation, interference with the normal functioning of neighboring cells, release ot cytokines or other secretory products at abnormal levels, suppression or aggravation oi any inflammatory or immunoiogical response, infiltration of inflammatory cells (neutrophihc. eosinophihc. monocytic, lymphocytic) into tissue spaces, etc
  • “Mammal” for purposes of treatment refers to any animal classified as a mammal, mcludmg humans, domestic and farm animals, and zoo. sports, or pet animals, such as dogs, horses, cattle, pigs, apes, hamsters, ferrets, cats, etc Preferably, the mammal is human.
  • Administration "in combination with” one or more further therapeutic agents includes simultaneous (concurrent) and consecutive administration in any order.
  • Car ⁇ ers as used herem include pharmaceutically acceptable earners, excipients. or stabilizers which are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed. Often the physiologically acceptable earner is an aqueous pH buffered solution.
  • physiologically acceptable car ⁇ ers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid: low molecular weight (less than about 10 residues) polypeptide; protems, such as serum albumin, gelatm, or immunoglobulins; hydrophilic polymers such as polyvmylpyrrolidone; ammo acids such as glycme, glutamine, asparagine, arginine or lysme; monosaccha ⁇ des, disaccharides, and other carbohydrates including glucose, mannose.
  • buffers such as phosphate, citrate, and other organic acids
  • antioxidants including ascorbic acid: low molecular weight (less than about 10 residues) polypeptide
  • protems such as serum albumin, gelatm, or immunoglobulins
  • hydrophilic polymers such as polyvmylpyrrolidone
  • ammo acids such as glycme, glutamine, asparagine, arginine or lysme
  • chelating agents such as EDTA
  • sugar aicohols such as mannitol or sorbi t ol: salt-forming counte ⁇ ons such as sodium
  • noniomc surfactants such as TWEENTM, polyethylene glycol (PEG), and PLURONICSTM
  • cytotoxic agent refers to a substance that inhibits or prevents the function of cells and/or causes destruction of cells.
  • the term is intended to include radioactive isotopes (e.g , I 111 . 1 125 , Y 90 and Re ), chemotherapeutic agents, and toxins such as enzymatically active toxins of bacte ⁇ al. fungal, plant or animal o ⁇ gm, or fragments thereof.
  • a “chemotherapeutic agent” is a chemical compound useful in the treatment of cancer.
  • chemotherapeutic agents include adnamycm. doxorubicin. epirubicin. 5-fluorourac ⁇ l, cytosine arabinoside ("Ara-C " ) , cyclophosphamide. thiotepa, busulfan.
  • cytoxin. taxoids e.g . pac taxel (Taxol. Bristol-Myers Squibb Oncology, P ⁇ nceton. NJ), and doxetaxel (Taxotere, Rh ⁇ ne-Poulenc Rorer, Antony. France), toxotere. metho t rexate.
  • a “growth inhibitory agent” when used herein refers to a compound or composition which inhibits grow t h of a cell , especiall y cancer cell overexpressing any of the genes identified herein, either in vitro or in vivo
  • the growth inhibitory agent is one which significantly reduces the percentage of cells overexpressing such genes in S phase.
  • growth inhibitory agen t s include agents that block cell cycle progression (at a place other than S phase), such as agents that prise G l arrest and M-phase arrest.
  • Classical M-phase blockers include the vmcas (vinc ⁇ stine and vmblastine), t axol, and topo II inhibitors such as doxorubicin. epirubicin. daunorubicin.
  • cytokme is a generic term for proteins released by one cell population which act on another cell as intercellular mediators.
  • cytokines are lymphok es. monokines. and traditional polypeptide hormones. Included among the cytokines are grow t h hormone such as human growth hormone , N-methionyl human growth hormone, and bovine growth hormone: para t hyroid hormone; thyroxine; insulm; proinsuiin: reiaxm; prorelaxm: glycoprotein hormones such as follicle stimulating hormone (FSH), thyroid stimuiatmg hormone (TSH), and luteimzing hormone (LH); hepatic growth factor: fibroblast growth factor: prolactin; placental lactogen tumor necrosis factor- ⁇ and - ⁇ ; mullenan-inhibiting substance: mouse gonadotropm-associated peptide: inhibm: activin; vascular endothelial grow t h factor
  • IL-CSF granulocyte-macrophage-CSF
  • G-CSF granulocyte-CSF
  • interieukins ILs
  • cytokme includes proteins from namral sources or from recombinant cell culture and biologically active equivalents of the native sequence cytokmes
  • the term 'epitope tagged ' when used herein refers to a chimenc polypeptide comp ⁇ sing a PRO polypeptide fused to a 'tag polypeptide '
  • the tag polypeptide has enough residues to provide an epitope agamst which an antibody can be made vet is short enough such that it does not interfere with activity of the polypeptide to which it is fused
  • the tag polypeptide preferably also is fairlv unique so that the antibody does not substantially cross-react with other epitopes
  • Suitable tag polypeptides generally have at least six ammo acid residues and usually between about 8 and 50 ammo acid residues (preferably, between about 10 and 20 ammo acid residues) "Active' or 'activity ' in the context of va ⁇ ants ot the PRO polypeptide refers to form(s) of proteins of the invention which retain the biologic and or the ability to mduce the production of an antibody agamst an antigenic epitope possessed by the PRO polypeptid
  • a "smail molecule ' is defined herein to have a molecular weight below about 600 daltons. and is generally an organic compound
  • a “liposome” is a smail vesicle composed of va ⁇ ous types of lipids, phospho pids and/or surfactant which is useful for delivery of a drug (optionally mcludmg a chemotherapeutic agent) to a mammal
  • the components of the liposome are commonly arranged in a bilayer formation, similar to the lipid arrangement of biological membranes
  • the term 'lmmunoadhesin ' designates antibody-like molecules which combme the binding specificity of a heterologous protein (an “adhesin 1 ) with the effector functions of immunoglobulin constant domams Structurally, the immunoadhesins comp ⁇ se a fusion of an ammo acid sequence with the desired binding specificitv which is other than the antigen recognition and binding site of an antibody (t e , is "heterologous '), and an immunoglobulin constant domam sequence
  • the immunoglobulin constant domain sequence in the lmmunoadhesin may be obtained from any immunoglobulin. such as IgG-1, IgG-2, IgG-3, or IgG-4 subtypes, IgA (including IgA-1 and IgA-2). IgE, IgD or IgM.
  • I*Q *l [0, 1.-5.2.2,-5.-1.3,-2.0, 1.-2. 1. l._M.0, 4. l.-l.-l.0.-2.-5.0,-4, 3 ⁇ , l*R*l -2.0.-4.-1.-1.-4,-3,2.-2,0.3.-3.0.0,_M.0.1.6.0.-1.0.-2.2.0.-4.0 ⁇ . l*S*l 1,0.0.0.0.-3.1.-1.-1,0.0.-3.- 2. l._M. l.-l.0.2.1.0.-1.-2.0,-3.0 ⁇ .
  • nvvi */ int dmaxO: /* final diag » ' int dna; /* set if dna: mainO */ int endgaps: /* set if penalizing end gaps */ int gapx, gapy; /* total gaps in seqs */ int lenO.
  • lenl /* seq lens */ int ngapx, ngapy; /* total size ot gaps */ int smax: /* max score: nw() */ int *xbm: /* bitmap tor matching */ long offset; /* current offset in mp file */ struct diag *dx: /* holds diagonals */ struct path PP[2]; /* holds path tor seqs */ char *calloc().
  • the program mav create a tmp file in /tmp to hold info about traceback Original version developed under BSD 43 ⁇ n a va ⁇ 8650
  • 0], &len0). seqx(l] getseq(namex
  • static nm /* matches in core - for checking */ static Imax: /* lengths ot stripped file names */ static ij[2]; /* jmp index for a path */ static nc(2]. /* number at start ot current iine */ static n ⁇ [2]; /* current elem number — for gapping */ static s ⁇ z[2]. static char *ps[2]. /* ptr to current element */ static char *po[2]. /* ptr to next output char slot */ static char oouutt((22]][[IP_LINE], /* output line */ static char starfP 1 il. * set by stars! ) *//
  • *py + + *px. else if (islower( *px))
  • *py++ loupper(*px) if( ⁇ ndex( ATGCU *(py-l))) natgc + + ⁇ ⁇
  • the present invention provides newly identified and isolated nucleotide sequences encoding the polypeptides in the present application as PRO polypeptides
  • cDNAs encoding vanous PRO polypeptides have been identified and isolated, as disclosed in further detail in the Examples below. It is noted that proteins produced in separete expression rounds may be given different PRO numbers but the UNQ number is unique for any given DNA and the encoded protein, and will not be changed.
  • the protein encoded by the full length native nucleic acid molecules disclosed herein as well as all further native homologues and va ⁇ ants included m the foregoing definition of PRO. will be referred to as "PRO/number" or even "PRO", regardless of their o ⁇ gm or mode of preparation.
  • DNA29101 -1276 DNA30871-1 157. DNA30942- 1 134. DNA33087- 1 158. DNA33460- 1 166. DNA34387- 1 138, DNA35558- 1 167, DNA35638-1141, DNA35916-1 161 , DNA39523-1192, DNA40620-1183, DNA40982-1235, DNA44184-1319, DNA44205-1285. DNA45410-1250, DNA45416-1251, DNA45419-1252. DNA47365- 1206. DNA47470-1130. DNA48314-1320. DNA49435-1219, DNA50921-1458, DNA53974-1401.
  • DNA64885- 1529. DNA65404-1551, DNA65412-1523, DNA66675- 1587, DNA68864- 1629, DNA68872-1620, DNA68874-1622, DNA76400-2528, DNA77624-2515, DNA30868-1156, DNA36638-1056, DNA38260- 1 180, DNA40592-1242.
  • PRO1007. PROl 184. PRO1031. PR01346. PROl 155. PRO1250. PR01312. PR01192, PR01246. PR01283, PROl 195. PR01343, PR01418. PROI387. PRO1410. PR01917, PR01868. PRO205, PR021, PR0269, PR0344. PR0333. PR0381. PRO720, PR0866, PRO840, PR0982, PR0836, PR01159, PR01358, PR01325, PR01338. PR01434, PR04333. PRO4302. PRO4430 and PR05727 polypeptides, respectively
  • PRO va ⁇ ants can be prepared PRO va ⁇ ants can be prepared bv introducing approp ⁇ ate nucleotide changes into the PRO DNA. and'or by synthesis ot the desired PRO polypeptide Those skilled the art will appreciate that amino acid changes mav alter post-translational processes ot the PRO. such as changing the number or position ot glycosviation sites or alte ⁇ ng the membrane anchoring characte ⁇ stics.
  • Va ⁇ ations in the native full-length PRO sequence or in various domains of the PRO described herein. can be made, for example, using any of the techniques and guidelines tor conservative and non-conservative mutations set forth, for instance.
  • U S Patent No 5,364,934 Va ⁇ ations may be a substitution, deletion or insertion of one or more codons encoding the PRO that results in a change m the ammo acid sequence of the PRO as compared with the native sequence PRO
  • the variation is by substitution of at least one ammo acid with any other amino acid in one or more of the domains of the PRO
  • Guidance determining which amino acid residue may be inserted, substituted or deleted without adversely affecting the desired activity mav be found bv comparing the sequence ot the PRO with that of homologous known protein molecules and minimizing the number ot amino acid sequence changes made in regions ot high homology
  • Amino acid substitutions can be the result of replacing one ammo acid with another ammo acid having similar structural and or chemical properties, such
  • Insertions or deletions may optionally be in the range of about 1 to 5 am o acids.
  • the va ⁇ ation allowed may be determmed by systematically making insertions, deletions or substitutions of ammo acids in the sequence and testing the resulting va ⁇ ants for activity exhibited by the full-length or mature native sequence.
  • PRO polypeptide fragments are provided herein. Such fragments may be truncated at the N-terminus or C-termmus, or may lack internal residues, for example, when compared with a full length native protem. Certain fragments lack ammo acid residues that are not essential for a desired biological activity of the PRO polypeptide.
  • PRO fragments may be prepared by any of a number of conventional techniques. Desired peptide fragments may be chemically synthesized. An alternative approach involves generating PRO fragments by enzymatic digestion, e g., by treating the protein with an enzyme known to cleave protems at sites defined by particular ammo acid residues, or by digesting the DNA with suitable rest ⁇ ction enzymes and isolating the desired fragment. Yet another suitable technique mvolves isolating and amplifying a DNA fragment encoding a desired polypeptide fragment, by polymerase chain reaction (PCR). Oligonucleotides that define the desired termmi of the DNA fragment are employed at the 5' and 3' pnmers in the PCR. Preferably, PRO polypeptide fragments share at least one biological and ' or immunological activity with the native PRO polypeptide disclosed herein.
  • PCR polymerase chain reaction
  • conservative substimtions of mterest are shown in Table 6 under the headmg of preferred substitutions. If such substimtions result in a change in biological activity, then more substantial changes, denominated exemplary substimtions in Table 6. or as further desc ⁇ bed below in reference to ammo acid classes, are introduced and the products screened.
  • Substantial modifications in function or immunological identity of the invention polypeptide are accomplished by selecting substimtions that differ significantly in their effect on maintaining (a) the structore of the polypeptide backbone in the area of the substitution, tor example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side cham.
  • Naturally occumng residues are divided into groups based on common side-cham properties: ( 1 ) hydrophobic: norieucme. met, ala. val. leu, ile, 5 (2) neutral hydrophilic: cys, ser. thr;
  • Non-conservative substimtions will entail exchangmg a member of one of these classes for another class. Such substituted residues also may be introduced into the conservative substitution sites or. more preferably, into the remammg (non-conserved) sites.
  • va ⁇ ations can be made using methods known in the art such as ohgonucleotide-mediated (site- directed) mutagenesis. alanine scanning, and PCR mutagenesis Site-directed mutagenesis fCarter et al . Nucl.
  • Scanning amino acid analysis can also be employed to identify one or more ammo acids along a 0 contiguous sequence.
  • preferred scanning amino acids are relatively small, neutral amino acids.
  • ammo acids include alanine, glycme. se ⁇ ne, and cysteine.
  • Alanme is typically a preferred scanning ammo acid among this group because it eliminates the side-chain beyond the beta-carbon and is less likely to alter the main-chain conformation of the vanant [Cunningham and Wells. Science. 244. 1081 -1085 ( 1989)].
  • Alanine is also typically preferred because it is the most common amino acid. Further, it is frequently found m 5 both buried and exposed positions [Creighton. The Proteins. (W H. Freeman & Co., N.Y.): Chothia. J. Mol. Biol . 150.1 ( 1976)] If alanine substitution does not yield adequate amounts of vanant. an lsote ⁇ c amino acid can be used.
  • Covalent modifications of PRO polypeptides are included within the scope of this invention.
  • One 0 type of covalent modification includes reacting targeted ammo acid residues of a PRO polypeptide with an organic de ⁇ vatizing agent that is capable of reacting with selected side chains or the N- or C- terminal residues of the PRO.
  • De ⁇ vatization with bifunctional agents is useful, for instance, for crosshnking PRO to a water- msoluble support mat ⁇ x or surface for use in the method for pu ⁇ fymg anti-PRO antibodies, and vice-versa.
  • Commonly used crosslinking agents include, e.g., l,l-bis(d ⁇ azoacetyl)-2-phenylethane, glutaraldehyde, N-
  • 35 hydroxysuccmimide esters for example, esters with 4-azidosalicylic acid, homobifimctional imidoesters, including disuccinimidyl esters such as 3,3'-dithiobis(succ ⁇ n ⁇ midylprop ⁇ onate), bifunctional maleimides such as bis-N-maieimido-l,8-octane and agents such as methyl-3-[(p-azidophenyl)dithio]prop ⁇ o ⁇ midate.
  • esters with 4-azidosalicylic acid homobifimctional imidoesters, including disuccinimidyl esters such as 3,3'-dithiobis(succ ⁇ n ⁇ midylprop ⁇ onate), bifunctional maleimides such as bis-N-maieimido-l,8-octane and agents such as methyl-3-[(p-azidophenyl)dithio]prop ⁇ o ⁇ midate.
  • Another type of covalent modification of the PRO polypeptide included withm the scope of this invention comp ⁇ ses alte ⁇ ng the native glycosylation pattern of the polypeptide.
  • "Altenng the native glycosylation pattern” is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence PRO polypeptide (either by removing the underlying glycosylation site or by deleting the glycosylation by chemical and/or enzymatic means), and/or adding one or more glycosylation sites that are not present in the native sequence PRO.
  • the phrase includes qualitative changes in the glycosylation of the native proteins, involving a change in the nature and proportions of the va ⁇ ous carbohydrate moieties present.
  • Addition of glycosylation sites to the PRO polypeptide may be accomplished by alte ⁇ ng the amino acid sequence.
  • the alteration may be made, for example, by the addition of. or substitution by, one or more serine or threonine residues to the native sequence PRO (for O-lmked glycosylation sites).
  • the PRO ammo acid sequence may optionally be altered through changes at the DNA level, particularly by mutating the DNA encoding tne PRO polypeptide at preselected bases such that codons are generated that will translate into the desired amino acids
  • Another means of increasing the number of carbohydrate moieties on the PRO polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, e.g.. in WO 87 , 05330 published 1 1 September 1987. and in Aplin and Wr.ston. CRC Crit. Rev. Biochem . pp. 259- 306 ( 1981 )
  • Removal of carbohydrate moieties present on the PRO polypeptide may be accomplished chemically or enzymatically or by mutat.onal substitution of codons encoding for ammo acid residues that serve as targets for glycosylation.
  • Chemical deglycosyiation techniques are known in the art and described, for instance, by Hakimuddin. et al , Arch Biochem Biophvs . 259-52 ( 1987) and by Edge a al . Anal. Biochem .
  • Enzymatic cleavage ot carbohydrate moieties on polypeptides can be achieved by the use of a va ⁇ ery of endo- and exo-glycosidases as described by Thotakura et al., Met . Enzvmoi. _38.350 ( 1987)
  • Another type of covalent modification ot PRO compnses linking the PRO polypeptide to one ot a vanety of nonprotemaceous polymers .g., polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylenes. in the manner set forth in U.S. Patent Nos. 4,640.835; 4,496,689; 4,301 ,144: 4,670,417; 4,791.192 or 4,179,337.
  • PRO polypeptides may also be modified in a way to form a chimenc molecule comp ⁇ sing the invention polypeptide fused to another, heterologous polypeptide or ammo acid sequence.
  • such a chimenc molecule compnses a fusion of the PRO with a tag polypeptide which provides an epitope to which an anti-tag antibody can selectively bind.
  • the epitope tag is generally placed at the ammo- or carboxyl- terminus of the PRO. The presence of such epitope-tagged forms of the PRO polypeptide can be detected using an antibody against the tag polypeptide. Also, provision of the epitope tag enables the PRO to be readily pu ⁇ fied by affinity pu ⁇ fication using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag.
  • tag polypeptides and their respective antibodies are well known m the art.
  • poly-histidine poly-his
  • poly-histidine-glycine poly-his-glycine tags
  • flu HA tag polypeptide and its antibody 12CA5 [Field et al.. Mol. Cell. Biol., 8:2159-2165 (1988)]
  • c-myc tag and the 8F9. 3C7. 6E 10, G4.
  • B7 and 9E 10 antibodies thereto [ Ev an et al Molecular and Cellular Biology, 5:3610-3616 ( 1985)], and the Herpes Simplex virus glycoprotem D (gD) tag and its antibody [Paborsky et al..
  • tag polypeptides include the Flag-peptide [Hopp et al.. BioTechnology, 6. 1204-1210 ( 1988)]. the KT3 epitope peptide [Martin et al Science, 255.192-194 (1992)]; an ⁇ -tubuhn epitope peptide [Skinner et al , J Biol Chem , 266 15163-15166 ( 1991)]; and the T7 gene 10 protein peptide tag [Lutz-Freyermuth et al , Proc Natl Acad Set USA. 87 6393-6397 (1990)].
  • the chimenc molecule may comp ⁇ se a fusion of the PRO polypeptide with an immunoglobulin or a particular region of an immunoglobulin.
  • an immunoglobulin also referred to as an "lmmunoadhesin ).
  • a fusion could be to the Fc region of an IgG molecule.
  • the Ig fusions preferably include the substitution of a soluble (transmembrane domain deleted or inactivated) form ot an mve ⁇ tion polypeptide in place of at least one va ⁇ able region withm an Ig molecule.
  • the immunoglobulin fusion includes the hmge. CH2 and CH3, or the hinge, CHI . CH2 and CH3 regions of an IgG I molecule
  • the desc ⁇ ption below relates to primarily lo production of PRO by culm ⁇ ng cells transformed or transfected with a vector containing PRO nucleic acid It is. ot course, contemplated that alternative methods, which are well known in the art. mav be employed to prepare PRO.
  • the PRO sequence, or portions thereof may be produced by direct peptide synthesis using solid-phase techniques [see, e g.. Stewart et al., Solid-Phase Peptide Svnthesis. W H Freeman Co , San Francisco, CA ( 1969).
  • In vitro protein synthesis may be performed using manual techniques or by automation Automated synthesis may be accomplished, for instance, using an Applied Biosystems Peptide Synthesizer (Foster City. CA) using the manufacmrer's instructions Va ⁇ ous portions of the PRO may be chemically synthesized separately and combined using chemical or enzymatic methods to produce the full- length PRO
  • DNA encoding the PRO mav be obtained from a cDNA library prepared from tissue believed to possess the polypeptide mRNA and to express it at a detectable level. Accordingly, human PRO DNA can be conveniently obtained from a cDNA library prepared from human tissue, such as desc ⁇ bed in the Examples.
  • the PRO-encodmg gene may also be obtained from a genomic library, oligonucleotide synthesis, or other known synthetic procedures (e g , automated nucleic acid synthesis).
  • Libranes can be screened with probes (such as antibodies to the PRO polypeptide or oligonucleotides of at least about 20-80 bases) designed to identify the gene of interest or the prote encoded by it. Screenmg the cDNA or genomic library with the selected probe may be conducted using standard procedures, such as desc ⁇ bed in Sambrook et al , Molecular Cloning A Laboratorv Manual (New York: Cold Sp ⁇ ng Harbor Laboratory Press, 1989). An alternative means to isolate the gene encoding the PRO polypeptide is to use PCR methodology [Sambrook et al., supra; Dieffenbach et al., PCR Primer: A Laboratory Manual (Cold Sp ⁇ ng Harbor Laboratory Press, 1995)].
  • the oligonucleotide sequences selected as probes should be of sufficient length and sufficiently unambiguous that false positives are minimized.
  • the oligonucleotide is preferably labeled such that it can be detected upon hybndization to DNA in the library being screened. Methods of labeling are well known in the art, and include the use of radiolabels like : P-labeled ATP, biot ylation or enzyme labeling. Hybndization conditions, including moderate stringency and high stringency, are provided m Sambrook et al . supra.
  • Sequences identified in such library screening methods can be compared and aligned to other known sequences deposited and available m public databases such as GenBank or other private sequence databases. Sequence identity (at either the amino acid or nucleotide level) withm defined regions of the molecule or across the full-length sequence can be determined using methods known the art and as desc ⁇ bed herem.
  • Nucleic acid having protein coding sequence may be obtained by screening selected cDNA or genomic libranes using the deduced amino acid sequence disclosed herein for the first time. and. if necessary, using conventional p ⁇ er extension procedures as descnbed in Sambrook et al., supra, to detect precursors and processing intermediates of mRNA that may not have been reverse-transc ⁇ bed into cDNA. 2. Selection and Transformation of Host Cells
  • Host cells are transfected or transformed with expression or cloning vectors desc ⁇ bed herein for production ot the PRO polypeptides and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transtormants. or amplifying the genes encoding the desired sequences
  • the culture conditions such as media, temperamre. pH and the like, can be selected by the skilled artisan without undue e.xpe ⁇ mentation
  • principles, protocols, and practical techniques for maximizing the productivity of cell cultures can be found in Mammalian Cell Biotechnology A Practical Approach. M. Butler, cd (IRL Press. 1991 ) and Sambrook et al . supra.
  • Suitable host cells for cloning or expressing the DNA in the vectors herein include prokaryote, yeast, or higher eukaryote cells.
  • Suitable prokaryotes include but are not limited to eubacteria. such as Gram- negative or Gram-positive organisms, for example, Enterobacteriaceae such as E. coli.
  • E. coli strains are publicly available, such as E. coli K12 strain MM294 (ATCC 31,446); E.
  • coli X1776 ATCC 31,537); E. coli strain W3110 (ATCC 27,325) and K5 772 (ATCC 53,635).
  • Other suitable prokaryotic host cells include Enterobacte ⁇ aceae such as Escherichia, e.g., E. coli, Enterobacter, Erwinia, Klebsiella. Proteus, Salmonella, e.g., Salmonella tvphimurium. Serraua. e g , Serrana marcescans. and Shigella. as well as Bacilli such as B. subttlis and B. lichemformts (e g., B.
  • Strain W31 10 is one particularly preferred host or parent host because it is a common host strain for recombinant DNA product fermentations. Preferably, the host cell secretes minimal amounts of proteolytic enzymes.
  • strain W31 10 may be modified to effect a genetic mutation in the genes encoding proteins endogenous to the host, with examples of such hosts including E. coli W31 10 strain 1A2. which has the complete genotype ton.4 : E. coli W3 1 10 strain 9E4.
  • E. coli W31 10 strain 27C7 ATCC 55,244. which has the complete genotype tonA ptri phoA E15 (argF-lac)l69 degP ompT kan .
  • in vitro methods of cloning e.g., PCR or other nucieic acid polymerase reactions, are suitable.
  • eukaryotic microbes such as filamentous fungi or veast are suitable cloning or expression hosts tor PRO-encodmg vectors Saccharomvces ccrevisiae is a commonly used lower eukaryotic host microorganism.
  • Others include Schizosaccharomvccs pombe (Beach and Nurse. Nature. 290: 140 [ 1981 ], EP 139.383 published 2 May 1985). Kluweromvces hosts (U S. Patent No.
  • yarrowia Pichia pastons (EP 183.070, Sreek ⁇ shna et at., J Basic Microbiol.. 28.265-278 [1988]); Candida. Tnchoderma reesia (EP 244,234). Neurospora crassa (Case et al , Proc. Natl Acad. Sci. USA, 76:5259-5263 [ 1979]). Schwanmomvc j uch as Schwannio mre.? occidentalis (EP 394.538 published 31 October 1990); and filamentous fungi such as. e g . Neuro pora. Penicillium.
  • Methylotropic yeasts are suitable herein and include, but are not limited to, yeast capable of growth on methanol selected from the genera consisting of Hansenula,
  • Candida Kloeckera. Pichia. Saccharomvces, Torulopsis, and Rhodotorula.
  • a list of specific species that are exemplary of this class of yeasts may be found in C. Anthony, The Biochemistry ofMethylotrophs, 269 ( 1982).
  • Suitable host ceils for the expression of glycosyiated PRO polypeptides are de ⁇ ved from multicellular organisms.
  • invertebrate cells include insect cells such as Drosophila S2 and Spodoptera Sf9, as well as plant cells.
  • useful mammalian host cell lines include Chinese hamster ovary (CHO) and COS cells. More specific examples include monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al. J. Gen Virol. 36:59 ( 1977)); Chinese hamster ovary cellsADHFR (CHO, Urlaub and Chasm, Proc. Natl. Acad. Sci.
  • mice sertoli cells TM4, Mather, Biol. Reprod. 23:243-251 (1980)
  • human lung cells WI38, ATCC CCL 75
  • human liver cells Hep G2, HB 8065
  • mouse mammary tumor MMT 060562. ATCC CCL51
  • the selection of the approp ⁇ ate host cell is deemed to be withm the skill in the art.
  • the nucleic acid (e g., cDNA or genomic DNA) encodmg the PRO polypeptides may be inserted into a rephcable vector for clonmg (amplification of the DNA) or for expression.
  • a rephcable vector for clonmg (amplification of the DNA) or for expression.
  • the vector may. for example, be in the form of a plasmid. cosmid. viral particie. phagemid or phage.
  • the approp ⁇ ate nucleic acid sequence may be inserted into the vector by a va ⁇ efy of procedures. In generaL DNA is inserted into an approp ⁇ ate resr ⁇ ction endonuclease s ⁇ te(s) using techniques known in the art.
  • Vector components generally include, but are not limited to.
  • a signal sequence one or more of a signal sequence, an o ⁇ gin of replication.
  • one or more marker genes one or more marker genes, an enhancer element, a promoter, and a transcnption termination sequence. Construction of suitable vectors containmg one or more of these components employs standard ligation techniques which are known to the skilled artisan.
  • the PRO may be produced recombmantly not only directly, but also as a fusion polypeptide with a heterologous polypeptide.
  • a heterologous polypeptide which may be a signal sequence or other polypeptide having a specific cleavage site at the N-terminus of the mature protein or polypeptide.
  • the signal sequence mav be a component of the vector, or it may be a part of the PRO-encoding DNA that is inserted into the vector.
  • the signal sequence may be a prokarvotic signal sequence selected, for example, from the group of the alkaline phosphatase. penicilhnase. Ipp, or heat-stable enterotoxin II leaders.
  • the signal sequence may be, e.g., the yeast invertase leader, alpha factor leader (including Saccharomvces and Kluvveromyces ⁇ -factor leaders, the latter desc ⁇ bed in U.S. Patent No. 5,010,182). or acid phosphatase leader, the C. albicans glucoamylase leader (EP 362.179 published 4 Ap ⁇ l 1990), or the signal desc ⁇ bed in WO 90/13646 published 15 November 1990.
  • mammalian signal sequences may be used to direct secretion of the protein, such as signal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders
  • Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells Such sequences are well known for a va ⁇ ety of bactena. yeast, and viruses.
  • the o ⁇ gin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria
  • the 2 ⁇ plasmid o ⁇ gm is suitable for yeast
  • various viral origins SV40, polyoma. adenovirus.
  • VSV or BPV are useful for clonmg vectors in mammalian cells.
  • Expression and cloning vectors will typically contain a selection gene, also termed a selectable marker.
  • Typical selection genes encode protems that (a) confer resistance to antibiotics or other toxms, e.g., ampicillin. neomycin, methotrexate, or tetracycime, (b) complement auxotrophic deficiencies, or (c) supply c ⁇ tical nur ⁇ ents not available from complex media, e.g., the gene encoding D-alanine racemase for Bacilli.
  • suitable selectable markers for mammalian cells are those that enable the identification of cells competent to take up the PRO-encoding nucleic acid, such as DHFR or thymidine kinase.
  • An approp ⁇ ate host cell when wild-type DHFR is employed is the CHO cell line deficient in DHFR activity, prepared and propagated as described by Urlaub et al., Proc. Natl. Acad. Sci. USA, 77:4216 (1980).
  • a suitable selection gene for use in yeast is the trp ⁇ gene present m the yeast plasmid YRp7 [Stinchcomb et al. Nature, 282:39 (1979); Kingsman et al, Gene, 7:141 (1979); Tschemper et al.
  • the trpl gene provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example, ATCC No. 44076 or PEP4- 1 [Jones. Genetics. 85 12 (1977)]
  • Expression and cloning vectors usually contain a promoter operably linked to the PRO-encodmg nucleic acid sequence to direct mRNA synthesis. Promoters recognized by a vanety of potential host cells are well known. Promoters suitable for use with prokaryotic hosts include the ⁇ -lactamase and lactose promoter systems [Chang et al. Nature. 275:615 (1978); Goeddel et al . Nature, 28__:544 ( 1979)], alkaline phosphatase. a tryptophan (tip) promoter system [Goeddel.
  • Promoters for use in bacte ⁇ ai systems also will contain a Shine-Dalgarno (S.D.) sequence operably linked to the DNA encoding PRO.
  • suitable promoting sequences for use with yeast hosts include the promoters for 3- phosphogiycerate kinase [Hitzeman et al . J. Biol Chem . 255:2073 (1980)] or other glycolytic enzymes [Hess et al, J.
  • yeast promoters which are inducible promoters having the additional advantage of transc ⁇ ption controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2. isocytochrome C. acid phosphatase. degradative enzymes associated with nitrogen metabolism, metallothionein. glyceraldehyde-3- phosphate dehydrogenase. and enzymes responsible for maltose and galactose utilization. Suitable vectors and promoters for use in yeast expression are further desc ⁇ bed in EP 73,657.
  • PRO transc ⁇ ption from vectors in mammalian host cells is controlled, for example, by promoters obtained from the genomes of viruses such as polyoma virus, fowlpox virus (UK 2.21 1,504 published 5 July 1989).
  • adenovirus such as Adenovirus 2.
  • hepatitis-B virus and Simian Virus 40 (SV40). from heterologous mammalian promoters, e.g . the actm promoter or an immunoglobulin promoter, and from heat-shock promoters, provided such promoters are compatible with the host cell systems.
  • Transc ⁇ ption ot a DNA encoding the PRO polypeptide by higher eukaryotes may be increased by inserting an enhancer sequence into the vector.
  • Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp, that act on a promoter to increase its transc ⁇ ption.
  • Many enhancer sequences are now known from mammalian genes (globin. elastase, albumin, ⁇ -fetoprotem. and msuhn). Typically, however, one will use an enhancer from a eukaryotic cell virus.
  • Examples include the SV40 enhancer on the late side of the replication o ⁇ gm (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication o ⁇ gm, and adenovirus enhancers.
  • the enhancer may be spliced into the vector at a position 5' or 3' to the coding sequence of the PRO polypeptide. but is preferably located at a site 5' from the promoter.
  • Expression vectors used in eukaryotic host cells will also contain sequences necessary for the termination of transc ⁇ ption and for stabilizing the mRNA. Such sequences are commonly available from the 5' and, occasionally 3', untranslated regions of eukaryotic or viral DNAs or cDNAs. These regions contain nucleotide segments transc ⁇ bed as polyadenylated fragments in the untranslated portion of the mRNA encodmg PRO.
  • antibodies may be employed that can recognize specific duplexes, including DNA duplexes.
  • RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes The antibodies m mm may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.
  • Gene expression may be measured by immunological methods, such as immunohistochemical staining of cells or tissue sections and assav of cell culture or body fluids, to quantitate directly, the expression ot gene product.
  • Antibodies useful for immunohistochemical staining and or assay of sample fluids mav be either monoclonal or polyclonal. and may be prepared in any mammal. Conveniently, the antibodies may be prepared against a native sequence PRO polypeptide or against a synthetic peptide based on the DNA sequences provided herein or against exogenous sequence fused to DNA encoding the PRO polypeptide and encoding a specific antibody epitope. 5.
  • Forms of the PRO may be recovered from culture medium or from host cell lysates. If membrane- bound, it can be released from the membrane using a suitable detergent solution (e.g., Triton * -X 100) or by enzymatic cleavage.
  • a suitable detergent solution e.g., Triton * -X 100
  • Cells employed in expression of the PRO polypeptide can be disrupted by va ⁇ ous physical or chemical means, such as freeze-thaw cycling, sonication. mechanical disruption, or cell lysing agents
  • the following procedures are exemplary of suitable purification procedures: by fractionation on an ion-exchange column: ethanol precipitation: reverse phase HPLC, chromatography on silica or on a cation-exchange resin such as DEAE; chromatofocusmg; SDS-PAGE. ammonium sulfate precipitation; gel filtration using, for example. Sephadex G-75; protein A Sepharose columns to remove contammants such as IgG: and metal chelating columns to bind epitope-tagged forms of the PRO polypeptide.
  • protem pu ⁇ fication may be employed and such methods are known in the art and desc ⁇ bed for example m Deutscher. Methods in Enzvmology, ]__2 (1990); Scopes, Protein Purification: Principles and Practice, Springer- Verlag, New York (1982).
  • the pu ⁇ fication step(s) selected will depend, for example, on the nature of the production process used and the particular PRO polypeptide produced.
  • tissue expression in vanous human tissues can be identified by determining mRNA expression in vanous human tissues.
  • the location of such genes provides information about which tissues are most likely to be affected by the stimulating and inhibiting activities of the PRO polypeptides.
  • the location of a gene in a specific tissue also provides sample tissue for the activity blocking assays discussed below.
  • gene expression in vanous tissues mav be measured by conventional Southern blotting, Northern blotting to quantitate the transc ⁇ ption of mRNA (Thomas. Proc. Natl. Acad. Sci. USA. 77.5201 -5205 [ 1980]). dot blotting (DNA analysis), or in situ hybridization, usmg an approp ⁇ ately labeled probe , based on the sequences provided herein.
  • antibodies may be employed that can recognize specific duplexes, mcludmg DNA duplexes. RNA duplexes, and DNA-RNA hyb ⁇ d duplexes or DNA-protein duplexes.
  • Gene expression m va ⁇ ous tissues may be measured by immunological methods, such as immunohistochemical staining of tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product.
  • Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any mammal. Conveniently, the antibodies may be prepared against a native sequence of a PRO polypeptide or agamst a synthetic peptide based on the DNA sequences encoding the PRO polypeptide or agamst an exogenous sequence fused to a DNA encoding a PRO polypeptide and encoding a specific antibody epitope.
  • General techniques for generating antibodies , and special protocols for Northern blotting and in situ hyb ⁇ dization are provided below F Antibody Binding Studies
  • the activity of the PRO polypeptides can be further verified by antibody binding studies, in which the ability ot ant ⁇ -PRO200. ant ⁇ -PRO204. ant ⁇ -PR0212. ant ⁇ -PR0216. ant ⁇ -PR0226, ant ⁇ -PRO240. ant ⁇ -PR0235. ant ⁇ -PR0245. ant ⁇ -PR0172, ant ⁇ -PR0273. ant ⁇ -PR0272, ant ⁇ -PR0332, ant ⁇ -PR0526. ant ⁇ -PRO701 , anti- PR0361. ant ⁇ -PR0362. ant ⁇ -PR0363. ant ⁇ -PR0364. ant ⁇ -PR0356. ant ⁇ -PR0531 , ant ⁇ -PR0533.
  • Exemplary antibodies include polycional. monoclonal, humanized, bispecific. and heterocon j ugate antibodies, the preparation of which will be desc ⁇ bed hereinbelow.
  • Antibody binding studies may be earned out in any known assay method, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays. Zola, Monoclonal Antibodies: A Manual of Techniques, pp.147- 158 (CRC Press, Inc., 1987).
  • ком ⁇ онентs rely on the ability of a labeled standard to compete with the test sample analyte for binding with a limited amount of antibody.
  • the amount of target protein in the test sample is inversely proportional to the amount of standard that becomes bound to the antibodies.
  • the antibodies preferably are insolubilized before or after the competition, so that the standard and analyte that are bound to the antibodies may conveniently be separated from the standard and analyte which remain unbound.
  • Sandwich assays involve the use of two antibodies, each capable of binding to a different immunogenic portion, or epitope, of the protein to be detected.
  • the test sample analyte is bound by a first antibody which is immobilized on a solid support, and thereafter a second antibody binds to the analyte, thus forming an insoluble three-part complex.
  • a first antibody which is immobilized on a solid support
  • a second antibody binds to the analyte, thus forming an insoluble three-part complex.
  • the second antibody may itself be labeled with a detectable moiety (direct sandwich assays) or may be measured using an anti-immunoglobu n antibody that is labeled with a detectable moiety (indirect sandwich assay)
  • sandwich assay is an ELISA assay, in which case the detectable moiety is an enzyme.
  • the tissue sample may be fresh or frozen or may be embedded in paraffin and fixed with a preservative such as formalin, for example.
  • a preservative such as formalin, for example.
  • cells of a cell type known to be involved in a particular immune related disease are transfected with the cDNAs descnbed herein, and the ability of these cDNAs to stimulate or inhibit immune function is analyzed. Suitable cells can be transfected with the desired gene, and monitored for immune function activity. Such transfected cell lines can then be used to test the ability of poly- or monoclonal antibodies or antibody compositions to inhibit or stimulate immune function, for example to modulate T-cell proliferation or inflammatory cell infiltration. Cells transfected with the codmg sequences of the genes identified herein can further be used to identify drug candidates for the treatment of immune related diseases.
  • p ⁇ mary cultures derived from transgenic animals can be used in the cell-based assays herein, although stable cell lines are preferred. Techniques to de ⁇ ve continuous cell lines from transgenic animals are well known in the art (see, e.g.. Small et al. Mol Cell. Biol. 5: 642-648 [ 1985]).
  • MLR mixed lymphocyte reaction
  • a proliferative T cell response in an MLR assay may be due to direct mitogenic properties of an assayed molecule or to external antigen induced activation. Additional verification of the T cell stimulatory activity of the PRO polypeptides can be obtained by a costimulation assay.
  • T cell activation requires an antigen specific signal mediated through the T-cell receptor (TCR) and a costimuiatory signal mediated through a second ligand binding interaction, tor example, the B7 (CD80. CD86)/CD28 binding mteraction.
  • T cell activation has both negative and posi t ive controls through the bmdmg of ligands which have a negative or positive effect.
  • CD28 ana CTLA-4 are related glycoproteins in the Ig superfamily which bind to B7 CD28 bmding to B7 has a positive costimulation effect of T cell activation, conversely, CTLA-4 bmdmg t o B7 has a negative T cell deactivatmg effect Chambers.
  • PRO polypeptides. as well as other compounds of the invention, which are stimulators (costimulators) of T cell proliferation and agonists, e g , agonist antibodies, thereto as determined by MLR and costimulation assays , for example, are useful in treating immune related diseases characte ⁇ zed by poor, suboptimal or i nadequa t e immune function These diseases are treated by stimulating the proliferation and activation of T cells ( and T cell mediated immunit y ) and enhancing the immune response in a mammal through adminis t ration of a s t imulator y compound, such as the stimulating PRO polypeptides
  • the stimulating polypeptide mav. for example be a PRO200. PRO204.
  • an agonist stimulating compound has also been validated expe ⁇ mentallv Activation of 4- 1BB by treatment with an agonist ant ⁇ -4-l BB antibody enhances eradication of tumors Hellstrom. I. and Hellstrom. K. E. , Crit Rev Immunol ( 1998) ]8 1 Immunoadjuvant therapy for treatment of tumors, desc ⁇ bed in more detail below, is another example of the use of the stimulating compounds of the invention.
  • An immune stimulating or enhancing effect can also be achieved by antagonizing or blocking the activity of a PRO which has been found to be inhibiting in the MLR assay. Negatmg the inhibitory activity of the compound produces a net stimulatory effect.
  • Suitable antagonists/blocking compounds are antibodies or fragments thereof which recognize and bind to the inhibitory protein, thereby blocking the effective mteraction of the protein with its receptor and inhibiting signalmg through the receptor. This effect has been validated m expenments usmg ant ⁇ -CTLA-4 antibodies which enhance T cell proliferation, presumably by removal of the inhibitory signal caused by CTLA-4 bmdmg. Walunas, T. L. et al, Immunity (1994) VA05.
  • an immune stimulating or enhancing effect can also be achieved by administration of a PRO which has vascular permeability enhancing properties.
  • Enhanced vacuolar permeability would be beneficial to disorders which can be attenuated bv local infiltration of immune cells (e g , monocytes. eosmophils. PMNs) and inflammation
  • PRO polypeptides as well as other compounds of the mvention which are direct inhibitors of T cell proliferation/activation, lymphokine secretion, and/or vascular permeability can be directiy used to suppress the immune response
  • These compounds are useful to reduce the degree of the immune response and to treat immune related diseases characte ⁇ zed by a hyperactive superoptimal. or autoimmune response
  • This use of the compounds of the invention has been validated by the expenments desc ⁇ bed above in which CTLA-4 b dmg to receptor B7 deactivates T cells
  • the direct inhibitory compounds of the invention function in an analogous manner
  • the use of compound which suppress vascular permeability would be expected to reduce inflammation Such uses would be beneficial in treating conditions associated with excessive inflammation
  • results of the ceil based in itro assavs can be further v erified using in ⁇ ⁇ vo animal models and assays for T-cell function
  • a va ⁇ ety ot well known animal models can be used to further understand the role of the genes identified herein m the development and pathogenesis of immune related disease, and to test the efficacy of candidate therapeutic agents, including antibodies, and other antagonists of the native polypeptides.
  • Animal models of immune related diseases include both non-recombmant and recombinant (transgenic) animals
  • Non-recombmant animal models include, for example, rodent, e g , mu ⁇ ne models
  • Such models can be generated bv introducing cells into syngeneic mice using standard techniques, e subcutaneous injection, tail vein injection spleen implantation intrape ⁇ toneal implantation, implantation under the renal capsule, etc
  • Graft-versus-host disease occurs when lmmunocompetent cells are transplanted into immunosuppressed or tolerant patients The donor cells recogmze and respond to host antigens The response can varv from life threatening severe inflammation to mild cases of diarrhea and weight loss.
  • Graft-versus-host disease models provide a means of assessing T cell reactivity against MHC antigens and mmor transplant antigens A suitable procedure is desc ⁇ bed m detail in Current Protocols in Immunology, above, unit 4 3
  • An animal model for skin allograft rejection is a means of test g the ability of T cells to mediate in vivo tissue destruction and a measure of their role in transplant rejection
  • the most common and accepted models use mu ⁇ ne tail-skin grafts
  • skm allograft rejection is mediated by T cells, helper T cells and killer-effector T cells, and not antibodies.
  • transplant rejection models which can be used to test the compounds of the invention are the allogeneic heart transplant models descnbed by Tanabe. M. et al Transplantation ( 1 94) 58 23 and Tinubu. S. A. et al J Immunol (1994) 4330-4338.
  • Delayed type hypersensitivity reactions are a T cell mediated in vivo immune response charactenzed by inflammation which does not reach a peak until after a pe ⁇ od of time has elapsed after challenge with an antigen. These reactions also occur in tissue specific autoimmune diseases such as multiple sclerosis (MS) and expe ⁇ mental autoimmune encephalomyehtis (EAE. a model for MS) A suitable procedure is described in detail in Current Protocols in Immunology, above, unit 4.5
  • EAE is a T cell mediated autoimmune disease charactenzed by T cell and mononuclear cell inflammation and subsequent demyehnation of axons in the central nervous system.
  • EAE is generally considered to be a relevant animal model for MS in humans Bolton. C. Multiple Sclerosis ( 1995) ]_ 143. Both acute and relapsmg-remitting models have been developed.
  • the compounds of the mvention can be tested for T cell stimulatory or inhibitory activity agamst immune mediated demyehnating disease using the protocol described in Current Protocols in Immunologv, above, units 15 1 and 15 2. See also the models for myeiin disease in which o godendrocvtes or Schwann cells are grafted into the central nervous system as desc ⁇ bed in Duncan. I D et al Molec Med ( 1997) 554-561
  • Contact hypersensitivity is a simple delayed type hypersensitivity in v vo assay of cell mediated immune function
  • cutaneous exposure to exogenous haptens which gives rise to a delayed type hypersensitivity reaction which is measured and quantitated.
  • Contact sensitivity involves an initial sensitizing phase followed by an elicitation phase.
  • the elicitation phase occurs when the T lymphocytes encounter an antigen to which they have had previous contact. Swelling and inflammation occur, making this an excellent model of human allergic contact dermatitis.
  • a suitable procedure is desc ⁇ bed in detail m Current Protocols in Immunology, Eds. J. E. Cologan, A M Kruisbeek, D. H. Marguhes, E. M. Shevach and W Strober. John Wiley & Sons, Inc.. 1994. unit 4 2 See also Grabbe. S. and Schwarz. T, Immun Todav ]9 (1): 37-44 ( 1998)
  • An animal model for arthritis is collagen-induced arthntis
  • This model shares clinical, histological and immunological characte ⁇ stics of human autoimmune rheumatoid arthntis and is an acceptable model for human autoimmune arthntis.
  • Mouse and rat models are charactenzed by synovitis. erosion of cartilage and subchondral bone.
  • the compounds of the invention can be tested for activity agamst autoimmune arthntis using the protocols desc ⁇ bed in Current Protocols in Immunology, above, units 15 5. See also the model usmg a monoclonal antibody to CD 18 and VLA-4 integrals descnbed m Issekutz, A.C. et al, Immunology (1996) 88:569.
  • a model of asthma has been desc ⁇ bed in which antigen-induced airway hyper-reactivity, pulmonary eosinophiha and inflammation are induced by sensitizing an animal with ovalbumm and then challenging the animai with the same protem delivered by aerosol.
  • Several animal models (gumea pig, rat, non-human p ⁇ mate) show symptoms similar to atopic asthma in humans upon challenge with aerosol antigens.
  • Murine models have many of the features of human asthma. Suitable procedures to test the compounds of the mvention for activity and effectiveness m the treatment of asthma are desc ⁇ bed by Wolyniec. W. W. et al, Am. J. Resptr. Cell Mol. Biol. (1998) ]8:777 and the references cited therein.
  • the compounds of the invention can be tested on animal models for psonasis like diseases. Evidence suggests a T cell pathogenesis for pso ⁇ asis.
  • the compounds of the invention can be tested in the scid scid mouse model descnbed by Schon. M. P. et al, Nat. Med. (1997) 3: 183, in which the mice demonstrate histopathologic skin lesions resemblmg pso ⁇ asis.
  • Another suitable model is the human skin/scid mouse chimera prepared as desc ⁇ bed by Nickoloff. B. J. et al. Am. J. Path. (1995) 146:580.
  • Recombinant (transgenic) animal models can be engmeered by mtroducmg the coding portion of the genes identified herein into the genome of animals of mterest, using standard techniques for producing transgenic animals.
  • Animals that can serve as a target for transgenic manipulation mclude. without limitation. mice. rats, rabbits, guinea pigs, sheep, goats, pigs, and non-human primates, e.g., baboons, chimpanzees and monkeys.
  • Techniques known in the art to introduce a transgene into such animals include pronucleic microinjection (Hoppe and Wanger, U.S. Patent No.
  • transgenic animals include those that carry the transgene only in pan ot their cells ("mosaic animals")
  • the transgene can be integrated either as a single transgene. or m concatamers. e ., head-to-head or head-to-tail tandems.
  • Selective introduction of a transgene into a particular cell type is also possible by following, for example, the technique of Lasko et al, Proc. Natl. Acad. Sci. USA 89. 6232-636 ( 1992).
  • the expression of the transgene in transgenic animals can be monitored by standard techniques. For example. Southern blot analysis or PCR amplification can be used to venfy the integration of the transgene. The level of mR A expression can then be analyzed using techniques such as in situ hyb ⁇ dization. Northern blot analysis. PCR, or immunocytochemistry The animals may be further examined for signs of immune disease pathology, for example by histological examination to determine infiltration ot immune cells into specific tissues. Blocking experiments can also be pe ⁇ ormed m which the transgenic animals are treated with the compounds of the invention to determine the extent of the T cell proliferation stimulation or inhibition of the compounds. In these expenments. blocking antibodies which bind to the PRO polypeptide. prepared as descnbed above, are admmistered to the animal and the effect on immune function is determined.
  • "knock out" animals can be constructed which have a defective or altered gene encoding a polypeptide identified herein, as a result of homologous recombmation between the endogenous gene encoding the polypeptide and altered genomic DNA encoding the same polypeptide introduced into an embryonic cell of the animal.
  • cDNA encodmg a particular polypeptide can be used to clone genomic DNA encoding that polypeptide accordance with established techniques.
  • a portion of the genomic DNA encoding a particular polypeptide can be deleted or replaced with another gene, such as a gene encoding a selectable marker which can be used to monitor integration.
  • flanking DNA typically, several kilobases of unaltered flanking DNA (both at the 5' and 3' ends) are included in the vector [see e.g., Thomas and Capecchi, Cell, 5__:503 (1987) for a desc ⁇ ption of homologous recombination vectors].
  • the vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells m which the introduced DNA has homologously recombined with the endogenous DNA are selected [see e g., Li et al. Cell. 69 915 (1992)].
  • the selected cells are then injected into a blastocyst of an animal (e g., a mouse or rat) to form aggregation chimeras [see e.g., Bradley, in Teratocarcinomas and Embrvomc Stem Cells. A Practical Approach. E. J. Robertson, ed. (IRL. Oxford. 1987), pp. 1 13-152].
  • a chimenc embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term to create a "knock out" animal.
  • Progeny harbo ⁇ ng the homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed animals in which all cells of the animal contain the homologously recombined DNA. Knockout animals can be charactenzed for instance, for their ability to defend against certain pathological conditions and for their development of pathological conditions due to absence of the polypeptide.
  • the immunostimulating compounds of the invention can be used in immunoadjuvant therapy for the treatment of tumors (cancer).
  • tumors cancer
  • T cells recognize human tumor specific antigens.
  • DeSmet. C. et al . ( 1996) Proc. atl Acad. Sci USA. 93 7149 It has been shown that costimulation of T cells induces tumor regression and an antitumor response both in vitro and in vivo Melero, I. et al.
  • the stimulatory compounds of the invention can be administered as adjuvants, alone or together with a growth regulating agent, cytotoxic agent or chemotherapeutic agent, to stimulate T cell proliferation activation and an antitumor response to tumor antigens.
  • the growth regulating, cytotoxic. or chemotherapeutic agent may be administered in conventional amounts using known administration regimes. Immunostimulating activity by the compounds of the invention allows reduced amounts of the growth regulating, cytotoxic. or chemotherapeutic agents thereby potentially lowenng the toxicity to the patient.
  • Screening assays tor drug candidates are designed to identify compounds that bind to or complex with the polypeptides encoded by the genes identified herein or a biologically active fragment thereof, or otherwise interfere with the interaction of the encoded polypeptides with other cellular proteins.
  • Such screenmg assays will include assays amenable to high-throughput screenmg of chemical libranes, making them particularly suitable for identifying small molecule drug candidates.
  • Small molecules contemplated include synthetic organic or inorganic compounds, including peptides, preferably soluble peptides, (poly)pepttde- lmmunoglobulin fusions, and.
  • antibodies including, without limitation, poly- and monoclonal antibodies and antibody fragments, single-chain antibodies, anti-idiotypic antibodies, and chimenc or humanized versions of such antibodies or fragments, as well as human antibodies and antibody fragments.
  • the assays can be performed in a va ⁇ ety of formats, including protein-protein binding assays, biochemical screenmg assays, immunoassays and cell based assays, which are well charactenzed in the art.
  • the polypeptide encoded by the gene identified herem or the drug candidate is immobilized on a solid phase g on a microtiter plate, bv covalent or non-covalent attachments
  • Non-covalent attachment generally is accomplished by coatmg the solid surface with a solution of the polypeptide and drying Alternatively an immobilized antibody, e g a monoclonal antibody, specific for the polypeptide to be immobilized can be used to anchor it to a solid surface
  • the assav is performed by adding the non-immobilized component, which mav be labeled bv a detectable label, to the immobilized component, e g the coated surface containmg the anchored component
  • a gene identified herein its interaction with that protein can be assaved bv methods well known tor detecting protein- protein interactions
  • Such assays include traditional approaches such as. cross-linking, o- lmmunoprecipitation and co-pu ⁇ fication through gradients or hromatographic columns
  • protein- protein interactions can be monitored bv using a veast-based genetic system described bv Fields and co- workers [Fields and Song, Nature (London) 340 245-246 ( 1989), Chien et al . Pioc Natl Acad Sci USA 88, 9578-9582 ( 1991 )] as disclosed by Chevray and Nathans.
  • transc ⁇ ptional activators such as yeast GAL4, consist of two physically discrete modular domains, one acting as the DNA-binding domain, while the other one functioning as the transc ⁇ ption activation domain
  • the yeast expression system desc ⁇ bed in the foregoing publications (generally referred to as the "rvvo-hyb ⁇ d system ') takes advantage of this property and employs two hvb ⁇ d proteins one in which the target protem is fused to the DNA-bindmg domain of GAL4 and another, in which candidate activating proteins are fused to ihe activation domain
  • the expression ot a G ⁇ Ll-/ ⁇ ⁇ :Z reporter gene under control of a GAL4-act ⁇ vated promoter depends on reconstitution ot GAL4 activity via protein-protein interaction Colonies containing interacting polypeptides are detected with a chromogenic substrate for ⁇ -galactosidase
  • MATCH chromogenic substrate for ⁇ -galactosidase
  • a reaction mixmre is usually prepared containmg the product of the gene and the mtra- or extracellular component under conditions and for a time allowing for the mteraction and bmdmg of the rwo products
  • the reaction is run m the absence and in the presence of the test compound
  • a placebo may be added to a third reaction mixmre. to serve as positive control
  • the bindmg (complex formation) between the test compound and the mtra- or extracellular component present in the mixture is monitored as desc ⁇ bed above. The formation of a complex in the control react ⁇ on(s) but not m the reaction mixmre containmg the test compound indicates that the test compound interferes with the interaction of the test compound and its reaction partner.
  • compositions useful in the treatment of immune related diseases include, without limitation. proteins, antibodies, small organic molecules, peptides. phosphopeptides, antisense and ⁇ bozyme molecules. triple helix molecules, etc. that inhibit or stimulate immune function, for example. T cell proliferation activation, lymphokine release, or immune cell infiltration.
  • antisense RNA and RNA molecules act to directly block the translation of mRNA by hyb ⁇ dizing to targeted mRNA and preventing protein translation.
  • antisense DNA is used.
  • ohgodeoxy ⁇ bonucleotides de ⁇ ved from the translation initiation site e.g . between about -10 and +10 positions of the target gene nucleotide sequence, are preferred.
  • Ribozymes are enzymatic RNA molecules capable of catalyzmg the specific cleavage of RNA. Ribozymes act by sequence-specific hyb ⁇ dization to the complementary target RNA. followed by endonucleolytic cleavage. Specific ⁇ bozyme cleavage sites withm a potential RNA target can be identified by known techniques for further details see. e g . Rossi. Current B ⁇ olog ⁇ 4. 469-471 ( 1994). and PCT publication No WO 97/33551 (published September 18. 1997)
  • Nucleic acid molecules in triple helix formation used to inhibit transc ⁇ ption should be single-stranded and composed of deoxynucleotides.
  • the base composition of these oligonucleotides is designed such that it promotes triple helix formation via Hoogsteen base pai ⁇ ng rules, which generally require sizeable stretches of pu ⁇ nes or pynmidines on one strand of a duplex.
  • Antibodies The present invention further provides anti-PRO antibodies and fragments thereof which may inhibit
  • anti-PRO antibodies or fragments thereof include polyclonal. monoclonal, humanized, bispecific and heteroconjugate antibodies.
  • the anti-PRO antibodies may comp ⁇ se polyclonal antibodies. Methods of prepa ⁇ ng polyclonal antibodies are known to the skilled artisan. Polycionai antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or lntrape ⁇ toneai injections. The immunizing agent may mclude the PRO polypeptide or a fusion protein thereof. It may be useful to conjugate the unmumzing agent to a protein known to be immunogenic m the mammal being immunized.
  • immunogenic proteins include but are not limited to keyhole limpet hemocyanm. serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor.
  • adjuvants which may be employed include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate). The immunization protocol may be selected by one skilled in the art without undue experimentation.
  • the anti-PRO antibodies may, alternatively, be monoclonal antibodies. Monoclonal antibodies may be prepared usmg hyb ⁇ doma methods, such as those desc ⁇ bed by Kohler and Milstem. Nature, 256:495
  • lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent.
  • the lymphocytes may be immunized in vitro.
  • the immunizing agent will typically include the PRO polypeptide or a fusion protein thereof.
  • PBLs pe ⁇ pheral blood lymphocytes
  • spleen cells or lymph node cells are used if non-human mammalian sources are desired.
  • the lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hyb ⁇ doma cell [Goding. Monoclonal Antibodies Principles and Practice, Academic Press. (1986) pp. 59- 103].
  • Immortalized cell Imes are usually transformed mammalian ceils, particularly myeioma cells of rodent, bovine and human ongm.
  • rat or mouse myeloma cell lines are employed.
  • the hyb ⁇ doma cells may be cultured in a suitable culture medium that preferably contams one or more substances that inhibit the growth or survival of the untused. immortalized cells
  • the culture medium for the hyb ⁇ domas typically will include hvpoxanthine. ammopte ⁇ n. and thymidine ("HAT medium"), which substances prevent the growth of HGPRT deficient cells
  • Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. More preferred immortalized cell lines are mu ⁇ ne myeloma lines, which can be obtained, for instance, from the Salk Institute Cell Distribution Center, San Diego, California and the Ame ⁇ can Type Culture Collection. Manassas, Virginia Human myeloma and mouse-human heteromyeloma cell lines also have been desc ⁇ bed for the production of human monoclonal antibodies [Kozbor. J Immunol , 133.3001 (1984), Brodeur et al, Monoclonal Ant ⁇ odi Pioduction Techniques and Applications. Marcel Dekker, Inc.. New York, ( 1987) pp 51 -63]
  • the culture medium in which the hvb ⁇ doma cells are cultured can then be assayed for the presence of monoclonal antibodies directed agamst PRO
  • the binding specificity of monoclonal antibodies produced by the hyb ⁇ doma cells is determined by lmmunoprecipitation or by an in vitro bindmg assay, such as radioimmunoassay (PJA) or enzyme-linked lmmunoabsorbent assay (ELISA).
  • PJA radioimmunoassay
  • ELISA enzyme-linked lmmunoabsorbent assay
  • the bmdmg affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson and Pollard, Anal. Biochem., J07.220 (1980).
  • the alterations may be subcloned by limiting dilution procedures and grown by standard methods [Goding, supra). Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI- 1640 medium. Alternatively, the hyb ⁇ doma cells may be grown in vivo as ascites in a mammal.
  • the monoclonal antibodies secreted by the subclones may be isolated or pu ⁇ fied from the culture medium or ascites fluid by conventional immunoglobulin pu ⁇ fication procedures such as, for example, protem A-Sepharose, hydroxyapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.
  • the monoclonal antibodies may also be made by recombinant DNA methods, such as those desc ⁇ bed in U.S. Patent No. 4,816,567.
  • DNA encodmg the monoclonal antibodies of the mvention can be readily isolated and sequenced using conventional procedures (e g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of mu ⁇ ne antibodies).
  • the hyb ⁇ doma ceils of the invention serve as a preferred source of such DNA.
  • the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells.
  • the DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domams m place of the homologous mu ⁇ ne sequences [U.S. Patent No. 4,816,567, Momson et al, supra] or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobuiin polypeptide.
  • non-immunoglobuiin polypeptide can be substituted for the constant domains of an antibody of the invention, or can be substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimenc bivalent antibody
  • the antibodies are preferably monovailing antibodies.
  • Methods for prepa ⁇ ng monovalent antibodies are well known in the art For example, one method involves recombinant expression of immunoglobulin light chain and modified heaw chain.
  • the heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain crosshnking.
  • the relevant cysteine residues are substituted with another ammo acid residue or are deleted so as to prevent crosshnking.
  • the anti-PRO antibodies of the invention may further comp ⁇ se humanized antibodies or human antibodies.
  • Humanized forms of non-human (e g., mu ⁇ ne) antibodies are chimenc immunoglobulins. immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab'. F(ab')2 or other antigen-binding subsequences of antibodies) which contain minimal sequence de ⁇ ved from non-human immunoglobulin.
  • Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non- human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity
  • CDR complementary determining region
  • donor antibody such as mouse, rat or rabbit having the desired specificity, affinity and capacity
  • Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues.
  • Humanized antibodies may also comp ⁇ se residues which are found neither m the recipient antibody nor in the imported CDR or framework sequences.
  • the humanized antibody will compnse substantially all of at least one, and typically two, va ⁇ able domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence.
  • the humanized antibody optimally also will comp ⁇ se at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al, Nature. 321:522-525 (1986); Riechmann et al, Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol.2:593-596 (1992)].
  • Fc immunoglobulin constant region
  • a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import 1 variable domain Humanization can be essentially performed following the method of Winter and coworkers [Jones et al , Nature, 32_ 522-525 ( 1986), Riechmann et al , Nature. 332.323-327 (1988); Verhoeven et al , Science.
  • humanized antibodies are chimenc antibodies (U S Patent No 4,816,567), wherein substantially less than an mtact human va ⁇ able domam has been substituted bv the corresponding sequence from a non-human species
  • humanized antibodies are rypicallv human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies
  • Human antibodies can also be produced using va ⁇ ous techniques known in the art. including phage display libranes [Hoogenboom and Winter. J Mol Biol . 227 381 ( 1991 ). Marks et al . J Mol Biol . 222.581 ( 1991 )] The techniques of Cole et al and Boerner et al are also available for the preparation of human monoclonal antibodies (Cole et al Monoclonal Antibodies and Cancer Tl erapv, Alan R Liss, p 77 ( 1985), Boerner et al J Immunol .
  • human antibodies can be made by introducing of human immunoglobulin loci into transgenic animals, e g mice in which the endogenous immunoglobulin genes have been partially or completely inactivated Upon challenge, human antibodv production is observed which closelv resembles that seen in humans in all respects, including gene rearrangement assembly , and antibodv repertoire Tins approach is descnbed. for example, in U S Patent Nos 5 545.807 5 545,806. 5.569,825. 5,625, 126. 5,633,425. 5,661.016.
  • the antibodies mav also be affinity matured using known selection and or mutagenesis methods as desc ⁇ bed abov e
  • Preferred affinity matured antibodies have an affinity which is five times, more preferably 10 tunes, ev en more preferably 20 or 30 times greater than the starting antibody (generally munne. humanized or human ) trom which the matured antibodv is prepared 4 Bispecific Antibodies
  • Bispecific antibodies arc monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens
  • one of the binding specificities may be for the PRO.
  • the other one is for any other antigen, and preferably for a cell-surface protein or receptor or receptor subunit
  • bispecific antibodies are known in the art Traditionally, the recombinant production of bispecific antibodies is based on the coexpression of two immunoglobulin heavy-chain/hght- cha pairs, where the two heavy chains have different specificities (Milstein and Cuello. Nature. 305 537-539 [1983]) Because of the random assortment of immunoglobulin heavy and light chams, these hyb ⁇ domas (quadromas) produce a potential mixmre of ten different antibody molecules, of which only one has the correct bispecific structure. The pu ⁇ fication of the correct molecule is usually accomplished by affinity chromatography steps. Similar procedures are disclosed m WO 93/08829, published 13 May 1993. and m Traunecker et al, EMBO J , KU655-3659 ( 1991)
  • Antibody va ⁇ able domams with the desired bmdmg specificities can be fused to immunoglobulin constant domain sequences.
  • the fusion preferably is with an immunoglobulm heavy-chain constant domain, compnsing at least part ot the hmge. CH2 and CH3 regions It is preferred to have the first heavy-chain constant region (CHI ) containing the site necessary tor light-chain bmdmg present in at least one of the fusions DNAs encoding the immunoglobulin heavy-chain fusions and.
  • CHI first heavy-chain constant region
  • the immunoglobulm light cham are inserted into separate expression vectors, and are cotransfected into a suitable host organism.
  • the immunoglobulm light cham are inserted into separate expression vectors, and are cotransfected into a suitable host organism.
  • the interface between a pan of antibody molecules can be engineered to maximize the percentage of heterodimers which are recovered from recombinant cell culture
  • the preferred interface compnses at least a part of the CH3 region of an antibodv constant domain
  • one or more small amino acid side chams from the interface of the first antibodv molecule are replaced with larger side chains (e g tyrosine or tryptophan)
  • Compensatory "cavities ' of identical or similar size to the large side cha ⁇ n(s) are created on the interface of the second antibodv molecule by replacing large ammo acid side chains with smaller ones (e g alanine or threonine)
  • Bispecific antibodies can be prepared as full length antibodies or antibodv fragments (e F(ab') 2 bispecific antibodies) Techniques for generating bispecific antibodies from antibodv fragments have been described in the literature For example bispecific antibodies can be prepared can be prepared using chemical linkage Brennan et al Science 229 81 ( 1985) desc ⁇ be a procedure wherein mtact antibodies are proteolvtically cleaved to generate F(ab') 2 fragments These fragments are reduced in the presence of the dithiol compiexing agent sodium arsemte to stabilize vicinal dithiols and prevent l ⁇ termolecular disulfide formation The Fab fragments generated are then converted to thionitrobenzoate (TNB) de ⁇ vatives One of the Fab TNB de ⁇ vatives is then reconverted to the Fab -thiol by reduction with mercaptoethvlamine and is mixed with an equimolar amount of the other Fab'-TNB de ⁇ vative to form
  • Fab' fragments mav be directlv recovered from E coli and chemicallv coupled to form bispecific antibodies Shalabv et al J Exp M d _____ 217-225 ( 1992) desc ⁇ be the production of a fully humanized bispecific antibody F(ab ) 2 molecule
  • Each Fab fragment was separately secreted from E colt and subjected to directed chemical coupling in vitro to form the bispecific antibody
  • the bispecific antibody thus formed was able to bind to cells overexpressing the ErbB2 receptor and normal human T cells, as well as t ⁇ gger the lytic activity of human cytotoxic lymphocytes against human breast tumor targets
  • bispecific antibodies have been produced using leuci ⁇ e zippers Kostelny et al . J Immunol _48 (5) 1547-1553 (1992)
  • the leucme zipper peptides from the Fos and Jun proteins were linked to the Fab portions of rwo different antibodies by gene fusion
  • the antibody homodimers were reduced at the hmge region to form monomers and then re-oxidized to form the antibodv heterodimers This method can also be utilized for the production of antibody homodimers.
  • the fragments comp ⁇ se a heavy-chain vanable domam (V H ) connected to a light-cham va ⁇ able domam (V L ) by a lmker which is too short to allow pairing between the rwo domains on the same cham. Accordingly, the V H and V t domams of one fragment are forced to pan- with the complementary V L and V H domams of another fragment, thereby forming two antigen-binding sites.
  • bispecific antibodies may bind to two different epitopes on a given PRO polypepide herein.
  • an anti-PRO arm may be combined with an arm which binds to a triggering molecule on a leukocyte such as a T-cell receptor molecule (e.g., CD2. CD3. CD28, or B7), or Fc receptors for IgG (Fc ⁇ R), such as Fc ⁇ RI (CD64), Fc ⁇ RII (CD32) and Fc ⁇ RIII (CD 16) so as to focus cellular defense mechanisms to the cell expressing the particular PRO polypeptide.
  • Bispecific antibodies may also be used to localize cytotoxic agents to cells which express a particular PRO polypeptide.
  • antibodies possess a PRO polypeptide - binding arm and an arm which binds a cytotoxic agent or a radionuclide chelator.
  • a cytotoxic agent or a radionuclide chelator such as EOTUBE, DPTA. DOTA. or TETA
  • Another bispecific antibody of interest binds the PRO polypeptide and further binds tissue factor ( TD).
  • Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells [U.S. Patent No. 4.676,980], and for treatment of HIV infection [WO 91/00360; WO 92/200373. EP 03089]. It is contemplated that the antibodies may be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosshnking agents. For example, immunotoxins may be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyi-4-mercaptobuty ⁇ m ⁇ date and those disclosed, for example, in U.S. Patent No. 4.676,980.
  • effector function enginee ⁇ ng It may be desirable to modify the antibody of the invention with respect to effector function, so as to enhance the effectiveness of the antibody in treating an immune reiated disease, for example.
  • cysteine residue! s may be introduced in the Fc region, thereby allowing mtercham disulfide bond formation in this region.
  • the homodime ⁇ c antibody thus generated may have improved mtemalization capability and/or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicify (ADCC). See Caron el al. J. Exp Med. J_76:l 191-1 195 (1992) and Shopes, B. J. Immunol. 148:2918-2922 (1992).
  • Homodimeric antibodies with enhanced anti-tumor activity may also be prepared using heterobifunctional cross-linkers as desc ⁇ bed in Wolff « al. Cancer Research 53:2560-2565 (1993).
  • an antibody can be engineered which has dual Fc regions and may thereby have enhanced complement lysis and ADCC capabilities. See Stevenson et al. Anti-Cancer Drug Desig _3:219-230 (1989). 7. Immunoconiugates
  • the invention also pertains to immunoconjugates comp ⁇ sing an antibody conjugated to a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g., an enzymatically active toxin of bacte ⁇ al, fungal, plant or animal origin, or fragments thereof), or a radioactive isotope (i.e., a radioco ⁇ jugate).
  • a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g., an enzymatically active toxin of bacte ⁇ al, fungal, plant or animal origin, or fragments thereof), or a radioactive isotope (i.e., a radioco ⁇ jugate).
  • Enzymatically active tox s and fragments thereof which can be used include diphtheria A chain, nonbmdtng active fragments of diphthe ⁇ a toxm. exotoxin A chain (from Pseudomonas aerugtnosa). ncin A chain, ab ⁇ n A chain, modeccm A cham. alpha-sarcin. Aleurites fordu proteins, dianthin proteins, Phvtolaca amertcana proteins (PAPI, PAPII. and PAP-S), momordica charantia inhibitor, curcm, crot .
  • Conjugates of the antibody and cytotoxic agent are made using a va ⁇ ety of bifunctional protein couplmg agents such as N-succ ⁇ n ⁇ m ⁇ dvl-3-(2-pyndyld ⁇ th ⁇ ol) propionate (SPDP).
  • SPDP N-succ ⁇ n ⁇ m ⁇ dvl-3-(2-pyndyld ⁇ th ⁇ ol) propionate
  • ncin immunotoxin can be prepared as desc ⁇ bed m Vitetta et al Science 238 1098 ( 1987) Carbon- 14- labeled l - ⁇ soth ⁇ ocvanatobenzyI
  • the antibody may be conjugated to a 'receptor" (such streptavidin) for utilization in tissue pretargeting wherein the antibodv-receptor con j ugate is administered to the patient, followed by removal of unbound conjugate from the circulation using a clearing agent and then administration of a "ligand” (e g , avidm) which is conjugated to a cytotoxic agent (e g , a radionucleotide) 8 Immunohposomes
  • Liposomes containing the antibodv are prepared bv methods known m the art. such as described in Epstein et al , Proc Natl Acad Sci USA. _82 3688 ( 1985) Hwang et al Proc Natl Acad Sci USA, 77 4030 ( 1980), and U S Pat Nos 4,485,045 and 4 544 545 Liposomes with enhanced circulation time are disclosed in U S Patent No 5.013.556
  • Particularly useful liposomes can be generated bv the reverse phase evaporation method with a lipid composition comp ⁇ sing phosphatidvlcholme.
  • cholesterol and PEG-de ⁇ vatized phosphatidviethanolamme (PEG-PE) Liposomes are extruded through filters of defined pore size to yield liposomes with the desired diameter Fab' fragments of the antibodv of the present mvention can be conjugated to the liposomes as desc ⁇ bed in Martin et al ,_J Biol Chem 257 286-288 (1982) via a disulfide interchange reaction.
  • a chemotherapeutic agent such as doxorubicin
  • doxorubicin may be optionally contained withm the liposome
  • the active PRO molecules of the invention e g , PRO polypeptides, anti-PRO antibodies, and/or va ⁇ ants of each
  • odier molecules identified by the screenmg assays disclosed above can be administered for the treatment of immune related diseases, m the form of pharmaceutical compositions.
  • Therapeutic formulations of the active PRO molecule are prepared for storage by mixmg the active molecule havmg the desired degree of pu ⁇ ty with optional pharmaceuticallv acceptable earners, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition. Osol. A. Ed. [1980]). in the form ot lyophilized formulations or aqueous solutions. Acceptable car ⁇ ers, excipients.
  • buffers such as phosphate, citrate, and other organic acids, antioxidants mcludmg ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyi ammonium chlo ⁇ de, hexamethonium chlo ⁇ de; benzalkomum chlo ⁇ de, benzethonium chlo ⁇ de, phenol, butyl or benzyl alcohol, alkyl parabens such as methyl or propyl paraben: catechol, resorcmol, cyclohexanol. 3-pentanoi. and m-cresol).
  • buffers such as phosphate, citrate, and other organic acids, antioxidants mcludmg ascorbic acid and methionine
  • preservatives such as octadecyldimethylbenzyi ammonium chlo ⁇ de, hexamethonium chlo ⁇ de;
  • polypeptides such as serum albumin, gelatin, or immunoglobulins: hydrophihc polymers such as polyvinylpyrrohdone, ammo acids such as glycine, glutamine. asparagine, histidine. arginine. or lysine; monosaccha ⁇ des disacchandes. and other carbohydrates mcludmg glucose. mannose. or dext ⁇ ns, chelating agents such as EDTA, sugars such as sucrose, mannitol.
  • hydrophihc polymers such as polyvinylpyrrohdone, ammo acids such as glycine, glutamine. asparagine, histidine. arginine. or lysine
  • monosaccha ⁇ des disacchandes. and other carbohydrates mcludmg glucose. mannose. or dext ⁇ ns
  • chelating agents such as EDTA
  • sugars such as sucrose, mannitol.
  • trehalose or sorbitol trehalose or sorbitol
  • salt-forming counter-ions such as sodium: metal complexes (e g , Zn-protein complexes), and/or non-ionic surfactants such as TWEENTM, PLURONICSTM or polyethylene glycol (PEG)
  • Lipofections or liposomes can also be used to deliver the PRO molecule into cells Where antibody fragments are used, the smallest inhibitor/ fragment which specifically binds to the binding domain of the target protein is preferred
  • peptide molecules can be designed which retain the ability to bmd the target protein sequence
  • Such peptides can be synthesized chemically and/or produced by recombinant DNA technology (see, e g . Marasco et al . Proc. Natl. Acad. Sci USA 90, 7889-7893 [1993])
  • the formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other Alternatively, or in addition, the composition may comp ⁇ se a cytotoxic agent, cvtokme or growth inhibitory agent Such molecules are suitably present in combination in amounts that are effective for the purpose intended
  • the active PRO molecules mav also be entrapped in microcapsules prepared, for example, by coacervation techniques or bv intertacial polyme ⁇ zation. for example, hydroxymethvlcellulose or gelatm- microcapsules and poly-(methvlmethacylate) microcapsules. respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres. microemulsions. nano-particles and nanocapsules) or macroemulsions.
  • colloidal drug delivery systems for example, liposomes, albumin microspheres. microemulsions. nano-particles and nanocapsules
  • Such techniques are disclosed in Remington's Pharmaceutical Sciences 16th edition. Osol, A. Ed. (1980).
  • the formulations to be used for in vivo administration must be ste ⁇ le. This is readily accomplished by filtration through ste ⁇ le filtration membranes.
  • Sustamed-release preparations or the PRO molecules may be prepared.
  • Suitable examples of sustamed-release preparations include semipermeable matrices of solid hydrophobic polymers containmg the antibody, which matnces are m the form of shaped articles, e g , films, or microcapsules.
  • sustained-release matrices include polyesters, hydrogels (for example, p ⁇ ly(2-hydroxyethyl-methacrylate), or poly(v ⁇ nylalcohol)), polylactides (U.S. Pat. No.
  • copolymers of L-glutamic acid and ⁇ -ethyl-L- glutamate non-degradable ethylene-vmyl acetate
  • degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOTTM (in ectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate)
  • poly-D-(-)-3-hvdroxyburv ⁇ c acid While polymers such as ethylene-vmvl acetate and lactic acid- glycohc acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter tune pe ⁇ ods
  • encapsulated antibodies remain m the bodv for a long time, they mav denature or aggregate as a result of exposure to moisture at 37°C, resulting in a loss of biological activity and possible changes in immunogenicity Rational strategies can be devised for stabilization depending on the mechanism involved.
  • stabilization may be achieved bv modifying sulfhydryl residues, lyophi zing from acidic solutions, controlling moisture content, using approp ⁇ ate additives, and developmg specific polymer matnx compositions N Methods of Treatment
  • polypeptides, antibodies and other active compounds of the present invention mav be used to treat va ⁇ ous immune related diseases and conditions, such as T cell mediated diseases including those charactenzed by infiltration of inflammatory cells into a tissue, stimulation of T-ceil proliferation inhibition of T-cell proliferation increased or decreased vascular permeability or the inhibition thereof
  • antibodies and other compounds of the invention include, but are not limited to svstemic lupus erythematosis rheumatoid arthntis, juvenile chronic arthntis osteoarth ⁇ tis spondvloarthropathies systemic sclerosis (scleroderma), idiopathic inflammatory myopathies (dermatomyositts, polymyositis), S j ogren s syndrome, systemic vascu tis. sarcoidosis, autoimmune hemolytic anemia (immune pancytopema. paroxysmal nocmmal hemoglobinuna).
  • autoimmune thrombocytopenia idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia.
  • thyroiditis Grave's disease, Hashimoto's thyroiditis. juvenile lymphocytic thyroiditis. atrophic thvroiditis
  • diabetes mellitus idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia.
  • immune-mediated renal disease glomeruio ⁇ eph ⁇ tis, tubulointerstitial nephritis
  • demyehnating diseases of the central and pe ⁇ pheral nervous systems such as multiple sclerosis, idiopathic demyehnating polyneuropathv or Guilla -Barre syndrome, and chronic inflammatory demvehnating polyneuropathv hepatobi arv diseases such as infectious hepatitis (hepatitis A. B, C, D E and other non- hepatotropic v iruses), autoimmune chronic active hepatitis, p ⁇ marv biharv cirrhosis, granulomatous hepatitis.
  • infectious hepatitis hepatitis A. B, C, D E and other non- hepatotropic v iruses
  • autoimmune chronic active hepatitis p ⁇ marv biharv cirrhosis
  • granulomatous hepatitis granul
  • autoimmune or immune-mediated skin diseases including bullous skin diseases, erythema multiforme and contact dermatitis, pso ⁇ asis.
  • allergic diseases such as asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urtica ⁇ a.
  • l mmunologic diseases of the lung such as eosinophi c pneumonias, idiopathic pulmonary fibrosis and hypersensitivity pneumonitis, transplantation associated diseases mcludmg graft rejection and graft -versus-host-disease
  • T lymphocytes In systemic lupus erythematosus. the central mediator of disease is the production of auto-reactive antibodies to self protems/tissues and the subsequent generation of immune-mediated inflammation antibodies either directly or mdirectlv mediate tissue injury Though T lymphocytes have not been shown to be directly involved m tissue damage, T lymphocytes are required for the development of auto-reactive antibodies.
  • Rheumatoid arthntis is a chronic systemic autoimmune inflammatory disease that mamly involves the synovial membrane of multiple joints with resultant injury to the articular cartilage.
  • the pathogenesis is T lymphocyte dependent and is associated with the production of rheumatoid factors, auto- antibodies directed against self IgG. with the resultant formation of immune complexes that attain high levels in joint fluid and blood.
  • the second form of extra-articular disease is the so cailed Felty's syndrome which occurs late in the RA disease course, sometimes after joint disease has become quiescent, and involves the presence of neutropenia. thrombocytopenia and splenomegaly. This can be accompanied by vascuhtis in multiple organs with formations of mfarcts. skin ulcers and gangrene. Patients often also develop rheumatoid nodules in the subcutis tissue overlying affected jomts; the nodules late stage have necrotic centers surrounded bv a mixed inflammatory ceil infiltrate.
  • Other manifestations which can occur in RA include: pe ⁇ carditis. pleu ⁇ tis. coronary a ⁇ e ⁇ tis. intestinal pneumonitis with pulmonary fibrosis. keratoconjunctivitis sicca. and rhematoid nodules.
  • Juvenile chronic arthritis is a chronic idiopathic inflammatory disease which begms often at less than 16 years of age. Its phenotype has ome similanties to RA; some patients which are rhematoid factor positive are classified as juvenile rheumatoid arthritis. The disease is sub-classified into three major categories: pauciarticular. polyarticular. and systemic. The arthritis can be severe and is typically destructive and leads to joint ankylosis and retarded growth Other manifestations can include chronic ante ⁇ or uveitis and systemic amyloidosis.
  • Spondyloanhropathies are a group of disorders with some common clinical features and the common association with the expression of HLA-B27 gene product.
  • the disorders include: ankvlosing sponyhtis.
  • Reiter's syndrome reactive arthntis.
  • arthntis associated with inflammatory bowel disease, spondylitis associated w ith psoriasis, luv cnile onset spondyloarthropathy and undifferentiated spondyloartliropathy.
  • Distinguishing features include sacroileitis with or without spondylitis; inflammatory asymmet ⁇ c arthritis; association with HLA-B27 (a serologically defined allele of the HLA-B locus of class I MHC); ocular inflammation, and absence ot autoantibodies associated with other rheumatoid disease.
  • the cell most implicated as key to mduction of the disease is the CD8+ T lymphocyte, a cell which targets antigen presented by class I MHC molecules.
  • CD8+ T cells may react agamst the class I MHC allele HLA-B27 as if it were a foreign peptide expressed by MHC class 1 molecules.
  • Systemic sclerosis (scleroderma) has an unknown etiology. A hallmark of the disease is induration of the skm: likely this is induced by an active inflammatory process. Scleroderma can be localized or systemic; vascular lesions are common and endothelial cell injury in the microvasculature is an early and important event in the development of systemic sclerosis: the vascular injury may be immune mediated.
  • ICAM- 1 is often upregulated on the cell surface of fibroblasts in skin lesions suggestmg that T cell interaction with these cells may have a role in the pathogenesis of the disease.
  • Other organs involved include, the gastrointestinal tract: smooth muscle atrophy and fibrosis resultmg m abnormal pe ⁇ stalsis/moti ty, kidney concenmc subendothe al intimal proliferation affecting small arcuate and lnteriobular arte ⁇ es with resultant reduced renal cortical blood flow, results in protemuna. azotemia and hypertension, skeletal muscle, atrophy, interstitial fibrosis. inflammation; lung, interstitial pneumomtis and interstitial fibrosis. and heart contraction band necrosis, scamng/ fibrosis
  • Idiopathic inflammatory myopathies mcludmg dermatomvositis, polymyositis and others are disorders of chronic muscle inflammation of unknown etiology resulting m muscle weakness. Muscle injury/ inflammation is often symmetric and progressive Autoantibodies are associated with most forms These myositis-specific autoantibodies are directed agamst and inhibit the function of components, proteins and RNA's. involved m protein synthesis
  • Sjogren's syndrome is due to immune-mediated inflammation and subsequent functional destruction of the tear glands and salivary glands
  • the disease can be associated with or accompanied bv inflammatory connective tissue diseases
  • the disease is associated with autoantibody production agamst Ro and La antigens. both ot w hich are small RNA-protein complexes Lesions result in kcratoconiunctivitis sicca. xerostomia, with other manifestations or associations including bilary cirrhosis, peripheral or sensory neuropathy, and palpable purpura
  • Systemic vascuhtis are diseases in which the p ⁇ marv lesion is inflammation and subsequent damage to blood vessels which results in ischemia/necrosis/degeneration to tissues supplied by the affected vessels and evenmal end-organ dysfunction in some cases
  • Vasculitides can also occur as a secondary lesion or sequelae to other immune- inflammatory mediated diseases such as rheumatoid arthntis, systemic sclerosis, etc .
  • diseases also associated with the formation of immune complexes Diseases in the p ⁇ marv systemic vascuhtis group include systemic necrotizing vascuhtis polyarte ⁇ tis nodosa. allergic angntis and granulomatosis. poiyangutis.
  • v asculitides include mucocutancous Ivmph node syndrome (MLNS or Kawasaki's disease), isolated CNS vascuhtis. Behet's disease, thromboangiitis obhterans (Buergers disease) and cutaneous necrotizing venuhtis The pathogenic mechanism of most ot the types of v ascuhtis listed is believed to be pnma ⁇ lv due to the deposition of immunoglobulin complexes in the vessel wall and subsequent induction of an inflammatory response either via ADCC.
  • Sarcoidosis is a condition of unknown etiology which is charactenzed by the presence of eptthehoid granulomas in nearly any tissue in the body, involvement of the lung is most common.
  • the pathogenesis involves the persistence of activated macrophages and lymphoid cells at sites of the disease with subsequent chronic sequelae resultant trom the release of locally and systemically active products released by these cell types Autoimmune hemolytic anemia including autoimmune hemolytic anemia, immune pancytopema.
  • paroxysmal noctural hemoglobmu ⁇ a is a result of production of antibodies that react with antigens expressed on the surface of red blood cells (and m some cases other blood cells mcludmg platelets as well) and is a reflection of the removal of those antibody coated cells via complement mediated lysis and or ADCC Fc- receptor-mediated mechanisms.
  • complement mediated lysis and or ADCC Fc- receptor-mediated mechanisms In autoimmune thrombocytopenia including thrombocytopenic purpura. and immune-mediated thrombocytopenia m other clinical settings, platelet destruction/removal occurs as a result of either antibody or complement attaching to platelets and subsequent removal by complement lysis, ADCC or FC-receptor mediated mechanisms.
  • Thyroiditis mcludmg Grave's disease. Hashimoto's thyroiditis.
  • juvenile lymphocytic thyroiditis and atrophic thyroiditis, are the result of an autoimmune response against thyroid antigens with production of antibodies that react with proteins present in and often specific for the thyroid gland.
  • Type I diabetes melhtus or insulin-dependent diabetes is the autoimmune destruction of pancreatic islet ⁇ cells, this destruction is mediated by auto-antibodies and auto-reactive T cells. Antibodies to insulin or the insulin receptor can also produce the phenotype of insulin-non-responsiveness.
  • Immune mediated renal diseases including glomeruloneph ⁇ tis and tubulointerstitial neph ⁇ tis. are the result of antibody or T lymphocyte mediated injury to renal tissue either directly as a result of the production of autoreac e antibodies or T cells against renal antigens or indirectly as a result of the deposition of antibodies and/or immune complexes in the kidney that are reactive against other, non-renal antigens.
  • immune-mediated diseases that result in the formation of immune-complexes can also mduce immune mediated renal disease as an indirect sequelae
  • Both direct and indirect immune mechanisms result in inflammatory response that produces/induces lesion development in renal tissues with resultant organ function impairment and in some cases progression to renal failure. Both humoral and cellular immune mechanisms can be involved in the pathogenesis of lesions.
  • Demyehnating diseases of the central and pe ⁇ pheral nervous systems mcluding Multiple Sclerosis; idiopathic demyehnating polyneuropathy or Guillain-Barre syndrome: and Chronic Inflammatory Demyehnating Polyneuropathy, are believed to have an autoimmune basis and result m nerve demyehnation as a result of damage caused to oligodendrocytes or to myehn directly In MS there is evidence to suggest that disease induction and progression is dependent on T lymphocvtes.
  • Multiple Sclerosis is a demyehnating disease that is T lymphocyte-dependent and has either a relapsing-remitting course or a chronic progressive course
  • the etiology is unknown: however, viral infections, genetic predisposition, environment, and autoimmuniry all cont ⁇ bute.
  • Lesions contain infiltrates of predominantly T lymphocyte mediated, microg al cells and mfiltratmg macrophages; CD4+T lymphocytes are the predominant cell type at lesions.
  • the mechanism of o godendrocyte cell death and subsequent demyehnation is not known but is likely T lymphocyte driven.
  • Inflammatory and Fibrotic Lung Disease including Eosinophi c Pneumonias; Idiopathic Pulmonary Fibrosis, and Hypersensitivity Pneumomtis may mvolve a deregulated immune-inflammatory response. Inhibition of that response would be of therapeutic benefit.
  • Pso ⁇ asis is a T lymphocyte-mediated inflammatory disease. Lesions contain infiltrates of T lymphocytes, macrophages and antigen processing cells, and some neutrophils. Allergic diseases, including asthma: allergic rhinitis: atopic dermatitis: food hypersensitivity; and urtica ⁇ a are T lymphocyte dependent. These diseases are predominantly mediated by T lymphocyte induced inflammation. IgE mediated-inflammation or a combmation of both.
  • Transplantation associated diseases mcludmg Graft rejection and Graft-Versus-Host-Disease (GVHD) are T lymphocyte-dependent; inhibition of T lymphocyte function is ameliorative.
  • infectious disease including but not limited to viral infection (mcludmg but not limited to AIDS, hepatitis A, B. C, D, E and he ⁇ es) bacte ⁇ al infection, fungal infections, and protozoal and parasitic fections (molecules (or de ⁇ vatives/agomsts) which stimulate the MLR can be utilized therapeutically to enhance the immune response to infectious agents), diseases of immunodeficiency (molecules/de ⁇ vatives/agomsts) which stimulate the MLR can be utilized therapeutically to enhance the immune response for conditions of inhented. acquired, infectious induced (as in HIV infection), or latrogenic (i e , as from chemotherapy) immunodeficiency), and neoplasm.
  • viral infection mcludmg but not limited to HIV, hepatitis A, B. C, D, E and he ⁇ es
  • bacte ⁇ al infection bacte ⁇ al infection
  • fungal infections and protozoal and parasitic
  • Molecules that inhibit the lymphocyte response in the MLR also function in vivo du ⁇ ng neoplasm to suppress the immune response to a neoplasm; such molecules can either be expressed by the neoplastic cells themselves or their expression can be induced by the neoplasm in other cells. Antagonism of such inhibitory molecules (either with antibody, small molecule antagonists or other means) enhances immune-mediated tumor rejection.
  • inhibition of molecules with proinflammatory properties may have therapeutic benefit in reperfusion injury: stroke; mvocardiai infarction, atherosclerosis, acute lung injury, hemorrhagic shock, bum: sepsis/septic shock, acute tubular necrosis: endomet ⁇ osis. degenerative joint disease and pancreatis
  • the compounds of the present invention are admmistered to a mammal, preferably a human, in accord with known methods, such as intravenous administration as a bolus or by cont uous infusion over a penod of time, by mtramuscular, intrape ⁇ toneal. lntracerobrospinal, subcutaneous, intra-articular. mtrasynovial. intrathecal. oral, topical, or mhalation (intranasal. intrapulmonary) routes. Intravenous or inhaled administration of polypeptides and antibodies is preferred.
  • immunoadjuvant therapy other therapeutic regimens, such administration of an anti-cancer agent, may be combmed with the administration of the proteins, antibodies or compounds of the instant invention.
  • the patient to be treated with a the immunoadjuvant of the mvention may also receive an anti- cancer agent (chemotherapeutic agent) or radiation therapy.
  • chemotherapeutic agent chemotherapeutic agent
  • Preparation and dosmg schedules for such chemotherapeutic agents may be used according to manufacturers' instructions or as determmed empincally by the skilled practitioner. Preparation and dosmg schedules for such chemotherapy are also desc ⁇ bed in Chemotherapy Service Ed., M.C. Perry, Williams & Wilkins, Baltimore, MD (1992).
  • the chemotherapeutic agent may precede, or follow administration of the immunoadjuvant or may be given simultaneously therewith. Additionally, an anti-oestrogen compound such as tamoxifen or an anti-progesterone such as onap ⁇ stone (see, EP 616812) may be given dosages known tor such molecules
  • admmister antibodies agamst other immune disease associated or tumor associated antigens, such as antibodies which bind to CD20, CD1 la. CD 18. ErbB2. EGFR, ErbB3. ErbB4, or vascular endothelial factor (VEGF)
  • VEGF vascular endothelial factor
  • t wo or more antibodies binding the same or two or more different antigens disclosed herein may be coadmmistered to the patient
  • the PRO polypeptides are coadmmistered with a growth inhibitory agent
  • t he growth inhibitory agent may be administered first , followed by a PRO polypeptide
  • simultaneous administration or administration first is also contemplated Suitable dosages for the growth inhibitory agent are those presently used and may be lowered due to the combined action (synergy) of the growth inhibitory agent and the PRO polypeptide
  • the approp ⁇ ate dosage of an a compound of the mvention will depend on the type of disease to be treated, as defined above, the seventy and course of t he disease , whether the agent is administered for preventive or therapeutic purposes, previous therapy the patient's clinical history and response to the compound, and the discretion of the at t ending physician
  • the compound is suitabl y admmistered to the patient at one time or over a series of treatments
  • polypeptide or antibodv is an initial candidate dosage tor administration to the patient whether, for example , bv one or more separate administrations or by continuous infusion
  • a typical dailv dosage might range from about 1 ⁇ g/kg to 100 mg/kg or more, depending on the factors mentioned above
  • the treatment is sustained until a desired suppression of disease s y mptoms occurs
  • other dosage regimens mav be useful
  • the progress of this therapv is easil y monitored bv conventional techniques and assays O Articles of Manufacture
  • the article of manufacture comp ⁇ ses a container and an instruction Suitable containers include, for example. bottles vials sv ⁇ nges and test tubes
  • the containers mav be formed from a va ⁇ e t y of ma t enals such as glass or plastic
  • the container holds a composition which is effective for diagnosmg or treating the condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceabie by a hypodermic injection needle)
  • the active agen t m the composition is usually a polypeptide or an antibody of the invention An instruction or label on.
  • the container indicates that the composition is used for diagnosing or treating the condition of choice
  • the article of manufacture may further compnse a second container comp ⁇ sing a pharmaceutically-acceptable buffer, such as phosphate-buffered saline. Ringer's solution and dextrose solution It may further mclude other matenals desirable from a commercial and user standpoint including other buffers, diluents, filters, needles, synnges, and package inserts with instructions for use p - Diagnosis and Prognosis of Immune Related Disease
  • Cell surface protems such as proteins which are overexpressed m certain immune related diseases, are excellent targets for drug candidates or disease treatment
  • the same protems along with secreted protems encoded bv the genes amplified in immune related disease states find additional use m the diagnosis and prognosis of these diseases.
  • antibodies directed agamst the protem products of genes amplified in multiple sclerosis, rheumatoid arthntis, or another immune related disease can be used as diagnostics or prognostics.
  • antibodies can be used to qualitatively or quantitatively detect the expression of proteins encoded by amplified or overexpressed genes ("marker gene products").
  • the antibody preferably is equipped with a detectable, e.g., fluorescent label, and binding can be monitored by light microscopy, flow cytometry, fluo ⁇ metry, or other techniques known in the art. These techniques are particularly suitable, if the overexpressed gene encodes a cell surface protem Such binding assays are performed essentially as described above. In situ detection of antibody binding to the marker gene products can be performed, for example, by immunofluorescence or lmmunoelectron microscopy.
  • a histological specimen is removed from the patient, and a labeled antibody is applied to it. preferably by overlaying the antibody on a biological sample.
  • This procedure also allows for determining the dist ⁇ bution of the marker gene product in the tissue examined. It will be apparent for those skilled in the art that a wide va ⁇ ety of histological methods are readily available for m situ detection.
  • EXAMPLE 1 Isolation of cDNA clones Encoding Human PRO200, PRO204, PR0212, PR0216. PR0226, PRO240, PR0235. PR0245, PR0172, PR0273, PR0272, PR0332, PR0526, PRO701 , PR0361. PR0362, PR0363, PR0364. PR0356, PR0531, PR0533, PRO1083, PR0865, PRO770, PR0769, PR0788, PROl 114, PRO1007, PROl 184. PRO1031, PR01346, PROl 155, PRO1250, PR01312, PROl 192, PR01246. PR01283, PROl 195, PR01343.
  • PR0381. PRO720, PRO866, PRO840, PR0982, PR0836, PROl 159, PR01358, PR01325, PR01338. PR01434.
  • PR04333. PRO4302. PRO4430 and PR05727 polypeptide.
  • the extracellular domain (ECD) sequences (including the secretion signal sequence, if any) from about 950 known secreted proteins from the Swiss-Prot public database were used to search EST databases.
  • the EST databases included public EST databases (e.g , GenBank), a pnvate EST database (LIFESEQ Incyte Pharmaceuticals. Palo Alto, CA), and proprietary ESTs from Genentech.
  • the search was performed using the computer program BLAST or BL ⁇ ST2 [Altschul et al . Methods m 266- 460-480 ( 1996)] as a companson of the ECD protein sequences to a 6 frame translation of the EST sequences.
  • RNA for construction of the cDNA libranes was isolated from va ⁇ ous human tissue libranes. including, e.g.. fetal lung, fetal liver, fetal brain, small intestine, smooth muscle cells, etc.
  • the cDNA libranes used to isolated the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA.
  • the cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized approp ⁇ ately by gel electrophoresis, and cloned in a defined o ⁇ entation into a suitable cloning vector (such as pRKB; pR 5B is a precursor of pRK5D that does not contain the Sfil site; see. Holmes et al. Science. 253: 1278-1280 (1991)) in the unique Xhol and Notl sites.
  • a suitable cloning vector such as pRKB; pR 5B is a precursor of pRK5D that does not contain the Sfil site; see. Holmes et al. Science. 253: 1278-1280 (1991)
  • the clones were sequenced using known and readily available methodology.
  • Amylase yeast screen is a Amylase yeast screen:
  • oligo dT primed cDNA library mRNA was isolated from vanous tissues (e.g., such as those indicated above under the ECD homology procedure) using reagents and protocols from Invitrogen, San Diego, CA (Fast Track 2). This RNA was used to generate an oligo dT primed cDNA library in the vector pRK5D using reagents and protocols from Life Technologies, Gaithersburg, MD (Super Sc ⁇ pt Plasmid System). In this procedure, the double stranded cDNA was sized to greater than 1000 bp and the Sall/Notl hnkered cDNA was cloned into Xhol/Notl cleaved vector.
  • pRK5D is a cloning vector that has an sp6 transcnption initiation site followed by an Sfil rest ⁇ ction enzyme site preceding the Xhol Notl cDNA clonmg sites.
  • pSST-AMY.O is a cloning vector that has a yeast alcohol dehydrogenase promoter preceding the cDNA clonmg sites and the mouse amylase sequence (the mature sequence without the secretion signal ) followed by the yeast alcohol dehydrogenase terminator, after the cloning sites.
  • cDNAs cloned into this vector that are fused in frame with amylase sequence will lead to the secretion of amylase from appropriately transfected yeast colonies.
  • Transformation and Detection DNA from the library desc ⁇ bed in paragraph 2 above was chilled on ice to which was added electrocompetent DH10B bacte ⁇ a (Life Technologies, 20 ml). The bactena and vector mixmre was then electroporated as recommended by the manufacturer. Subsequently, SOC media (Life Technologies. 1 ml) was added and the mixmre was incubated at 37°C for 30 minutes. The transformants were then plated onto 20 standard 150 mm LB plates containing ampicillin and mcubated for 16 hours (37°C). Positive colonies were scraped off the plates and the DNA was isolated from the bacte ⁇ al pellet using standard protocols, e g , Cisco- gradient. The purified DNA was then earned on to the yeas t pro t ocols below.
  • the yeast methods were divided into three catego ⁇ es: ( 1 ) Transformation of yeast with the plasmid cDNA combined vector; (2) Detection and isolation of yeast clones secretmg amylase; and (3) PCR amplification of the insert directiy from the yeast colony and punfication of the DNA for sequencing and further analysis.
  • yeast strain used was HD56-5A (ATCC-90785). This strain has the following genotype: MAT alpha, ura3-52, leu2-3, leu2-1 12, his3-l l, his3-15, MAL ⁇ SUC". GAl ⁇
  • yeast mutants can be employed that have deficient post-translational pathways. Such mutants may have translocation deficient alleles in seel I, secll. sec62. with truncated ⁇ ?C71 being most preferred.
  • antagonists including antisense nucleotides and or ligands which interfere with the normal operation of these genes, other proteins implicated m this post translation pathway (e.g., SEC ⁇ lp, SEC72p, SEC62p, SEC63p, TDJlp or SSAlp-4p) or the complex formation of these proteins may also be preferably employed in combination with the amylase- expressing yeast.
  • Transformation took place by mixing the prepared cells (100 ⁇ l) with freshly denatured single stranded salmon testes DNA (Lofstrand Labs. Gaithersburg, MD) and transforming DNA (I ⁇ g, vol. ⁇ 10 ⁇ l) in microfiige tubes The mixmre was mixed b ⁇ efly by vortexing, then 40% PEG/TE (600 ⁇ l, 40% polyethylene glycol-4000, 10 M T ⁇ s-HCI, 1 mM EDTA, 100 mM L ⁇ 2Ac, pH 7.5) was added.
  • PEG/TE 600 ⁇ l, 40% polyethylene glycol-4000, 10 M T ⁇ s-HCI, 1 mM EDTA, 100 mM L ⁇ 2Ac, pH 7.5
  • the transformation was performed using a single, large scale reaction, wherein reagent amounts were scaled up accordingly.
  • the selective media used was a synthetic complete dextrose agar lackmg uracii (SCD-Ura) prepared as desc ⁇ bed in Kaiser et al , Methods in Yeast Genetics, Cold Sp ⁇ ng Harbor Press. Cold Sp ⁇ ng Harbor, NY, p. 208-210 ( 1994) Transformants were grown at 30°C for 2-3 days.
  • SCD-Ura synthetic complete dextrose agar lackmg uracii
  • the detection of colonies secreting amylase was performed by mcludmg red starch in the selective growth media.
  • Starch was coupled to the red dye (Reactive Red- 120, Sigma) as per the procedure descnbed by Biely et al. Anal Biochem . _72 176- 179 ( 1988)
  • the coupled starch was inco ⁇ orated into the SCD-Ura agar plates at a final concentration of 0 15% (w/v). and was buffered with potassium phosphate to a pH of 7 0 (50- 100 mM final concentration)
  • the positive colonies were picked and streaked across fresh selective media (onto 150 mm plates) in order to obtain well isolated and identifiable single colonies.
  • Well isolated single colonies positive for amylase secretion were detected by direct inco ⁇ oration of red starch into buffered SCD-Ura agar. Positive colonies were determmed by their ability to break down starch resulting m a clear halo around the positive colony visualized directly.
  • the yeast EST fragment identified above was used to search va ⁇ ous expressed sequence tag (EST ) databases.
  • the EST databases included public EST databases (e g., GenBank, Merck/Wash U) and a prop ⁇ etary EST DNA database (LIFESEQ W , Incyte Pharmaceuticals, Palo Alto, CA).
  • the search was performed usmg the computer program BLAST or BLAST2 (Altshul et al. Methods in Enzvmology 266:460-480 (1996)) as a compa ⁇ son of the ECD protem sequences to a 6 frame translation of the EST sequence.
  • a consensus DNA sequence was assembled relative to other EST sequences using phrap.
  • the consensus DNA sequence was extended using repeated cycles of BLAST and phrap to extend the consensus sequence as far as possible using the sources of EST sequences discussed above as well as EST sequences propnetary to Genentech. Based on this consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone encoding the particular PRO polypeptide.
  • DNA from the libranes was screened by PCR amplification, as per Ausubel et al, Current Protocols in Molecular Biology, with the PCR p ⁇ mer pair. A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs
  • RNA for construction of the cDNA libranes was isolated from vanous human tissues.
  • the cDNA libranes used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen. San Diego, CA
  • the cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl. sized appropriately by gel electrophoresis. and cloned in a defined onentation into a suitable cloning vector (such as pRKB or pRKD.
  • pRK5B is a precursor of pRK5D that does not contain the Sfil site; Holmes et al.. Science, 253: 1278-1280 (1991)) in the unique Xhol and Notl sites.
  • ESTs Expressed Sequence Tags
  • the signal sequence algo ⁇ thm computes a secretion signal score based on the character of the DNA nucleotides surrounding the first and optionally the second methionine codon(s) (ATG) at the 5'-end of the sequence or sequence fragment under consideration.
  • the nucleotides following the first ATG must code for at least 35 unambiguous amino acids without any stop codons. If the first ATG has the required ammo acids, the second is not examined. If neither meets the requirement, the candidate sequence is not scored.
  • the DNA and corresponding ammo acid sequences surrounding the ATG codon are scored using a set of seven sensors (evaluation parameters) known to be associated with secretion signals.
  • EST sequences which were compared to a va ⁇ ety of expressed sequence tag (EST) databases which mcluded public EST databases (e.g., GenBank) and a prop ⁇ etary EST DNA database (LIFESEQ R , Incyte Pharmaceuticals, Palo Alto, CA).
  • EST expressed sequence tag
  • LIFSEQ R prop ⁇ etary EST DNA database
  • the homology search was performed using the computer program BLAST or BLAST2 (Altshul et al, Methods in Enzymology 266:460-480 (1996)).
  • Probes based on an expressed sequence tag (EST) identified from the Incyte Pharmaceuticals database due to homology with VEGF were used to screen a cDNA library de ⁇ ved from the human glioma cell line G61. Screening may be conducted in a manner similar to the procedure disclosed elsewhere in this application. In particular, Incyte Clone "INC 1302516" was used to generate the following four probes-
  • ORF open reading frame
  • CMV-based expression vector An epitope-tag (FLAG, Kodak) and Histidine-tag (His8) were inserted between the ORF and stop codon.
  • UNQ174-H ⁇ s8 and UNQ174-FLAG were transfected into human embryonic kidney 293 cells by SuperFect (Qiagen) and pulse-labeled for 3 hours with [ 35 S]meth ⁇ on ⁇ ne and [ 35 C]cyste ⁇ ne.
  • the UNQ174-IgG plasmid was co-transtected with Baculogold Baculovirus DNA (Pharmmgen) using Lipofectin (GibcoBRL) into 10 5 Sf9 cells grown in Hmk's TNM-FH medium (JRH Biosciences) supplemented with 10% fetal bovine serum Cells were incubated for 5 days at 28°C.
  • the supernatant was harvested and subsequently used for the first viral amplification by infecting Sf9 cells at an approximate multiplicity of mfection (MOI) of 10 Cells were incubated for 3 days, then supernatant harvested, and expression of the recombinant plasmid determmed by binding of 1 ml of supernatant to 30 ⁇ l of Protem-A Sepharose CL-4B beads (Pharmacia) followed by subsequent SDS-PAGE analysis
  • the first amplification supernatant was used to mfect a 500 ml spinner culmre of Sf9 cells grown in ESF-921 medium (Expression Systems LLC) at an approximate MOI ot 0 1 Cells were treated as above, except harvested supernatant was sterile filtered Specific protein was pu ⁇ fied bv binding to Protein-A Sepharose 4 Tast Flow (Pharmacia) column
  • Figure 4 A cDNA containing DNA encoding UNQ 178 (SEQ ID NO 12) has been deposited with the ATTC on October 16 1997 and has been assigned deposit number 209380
  • PCR pnmers forward and reverse
  • probes used in the procedure were the following forward p ⁇ mer 3 CACGCTGGTTTCTGCTTGGAG-3' (SEQ ID NO 15) reverse pnmer 5 AGCTGGTGC ⁇ CAGGGTGTCATG-3' (SEQ ID NO 16) hybridization probe (SEQ ID NO 17)
  • DNA33087 contams a single open reading frame with an apparent translation initiation site nucleotide residues 268-270 and ending at the stop codon (TAG) are residues 1531-1533 (Fig. 7, SEQ ID NO: 18), as indicated by bolded underline.
  • the predicted PR0215 polypeptide precursor i.e , UNQ 190, SEQ ID NO: 19
  • UNQ 190 SEQ ID NO: 19
  • a cDNA clone containing DNA33087 (identified as DNA33087-1 158) has been deposited with the ⁇ mencan Type Culture Collection (ATCC) on September 16, 1997 and has been assigned ATCC Dep. No 209381
  • DNA33460 contains a single open reading frame with an apparent translation initiation site at nucleotide residues 62-64 and ending at the stop codon (TGA) at residues 1391-1393 (Fig. 9. SEQ ID NO 20), as indicated by bolded underline.
  • the predicted PR0226 polypeptide precursor i e , UNQ200.
  • SEQ ID NO 21 is 443 ammo acids long, has a calculated molecular weight of 49.391 daltons, a pi of 4 82 and is shown m Figure 10 as UNQ200 (SEQ ID NO.21)
  • a cDNA clones containing DNA33460 (SEQ ID NO:20), designated as DNA33460-1166. has been deposited with the ATCC on October 16, 1997 and has been assigned ATCC deposit number 209376
  • oligonucleotide sequences used m the above procedure were the following: 28722-p (OLI488) (SEQ ID NO: 22)
  • DNA34387 contains a single open reading frame with an apparent translation initiation site at nucleotide positions 12-14 and ending at the stop codon (TGA) at nucleotide positions 699-701 (Fig 11, SEQ ID NO 25), as indicated by bolded underline
  • the predicted PRO240 polypeptide precursor i e , UNQ214. SEQ ID NO 26
  • SEQ ID NO 26 is 229 ammo acids long, has a calculated molecular weight of 24 689 daltons. a pi of 7 83 and is shown in Figure 12
  • a cDNA clone containing DNA34387 (SEQ ID NO 25) has been deposited with ATCC on September 16, 1997 and is assigned ATCC deposit no 209260
  • PCR pnmers forward and reverse
  • hybndization probe synthesized for use in the above- desc ⁇ bed procedure were the following forward PCR p ⁇ mer 5'-TCAGCTCCAGACTCTGATACTGCC-3' (SEQ ID NO 27) reverse PCR primer 5'-TGCCTTTCTAGGAGGC ⁇ GAGCTCC-3* (SEQ ID NO 28) hybndization probe (SEQ ID NO 29)
  • DNA35558 clone shown in Figure 13 contains a single open reading frame with an apparent translation initiation site at nucleotide positions 667-669 and ending at the stop codon (TGA) at nucieotide positions 2323-
  • a cDNA clone containing DNA35558 has been deposited with ATCC on October 16, 1997 and is assigned ATCC deposit no 209374
  • the PCR pnmers (forward and reverse) and hybndization probe synthesized for use in the above procedure were forward PCR primer 5'-TGGAATACCGCCTCCTGCAG-3' (SEQ ID NO 32) reverse PCR p ⁇ mer 5'-CTTCTGCCCTTTGGAGAAGATGGC-3' (SEQ ID NO 33) hybndization probe 5'-GGACTCACTGGCCCAGGCCTTCAATATCACCAGCCAGGACGAT-3' (SEQ ID NO 34) H.
  • PCR pnmers forward and reverse
  • hybndization probes synthesized for use with the above- desc ⁇ bed method were the following: forward PCR p ⁇ mer 5'-ATCGTTGTGAAGTTAGTGCCCC-3' (SEQ ID NO:37) reverse PCR pnmer 5 , -ACCTGCGATATCCAACAGAATTG-3' (SEQ ID NO:38) hybndization probe (SEQ ID NO:39) 5'-GGAAGAGGATACAGTCACTCTGGAAGTATTAGTGGCTCCAGCAGTTCC-3'
  • DNA35638- 1 141 The entire nucleotide sequence of DNA35638 (SEQ ID N0 35) is shown in Figure 15.
  • Clone DNA35638 contains a single open reading frame with an apparent translation mitiation site at nucleotide positions 89-91 and endmg at the stop codon (TAG) at nucleotide positions 1025-1027 (Fig. 15; SEQ ID NO-35)
  • the predicted PR0245 polypeptide precursor i e , UNQ219, SEQ ID NO.36
  • a clone containing DNA35638 (SEQ ID NO 35). designated as DNA35638- 1 141 has been deposited with ATCC on September 16. 1997 and is assigned ATCC deposit no 209265.
  • UNQ 146. SEQ ID NO 41 is 723 amino acids long, has a calculated molecular weight of 78.055 daltons and a pi of 6 17 (Fig. 18).
  • a cDNA clone containing DNA35916 (SEQ ID NO 40) has been deposited with ATCC on October 28, 1997 (designated as DNA35916-1 161) and has been assigned ATCC deposit no. 209419.
  • the oligonucleotide sequences used in the above procedure were the following: 28765.p (OLI633)
  • PR0272 encoding DNA sequences were the following forward PCR p ⁇ mer ( fl) 5'-CGCAGGCCCTCATGGCCAGG-3' (SEQ ID NO 52) forward PCR p ⁇ mer ( f2) 5'-GAAATCCTGGGTAATTGG-3' (SEQ ID NO 53) reverse PCR p ⁇ mer 5'-GTGCGCGGTGCTCACAGCTCATC-3' (SEQ ID NO 54) hyb ⁇ dization probe
  • Clone DNA40620 (SEQ ID NO 50) contams a single open readmg frame with an apparent translation initiation site at nucleotide positions 35-37 and endmg at the stop codon (TGA) at nucleotide positions 1020-
  • the ent i re nucleotide sequence of DNA40982 (SEQ ID NO:56) is shown in Figure 23.
  • Clone DNA40982 (SEQ ID NO:56) contains a single open reading frame with an apparent translation initiation site at nucleotide pos i t i ons 342-344 and ending at the stop codon (TAG) at nucleotide posi t ions 2268-2270, as ind i cated i n Figure 23 by bolded underline.
  • the predicted PR0332 polypeptide precursor i.e. , UNQ293 , SEQ ID NO:57, Fig.
  • a cDNA clone con t a i nmg DNA40982 (SEQ ID NO:56) (designated as DNA40982-1235) has been deposited w i th ATCC on November 7, 1997 and is assigned ATCC deposit no. 209433.
  • PCR pnmers forward and reverse
  • hybridization probes synthesized were t he following: forward PCR p ⁇ mer: 5'-TGGCTGCCCTGCAGTACCTCTACC-3' (SEQ ID NO:63) reverse PCR p ⁇ mer: 5'-CCCTGCAGGTCATTGGCAGCTAGG-3' (SEQ ID NO:64) hybridization probe: (SEQ - D NQ . 65)
  • Clone DNA44184 (SEQ ID NO:61 ) contains a single open reading frame wi t h an apparen t t ransla t ion init i at i on sue at nucleo t .de positions 514-516 and ending at the stop codon (TGA) a t nucleotide positions 1933- 1935 (F i gure 61 ), as i ndicated by bolded underline.
  • the predicted PR0526 polypep t ide precursor i.e . UNQ330, SEQ ID N0.62
  • i s 473 ammo acids long ( Figure 62).
  • the UNQ330 (SEQ ID NO.62) pro t ein shown i n F i gure 62 has an es ti mated molecular weight of about 50708 daltons and a pi of about 9.28.
  • a cDNA clone conta i nmg DNA44184 has been deposited with the ATCC on 26 March 1998 (under the designa t ion DNA44184- 1319) and is assigned deposit number 209704.
  • Analys i s of UNQ330 (SEQ ID NO:62) reveals that the signal pep t ide sequence is at about ammo acids 1-26.
  • a leucine z i pper pa t tern is at about ammo acids 135-156.
  • a glycosammoglycan attachment is at about amino ac i ds 436-439.
  • N- lycosylation sites are at about ammo acids 82-85, 179-182, 237-240 and 423-426.
  • a von Willebrand factor (VWF) type C domain(s) is found at about ammo acids 411-425. The skilled artisan can understand which nucleotides correspond to these ammo acids based on the sequences provided herein.
  • Clone DNA44205 (SEQ ID NO:66) contains a single open reading frame (with an apparent translation initiation site at nucleotide positions 50-52 and ending at the stop codon (TAG) at nucleotide positions 2498- 3000, as indicated by bolded underline in Figure 27
  • the predicted PRO701 polypeptide precursor i.e , Fig. 28, UNQ365, SEQ ID N0 67
  • a cDNA clone contaming DNA44205 (SEQ ID NO-66) (designated as DNA44205-1285) has been deposited with ATCC on March 31 , 1998 and is assigned ATCC deposit no 209720.
  • UNQ365 (SEQ ID NO 67) contains a potential signal peptide cleavage site at about amino acid position 25 There are potential N-glycosylation sites at about ammo acid positions 83, 511, 716 and 803.
  • the carboxylesterases type-B signature 2 sequence is at about residues 125 to 135 Regions homologous with carboxylesterase type-B are also at about residues 54-74 197-212 and 221 -261
  • a potential transmembrane region corresponds approximately to amino acids 671 through about 700
  • the corresponding nucleic acids can be routinely determmed from the sequences provided herem.
  • regions mdicattve of the arginase family protems are present at about residues F3 to V14 and again at 139 to T57, while a transmembrane domam exists at about residues P380 to S409.
  • a cDNA clone contaming DNA45410 (SEQ ID NO 71) has been deposited with ATCC on February 5. 1998 and is assigned ATCC deposit no 209621
  • the PCR pnmers (forward and reverse) and hybndization probe synthesized for use m the above procedure were- forward PCR p ⁇ mer 1 - S'-TATCCCTCCAATTGAGCACCCTGG-S' (SEQ ID NO 81 ) forward PCR p ⁇ mer 2 S'-GTCGGAAGACATCCCAACAAG-S' (SEQ ID NO 82) reverse PCR p ⁇ mer I 5'-CTTCACAATGTCGCTGTGCTGCTC-3' (SEQ ID NO 83) reverse PCR p ⁇ mer 2 5'-AGCCAAATCCAGCAGCTGGCTTAC-3' (SEQ ID NO 84) hyb ⁇ dization probe
  • Clone DNA45416 (SEQ ID NO 79) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 1 19- 121 and ending at the stop codon (TAA) at nucleotide positions 1082-
  • UNQ317, SEQ ID NO 80) is 321 amino acids long ( Figure 32)
  • the UNQ317 protem (SEQ ID NO 80) shown in Figure 32 has an estimated molecular weight of about 35,544 daltons and a pl of about 8 51 Analysis of the
  • UNQ317 polypeptide as shown in Figure 32 evidences the presence of a glycosaminoglycan attachment site at about amino acid 149 to about amino acid 152 and a transmembrane domam from about ammo acid 276 to about amino acid 306
  • a cDNA clone containing DNA45416 (SEQ ID NO 79) has been deposited with ATCC on February 5, 1998 and is assigned ATCC deposit no 209620
  • PCR pnmers forward and reverse
  • hybndization probe synthesized for use in the above procedure were: forward PCR p ⁇ mer-
  • the UNQ318 protem (SEQ ID NO:87) shown in Figure 34 has an estimated molecular weight of about 41,281 daltons and a pi of about 8.33. Analysis of the UNQ318 polypeptide as shown in Figure 34 evidences the presence of a transmembrane domain at about ammo acid residue 221 to about residue 254.
  • a cDNA clone contammg DNA45419 (SEQ ID NO:86) has been deposited with ATCC on February 5, 1998 and is assigned ATCC deposit no. 209616.
  • EST expressed sequence tag
  • PCR pnmers forward and reverse
  • hybndization probes synthesized for use in the above- desc ⁇ bed screening procedure were: forward PCR p ⁇ mer (44825.fl). 5'-CACAGCACGGGGCGATGGG-3' (SEQ ID NO:93) forward PCR p ⁇ mer (44825.Q): 5'-GCTCTGCGTTCTGCTCTG-3' (SEQ ID NO:94) forward PCR p ⁇ mer (44825.GITR.Q:
  • Clone DNA47365 (SEQ ID NO:91 ) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 121-123 and ending at the stop codon (TGA) at nucleotide positions 844-
  • the predicted PR0364 polypeptide precursor i.e., UNQ319, SEQ ID NO:92
  • the UNQ319 (SEQ ID NO:92) protem shown in Figure 36 has an estimated molecular weight of about 26.000 daltons and a pi of about 6.34.
  • a potential N- glycosylation sites exists between amino acids 146 and 149 of the amino acid sequence shown in Figure 36.
  • a putative signal sequence is from amino acids 1 to 25 and a potential transmembrane domain exists between amino acids 162 to 180 of the sequence shown in Figure 36.
  • a cDNA clone containing DNA47365 (designated DNA47365-1206) has been deposited with ATCC on November 7, 1997 and is assigned ATCC Deposit No. ATCC 209436.
  • Oligo dT pruned cDNA libranes were prepared from uterus mRNA purchased from Clontech, Inc. (Palo Alto. CA, USA, catalog # 6537-1) in the vector pRK5D using reagents and protocols from Life Technologies, Gaithersburg, MD (Super Script Plasmid System)
  • pRK5D is a cloning vector that has an sp6 transcnption initiation site followed by an Sfil rest ⁇ ction enzyme site preceding the Xhol/Notl cDNA cloning sites
  • the cDNA was pnmed with oligo dT contammg a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized to greater than 1000 bp approp ⁇ ately by gel electrophoresis.
  • DNA sequencing of the clones isolated as desc ⁇ bed above gave a full-length DNA sequence encoding the native sequence PR0356 (NL4) (i e , DNA47470, SEQ ID NO 101 ) and the de ⁇ ved PR0356 protem sequence UNQ313 (SEQ ID NO 102)
  • PCR pnmers forward and reverse
  • hybridization probe synthesized were: forward PCR p ⁇ mer: 5'-CTGAGAACGCGCCTGAAACTGTG-3' (SEQ ID NO: 108) reverse PCR p ⁇ mer: 5VAGCGTTGTCATTGACATCGGCG-3' (SEQ ID NO.109) hyb ⁇ dization probe (SEQ ID NO 1 10)
  • Clone DNA48314 contains a smgle open readmg frame with an apparent translat i on i n i tiation site at nucleotide positions 171-173 and endmg at the stop codon (TGA) at nucleotide pos i t i ons 2565-2567 ( Figure 39), as mdicated by bolded underime
  • the predicted PR0531 polypeptide precursor i e , UNQ332, SEQ ID NO 107) is 789 ammo acids long
  • the UNQ332 protem shown i n F i gure 39 has an estimated molecular weight of about 87552 daltons and a pi of about 4 84
  • a clone contammg DNA48314 (SEQ ID NO 106) has been deposited with the ATCC on 26 March 1998, and has been assigned deposit number 209702
  • Analys i s of the UNQ332 ammo acid sequence of SEQ ID NO 107 reveals a cadhenn extracellular repeated domam signature at about amino acids 122-132, 231-241 , 336-346 439-449 and 549-559
  • An ATP/GTP-bmd i ng s i te motif A (P-loop) is found at about amino acids 285-292 of SEQ ID NO 107
  • N- glycosvlat i on s i tes are found at least at about amino acids 567-570, 786-790, 418-421 and 336-339
  • the signal pept i de i s at about amino acids 1 -26 and the transmembrane domain is at about ammo acids 685-712 of SEQ ID NO 107
  • the EST sequence accession number AF007268 The EST sequence accession number AF007268.
  • a mu ⁇ ne fibroblast growth factor (FGF- 15) was used to search va ⁇ ous public EST databases (e g , GenBank, Dayhoff, etc )
  • the search was performed using the computer program BLAST or BLAST2 [Altschul et al Methods in Enzvmology, 266 460-480 ( 1996)] as a compa ⁇ son of the ECD protem sequences to a 6 frame translation of the EST sequences
  • sequence oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that conta i ned the sequence of interest and 2) for use as probes to isolate a clone of the full-length coding sequence
  • a source ot a full-length clone DNA from the libranes was screened bv PCR amplification as per Ausubel et al Current Protocols m Molecular Biology , with the PCR pr i mer pa i r
  • a pos i t i ve library was then used to isolate clones encoding the PR0533 gene of mterest by an in v i vo clonmg procedure using the probe oligonucleotide and one of the PCR pnmers RNA for construction of the cDNA libranes was isolated from human fetal retina
  • Notl s i te l i nked w i th blunt to Sail hemikinased adaptors, cleaved with Notl, sized approp ⁇ ately by gel electrophores i s, and cloned m a defined o ⁇ entation mto a suitable clonmg vector (such as pRKB or pRKD, P RK5B i s a precursor of pRK5D that does not contain the Sfil site, Holmes et al , Science. 253 1278-1280
  • a cDNA clone was sequenced m its entirety The full length nucleotide sequence DNA49435 (SEQ ID NO 1 11) i s shown i n F i gure 41 Clone DNA49435 (SEQ ID NO 1 1 1) contams a smgle open reading frame w i th an apparent translat i on initiation site at nucleotide positions 464-466 and endmg at the stop codon (TAA) at nucleot i de pos i t i ons 649-651. as indicated by bolded underline m Fig 41
  • the predicted PR0533 polypeptide precursor i.e..
  • UNQ334, SEQ ID NO: 112) is 216 ammo acids long, has a calculated molecular weight of 24,003 daltons and a pl of 6.99.
  • Clone DNA49435-1219 has been deposited with ATCC (under the designation DNA49435-1219) on November 21, 1997 and is assigned ATCC deposit no. 209480.
  • oligonucleotide sequences used in the above procedure were the following: FGF15.f: 5'-ATCCGCCCAGATGGCTACAATGTGTA-3' (SEQ ID NO 113)
  • FGF15.p 5'-GCCTCCCGGTCTCCCTGAGCAGTGCCAAACAGCGGCAGTGTA-3' (SEQ ID NO 114)
  • FGF15.r 5'-CCAGTCCGGTGACAAGCCCAAA-3' (SEQ ID NO 115)
  • PCR pnmers forward and reverse
  • hybndization probes synthesized for use in the above procedure were the following: forward pnmer: (43422.fi ): 5'-GGC ATTGGAGC AGTGCTGGGTG-3' (SEQ ID NO: 1 18) forward p ⁇ mer: (43422.C): 5'-AGAGCAACTCAGACAGCG-3' (SEQ ID NO: 1 19) reverse p ⁇ mer: (43422.rl ): 5'-TGGAGGCCTAGATGCGGCTGGACG-3' (SEQ ID NO: 120) reverse p ⁇ mer: (43422.r2): 5'-CGAGGAGACCATCAGCAC-3' (SEQ ID NO: 121) hybridization probe: (43422.pl): (SEQ ID NO: 122)
  • DNA50921 (SEQ ID NO: 116) contams a single open reading frame with an apparent translation initiation sue at nucleotide positions 154-156 and ending at the stop codon (TAG) at nucleotide positions 2233-2235 ( Figure 43). as indicated by bolded underline.
  • the predicted PRO 1083 polypeptide precursor i.e., UNQ540, SEQ ID NO.117, Figure 44
  • the UNQ540 (SEQ ID NO: l 17) protein shown m Figure 44 has an estimated molecular weight of about 77738 and a pi of about 8.87.
  • a clone contammg DNA50921 has been deposited with the ATCC on May 12, 1998 and has been assigned deposit number 209859.
  • DNA sequence DNA53974 (Fig. 45, SEQ ID NO: 123) and the denved PR0865 native sequence protein UNQ434 (SEQ ID NO: 124).
  • DNA53974 (SEQ ID NO: 123) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 173-175 and ending at the stop codon (TAA) at nucleotide positions 1577- 1579 ( Figure 45). as indicated by bolded underline.
  • the predicted PR0865 polypeptide precursor i.e.. UNQ865. SEQ ID NO: 124) is 468 amino acids long.
  • the UNQ434 (SEQ ID NO: 124) protein shown in Figure 46 has an estimated molecular weight of about 54,393 and a pi of about 5.63.
  • a clone containing DNA53974 (SEQ ID NO.123) has been deposited with the ATCC on April 14, 1998 and has been assigned deposit number 209774
  • EST expressed sequence tag
  • the full-length clone corresponding to the EST AA524300 was purchased from Incyte (Incyte Pharmaceuticals, Palo Alto, CA) and sequenced in entirety.
  • FIG. 47 This full-length clone, designated DNA54228 (SEQ ID NO: 133), contains a single open reading frame with an apparent translation initiation site at nucleotide positions 100-102 (Fig.47; SEQ ID NO: 133) and ending at the stop codon (TGA) at residues 433-435, as indicated by bolded underime.
  • the predicted PRO770 polypeptide precursor (including a putative signal sequence of 20 amino acids) (i.e., UNQ408, SEQ ID NO: 134) is 11 1 ammo acids long, has a calculated molecular weight of 1 1,730 daltons and a pl of 7 82.
  • mice Female Balb/C mice, 6 to 8 weeks of age, were separated into two expe ⁇ mental groups: controls and asthmatics.
  • the asthmatic group was immunized intrapentoneally with 10 ⁇ g ovalbumm -i- 1 mg alum, while the control group was not.
  • mice Two weeks later, mice were exposed daily to an aerosol of 10 mg/ml ovalbumm in PBS aerosolized with a UlrraNeb nebulizer (DeVilbiss) at the rate of 2 ml/mm for 30 mm each day.
  • UlrraNeb nebulizer UlrraNeb nebulizer
  • T ⁇ cine gel shows that a low molecular weight protein is expressed in the BAL samples from asthmatic mice but not in the BAL samples from control mice This low molecular weight protein was termed m-FIZZl and was seen to co-migrate with a 8300 Dalton marker protein.
  • Partial protein sequence The protein of interest was transferred upon a PVDF membrane and sequenced by Edman degradation Tins sequence served as a template for the preparation of various cloning ohgos as desc ⁇ bed below.
  • Partial cDNA sequence We designed two degenerate oligonucleotide PCR primers corresponding to the putative DNA sequence for the first 7 and the last 7 ammo acids of the partial protein sequence..
  • This oligo was used as an RT-PCR p ⁇ mer in combination with 5' and 3' amphmers from Clontech. Ohgo #4-
  • This oligo was used as an RT-PCR p ⁇ mer in combination with oligo d(T).
  • DNA 54231 contains a single open reading frame with an apparent translation initiation site at nucleotide positions 75-77 and ending at the stop codon (TGA) at residues 417-419 as indicated by bolded underline (Fig 49)
  • the predicted PR0769 polypeptide precursor (mcludmg a signal sequence ot 10 ammo ac ⁇ ds)(; e , UNQ407, SEQ ID NO 140) is 1 14 amino acids long, has a calculated molecular weight of 12,492 daltons and a pi of 8 19 Based on its homology to m-FIZZl (34%, using the ALIGN software) the protein was designated m-FIZZ3
  • a clone containing DNA54231 (designated DNA54231-1366) has been deposited with ATCC on Ap ⁇ l 23. 1998 and has been assigned ATCC
  • Clone DNA56405 (SEQ ID NO 141 ) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 84-86 and ending at the stop codon (TAG) at nucleotide positions 459-461 ( Figure 51 ) as indicated by bolded underline
  • the predicted native sequence PR0788 polypeptide precursor (; c UNQ430 SEQ ID NO 142) is 125 ammo acids long ( Figure 52).
  • PCR pnmers used in the isolation screen descnbed m the previous paragraph were: forward pnmer: (48466.fl): 5'-AGGCTTCGCTGCGACTAGACCTC-3' (SEQ ID NO: 145) reverse p ⁇ mer: (48466.rl): 5'-CCAGGTCGGGTAAGGATGGTTGAG-T (SEQ ID NO: 146) hybndization probe- 48466 pl )

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Diabetes (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biomedical Technology (AREA)
  • Toxicology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Pulmonology (AREA)
  • Endocrinology (AREA)
  • Microbiology (AREA)
  • Rheumatology (AREA)
  • Hematology (AREA)
  • Cell Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Otolaryngology (AREA)
  • Obesity (AREA)
  • Dermatology (AREA)

Abstract

The present invention relates to a composition containing novel proteins and methods for the diagnosis and treatment of immune related diseases.

Description

COMPOSITIONS AND METHODS FOR THE TREATMENT OF IMMUNE RELATED DISEASES
Field of the Invention The present invention relates to compositions and methods for the diagnosis and treatment of immune related diseases.
Background of the Invention Immune reiated and inflammatory diseases are the manifestation or consequence of fairiy complex, often multiple interconnected biological pathways which in normal physiology are cπtical to respond to insult or injury, initiate repair from insult or injury, and mount innate and acquired defense against foreign organisms. Disease or pathology occurs when these normal physiological pathways cause additional insult or injury either as directly related to the intensity of the response, as a consequence of abnormal regulation or excessive stimulation, as a reaction to self, or as a combination of these. Though the genesis of these diseases often involves multistep pathways and often multiple different biological svstems/pathways. intervention at cπtical points in one or more of these pathways can have an ameliorative or therapeutic effect. Therapeutic intervention can occur by either antagonism of a detπmental process/pathway or stimulation of a beneficial process/pathway.
Many immune reiated diseases are known and have been extensively studied. Such diseases include immune-mediated inflammatory diseases, non-immune-mediated inflammatory diseases, infectious diseases, immunodeficiency diseases, neoplasia, etc.
T lymphocytes (T cells) are an important component of a mammalian immune response. T cells recognize antigens which are associated with a self-molecule encoded by genes within the major histocompatibility complex (MHC). The antigen may be displayed together with MHC molecules on the surface of antigen presenting cells, virus infected cells, cancer ceils, grafts, etc. The T cell system elimmates these altered cells which pose a health threat to the host mammal. T cells include helper T cells and cytotoxic T cells. Helper T cells proliferate extensively following recognition of an antigen -MHC complex on an antigen presenting cell. Helper T cells also secrete a variety of cytokines. i.e., lymphokines, which play a central role in the activation of B cells, cytotoxic T cells and a variety of other cells which participate in the immune response.
A central event in both humoral and cell mediated immune responses is the activation and clonal expansion of helper T cells. Helper T cell activation is initiated by the interaction of the T cell receptor (TCR) - CD3 complex with an antigen-MHC on the surface of an antigen presenting cell. This interaction mediates a cascade of biochemical events that induce the resting helper T cell to enter a cell cycle (the GO to Gl transition) and results in the expression of a high affinity receptor for IL-2 and sometimes IL-4. The activated T cell progresses through the cycie proliferating and differentiating into memory cells or effector cells.
In addition to the signals mediated through the TCR, activation of T cells involves additional cosπmulation induced by cytokines released by the antigen presenting cell or through interactions with membrane bound molecules on the antigen presenting cell and the T cell. The cytokines IL-1 and IL-6 have been shown to provide a costimuiatory signal. Also, the interaction between the B7 molecule expressed on the surface ot an antigen presenting cell and CD28 and CTLA-4 molecules expressed on the T cell surface ettect 1 cell activation Activated T cells express an increased number ot cellular adhesion molecules, such as ICAM- 1 , integrins, VLA-4, LFA- 1 , CD56, etc
T-cell proliferation in a mixed Kmphocvte culture or mixed lymphocyte reaction (MLR) is an established indication of the ability of a compound to stimulate the immune system In many immune responses inflammatory cells infiltrate the site ot mjurv or infection The migrating cells mav be neutrophihc, eosinophihc monocytic or lymphocvtic as can be determined bv histologic examination of the affected tissues
Current Protocols in Immunology, ed John E Coligan, 1994 John Wilev & Sons, Inc
Immune related diseases can be treated bv suppressing the immune response Using neutralizing antibodies that inhibit molecules having immune stimulatory activity would be beneficial in the treatment of immune-mediated and inflammatory diseases Molecules which inhibit the immune response can be utilized
(proteins directly or \ ιa the use of antibody agonists) to inhibit the immune response and thus ameliorate immune reiated disease
Summary of the Inv ention
The present inv ention concerns compositions and methods tor the diagnosis and treatment ot immune related disease in mammals including humans The present invention is based on the identification of proteins (includinc agonist and antagonist antibodies) which either stimulate or inhibit the immune response in mammals Immune related diseases can be treated by suppressing or enhancing the immune response Molecules that enhance the immune response stimulate or potentiate the immune response to an antigen Molecules w hich stimulate the immune response can be used therapeutically where enhancement of the immune response would be beneficial Such stimulatory molecules can also be inhibited where suppression of the immune response would be of value
Neutralizing antibodies are examples of molecules that inhibit molecules having immune stimulatory activity and which would be beneficial in the treatment ot immune related and inflammatory diseases Molecules which inhibit the immune response can also be utilized (proteins directly or via the use ot antibody agonists I to inhibit the immune response and thus ameliorate immune related disease
Accordingly, the PRO polypeptides and anti-PRO antibodies and fragments thereof are useful foi the diagnosis and/or treatment (including prevention) of immune related diseases Antibodies which bind to stimulatory proteins are useful to suppress the immune system and the immune response Antibodies which bind to inhibitory proteins are useful to stimulate the immune system and the immune response The PRO polypeptides and anti-PRO antibodies also useful to prepare medicines and medicaments for the treatment of immune related and inflammatory diseases
In one embodiment, the mvention provides for isolated nucleic acid molecules compπsing nucleotide sequences that encodes a PRO polypeptide
In one aspect, the isolated nucleic acid molecule compπses a nucleotide sequence having at least about 80% nucleic acid sequence identity, alternatively at least about 81% nucleic acid identity, alternatively at least about 82% nucleic acid sequence identity, alternatively at least about 83% nucleic acid sequence identity, alternatively at least about 84% nucleic acid sequence identity, alternatively at least about 85% nucleic acid sequence identity, alternatively at least about 86% nucleic acid sequence identity, alternatively at least about 87% nucleic acid sequence identity, alternatively at least about 88% nucleic acid sequence identity, alternatively at least about 89% nucleic acid sequence identity, alternatively at least about 90% nucleic acid sequence identity, alternatively at least about 91% nucleic acid sequence identity, alternatively at least about 92% nucleic acid sequence identity, alternatively at least about 93% nucleic acid sequence identity, alternatively at least about 94% nucleic acid sequence identity, alternatively at least about 95% nucleic acid sequence identity, alternatively at least about 96% nucleic acid sequence identity, alternatively at least about 97% nucleic acid sequence identity, alternatively at least about 98% nucleic acid sequence identity and alternatively at least about 99% nucleic acid sequence identity to (a) a DNA molecule encoding a PRO polypeptide having a full-length amino acid sequence as disclosed herein, an ammo acid sequence lacking the signal peptide as disclosed herein, an extracellular domam of a transmembrane protein, with or without the signal peptide. as disclosed herein or any other specifically defined fragment of the full-length amino acid sequence as disclosed herein, or (b) the complement ot the DNA molecule of (a).
In other aspects, the isolated nucleic acid molecule compπses a nucleotide sequence having at least about 80% nucleic acid sequence identity, alternatively at least about 81% nucleic acid sequence identity. alternatively at least about 82% nucleic acid sequence identity, alternatively at least about 83% nucleic acid sequence identity, alternatively at least about 84% nucleic acid sequence identity, alternatively at least about 85% nucleic acid sequence identity, alternatively at least about 86% nucleic acid sequence identity, alternatively at least about 87% nucleic acid sequence identity, alternatively at least about 88% nucleic acid sequence identity, alternatively at least about 89% nucleic acid sequence identity, alternatively at least about 90% nucleic acid sequence identity, alternatively at least about 91% nucleic acid sequence identity, alternatively at least about 92% nucleic acid sequence identity, alternatively at least about 93% nucleic acid sequence identity, alternatively at least about 94% nucleic acid sequence identity, alternatively at least about 95% nucleic acid sequence identity, alternatively at least about 96% nucleic acid sequence identity, alternatively at least about 97% nucleic acid sequence identity, alternatively at least about 98% nucleic acid sequence identity, alternatively at least about 99% nucleic acid sequence identity to (a) a DNA molecule compπsing the coding sequence of a full-length PRO polypeptide cDNA as disclosed herein, the coding sequence ot a PRO polypeptide lacking the signal peptide as disclosed herein, the coding sequence ot an extracellular domam of a transmembrane PRO polypeptide. with or without the signal peptide. as disclosed herein or the coding sequence of any other specifically defined fragment of the full-length amino acid sequence as disclosed herein, or (b) the complement of the DNA molecule of (a).
In a further aspect, the invention concerns an isolated nucleic acid molecule compπsmg a nucleotide sequence having at least about 80% nucleic acid sequence identity, alternatively at least about 81% nucleic acid sequence identity, alternatively at least about 82% nucleic acid sequence identity, alternatively at least about 83% nucleic acid sequence identity, alternatively at least about 84% nucleic acid sequence identity, alternatively at least about 85% nucleic acid sequence identity, alternatively at least about 86% nucleic acid sequence identity, alternatively at least about 87% nucleic acid sequence identity, alternatively at least about 88% nucleic acid sequence identity, alternatively at least about 89% nucleic acid sequence identity, alternatively at least about 90% nucleic acid sequence identity, alternatively at least about 91% nucleic acid sequence identity, alternatively at least about 92% nucleic acid sequence identity, alternatively at least about 93% nucleic acid sequence identity, alternatively at least about 94% nucleic acid sequence identity, alternatively at least about 95% nucleic acid sequence identity, alternatively at least about 96% nucleic acid sequence identity, alternatively at least about 97% nucleic acid sequence identity, alternatively at least about 98% nucleic acid sequence identity, alternatively at least about 99% nucleic acid sequence identity to (a) a DNA molecule that encodes the same mature polypeptide encoded by any of the human protein cDNAs deposited with the ATCC as disclosed herein, or (b) the complement of the DNA molecule of (a).
In another aspect, the invention provides for isolated nucleic acid molecule compπsmg a nucleotide sequence encodmg a PRO polypeptide with is either transmembrane domain-deleted or transmembrane domam-inactivated. or is complementary to such encoding nucleotide sequence, wherem the transmembrane domaιn(s) of such polypeptides are disclosed herein. Therefore, soluble extracellular domains of the herein descπbed PRO polypeptides are contemplated.
Another embodiment is directed to fragments of a PRO polypeptide coding sequence, or the complement thereof, that may find use as. for example, hybπdization probes, for encoding fragments of a PRO polypeptide that may optionally encode a polypeptide compπsing a binding site for an anti-PRO polypeptide antibody or as antisense oligonucleotide probes Such nucleic acid fragments are usually at least about 20 nucleotides in length, alternatively at least about 30 nucleotides in length, alternatively at least about 40 nucleotides m length, alternatively at least about 50 nucleotides in length, alternatively at least about 60 nucleotides in length, alternatively at least about 70 nucleotides in length, alternatively at least about 80 nucleotides in length, alternatively at least about 90 nucleotides in length, alternatively at least about 100 nucleotides in length, alternatively at least about 1 10 nucleotides in length, alternatively at least about 120 nucleotides in length, alternatively at least about 130 nucleotides in length, alternatively at least about 140 nucleotides in length, alternatively at least about 150 nucleotides in length, alternatively at least about 160 nucleotides in length, alternatively at least about 170 nucleotides in length, alternatively at least about 180 nucleotides in length, alternatively at least about 190 nucleotides in length, alternatively at least about 200 nucleotides in length, alternatively at least about 250 nucleotides in length, alternatively at least about 300 nucleotides in length, alternatively at least about 350 nucleotides in length, alternatively at least about 400 nucleotides in length, alternatively at least about 450 nucleotides in length, alternatively at least about 500 nucleotides in length, alternatively at least about 600 nucleotides in length, alternatively at least about 700 nucleotides in length, alternatively at least about 800 nucleotides in length, alternatively at least about 900 nucleotides in length, alternatively at least about 1000 nucleotides in length, alternatively at least about 1500 nucleotide in length, alternatively at least about 2000 nucleotides in length, alternatively at least about 2500 nucleotide in length, alternatively at least about 3000 nucleotide in length, alternatively at least about 4000 nucleotide in length, alternatively at least about 5000 nucleotides in length, or more, wherein in this context the term "about" means the referenced nucleotide sequence length plus or minus 10% of that referenced length. It is noted that novel fragments of a nucieotide sequence encoding the respective PRO polypeptide may be determmed in a routine manner by alignmg the respective nucleotide encoding a PRO polypeptide with other known nucieotide sequences using any of a number of well known sequence alignment programs and determining which nucleotide sequence fragment(s) are novel. All such nucleotide sequences encoding the respective PRO polypeptides are contemplated herem. Also contemplated are the nucleotide molecules which encode fragments of the PRO polypeptides. preferably those polypeptide fragments that compπse a binding site for an anti-PRO polypeptide antibody. In another embodiment, the invention provides isolated PRO polypeptides encoded by any of the isolated nucleic acid sequences heremabove identified.
In a certain aspect, the invention concerns an isolated PRO polypeptide. compπsing an amino acid sequence having at least about 80% ammo acid sequence identity, alternatively at least about 81% ammo acid sequence identity, alternatively at least about 82% ammo acid sequence identity, alternatively at least about 83% ammo acid sequence identity, alternatively at least about 84% amino acid sequence identity, alternatively at least about 85% amino acid sequence identity, alternatively at least about 86% ammo acid sequence identity, alternatively at least about 87% ammo acid sequence identity, alternatively at least about 88% amino acid sequence identity, alternatively at least about 89% ammo acid sequence identity, alternatively at least about 90% ammo acid sequence identity, alternatively at least about 91% am o acid sequence identity, alternatively at least about 92% ammo acid sequence identity, alternatively at least about 93% ammo acid sequence identity, alternatively at least about 94% ammo acid sequence identity, alternatively at least about 95% ammo acid sequence identity, alternatively at least about 96% ammo acid sequence identity, alternatively at least about 97% amino acid sequence identity, alternatively at least about 98% amino acid sequence identity, alternatively at least about 99% amino acid sequence identity to a PRO polypeptide having a full-length amino acid sequence as disclosed herein, an amino acid sequence lacking the signal peptide as disclosed herein, an extracellular domain of a transmembrane protein, with or without the signal peptide. as disclosed herein or any other specifically defined fragment of the full-length amino acid sequence as disclosed herem.
In a fuπher aspect, the invention concerns an isolated PRO polypeptide compπsing an amino acid sequence having at least about 80% amino acid sequence identity, alternatively at least about 81% ammo acid sequence identity, alternatively at least about 82% ammo acid sequence identity, alternatively at least about
83%o am o acid sequence identity, alternatively at least about 84% amino acid sequence identity, alternatively at least about 85% amino acid sequence identity, alternatively at least about 86% ammo acid sequence identity, alternatively at least about 87% ammo acid sequence identity, alternatively at least about 88% ammo acid sequence identity, alternatively at least about 89% amino acid sequence identity, alternatively at least about
90% amino acid sequence identity, alternatively at least about 91% amino acid sequence identity, alternatively at least about 92% ammo acid sequence identity, alternatively at least about 93% ammo acid sequence identity, alternatively at least about 94% amino acid sequence identity, alternatively at least about 95% amino acid sequence identity, alternatively at least about 96% ammo acid sequence identity, alternatively at least about 97% amino acid sequence identity, alternatively at least about 98% ammo acid sequence identity, alternatively at least about 99% ammo acid sequence identity to an ammo acid sequence encoded by any of the human protem cDNAs deposited with the ATCC as disclosed herem.
In a former aspect, the invention concerns an isolated PRO polypeptide compπsing an ammo acid sequence scoπng at least about 80% positives, alternatively at least about 81% positives, alternatively at least about 82% positives, alternatively at least about 83% positives, alternatively at least about 84% positives, alternatively at least about 85% positives, alternatively at least about 86% positives, alternatively at least about 87% positives, alternatively at least about 88% positives, alternatively at least about 89% positives, alternatively at least about 90% positives, alternatively at least about 91% positives, alternatively at least about 92% positives, alternatively at least about 93% positives, alternatively at least about 94% positives, alternatively at least about 95% positives, alternatively at least about 96% positives, alternatively at least about 97% positives, alternatively at least about 98% positives, alternatively at least about 99% positives when compared with the ammo acid sequence of a PRO polypeptide having a full-length ammo acid sequence as disclosed herein, an ammo acid sequence lackmg the signal peptide as disclosed herem, an extracellular domain of a transmembrane protein, with or without the signal peptide. as disclosed herein or any other specifically defined fragment of the full-length ammo acid sequence as disclosed herem.
In a specific aspect, the invention provides an isolated PRO polypeptide without the N-termmal signal sequence and'or the initiating methionine and is encoded by a nucleotide sequence that encodes such an ammo acid sequence as hereinbefore described Processes tor producing the same are also herein descπbed. wherem those processes compπse cultunng a host cell compπsing a v ector which compπses the appropπate encodmg nucleic acid molecule under conditions suitable for expression of the PRO polypeptide and recovermg the same from the cell culture.
In another aspect, the invention provides an isolated PRO polypeptide which is either transmembrane- deleted or transmembrane domam-inactivated Processes for producing the same are also herein descπbed. wherein those processes compπse cultunng a host cell compπsing a vector which compπses the appropπate encodine nucleic acid molecule under conditions suitable lor expression of the PRO polvpeptide and recovering the PRO polypeptide trom the cell culture
In another embodiment, the invention provides vectors compπsing DNA encoding anv of the PRO polypeptides Host cells comprising any such vector are also provided By way of example, the host cells may be CHO cells. E coli or yeast A process tor producing any of the herein described polypeptides is further provided and compπses culmπng host cells under conditions suitable for expression of the desired polypeptides and recoveπng the desired polypeptide from the cell culture.
In other embodiments, the invention provides chimenc molecules comprising any of the herem described polypeptides fused to a heterologous polypeptide or amino acid sequence Examples of such chimenc molecules compπse anv of the herein descπbed polypeptides fused to an epitope tag sequence or a Fc region ot an immunoglobulin
In yet other embodiments, the invention provides oligonucleotide probes useful for isolating genomic and cDNA nucieotide sequences or as antisense probes, wherem those probes may be deπved trom anv of the above or below described nucleotide sequences
In yet another embodiment, the invention concerns agonists and antagonists of the PRO polypeptides. that mimic or inhibit one or more functions or activities of the PRO polypeptides In a particular embodiment, the agonist or antagonist is an antibody that bmds to the PRO polypeptides or a small molecule.
In another embodiment, the invention provides an antibody which specifically binds to any of the above or below descπbed polypeptides Optionally, the antibody is a monoclonal antibody, humanized antibody, antibody fragment or single-chain antibody In one aspect, the present invention concerns an isolated antibody which bmds a PRO polypeptide In another aspect, the antibody mimics the activity of a PRO polypeptide (an agonist antibody) or conversely the antibody inhibits or neutralizes the activity of a PRO polypeptide (an antagonist antibody) In another aspect, the antibody is a monoclonal antibody, which preferably has nonhuman compiementanty determining region (CDR) residues and human framework region (FR) residues. The antibody may be labeled and may be immobilized on a solid support. In a further aspect, the antibody is an antibody fragment, a monoclonal antibody, a smgle-cham antibody, or an anti-idiotypic antibody.
In a further embodiment, the invention concerns a method of identifying agonists or antagonists to a PRO polypeptide which compπses contacting the PRO polypeptide with a candidate molecule and monitoring a biological activity mediated by said PRO polypeptide Preferably, the PRO polypeptide is a native sequence PRO polypeptide.
In another embodiment, the invention concerns a composition ot matter containing PRO polypeptide or an agonist or antagonist antibody which binds the polypeptide in admixture with a earner or excipient. In one aspect, the composition contains a therapeutically effective amount of the peptide or antibody. In another aspect, when the composition contains an immune stimulating molecule, the composition is useful for: (a) increasing infiltration of inflammatory cells into a tissue of a mammal in need thereof, (b) stimulating or enhancing an immune response in a mammal in need thereof, or (c) increasing the proliferation of T- lymphocytes in a mammal in need thereof in response to an antigen. In a further aspect, when the composition contains an immune inhibiting molecule, the composition is useful for: (a) decreasing infiltration of inflammatory cells into a tissue of a mammal in need thereof, (b) inhibiting or reducing an immune response in a mammal m need thereof or ( c) decreasing the proliferation of T-lymphocvtes in a mammal in need thereof in response to an antigen In another aspect, the composition contains a tuπher active ingredient, which may. for example, be a fuπher antioody or a cytotoxic or chemotherapeutic agent Preferably, the composition is steπie.
In another embodiment, the invention concerns the use of the polypeptides and antibodies of the invention to prepare a composition or medicament which has the uses descnbed above.
In a further embodiment, the invention concerns nucleic acid encoding an antι-PRO200, antι-PRO204, antι-PR0212. antι-PR0216. antι-PR0226, antι-PRO240, antι-PR0235. antι-PR0245. antι-PR0172. anti- PR0273. antι-PR0272, antι-PR0332, antι-PR0526, antι-PRO701. antι-PR0361. antι-PR0362. antι-PR0363, antι-PR0364. antι-PR0356. antι-PR053 1. antι-PR0533. antι-PRO 1083. antι-PR0865. antι-PRO770. anti- PR0769. antι-PR0788. anti-PRO l 1 14, antι-PRO 1007, antι-PR01 184. antι-PRO1031. antι-PRO I 346, anti- PR01 155. antι-PRO 1250. antι-PR013 12. anti-PRO l 192. antι-PR01246. antι-PR012S3. anti-PRO l 195. anti- PRO I 343. antι-PR01418. antι-PR01387. antι-PRO 1410. antι-PR01917. antι-PR01868, antι-PRO205. anti- PR021. antι-PR0269. antι-PR0344, antι-PR0333, antι-PR0381. antι-PRO720, antι-PR0866, antι-PRO840, antι-PR0982. antι-PR0836. anti-PRO l 159. antι-PR01358, antι-PR01325. antι-PR01338, antι-PR01434, antι-PR04333, antι-PRO4302. antι-PRO4430 or antι-PR05727 antibody, and vectors and recombinant host cells compπsing such nucleic acid. In a still further embodiment, the invention concerns a method for producing such an antibody by culmπng a host cell transformed with nucleic acid encodmg the antibody under conditions such that the antibody is expressed, and recoveπng the antibody from the cell culture.
In a further embodiment, the invention concerns an isolated nucleic acid molecule that hybndizes to the a nucleic acid molecule encodmg a PRO polypeptide. or the complement thereof. The nucleic acid preferably is DNA. and hybπdization preferably occurs under stπngent conditions. Such nucleic acid molecules can act as antisense molecules of the amplified genes identified herem, which, in turn, can find use in the modulation of the respective amplified genes, or as antisense pπmers in amplification reactions. Furthermore, such sequences can be used as part of πbozyme and/or triple helix sequence which, in turn, may be used in regulation of the amplified genes. In another embodiment, the invention concerns a method for determining the presence of a PRO polypeptide compπsmg exposmg a cell suspected of contammg and or expressing the polypeptide to an anti- PRO200, antι-PRO204, antι-PR0212. antι-PR0216. antι-PR0226. antι-PRO240. antι-PR0235, antι-PR0245. antι-PR0172, antι-PR0273. antι-PR0272. antι-PR0332. antι-PR0526. antι-PRO701. antι-PR0361, anti- PR0362, antι-PR0363, antι-PR0364. antι-PR0356. antι-PR0531 , antι-PR0533, antι-PRO1083. antι-PR0865, antι-PRO770, antι-PR0769, antι-PR0788. anti-PROl 1 14. antι-PRO1007, anti-PROl 184. antι-PRO1031. anti- PR01346, anti-PRO l 155. antι-PRO 1250. antι-PR01312, anti-PRO l 192. antι-PR01246, antι-PR01283, anti- PRO l 195, antι-PR01343. antι-PR01418. antι-PR01387, antι-PRO 1410. antι-PR01917, antι-PROI 868. anti- PRO205. antι-PR021. antι-PR0269. antι-PR0344 antι-PR0333. antι-PR0381. antι-PRO720. antι-PR0866, antι-PRO840, antι-PR0982. antι-PR0836. anti-PROl 159. antι-PR01358, antι-PR01325. antι-PR01338. anti- PR01434, antι-PR04333. antι-PRO4302, antι-PRO4430 or antι-PR05727 antibody and determining binding of the antibody to the cell
In yet another embodiment, the present invention concerns a method of diagnosmg an immune related disease in a mammal, compπsing detecting the level of expression of a gene encodinα a PRO polypeptide (a) in a test sample ot tissue cells obtained trom the mammal, and (b) in a control sample ot known normal tissue cells of the same cell type, wherein a higher or lower expression level in the test sample as compared to the control sample indicates the presence ot immune related disease in the mammal trom which the test tissue cells were obtained
In another embodiment, the present invention concerns a method of diagnosing an immune disease in a mammal, compπsing (a) contacting an anti-PRO polypeptide antibody with a test sample of tissue cells obtained from the mammal, and (b) detecting the formation of a complex between the antibody and the respective PRO polypeptide. respectively, in the test sample, wherein the formation of said complex >s indicativ e of the presence or absence of said disease The detection may be qualitative or quantitative, and may be performed in compaπson with monitoring the complex formation in a control sample of known normal tissue ceils of the same cell type A larger quantity of complexes formed in the test sample indicates the presence or absence ot an immune disease in the mammal from which the test tissue cells were obtained The antibody prcterablv cames a detectable label Complex formation can be monitored, for example, by light microscopy, flow cytometrv, fluoπmetry. or other techniques known in the art The test sample is usually obtained from an individual suspected of having a deficiency or abnormality of the immune system In another embodiment, the present invention concerns a diagnostic kit. containing an antι-PRO200. antι-PRO204, antι-PR0212. antι-PR0216, antι-PR0226. antι-PRO240, antι-PR0235, antι-PR0245, anti- PR0172, antι-PR0273, antι-PR0272. antι-PR0332. antι-PR0526, antι-PRO701. antι-PR0361. antι-PR0362, antι-PR0363, antι-PR0364, antι-PR0356. antι-PR0531. antι-PR0533, antι-PRO1083, antι-PR0865, anti- PRO770, antι-PR0769, antι-PR0788, anti-PROl 1 14. anti-PRO 1007, anti-PROl 184, anti-PRO 1031 , anti- PR01346. anti-PROl 155, antι-PRO1250, antι-PR01312. anti-PROl 192, antι-PR01246. antι-PR01283. anti- PROl 195, antι-PR01343, antι-PR01418, antι-PR01387, antι-PRO 1410. antι-PR01917. antι-PR01868, anti- PRO205, antι-PR021, antι-PR0269, antι-PR0344, antι-PR0333, antι-PR0381, antι-PRO720, antι-PR0866, anti-PRO840. antι-PR0982, antι-PR0836, anti-PROl 159, antι-PR01358, antι-PR01325. antι-PR01338, anti- PRO 1434, antι-PR04333, antι-PRO4302, antι-PRO4430 or antι-PR05727 antibody and a earner (e.g., a buffer) in suitable packagmg. The kit preferably contams instructions for usmg the antibody to detect the PRO polypeptide.
In a further embodiment, the invention concerns an article of manufacture, compπsing: a container; an instruction on the container: and a composition compπsing an active agent contained withm the container, wherein the composition is effective for stimulating or inhibiting an immune response in a mammal, the instruction on the container indicates that the composition can be used to treat an immune related disease, and the active agent in the composition is an agent stimulating or inhibiting the expression and/or activity of the PRO polypeptide. In a preferred aspect, the active agent is a PRO200. PRO204. PR0212. PR0216. PR0226. PRO240. PR0235. PR0245. PR0172. PR0273, PR0272, PR0332. PR0526. PRO701 , PR0361. PR0362. PR0363, PR0364, PR0356. PR0531 , PR0533, PRO1083. PR0865. PRO770, PR0769, PR0788. PROI 114. PROI007, PROH 84. PRO1031. PR01346. PR01 155. PRO I250, PR01312, PROI 192, PR01246. PR01283. PR01 195. PR01343, PR01418, PR01387, PRO1410. PR01917, PR01868, PRO205. PR021, PR0269, PR0344. PR0333. PR0381. PRO720. PR0866. PRO840. PR0982. PR0836, PR01 159. PR01358. PR01325. PR01338 PR0 I434. PR04333. PRO4302. PRO4430 or PR05727 polypeptide or an antι-PRO200. anti- PRO204 antι-PR0212. antι-PR0216. antι-PR0226. antι-PRO240. antι-PR0235. antι-PR0245, antι-PR0172. antι-PR0273. antι-PR0272. untι-PR0332. antι-PR0526, antι-PRO701. antι-PR0361. antι-PR0362. anti- PR0363. antι-PR0364. antι-PR0356, antι-PR0531. antι-PR0533, antι-PRO1083. antι-PR0865. antι-PRO770. antι-PR0769. antι-PR0788. anti-PROl 1 14. antι-PRO 1007. anti-PROl 184. antι-PRO1031. antι-PR01346, anti-PROl 155. antι-PRO 1250. antι-PR01312, anti-PROl 192, antι-PR01246. antι-PR01283, anti-PROl 195, antι-PR01343, antι-PR01418, antι-PR01387. antι-PRO1410, antι-PR01917, antι-PR01868, antι-PRO205, antι-PR021. antι-PR0269. antι-PR0344, antι-PR0333. antι-PR0381. antι-PRO720. antι-PR0866, anti- PRO840. antι-PR0982. antι-PR0836, anti-PROl 159, antι-PR01358. antι-PR01325. antι-PR01338. anti- PR01434. antι-PR04333. antι-PRO4302. antι-PRO4430 or antι-PR05727 antibody A further embodiment is a method for identifying a compound capable of inhibiting the expression and or activity ot a PRO polypeptide bv contacting a candidate compound with a PRO polypeptide under conditions and for a time sufficient to allow these two components to interact In a specific aspect, either the candidate compound or the PRO polypeptide is immobilized on a solid support In another aspect, the non- lmmobihzed component carπes a detectable label Another embodiment of the present invention is directed to the use of a PRO polypeptide. or an agonist or antagonist thereof as hereinbefore descπbed, or an anti-PRO antibody, for the preparation of a medicament useful m the treatment of a condition which is responsive to the PRO polypeptide. an agonist or antagonist thereof or an anti-PRO antibody.
Bnef Descπption of the Drawings
Figure 1 shows DNA29101-1276 (SEQ ID NO: l).
Figure 2 shows the native sequence PRO200 polypeptide UNQ174 (SEQ ID NO:2).
Figure 3 shows DNA30871-1157 (SEQ ID NO:l 1)
Figure 4 shows the native sequence partial length PRO204 polypeptide UNQ178 (SEQ ID NO: 12) . Figure 5 shows DNA30942-1134 (SEQ ID NO: 13). Figure 6 shows the native sequence PR0212 polypeptide UNQ 186 (SEQ ID NO 14)
Figure 7 shows DNA33087-1 158 (SEQ ID NO 18)
Figure 8 shows the native sequence PR0216 polypeptide UNQ190 (SEQ ID NO 19)
Figure 9 shows DNA33460-1 166 (SEQ ID NO 20) Figure 10 shows the native sequence PR0226 polypeptide UNQ200 (SEQ ID NO 21)
Figure 1 1 shows DNA34387- 1 138 (SEQ ID NO 25)
Figure 12 shows the native sequence PRO240 polypeptide UNQ214 (SEQ ID NO 26)
Figure 13 shows DNA35558-1 167 (SEQ ID NO 30)
Figure 14 shows the native sequence PR0235 polypeptide UNQ209 (SEQ ID NO 31) Figure 15 shows DNA35638- 1 141 (SEQ ID NO 35)
Figure 16 shows the native sequence PR0245 polypeptide UNQ219 (SEQ ID NO 36)
Figure 17 shows DNA35916- 1 161 (SEQ ID NO 40)
Figure 18 shows the native sequence PRO 172 polypeptide UNQ146 (SEQ ID NO 41 )
Figure 19 shows DNA39523- 1 192 (SEQ ID NO 45) Figure 20 shows the native sequence PR0273 polypeptide UNQ240 (SEQ ID NO 46)
Figure 21 shows DNA40620-1 183 (SEQ ID NO 50)
Figure 22 shows the native sequence PR0272 polypeptide UNQ239 (SEQ ID NO 51 )
Figure 23 shows DNA40982- 1235 (SEQ ID NO 56)
Figure 24 shows the native sequence PR0332 polypeptide UNQ293 (SEQ ID NO 57) Figure 25 shows DNA44184- 1319 (SEQ ID NO 61)
Figure 26 shows the native sequence PR0526 polypeptide UNQ330 (SEQ ID NO 62)
Figure 27 shows DNA44205- I285 (SEQ ID NO 66)
Figure 28 shows the native sequence PRO701 polypeptide UNQ365 (SEQ ID NO 67)
Figure 29 shows DNA45410- 1250 (SEQ ID NO 71) Figure 30 shows the native sequence PR0361 polypeptide UNQ316 (SEQ ID NO 72)
Figure 3 1 shows DN A45416- 1251 (SEQ ID NO 79)
Figure 32 shows the native sequence PR0362 polypeptide UNQ317 (SEQ ID NO 80)
Figure 33 shows DNA45419- 1252 (SEQ ID NO 86)
Figure 34 shows the native sequence PR0363 polypeptide UNQ318 (SEQ ID NO 87) Figure 35 shows DNA47365- 1206 (SEQ ID NO 91)
Figure 36 shows the native sequence PR0364 polypeptide UNQ319 (SEQ ID NO 92).
Figure 37 shows DNA47470-1 130 (SEQ ID NO 101 )
Figure 38 shows the native sequence PR0356 polypeptide UNQ313 (SEQ ID NO 102)
Figure 39 shows DNA48314-1320 (SEQ ID NO 106) Figure 40 shows the native sequence PR0531 polypeptide UNQ332 (SEQ ID NO 107)
Figure 41 shows DNA49435-1219 (SEQ ID NO 111)
Figure 42 shows the native sequence PR0533 polypeptide UNQ334 (SEQ ID NO.112)
Figure 43 shows DNA50921-1458 (SEQ ID NO.l 16)
Figure 44 shows the native sequence PRO1083 polypeptide UNQ540 (SEQ ID NO 117). Figure 45 shows DNA53974-1401 (SEQ ID NO. I23) Figure 46 shows the native sequence PR0865 polypeptide UNQ434 (SEQ ID NO 124)
Figure 47 shows DNA54228- 1366 (SEQ ID NO 133)
Figure 48 shows the native sequence PRO770 polypeptide UNQ408 (SEQ ID NO 134)
Figure 49 shows DNA54231- 1366 (SEQ ID NO 139) Figure 50 shows the native sequence PR0769 polypeptide UNQ407 (SEQ ID NO 140)
Figure 51 shows DNA56405- 1357 (SEQ ID NO 141 )
Figure 52 shows the native sequence PR0788 polypeptide UNQ430 (SEQ ID NO 142)
Figure 53 shows DNA57033- 1403 (SEQ ID NO 143)
Figure 54 shows the native sequence PRO l 1 14 polypeptide UNQ557 (SEQ ID NO 144) Figure 55 shows DNA57690- 1374 (SEQ ID NO 145)
Figure 56 shows the native sequence PRO 1007 polypeptide UNQ491 (SEQ ID NO 146)
Figure 57 shows DNA59220- 1514 (SEQ ID NO 147)
Figure 58 shows the native sequence PRO l 184 polypeptide UNQ598 (SEQ ID NO 148)
Figure 59 shows DNA59294- 1381 (SEQ ID NO 149) Tigure 60 shows the native sequence PRO 1031 polypeptide UNQ516 (SEQ ID NO 150)
Figure 61 shows DNA59776- 1600 (SEQ ID NO 151 )
Figure 62 shows the native sequence PRO 1346 polypeptide UNQ70I (SEQ ID NO 152)
Figure 63 shows DNA59849- 1504 (SEQ ID NO 156)
Figure 64 shows the native sequence PROl 155 polypeptide UNQ585 (SEQ ID NO 157) Figure 65 shows DNA60775- 1532 (SEQ ID NO 158)
Figure 66 shows the native sequence PRO 1250 polypeptide UNQ633 (SEQ ID NO 159)
Figure 67 shows DNA61873- 1574 (SEQ ID NO 160)
Figure 68 shows the native sequence PR01312 polypeptide UNQ678 (SEQ ID NO 161 )
Figure 69 shows DNA62814- 1521 (SEQ ID NO 162) Figure 70 shows the nativ e sequence PROl 192 polypeptide UNQ606 (SEQ ID NO 163)
Figure 71 shows DNA64885- 1529 (SEQ ID NO 167)
Figure 72 shows the nativ e sequence PRO 1246 polypeptide UNQ630 (SEQ ID NO 168)
Figure 73 shows DNA65404- 1551 (SEQ ID NO 169)
Figure 74 shows the native sequence PRO 1283 polypeptide UNQ653 (SEQ ID NO 170) Figure 75 shows DNA65412- 1523 (SEQ ID NO 177)
Figure 76 shows the native sequence PRO l 195 polypeptide UNQ608 (SEQ ID NO 178)
Figure 77 shows DNA66675- 1587 (SEQ ID NO 179)
Figure 78 shows the native sequence PRO 1343 polypeptide UNQ698 (SEQ ID NO 180)
Figure 79 shows DNA68864- 1629 (SEQ ID NO 184) Figure 80 shows the native sequence PR01418 polypeptide UNQ732 (SEQ ID NO 185)
Figure 81 shows DNA68872- 1620 (SEQ ID NO 186)
Figure 82 shows the native sequence PR01387 polypeptide UNQ722 (SEQ ID NO 187)
Figure 83 shows DNA68874-1622 (SEQ ID NO 188)
Figure 84 shows the native sequence PRO1410 polypeptide UNQ728 (SEQ ID NO 189) Figure 85 shows DNA76400-2528 (SEQ ID NO 190) Figure 86 shows the native sequence PR01917 polypeptide UNQ900 (SEQ ID NO 191)
Figure 87 shows DNA77624-2515 (SEQ ID NO 192)
Figure 88 shows the nati e sequence PR01868 polypeptide UNQ859 (SEQ ID NO 193)
Figure 89 shows DNA30868- 1 156 (SEQ ID NO 228)
Figure 90 shows the partial nati e sequence PRO205 polypeptide UNQ 179 (SEQ ID NO 229)
Figure 91 shows DNA36638- 1056 (SEQ ID NO 230)
Figure 92 shows the native sequence PR021 polypeptide UNQ21 (SEQ ID NO 231)
Figure 93 shows DNA38260- 1 180 (SEQ ID NO 232)
Figure 94 shows the nativ e sequence PR0269 polypeptide UNQ236 (SEQ ID NO 233)
Figure 95 shows DNA40592 1242 (SEQ ID NO 240)
Figure 96 shows the native sequence PR0344 polypeptide UNQ303 (SEQ ID NO 241 )
Figure 97 shows DNA41374- 1312 (SEQ ID NO 248)
Figure 98 shows the partial length native sequence PR0333 polypeptide UNQ294 (SEQ ID NO 249)
Figure 99 shows DNA44194- 1317 (SEQ ID NO 250)
Figure 00 shows the nativ e sequence PR0381 polypeptide UNQ322 (SEQ ID NO 25 1 ) Figure 01 shows DNA53517 1366 (SEQ ID NO 255) Figure 02 shows the nativ e sequence PRO720 polypeptide UNQ388 (SEQ ID NO 256) Figure 03 shows DNA53971 1359 (SEQ ID NO 257) Figure 04 shows the native sequence PRO866 polypeptide UNQ435 (SEQ ID NO 258) Figure 05 shows DNA53987-1438 (SEQ ID NO 266) Figure 06 shows the native sequence PRO840 polypeptide UNQ433 (SEQ ID NO 267) Figure 07 shows DNA57700- 1408 (SEQ ID NO 268) Figure 08 shows the nativ e sequence PR0982 polypeptide UNQ483 (SEQ ID NO 269) Figure 09 shows DNA59620- 1463 (SEQ ID NO 270) Figure 0 shows the nativ e sequence PR0836 polypeptide UNQ545 (SEQ IDNO 271 ) Figure 1 shows DNA60627- 1 08 (SEQ ID NO 272) Figure 2 shows the nati e sequence PRO l 159 polypeptide UNQ589 (SEQ ID NO 273) Figure 3 shows DNA64890- 1612 (SEQ ID NO 274) Figure 4 shows the native sequence PRO 1358 polypeptide UNQ707 (SEQ ID NO 275) Figure 5 shows DNA66659- 1593 (SEQ ID NO 276) Figure 6 shows the native sequence PRO 1325 polypeptide UNQ685 (SEQ ID NO 277) Figure 7 shows DNA66667-1596 (SEQ ID NO 278) Figure 8 shows the nativ e sequence PR01338 polypeptide UNQ693 (SEQ ID NO 279) Figure 9 shows DNA68818-2536 (SEQ ID NO 280) Figure 20 shows the native sequence PR01434 polypeptide UNQ739 (SEQ ID NO 281) Figure 21 shows DNA84210-2576 (SEQ ID NO 285) Figure 22 shows the native sequence PR04333 polypeptide UNQ1888 (SEQ ID NO 286) Figure 23 shows DNA92218-2554 (SEQ ID NO 292) Figure 24 shows the native sequence PRO4302 polypeptide UNQ1866 (SEQ ID NO 293) Figure 25 shows DNA96878-2626 (SEQ ID NO 294) Figure 126 shows the native sequence PRO4430 polypeptide UNQ 1947 (SEQ ID NO:295).
Figure 127 shows DNA98853- I739 (SEQ ID NO:296).
Figure 128 shows the native sequence PR05727 polypeptide UNQ2448 (SEQ ID NO:297).
Detailed Descπption of the Preferred Embodiments
I. Definitions
The terms "PRO polypeptιde(s)" and "PRO" as used herem and when immediately followed by a numeπcal designation refer to vaπous polypeptides. wherein the complete designation (i.e.. "PRO/number" or more particularly. PRO200. PRO204. PR0212. PR0216, PR0226. PRO240. PR0235. PR0245. PROl 72, PR0273, PR0272, PR0332. PR0526. PRO701. PR0361. PR0362. PR0363. PR0364, PR0356. PR0531, PR0533. PRO1083, PR0865, PRO770, PR0769, PR0788, PROl 1 14, PRO1007, PR01184, PRO1031, PR01346, PROl 155, PRO1250, PR013 I2. PROl 192, PR01246, PR01283. PROl 195, PR01343. PR01418, PR01387, PRO1410, PR01917, PR01868. PRO205, PR021. PR0269, PR0344. PR0333. PR0381. PRO720, PR0866. PRO840, PR0982, PR0836. PROl 159. PR01358, PR01325. PR01338. PR01434. PR04333, PRO4302. PRO4430 or PR05727) refers to particular polypeptide sequences as described herein. The terms "PRO/numoer polypeptide" and "PRO/number" wherein the term "number" is provided as an actual numeπcai designation (e g . as descπbed above) as used herein encompass native sequence polypeptides and polypeptide variants (which are further defined herein) The PRO polypeptides descπbed herein may be isolated from a vaπety of sources, such as from human tissue types or from another source, or prepared by recombinant or synthetic methods.
A "native sequence PRO polypeptιde(s)" compπses a polypeptide having the same amino acid sequence as the corresponding PRO polypeptide derived from nature. Such native sequence PRO/number polypeptides can be isolated from nature or can be produced by recombinant or synthetic means. The term "native sequence PRO polypeptιde(s)" specifically encompasses naturally-occurring truncated or secreted forms ot the specific PRO/number polypeptide (e g., an extracellular domain sequence), namrally-occumng vaπant forms (e g , alternatively spliced forms) and natural ly-occumng allelic vaπants of the polypeptide. In vaπous embodiments of the invention, the native sequence PRO polypeptides disclosed herein are mature or full-length native sequence polypeptides compπsing the full-length am o acids sequences shown in the accompanying figures. Start and stop codons are shown in bold font and underlmed in the figures. However, while the PRO/number polypeptides disclosed in the accompanying figures are shown to beg with methionine residues designated herein as ammo acid position 1 m the figures, it is conceivable and possible that other methionine residues located either upstream or downstream from the ammo acid position 1 in the figures may be employed as the starting amino acid residue for the PRO polypeptides.
The "PRO polypeptιde(s) extracellular domam" or "ECD" refers to a form of the said polypeptide which is essentially free of the transmembrane and cytoplasmic domams. Ordinaπly, a PRO polypeptide ECD will have less than 1% of such transmembrane and or cytoplasmic domams and preferably, will have less than 0.5% of such domains. It will be understood that any transmembrane domains identified for the PRO polypeptides of the present mvention are identified pursuant to criteria routinely employed in the art for identifying that type of hydrophobic domain. The exact boundaries of a transmembrane domain may vary but most likely by no more than about 5 ammo acids at either end of the domain as initially identified herem. Optionallv therefore an extracellular domain of a PRO polypeptide mav contain from about 5 or fewer ammo acids on either side of the transmembrane domain/extracellular domain boundary as identified in the Examples or specification and such polypeptides with or without the associated signal peptide and nucleic acid encodmg them, are contemplated bv the present invention The approximate location of the 'signal peptides" of the vanous PRO/number PRO polypeptides disclosed herein are shown in the present specification and/or the accompanying figures It is noted, however, that the C-terminal boundary of a signal peptide mav vary but most likely bv no more than about 5 amino acids on either side of the signal peptide C terminal boundary as initially identified herein, wherein the C- termmal boundary of the signal peptide mav be identified pursuant to cπteπa routinelv employed in the art for identifying that type ot amino acid sequence element (e g Nielsen et al Prot Eng K) 1-6 (1997) and von Hemje et al , Nucl Acids Res \4 4683-4690 ( 1986)) Moreover it is also recognized that, in some cases, cleavage of a signal sequence from a secreted polypeptide is not entirelv uniform resulting in more than one secreted species These mature polypeptides where the signal peptide is cleaved within no more than about 5 amino acids on either side of the C-terminal boundary of the signal peptide as identified herein, and the polynucleotides encoding them are contemplated bv the present inv ention
A PRO polypeptide variant "PRO/number variant or PRO vaπant means an active PRO polypeptide as defined herein (e g below) having at least about 80% amino acid sequence identitv ith a full- length nativ e sequence PRO polypeptide sequence as disclosed herein a PRO polypeptide sequence lacking the signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide with or without the signal peptide as disclosed herem or anv other fragment of a full-length PRO polypeptide sequence as disclosed herein Such PRO polypeptide vaπants include for instance, polypeptides wherein one or more amino acid residues are added or deleted, at the N- or C-terminus of the full-length native ammo acid sequence OrdinaπK a PRO polypeptide vaπant will have at least about 80% ammo acid sequence identity alternatively at least about 81 % ammo acid sequence identity alternatively at least about 82% ammo acid sequence identity, alternatively at least about 83% amino acid sequence identity alternativelv at least about 84% amino acid sequence identity alternativelv at least about 85% amino acid sequence identity alternatively at least about 86% amino acid sequence identity alternativ ely at least about 87% amino acid sequence identity alternatively at least about 88% ammo acid sequence identity alternatively at least about 89% ammo acid sequence identity, alternatively at least about 90% ammo acid sequence identity alternatively at least about 91% ammo acid sequence identify, alternatively at least about 92% amino acid sequence identity, alternatively at least about 93% amino acid sequence identity, alternatively at least about 94% ammo acid sequence identity, alternatively at least about 95% ammo acid sequence identity, alternatively at least about 96% ammo acid sequence identity, alternativelv at least about 97% ammo acid sequence identity, alternatively at least about 98% ammo acid sequence identity, alternatively at least about 99% ammo acid sequence identity with a full-length native sequence PRO polypeptide sequence as disclosed herein, a PRO polypeptide sequence lackmg the signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide, with or without the signal peptide, as disclosed herem or any other specifically defined fragment of a full-length PRO polypeptide sequence as disclosed herem Ordinaπly, PRO polypeptide vaπants are at least about 10 ammo acids in length, alternatively at least about 20 ammo acids in length, alternatively at least about 30 ammo acids m length, alternatively at least about 40 amino acids length, alternatively at least about 50 ammo acids m length, alternatively at least about 60 amino acids in length, alternatively at least about 70 ammo acids in length, alternatively at least about 80 amino acids in length, alternatively at least about 90 ammo acids in length, alternatively at least about 100 ammo acids in length, alternatively at least about 150 amino acids in length, alternatively at least about 200 ammo acids in length, alternatively at least about 300 ammo acids m length, alternatively at least about 400 ammo acids on length, alternatively at least about 500 ammo acids length, alternatively at least about 600 ammo acids in length, alternatively at least about 700 ammo acids in length, alternatively at least about 800 ammo acids in length, alternatively at least about 900 ammo acids in length, alternatively at least about 1000 amino acids in length, alternatively at least bout 1200 ammo acids in length, alternatively at least about 1400 amino acids in length, alternatively at least about 1500 ammo acids in length or more.
"Percent (%) ammo acid sequence identity" with respect to the PRO polypeptide sequences identified herein is defined as the percentage of ammo acid residues in a candidate sequence that are identical with the ammo acid residues m the specific PRO/number polypeptide sequence, after aligning the sequences and introducing gaps, if necessarv. to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part ot the sequence identify Alignment tor purposes of determining percent amino acid sequence identify can be achieved in vanous ways that are within the skill in the art. tor instance, using pub clv available computer software sucn as BLAST, BLAST-2. ALIGN or Megahgn (DNASTAR) software Those skilled in the art can determine appropπate parameters for measuπng alignment, including any algoπthms needed to achieve maximal alignment over the full length of the sequences being compared. For purposes herein, however. % amino acid sequence identity values are generated using the sequence comparison computer program ALIGN-2. wherein the complete source code for the ALIGN-2 program is provided in Table 1 below. The ALIGN-2 sequence compaπson computer program was authored by Genentech. Inc and the source code shown in Tables 1 below has been filed with user documentation in the U.S. Copyπght Office. Washington D C, 20559 where it is registered under U S. Copyright Registration No TXU510087 The ALIGN-2 program is pubhclv available through Genentech. Inc . South San Francisco. California or mav be compiled from the source code provided in Table 1 below The ALIGN-2 program should be compiled tor use on a UNIX operating system, preferably digital UNIX V4 0D. All sequence compaπson parameters are set by the ALIGN-2 program and do not vary
In situations where ALIGN-2 is employed for amino acid sequence compaπsons, the % amino acid sequence identity of a given ammo acid sequence A to, with, or against a given ammo acid sequence B (which can alternatively be phrased as a given ammo acid sequence A that has or compπses a certain % ammo acid sequence identity to, with, or against a given amino acid sequence B) is calculated as follows:
100 times the fraction X/Y
where X is the number of amino acid residues scored as identical matches by the sequence alignment program ALIGN-2 in that program's alignment of A and B, and where Y is the total number of ammo acid residues in B. It will be appreciated that where the length of ammo acid sequence A is not equal to the length of ammo acid sequence B, the % ammo acid sequence identity of A to B will not equal the % ammo acid sequence identity of B to A. As examples of % ammo acid sequence identity calculations usmg this method, Tables 2 and 3 demonstrate how to calculate the % amino acid sequence identity ot the amino acid sequence designated "Compaπson Protein to the amino acid sequence designated "PRO", wherein 'PRO" represents the ammo acid sequence of a hypothetical PRO/number polypeptide of interest, Compaπson Protein" represents the ammo acid sequence of a polypeptide against which the PRO" polypeptide of interest is being compared, and 'X, "Y" and "Z" each represent different hypothetical ammo acid residues
Unless specifically stated otherwise all % amino acid sequence identify values used herein are obtained as descπbed in the immediately preceding paragraph using the ALIGN-2 computer program. However, % amino acid sequence identify values may also be obtained as descπbed below by using the WU- BLAST 2 computer program (Altschul et al Methods in 266 460-480 ( 1996)) Most ot the WU- BLAST 2 search parameters are set to the default values Those not set to default values. ; c the adjustable parameters are set with the following values overlap span = 1 overlap fraction = 0 125, word threshold (T) = 1 1 , and scoπng matπx = BLOSUM62 When WU-BLAST-2 is employed, a % ammo acid sequence identity value is determmed bv dividing (a) the number of matchmg identical ammo acid residues between the amino acid sequence ot the PRO polypeptide of interest having a sequence deπved from the native sequence PRO polvpeptide and the compaπson ammo acid sequence ot interest (i e the sequence against which the PRO polypeptide is being compared hich mav oe a PRO polypeptide aπant) as determined bv WU-BLAST-2 by (b) the total number ot amino acid residues ot the PRO polypeptide of interest For example, in the statement 'a polypeptide compπsing an amino acid sequence A which has or having at least 80% ammo acid sequence identify to the ammo acid sequence B", the ammo acid sequence A is the compaπsoπ ammo acid sequence of interest and the amino acid sequence B is the amino acid sequence of the PRO polypeptide of interest
Percent ammo acid sequence identity may also be determined using the sequence comparison program NCBI-BLAST2 (Altschul et al Nucleic Acids Res 25 3389-3402 ( 1997)) The NCBI-BLAST2 sequence comparison program mav be downloaded from 'http //www ncbi nlm gov or otherwise obtained from the National Institute of Health. Bethesda, MD NCBI-BLAST2 uses several search parameters wherein all of those search parameters are set to default values including, for example, unmask = yes. strand = all expected occurrences = 10 minimum low complexity length = 15/5. multi-pass e value = 0 01 constant tor multi-pass = 25 dropotf for final gapped alignment = 25 and scoπng matπx = BLOSUM62
In situations where NCBI-BLAST2 is employed for ammo acid sequence compaπsons, the % ammo acid sequence identity of a given amino acid sequence A to, with, or against a given am o acid sequence B (which can alternatively be phrased as a giv en amino acid sequence A that has or compπses a certain % ammo acid sequence identity to, with, or agamst a given amino acid sequence B) is calculated as follows
100 times the fraction X/Y
where X is the number of ammo acid residues scored as identical matches by the sequence alignment program NCBI-BLAST2 m that program s alignment of A and B, and where Y is the totai number of ammo acid residues in B It will be appreciated that where the length of ammo acid sequence A is not equal to the length of ammo acid sequence B, the % ammo acid sequence identity of A to B will not equal the % ammo acid sequence identity of B to A "PRO vaπant polynucleotide" or "PRO vaπant nucleic acid sequence means a nucleic acid molecule which encodes an active PRO polypeptide as defined below and which has at least about 80% nucieic acid sequence identity with a nucleotide sequence encoding- ( 1 ) a full-length native sequence PRO polypeptide as disclosed herein, (2) a full-length native sequence PRO polypeptide lacking the signal peptide as disclosed herem; (3) an extracellular domain of a PRO polypeptide, with or without the signal peptide. as disclosed herein or (4) any other fragment of a full-length PRO polypeptide sequence as disclosed herein. Ordmaπiy, a PRO polypeptide vaπant polynucleotide will have at least about 80% nucleic acid sequence identity, alternatively at least about 81% nucleic acid sequence identity, alternatively at least about 82% nucleic acid sequence identity, alternatively at least about 83% nucleic acid sequence identity, alternatively at least about 84% nucleic acid sequence identity, alternatively at least about 85% nucleic acid sequence identity, alternatively at least about 86% nucleic acid sequence identity, alternatively at least about 87% nucleic acid sequence identify, alternatively at least about 88% nucleic acid sequence identity, alternatively at least about 89%o nucieic acid sequence identity, alternatively at least about 90% nucleic acid sequence identity, alternatively at least about 91 % nucleic acid sequence identity alternatively at least about 92% nucleic acid sequence identity alternativ ely at least about 93% nucleic acid sequence identity, alternatively at least about 94% nucleic acid sequence identity, alternatively at least about 95% nucleic acid sequence identity, alternativ ely at least about 96% nucleic acid sequence identity, alternatively at least about 97% nucleic acid sequence identity, alternatively at least about 98% nucleic acid sequence identity, alternatively at least about 99% nucleic acid sequence identity with ( 1 ) a nucleic acid sequence encoding a full-length native sequence PRO polypeptide sequence as disclosed herein, (2) a full-length native sequence PRO polypeptide sequence lackmg the signal peptide as disclosed herein, (3) an extracellular domain of a PRO polypeptide sequence, with or without the signal sequence, as disclosed herein or (4) any other fragment of a full-length PRO polypeptide on sequence as disclosed herein Vanants do not encompass the native nucleotide sequence.
Ordmaπly. PRO polypeptide variant polynucleotides are at least about 30 nucleotides in length, alternatively at least about 60 nucleotides in length, alternatively at least about 90 nucleotides in length, alternati ely at least about 120 nucleotides in length, alternati ely at least about 150 nucleotides in length, alternativ ely at least about 180 nucleotides in length, alternatively at least about 210 nucleotides in length. alternatively at least about 240 nucleotides in length, alternatively at least about 270 nucleotides length, alternatively at least about 300 nucleotides in length, alternatively at least about 450 nucleotides in length, alternatively at least about 500 nucleotides in length, alternatively at least about 600 nucleotides in length, alternatively at least about 700 nucleotides in length, alternatively at least about 800 nucieotides in length, alternatively at least about 900 nucleotides in length, alternatively at least about 1000 nucleotides in length, alternatively at least about 1200 nucleotides in length, alternatively at least about 1400 nucleotides in length, alternatively at least about 1600 nucleotides in length, alternatively at least about 1800 nucleotides in length, alternatively at least about 2000 nucleotides in length, alternatively at least about 2500 nucleotides in length, alternatively at least about 3000 nucleotides m length, alternatively at least about 3500 nucleotides in length, alternatively at least about 4000 nucleotides, alternatively at least about 5000 nucleotides or more.
"Percent (%) nucieic acid sequence identity" with respect to PRO-encoding nucleic acid sequences identified herem is defined as the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in the PRO nucieic acid sequence of interest, after alignmg the sequences and mtroducmg gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid sequence identity can be achieved in vaπous ways that are within the skill in the art. for instance, using publicly available computer software such as BLAST. BLAST-2. ALIGN or Mega gn (DNASTAR) software For purposes herein, however, % nucleic acid sequence identity values are generated usmg the sequence compaπson computer program ALIGN-2, wherem the complete source code for the ALIGN-2 program is provided in Table 1 below The ALIGN-2 sequence compaπson computer program was authored by Genentech. Inc. and the source code shown in Table 1 below has been filed with user documentation in the U.S. Copyπght Office. Washington D.C, 20559. where it is registered under U.S. Copyπght Registration No. TXU510087 The ALIGN-2 program is pubhclv available through Genentech. Inc.. South San Francisco, California or may be compiled from the source code provided in Table 1 below. The ALIGN-2 program should be compiled for use on a UNIX operating system, preferably digital UNIX V4.0D. All sequence compaπson parameters are set by the ALIGN-2 program and do not vary
In situations where ALIGN-2 is employed for nucleic acid sequence compaπsons. the % nucleic acid sequence identify of a given nucleic acid sequence C to. with, or against a given nucleic acid sequence D ( which can alternatively be phrased as a given nucleic acid sequence C that has or comprises a certain % nucleic acid sequence identity to. with, or against a given nucleic acid sequence D) is calculated as follows'
100 times the fraction W/Z
where W is the number of nucleotides scored as identical matches by the sequence alignment program ALIGN- 2 m that program's alignment of C and D. and where Z is the total number of nucleotides in D. It will be appreciated that where the length of nucleic acid sequence C is not equal to the length of nucieic acid sequence D, the % nucleic acid sequence identity of C to D will not equal the % nucleic acid sequence identity of D to C. As examples of % nucleic acid sequence identity calculations. Tables 4 and 5. demonstrate how to calculate the % nucieic acid sequence identity of the nucieic acid sequence designated "Compaπson DNA" to the nucleic acid sequence designated "PRO-DNA". wherein "PRO-DNA" represents a hypothetical PRO polypeptide - encoding nucleic acid sequence of interest, "Comparison DNA" represents the nucleotide sequence of a nucleic acid molecule against which the "PRO-DNA" nucleic acid molecule of interest is being compared, and "N", "L" and "V" each represent different hypothetical nucleotides. Unless specifically stated otherwise, all % nucleic acid sequence identity values used herein are obtained as descπbed in the immediately preceding paragraph using the ALIGN-2 computer program. However. % nucleic acid sequence identity values may also be obtained as descπbed below by using the WU- BLAST-2 computer program (Altschul et al . Methods in Enzymology 266:460-480 (1996)). Most of the WU- BLAST-2 search parameters are set to the default values. Those not set to default values, i.e.. the adjustable parameters, are set with the following values: overlap span = 1 , overlap fraction = 0.125, word threshold (T) = 11, and scoπng matπx = BLOSUM62. When WU-BLAST-2 is employed, a % nucleic acid sequence identity value is determmed by dividing (a) the number of matching identical nucleotides between the nucleic acid sequence of the PRO polypeptide - encoding nucleic acid molecule of interest having a sequence deπved from the native sequence PRO polypeptide - encoding nucleic acid (i.e., the reference sequence) and the compaπson nucleic acid molecule of interest (i e., the sequence agamst which the PRO polypeptide - encodmg nucleic acid molecule of interest is being compared - which mav be a PRO vaπant polynucleotide) as determmed by WU- BLAST-2 bv (b) the total number of nucleotides of the PRO reference sequence For example, in the statement "an isolated nucleic acid molecule compπsing a nucleic acid sequence A which has or havmg at least 80% nucleic acid sequence identify to the nucleic acid sequence B" the nucleic acid sequence A is the compaπson nucleic acid molecule of interest and the nucleic acid sequence B is the nucleic acid sequence of the PRO polypeptide - encoding nucleic acid molecule of interest
Percent nucleic acid sequence identify may also be determined usmg the sequence compaπson program NCBI-BLAST2 (Altschul et al Nucleic Acids Res 25 3389-3402 (1997)) The NCBI-BLAST2 sequence compaπson program mav be downloaded from http //www ncbi nlm nih gov ' or otherwise obtained from the National Institute of Heath Bethesda MD NCBI-BLAST2 uses several search parameters, wherein ail of those search parameters are set to default values including for example, unmask = ves, strand = all. expected occurrences = 10 minimum low complexity length = 1 ^5 multi-pass e-value = 0 01 , constant for multi-pass = 25 dropoff for final gapped alignment = 25 and scoring matπx = BLOSUM62
In situations where NCBI-BLAST2 is employed for sequence compaπsons the % nucleic acid sequence identify of a given nucleic acid sequence C to with or acainst a given nucieic acid sequence D ( which can alternati ely be phrased as a given nucleic acid sequence C that has or compπses a certain % nucleic acid sequence identify to with or against a giv en nucleic acid sequence D) is calculated as follows
100 times the fraction W/Z
where W is the number of nucleotides scored as identical matches bv the sequence alignment program NCBI- BLAST2 in that program s alignment of C and D and where Z is the total number of nucleotides in D It will be appreciated that where the length of nucieic acid sequence C is not equal to the length ot nucleic acid sequence D the % nucleic acid sequence identity of C to D will not equal the % nucleic acid sequence identity of D to C
In other emoodiments PRO vaπant polvnucleotides are nucleic acid molecules that encode an active PRO polypeptide and which arc capable of hybridizing, preferably under stringent hv bπdization and wash conditions, to nucleotide sequences encoding a full-length PRO polypeptides as disclosed herein PRO variant polypeptides mav be those that are encoded by a PRO variant polynucleotide The term positives", in the context of sequence comparison performed as descπbed above, mcludes residues in the sequences compared that are not identical but have similar properties (e g , as a result of conservative substitutions, see Table 6 below) For purposes herein, the % value of positives is determined by dividing (a) the number of ammo acid residues scoπng a positive value between the PRO polypeptide sequence of mterest havmg a sequence deπved from a native sequence PRO polypeptide and the compaπson amino acid sequence of interest (; e , the ammo acid sequence against which the PRO polypeptide sequence is being compared) as determined in the BLOSUM62 matπx of WU-BLAST-2 by (b) the total number of ammo acid residues of the PRO polypeptide of mterest
Unless specifically stated otherwise, the % value of positives is calculated as descπbed in the immediately preceding paragraph However, in the context of the ammo acid sequence identity compaπsons performed as descπbed for ALIGN-2 and NCBI-BLAST-2 above, mcludes ammo acid residues m the sequences compared that are not onlv identical, but also those that have similar properties. Ammo acid residues that score a positive value to an amino acid residue of interest are diose that are either identical to the amino acid residue of interest or are a preferred substitution (as defined in Table 1 below) of the ammo acid residue of mterest. For ammo acid sequence compaπsons using ALIGN-2 or NCBI-BLAST2. the % value of positives of a given ammo acid sequence A to. with, or agamst a given amino acid sequence B (which can alternatively be phrased as a given ammo acid sequence A that has or compπses a certain % positives to. with, or agamst a given ammo acid sequence B) is calculated as follows
100 times the fraction X/Y
where X is the number of amino acid residues scoπng a positive value as defined above by the sequence alignment program ALIGN-2 or NCBI-BLAST2 in that program's alignment ot A and B, and where Y is the total number of amino acid residues in B It will be appreciated that where the length of ammo acid sequence A is not eoual to the length of amino acid sequence B the % positives ot A to B will not equal the % positives of B to A
"Isolated." when used to describe the vaπous polypeptides disclosed herem. means polypeptide that has been identified and separated and/or recovered from a component of its natural environment Contaminant components of its namral environment are materials that would typically interfere with diagnostic or therapeutic uses for the polypeptide. and may include enzymes, hormones, and other protemaceous or non- prote aceous solutes In preferred embodiments, the polypeptide will be purified (1) to a degree sufficient to obtain at least 15 residues of N-terminal or internal ammo acid sequence by use of a spinning cup sequenator. or (2) to homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or. preferably, silver stain Isolated polypeptide includes polypeptide m situ within recombinant cells, since at least one component of the PRO polypeptide in its namral environment will not be present Ordmaπly. however isolated polypeptide will be prepared bv at least one purification step
An "isolated" PRO polypeptide - encodmg nucleic acid or other polypeptide-encoding nucieic acid is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordmaπly associated in the narurai source of the polypeptide-encoding nucleic acid. An isolated polypeptide-encoding nucleic acid molecule is other than in the context or setting m which it is found in nature Isolated polypeptide - encoding nucleic acids therefore are distinguished from the polypeptide - encodmg nucleic acid molecule existing m natural cells. However, an isolated PRO polypeptide - encoding nucleic acid molecule mcludes the same contained in cells that ordmaπly express the specific polypeptide where, for example, the nucleic acid molecule is in a chromosomal location different from that of natural cells. The term "control sequences" refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism The control sequences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, and a πbosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.
Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotem that participates in the secretion of the polypeptide: a promoter or enhancer is operably linked to a coding sequence if it affects the transcπption of the sequence: or a ribosome binding sue is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the DNA sequences being linked are contiguous, and. in the case of a secretory leader, contiguous and in readmg phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice.
"Stringency" of hybπdization reactions is readily determinable by one of ordinary skill in the art, and generally is an empiπcal calculation dependent upon probe length, washmg temperamre. and sait concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybπdization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperamre. The higher the degree of desired homology between the probe and hybπdizable sequence, the higher the relative temperamre which can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so For additional details and explanation of stπngencv of" hybridization reactions, see Ausubel et al , Current Protocols in Molecular Bιolog\ . Wiley Interscicnce Publishers. ( 1995)
"Stπngent conditions" or "high stringency conditions. ' as defined herein, may be identified by those that: ( 1 ) employ low ionic strength and high temperamre for washing, for example 0 015 M sodium chloride/0.0015 M sodium cιtrate/0.1% sodium dodecyl sulfate at 50°C; (2) employ duπng hybπdization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumιn/0.1% Ficoll/0.1% polyvιnylpyrrolιdone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloπde, 75 mM sodium citrate at 42°C, or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate). 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate. 5 x Denhardt's solution. sonicated salmon sperm DNA (50 μg/ml). 0 1% SDS. and 10% dextran sulfate at 42°C, with washes at 42°C in 0.2 x SSC (sodium chlonde/sodium citrate) and 50% formamide at 55°C. followed by a high-stringency wash consisting of 0.1 x SSC containing EDTA at 55°C.
"Moderately stπngent conditions" may be identified as descπbed by Sambrook et al.. Molecular Cloning. A Laboratory Manual. New York: Cold Spring Harbor Press. 1989. and include the use of washmg solution and hybπdization conditions ( g., temperamre. ionic strength and %SDS) less stπngent that those descπbed above. An example of moderately stπngent conditions is overnight incubation at 37°C in a solution compπsing: 20% formamide. 5 x SSC (150 mM NaCl, 15 mM tπsodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution. 10% dextran sulfate, and 20 μg mL denatured sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at about 37-50°C. The skilled artisan will recognize how to adjust the temperamre, ionic strength, etc , as necessary to accommodate factors such as probe length and the like.
"Antibodies" (Abs) and "immunoglobulins" (Igs) are glycoprotems having the same general structural characteπstics. While antibodies exhibit binding specificity to a specific antigen, immunoglobulins include both antibodies and other antibody-like molecules which lack antigen specificity. Polypeptides of the latter kind are, for example, produced at low levels by the lymph system and at increased levels by yeiomas. The term "antibody" is used in the broadest sense and specifically covers, without limitation, mtact monoclonal antibodies (including agonist, antagonist and neutralizing antibodies), polyclonal antibodies, multispecific antibodies (e g , bispecific antibodies) formed trom at least two intact antibodies, s gie cham antibodies binding the epitopes specific to the PRO polypeptide and antibody fragments so long as they exhibit the desired biological activity An antι-PRO200. antι-PRO204, antι-PR0212. antι-PR0216. antι-PR0226, antι-PRO240, antι-PR0235, antι-PR0245, anti-PRO 172. antι-PR0273, antι-PR0272. antι-PR0332. antι-PR0526, anti- PRO701 , antι-PR0361 , antι-PR0362, antι-PR0363. antι-PR0364. antι-PR0356. antι-PR0531, antι-PR0533, antι-PRO 1083. antι-PR0865. antι-PRO770. antι-PR0769, antι-PR0788. anti-PRO 1 1 14. antι-PRO1007. anti- PRO l 184. antι-PRO 1031 , antι-PR01346. anti-PROl 155, antι-PRO 1250, antι-PR01312, antι-PR01 192. anti- PR01246. antι-PR01283. anti-PRO l 195, antι-PR01343, antι-PRO I418. antι-PR01387. antι-PRO1410. anti- PR01917. antι-PR01868, antι-PRO205. antι-PR021. antι-PR0269, antι-PR0344, antι-PR0333. antι-PR0381, antι-PRO720, antι-PR0866, antι-PRO840. antι-PR0982. antι-PR0836, anti-PRO l 159. antι-PR01358, anti- PR01325. antι-PR01338, antι-PR01434. antι-PR04333, antι-PRO4302, antι-PRO4430 or antι-PR05727 antibody is an antibody which immunologically binds to a PRO200. PRO204. PR0212. PR0216. PR0226, PRO240. PR0235. PR0245. PR0172, PR0273. PR0272. PR0332. PR0526, PRO701. PR0361. PR0362. PR0363 PR0364. PR0356 PR053 1. PR0533. PRO 1083. PR0865. PRO770. PR0769. PR0788. PROl 1 14. PRO 1007 PRO l 184 PRO103 1. PR01346. PRO l 155. PRO 1250. PR01312. PRO l 192. PR01246. PR01283, PROl 195. PR01343. PR01418. PR013S7. PRO1410. PROI9I 7, PR01868. PRO205. PR021. PR0269, PR0344. PR0333, PR0381 , PRO720. PR0866. PRO840. PR0982. PR0836. PROl 159. PRO 1358. PRO 1325. PR01338. PROI434. PR04333. PRO4302. PRO4430 or PR05727, respectively, polypeptide The antibody may bind to any domain of the PRO polypeptide which may be contacted by the antibody For example, the antibody may bind to any extracellular domain of the polypeptide and when the entire polypeptide is secreted, to any domain on the polypeptide which is available to the antibody for binding.
"Native antibodies" and "native immunoglobulins" are usually heterotetrameπc glycoproteins of about 150,000 daltons. composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number ot disulfide linkages varies among the heaw chains ot different immunoglobulin isotvpes Each heaw and light cham also has regularly spaced lntrachain disulfide bπdges. Each heavy chain has at one end a vaπable domain ( VH) followed by a number of constant domams. Each light cham has a variable domain at one end ( VL) and a constant domam at its other end: the constant domam of the light chain is aligned with the first constant domain of the heavy chain, and the light-chain vaπable domain is aligned with the vaπable domain of the heavy chain. Particular ammo acid residues are believed to form an mterface between the light- and heavy-chain vaπable domams.
The term "vaπabie" refers to the fact that certain portions of the vaπable domams differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. However, the variability is not evenly distπbuted throughout the vaπable domams of antibodies. It is concentrated in three or four segments called "complemeπtaπty-determining regions" (CDRs) or "hypervanable regions" in both in the light-chain and the heavy-chain vaπable domams. The more highly conserved portions of vaπable domams are called the framework (FR). The vaπable domams of native heavy and light chams each compπse four or five FR regions, largely adoptmg a β-sheet configuration, connected by the CDRs, which form loops connecting, and in some cases forming part of, the β-sheet structure. The CDRs m each cham are held together in close proximity by the FR regions and. with the CDRs from the other cham. conmbute to the formation of the antigen-binding site ot antibodies (see Kabat et al . NIH Publ. No.91-3242, Vol. I, pages 647-669 ( 1991 )) There are at least two techniques for determining the extent of the CDRs: (1 ) An approach based on the extent of cross-species sequence vaπabihty (/ c . Kabat et al , Sequences of Proteins of Immunological Interest (National Institute of Health, Bethesda. MD), and (2) an approach based on crystallographic studies ot antigen-antibody complexes (Chothia, C et at , ( 1989), Nature 342. 877). Moreover, CDR's can also be defined using a hybπd approach incorporating the residues identified by both of the previous techniques The constant domams are not mvoived directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular toxicity "Antibody fragments" compπse a portion of an intact antibody, preferably the antigen binding or vaπable region of the intact antibody Examples of antibody fragments include Fab. Fab'. F(ab')2, and Fv fragments, diabodies. linear antibodies (Zapata et al . Protein Eng 8 ( 10) 1057- 1062 [1995]), singie-cham antibody molecules, and multispecific antibodies formed from antibody fragments.
Papain digestion of antibodies produces two identical antigen- binding fragments, called "Fab" tragments. each with a single antigen-binding site, and a residual c" fragment, whose name reflects its ability to crystallize readilv Pepsin treatment yields an 1 (ab'b fragment that has two antigen-combining sites and is still capable of cross-linking antigen
"Fv" is the minimum antibody fragment w hich contains a complete antigen-recognition and binding site. This region consists of a dimer of one heavy- and one light-chain variable domam m tight, non-covalent association it is in this configuration that the three CDRs of each vaπable domain interact to define an antigen-binding site on the surface ot the V^-VJL dimer Collectively, the six CDRs confer antigen-binding specificity to the antibody However, even a single vaπable domain (or half of an Fv compπsing only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site The Fab fragment also contains the constant domain of the light chain and the first constant domain
(CH I ) of the heaw chain Fab' fragments differ from Fab fragments bv the addition ot a few residues at the carboxv terminus of the heaw chain CH I domain including one or more cysteines trom the antibody hinge region Fab'-SH is the designation herein for Fab' in which the cysteine resιdue(s) of the constant domains bear a free thiol group. F(ab')2 antibody fragments onginally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.
The "light chains" of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa (K) and lambda (λ). based on the ammo acid sequences of their constant domams.
Depending on the ammo acid sequence of the constant domam of their heavy chains, immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulms: IgA, IgD, IgE. IgG, and IgM, and several of these may be further divided into subclasses (isotypes), e.g., IgGl, IgG2, IgG3, IgG4, IgA, and IgA2. The heavy-chain constant domains that correspond to the different classes of immunoglobulms are called α, δ, ε, γ, and μ, respectively. The subunit structures and three-dimensional configurations of different classes of immunoglobulms are well known. The term "monoclonal antibody" as used herein refers to an antibody obtamed from a population of substantially homogeneous antibodies, i.e., the individual antibodies compπsing the population are identical except for possible naturally occurπng mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed agamst a single antigenic site. Furthermore, in contrast to conventional (polyclonal) antibody preparations which typically include different antibodies directed against different determinants (epitopes). each monoclonal antibody is directed agamst a single determinant on the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they are synthesized by the hybπdoma culture, uncontaminated by other immunoglobulins. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiπng production of the antibody by any particular method. For example, the monoclonal antibodies to be used in accordance with the present invention may be made by the hybπdoma method first descπbed by Kohler et al , Nature, 256: 495 [1975], or may be made by recombinant DNA methods (see, e.g., U.S. Patent No 4,816,567). The "monoclonal antibodies" may also be isolated from phage antibody braπes using the techniques descπbed in Clackson ct al.. Nature. 352:624-628 [1991 ] and Marks et al , J. Mol Biol.. 222.581 -597 ( 1991 ). tor example. See also U.S Patent Nos 5.750,373. 5,571.698, 5.403.484 and 5.223.409 which descπbe the preparation of antibodies using phagemid and phage vectors.
The monoclonal antibodies herein specifically include "chimenc" antibodies (immunoglobulins) in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies deπved from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chaιn(s) is identical with or homologous to corresponding sequences in antibodies deπved from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (U.S. Patent No. 4,816,567: Momson et al., Proc. Natl. Acad. Set. USA. 8 6851 -6855 [ 1984])
"Humanized" forms of non-human (e g , muπne) antibodies are chimenc immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab'. F(ab')7 or other antigen-binding subsequences of antibodies) which contain minimal sequence deπved from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a compiementaπty-determining region (CDR) of the recipient are replaced by residues from a CDR of a non- human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity, and capacity. In some instances. Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies may compπse residues which are found neither m the recipient antibody nor m the imported CDR or framework sequences. These modifications are made to further refine and maximize antibody performance. In general, the humanized antibody will compπse substantially all of at least one. and typically two, vaπable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and ail or substantially all of the FR regions are those of a human immunoglobulin sequence. The humanized antibody optimally also will compπse at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details, see Jones et al., Nature, 32 522-525 (1986); Reichmann et al.. Nature, 332:323-329 [1988]; and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992). The humanized antibody includes a "primatιzed"antιbody where the antigen-bmding region of the antibody is derived from an antibody produced by immunizing macaque monkeys with the antigen ot mterest. Antibodies containmg residues from Old World monkeys are also possible within the invention. See, for example. U.S. Patent Nos. 5,658,570; 5,693,780; 5,681.722, 5,750,105; and 5.756,096.
Antibodies and fragments thereof this invention also include "affinity matured" antibodies in which an antibody is altered to change the amino acid sequence of one or more of the CDR regions and/or the framework regions to alter the affinity of the antibody or fragment thereof for the antigen to which it bmds. Affinity maturation may result in an increase or in a decrease m the affinity of the matured antibody for the antigen relative to the starting antibody Typically, the starting antibody will be a humanized, human, chimenc or murine antibody and the affinity matured antibody will have a higher affinity than the starting antibody. During the maturation process, one or more of the ammo acid residues in the CDRs or in the framework regions are changed to a different residue using any standard method. Suitable methods include point mutations using well known cassette mutagenesis methods (Wells et al , 1985. Gene 34.315) or oligonucleotide mediated mutagenesis methods (Zoller et al , 1987, Nucleic Acids Res. J0.6487-6504). Affinity maturation may also be performed using known selection methods in which many mutations are produced and mutants having the desired affinity are selected from a pool or library ot mutants based on improved affinity tor the antigen or ligand. Known phage display techniques can be conveniently used in this approach See. for example, U S 5,750,373, U.S. 5,223,409, etc
Human antibodies are also with in the scope of the antibodies of the invention. Human antibodies can be produced using various techniques known in the art, including phage display hbraπes [Hoogenboom and Winter. ./ Mol. Biol . 227.381 ( 1991 ), Marks et at , J. Mol. Biol . 222.581 ( 1991)]. The techniques of Cole et al. and Boemer et al. are also available for the preparation of human monoclonal antibodies (Cole et al.. Monoclonal Antibodies and Cancer Therapy, Alan R. Liss. p. 77 ( 1985); Boerner et al.. J Immunol., 147 (L:86-95 (1991 ); U. S. 5,750, 373] Similarly, human antibodies can be made by introducing of human immunoglobulin loci into transgenic animals, e g , mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in ail respects, including gene rearrangement, assembly, and antibody repertoire This approach is described, for example, in U.S. Patent Nos 5,545,807, 5.545.806, 5.569,825. 5,625,126. 5,633,425; 5,661,016. and m the following scientific publications: Marks et al., Bio/Technology JO. 779-783 ( 1992); Lonberg et at . Nature 368 856-859 (1994); Morrison, Nature 368, 812-13 (1994); Fishwild et al., Nature Biotechnology J4. 845-51 ( 1996); Neuberger, Nature Biotechnology \A. 826 ( 1996): Lonberg and Huszar. Intern. Rev. Immunol L3 65-93 (1995).
"Single-chain Fv" or "sFv" antibody fragments compπse the VH and VL domams of antibody, wherem these domains are present in a single polypeptide chain. Preferably, the Fv polypeptide further compnses a polypeptide linker between the V^ and V^ domams which enables the sFv to form the desired structure for antigen binding. For a review of sFv see Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113. Rosenburg and Moore eds., Springer- Verlag, New York, pp. 269-315 (1994).
The term "diabodies" refers to small antibody fragments with two antigen-binding sites, which fragments compπse a heavy-chain vaπable domam (VJJ) connected to a light-chain vaπable domain (VTJ in the same polypeptide chain (VJJ - VT . By using a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domams of another chain and create two antigen-bindmg sites. Diabodies are descπbed more tully in. for example, EP 404.097. WO 93/11161. and Holhnger et al . Proc. Natl. Acad. Sci USA. 90 6444-6448 ( 1993).
The word "label" when used herein refers to a detectable compound or composition which is conjugated directly or indirectly to the compound, e g , antibody or polypeptide. so as to generate a "labelled" compound. The label may be detectable by itself (e g , radioisotope labels or fluorescent labels) or. m the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition which is detectable
By "solid phase" is meant a non-aqueous matπx to which the compound of the present invention can adhere Examples of solid phases encompassed herem include those formed partially or entirely of glass (e g , controlled pore glass), polysacchandes (e g , agarose). polyacrylamides, polystyrene, polyvinyl alcohoi and si cones. In certain embodiments, depending on the context, the solid phase can compπse the well of an assay plate; in others it is a puπfication column (e g , an affinity chromatography column) This term also includes a discontinuous solid phase of discrete particles, such as those described in U.S Patent No 4.275.149
The term "immune reiated disease" means a disease in which a component of the immune system of a mammal causes, mediates or otherwise contributes to a morbidity in the mammal Also included are diseases in which stimulation or intervention of the immune response has an ameliorative effect on progression of the disease Included within this term are immune-mediated inflammatory diseases, non-immune-mediated inflammatory diseases, infectious diseases, immunodeficiency diseases, neoplasia. etc
The term "T cell mediated" disease means a disease in which T cells directly or indirectly mediate or otherwise contπbute to a morbidity in a mammal. The T cell mediated disease may be associated with cell mediated effects, lymphokine mediated effects, etc , and even effects associated with B cells if the B cells are stimulated, for example, by the lymphokines secreted by T cells.
Examples of immune-related and inflammatory diseases, some of which are immune or T cell mediated, which can be treated according to the mvention include systemic lupus ervthematosis. rheumatoid arthπtis. juvenile chronic arthritis, spondyloarthropathies. systemic sclerosis (scleroderma). idiopathic inflammatory myopathies (dermatomvositis polymyositis). Sjogren's syndrome, systemic v ascu tis, sarcoidosis. autoimmune hemolvtic anemia ( immune pancytopenia. paroxysmal nocturnal hemoglobinuπa), autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura. immune-mediated thrombocytopenia), thyroiditis (Grave's disease, Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis, atrophic thyroiditis), diabetes mel tus. immune-mediated renal disease (glomerulonephπtis. tubulointerstitial nephπtis), demye nating diseases of the central and peπpheral nervous systems such as multiple sclerosis, idiopathic demyelinating polyneuropathy or Guillam-Barre syndrome, and chronic inflammatory demyehnating poiyneuropathy, hepatobi ary diseases such as infectious hepatitis (hepatitis A, B, C, D, E and other non- hepatotropic viruses), autoimmune chronic active hepatitis, pπmary biliary cirrhosis, granulomatous hepatitis. and sclerosmg cholangitis, inflammatory bowel disease (ulceranve colitis: Crohn's disease), gluten-sensitive enteropathy, and Whipple's disease, autoimmune or immune-mediated skin diseases mcludmg bullous skin diseases, erythema multiforme and contact dermatitis, psoπasis, allergic diseases such as asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urticaπa. lmmunoiogic diseases of the lung such as eosuiophilic pneumonias, idiopathic pulmonary fibrosis and hypersensitivity pneumonitis, transplantation associated diseases including graft rejection and graft -versus-host-disease. Infectious diseases mcludmg viral diseases such as AIDS (HIV infection), hepatitis A. B, C, D. and E. herpes, etc . bacteπal infections, fungal infections, protozoal infections and parasitic infections.
"Treatment" is an intervention performed with the intention of preventing the development or alteπng the pathology of a disorder Accordingly, "treatment" refers to both therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already with the disorder as well as those in which the disorder is to be prevented. In treatment of an immune related disease, a therapeutic agent may directly decrease or increase the magnitude of response of a component of the immune response, or render the disease more susceptible to treatment by other therapeutic agents, e g , antibiotics, antifuπgals, anti- lnflammatory agents, chemotherapeutics. etc The term "effective amount" is at least the minimum concentration or amount of a PRO polypeptide and or agonist antagonist which causes, induces or results in either a detectable improvement m a component of the immune response in mammals as measured in an in vitro assay. For example, an increase or decrease m the proliferation of T-cells and/or vascular permeability as measured in Examples provided herein. Furthermore, a "therapeutically effective amount" is the minimum concentration or amount of a PRO polypeptide and/or agonist/antagonist which would be effective in at least attenuating a pathology (increasing or decreasing as the case may be) a component ot the immune response in mammals, the results of which effects a treatment as defined in the previous paragraph.
"Chronic" administration refers to administration of the agent(s) in a continuous mode as opposed to an acute mode, so as to mamtain the initial therapeutic effect (activity) for an extended period of time. "Intermittent" administration is treatment that is not consecutively done without interruption, but rather is cyclic in nature.
The "pathology" of an immune related disease includes all phenomena that compromise the well- being of the patient This includes, without limitation, abnormal or uncontrollable cell growth, antibody production, auto-antibody production, complement production and activation, interference with the normal functioning of neighboring cells, release ot cytokines or other secretory products at abnormal levels, suppression or aggravation oi any inflammatory or immunoiogical response, infiltration of inflammatory cells (neutrophihc. eosinophihc. monocytic, lymphocytic) into tissue spaces, etc
"Mammal" for purposes of treatment refers to any animal classified as a mammal, mcludmg humans, domestic and farm animals, and zoo. sports, or pet animals, such as dogs, horses, cattle, pigs, apes, hamsters, ferrets, cats, etc Preferably, the mammal is human.
Administration "in combination with" one or more further therapeutic agents includes simultaneous (concurrent) and consecutive administration in any order.
"Carπers" as used herem include pharmaceutically acceptable earners, excipients. or stabilizers which are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed. Often the physiologically acceptable earner is an aqueous pH buffered solution. Examples of physiologically acceptable carπers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid: low molecular weight (less than about 10 residues) polypeptide; protems, such as serum albumin, gelatm, or immunoglobulins; hydrophilic polymers such as polyvmylpyrrolidone; ammo acids such as glycme, glutamine, asparagine, arginine or lysme; monosacchaπdes, disaccharides, and other carbohydrates including glucose, mannose. or dextπns; chelating agents such as EDTA; sugar aicohols such as mannitol or sorbitol: salt-forming counteπons such as sodium; and/or noniomc surfactants such as TWEEN™, polyethylene glycol (PEG), and PLURONICS™
The term "cytotoxic agent" as used herein refers to a substance that inhibits or prevents the function of cells and/or causes destruction of cells. The term is intended to include radioactive isotopes (e.g , I111. 1125, Y90 and Re ), chemotherapeutic agents, and toxins such as enzymatically active toxins of bacteπal. fungal, plant or animal oπgm, or fragments thereof.
A "chemotherapeutic agent" is a chemical compound useful in the treatment of cancer. Examples of chemotherapeutic agents include adnamycm. doxorubicin. epirubicin. 5-fluorouracιl, cytosine arabinoside ("Ara-C"), cyclophosphamide. thiotepa, busulfan. cytoxin. taxoids. e.g . pac taxel (Taxol. Bristol-Myers Squibb Oncology, Pπnceton. NJ), and doxetaxel (Taxotere, Rhόne-Poulenc Rorer, Antony. France), toxotere. methotrexate. cisplatin, melphalan. vmblastine. bleomycm. etoposide. ifosfamide. mitomycin C. mitoxantrone. vincπstine. vinorelbine. carboplatin. tenφoside. daunomycin. carminomycin. ammopteπn. dacπnomycm, mitomycins, esperamicins (see U.S. Pat. No. 4.675,187), melphalan and other related nitrogen mustards. Also included in this definition are hormonal agents that act to regulate or inhibit hormone action on tumors such as tamoxifen and onapπstone
A "growth inhibitory agent" when used herein refers to a compound or composition which inhibits growth of a cell, especially cancer cell overexpressing any of the genes identified herein, either in vitro or in vivo Thus, the growth inhibitory agent is one which significantly reduces the percentage of cells overexpressing such genes in S phase. Examples of growth inhibitory agents include agents that block cell cycle progression (at a place other than S phase), such as agents that duce G l arrest and M-phase arrest. Classical M-phase blockers include the vmcas (vincπstine and vmblastine), taxol, and topo II inhibitors such as doxorubicin. epirubicin. daunorubicin. etoposide. and bleomycm Those agents that arrest G l also spill over into S-phase arrest, for example, DNA alkylatmg agents such as tamoxifen, prednisone. dacarbazine. mechlorethamine. cisplatin. methotrexate. 5-fluorouracιl. and ara-C. Further information can be found in The Molecular Basis of Cancer. Mendelsohn and Israel, eds.. Chapter 1. entitled "Cell cycle regulation, oncogens, and antineoplastic drugs" bv Murakami ct al (WB Saunders- Philadelphia. 1995). especially p. 13.
The term "cytokme" is a generic term for proteins released by one cell population which act on another cell as intercellular mediators. Examples of such cytokines are lymphok es. monokines. and traditional polypeptide hormones. Included among the cytokines are growth hormone such as human growth hormone, N-methionyl human growth hormone, and bovine growth hormone: parathyroid hormone; thyroxine; insulm; proinsuiin: reiaxm; prorelaxm: glycoprotein hormones such as follicle stimulating hormone (FSH), thyroid stimuiatmg hormone (TSH), and luteimzing hormone (LH); hepatic growth factor: fibroblast growth factor: prolactin; placental lactogen tumor necrosis factor-α and -β; mullenan-inhibiting substance: mouse gonadotropm-associated peptide: inhibm: activin; vascular endothelial growth factor; integrin; thrombopoietm (TPO); nerve growth factors such as NGF-β, platelet-growth factor; transforming growth factors (TGFs) such as TGF-α and TGF- β; insulin-like growth factor-I and -II; erythropoietm (EPO); osteomductive factors; interferons such as interferon- α, -β, and -γ; colony stimulating factors (CSFs) such as macrophage-CSF (M-
CSF); granulocyte-macrophage-CSF (GM-CSF); and granulocyte-CSF (G-CSF); interieukins (ILs) such as IL-
1, IL-lα, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-11, IL-12; a tumor necrosis factor such as TNF-α or TNF-β; and other polypeptide factors including LIF and bt ligand (KL). As used herem. the term cytokme includes proteins from namral sources or from recombinant cell culture and biologically active equivalents of the native sequence cytokmes
The term 'epitope tagged ' when used herein refers to a chimenc polypeptide compπsing a PRO polypeptide fused to a 'tag polypeptide ' The tag polypeptide has enough residues to provide an epitope agamst which an antibody can be made vet is short enough such that it does not interfere with activity of the polypeptide to which it is fused The tag polypeptide preferably also is fairlv unique so that the antibody does not substantially cross-react with other epitopes Suitable tag polypeptides generally have at least six ammo acid residues and usually between about 8 and 50 ammo acid residues (preferably, between about 10 and 20 ammo acid residues) "Active' or 'activity ' in the context of vaπants ot the PRO polypeptide refers to form(s) of proteins of the invention which retain the biologic and or the ability to mduce the production of an antibody agamst an antigenic epitope possessed by the PRO polypeptide More specifically "biological activity" refers to a biological function (either inhibitory or stimulatory) caused bv a native sequence or naturallv-occurπng PRO polypeptide Ev en more specifically "biological activity' in the context ot an antibody or another molecule that can be identified bv the screenmg assavs disclosed herein (c g an organic or inorganic small molecule peptide tic ) can be the ability of such molecules to induce or inhibit infiltration ot inflammatory cells into a tissue to stimulate or inhibit T cell proliferation or activation to stimulate or inhibit cytokme release bv cells or to increase or decrease vascular permeability Another specific biological activity is the increased vascular permeability or the inhibition thereof The term 'antagonist" is used in the broadest sense, and includes any molecule that partially or fully blocks, inhibits or neutralizes a biological activity of a native sequence PRO polypeptide disclosed herein In a similar manner the term agonist" is used m the broadest sense and includes anv molecule that mimics or amplifies a biological activity of a native sequence PRO polypeptide disclosed herein Suitable agonist or antagonist molecules specifically include agonist or antagonist antibodies or antibodv fragments fragments or amino acid sequence variants of native PRO polypeptides peptides small organic molecules tc Methods for identify ing agonists or antagonists of a PRO polypeptide mav comprise contacting a PRO polvpeptide with a candidate agonist or antagonist molecule and measuπng a detectable change m one or more biological activities normally associated with the same
A "smail molecule ' is defined herein to have a molecular weight below about 600 daltons. and is generally an organic compound
A "liposome" is a smail vesicle composed of vaπous types of lipids, phospho pids and/or surfactant which is useful for delivery of a drug (optionally mcludmg a chemotherapeutic agent) to a mammal The components of the liposome are commonly arranged in a bilayer formation, similar to the lipid arrangement of biological membranes As used herein, the term 'lmmunoadhesin ' designates antibody-like molecules which combme the binding specificity of a heterologous protein (an "adhesin1 ) with the effector functions of immunoglobulin constant domams Structurally, the immunoadhesins compπse a fusion of an ammo acid sequence with the desired binding specificitv which is other than the antigen recognition and binding site of an antibody (t e , is "heterologous '), and an immunoglobulin constant domam sequence The adhesin part of an lmmunoadhesin molecule rypicallv is a contiguous ammo acid sequence compπsmg at least the binding site of a receptor or a ligand. The immunoglobulin constant domain sequence in the lmmunoadhesin may be obtained from any immunoglobulin. such as IgG-1, IgG-2, IgG-3, or IgG-4 subtypes, IgA (including IgA-1 and IgA-2). IgE, IgD or IgM.
Table 1
/*
* C-C increased from 12 to 15
* Z is average of EQ
* B is average of ND
* match with stop is _M: stop-stop = 0; J (joker) match = 0 */
#define _M -8 /* value of a match with a stop */ int day[26][26] = {
/* A B C D E F G H I J K L M N O P Q R S T U V W X Y Z*/
/* A */ { 2.0.-2.0.0,-4.1.-1,-1,0.-1.-2, -1, 0._M.1.0.-2.1.1, 0.0.-6.0.-3.0},
/* B */ \ 0.3.-4.3.2.-5,0.1.-2.0.0,-3,- -2.2._M.-1, 1.0, 0, 0.0,-2.-5.0,-3, 1},
/* C */ -2,-4.-15.-5.-5.-4.-3.-3.-2.0,-5,-6.-5.-4._M.-3.-5.-4.0,-2, 0.-2,-8, 0, 0.-5},
/* D */ 0,3,-5.4, 3.-6.1, 1.-2,0,0.-4.- -3.2,_M.-1, 2.-1.0, 0.0.-2.-7.0.-4.2},
/* E */ 0.2,-5, 3,4,-5,0, 1,-2.0,0,-3.- -2, l. M.-l.2.-1.0.0, 0,-2.-7.0.-4.3},
/* F */ -4,-5,-4.-6.-5.9,-5.-2.1.0.-5.2, 0.-4._M.-5.-5.-4.-3.-3.0,-1.0.0, 7.-5},
/* G */ { 1.0.-3.1.0,-5,5.-2.-3.0,-2.-4, -3.0,_M. -1.-1.-3.1.0, 0.-1.-7.0,-5.0},
1* H */ -1.1.-3.1.1.-2.-2.6.-2.0.0.-2. -2.2,_M.0.3.2.-1,-1.0.-2.-3.0.0.2},
/* I */ -1.-2.-2.-2.-2.1.-3.-2.5,0.-2.2. 2.-2._M. -2.-2.-2.-1.0.0.4.-5.0,-1.-2},
1*1 *! 0.0.0.0.0.0.0.0.0,0.0.0.0.0._M.0.0.0.0.0.0.0.0.0.0.0},
/*K */ -1.0.-5.0.0.-5.-2.0.-2.0.5.-3. 0. l._M.-I.1.3.0.0.0.-2.-3.0.-4.0}.
/* L *,' -2.-3.-6.-4.-3.2.-4.-2.2.0.-3.6.4. -3. _M. -3.-2.-3. -3.-1.0.2.-2.0.-1.-2}.
/* M */ -1.-2.-5.-3.-2.0.-3.-2.2.0.0.4, 6.-2. M. -2.-1.0.-2.-1.0.2.-4.0.-2.-1}.
/*N */ 0.2.-4.2.1.-4.0.2.-2.0.1.-3.- 2.2._M.-1.1.0.1.0.0.-2.-4.0.-2.1}.
1*0 *! M, M._M. M._M._M. M._M._M. _M._M._M._M._M.0. M._M._M._M._M._M._M._M._M._M._M}.
1* ?*! 1.-1.-3.-1.-1.-5,-1.0.-2,0.-1.-3. "2,-1. _M.6.0.0.1.0.0.-1,-6.0,-5, 0},
I*Q *l [0, 1.-5.2.2,-5.-1.3,-2.0, 1.-2. 1. l._M.0, 4. l.-l.-l.0.-2.-5.0,-4, 3}, l*R*l -2.0.-4.-1.-1.-4,-3,2.-2,0.3.-3.0.0,_M.0.1.6.0.-1.0.-2.2.0.-4.0}. l*S*l 1,0.0.0.0.-3.1.-1.-1,0.0.-3.- 2. l._M. l.-l.0.2.1.0.-1.-2.0,-3.0}.
1*1*1 1,0,-2.0.0.-3.0.-1,0.0,0.-1.- -1.0._M.0.-1.-1.1.3.0.0.-5.0.-3.0},
/*u */ 0, 0, 0.0.0.0.0, 0, 0.0.0.0.0.0._M.0.0.0.0.0.0.0.0.0.0, 0},
/* v*/ 0.-2.-2.-2.-2.-1.-1.-2.4.0.-2.2. 2.-2._M. -1.-2.-2.-1.0.0.4.-6, 0,-2,-2}.
/* w*/ -6,-5.-8.-7.-7.0.-7,-3.-5.0.-3.-2. ,-4,-4._M.-6.-5.2.-2.-5.0.-6,17.0.0,-6}. ι*x*ι 0.0.0.0.0.0.0.0.0.0.0, 0, 0.0._M.0.0.0.0, 0.0, 0.0.0.0.0},
/* Y */ -3.-3.0.-4.-4.7.-5.0.-1.0.-4.-1. -2.-2._M.-5.-4.-4.-3.-3, 0.-2.0.0.10.-4}.
/*z */ 0.1.-5.2.3,-5.0,2.-2.0.0.-2.- -1. l._M.0.3.0.0.0.0,-2.-6.0,-4.4}
Page 1 of day. h Table 1 (conf)
/* */
^include < stdιo.h> <ctype.h>
^define MAXJMP 16 /* max jumps in a diag */
^define AXGAP 24 /* don't continue to penalize gaps larger than this */
//define JMPS 1024 * max jmps in an path */
^define MX 4 /* save it there's at least MX-1 bases since last jmp */
^define DMAT 3 /* value ot matching bases */
^define DMIS 0 /* penalty tor mismatched bases */
^define DINS0 8 /* penalty tor a gap */
^define D1NS1 1 /* penalty per base */
#defϊne PINS0 8 /* penalty tor a gap */
^define PINS 1 4 /* penalty per residue */ struct jmp { short nfMAXJMP]; /* size of jmp (neg for dely) */ unsigned short x(MAXJMP). '* base no of jmp in seq x */
} • /* limits seq to 2 " 16 - 1 */ struct dun { int score; /* score at last jmp *' long offset: /* offset ot prev bloc */ short ljmp; /* current jmp index */ struct jmp Jp: /* list ot jmps */ }• struct path { int spe: /* number ot leading spaces */ short nfJMPS]. /* size ot jmp (gap) */ int xfJMPS]. /* lo ot jmp (last elem before gap) */
}• char •ofile: /* output file name */ char *namex|2]. /* seq names: getseqsO */ char prog: /* prog name tor err msgs */ char *seqx[2|, /* seqs. geiseqsi ) */ int dmax: /* best diag. nvvi ) */ int dmaxO: /* final diag »' int dna; /* set if dna: mainO */ int endgaps: /* set if penalizing end gaps */ int gapx, gapy; /* total gaps in seqs */ int lenO. lenl: /* seq lens */ int ngapx, ngapy; /* total size ot gaps */ int smax: /* max score: nw() */ int *xbm: /* bitmap tor matching */ long offset; /* current offset in mp file */ struct diag *dx: /* holds diagonals */ struct path PP[2]; /* holds path tor seqs */ char *calloc(). *malloc(), *ιndex(), *strcpy(); char *getseq(), *g_calloc(); Table 1 (co ')
/* Needleman-Wunsch alignment program usage progs file 1 file2 where file 1 and file2 are two dna or two protein sequences The sequences can be in upper- or lower-case an mav contain ambiguity Any lines beginning with '.','> or ' < ' are ignored Max file length is 65535 (limited by unsigned short x in the jmp struct) A sequence with 1/3 or more of its elements ACGTU is assumed to be DNA Output is in the file ahgn.out
: The program mav create a tmp file in /tmp to hold info about traceback Original version developed under BSD 43 υn a vaλ 8650
//include nw h ' ^include dav h static _dbval[26] = {
1.14.2.13.0,0.4,11,0.0.12,0.3,15.0,0,0.5.6.8.8.7.9.0.10,0
static _pbvalf26] = {
1.2I(1< <( D'- A'))|(l< <( N 'A)).4 8 16 32.64 128 256 OxFFFFFFF 1< < 10 1< < 11 1< < 12. ! < < 13.1< < 14 1<<15 1<<16 1<<17 1<<18 1< < 19 1 < < 20 1< <21 1< <22. 1<<23.1<<24 1<<25|(K<( C 'A ))|(1< <( Q'-'A'))
mainfac av) int ac. char *av[]; prog = av[0], if(ac '= 3) { fpnntKstderr. 'usage %s filel file2\n'. prog). fpnntKstderr where filel and file2 are two dna or two protein sequences \n '), fpnntKstderr. The sequences can be in upper- or lower-case\n'), fpnntKstderr. Any lines beginning with or < ' are ιgnored\n') fpnntKstderr Output is in the file \ align oun n '), exιt(l),
} na exfO] = av[l], namexfi] = av[2), seqx[0] = getseq(namex|0], &len0). seqx(l] = getseq(namex|l j. &lenl). xbm = (dna).' dbval jbval. endgaps = 0, /* 1 to penalize endgaps */ ofile = 'ahgn.out /* output file */ nw(); /* fill in the matrix, get the possible jmps */ readjmpsO. /* get the actual jmps */ pπnt(); /* print stats, alignment */ cleanup(O), /* unlink any tmp files */ Table 1 (conf) /* do the alignment, return best score: mamO
* dna: values m Fitch and Smith. PNAS.80.1382-1386.1983
* pro- PAM 250 values
* When scores are equal, we prefer mismatches to any gap, prefer
* a new gap to extendmg an ongoing gap, and prefer a gap in seqx
* to a gap in seq y.
*/ nw()
{ char *px. *py. /* seqs and ptrs */ int *ndely, *dely. * keep track ot dely */ int ndelx, delx. /* keep track of delx */ int *tmp; /* for swapping rowO. rowl */ int mis: /* score for each type */ int insO, msl. /* insertion penalties */ register id; /* diagonal index */ register υ; /* jmp index */ register *col0, *coll. /* score tor curr. last row */ register xx. yy; /* index into seqs */ dx = (struct diae *)c calloci 'to get diacs lenO + lenl -t- 1 si/.eoh struct diac)). ndelv = unt *)g_calloo( to get ndelv lenl + 1 sizeof(inU) dely = (int *)g_callocι to get dely lenl + 1, sizeofunt)). colO = (int *)g_alloc( to get colO" lenl + 1 sιzeof(int)) coll = (int *)g_calloc( to get coll ', lenl +1, sizeofϊint)). insO = (dna)' DINSO PINS0. insi = (dna).' DINS1 PINS1. smax = -10000. if (endgaps) { for (col0[0] = dely[01 = -insO. yy = 1, yy < = lenl; yy++) col0[yy] = dely[yyj = col0[yy-lj - msl, ndely[yy] = yy
} col0[0] = 0 /* Waterman Bull Math Biol 84 */
} else for (yy = i \y < = lenl. yy + + ) deiytyy] = -insO.
/* fill in match matrix */ for (px = seqx[0], xx = 1. xx < = lenO; px+ +, xx+ + ) { /* initialize first entry in col */ if (endgaps) { if(xx == 1) col 1 [0] = delx = -OnsO + insl); else col 1(0] = delx = col0[0] - msl; ndelx = xx:
} else { ndelx = 0; Table 1 (conf)
...n seqx[l], yy = 1; yy < = lenl; py+ +. yy++) { mis = col0[yy-l], if (dna) mis += ιχbm[*px- A']&xbm|*py- A'D' DMAT . DMIS; else mis += _day[*px-'A'][*py-'A'|. /* update penalty tor del in x seq.
* favor new del over ongong del
* ignore MAXGAP if weighting endgaps */ if (endgaps | | ndeiylyy] < MAXGAP) { if (col0[yyl - insO > = dely[yy]) { delylyy] = coi0[yy] - (insO + insI); ndely[yy] = 1, } else { dely(yy) -= msl. ndely[yy]+ + :
}
} else { if (col0[yyj - (insO + in l I > = dely(yyl) { delyjyyj = col0[yy| - (insO + insl). ndelylyyj = 1,
} else ndelyjyyj + +
} /* update penalty tor del in y seq;
* favor new del over ongong del */ if (endgaps | | ndelx < MAXGAP) { if (coll(yy-l) - insO >= delx) { delx = coll [yy-11 -dπsO + insl): ndelx = I, } else { delx -= msl; ndelx + + }
} else { if (coll(>y-l| - unsO + insI) > = delx) { delx = coll[yy-l] - (insO + insl); ndelx = 1. } else ndelx+ + .
}
/* pick the maximum score: we're favoring * mis over any del and delx over dely
*/ Table 1 (conf) id = xx - yy + lenl - 1 , ...nw if (mis > = delx && mis > = delyfyy]) coll[yy] = mis; else if (delx > = dely[yy]) { collfyy] = delx: IJ = dxfid) ump: if (dx(ιd).jp n[0) && (Idna 1 1 (ndelx > = MAXJMP && xx > dxfid] jp x[ιj] +MX) 1 1 mis > dx[ιd]. score + DINS0)) { if ( + + ιj > = MAXJMP) { wπtejmps(ιd). ij = dx(ιdj.ιjmρ = 0. dxfid). offset = offset: offset + = sizeof(stπιct jmp) + sizeof(offset): } } dxfidj.jp n[ιjj = ndelx; dx(ιd|.jp.xjιj] = xx: dx(ιd|. score = delx:
} else { col l fyyl = delv(y> ] IJ = dx|ιd] ijmp. if (dx[ιd| jp n|0| && ( 'dna | | (ndelylyy] > = MAXJMP
&& xx > dxfid] jp x(ιj] + MX) [ | mis > dx(ιd].score + DINS0)) { if ( + + ιj > = MAXJMP) { wπtejmps( ιd).
IJ = dxfidj.ijmp = 0. dxfid]. offset = offset: offset + = sizeoftstruct mp) + sizeof(offset):
} } dx(ιd].jp nfij] = -ndelylyy]; dxfidj.jp x(ιjj = xx, dxfid]. score = delyfyy];
} if (xx = = Ien0 && vy < lenl ) {
/* last col
*/ if (endgaps) col lfyy] - = ms0 + ιnsl *(lenl-yy); if (col l fyy] > smax) { s ax = collfyy]; dmax = id, } } } if (endgaps && xx < lenO) coll[yy-l ] - = ιns0 + ιnsl *(len0-xx): if (collfyy- 1] > smax) {
tmp = colO: colO = coll; col l = tmp;
}
(void) fτee((char *)ndely); (void) free((char *)dely);
(void) free((char *)col0); (void) free((char *)coll);
} nw.c Table 1 (conf)
/*
* printO — only routine visible outside this module
* static:
* getmatO - trace back best path, count matches. pπnt()
* pr_ahgn() - print alignment ot described m array pf]: printO
* dumpblockO - dump a block of lines with numbers, stars. pr_ahgn() * numsO ~ put out a number line: dumpblockO
* putlmeO - put out a line (name. fnum|. seq. ]num|): dumpbiockO
* starsO - -put a line of stars: dumpblockO
* stπpnameO - strip any path and prefix from a seqname */
^include nw h"
Λlefine SPC 3
^define P LINE 256 /* maximum output line */ /define P SPC 3 /* space between name or nu and seq */ extern _day(26]f26]. int olen; /* set output line length */
FILE *tx. /* output file *' printO print { int lx. ly, firstgap. lastgap; '* over iiff ((((ffxx == topen(ofiIe. "w")) = = 0) { fpnntKstderr. ' %±. can't write %s\n" . prog, ofile): cleanup( 1 );
} fpπntf(fx, " < first sequence: %s (length = %d)\n". namex(O). lenO): fpnntf(fx. " < second sequence- %s (length = %d)\π" . namexf l ], lenl ) olen = 60; lx = lenO: ly = lenl: firstgap = lastgap = 0 if (dmax < lenl - 1 ) { '* leading gap in x * ' pp[0].spc = Iirst ap = len l - dmax - 1 , ly -= pp[0].spc.
} else if (dmax > lenl - 1 ) { /* leading gap in y */ pp[l].spc = firstgap = dmax - (lenl - 1 ). lx -= pp[l].spc:
} if (dmaxO < lenO - 1) { /* trailing gap in x */ lastgap = lenO - dmaxO -1 ; lx -= lastgap;
} eke if (dmaxO > lenO - 1) { /* trailing gap in y */ lastgap = dmaxO - (lenO - 1), ly -= lastgap;
} getmattfx, ly, firstgap, lastgap); pr_align();
} Table 1 (conf)
/*
* trace back the best path, count matches */ static getmatdx. I\ firstgap. lastgap) getmat int lx, ly; /* "core' (minus endgaps) */ int firstgap, lastgap: /* leading traiiinc overlap */
{ int nm. IO, il. si zO. sizl. char outx[32]. double pet: register nO, nl; register char *p0, *pl.
/* get total matches, score
*/ pO = seqxfO] + pp[l] spe: pt = seqxfl] + pp(0] spe. nO = ppflj.spc + 1. nl = pp(0] spe + 1 nm = 0 while ( *pO&& *pl ) { if(sιzθ) { pl + + . nl + + .
} eellssee {{ if (xbm|*p0- A']&xbm|*pl-'A']) nm+ + . if(nO++ == pp(θ).xfιθl) sizO = pp|01 nfιO+ + ], if(nl + * == pp(l| xfill)
}
/* pet homology
* if penalizing endgaps. base is the shorter seq * else, knock off overhangs and take shorter core
*/ if (endgaps) lx = (lenO < lenl)? lenO : lenl; else lx = (lx < ly)9 lx : ly; pet = 100.*(double)nm/(double)lx: fpnntf(fx, "\n"); fpππtftfx, " < %d match%s in an overlap of %d: %.2l percent sιmιlaπry\n" ran, (nm == 1)? "" : "es", lx, pet); Table 1 (conf) tpπntf(fx. '< gaps in first sequence- %d", gapxj, ...gctmat if (gapx) {
(void) spπntKoutx. ' (%d %s%s)", ngapx, (dna)' 'base '-"residue . (ngapx = = 1)' s"). fpπntf(fx. '%s'. outx); fpπntKtx. ". gaps in second sequence- %d". gapy); if (gapy) {
(void) spπntKoutx. ' ("d %s%s)\ ngapy, (dna)' "base' "residue', (ngapy = = IV "s"). fpπntf(fx."%s", outx);
} if (dna) fpπntKfx.
"\n<score: %d (match = %d. mismatch = %d. gap penaltv = %d + %d per base)\n". smax, DMAT. DMIS. DINSO. DINS1), else fpπntKfx.
"\n< score- %d (Dayhotf PAM 250 matrix, gap penalty = %d + %d per resιdue)\n". smax. PINS0. PINS1). if (endgaps) fpπntKfx
'< endgaps penalized led endgap ' ύ tόs s. right endgap "d %s%s\n . firstgap. i dna)' "base residue (firstgap == 1)'"" "s . lastgap, (dna)' "base residue', (lastgap == 1)' "" "s"). else fpπntKfx. < ndgaps not penalιzed\n )
static nm: /* matches in core - for checking */ static Imax: /* lengths ot stripped file names */ static ij[2]; /* jmp index for a path */ static nc(2]. /* number at start ot current iine */ static nι[2]; /* current elem number — for gapping */ static sιz[2]. static char *ps[2]. /* ptr to current element */ static char *po[2]. /* ptr to next output char slot */ static char oouutt((22]][[IP_LINE], /* output line */ static char starfP 1 il. * set by stars! ) */
/*
* print alignment ot described in struct path ppf]
*/ static
Pr. _align() ρr_align
{ int nn; /* char count */ int more; register l; for (l = 0. Imax = 0. l < 2. ι + +) { nn = stripnametnamexfi]), if (nn > Imax)
Imax = nn: nc[i] = 1: ni[ij = = 1; sizfi] = >j[i] = 0; ps[i] = seqxfi]; po[i] = outfi]; Table 1 (conf) for (nn = nm = 0. more = 1. more: ) { ...pralign for (i = more = 0. i < 2: ι++) { /*
* do we have more ot this sequence? */ if(!*ps[ι]) continue: more+ + . if (ppfij.spc) { /* leading space */ *pofi]++ = ', pp[ι].spc-:
} else if (sizfi]) { /* in a gap */
*po[i] + + = '-'. sizfi]-:
} else { /* we're putting a seq element */ *po[i] = *ps(ι]; if (lslowerCpsfi]))
*ps(ι| = toupper(*ps[ι]). po(ι] + + . ps(ι]+ +
/*
* are we at next gap for this seq.' */ if(ni[i] ==pp|.].x[ιj[ι]]){ /*
* we need to merge all gaps
* at this location */ sizfi] while (nifi] == ppfij.xfijfi]]) sizfi] += pp[ι].n[ιjfι]++],
} nι[i] + + .
}
} if ( + +nn == olen | | Imore && nn) { dumpblockO; for(i = 0; i < 2; i + +) pofi] = outfi]; nn = 0: } }
* dump a block of Imes, including numbers, stars: pr_alιgn()
*/ static dumpblockO dumpblock
{ register i; for(i =0;i < 2;i++) *po[i]- = '\0'; Table 1 (conf)
...dumpblock
(void) putc( \n . fx), for(ι = 0, l < 2. ι + +){ if (*out[ιj && (*outfι] ' = 11 *(po[ι]) ' = )) { if (i ==0) nums(ι). if (i == 0&& *out(l]) starsO; putl e(ι). if(ι = = 0 && *out| 11) fpπntKfx. star). if (i == 1) nums(ι).
/*
* put out a number line- dumpblockO
*/ static nums(ιx) int ix. /* index in ouι| | holding seq line */
{ char nlinefP LlNE] register i.J. register char *pn. *px. *py; for(pn ; = niine. I = 0, I < lmax + P_SPC. ι + + . pn++) *pn = for (i = ncfix], py = outfix]; *py, py++ pn++) { ifCpy == || *py == -)
*pn = ', else { if(ι%10 ==0 || (i == 1 &&nc[ιx] ' = D){ j =(ι < 0)'-ι i. for(px = pπ j. j /= 10 px~)
*px =j%10 + 0 if (i < 0)
*px =
} else
*pn =
1++,
}
}
*pn = '\0'; ncfix] = i. for(pn = niine; *pn, pn++) (void) putc(*pn, lx). (void) putc('\n', fx).
/*
* put out a line (name, fnum], seq, fnum])- dumpblockO
*/ static pιulιne(ιx) putline
{ Table 1 (conf)
...putline int l. register char *px; for(px = namexfix], i = 0, *px && *px ' = , px+ + . ι + +)
(void) putc(*px. fx), for(: l < lmax + P SPC. ι++) (void) putc( . fx).
/* these count from 1
* nif ] is current element ( trom 1 )
* ncf] is number at staπ ot current line */ for (px = outfix]; *px px++)
(void) putc(*px&0x7F, fx); (void) putcl \n', fx),
}
/*
* put a line ot stars (seqs alwavs in out(0] out]l|) dumpblockO */ static stars() stars
register char *p0, *pl. ex. *px, if('*out|0] I I CoutfO] == ' && *(po[0]) == ') | | '•outfi] || (*outfl] == &&*(po[l]) == ')) return: px = star: for (i = lmax + P SPC. I. ι-) *px + + = ' ', for(p0 = ouifO], pi = out|l], *p0 && *pl p0++ pl++){ if (ιsalpha( *p0) && ιsalpha( *p 1 )) { if(xbm|*p0 A ]&xbm|*pl A ]) { ex = '*' nm+ + , } elseif 'dna && _day[*pO-'A'][*pl-'A'l > 0) ex = ' ', else ex = ' ', } else ex = ' '. *px++ = ex;
} *ρx++ = '\n';
*ρx = '\0', Table 1 (conf)
/*
* strip path or prefix from pn, remra len: pr_ahgn() */ static stripname(pn) stripname char *pn: /* file name (may be path) */
{ register char *px, *py; py =0; for(px = pn: *px: px++) if(*px == V) py = px + 1 : if(py).
(void) strcpy(pn. py); return(strlen(pn));
Table 1 (conf)
/*
* cleanupO — cleanup any tmp file
* getseqO — read in seq. set dna. len. maxlen
* g_calloc() - callocO with error checkin
* readjmpsO - get the good mps. trom tmp file if necessary
* writejmpsO — write a filled array of jmps to a tmp file: nwi > */
^include "nw.h" ^include <sys/file.h> char *jname = Vtmp/homgXXXXXX" /* tmp file for jmps */
FILE *fj; int cleanupO; /* cleanup tmp file */ long lseekO;
/* remove any tmp file if we blow
*/ cleanupO) cleanup int
{ if(fj)
(void) unlιnk(jname). exιt(ι):
/*
* read, return ptr to seq. set dna. len. maxlen
* skip lines staπing with ':', '<', or ' > '
* seq in upper or lower case */ char * getseq(file. len) getseq char *file: /* file name */ int *len; /* seq len */ char line(1024], *pseq register char *px, *py; int natgc. tlen.
FILE *fp: if ((fp = toρen(fιIe."r")) == 0) { fpnntKstderr. "%s: can t read %s\n", prog, file): exit(l);
} tlen = natgc = 0: while (ιgets(iine.1024. fp)) { if (*line == ':' 11 *line == '<' 11 *line == '>') continue: for(px = line; *px '= '\n'; px++) if (isuppeπ.*px) || ιsiower(*px)) tlen+ + ;
} if ((pseq = malloc((unsigned)(t!en+6))) = = 0) { fprintf(stderr."%s: raallocO failed to get %d bytes for %s\n", prog, tlen+6. file); exit(l);
} pseq[0] = pseqfl] = pseq[2] = pseq[3] = '\0'; Table 1 (conf)
.getseq py = pseq + 4 *len = tlen. rewιnd(fp). while (fgetsdme 1024 fp)) { if(*hne== || *lιne== < || *lιne== >') continue for (px = line. *px ' = >n px++){ if (ιsupper(*px))
*py + + = *px. else if (islower( *px))
*py++ = loupper(*px) if(ιndex( ATGCU *(py-l))) natgc + + } }
*py++ = \0'. *py = >0 (void) fclose(fp) dna = natgc > (tlen/3) return! pse +4)
} char * g_callocιmsg. nx sz) gcalloc char *msg. /* program callinc routine */ int nx sz. /* number and size ot elements */
{ char *px. *calloc(). if((px = cjiloc((unsιgned)nx (unsιgned)sz)) = = 0) { if (*msg { fpnntKstderr. %s g_calloc() failed %s (n=%d. sz=%d)\n", prog, msg. nx. sz). exκ(l), } } return(px)
/*
* get final jmps trom dx( ] or tmp file set pp[] reset dmax maim )
*/ readjmpsO readjmps
{ int fd = -l. register I, j, xx; if( {
(void) fclose(fj), if ((fd = open(jname.0_RDONLY.0)) < 0) { fpnntKstderr. %s can t open() %s\n", prog, jname), cleanup(l), } } for(ι = iO = il = 0, dmaxO = dmax. xx = lenO; , ι + +) { while (i){ for d = dxfdmax] ijmp; j > = 0 && dxfdmax] jp.xfj] > = xx; J--) Table 1 (conf)
...readjmps if 0 < 0 && dxfdmax] offset && tj) {
(void) Iseekffd. dxfdmax] offset 0), (void) readdd, (char *)&dx[dmax| jp, sizeoftstruct jmp));
(void) readltd, (char *)&dx(dmax] offset. sιzeof(dxfdmax|. offset)); dxfdmax] ijmp = MAXJMP- 1,
} else break.
} if (i > = JMPS) { fpnntKstderr. %s too many gaps in alignment prog). cleanup( 1 ) } ifO > = 0){ siz = dxfdmaxl jp nfjj xx = dxfdmax] jp x(j] if (siz < 0) { /* gap in second seq */
XX + = IZ.
/* id = xx vy + lent - 1 */ pp(I] λf 111 = xx dmax + lenl - 1 gapy + + ngapy -= si7 /* ignore MAXGAP when doing endgaps */ siz = (-siz < MAXGAP | | endgaps)' siz MAXGAP ιl + + .
} else if (siz > 0) { /* gap in first seq */ pp(0] nfiOl = siz. gapx+ + ngapx + = siz. /* ignore MAXGAP when doing endgaps */ siz = (siz < MAXGAP | | endgaps)' siz MAXGAP ι0+ + }
} else break.
} /* reverse the order of jmps
*/ for 0 =0. i0~, j < iO, j + + . ι0~) { i = ppfO] nfj], pp[0].nfj] = pp[0] nfiO], pp[0].n[i0] = .. l = ppf0].x(j], pp[0] xfj] = pp[0] xfiO], pp[0] xfiO] = i. } ford =0, ιl~, j < 11.J + + , ιl--){ l = ppfl] nfj], ppfl] nfj] = ppfl] nfil], ppflj.nfil] = i. . = ppfl]. xfj], ppfl] xfj] = pp(l] xfil], pp[l].x[ιl] = i.
} if (fd > = 0)
(void) close(fd), if(fj){
(void) unlιnk(jname) fj=0; offset = 0,
} } Table 1 (conf)
/*
* write a filled jmp struct offset of the prev one (if anyj: nw() */ wπtejmps(ιx) writejmps
{ char *mktemp(); if (!fj) { if (mktemp(jname) < 0) { fpπntftstderr, %s can t mktempO %s\n". prog, jname): cleanup( l ). } if ((fj = fopendname. 'w")) = = 0) { fpnntKstderr. ' 5όs. can t write %s\n", prog, jname): exιt(l):
} }
(void) fwrιte((char *)&dx[ιx] jp. sizeofi struct jmp), 1 , fj). (void) fwriteuchar *)&dx(ιx| offset. sιzeof(dx(ιx|. offset). 1. fj), }
Table 2
PRO XXXXXXXXXXXXXXX (Length = 15 amino acids) Comparison Protein XXXXYYYYYYY (Length = 12 amino acids)
% amino acid sequence identity =
(the number of identically matching amino acid residues between the two polypeptide sequences as determined by ALIGN-2) divided by (the total number of ammo acid residues of the PRO polypeptide) =
5 divided by 15 = 33.3 %
Table 3
PR0 XXXXXXXXXX (Length = 10 ammo acids)
Comparison Protein XXXXXYYYYYYZZYZ (Length = 15 ammo acids)
% ammo acid sequence identity =
(the number of identically matching amino acid residues between the two polypeptide sequences as determined by ALIGN-2) divided by (the total number of ammo acid residues ot the PRO polypeptide) =
5 divided by 10 = 50%
Table 4
PRO-DNA NNNNNNNNNNNNNN (Length = 14 nucleotides) Comparison DNA NNNNNNLLLLLLLLLL (Length = 16 nucleotides)
% nucleic acid sequence identity =
(the number ot identically matching nucleotides between the two nucleic acid sequences as determined by ALIGN-2) divided by (the total number ot nucleotides ot the PRO-DNA nucleic acid sequence) =
6 divided bv 14 = 42.9%
Table 5
PRO-DNA NNNNNNNNNNNN (Length = 12 nucleotides) Comparison DNA NNNNLLLVV (Length = q nucleotides)
% nucleic acid sequence identity =
(the number ot identicalK matching nucleotides between the two nucieic acid sequences as determined by ALIGN-2) divided b> (the total number ot nucleotides ot the PRO-DNA nucleic acid sequence) =
4 divided bv 12 = 33 3%
II Compositions and Methods of the Invention
1. Preparation ot the PRO polypeptides of the invention
The present invention provides newly identified and isolated nucleotide sequences encoding the polypeptides in the present application as PRO polypeptides In particular, cDNAs encoding vanous PRO polypeptides have been identified and isolated, as disclosed in further detail in the Examples below. It is noted that proteins produced in separete expression rounds may be given different PRO numbers but the UNQ number is unique for any given DNA and the encoded protein, and will not be changed. However, for the sake of simplicity, in the present specification the protein encoded by the full length native nucleic acid molecules disclosed herein as well as all further native homologues and vaπants included m the foregoing definition of PRO. will be referred to as "PRO/number" or even "PRO", regardless of their oπgm or mode of preparation.
In particular. cDNA encoding a PRO200, PRO204, PR0212. PR0216, PR0226. PRO240, PR0235, PR0245. PR0172. PR0273. PR0272, PR0332. PR0526, PRO701. PR0361. PR0362, PR0363. PR0364, PR0356. PR0531. PR0533, PRO1083. PR0865, PRO770, PR0769, PR0788. PROl 1 14, PRO1007, PROl 184. PRO1031. PR01346. PROl 155, PRO1250. PR01312. PROl 192, PR01246. PR01283, PROl 195, PR01343. PR01418. PR01387. PRO 1410. PR01917 PR01868. PRO205. PR021. PR0269. PR0344. PR0333. PR0381 , PRO720. PR0866. PRO840. PR0982. PR0836. PROl 159. PR01358. PR01325. PR0133S. PR01434. PR04333. PRO4302. PRO4430 and PR05727 polypeptide (corresponding to UNQI74. UNQ178. UNQ186, UNQ190, UNQ200. UNQ214. UNQ209, UNQ219. UNQ146. UNQ240. UNQ239. UNQ293. UNQ330. UNQ365, UNQ316, UNQ317, UNQ318. (JNQ319, UNQ313, UNQ332. UNQ334, UNQ540. UNQ434. UNQ408. UNQ407, UNQ430, U Q557. UNQ491, UNQ598, U Q51 . UNQ701. UNQ585. UNQ633. UNQ678, UNQ606. UNQ630. UNQ653, UNQ608, UNQ698, UNQ732. UNQ722, UNQ728, UNQ900. UNQ859, UNQ 179. UNQ21, UNQ236. LTNQ303, UNQ294. UNQ322. UNQ388, UNQ435. UNQ433, UNQ483. UNQ545. UNQ589, UNQ707. UNQ685, UNQ693, UNQ739, UNQ1888, UNO 1866. UNQ 1947 and UNQ2448, respectively) has been identified and isolated, as disclosed in further detail in the Examples below
In even greater particularity, the present specification dcscnbes the cDNAs DNA29101 -1276. DNA30871-1 157. DNA30942- 1 134. DNA33087- 1 158. DNA33460- 1 166. DNA34387- 1 138, DNA35558- 1 167, DNA35638-1141, DNA35916-1 161 , DNA39523-1192, DNA40620-1183, DNA40982-1235, DNA44184-1319, DNA44205-1285. DNA45410-1250, DNA45416-1251, DNA45419-1252. DNA47365- 1206. DNA47470-1130. DNA48314-1320. DNA49435-1219, DNA50921-1458, DNA53974-1401. DNA54228-1366, DNA54231 -1366, DNA56405-1357, DNA57033-1403, DNA57690-1374, DNA59220- 1514, DNA59294-1381. DNA59776-1600, DNA59849-1504, DNA60775-1532, DNA61873- 1574, DNA62814-1521. DNA64885- 1529. DNA65404-1551, DNA65412-1523, DNA66675- 1587, DNA68864- 1629, DNA68872-1620, DNA68874-1622, DNA76400-2528, DNA77624-2515, DNA30868-1156, DNA36638-1056, DNA38260- 1 180, DNA40592-1242. DNA41374-1312, DNA44194- 1317, DNA53517- 1366, DNA53971-1359, DNA53987-1438, DNA57700-1408, DNA59620-1463, DNA60627-1508, DNA64890-1612, DNA66659-1593, DNA66667-1596, DNA68818-2536, DNA84210-2576, DNA92218- 2554, DNA96878-2626, DNA98853-1739 which encode native sequence PRO200, PRO204, PR0212, PR0216, PR0226, PRO240, PR0235, PR0245, PR0172, PR0273, PR0272, PR0332, PR0526, PRO701, PR0361, PR0362, PR0363, PR0364, PR0356, PR0531, PR0533, PRO 1083, PR0865, PRO770, PR0769, PR0788, PROl 1 14. PRO1007. PROl 184. PRO1031. PR01346. PROl 155. PRO1250. PR01312. PR01192, PR01246. PR01283, PROl 195. PR01343, PR01418. PROI387. PRO1410. PR01917, PR01868. PRO205, PR021, PR0269, PR0344. PR0333. PR0381. PRO720, PR0866, PRO840, PR0982, PR0836, PR01159, PR01358, PR01325, PR01338. PR01434, PR04333. PRO4302. PRO4430 and PR05727 polypeptides, respectively
As disclosed in the Examples below, various cDNA clones have been deposited with the ATCC. The actual nucleotide sequence of those clones can readily be determined by the skilled artisan by sequencing of the deposited clone using routine methods in the art. It is understood that the sequence of the deposit contams the correct sequence in the event of a discrepancy between the deposited sequence and those disclosed herein. The predicted amino acid sequence can be determined from the nucleotide sequence using routine skill. For the PRO polypeptides and encodmg nucleic acids descπbed herein. Applicants have identified what is believed to be the reading frame best identifiable with the sequence information available at the time. B. PRO Polypeptide Vanants
In addition to the full-length native sequence PRO polypeptides descπbed herein, it is contemplated that PRO vaπants can be prepared PRO vaπants can be prepared bv introducing appropπate nucleotide changes into the PRO DNA. and'or by synthesis ot the desired PRO polypeptide Those skilled the art will appreciate that amino acid changes mav alter post-translational processes ot the PRO. such as changing the number or position ot glycosviation sites or alteπng the membrane anchoring characteπstics.
Vaπations in the native full-length PRO sequence or in various domains of the PRO described herein. can be made, for example, using any of the techniques and guidelines tor conservative and non-conservative mutations set forth, for instance. U S Patent No 5,364,934 Vaπations may be a substitution, deletion or insertion of one or more codons encoding the PRO that results in a change m the ammo acid sequence of the PRO as compared with the native sequence PRO Optionally the variation is by substitution of at least one ammo acid with any other amino acid in one or more of the domains of the PRO Guidance determining which amino acid residue may be inserted, substituted or deleted without adversely affecting the desired activity mav be found bv comparing the sequence ot the PRO with that of homologous known protein molecules and minimizing the number ot amino acid sequence changes made in regions ot high homology Amino acid substitutions can be the result of replacing one ammo acid with another ammo acid having similar structural and or chemical properties, such as the replacement of a leucine with a serine. / e , conservative amino acid replacements. Insertions or deletions may optionally be in the range of about 1 to 5 am o acids. The vaπation allowed may be determmed by systematically making insertions, deletions or substitutions of ammo acids in the sequence and testing the resulting vaπants for activity exhibited by the full-length or mature native sequence.
PRO polypeptide fragments are provided herein. Such fragments may be truncated at the N-terminus or C-termmus, or may lack internal residues, for example, when compared with a full length native protem. Certain fragments lack ammo acid residues that are not essential for a desired biological activity of the PRO polypeptide.
PRO fragments may be prepared by any of a number of conventional techniques. Desired peptide fragments may be chemically synthesized. An alternative approach involves generating PRO fragments by enzymatic digestion, e g., by treating the protein with an enzyme known to cleave protems at sites defined by particular ammo acid residues, or by digesting the DNA with suitable restπction enzymes and isolating the desired fragment. Yet another suitable technique mvolves isolating and amplifying a DNA fragment encoding a desired polypeptide fragment, by polymerase chain reaction (PCR). Oligonucleotides that define the desired termmi of the DNA fragment are employed at the 5' and 3' pnmers in the PCR. Preferably, PRO polypeptide fragments share at least one biological and'or immunological activity with the native PRO polypeptide disclosed herein.
In particular embodiments, conservative substimtions of mterest are shown in Table 6 under the headmg of preferred substitutions. If such substimtions result in a change in biological activity, then more substantial changes, denominated exemplary substimtions in Table 6. or as further descπbed below in reference to ammo acid classes, are introduced and the products screened.
Table 6
Oπgmal Exemplary Preferred
Residue Substimtions Substimtions
Arg (R) lys; gin: asn lys
Asn (N) gin: his: lys; arg gin
Asp (D) glu glu
Cys (C) ser ser
Gin (Q) asn asn
Glu (E) asp asp
Gly (G) pro; ala ala
His (H) asn: gin: lys; arg arg
He (I) leu; val: met; ala; phe; norleucine leu
Leu (L) norleucine; lie val;
Lys (K) arg; gin; asn arg
Met (M) leu; phe; ile leu
Phe (F) leu; val: ile; ala; ryr leu
Pro (P) ala ala
Ser (S) thr thr
Thr (T) ser ser
Trp (W) fyr; phe tyr
Tyr (Y) tip; phe; thr; ser phe
Val (V) ile; leu; met; phe; ala; norleucine leu
Substantial modifications in function or immunological identity of the invention polypeptide are accomplished by selecting substimtions that differ significantly in their effect on maintaining (a) the structore of the polypeptide backbone in the area of the substitution, tor example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side cham. Naturally occumng residues are divided into groups based on common side-cham properties: ( 1 ) hydrophobic: norieucme. met, ala. val. leu, ile, 5 (2) neutral hydrophilic: cys, ser. thr;
(3) acidic: asp, glu;
(4) basic: asn. gin, his. lys, arg;
(5) residues that influence chain oπentation: gly, pro: and
(6) aromatic: tip, tyr, phe.
10 Non-conservative substimtions will entail exchangmg a member of one of these classes for another class. Such substituted residues also may be introduced into the conservative substitution sites or. more preferably, into the remammg (non-conserved) sites.
The vaπations can be made using methods known in the art such as ohgonucleotide-mediated (site- directed) mutagenesis. alanine scanning, and PCR mutagenesis Site-directed mutagenesis fCarter et al . Nucl.
I S It ids Res . J_3 4331 ( 1986). Zoller <?/ «/ . Nucl Acids Res . j θ.6487 ( 1987)1. cassette mutagenesis f Wells et al .
Gene. 34 315 ( 1985)]. restnction selection mutagenesis [Wells et at , Philos Trans. R. Soc. London SerA. 317 415 ( 1986)j or other known techniques can be performed on the cloned DNA to produce the PRO variant variant DNA
Scanning amino acid analysis can also be employed to identify one or more ammo acids along a 0 contiguous sequence. Among the preferred scanning amino acids are relatively small, neutral amino acids. Such ammo acids include alanine, glycme. seπne, and cysteine. Alanme is typically a preferred scanning ammo acid among this group because it eliminates the side-chain beyond the beta-carbon and is less likely to alter the main-chain conformation of the vanant [Cunningham and Wells. Science. 244. 1081 -1085 ( 1989)]. Alanine is also typically preferred because it is the most common amino acid. Further, it is frequently found m 5 both buried and exposed positions [Creighton. The Proteins. (W H. Freeman & Co., N.Y.): Chothia. J. Mol. Biol . 150.1 ( 1976)] If alanine substitution does not yield adequate amounts of vanant. an lsoteπc amino acid can be used.
C. Modifications of PRO
Covalent modifications of PRO polypeptides are included within the scope of this invention. One 0 type of covalent modification includes reacting targeted ammo acid residues of a PRO polypeptide with an organic deπvatizing agent that is capable of reacting with selected side chains or the N- or C- terminal residues of the PRO. Deπvatization with bifunctional agents is useful, for instance, for crosshnking PRO to a water- msoluble support matπx or surface for use in the method for puπfymg anti-PRO antibodies, and vice-versa. Commonly used crosslinking agents include, e.g., l,l-bis(dιazoacetyl)-2-phenylethane, glutaraldehyde, N-
35 hydroxysuccmimide esters, for example, esters with 4-azidosalicylic acid, homobifimctional imidoesters, including disuccinimidyl esters such as 3,3'-dithiobis(succιnιmidylpropιonate), bifunctional maleimides such as bis-N-maieimido-l,8-octane and agents such as methyl-3-[(p-azidophenyl)dithio]propιoιmidate.
Other modifications include deamidation of glutaminyl and asparagmyl residues to the corresponding glutamyl and asparryi residues, respectively, hydroxylation of proline and lysine, phosphorylation of hydroxyl 0 groups of seryl or threonyl residues, methylation of the α-ammo groups of lysine, argmme. and histidine side chams [T.E. Creighton. Proteins Structure and Molecular Properties. W.H. Freeman & Co.. San Francisco, pp. 79-86 ( 1983)], aceryiation ot the N-terminal amine. and amidation of any C-terminai carboxyi group.
Another type of covalent modification of the PRO polypeptide included withm the scope of this invention compπses alteπng the native glycosylation pattern of the polypeptide. "Altenng the native glycosylation pattern" is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence PRO polypeptide (either by removing the underlying glycosylation site or by deleting the glycosylation by chemical and/or enzymatic means), and/or adding one or more glycosylation sites that are not present in the native sequence PRO. In addition, the phrase includes qualitative changes in the glycosylation of the native proteins, involving a change in the nature and proportions of the vaπous carbohydrate moieties present.
Addition of glycosylation sites to the PRO polypeptide may be accomplished by alteπng the amino acid sequence. The alteration may be made, for example, by the addition of. or substitution by, one or more serine or threonine residues to the native sequence PRO (for O-lmked glycosylation sites). The PRO ammo acid sequence may optionally be altered through changes at the DNA level, particularly by mutating the DNA encoding tne PRO polypeptide at preselected bases such that codons are generated that will translate into the desired amino acids
Another means of increasing the number of carbohydrate moieties on the PRO polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, e.g.. in WO 87, 05330 published 1 1 September 1987. and in Aplin and Wr.ston. CRC Crit. Rev. Biochem . pp. 259- 306 ( 1981 )
Removal of carbohydrate moieties present on the PRO polypeptide may be accomplished chemically or enzymatically or by mutat.onal substitution of codons encoding for ammo acid residues that serve as targets for glycosylation. Chemical deglycosyiation techniques are known in the art and described, for instance, by Hakimuddin. et al , Arch Biochem Biophvs . 259-52 ( 1987) and by Edge a al . Anal. Biochem . H 8.131 ( 1981 ) Enzymatic cleavage ot carbohydrate moieties on polypeptides can be achieved by the use of a vaπery of endo- and exo-glycosidases as described by Thotakura et al., Met . Enzvmoi. _38.350 ( 1987)
Another type of covalent modification ot PRO compnses linking the PRO polypeptide to one ot a vanety of nonprotemaceous polymers, .g., polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylenes. in the manner set forth in U.S. Patent Nos. 4,640.835; 4,496,689; 4,301 ,144: 4,670,417; 4,791.192 or 4,179,337.
The PRO polypeptides may also be modified in a way to form a chimenc molecule compπsing the invention polypeptide fused to another, heterologous polypeptide or ammo acid sequence.
In one embodiment, such a chimenc molecule compnses a fusion of the PRO with a tag polypeptide which provides an epitope to which an anti-tag antibody can selectively bind. The epitope tag is generally placed at the ammo- or carboxyl- terminus of the PRO. The presence of such epitope-tagged forms of the PRO polypeptide can be detected using an antibody against the tag polypeptide. Also, provision of the epitope tag enables the PRO to be readily puπfied by affinity puπfication using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag. Various tag polypeptides and their respective antibodies are well known m the art. Examples include poly-histidine (poly-his) or poly-histidine-glycine (poly-his-gly) tags; the flu HA tag polypeptide and its antibody 12CA5 [Field et al.. Mol. Cell. Biol., 8:2159-2165 (1988)]; the c-myc tag and the 8F9. 3C7. 6E 10, G4. B7 and 9E 10 antibodies thereto [ Ev an et al Molecular and Cellular Biology, 5:3610-3616 ( 1985)], and the Herpes Simplex virus glycoprotem D (gD) tag and its antibody [Paborsky et al.. Protein Engineering, 3(6) 547-553 ( 1990)] Other tag polypeptides include the Flag-peptide [Hopp et al.. BioTechnology, 6. 1204-1210 ( 1988)]. the KT3 epitope peptide [Martin et al Science, 255.192-194 (1992)]; an α-tubuhn epitope peptide [Skinner et al , J Biol Chem , 266 15163-15166 ( 1991)]; and the T7 gene 10 protein peptide tag [Lutz-Freyermuth et al , Proc Natl Acad Set USA. 87 6393-6397 (1990)].
In an alternative embodiment, the chimenc molecule may compπse a fusion of the PRO polypeptide with an immunoglobulin or a particular region of an immunoglobulin. For a bivalent form of the chimenc molecule (also referred to as an "lmmunoadhesin ). such a fusion could be to the Fc region of an IgG molecule. The Ig fusions preferably include the substitution of a soluble (transmembrane domain deleted or inactivated) form ot an mveπtion polypeptide in place of at least one vaπable region withm an Ig molecule. In a particularly preferred embodiment, the immunoglobulin fusion includes the hmge. CH2 and CH3, or the hinge, CHI . CH2 and CH3 regions of an IgG I molecule For the production of immunoglobulin fusions see also US Patent No 5.428, 130 issued June 27, 1995 D Preparation of PRO
The descπption below relates to primarily lo production of PRO by culmπng cells transformed or transfected with a vector containing PRO nucleic acid It is. ot course, contemplated that alternative methods, which are well known in the art. mav be employed to prepare PRO. For instance, the PRO sequence, or portions thereof, may be produced by direct peptide synthesis using solid-phase techniques [see, e g.. Stewart et al., Solid-Phase Peptide Svnthesis. W H Freeman Co , San Francisco, CA ( 1969). Merπfield, J Am Chem Soc 85 2149-2154 ( 1963)] In vitro protein synthesis may be performed using manual techniques or by automation Automated synthesis may be accomplished, for instance, using an Applied Biosystems Peptide Synthesizer (Foster City. CA) using the manufacmrer's instructions Vaπous portions of the PRO may be chemically synthesized separately and combined using chemical or enzymatic methods to produce the full- length PRO
1 Isolation ot DNA Fncodine the PRO Polvpeptιde(s)
DNA encoding the PRO mav be obtained from a cDNA library prepared from tissue believed to possess the polypeptide mRNA and to express it at a detectable level. Accordingly, human PRO DNA can be conveniently obtained from a cDNA library prepared from human tissue, such as descπbed in the Examples. The PRO-encodmg gene may also be obtained from a genomic library, oligonucleotide synthesis, or other known synthetic procedures (e g , automated nucleic acid synthesis).
Libranes can be screened with probes (such as antibodies to the PRO polypeptide or oligonucleotides of at least about 20-80 bases) designed to identify the gene of interest or the prote encoded by it. Screenmg the cDNA or genomic library with the selected probe may be conducted using standard procedures, such as descπbed in Sambrook et al , Molecular Cloning A Laboratorv Manual (New York: Cold Spπng Harbor Laboratory Press, 1989). An alternative means to isolate the gene encoding the PRO polypeptide is to use PCR methodology [Sambrook et al., supra; Dieffenbach et al., PCR Primer: A Laboratory Manual (Cold Spπng Harbor Laboratory Press, 1995)].
The Examples below descnbe techniques for screenmg a cDNA library. The oligonucleotide sequences selected as probes should be of sufficient length and sufficiently unambiguous that false positives are minimized. The oligonucleotide is preferably labeled such that it can be detected upon hybndization to DNA in the library being screened. Methods of labeling are well known in the art, and include the use of radiolabels like :P-labeled ATP, biot ylation or enzyme labeling. Hybndization conditions, including moderate stringency and high stringency, are provided m Sambrook et al . supra. Sequences identified in such library screening methods can be compared and aligned to other known sequences deposited and available m public databases such as GenBank or other private sequence databases. Sequence identity (at either the amino acid or nucleotide level) withm defined regions of the molecule or across the full-length sequence can be determined using methods known the art and as descπbed herem.
Nucleic acid having protein coding sequence may be obtained by screening selected cDNA or genomic libranes using the deduced amino acid sequence disclosed herein for the first time. and. if necessary, using conventional pπ er extension procedures as descnbed in Sambrook et al., supra, to detect precursors and processing intermediates of mRNA that may not have been reverse-transcπbed into cDNA. 2. Selection and Transformation of Host Cells
Host cells are transfected or transformed with expression or cloning vectors descπbed herein for production ot the PRO polypeptides and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transtormants. or amplifying the genes encoding the desired sequences The culture conditions, such as media, temperamre. pH and the like, can be selected by the skilled artisan without undue e.xpeπmentation In general, principles, protocols, and practical techniques for maximizing the productivity of cell cultures can be found in Mammalian Cell Biotechnology A Practical Approach. M. Butler, cd (IRL Press. 1991 ) and Sambrook et al . supra.
Methods of transfection are known to the ordmaπly skilled artisan, for example. CaP04 and electroporation. Depending on the host cell used, transformation is performed using standard techniques appropπate to such cells. The calcium treatment employing calcium chloπde. as descπbed in Sambrook et al., supra, or electroporation is generally used for prokaryotes or other cells that contain substantial cell-wall barriers Infection with Agrobacterium tumefaciens is used for transformation of certain plant cells, as described by Shaw et al . Gene. 23 315 ( 1983) and WO 89/05859 published 29 June 1989. For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham and van der Eb. Virology, 52:456-457 (1978) can be employed. General aspects of mammalian cell host system transformations have been descπbed in U.S. Patent No 4.399.216. Transformations into yeast are typically earned out according to the method of Van Solingen et al, J. Bact.. 30:946 (1977) and Hsiao et al., Proc. Natl. Acad. Sci. (USA), 76:3829 (1979). However, other methods for introducing DNA into ceils, such as by nuclear microinjection, electroporation. bacteπal protoplast fusion with intact cells, or polycations. e.g., polybrene, polyomithme. may also be used. For vaπous techniques for transforming mammalian cells, see eown et al.. Methods in Enzvmology, ]85:527-537 (1990) and Mansour et al.. Nature. 336:348-352 (1988). Suitable host cells for cloning or expressing the DNA in the vectors herein include prokaryote, yeast, or higher eukaryote cells. Suitable prokaryotes include but are not limited to eubacteria. such as Gram- negative or Gram-positive organisms, for example, Enterobacteriaceae such as E. coli. Various E. coli strains are publicly available, such as E. coli K12 strain MM294 (ATCC 31,446); E. coli X1776 (ATCC 31,537); E. coli strain W3110 (ATCC 27,325) and K5 772 (ATCC 53,635). Other suitable prokaryotic host cells include Enterobacteπaceae such as Escherichia, e.g., E. coli, Enterobacter, Erwinia, Klebsiella. Proteus, Salmonella, e.g., Salmonella tvphimurium. Serraua. e g , Serrana marcescans. and Shigella. as well as Bacilli such as B. subttlis and B. lichemformts (e g., B. hchemformis 41P disclosed in DD 266.710 published 12 Apπi 1989), Pseudomonas such as P aentginosa. and Streptomvces. These examples are illustrative rather than limiting. Strain W31 10 is one particularly preferred host or parent host because it is a common host strain for recombinant DNA product fermentations. Preferably, the host cell secretes minimal amounts of proteolytic enzymes. For example, strain W31 10 may be modified to effect a genetic mutation in the genes encoding proteins endogenous to the host, with examples of such hosts including E. coli W31 10 strain 1A2. which has the complete genotype ton.4 : E. coli W3 1 10 strain 9E4. which has the complete genotype tonA ptri; E. coli W31 10 strain 27C7 (ATCC 55,244). which has the complete genotype tonA ptri phoA E15 (argF-lac)l69 degP ompT kan . E. coli W31 10 strain 37D6. which has the complete genotype tonA ptri phoA E15 (argF- lac)169 degP ompT rbs7 ilvG kan : E. coli W31 10 strain 40B4. which is strain 37D6 with a non-kanamyciπ resistant degP deletion mutation: and an E. coli strain having mutant periplasmic protease disclosed in U.S. Patent No 4,946.783 issued 7 August 1990. Alternatively, in vitro methods of cloning, e.g., PCR or other nucieic acid polymerase reactions, are suitable. In addition to prokaryotes. eukaryotic microbes such as filamentous fungi or veast are suitable cloning or expression hosts tor PRO-encodmg vectors Saccharomvces ccrevisiae is a commonly used lower eukaryotic host microorganism. Others include Schizosaccharomvccs pombe (Beach and Nurse. Nature. 290: 140 [ 1981 ], EP 139.383 published 2 May 1985). Kluweromvces hosts (U S. Patent No. 4.943.529: Fleer et al., Bio/Technology, 9 968-975 ( 1991 )) such as. c g , K lactis (MW98-8C, CBS683, CBS4574. Louvencourt et al.. J. Bacteriol . 54(2):737-742 [ 1983]), K fragihs (ATCC 12,424). K. bulgaricus (ATCC 16.045), K. wickeramu (ATCC 24.178), K waltn (ATCC 56,500). A', drosophilarum (ATCC 36.906: Van den Berg et al., Bio/Technology, 8 135 ( 1990)), K. thermotoleran . and K marxianus; yarrowia (EP 402.226): Pichia pastons (EP 183.070, Sreekπshna et at., J Basic Microbiol.. 28.265-278 [1988]); Candida. Tnchoderma reesia (EP 244,234). Neurospora crassa (Case et al , Proc. Natl Acad. Sci. USA, 76:5259-5263 [ 1979]). Schwanmomvc j uch as Schwannio mre.? occidentalis (EP 394.538 published 31 October 1990); and filamentous fungi such as. e g . Neuro pora. Penicillium. Tυhpocladium I WO 91 /00357 published 10 January 1991 ). and Λ sperg lus hosts such as A nidulans (Ballance et al . Biochem Biophvs. Res Commun.. 1 12:284-289 [ 1983], Tilbum et al.. Gene. 26:205-221 [ 1983]; Yelton et al.. Proc. Natl. Acad. Sci. USA. 8__: 1470- 1474 [ 1984]) and A. ntger (Kelly and Hynes. EMBO J.. 4.475-479 [1985]). Methylotropic yeasts are suitable herein and include, but are not limited to, yeast capable of growth on methanol selected from the genera consisting of Hansenula,
Candida, Kloeckera. Pichia. Saccharomvces, Torulopsis, and Rhodotorula. A list of specific species that are exemplary of this class of yeasts may be found in C. Anthony, The Biochemistry ofMethylotrophs, 269 ( 1982).
Suitable host ceils for the expression of glycosyiated PRO polypeptides are deπved from multicellular organisms. Examples of invertebrate cells include insect cells such as Drosophila S2 and Spodoptera Sf9, as well as plant cells. Examples of useful mammalian host cell lines include Chinese hamster ovary (CHO) and COS cells. More specific examples include monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al. J. Gen Virol. 36:59 ( 1977)); Chinese hamster ovary cellsADHFR (CHO, Urlaub and Chasm, Proc. Natl. Acad. Sci. USA 77:4216 (1980)); mouse sertoli cells (TM4, Mather, Biol. Reprod. 23:243-251 (1980)); human lung cells (WI38, ATCC CCL 75); human liver cells (Hep G2, HB 8065); and mouse mammary tumor (MMT 060562. ATCC CCL51 ) The selection of the appropπate host cell is deemed to be withm the skill in the art.
3. Selection and Use of a Rep cable Vector
The nucleic acid (e g., cDNA or genomic DNA) encodmg the PRO polypeptides may be inserted into a rephcable vector for clonmg (amplification of the DNA) or for expression. Various vectors are publicly available. The vector may. for example, be in the form of a plasmid. cosmid. viral particie. phagemid or phage. The appropπate nucleic acid sequence may be inserted into the vector by a vaπefy of procedures. In generaL DNA is inserted into an appropπate resrπction endonuclease sιte(s) using techniques known in the art. Vector components generally include, but are not limited to. one or more of a signal sequence, an oπgin of replication. one or more marker genes, an enhancer element, a promoter, and a transcnption termination sequence. Construction of suitable vectors containmg one or more of these components employs standard ligation techniques which are known to the skilled artisan.
The PRO may be produced recombmantly not only directly, but also as a fusion polypeptide with a heterologous polypeptide. which may be a signal sequence or other polypeptide having a specific cleavage site at the N-terminus of the mature protein or polypeptide. In general, the signal sequence mav be a component of the vector, or it may be a part of the PRO-encoding DNA that is inserted into the vector. The signal sequence may be a prokarvotic signal sequence selected, for example, from the group of the alkaline phosphatase. penicilhnase. Ipp, or heat-stable enterotoxin II leaders. For yeast secretion the signal sequence may be, e.g., the yeast invertase leader, alpha factor leader (including Saccharomvces and Kluvveromyces α-factor leaders, the latter descπbed in U.S. Patent No. 5,010,182). or acid phosphatase leader, the C. albicans glucoamylase leader (EP 362.179 published 4 Apπl 1990), or the signal descπbed in WO 90/13646 published 15 November 1990. In mammalian cell expression, mammalian signal sequences may be used to direct secretion of the protein, such as signal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells Such sequences are well known for a vaπety of bactena. yeast, and viruses. The oπgin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2μ plasmid oπgm is suitable for yeast, and various viral origins (SV40, polyoma. adenovirus. VSV or BPV) are useful for clonmg vectors in mammalian cells. Expression and cloning vectors will typically contain a selection gene, also termed a selectable marker. Typical selection genes encode protems that (a) confer resistance to antibiotics or other toxms, e.g., ampicillin. neomycin, methotrexate, or tetracycime, (b) complement auxotrophic deficiencies, or (c) supply cπtical nurπents not available from complex media, e.g., the gene encoding D-alanine racemase for Bacilli.
An example of suitable selectable markers for mammalian cells are those that enable the identification of cells competent to take up the PRO-encoding nucleic acid, such as DHFR or thymidine kinase. An appropπate host cell when wild-type DHFR is employed is the CHO cell line deficient in DHFR activity, prepared and propagated as described by Urlaub et al., Proc. Natl. Acad. Sci. USA, 77:4216 (1980). A suitable selection gene for use in yeast is the trpϊ gene present m the yeast plasmid YRp7 [Stinchcomb et al. Nature, 282:39 (1979); Kingsman et al, Gene, 7:141 (1979); Tschemper et al. Gene, ]0:157 (1980)]. The trpl gene provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example, ATCC No. 44076 or PEP4- 1 [Jones. Genetics. 85 12 (1977)]
Expression and cloning vectors usually contain a promoter operably linked to the PRO-encodmg nucleic acid sequence to direct mRNA synthesis. Promoters recognized by a vanety of potential host cells are well known. Promoters suitable for use with prokaryotic hosts include the β-lactamase and lactose promoter systems [Chang et al. Nature. 275:615 (1978); Goeddel et al . Nature, 28__:544 ( 1979)], alkaline phosphatase. a tryptophan (tip) promoter system [Goeddel. Nucleic Acids Res., 8.4057 (1980): EP 36,776], and hybπd promoters such as the tac promoter [deBoer et al. Proc. Natl. Acad. Sci. USA. 80:21-25 (1983)]. Promoters for use in bacteπai systems also will contain a Shine-Dalgarno (S.D.) sequence operably linked to the DNA encoding PRO. Examples of suitable promoting sequences for use with yeast hosts include the promoters for 3- phosphogiycerate kinase [Hitzeman et al . J. Biol Chem . 255:2073 (1980)] or other glycolytic enzymes [Hess et al, J. Adv Enzvme Reg., 7 149 (1968); Holland. Biochemistry, ]7 4900 ( 1978)], such as enolase. glyceraldehyde-3-phosphate dehydrogenase, hexokmase. pyruvate decarboxyiase, phospho-fructokinase, glucose-6-phosphate isomerase. 3-phosphoglycerate mutase. pyruvate kinase. tπosephosphate isomerase. phosphogiucose isomerase. and glucokinase
Other yeast promoters, which are inducible promoters having the additional advantage of transcπption controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2. isocytochrome C. acid phosphatase. degradative enzymes associated with nitrogen metabolism, metallothionein. glyceraldehyde-3- phosphate dehydrogenase. and enzymes responsible for maltose and galactose utilization. Suitable vectors and promoters for use in yeast expression are further descπbed in EP 73,657.
PRO transcπption from vectors in mammalian host cells is controlled, for example, by promoters obtained from the genomes of viruses such as polyoma virus, fowlpox virus (UK 2.21 1,504 published 5 July 1989). adenovirus (such as Adenovirus 2). bovine papilloma virus, avian sarcoma virus, cytomegalovirus. a retrovirus. hepatitis-B virus and Simian Virus 40 (SV40). from heterologous mammalian promoters, e.g . the actm promoter or an immunoglobulin promoter, and from heat-shock promoters, provided such promoters are compatible with the host cell systems.
Transcπption ot a DNA encoding the PRO polypeptide by higher eukaryotes may be increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp, that act on a promoter to increase its transcπption. Many enhancer sequences are now known from mammalian genes (globin. elastase, albumin, α-fetoprotem. and msuhn). Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication oπgm (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication oπgm, and adenovirus enhancers. The enhancer may be spliced into the vector at a position 5' or 3' to the coding sequence of the PRO polypeptide. but is preferably located at a site 5' from the promoter.
Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant, animal, human, or nucleated cells from other multicellular organisms) will also contain sequences necessary for the termination of transcπption and for stabilizing the mRNA. Such sequences are commonly available from the 5' and, occasionally 3', untranslated regions of eukaryotic or viral DNAs or cDNAs. These regions contain nucleotide segments transcπbed as polyadenylated fragments in the untranslated portion of the mRNA encodmg PRO. Still other methods, vectors, and host cells suitable for adaptation to the synthesis of the PRO polypeptide in recombinant vertebrate ceil culture are descnbed in Gething et al , Nature, 293:620-625 (1981); Mantei et al, Nature. 281.40-46 ( 1979); EP 117,060; and EP 1 17.058. 4. Detecting Gene Expression Gene expression may be measured m a sample directly, for example, by conventional Southern blotting. Northern blotting to quantitate the transcription of mRNA [Thomas, Proc. Natl Acad. Sci. USA, 77.5201 -5205 ( 1980)], dot blotting (DNA analysis), or in situ hybndization. using an appropπateiy labeled probe, based on the sequences provided herein. Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes. RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes The antibodies m mm may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.
Gene expression, alternatively, may be measured by immunological methods, such as immunohistochemical staining of cells or tissue sections and assav of cell culture or body fluids, to quantitate directly, the expression ot gene product. Antibodies useful for immunohistochemical staining and or assay of sample fluids mav be either monoclonal or polyclonal. and may be prepared in any mammal. Conveniently, the antibodies may be prepared against a native sequence PRO polypeptide or against a synthetic peptide based on the DNA sequences provided herein or against exogenous sequence fused to DNA encoding the PRO polypeptide and encoding a specific antibody epitope. 5. Puπfication of Polypeptide
Forms of the PRO may be recovered from culture medium or from host cell lysates. If membrane- bound, it can be released from the membrane using a suitable detergent solution (e.g., Triton* -X 100) or by enzymatic cleavage. Cells employed in expression of the PRO polypeptide can be disrupted by vaπous physical or chemical means, such as freeze-thaw cycling, sonication. mechanical disruption, or cell lysing agents
It may be desired to puπfy PRO polypeptide from recombinant ceil proteins or polypeptides. The following procedures are exemplary of suitable purification procedures: by fractionation on an ion-exchange column: ethanol precipitation: reverse phase HPLC, chromatography on silica or on a cation-exchange resin such as DEAE; chromatofocusmg; SDS-PAGE. ammonium sulfate precipitation; gel filtration using, for example. Sephadex G-75; protein A Sepharose columns to remove contammants such as IgG: and metal chelating columns to bind epitope-tagged forms of the PRO polypeptide. Various methods of protem puπfication may be employed and such methods are known in the art and descπbed for example m Deutscher. Methods in Enzvmology, ]__2 (1990); Scopes, Protein Purification: Principles and Practice, Springer- Verlag, New York (1982). The puπfication step(s) selected will depend, for example, on the nature of the production process used and the particular PRO polypeptide produced. E. Tissue Distribution
The location of tissues expressmg the PRO can be identified by determining mRNA expression in vanous human tissues. The location of such genes provides information about which tissues are most likely to be affected by the stimulating and inhibiting activities of the PRO polypeptides. The location of a gene in a specific tissue also provides sample tissue for the activity blocking assays discussed below. As noted before, gene expression in vanous tissues mav be measured by conventional Southern blotting, Northern blotting to quantitate the transcπption of mRNA (Thomas. Proc. Natl. Acad. Sci. USA. 77.5201 -5205 [ 1980]). dot blotting (DNA analysis), or in situ hybridization, usmg an appropπately labeled probe, based on the sequences provided herein. Alternatively, antibodies may be employed that can recognize specific duplexes, mcludmg DNA duplexes. RNA duplexes, and DNA-RNA hybπd duplexes or DNA-protein duplexes.
Gene expression m vaπous tissues, alternatively, may be measured by immunological methods, such as immunohistochemical staining of tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product. Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any mammal. Conveniently, the antibodies may be prepared against a native sequence of a PRO polypeptide or agamst a synthetic peptide based on the DNA sequences encoding the PRO polypeptide or agamst an exogenous sequence fused to a DNA encoding a PRO polypeptide and encoding a specific antibody epitope. General techniques for generating antibodies, and special protocols for Northern blotting and in situ hybπdization are provided below F Antibody Binding Studies
The activity of the PRO polypeptides can be further verified by antibody binding studies, in which the ability ot antι-PRO200. antι-PRO204. antι-PR0212. antι-PR0216. antι-PR0226, antι-PRO240. antι-PR0235. antι-PR0245. antι-PR0172, antι-PR0273. antι-PR0272, antι-PR0332, antι-PR0526. antι-PRO701 , anti- PR0361. antι-PR0362. antι-PR0363. antι-PR0364. antι-PR0356. antι-PR0531 , antι-PR0533. antι-PRO1083. antι-PR0865. antι-PRO770, antι-PR0769. antι-PR0788. anti-PRO l 1 14, antι-PRO1007. anti-PRO l 184. anti- PRO1031. antι-PR01346. anti-PROl 155, antι-PRO 1250. antι-PR013 I2. anti-PROl 192. antι-PR01246. anti- PR01283. anti-PRO l 195, antι-PR01343, antι-PR01418, antι-PR01387, antι-PRO 1410. antι-PR01917, anti- PR01868. antι-PRO205, antι-PR021. antι-PR0269, antι-PR0344. antι-PR0333. antι-PR0381. antι-PRO720. antι-PR0866. antι-PRO840. antι-PR0982. antι-PR0836. anti-PROl 159, antι-PR01358. antι-PR01325. anti- PR01338. antι-PR01434. antι-PR04333. antι-PRO4302. antι-PRO4430 or antι-PR05727 antibodies to inhibit the effect ot the PRO200. PRO204. PR0212. PR0216, PR0226. PRO240. PR0235. PR0245. PRO 172. PR0273. PR0272. PR0332. PR0526. PRO701. PR0361. PR0362, PR0363. PR0364. PR0356. PR053 1. PR0533. PRO1083. PR0865, PRO770, PR0769, PR0788, PROl 1 14, PRO1007, PRO l 184, PRO1031 , PR01346. PROl 155. PRO1250. PR01312, PROl 192, PRO 1246, PR01283, PROl 195. PR01343, PR01418. PR01387, PRO1410, PR01917. PRO I 868, PRO205. PR021 , PR0269. PR0344, PR0333, PR0381 , PRO720, PR0866, PRO840, PR0982, PR0836, PROl 159, PR01358, PR01325, PR01338, PR01434, PR04333, PRO4302, PRO4430 or PR05727 polypeptides. respectively, on tissue cells is tested. Exemplary antibodies include polycional. monoclonal, humanized, bispecific. and heteroconjugate antibodies, the preparation of which will be descπbed hereinbelow. Antibody binding studies may be earned out in any known assay method, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays. Zola, Monoclonal Antibodies: A Manual of Techniques, pp.147- 158 (CRC Press, Inc., 1987).
Competitive binding assays rely on the ability of a labeled standard to compete with the test sample analyte for binding with a limited amount of antibody. The amount of target protein in the test sample is inversely proportional to the amount of standard that becomes bound to the antibodies. To facilitate determining the amount of standard that becomes bound, the antibodies preferably are insolubilized before or after the competition, so that the standard and analyte that are bound to the antibodies may conveniently be separated from the standard and analyte which remain unbound.
Sandwich assays involve the use of two antibodies, each capable of binding to a different immunogenic portion, or epitope, of the protein to be detected. In a sandwich assay, the test sample analyte is bound by a first antibody which is immobilized on a solid support, and thereafter a second antibody binds to the analyte, thus forming an insoluble three-part complex. See, e.g., US Pat No. 4,376,110. The second antibody may itself be labeled with a detectable moiety (direct sandwich assays) or may be measured using an anti-immunoglobu n antibody that is labeled with a detectable moiety (indirect sandwich assay) For example, one type of sandwich assay is an ELISA assay, in which case the detectable moiety is an enzyme.
For lmmunohistochemistry. the tissue sample may be fresh or frozen or may be embedded in paraffin and fixed with a preservative such as formalin, for example. G. Cell-Based Assays Cell-based assays and animal models for immune related diseases can be used to further understand the relationship between the genes and polypeptides identified herein and the development and pathogenesis of immune related disease.
In a different approach, cells of a cell type known to be involved in a particular immune related disease are transfected with the cDNAs descnbed herein, and the ability of these cDNAs to stimulate or inhibit immune function is analyzed. Suitable cells can be transfected with the desired gene, and monitored for immune function activity. Such transfected cell lines can then be used to test the ability of poly- or monoclonal antibodies or antibody compositions to inhibit or stimulate immune function, for example to modulate T-cell proliferation or inflammatory cell infiltration. Cells transfected with the codmg sequences of the genes identified herein can further be used to identify drug candidates for the treatment of immune related diseases. In addition, pπmary cultures derived from transgenic animals (as descπbed below) can be used in the cell-based assays herein, although stable cell lines are preferred. Techniques to deπve continuous cell lines from transgenic animals are well known in the art (see, e.g.. Small et al. Mol Cell. Biol. 5: 642-648 [ 1985]).
One suitable cell based assay is the mixed lymphocyte reaction (MLR). Current Protocols in Immunology, unit 3.12; edited by J E Coligan, A M Kruisbeek, D H Marg es, E M Shevach. W Strober, National Instimtes of Health. Published by John Wiley & Sons, Inc. In this assay, the ability of a test compound to stimulate or inhibit the proliferation of activated T cells is assayed. A suspension of responder T cells is cultured with allogeneic stimulator cells and the proliferation of T cells is measured by uptake of tπtiated thymidine. This assay is a general measure of T cell reactivity. Since the majoπfy of T cells respond to and produce IL-2 upon activation, differences in responsiveness in this assay in part reflect differences in IL- 2 production by the responding cells. The MLR results can be verified by a standard lymphokine (IL-2) detection assay. Current Protocols in Immunology, above. 3.15, 6.3.
A proliferative T cell response in an MLR assay may be due to direct mitogenic properties of an assayed molecule or to external antigen induced activation. Additional verification of the T cell stimulatory activity of the PRO polypeptides can be obtained by a costimulation assay. T cell activation requires an antigen specific signal mediated through the T-cell receptor (TCR) and a costimuiatory signal mediated through a second ligand binding interaction, tor example, the B7 (CD80. CD86)/CD28 binding mteraction. CD28 crosshnking mcreases lvmphokine secretion bv activated T cells T cell activation has both negative and positive controls through the bmdmg of ligands which have a negative or positive effect. CD28 ana CTLA-4 are related glycoproteins in the Ig superfamily which bind to B7 CD28 bmding to B7 has a positive costimulation effect of T cell activation, conversely, CTLA-4 bmdmg to B7 has a negative T cell deactivatmg effect Chambers. C A and Allison. J P , Curr Opin Immunol ( 1997) 9 396 Schwartz. R. H., Cell (1992) 71.1065, Linsey, P S and Ledberter. J. A , Annu Rev Immunol (1993) ]j. 191 , June, C. H. et al Immunol Todav (1994) ]5 321. Jenkins, M K.. Immumn ( 1994) l_ 405 In a costimulation assay, the PRO polypeptides are assayed for T cell costimuiatory or inhibitory activity
PRO polypeptides. as well as other compounds of the invention, which are stimulators (costimulators) of T cell proliferation and agonists, e g , agonist antibodies, thereto as determined by MLR and costimulation assays, for example, are useful in treating immune related diseases characteπzed by poor, suboptimal or inadequate immune function These diseases are treated by stimulating the proliferation and activation of T cells (and T cell mediated immunity) and enhancing the immune response in a mammal through administration of a stimulatory compound, such as the stimulating PRO polypeptides The stimulating polypeptide mav. for example, be a PRO200. PRO204. PR0212, PR0216. PR0226. PRO240. PR0235, PR0245. PROl 72. PR0273. PR0272. PR0332, PR0526, PRO701. PR0361. PR0362. PR0363, PR0364. PR0356. PR0531 , PR0533. PRO1083, PR0865. PRO770. PR0769. PR0788, PROl 1 14. PRO1007, PROl 184, PRO1031 , PR01346, PROl 155, PRO 1250. PR01312. PROl 192, PR01246, PR01283, PROl 195, PR01343. PR01418, PR01387. PRO1410, PR01917. PR01868. PRO205. PR021 , PR0269, PR0344. PR0333, PR0381 , PRO720, PR0866. PRO840. PR0982, PR0836, PROl 159, PR01358, PR01325, PR01338, PR01434. PR04333, PRO4302. PRO4430 or PR05727 polypeptide or an agonist antibody thereof
Direct use of a stimulating compound as in the invention has been validated in expenments with 4- 1BB glycoprotein, a member of the tumor necrosis factor receptor family, which binds to a ligand (4- 1BBL) expressed on pnmed T cells and signals T cell activation and growth Alderson, M E et al , J Immunol ( 1994) 24 2219
The use ot an agonist stimulating compound has also been validated expeπmentallv Activation of 4- 1BB by treatment with an agonist antι-4-l BB antibody enhances eradication of tumors Hellstrom. I. and Hellstrom. K. E., Crit Rev Immunol (1998) ]8 1 Immunoadjuvant therapy for treatment of tumors, descπbed in more detail below, is another example of the use of the stimulating compounds of the invention.
An immune stimulating or enhancing effect can also be achieved by antagonizing or blocking the activity of a PRO which has been found to be inhibiting in the MLR assay. Negatmg the inhibitory activity of the compound produces a net stimulatory effect. Suitable antagonists/blocking compounds are antibodies or fragments thereof which recognize and bind to the inhibitory protein, thereby blocking the effective mteraction of the protein with its receptor and inhibiting signalmg through the receptor. This effect has been validated m expenments usmg antι-CTLA-4 antibodies which enhance T cell proliferation, presumably by removal of the inhibitory signal caused by CTLA-4 bmdmg. Walunas, T. L. et al, Immunity (1994) VA05.
Alternatively, an immune stimulating or enhancing effect can also be achieved by administration of a PRO which has vascular permeability enhancing properties. Enhanced vacuolar permeability would be beneficial to disorders which can be attenuated bv local infiltration of immune cells (e g , monocytes. eosmophils. PMNs) and inflammation
On the other hand. PRO polypeptides as well as other compounds of the mvention, which are direct inhibitors of T cell proliferation/activation, lymphokine secretion, and/or vascular permeability can be directiy used to suppress the immune response These compounds are useful to reduce the degree of the immune response and to treat immune related diseases characteπzed by a hyperactive superoptimal. or autoimmune response This use of the compounds of the invention has been validated by the expenments descπbed above in which CTLA-4 b dmg to receptor B7 deactivates T cells The direct inhibitory compounds of the invention function in an analogous manner The use of compound which suppress vascular permeability would be expected to reduce inflammation Such uses would be beneficial in treating conditions associated with excessive inflammation
Alternatively compounds, e g antibodies, which bind to stimulating PRO polypeptides and block the stimulating effect of these molecules produce a net inhibitory effect and can be used to suppress the T cell mediated immune response bv inhibiting T cell proliferation/activation and'or lymphokine secretion Blocking the stimulating ettect ot the polypeptides suppresses the immune response ot the mammal Tins use has been v alidated in experiments using an antι-IL2 antibodv In these experiments the antibodv binds to IL2 and blocks binding of IL2 to its receptor thereby achieving a T cell inhibitory effect H Vnimal Models
The results of the ceil based in itro assavs can be further v erified using in \ ιvo animal models and assays for T-cell function A vaπety ot well known animal models can be used to further understand the role of the genes identified herein m the development and pathogenesis of immune related disease, and to test the efficacy of candidate therapeutic agents, including antibodies, and other antagonists of the native polypeptides. including small molecule antagonists The in vivo nature of such models makes them predictive of responses in human patients Animal models of immune related diseases include both non-recombmant and recombinant (transgenic) animals Non-recombmant animal models include, for example, rodent, e g , muπne models Such models can be generated bv introducing cells into syngeneic mice using standard techniques, e subcutaneous injection, tail vein injection spleen implantation intrapeπtoneal implantation, implantation under the renal capsule, etc
Graft-versus-host disease occurs when lmmunocompetent cells are transplanted into immunosuppressed or tolerant patients The donor cells recogmze and respond to host antigens The response can varv from life threatening severe inflammation to mild cases of diarrhea and weight loss. Graft-versus-host disease models provide a means of assessing T cell reactivity against MHC antigens and mmor transplant antigens A suitable procedure is descπbed m detail in Current Protocols in Immunology, above, unit 4 3
An animal model for skin allograft rejection is a means of test g the ability of T cells to mediate in vivo tissue destruction and a measure of their role in transplant rejection The most common and accepted models use muπne tail-skin grafts Repeated experiments have shown that skm allograft rejection is mediated by T cells, helper T cells and killer-effector T cells, and not antibodies. Auchincloss, H. Jr. and Sachs, D. H., Fundamental Immunology, 2nd ed , W E. Paul ed.. Raven Press, NY, 1989, 889-992. A suitable procedure is descπbed in detail m Current Protocols in Immunology, above, unit 44 Other transplant rejection models which can be used to test the compounds of the invention are the allogeneic heart transplant models descnbed by Tanabe. M. et al Transplantation ( 1 94) 58 23 and Tinubu. S. A. et al J Immunol (1994) 4330-4338.
Animal models for delayed type hypersensitivity provides an assay of cell mediated immune function as well Delayed type hypersensitivity reactions are a T cell mediated in vivo immune response charactenzed by inflammation which does not reach a peak until after a peπod of time has elapsed after challenge with an antigen. These reactions also occur in tissue specific autoimmune diseases such as multiple sclerosis (MS) and expeπmental autoimmune encephalomyehtis (EAE. a model for MS) A suitable procedure is described in detail in Current Protocols in Immunology, above, unit 4.5
EAE is a T cell mediated autoimmune disease charactenzed by T cell and mononuclear cell inflammation and subsequent demyehnation of axons in the central nervous system. EAE is generally considered to be a relevant animal model for MS in humans Bolton. C. Multiple Sclerosis ( 1995) ]_ 143. Both acute and relapsmg-remitting models have been developed. The compounds of the mvention can be tested for T cell stimulatory or inhibitory activity agamst immune mediated demyehnating disease using the protocol described in Current Protocols in Immunologv, above, units 15 1 and 15 2. See also the models for myeiin disease in which o godendrocvtes or Schwann cells are grafted into the central nervous system as descπbed in Duncan. I D et al Molec Med ( 1997) 554-561
Contact hypersensitivity is a simple delayed type hypersensitivity in v vo assay of cell mediated immune function In this procedure, cutaneous exposure to exogenous haptens which gives rise to a delayed type hypersensitivity reaction which is measured and quantitated. Contact sensitivity involves an initial sensitizing phase followed by an elicitation phase. The elicitation phase occurs when the T lymphocytes encounter an antigen to which they have had previous contact. Swelling and inflammation occur, making this an excellent model of human allergic contact dermatitis. A suitable procedure is descπbed in detail m Current Protocols in Immunology, Eds. J. E. Cologan, A M Kruisbeek, D. H. Marguhes, E. M. Shevach and W Strober. John Wiley & Sons, Inc.. 1994. unit 4 2 See also Grabbe. S. and Schwarz. T, Immun Todav ]9 (1): 37-44 ( 1998)
An animal model for arthritis is collagen-induced arthntis This model shares clinical, histological and immunological characteπstics of human autoimmune rheumatoid arthntis and is an acceptable model for human autoimmune arthntis. Mouse and rat models are charactenzed by synovitis. erosion of cartilage and subchondral bone. The compounds of the invention can be tested for activity agamst autoimmune arthntis using the protocols descπbed in Current Protocols in Immunology, above, units 15 5. See also the model usmg a monoclonal antibody to CD 18 and VLA-4 integrals descnbed m Issekutz, A.C. et al, Immunology (1996) 88:569.
A model of asthma has been descπbed in which antigen-induced airway hyper-reactivity, pulmonary eosinophiha and inflammation are induced by sensitizing an animal with ovalbumm and then challenging the animai with the same protem delivered by aerosol. Several animal models (gumea pig, rat, non-human pπmate) show symptoms similar to atopic asthma in humans upon challenge with aerosol antigens. Murine models have many of the features of human asthma. Suitable procedures to test the compounds of the mvention for activity and effectiveness m the treatment of asthma are descπbed by Wolyniec. W. W. et al, Am. J. Resptr. Cell Mol. Biol. (1998) ]8:777 and the references cited therein. Additionally, the compounds of the invention can be tested on animal models for psonasis like diseases. Evidence suggests a T cell pathogenesis for psoπasis. The compounds of the invention can be tested in the scid scid mouse model descnbed by Schon. M. P. et al, Nat. Med. (1997) 3: 183, in which the mice demonstrate histopathologic skin lesions resemblmg psoπasis. Another suitable model is the human skin/scid mouse chimera prepared as descπbed by Nickoloff. B. J. et al. Am. J. Path. (1995) 146:580.
Recombinant (transgenic) animal models can be engmeered by mtroducmg the coding portion of the genes identified herein into the genome of animals of mterest, using standard techniques for producing transgenic animals. Animals that can serve as a target for transgenic manipulation mclude. without limitation. mice. rats, rabbits, guinea pigs, sheep, goats, pigs, and non-human primates, e.g., baboons, chimpanzees and monkeys. Techniques known in the art to introduce a transgene into such animals include pronucleic microinjection (Hoppe and Wanger, U.S. Patent No. 4,873,191); retrovirus-mediated gene transfer into germ lines (e g , Van der Putten et al , Proc. Natl. Acad. Sci. USA 82. 6148-615 [ 1985]); gene targeting m embryonic stem cells (Thompson et al , Cell 56, 313-321 [ 1989]); electroporation of embryos (Lo. Mol. Cel. Biol. 3, 1803-1814 [1983]); sperm-mediated gene transfer (Lavitrano et al. Cell 57. 717-73 [1989]). For review, see. lor example. U S Patent No 4.736.866
For the purpose ot the present invention, transgenic animals include those that carry the transgene only in pan ot their cells ("mosaic animals") The transgene can be integrated either as a single transgene. or m concatamers. e ., head-to-head or head-to-tail tandems. Selective introduction of a transgene into a particular cell type is also possible by following, for example, the technique of Lasko et al, Proc. Natl. Acad. Sci. USA 89. 6232-636 ( 1992).
The expression of the transgene in transgenic animals can be monitored by standard techniques. For example. Southern blot analysis or PCR amplification can be used to venfy the integration of the transgene. The level of mR A expression can then be analyzed using techniques such as in situ hybπdization. Northern blot analysis. PCR, or immunocytochemistry The animals may be further examined for signs of immune disease pathology, for example by histological examination to determine infiltration ot immune cells into specific tissues. Blocking experiments can also be peπormed m which the transgenic animals are treated with the compounds of the invention to determine the extent of the T cell proliferation stimulation or inhibition of the compounds. In these expenments. blocking antibodies which bind to the PRO polypeptide. prepared as descnbed above, are admmistered to the animal and the effect on immune function is determined.
Alternatively, "knock out" animals can be constructed which have a defective or altered gene encoding a polypeptide identified herein, as a result of homologous recombmation between the endogenous gene encoding the polypeptide and altered genomic DNA encoding the same polypeptide introduced into an embryonic cell of the animal. For example, cDNA encodmg a particular polypeptide can be used to clone genomic DNA encoding that polypeptide accordance with established techniques. A portion of the genomic DNA encoding a particular polypeptide can be deleted or replaced with another gene, such as a gene encoding a selectable marker which can be used to monitor integration. Typically, several kilobases of unaltered flanking DNA (both at the 5' and 3' ends) are included in the vector [see e.g., Thomas and Capecchi, Cell, 5__:503 (1987) for a descπption of homologous recombination vectors]. The vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells m which the introduced DNA has homologously recombined with the endogenous DNA are selected [see e g., Li et al. Cell. 69 915 (1992)]. The selected cells are then injected into a blastocyst of an animal (e g., a mouse or rat) to form aggregation chimeras [see e.g., Bradley, in Teratocarcinomas and Embrvomc Stem Cells. A Practical Approach. E. J. Robertson, ed. (IRL. Oxford. 1987), pp. 1 13-152]. A chimenc embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term to create a "knock out" animal. Progeny harboπng the homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed animals in which all cells of the animal contain the homologously recombined DNA. Knockout animals can be charactenzed for instance, for their ability to defend against certain pathological conditions and for their development of pathological conditions due to absence of the polypeptide. I. ImmunoAdiuvant Therapy
In one embodiment, the immunostimulating compounds of the invention can be used in immunoadjuvant therapy for the treatment of tumors (cancer). It is now well established that T cells recognize human tumor specific antigens. One group of tumor antigens, encoded by the MAGE, BAGE and GAGE families of genes, are silent in ail adult normal tissues . but are expressed in significant amounts in rumors. such as melanomas, lung tumors, head and neck tumors, and bladder carcinomas. DeSmet. C. et al . ( 1996) Proc. atl Acad. Sci USA. 93 7149 It has been shown that costimulation of T cells induces tumor regression and an antitumor response both in vitro and in vivo Melero, I. et al. Nature Medicine ( 1997) 3.682. Kwon. E. D. et al. Proc. Natl. Acad. Sci USA (1997) 94. 8099. Lynch, D. H. et al, Nature Medicine ( 1997) 3.625: Finn. O. J. and Lotze. M. T., J Immunol. ( 1998) 2__.1 14. The stimulatory compounds of the invention can be administered as adjuvants, alone or together with a growth regulating agent, cytotoxic agent or chemotherapeutic agent, to stimulate T cell proliferation activation and an antitumor response to tumor antigens. The growth regulating, cytotoxic. or chemotherapeutic agent may be administered in conventional amounts using known administration regimes. Immunostimulating activity by the compounds of the invention allows reduced amounts of the growth regulating, cytotoxic. or chemotherapeutic agents thereby potentially lowenng the toxicity to the patient.
J Screening Assays for Drug Candidates
Screening assays tor drug candidates are designed to identify compounds that bind to or complex with the polypeptides encoded by the genes identified herein or a biologically active fragment thereof, or otherwise interfere with the interaction of the encoded polypeptides with other cellular proteins. Such screenmg assays will include assays amenable to high-throughput screenmg of chemical libranes, making them particularly suitable for identifying small molecule drug candidates. Small molecules contemplated include synthetic organic or inorganic compounds, including peptides, preferably soluble peptides, (poly)pepttde- lmmunoglobulin fusions, and. in particular, antibodies including, without limitation, poly- and monoclonal antibodies and antibody fragments, single-chain antibodies, anti-idiotypic antibodies, and chimenc or humanized versions of such antibodies or fragments, as well as human antibodies and antibody fragments. The assays can be performed in a vaπety of formats, including protein-protein binding assays, biochemical screenmg assays, immunoassays and cell based assays, which are well charactenzed in the art.
All assays are common in that they call for contacting the drug candidate with a polypeptide encoded by a nucleic acid identified herein under conditions and for a time sufficient to allow these two components to interact. In bmding assays the interaction is binding and the complex formed can be isolated or detected in the reaction mixmre In a particular embodiment, the polypeptide encoded by the gene identified herem or the drug candidate is immobilized on a solid phase g on a microtiter plate, bv covalent or non-covalent attachments Non-covalent attachment generally is accomplished by coatmg the solid surface with a solution of the polypeptide and drying Alternatively an immobilized antibody, e g a monoclonal antibody, specific for the polypeptide to be immobilized can be used to anchor it to a solid surface The assav is performed by adding the non-immobilized component, which mav be labeled bv a detectable label, to the immobilized component, e g the coated surface containmg the anchored component When the reaction is complete, the non-reacted components are removed e g by washmg, and complexes anchored on the solid surface are detected When the oπginallv non-immobilized component carnes a detectable label the detection of label immobilized on the surface indicates that compiexing occurred Where the oπgmallv non-immobilized component does not carry a label, compiexing can be detected, for example, bv using a labelled antibody specifically binding the immobilized complex
If the candidate compound interacts with but does not bind to a particular protein encoded bv a gene identified herein its interaction with that protein can be assaved bv methods well known tor detecting protein- protein interactions Such assays include traditional approaches such as. cross-linking, o- lmmunoprecipitation and co-puπfication through gradients or hromatographic columns In addition, protein- protein interactions can be monitored bv using a veast-based genetic system described bv Fields and co- workers [Fields and Song, Nature (London) 340 245-246 ( 1989), Chien et al . Pioc Natl Acad Sci USA 88, 9578-9582 ( 1991 )] as disclosed by Chevray and Nathans. Pioc Natl Acad Sci USA 89 5789-5793 (1991) Many transcπptional activators, such as yeast GAL4, consist of two physically discrete modular domains, one acting as the DNA-binding domain, while the other one functioning as the transcπption activation domain The yeast expression system descπbed in the foregoing publications (generally referred to as the "rvvo-hybπd system ') takes advantage of this property and employs two hvbπd proteins one in which the target protem is fused to the DNA-bindmg domain of GAL4 and another, in which candidate activating proteins are fused to ihe activation domain The expression ot a GΛLl-/α<:Z reporter gene under control of a GAL4-actιvated promoter depends on reconstitution ot GAL4 activity via protein-protein interaction Colonies containing interacting polypeptides are detected with a chromogenic substrate for β-galactosidase A complete kit (MATCHMAKER ) for identifying protein-protein interactions between rwo specific proteins using the two- hybnd technique is commercially available from Clontech This system can also be extended to map protem domains mvolved in specific protem interactions as well as to pinpomt ammo acid residues that are crucial for these interactions
In order to find compounds that mterfere with the interaction of a gene identified herein and other intra- or extracellular components can be tested, a reaction mixmre is usually prepared containmg the product of the gene and the mtra- or extracellular component under conditions and for a time allowing for the mteraction and bmdmg of the rwo products To test the ability of a test compound to inhibit bmdmg, the reaction is run m the absence and in the presence of the test compound In addition, a placebo may be added to a third reaction mixmre. to serve as positive control The bindmg (complex formation) between the test compound and the mtra- or extracellular component present in the mixture is monitored as descπbed above. The formation of a complex in the control reactιon(s) but not m the reaction mixmre containmg the test compound indicates that the test compound interferes with the interaction of the test compound and its reaction partner.
K. Compositions and Methods for the Treatment of Immune Related Diseases
The compositions useful in the treatment of immune related diseases include, without limitation. proteins, antibodies, small organic molecules, peptides. phosphopeptides, antisense and πbozyme molecules. triple helix molecules, etc. that inhibit or stimulate immune function, for example. T cell proliferation activation, lymphokine release, or immune cell infiltration.
For example, antisense RNA and RNA molecules act to directly block the translation of mRNA by hybπdizing to targeted mRNA and preventing protein translation. When antisense DNA is used. ohgodeoxyπbonucleotides deπved from the translation initiation site, e.g . between about -10 and +10 positions of the target gene nucleotide sequence, are preferred.
Ribozymes are enzymatic RNA molecules capable of catalyzmg the specific cleavage of RNA. Ribozymes act by sequence-specific hybπdization to the complementary target RNA. followed by endonucleolytic cleavage. Specific πbozyme cleavage sites withm a potential RNA target can be identified by known techniques for further details see. e g . Rossi. Current Bιolog\ 4. 469-471 ( 1994). and PCT publication No WO 97/33551 (published September 18. 1997)
Nucleic acid molecules in triple helix formation used to inhibit transcπption should be single-stranded and composed of deoxynucleotides. The base composition of these oligonucleotides is designed such that it promotes triple helix formation via Hoogsteen base paiπng rules, which generally require sizeable stretches of puπnes or pynmidines on one strand of a duplex. For further details see, e.g.. PCT publication No. WO
97/33551 , supra.
These molecules can be identified by any or any combination of the screenmg assays discussed above and/or by any other screening techniques well known for those skilled in the art. L. Antibodies The present invention further provides anti-PRO antibodies and fragments thereof which may inhibit
(antagonists) or stimulate (agonists) T cell proliferation, eosinophil infiltration, vascular permeability, etc Such anti-PRO antibodies or fragments thereof include polyclonal. monoclonal, humanized, bispecific and heteroconjugate antibodies.
1. Polyclonal Antibodies The anti-PRO antibodies may compπse polyclonal antibodies. Methods of prepaπng polyclonal antibodies are known to the skilled artisan. Polycionai antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or lntrapeπtoneai injections. The immunizing agent may mclude the PRO polypeptide or a fusion protein thereof. It may be useful to conjugate the unmumzing agent to a protein known to be immunogenic m the mammal being immunized. Examples of such immunogenic proteins include but are not limited to keyhole limpet hemocyanm. serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. Examples of adjuvants which may be employed include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate). The immunization protocol may be selected by one skilled in the art without undue experimentation. 2. Monoclonal Antibodies The anti-PRO antibodies may, alternatively, be monoclonal antibodies. Monoclonal antibodies may be prepared usmg hybπdoma methods, such as those descπbed by Kohler and Milstem. Nature, 256:495
(1975) In a hybπdoma method, a mouse, hamster, or other appropπate host animal, is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent. Alternatively, the lymphocytes may be immunized in vitro.
The immunizing agent will typically include the PRO polypeptide or a fusion protein thereof. Generally, either peπpheral blood lymphocytes ("PBLs") are used if cells of human ongm are desired, or spleen cells or lymph node cells are used if non-human mammalian sources are desired. The lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybπdoma cell [Goding. Monoclonal Antibodies Principles and Practice, Academic Press. (1986) pp. 59- 103]. Immortalized cell Imes are usually transformed mammalian ceils, particularly myeioma cells of rodent, bovine and human ongm. Usually, rat or mouse myeloma cell lines are employed. The hybπdoma cells may be cultured in a suitable culture medium that preferably contams one or more substances that inhibit the growth or survival of the untused. immortalized cells For example, if the parental cells lack the enzyme hypoxanthme guan e phosphoπbosvl transferase (HGPRT or HPRT), the culture medium for the hybπdomas typically will include hvpoxanthine. ammopteπn. and thymidine ("HAT medium"), which substances prevent the growth of HGPRT deficient cells
Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. More preferred immortalized cell lines are muπne myeloma lines, which can be obtained, for instance, from the Salk Institute Cell Distribution Center, San Diego, California and the Ameπcan Type Culture Collection. Manassas, Virginia Human myeloma and mouse-human heteromyeloma cell lines also have been descπbed for the production of human monoclonal antibodies [Kozbor. J Immunol , 133.3001 (1984), Brodeur et al, Monoclonal Antώodi Pioduction Techniques and Applications. Marcel Dekker, Inc.. New York, ( 1987) pp 51 -63]
The culture medium in which the hvbπdoma cells are cultured can then be assayed for the presence of monoclonal antibodies directed agamst PRO Preferably, the binding specificity of monoclonal antibodies produced by the hybπdoma cells is determined by lmmunoprecipitation or by an in vitro bindmg assay, such as radioimmunoassay (PJA) or enzyme-linked lmmunoabsorbent assay (ELISA). Such techniques and assays are known in the art. The bmdmg affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson and Pollard, Anal. Biochem., J07.220 (1980).
After the desired hybπdoma cells are identified, the ciones may be subcloned by limiting dilution procedures and grown by standard methods [Goding, supra). Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI- 1640 medium. Alternatively, the hybπdoma cells may be grown in vivo as ascites in a mammal.
The monoclonal antibodies secreted by the subclones may be isolated or puπfied from the culture medium or ascites fluid by conventional immunoglobulin puπfication procedures such as, for example, protem A-Sepharose, hydroxyapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.
The monoclonal antibodies may also be made by recombinant DNA methods, such as those descπbed in U.S. Patent No. 4,816,567. DNA encodmg the monoclonal antibodies of the mvention can be readily isolated and sequenced using conventional procedures (e g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of muπne antibodies). The hybπdoma ceils of the invention serve as a preferred source of such DNA. Once isolated, the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. The DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domams m place of the homologous muπne sequences [U.S. Patent No. 4,816,567, Momson et al, supra] or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobuiin polypeptide. Such a non-immunoglobuiin polypeptide can be substituted for the constant domains of an antibody of the invention, or can be substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimenc bivalent antibody
The antibodies are preferably monovaient antibodies. Methods for prepaπng monovalent antibodies are well known in the art For example, one method involves recombinant expression of immunoglobulin light chain and modified heaw chain. The heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain crosshnking. Alternatively, the relevant cysteine residues are substituted with another ammo acid residue or are deleted so as to prevent crosshnking.
In vitro methods are also suitable for prepaπng monovalent antibodies. Digestion of antibodies to produce fragments thereof, particularly. Fab fragments, can be accomplished usmg routine techniques known
3. Human and Humanized Antibodies
The anti-PRO antibodies of the invention may further compπse humanized antibodies or human antibodies. Humanized forms of non-human (e g., muπne) antibodies are chimenc immunoglobulins. immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab'. F(ab')2 or other antigen-binding subsequences of antibodies) which contain minimal sequence deπved from non-human immunoglobulin. Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non- human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also compπse residues which are found neither m the recipient antibody nor in the imported CDR or framework sequences. In general, the humanized antibody will compnse substantially all of at least one, and typically two, vaπable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody optimally also will compπse at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al, Nature. 321:522-525 (1986); Riechmann et al, Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol.2:593-596 (1992)].
Methods for humanizing non-human antibodies are well known m the art. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import 1 variable domain Humanization can be essentially performed following the method of Winter and coworkers [Jones et al , Nature, 32_ 522-525 ( 1986), Riechmann et al , Nature. 332.323-327 (1988); Verhoeven et al , Science. 239 1534- 1536 ( 1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody Accordmgly, such "humanized" antibodies are chimenc antibodies (U S Patent No 4,816,567), wherein substantially less than an mtact human vaπable domam has been substituted bv the corresponding sequence from a non-human species In practice, humanized antibodies are rypicallv human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies
Human antibodies can also be produced using vaπous techniques known in the art. including phage display libranes [Hoogenboom and Winter. J Mol Biol . 227 381 ( 1991 ). Marks et al . J Mol Biol . 222.581 ( 1991 )] The techniques of Cole et al and Boerner et al are also available for the preparation of human monoclonal antibodies (Cole et al Monoclonal Antibodies and Cancer Tl erapv, Alan R Liss, p 77 ( 1985), Boerner et al J Immunol . 147(1 ) 86-95 ( 1991 ), U S 5,750, 373] Similarly, human antibodies can be made by introducing of human immunoglobulin loci into transgenic animals, e g mice in which the endogenous immunoglobulin genes have been partially or completely inactivated Upon challenge, human antibodv production is observed which closelv resembles that seen in humans in all respects, including gene rearrangement assembly , and antibodv repertoire Tins approach is descnbed. for example, in U S Patent Nos 5 545.807 5 545,806. 5.569,825. 5,625, 126. 5,633,425. 5,661.016. and in the following scientific publications Marks et al , Bio/Technologv ]0 779-783 (1992). Lonberg et al . Nature 368_ 856-859 ( 1994). Morrison Nature 368. 812- 13 ( 1994). Fishwild et al Nature Bιotechnolog\ J4, 845-51 ( 1996), Neuberger, Nature Biotechnology ]4 826 ( 1996). Lonberg and Huszar. Intern Rev Immunol J_3 65-93 (1995)
The antibodies mav also be affinity matured using known selection and or mutagenesis methods as descπbed abov e Preferred affinity matured antibodies have an affinity which is five times, more preferably 10 tunes, ev en more preferably 20 or 30 times greater than the starting antibody (generally munne. humanized or human ) trom which the matured antibodv is prepared 4 Bispecific Antibodies
Bispecific antibodies arc monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens In the present case, one of the binding specificities may be for the PRO. the other one is for any other antigen, and preferably for a cell-surface protein or receptor or receptor subunit
Methods for making bispecific antibodies are known in the art Traditionally, the recombinant production of bispecific antibodies is based on the coexpression of two immunoglobulin heavy-chain/hght- cha pairs, where the two heavy chains have different specificities (Milstein and Cuello. Nature. 305 537-539 [1983]) Because of the random assortment of immunoglobulin heavy and light chams, these hybπdomas (quadromas) produce a potential mixmre of ten different antibody molecules, of which only one has the correct bispecific structure. The puπfication of the correct molecule is usually accomplished by affinity chromatography steps. Similar procedures are disclosed m WO 93/08829, published 13 May 1993. and m Traunecker et al, EMBO J , KU655-3659 ( 1991)
Antibody vaπable domams with the desired bmdmg specificities (antibody-antigen combining sites) can be fused to immunoglobulin constant domain sequences. The fusion preferably is with an immunoglobulm heavy-chain constant domain, compnsing at least part ot the hmge. CH2 and CH3 regions It is preferred to have the first heavy-chain constant region (CHI ) containing the site necessary tor light-chain bmdmg present in at least one of the fusions DNAs encoding the immunoglobulin heavy-chain fusions and. if desired, the immunoglobulm light cham, are inserted into separate expression vectors, and are cotransfected into a suitable host organism For further details of generating bispecific antibodies see, tor example, Suresh et al , Methods in Enzvmology, V2Λ 210 ( 1986)
According to another approach descnbed in WO 96/2701 1, the interface between a pan of antibody molecules can be engineered to maximize the percentage of heterodimers which are recovered from recombinant cell culture The preferred interface compnses at least a part of the CH3 region of an antibodv constant domain In this method, one or more small amino acid side chams from the interface of the first antibodv molecule are replaced with larger side chains (e g tyrosine or tryptophan) Compensatory "cavities ' of identical or similar size to the large side chaιn(s) are created on the interface of the second antibodv molecule by replacing large ammo acid side chains with smaller ones (e g alanine or threonine) This provides a mechanism for increasing the vield of the heterodimer over other unwanted end-products such as homodimers
Bispecific antibodies can be prepared as full length antibodies or antibodv fragments (e F(ab')2 bispecific antibodies) Techniques for generating bispecific antibodies from antibodv fragments have been described in the literature For example bispecific antibodies can be prepared can be prepared using chemical linkage Brennan et al Science 229 81 ( 1985) descπbe a procedure wherein mtact antibodies are proteolvtically cleaved to generate F(ab')2 fragments These fragments are reduced in the presence of the dithiol compiexing agent sodium arsemte to stabilize vicinal dithiols and prevent lπtermolecular disulfide formation The Fab fragments generated are then converted to thionitrobenzoate (TNB) deπvatives One of the Fab TNB deπvatives is then reconverted to the Fab -thiol by reduction with mercaptoethvlamine and is mixed with an equimolar amount of the other Fab'-TNB deπvative to form the bispecific antibodv The bispecific antibodies produced can be used as agents for the selective immobilization ot enzvmes
Fab' fragments mav be directlv recovered from E coli and chemicallv coupled to form bispecific antibodies Shalabv et al J Exp M d _____ 217-225 ( 1992) descπbe the production of a fully humanized bispecific antibody F(ab )2 molecule Each Fab fragment was separately secreted from E colt and subjected to directed chemical coupling in vitro to form the bispecific antibody The bispecific antibody thus formed was able to bind to cells overexpressing the ErbB2 receptor and normal human T cells, as well as tπgger the lytic activity of human cytotoxic lymphocytes against human breast tumor targets
Vaπous technique for making and isolating bispecific antibody fragments directly from recombinant cell culture have also been described For example, bispecific antibodies have been produced using leuciπe zippers Kostelny et al . J Immunol _48 (5) 1547-1553 (1992) The leucme zipper peptides from the Fos and Jun proteins were linked to the Fab portions of rwo different antibodies by gene fusion The antibody homodimers were reduced at the hmge region to form monomers and then re-oxidized to form the antibodv heterodimers This method can also be utilized for the production of antibody homodimers. The "diabody" technology descπbed by Hollinger et al , Proc Natl Acad Set USA 90 6444-6448 (1993) has provided an alternative mechanism for making bispecific antibody fragments The fragments compπse a heavy-chain vanable domam (VH) connected to a light-cham vaπable domam (VL) by a lmker which is too short to allow pairing between the rwo domains on the same cham. Accordingly, the VH and Vt domams of one fragment are forced to pan- with the complementary VL and VH domams of another fragment, thereby forming two antigen-binding sites. Another strategy for making bispecific antibody fragments by the use of single-chain Fv (sFv) dimers has also been reported. See. Gruber et al. J. Immunol. 152:5368 (1994). Antibodies with more than two valencies are contemplated. For example, tπspecific antibodies can be prepared. Tuft et al, J. Immunol ]47 60 (1991).
Exemplary bispecific antibodies may bind to two different epitopes on a given PRO polypepide herein. Alternatively, an anti-PRO arm may be combined with an arm which binds to a triggering molecule on a leukocyte such as a T-cell receptor molecule (e.g., CD2. CD3. CD28, or B7), or Fc receptors for IgG (FcγR), such as FcγRI (CD64), FcγRII (CD32) and FcγRIII (CD 16) so as to focus cellular defense mechanisms to the cell expressing the particular PRO polypeptide. Bispecific antibodies may also be used to localize cytotoxic agents to cells which express a particular PRO polypeptide. These antibodies possess a PRO polypeptide - binding arm and an arm which binds a cytotoxic agent or a radionuclide chelator. such as EOTUBE, DPTA. DOTA. or TETA Another bispecific antibody of interest binds the PRO polypeptide and further binds tissue factor ( TD
5. Heterocon gate Antibodies
Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells [U.S. Patent No. 4.676,980], and for treatment of HIV infection [WO 91/00360; WO 92/200373. EP 03089]. It is contemplated that the antibodies may be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosshnking agents. For example, immunotoxins may be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyi-4-mercaptobutyπmιdate and those disclosed, for example, in U.S. Patent No. 4.676,980.
6. Effector function engineeπng It may be desirable to modify the antibody of the invention with respect to effector function, so as to enhance the effectiveness of the antibody in treating an immune reiated disease, for example. For example cysteine residue! s) may be introduced in the Fc region, thereby allowing mtercham disulfide bond formation in this region. The homodimeπc antibody thus generated may have improved mtemalization capability and/or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicify (ADCC). See Caron el al. J. Exp Med. J_76:l 191-1 195 (1992) and Shopes, B. J. Immunol. 148:2918-2922 (1992). Homodimeric antibodies with enhanced anti-tumor activity may also be prepared using heterobifunctional cross-linkers as descπbed in Wolff « al. Cancer Research 53:2560-2565 (1993). Alternatively, an antibody can be engineered which has dual Fc regions and may thereby have enhanced complement lysis and ADCC capabilities. See Stevenson et al. Anti-Cancer Drug Desig _3:219-230 (1989). 7. Immunoconiugates
The invention also pertains to immunoconjugates compπsing an antibody conjugated to a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g., an enzymatically active toxin of bacteπal, fungal, plant or animal origin, or fragments thereof), or a radioactive isotope (i.e., a radiocoηjugate).
Chemotherapeutic agents useful in the generation of such immunoconjugates have been described above. Enzymatically active tox s and fragments thereof which can be used include diphtheria A chain, nonbmdtng active fragments of diphtheπa toxm. exotoxin A chain (from Pseudomonas aerugtnosa). ncin A chain, abπn A chain, modeccm A cham. alpha-sarcin. Aleurites fordu proteins, dianthin proteins, Phvtolaca amertcana proteins (PAPI, PAPII. and PAP-S), momordica charantia inhibitor, curcm, crot . sapaonaπa officinahs inhibitor, gelonin mitogelhn. restnctocin. phenomvcm, enomycm and the tncothecenes. A vaπety of radionuchdes are available for the production of radioconjugated antibodies Examples include 212Bi, mI, In, 90Y and 1S6Re
Conjugates of the antibody and cytotoxic agent are made using a vaπety of bifunctional protein couplmg agents such as N-succιnιmιdvl-3-(2-pyndyldιthιol) propionate (SPDP). lmmothiolane (IT), bifunctional denvatives of imidoesters (such as dimethvl adipimidate HCL), active esters (such as disuccinimidyl suberate) aldehvdes (such as glutaraldehyde), bis-azido compounds (such as bis (p- azidobenzoyl) hexanediamine), bis-diazomum deπvatives (such as bιs-(p-dιazomumbenzoyl)- ethylenediamme), dnsocyanates (such as tolyene 2.6-dusocyanate), and bis-active fluonne compounds (such as l,5-difluoro-2,4-dmitrobenzene) For example, a ncin immunotoxin can be prepared as descπbed m Vitetta et al Science 238 1098 ( 1987) Carbon- 14- labeled l -ιsothιocvanatobenzyI-3-methyldιethvlene tπamineDentaacetic acid (MX DTPA) is an exemplary chelating agent tor conjugation of radionucleotide to the antibodv See W094/1 1026
In another embodiment the antibody may be conjugated to a 'receptor" (such streptavidin) for utilization in tissue pretargeting wherein the antibodv-receptor conjugate is administered to the patient, followed by removal of unbound conjugate from the circulation using a clearing agent and then administration of a "ligand" (e g , avidm) which is conjugated to a cytotoxic agent (e g , a radionucleotide) 8 Immunohposomes
The proteins, antibodies, etc disclosed herein may also be formulated as immunohposomes Liposomes containing the antibodv are prepared bv methods known m the art. such as described in Epstein et al , Proc Natl Acad Sci USA. _82 3688 ( 1985) Hwang et al Proc Natl Acad Sci USA, 77 4030 ( 1980), and U S Pat Nos 4,485,045 and 4 544 545 Liposomes with enhanced circulation time are disclosed in U S Patent No 5.013.556
Particularly useful liposomes can be generated bv the reverse phase evaporation method with a lipid composition compπsing phosphatidvlcholme. cholesterol and PEG-deπvatized phosphatidviethanolamme (PEG-PE) Liposomes are extruded through filters of defined pore size to yield liposomes with the desired diameter Fab' fragments of the antibodv of the present mvention can be conjugated to the liposomes as descπbed in Martin et al ,_J Biol Chem 257 286-288 (1982) via a disulfide interchange reaction. A chemotherapeutic agent (such as doxorubicin) may be optionally contained withm the liposome See Gabizon et al , J National Cancer Inst 8J_ ( 19) 1484 ( 1989) M Pharmaceutical Compositions The active PRO molecules of the invention (e g , PRO polypeptides, anti-PRO antibodies, and/or vaπants of each) as well as odier molecules identified by the screenmg assays disclosed above, can be administered for the treatment of immune related diseases, m the form of pharmaceutical compositions.
Therapeutic formulations of the active PRO molecule, preferably a polypeptide or antibody of the mvention, are prepared for storage by mixmg the active molecule havmg the desired degree of puπty with optional pharmaceuticallv acceptable earners, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition. Osol. A. Ed. [1980]). in the form ot lyophilized formulations or aqueous solutions. Acceptable carπers, excipients. or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids, antioxidants mcludmg ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyi ammonium chloπde, hexamethonium chloπde; benzalkomum chloπde, benzethonium chloπde, phenol, butyl or benzyl alcohol, alkyl parabens such as methyl or propyl paraben: catechol, resorcmol, cyclohexanol. 3-pentanoi. and m-cresol). low molecular weight (less than about 10 residues) polypeptides. proteins, such as serum albumin, gelatin, or immunoglobulins: hydrophihc polymers such as polyvinylpyrrohdone, ammo acids such as glycine, glutamine. asparagine, histidine. arginine. or lysine; monosacchaπdes disacchandes. and other carbohydrates mcludmg glucose. mannose. or dextπns, chelating agents such as EDTA, sugars such as sucrose, mannitol. trehalose or sorbitol; salt-forming counter-ions such as sodium: metal complexes (e g , Zn-protein complexes), and/or non-ionic surfactants such as TWEEN™, PLURONICS™ or polyethylene glycol (PEG)
Compounds identified by the screening assays disclosed herein can be formulated in an analogous manner, using standard techniques well known in the art. Lipofections or liposomes can also be used to deliver the PRO molecule into cells Where antibody fragments are used, the smallest inhibitor/ fragment which specifically binds to the binding domain of the target protein is preferred For example, based upon the variable region sequences of an antibody, peptide molecules can be designed which retain the ability to bmd the target protein sequence Such peptides can be synthesized chemically and/or produced by recombinant DNA technology (see, e g . Marasco et al . Proc. Natl. Acad. Sci USA 90, 7889-7893 [1993])
The formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other Alternatively, or in addition, the composition may compπse a cytotoxic agent, cvtokme or growth inhibitory agent Such molecules are suitably present in combination in amounts that are effective for the purpose intended
The active PRO molecules mav also be entrapped in microcapsules prepared, for example, by coacervation techniques or bv intertacial polymeπzation. for example, hydroxymethvlcellulose or gelatm- microcapsules and poly-(methvlmethacylate) microcapsules. respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres. microemulsions. nano-particles and nanocapsules) or macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences 16th edition. Osol, A. Ed. (1980).
The formulations to be used for in vivo administration must be steπle. This is readily accomplished by filtration through steπle filtration membranes.
Sustamed-release preparations or the PRO molecules may be prepared. Suitable examples of sustamed-release preparations include semipermeable matrices of solid hydrophobic polymers containmg the antibody, which matnces are m the form of shaped articles, e g , films, or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (for example, pσly(2-hydroxyethyl-methacrylate), or poly(vιnylalcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and γ-ethyl-L- glutamate, non-degradable ethylene-vmyl acetate, degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOT™ (in ectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hvdroxyburvπc acid While polymers such as ethylene-vmvl acetate and lactic acid- glycohc acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter tune peπods When encapsulated antibodies remain m the bodv for a long time, they mav denature or aggregate as a result of exposure to moisture at 37°C, resulting in a loss of biological activity and possible changes in immunogenicity Rational strategies can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism is discovered to be intermolecular S-S bond formation through thio-disuifide interchange, stabilization may be achieved bv modifying sulfhydryl residues, lyophi zing from acidic solutions, controlling moisture content, using appropπate additives, and developmg specific polymer matnx compositions N Methods of Treatment
It is contemplated that the polypeptides, antibodies and other active compounds of the present invention mav be used to treat vaπous immune related diseases and conditions, such as T cell mediated diseases including those charactenzed by infiltration of inflammatory cells into a tissue, stimulation of T-ceil proliferation inhibition of T-cell proliferation increased or decreased vascular permeability or the inhibition thereof
Exemplar conditions or disorders to be treated with the polypeptides. antibodies and other compounds of the invention, include, but are not limited to svstemic lupus erythematosis rheumatoid arthntis, juvenile chronic arthntis osteoarthπtis spondvloarthropathies systemic sclerosis (scleroderma), idiopathic inflammatory myopathies (dermatomyositts, polymyositis), Sjogren s syndrome, systemic vascu tis. sarcoidosis, autoimmune hemolytic anemia (immune pancytopema. paroxysmal nocmmal hemoglobinuna). autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia). thyroiditis (Grave's disease, Hashimoto's thyroiditis. juvenile lymphocytic thyroiditis. atrophic thvroiditis), diabetes mellitus. immune-mediated renal disease (glomeruioπephπtis, tubulointerstitial nephritis), demyehnating diseases of the central and peπpheral nervous systems such as multiple sclerosis, idiopathic demyehnating polyneuropathv or Guilla -Barre syndrome, and chronic inflammatory demvehnating polyneuropathv hepatobi arv diseases such as infectious hepatitis (hepatitis A. B, C, D E and other non- hepatotropic v iruses), autoimmune chronic active hepatitis, pπmarv biharv cirrhosis, granulomatous hepatitis. and sclerosmg cholangitis, inflammatory bowel disease (ulceranve colitis Crohn's disease), gluten-sensitive enteropathy, and Whipple s disease, autoimmune or immune-mediated skin diseases including bullous skin diseases, erythema multiforme and contact dermatitis, psoπasis. allergic diseases such as asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urticaπa. lmmunologic diseases of the lung such as eosinophi c pneumonias, idiopathic pulmonary fibrosis and hypersensitivity pneumonitis, transplantation associated diseases mcludmg graft rejection and graft -versus-host-disease
In systemic lupus erythematosus. the central mediator of disease is the production of auto-reactive antibodies to self protems/tissues and the subsequent generation of immune-mediated inflammation antibodies either directly or mdirectlv mediate tissue injury Though T lymphocytes have not been shown to be directly involved m tissue damage, T lymphocytes are required for the development of auto-reactive antibodies. The genesis of the disease is thus T lymphocyte dependent Multiple organs and systems are affected clinically mcludmg kidney, lung, musculoskeletal system, mucocutaneous, eye, central nervous system, cardiovascular system, gastrointestinal tract, bone marrow and blood Rheumatoid arthntis (RA) is a chronic systemic autoimmune inflammatory disease that mamly involves the synovial membrane of multiple joints with resultant injury to the articular cartilage. The pathogenesis is T lymphocyte dependent and is associated with the production of rheumatoid factors, auto- antibodies directed against self IgG. with the resultant formation of immune complexes that attain high levels in joint fluid and blood. These complexes in the joint may mduce the marked infiltrate of lymphocytes and monocytes into the synovium and subsequent marked synovial changes; the joint space/fluid if infiltrated by similar cells with the addition of numerous neutrophils. Tissues affected are pπmarily the joints, often in symmetπcal pattern. However, extra-articular disease also occurs in rwo major forms. One form is the development of extra-articular lesions with ongoing progressive joint disease and typical lesions of pulmonary fibrosis. vascuhtis. and cutaneous ulcers. The second form of extra-articular disease is the so cailed Felty's syndrome which occurs late in the RA disease course, sometimes after joint disease has become quiescent, and involves the presence of neutropenia. thrombocytopenia and splenomegaly. This can be accompanied by vascuhtis in multiple organs with formations of mfarcts. skin ulcers and gangrene. Patients often also develop rheumatoid nodules in the subcutis tissue overlying affected jomts; the nodules late stage have necrotic centers surrounded bv a mixed inflammatory ceil infiltrate. Other manifestations which can occur in RA include: peπcarditis. pleuπtis. coronary aπeπtis. intestinal pneumonitis with pulmonary fibrosis. keratoconjunctivitis sicca. and rhematoid nodules.
Juvenile chronic arthritis is a chronic idiopathic inflammatory disease which begms often at less than 16 years of age. Its phenotype has ome similanties to RA; some patients which are rhematoid factor positive are classified as juvenile rheumatoid arthritis. The disease is sub-classified into three major categories: pauciarticular. polyarticular. and systemic. The arthritis can be severe and is typically destructive and leads to joint ankylosis and retarded growth Other manifestations can include chronic anteπor uveitis and systemic amyloidosis.
Spondyloanhropathies are a group of disorders with some common clinical features and the common association with the expression of HLA-B27 gene product. The disorders include: ankvlosing sponyhtis. Reiter's syndrome (reactive arthntis). arthntis associated with inflammatory bowel disease, spondylitis associated w ith psoriasis, luv cnile onset spondyloarthropathy and undifferentiated spondyloartliropathy. Distinguishing features include sacroileitis with or without spondylitis; inflammatory asymmetπc arthritis; association with HLA-B27 (a serologically defined allele of the HLA-B locus of class I MHC); ocular inflammation, and absence ot autoantibodies associated with other rheumatoid disease. The cell most implicated as key to mduction of the disease is the CD8+ T lymphocyte, a cell which targets antigen presented by class I MHC molecules. CD8+ T cells may react agamst the class I MHC allele HLA-B27 as if it were a foreign peptide expressed by MHC class 1 molecules. It has been hypothesized that an epitope of HLA-B27 may mimic a bacteπal or other microbial antigenic epitope and thus mduce a CD8+ T cells response. Systemic sclerosis (scleroderma) has an unknown etiology. A hallmark of the disease is induration of the skm: likely this is induced by an active inflammatory process. Scleroderma can be localized or systemic; vascular lesions are common and endothelial cell injury in the microvasculature is an early and important event in the development of systemic sclerosis: the vascular injury may be immune mediated. An tmmunologic basis is implied by the presence of mononuclear cell infiltrates in the cutaneous lesions and the presence of anti- nuclear antibodies in many patients. ICAM- 1 is often upregulated on the cell surface of fibroblasts in skin lesions suggestmg that T cell interaction with these cells may have a role in the pathogenesis of the disease. Other organs involved include, the gastrointestinal tract: smooth muscle atrophy and fibrosis resultmg m abnormal peπstalsis/moti ty, kidney concenmc subendothe al intimal proliferation affecting small arcuate and lnteriobular arteπes with resultant reduced renal cortical blood flow, results in protemuna. azotemia and hypertension, skeletal muscle, atrophy, interstitial fibrosis. inflammation; lung, interstitial pneumomtis and interstitial fibrosis. and heart contraction band necrosis, scamng/ fibrosis
Idiopathic inflammatory myopathies mcludmg dermatomvositis, polymyositis and others are disorders of chronic muscle inflammation of unknown etiology resulting m muscle weakness. Muscle injury/ inflammation is often symmetric and progressive Autoantibodies are associated with most forms These myositis-specific autoantibodies are directed agamst and inhibit the function of components, proteins and RNA's. involved m protein synthesis
Sjogren's syndrome is due to immune-mediated inflammation and subsequent functional destruction of the tear glands and salivary glands The disease can be associated with or accompanied bv inflammatory connective tissue diseases The disease is associated with autoantibody production agamst Ro and La antigens. both ot w hich are small RNA-protein complexes Lesions result in kcratoconiunctivitis sicca. xerostomia, with other manifestations or associations including bilary cirrhosis, peripheral or sensory neuropathy, and palpable purpura
Systemic vascuhtis are diseases in which the pπmarv lesion is inflammation and subsequent damage to blood vessels which results in ischemia/necrosis/degeneration to tissues supplied by the affected vessels and evenmal end-organ dysfunction in some cases Vasculitides can also occur as a secondary lesion or sequelae to other immune- inflammatory mediated diseases such as rheumatoid arthntis, systemic sclerosis, etc . particularly in diseases also associated with the formation of immune complexes Diseases in the pπmarv systemic vascuhtis group include systemic necrotizing vascuhtis polyarteπtis nodosa. allergic angntis and granulomatosis. poiyangutis. Wegener's granulomatosis. lymphomatoid granulomatosis. and giant cell arteπtis Miscellaneous v asculitides include mucocutancous Ivmph node syndrome (MLNS or Kawasaki's disease), isolated CNS vascuhtis. Behet's disease, thromboangiitis obhterans (Buergers disease) and cutaneous necrotizing venuhtis The pathogenic mechanism of most ot the types of v ascuhtis listed is believed to be pnmaπlv due to the deposition of immunoglobulin complexes in the vessel wall and subsequent induction of an inflammatory response either via ADCC. complement activation, or both Sarcoidosis is a condition of unknown etiology which is charactenzed by the presence of eptthehoid granulomas in nearly any tissue in the body, involvement of the lung is most common. The pathogenesis involves the persistence of activated macrophages and lymphoid cells at sites of the disease with subsequent chronic sequelae resultant trom the release of locally and systemically active products released by these cell types Autoimmune hemolytic anemia including autoimmune hemolytic anemia, immune pancytopema. and paroxysmal noctural hemoglobmuπa is a result of production of antibodies that react with antigens expressed on the surface of red blood cells (and m some cases other blood cells mcludmg platelets as well) and is a reflection of the removal of those antibody coated cells via complement mediated lysis and or ADCC Fc- receptor-mediated mechanisms. In autoimmune thrombocytopenia including thrombocytopenic purpura. and immune-mediated thrombocytopenia m other clinical settings, platelet destruction/removal occurs as a result of either antibody or complement attaching to platelets and subsequent removal by complement lysis, ADCC or FC-receptor mediated mechanisms. Thyroiditis mcludmg Grave's disease. Hashimoto's thyroiditis. juvenile lymphocytic thyroiditis. and atrophic thyroiditis, are the result of an autoimmune response against thyroid antigens with production of antibodies that react with proteins present in and often specific for the thyroid gland. Expeπmental models exist mcludmg spontaneous models: rats (BUT and BB rats) and chickens (obese chicken strain); inducible models, immunization of animals with either thyroglobuhn. thyroid microsomal antigen (thyroid peroxidase). Type I diabetes melhtus or insulin-dependent diabetes is the autoimmune destruction of pancreatic islet β cells, this destruction is mediated by auto-antibodies and auto-reactive T cells. Antibodies to insulin or the insulin receptor can also produce the phenotype of insulin-non-responsiveness.
Immune mediated renal diseases, including glomerulonephπtis and tubulointerstitial nephπtis. are the result of antibody or T lymphocyte mediated injury to renal tissue either directly as a result of the production of autoreac e antibodies or T cells against renal antigens or indirectly as a result of the deposition of antibodies and/or immune complexes in the kidney that are reactive against other, non-renal antigens. Thus other immune-mediated diseases that result in the formation of immune-complexes can also mduce immune mediated renal disease as an indirect sequelae Both direct and indirect immune mechanisms result in inflammatory response that produces/induces lesion development in renal tissues with resultant organ function impairment and in some cases progression to renal failure. Both humoral and cellular immune mechanisms can be involved in the pathogenesis of lesions.
Demyehnating diseases of the central and peπpheral nervous systems, mcluding Multiple Sclerosis; idiopathic demyehnating polyneuropathy or Guillain-Barre syndrome: and Chronic Inflammatory Demyehnating Polyneuropathy, are believed to have an autoimmune basis and result m nerve demyehnation as a result of damage caused to oligodendrocytes or to myehn directly In MS there is evidence to suggest that disease induction and progression is dependent on T lymphocvtes. Multiple Sclerosis is a demyehnating disease that is T lymphocyte-dependent and has either a relapsing-remitting course or a chronic progressive course The etiology is unknown: however, viral infections, genetic predisposition, environment, and autoimmuniry all contπbute. Lesions contain infiltrates of predominantly T lymphocyte mediated, microg al cells and mfiltratmg macrophages; CD4+T lymphocytes are the predominant cell type at lesions. The mechanism of o godendrocyte cell death and subsequent demyehnation is not known but is likely T lymphocyte driven.
Inflammatory and Fibrotic Lung Disease, including Eosinophi c Pneumonias; Idiopathic Pulmonary Fibrosis, and Hypersensitivity Pneumomtis may mvolve a deregulated immune-inflammatory response. Inhibition of that response would be of therapeutic benefit.
Autoimmune or Immune-mediated Skm Disease mcludmg Bullous Skin Diseases, Erythema Multiforme, and Contact Dermatitis are mediated by auto-antibodies, the genesis of which is T lymphocyte- dependent.
Psoπasis is a T lymphocyte-mediated inflammatory disease. Lesions contain infiltrates of T lymphocytes, macrophages and antigen processing cells, and some neutrophils. Allergic diseases, including asthma: allergic rhinitis: atopic dermatitis: food hypersensitivity; and urticaπa are T lymphocyte dependent. These diseases are predominantly mediated by T lymphocyte induced inflammation. IgE mediated-inflammation or a combmation of both.
Transplantation associated diseases, mcludmg Graft rejection and Graft-Versus-Host-Disease (GVHD) are T lymphocyte-dependent; inhibition of T lymphocyte function is ameliorative.
Other diseases in which intervention of the immune and/or inflammatory response have benefit are infectious disease including but not limited to viral infection (mcludmg but not limited to AIDS, hepatitis A, B. C, D, E and heφes) bacteπal infection, fungal infections, and protozoal and parasitic fections (molecules (or deπvatives/agomsts) which stimulate the MLR can be utilized therapeutically to enhance the immune response to infectious agents), diseases of immunodeficiency (molecules/deπvatives/agomsts) which stimulate the MLR can be utilized therapeutically to enhance the immune response for conditions of inhented. acquired, infectious induced (as in HIV infection), or latrogenic (i e , as from chemotherapy) immunodeficiency), and neoplasm.
It has been demonstrated that some human cancer patients develop an antibody and or T lymphocyte response to antigens on neoplastic cells. It has also been shown in animal models of neoplasm that enhancement of the immune response can result in rejection or regression of that particular neoplasm Molecules that enhance the T lymphocyte response in the MLR have utility m vno in enhancing the immune response against neoplasm. Molecules which enhance the T lymphocyte prohferative response in the MLR (or small molecule agonists or antibodies that affected the same receptor in an agonistic fashion) can be used therapeutically to treat cancer. Molecules that inhibit the lymphocyte response in the MLR also function in vivo duπng neoplasm to suppress the immune response to a neoplasm; such molecules can either be expressed by the neoplastic cells themselves or their expression can be induced by the neoplasm in other cells. Antagonism of such inhibitory molecules (either with antibody, small molecule antagonists or other means) enhances immune-mediated tumor rejection.
Additionally, inhibition of molecules with proinflammatory properties may have therapeutic benefit in reperfusion injury: stroke; mvocardiai infarction, atherosclerosis, acute lung injury, hemorrhagic shock, bum: sepsis/septic shock, acute tubular necrosis: endometπosis. degenerative joint disease and pancreatis
The compounds of the present invention, e g , polypeptides or antibodies, are admmistered to a mammal, preferably a human, in accord with known methods, such as intravenous administration as a bolus or by cont uous infusion over a penod of time, by mtramuscular, intrapeπtoneal. lntracerobrospinal, subcutaneous, intra-articular. mtrasynovial. intrathecal. oral, topical, or mhalation (intranasal. intrapulmonary) routes. Intravenous or inhaled administration of polypeptides and antibodies is preferred.
In immunoadjuvant therapy, other therapeutic regimens, such administration of an anti-cancer agent, may be combmed with the administration of the proteins, antibodies or compounds of the instant invention. For example, the patient to be treated with a the immunoadjuvant of the mvention may also receive an anti- cancer agent (chemotherapeutic agent) or radiation therapy. Preparation and dosmg schedules for such chemotherapeutic agents may be used according to manufacturers' instructions or as determmed empincally by the skilled practitioner. Preparation and dosmg schedules for such chemotherapy are also descπbed in Chemotherapy Service Ed., M.C. Perry, Williams & Wilkins, Baltimore, MD (1992). The chemotherapeutic agent may precede, or follow administration of the immunoadjuvant or may be given simultaneously therewith. Additionally, an anti-oestrogen compound such as tamoxifen or an anti-progesterone such as onapπstone (see, EP 616812) may be given dosages known tor such molecules
It may be desirable to also admmister antibodies agamst other immune disease associated or tumor associated antigens, such as antibodies which bind to CD20, CD1 la. CD 18. ErbB2. EGFR, ErbB3. ErbB4, or vascular endothelial factor (VEGF) Alternatively, or in addition, two or more antibodies binding the same or two or more different antigens disclosed herein may be coadmmistered to the patient Sometimes, it may be beneficial to also admmister one or more cytokines to the patient In one embodiment, the PRO polypeptides are coadmmistered with a growth inhibitory agent For example, the growth inhibitory agent may be administered first, followed by a PRO polypeptide However, simultaneous administration or administration first is also contemplated Suitable dosages for the growth inhibitory agent are those presently used and may be lowered due to the combined action (synergy) of the growth inhibitory agent and the PRO polypeptide
For the treatment or reduction m the seventy of immune related disease, the appropπate dosage of an a compound of the mvention will depend on the type of disease to be treated, as defined above, the seventy and course of the disease, whether the agent is administered for preventive or therapeutic purposes, previous therapy the patient's clinical history and response to the compound, and the discretion of the attending physician The compound is suitably admmistered to the patient at one time or over a series of treatments
For example depending on the rvpe and sev eπtv of the disease, about 1 μg/kg to 15 mg/kg (e g . 0 1- 20 mg'kg) of polypeptide or antibodv is an initial candidate dosage tor administration to the patient whether, for example, bv one or more separate administrations or by continuous infusion A typical dailv dosage might range from about 1 μg/kg to 100 mg/kg or more, depending on the factors mentioned above For repeated administrations over several davs or longer, depending on the condition, the treatment is sustained until a desired suppression of disease symptoms occurs However, other dosage regimens mav be useful The progress of this therapv is easily monitored bv conventional techniques and assays O Articles of Manufacture
In another embodiment of the invention an article of manufacture containing matenals ( g , comprising a PRO molecule) useful for the diagnosis or treatment of the disorders descπbed above is provided
The article of manufacture compπses a container and an instruction Suitable containers include, for example. bottles vials svπnges and test tubes The containers mav be formed from a vaπety of matenals such as glass or plastic The container holds a composition which is effective for diagnosmg or treating the condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceabie by a hypodermic injection needle) The active agent m the composition is usually a polypeptide or an antibody of the invention An instruction or label on. or associated with, the container indicates that the composition is used for diagnosing or treating the condition of choice The article of manufacture may further compnse a second container compπsing a pharmaceutically-acceptable buffer, such as phosphate-buffered saline. Ringer's solution and dextrose solution It may further mclude other matenals desirable from a commercial and user standpoint including other buffers, diluents, filters, needles, synnges, and package inserts with instructions for use p- Diagnosis and Prognosis of Immune Related Disease
Cell surface protems. such as proteins which are overexpressed m certain immune related diseases, are excellent targets for drug candidates or disease treatment The same protems along with secreted protems encoded bv the genes amplified in immune related disease states find additional use m the diagnosis and prognosis of these diseases. For example, antibodies directed agamst the protem products of genes amplified in multiple sclerosis, rheumatoid arthntis, or another immune related disease, can be used as diagnostics or prognostics.
For example, antibodies, mcludmg antibody fragments, can be used to qualitatively or quantitatively detect the expression of proteins encoded by amplified or overexpressed genes ("marker gene products"). The antibody preferably is equipped with a detectable, e.g., fluorescent label, and binding can be monitored by light microscopy, flow cytometry, fluoπmetry, or other techniques known in the art. These techniques are particularly suitable, if the overexpressed gene encodes a cell surface protem Such binding assays are performed essentially as described above. In situ detection of antibody binding to the marker gene products can be performed, for example, by immunofluorescence or lmmunoelectron microscopy. For this purpose, a histological specimen is removed from the patient, and a labeled antibody is applied to it. preferably by overlaying the antibody on a biological sample. This procedure also allows for determining the distπbution of the marker gene product in the tissue examined. It will be apparent for those skilled in the art that a wide vaπety of histological methods are readily available for m situ detection.
The following examples are offered for illustrative purposes only, and are not intended to limit the scope ot the present invention m any way
All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety.
EXAMPLES
Commercially available reagents referred to in the examples were used according to manufacmrer's instructions unless otherwise indicated. The source of those cells identified in the following examples, and throughout the specification, by ATCC accession numbers is the Ameπcan Type Culture Collection, Manassas. VA. Unless otherwise noted, the present invention uses standard procedures of recombinant DNA technology, such as those descnbed here above and in the following textbooks: Sambrook et al. Molecular Cloning: A Laboraton Manual Cold Spnng Harbor Press N.Y.. 1989; Ausubel et al. Current Protocols in Molecular Biolog) , Green Publishmg Associates and Wiley Interscience, N.Y., 1989; Innis et al. PCR Protocols: A Guide to Methods and Applications. Academic Press, inc., N.Y., 1990: Harlow et al. Antibodies. A Laboratory Manual. Cold Spπng Harbor Press, Cold Spπng Harbor, 1988; Gait, M.J., Oligonucleotide Svnthesis, IRL Press, Oxford, 1984; R.I. Freshney, Animal Celt Culture, 1987; Coligan et al. Current Protocols in Immunology, 1991.
EXAMPLE 1 Isolation of cDNA clones Encoding Human PRO200, PRO204, PR0212, PR0216. PR0226, PRO240, PR0235. PR0245, PR0172, PR0273, PR0272, PR0332, PR0526, PRO701 , PR0361. PR0362, PR0363, PR0364. PR0356, PR0531, PR0533, PRO1083, PR0865, PRO770, PR0769, PR0788, PROl 114, PRO1007, PROl 184. PRO1031, PR01346, PROl 155, PRO1250, PR01312, PROl 192, PR01246. PR01283, PROl 195, PR01343. PR01418, PR01387, PRO1410, PR01917, PR01868, PRO205, PR021, PR0269, PR0344, PR0333. PR0381. PRO720, PRO866, PRO840, PR0982, PR0836, PROl 159, PR01358, PR01325, PR01338. PR01434. PR04333. PRO4302. PRO4430 and PR05727 polypeptide.
Various techniques were employed for isolating the cDNA clones described below. A general descπption of the methods employed follows immediately hereafter, whereas the details relating the specific sequences isolated is recited separately for each native sequence. It is understood that the actual sequences of the PRO polypeptides are those which are contained within or encoded by the clone deposited with the ATCC - and that in the in event of any discrepancy between the sequence deposited and the sequence disclosed herem. the sequence of the deposit is the true sequence
ECD Homology:
The extracellular domain (ECD) sequences (including the secretion signal sequence, if any) from about 950 known secreted proteins from the Swiss-Prot public database were used to search EST databases. The EST databases included public EST databases (e.g , GenBank), a pnvate EST database (LIFESEQ Incyte Pharmaceuticals. Palo Alto, CA), and proprietary ESTs from Genentech. The search was performed using the computer program BLAST or BLΛST2 [Altschul et al . Methods m 266- 460-480 ( 1996)] as a companson of the ECD protein sequences to a 6 frame translation of the EST sequences. Those compaπsons resulting in a BLAST score of 70 (or in some cases. 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green. University of Washington, Seattle, Washington). Using vanous ESTs. drawing from both public and pπvate databases, a consensus DNA sequence was assembled. Oligonucleotides were then synthesized to identify by PCR a cDNA library that contained the sequence of interest and for use as probes to isolate a clone encoding the particular native sequence PRO polypeptide identified herein.
In order to screen several libranes for a source of a full-length, native sequence clone. DNA from the libranes was screened by PCR amplification with the PCR pπmer pair identified below. A positive library was then used to isolate clones encoding the particular native sequence PRO polypeptide using the probe oligonucleotide and one of the PCR primers.
RNA for construction of the cDNA libranes was isolated from vaπous human tissue libranes. including, e.g.. fetal lung, fetal liver, fetal brain, small intestine, smooth muscle cells, etc. The cDNA libranes used to isolated the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropπately by gel electrophoresis, and cloned in a defined oπentation into a suitable cloning vector (such as pRKB; pR 5B is a precursor of pRK5D that does not contain the Sfil site; see. Holmes et al. Science. 253: 1278-1280 (1991)) in the unique Xhol and Notl sites. The clones were sequenced using known and readily available methodology.
Amylase yeast screen:
1. Preparation of oligo dT primed cDNA library mRNA was isolated from vanous tissues (e.g., such as those indicated above under the ECD homology procedure) using reagents and protocols from Invitrogen, San Diego, CA (Fast Track 2). This RNA was used to generate an oligo dT primed cDNA library in the vector pRK5D using reagents and protocols from Life Technologies, Gaithersburg, MD (Super Scπpt Plasmid System). In this procedure, the double stranded cDNA was sized to greater than 1000 bp and the Sall/Notl hnkered cDNA was cloned into Xhol/Notl cleaved vector. pRK5D is a cloning vector that has an sp6 transcnption initiation site followed by an Sfil restπction enzyme site preceding the Xhol Notl cDNA clonmg sites.
2. Preparation of random pnmed cDNA library A secondary cDNA library was generated in order to preferentially represent the 5' ends of the primary cDNA clones. Sp6 RNA was generated from the pπmary library (descπbed above), and this RNA was used to generate a random pnmed cDNA library in the vector pSST-AMY.O using reagents and protocols from Life Technologies (Super Script Plasmid System, referenced above). In this procedure the double stranded cDNA was sized to 500-1000 bp, hnkered with blunt to Notl adaptors, cleaved with Sfil, and cloned into Sfil Notl cleaved vector. pSST-AMY.O is a cloning vector that has a yeast alcohol dehydrogenase promoter preceding the cDNA clonmg sites and the mouse amylase sequence (the mature sequence without the secretion signal) followed by the yeast alcohol dehydrogenase terminator, after the cloning sites. Thus. cDNAs cloned into this vector that are fused in frame with amylase sequence will lead to the secretion of amylase from appropriately transfected yeast colonies.
3. Transformation and Detection DNA from the library descπbed in paragraph 2 above was chilled on ice to which was added electrocompetent DH10B bacteπa (Life Technologies, 20 ml). The bactena and vector mixmre was then electroporated as recommended by the manufacturer. Subsequently, SOC media (Life Technologies. 1 ml) was added and the mixmre was incubated at 37°C for 30 minutes. The transformants were then plated onto 20 standard 150 mm LB plates containing ampicillin and mcubated for 16 hours (37°C). Positive colonies were scraped off the plates and the DNA was isolated from the bacteπal pellet using standard protocols, e g , Cisco- gradient. The purified DNA was then earned on to the yeast protocols below.
The yeast methods were divided into three categoπes: ( 1 ) Transformation of yeast with the plasmid cDNA combined vector; (2) Detection and isolation of yeast clones secretmg amylase; and (3) PCR amplification of the insert directiy from the yeast colony and punfication of the DNA for sequencing and further analysis.
The yeast strain used was HD56-5A (ATCC-90785). This strain has the following genotype: MAT alpha, ura3-52, leu2-3, leu2-1 12, his3-l l, his3-15, MAL\ SUC". GAlΛ Preferably, yeast mutants can be employed that have deficient post-translational pathways. Such mutants may have translocation deficient alleles in seel I, secll. sec62. with truncated Λ?C71 being most preferred. Alternatively, antagonists (including antisense nucleotides and or ligands) which interfere with the normal operation of these genes, other proteins implicated m this post translation pathway (e.g., SECόlp, SEC72p, SEC62p, SEC63p, TDJlp or SSAlp-4p) or the complex formation of these proteins may also be preferably employed in combination with the amylase- expressing yeast.
Transformation was performed based on the protocol outlined by Gietz et al, Nucl. Acid. Res., 20: 1425 (1992). Transformed cells were then inoculated from agar into YEPD complex media broth (100 ml) and grown overnight at 30°C. The YEPD broth was prepared as descπbed in Kaiser et al, Methods in Yeast Genetics, Cold Spπng Harbor Press, Cold Spπng Harbor. NY, p. 207 (1994) The overnight culture was then diluted to about 2 x IO6 cells/ml (approx OD600 = 0 1) to fresh YEPD broth (500 ml) and regrown to 1 x IO7 cells/ml (approx. OD6oo=0.4-0 5). The cells were then harvested and prepared for transformation by transfer mto GS3 rotor bottles in a
Sorval GS3 rotor at 5.000 rpm for 5 minutes, the supernatant discarded, and then resuspended mto steπle water, and centnfuged again in 50 ml falcon tubes at 3,500 rpm m a Beckman GS-6KR centnfuge. The supernatant was discarded and the cells were subsequently washed with LiAc/TE (10 ml, 10 mM Tris-HCl, 1 mM EDTA pH 7.5, 100 mM Lι20OCCH3). and resuspended into LiAc/TE (2.5 ml). Transformation took place by mixing the prepared cells (100 μl) with freshly denatured single stranded salmon testes DNA (Lofstrand Labs. Gaithersburg, MD) and transforming DNA (I μg, vol. < 10 μl) in microfiige tubes The mixmre was mixed bπefly by vortexing, then 40% PEG/TE (600 μl, 40% polyethylene glycol-4000, 10 M Tπs-HCI, 1 mM EDTA, 100 mM Lι2Ac, pH 7.5) was added. This mixmre was gently mixed and incubated at 30°C while agitating for 30 minutes The cells were then heat shocked at 42°C for 15 minutes, and the reaction vessel centπtuged in a microfiige at 12.000 rpm tor 5- 10 seconds, decanted and resuspended into TE (500 ul. 10 mM Tπs-HCI. 1 mM EDTA pH 7 5) followed by recentnftigation. The cells were then diluted into TE (1 ml) and aliquots (200 μl) were spread onto the selective media previously prepared in 150 mm growth plates (VWR).
Alternatively, instead of multiple small reactions, the transformation was performed using a single, large scale reaction, wherein reagent amounts were scaled up accordingly.
The selective media used was a synthetic complete dextrose agar lackmg uracii (SCD-Ura) prepared as descπbed in Kaiser et al , Methods in Yeast Genetics, Cold Spπng Harbor Press. Cold Spπng Harbor, NY, p. 208-210 ( 1994) Transformants were grown at 30°C for 2-3 days.
The detection of colonies secreting amylase was performed by mcludmg red starch in the selective growth media. Starch was coupled to the red dye (Reactive Red- 120, Sigma) as per the procedure descnbed by Biely et al. Anal Biochem . _72 176- 179 ( 1988) The coupled starch was incoφorated into the SCD-Ura agar plates at a final concentration of 0 15% (w/v). and was buffered with potassium phosphate to a pH of 7 0 (50- 100 mM final concentration)
The positive colonies were picked and streaked across fresh selective media (onto 150 mm plates) in order to obtain well isolated and identifiable single colonies. Well isolated single colonies positive for amylase secretion were detected by direct incoφoration of red starch into buffered SCD-Ura agar. Positive colonies were determmed by their ability to break down starch resulting m a clear halo around the positive colony visualized directly.
Isolation and sequencing by standard techniques identified a yeast EST fragment which served as the basis for additional database mining as descπbed below.
4. Assembly
The yeast EST fragment identified above was used to search vaπous expressed sequence tag (EST ) databases. The EST databases included public EST databases (e g., GenBank, Merck/Wash U) and a propπetary EST DNA database (LIFESEQW, Incyte Pharmaceuticals, Palo Alto, CA). The search was performed usmg the computer program BLAST or BLAST2 (Altshul et al. Methods in Enzvmology 266:460-480 (1996)) as a compaπson of the ECD protem sequences to a 6 frame translation of the EST sequence. Those compaπsons resulting m a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled mto consensus DNA sequences with the program "phrap" (Phil Green. University of Washmgton, Seattle. Washmgton).
A consensus DNA sequence was assembled relative to other EST sequences using phrap. The consensus DNA sequence was extended using repeated cycles of BLAST and phrap to extend the consensus sequence as far as possible using the sources of EST sequences discussed above as well as EST sequences propnetary to Genentech. Based on this consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone encoding the particular PRO polypeptide. In order to screen several libranes for a full-length clone, DNA from the libranes was screened by PCR amplification, as per Ausubel et al, Current Protocols in Molecular Biology, with the PCR pπmer pair. A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs
RNA for construction of the cDNA libranes was isolated from vanous human tissues. The cDNA libranes used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen. San Diego, CA The cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl. sized appropriately by gel electrophoresis. and cloned in a defined onentation into a suitable cloning vector (such as pRKB or pRKD. pRK5B is a precursor of pRK5D that does not contain the Sfil site; Holmes et al.. Science, 253: 1278-1280 (1991)) in the unique Xhol and Notl sites.
Signal algorithm- A propπetary signal sequence finding algoπthm developed by Genentech. Inc was used upon
Expressed Sequence Tags (ESTs) and on clustered and assembled EST fragments from public (e g . GenBank) and or private (Lιfeseq\ Incyte Pharmaceuticals. Inc.. Palo Alto, CA) databases. The signal sequence algoπthm computes a secretion signal score based on the character of the DNA nucleotides surrounding the first and optionally the second methionine codon(s) (ATG) at the 5'-end of the sequence or sequence fragment under consideration. The nucleotides following the first ATG must code for at least 35 unambiguous amino acids without any stop codons. If the first ATG has the required ammo acids, the second is not examined. If neither meets the requirement, the candidate sequence is not scored. In order to determine whether the EST sequence contains an authentic signal sequence, the DNA and corresponding ammo acid sequences surrounding the ATG codon are scored using a set of seven sensors (evaluation parameters) known to be associated with secretion signals.
The above procedure resulted in the identification of EST sequences which were compared to a vaπety of expressed sequence tag (EST) databases which mcluded public EST databases (e.g., GenBank) and a propπetary EST DNA database (LIFESEQR, Incyte Pharmaceuticals, Palo Alto, CA). The homology search was performed using the computer program BLAST or BLAST2 (Altshul et al, Methods in Enzymology 266:460-480 (1996)). Those compaπsons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into a consensus DNA sequence with the program "phrap" (Phil Green, University of Washington, Seattle, Washington). This resulted in the identification of additional EST sequences which either corresponded to full-length clones, which were exammed and sequenced or served as a template for the creation of cloning oligonucleotides which were then used to screen vaπous tissue libranes resulting m isolation of DNA encoding a native sequence PRO polypeptide
A Isolation of cDNA clones Encoding Human PRO200 (UNQ 174)
Probes based on an expressed sequence tag (EST) identified from the Incyte Pharmaceuticals database due to homology with VEGF were used to screen a cDNA library deπved from the human glioma cell line G61. Screening may be conducted in a manner similar to the procedure disclosed elsewhere in this application. In particular, Incyte Clone "INC 1302516" was used to generate the following four probes-
5'-ACTTCTCAGTGTCCATAAGGG-3' (SEQ ID N0.3)
5'-GAACTAAAGAGAACCGATACCATTTTCTGGCCAGGTTGTC-3' (SEQ ID NO 4)
S'-CACCACAGCGTTTAACCAGG-S' (SEQ ID NO 5) S'-ACAACAGGCACAGTTCCCAC-S' (SEQ ID NO 6)
Nine positives were identified and charactenzed Three clones contained the full coding region and were identical in sequence Partial clones were also identified from a fetal lung library and were identical with the ghoma-denved sequence with the exception of one nucleotide change which did not alter the encoded
For mammalian protein expression, the entire open reading frame (ORF) was cloned mto a
CMV-based expression vector. An epitope-tag (FLAG, Kodak) and Histidine-tag (His8) were inserted between the ORF and stop codon. UNQ174-Hιs8 and UNQ174-FLAG were transfected into human embryonic kidney 293 cells by SuperFect (Qiagen) and pulse-labeled for 3 hours with [35S]methιonιne and [35C]cysteιne. Both epitope-tagged protems co-migrate when 20 microhters of 15-fold concentrated serum-free conditioned medium were electrophoresed on a polyacrvlamide gel (Novex) in sodium dodecvl sulfate sample buffer (SDS-PAGE) The UNQI74-IgG expression plasmid was constructed by cloning the ORF in front ot the human Fc (IgG) sequence
The UNQ174-IgG plasmid was co-transtected with Baculogold Baculovirus DNA (Pharmmgen) using Lipofectin (GibcoBRL) into 105 Sf9 cells grown in Hmk's TNM-FH medium (JRH Biosciences) supplemented with 10% fetal bovine serum Cells were incubated for 5 days at 28°C. The supernatant was harvested and subsequently used for the first viral amplification by infecting Sf9 cells at an approximate multiplicity of mfection (MOI) of 10 Cells were incubated for 3 days, then supernatant harvested, and expression of the recombinant plasmid determmed by binding of 1 ml of supernatant to 30 μl of Protem-A Sepharose CL-4B beads (Pharmacia) followed by subsequent SDS-PAGE analysis The first amplification supernatant was used to mfect a 500 ml spinner culmre of Sf9 cells grown in ESF-921 medium (Expression Systems LLC) at an approximate MOI ot 0 1 Cells were treated as above, except harvested supernatant was sterile filtered Specific protein was puπfied bv binding to Protein-A Sepharose 4 Tast Flow (Pharmacia) column
The entire nucleotide sequence of the identified clone DNA29101 is shown in Figure 1 (SEQ ID NO 1) Clone DNA29101 (SEQ ID NO 1 ) contains a single open reading frame with an apparent translation initiation site at nucleotide residues 285-287 and ending at the stop codon (TAG) found at nucleotide positions 1320-1322 (Figure 1, SEQ ID NO. l), as indicated by bolded underline. The predicted PRO200 polypeptide precursor (t e , UNQ 174, SEQ ID NO 2) is 345 ammo acids in length, has a calculated molecular weight of 39029 daltons. a pi of 606 and is shown in Figure 2 (SEQ ID NO 2) Potential N-glycosylation sites are at ammo acid residues 25. 54 and 254 CUB domains are at amino acid residues 52-65, 118-125 and 260-273. A cDNA containing DNA encoding UNQ 174 (SEQ ID NO 2) has been deposited with the ATCC on
March 5, 1998 and has been assigned deposit number 209653
B. Isolation of cDNA clones Encoding Human PRO204 (UNQ 178)
An expressed sequence tag (EST) DNA database (LIFESEQ* Incyte Pharmaceuticals, Palo Alto, CA) was searched and an EST was identified Human fetal retma cDNA libranes were screened with PCR oligonucleotide pnmers and confirmed by hybπdization with synthetic oligonucleotide piobe which was based upon the EST sequence hybndization probe
5'-GGCATGCAGCAGCTGGACATTTGCGAGGGCTTTTGCTGGCTG-3' (SEQ ID NO 7) forward PCR pπmer
5'-CTGCTGCAGAGTTGCACGAAC-3' (SEQ ID NO 8) reverse PCR pπmer 1
5'-CAGTTGTTGTTGTCACAGAGAAG-3' (SEQ ID NO 9) reverse PCR pπmer 2 5 AGTTCGTGCAACTCTGCAGCAG-3' (SEQ ID NO 10)
A cDNA clone was identified and sequenced in entirety The entire nucleotide sequence of the identified clone DNA30871 is shown in Figure 3 (SEQ ID NO 1 1) Clone DNA30871-1157 (SEQ ID NO 1 1) contains a single open readmg frame with an apparent translation initiation site at nucleotide positions 376-378 and ending at the stop codon (TAA) found at nucleotide positions 1498-1500 (Figure 3 SEQ ID NO 11), as indicated bv bolded underline The predicted PRO204 polypeptide precursor ( I e UNQ 178 SEQ ID NO 12) is 374 amino acids long has a calculated molecular weight of 39 285 daltons a pi of 6 06 and is shown in
Figure 4 A cDNA containing DNA encoding UNQ 178 (SEQ ID NO 12) has been deposited with the ATTC on October 16 1997 and has been assigned deposit number 209380
C Isolation of cDNA clones Encoding Human PRQ212 (UNQ186)
Use of the ECD homology procedure descπbed above from a human fetal lung library resulted in the identification of the full length DNA sequence for DNA30942 (Fig 5, SEQ ID NO 13) and the deπved protem sequence UNQ 186 (Fig 6, SEQ ID NO 14)
The PCR pnmers (forward and reverse) and probes used in the procedure were the following forward pπmer 3 CACGCTGGTTTCTGCTTGGAG-3' (SEQ ID NO 15) reverse pnmer 5 AGCTGGTGC λCAGGGTGTCATG-3' (SEQ ID NO 16) hybridization probe (SEQ ID NO 17)
5'-CCCAGGCACCTTCTCAGCCAGCCAGCAGCTCCAGCTCAGAGCAGTGCCAGCCC-3'
The entire nucleotide sequence of DNA30942 is shown in Figure 5 (SEQ ID NO 13) Clone DNA30942 (SEQ ID NO 13) contains a single open readmg frame with an apparent translation initiation site at nucieotide positions 101-103 and ending at the stop codon (TGA) at positions 1001-1003 (Fig 5, SEQ ID NO 13), as indicated in bolded underlme The predicted PR0212 polypeptide precursor of Fig 6 (SEQ ID NO 14) is 300 ammo acids long, has a calculated molecular weight of 32680 daltons and a pi of 8 70 It is believed that the PR0212 sequence of Fig 6 (SEQ ID NO 14) lacks a transmembrane domain It is also believed that ammo acids 1 to 215 of Fig 6 (SEQ ID NO 14) represents an ECD which mcludes four cysteine πch domams (CRDs) A cDNA clone contammg DNA30942 (SEQ ID NO 13) has been deposited with ATCC (identified as DNA30942-1134) on September 16, 1997 and has been assigned ATCC deposit no 209254 D. Isolation of cDNA clones Encoding Human PRQ216 (UNQ 190)
A procedure analogous to the one above for the isolation of PR0212 can be employed to isolate DNA33087 (SEQ ID NO 18) (Figure 7) which encodes the PR0216 polypeptide UNQ 190 (SEQ ID NO: 19)(Fιgure 8).
DNA33087 contams a single open reading frame with an apparent translation initiation site nucleotide residues 268-270 and ending at the stop codon (TAG) are residues 1531-1533 (Fig. 7, SEQ ID NO: 18), as indicated by bolded underline. The predicted PR0215 polypeptide precursor (i.e , UNQ 190, SEQ ID NO: 19) is 421 amino acids long, has a calculated molecular weight of 49492 daltons and a pi of 5.51 (Fig. 8). Hydropathy analysis suggests the presence of a signal sequence at ammo acid residues 1 to 20, tyrosine kinase phosphorylation sites at amino acid residues 268-274 and 300-306, and N-myπstoylation site residue 230-235, and leucine zippers at residues 146 to 167 and 217 to 238. Alternatively to traditional isolation techniques, the DNA sequence is publicly available from GenBank as accession number AB0001 14 which encodes Dayhoff protein ABOOOl 1-4 1 Alternativelv still, the sequence is descnbed in Ohno et al , Biochem Biophvs Res Commun 228(2)'
411-414 (1996) A cDNA clone containing DNA33087 (identified as DNA33087-1 158) has been deposited with the Λmencan Type Culture Collection (ATCC) on September 16, 1997 and has been assigned ATCC Dep. No 209381
E Isolation of cDNA clones Encoding Human PRQ226 (UNQ200)
Use of the ECD homology procedure descπbed above m a human fetal lung library resulted in the identification of the full-length DNA sequence for DNA33460 (Figure 9, SEQ ID NO.20) and the denved native sequence protein UNQ200 (SEQ ID NO.21)
DNA33460 contains a single open reading frame with an apparent translation initiation site at nucleotide residues 62-64 and ending at the stop codon (TGA) at residues 1391-1393 (Fig. 9. SEQ ID NO 20), as indicated by bolded underline. The predicted PR0226 polypeptide precursor (i e , UNQ200. SEQ ID NO 21) is 443 ammo acids long, has a calculated molecular weight of 49.391 daltons, a pi of 4 82 and is shown m Figure 10 as UNQ200 (SEQ ID NO.21) A cDNA clones containing DNA33460 (SEQ ID NO:20), designated as DNA33460-1166. has been deposited with the ATCC on October 16, 1997 and has been assigned ATCC deposit number 209376
The oligonucleotide sequences used m the above procedure were the following: 28722-p (OLI488) (SEQ ID NO: 22)
5'-TGTGTGGACATAGACGAGTGCCGCTACCGCTACTGCCAGCACCGC-3' 28722T (OLI489) (SEQ ID NO: 23) 5'-AGGACTGCCATAACTTGCCTG-3'
28722.r (OLI490) (SEQ ID NO: 24)
5'-ATAGGAGTTGAAGCAGCGCTGC-3' F Isolation of cDNA clones Encoding Human PRO240 (UNQ214)
Use of the ECD homology procedure described above m a human fetal liver library resulted m the isolation of the full-length DNA sequence for DNA34387 (Figure 11 , SEQ ID NO 25) and the denved native sequence protem UNQ214 (SEQ ID NO 26) The entire nucleotide sequence of DNA34387 is shown m Figure 11 (SEQ ID NO 25) The clone
DNA34387 contains a single open reading frame with an apparent translation initiation site at nucleotide positions 12-14 and ending at the stop codon (TGA) at nucleotide positions 699-701 (Fig 11, SEQ ID NO 25), as indicated by bolded underline The predicted PRO240 polypeptide precursor (i e , UNQ214. SEQ ID NO 26) is 229 ammo acids long, has a calculated molecular weight of 24 689 daltons. a pi of 7 83 and is shown in Figure 12 A cDNA clone containing DNA34387 (SEQ ID NO 25) has been deposited with ATCC on September 16, 1997 and is assigned ATCC deposit no 209260
The PCR pnmers (forward and reverse) and hybndization probe synthesized for use in the above- descπbed procedure were the following forward PCR pπmer 5'-TCAGCTCCAGACTCTGATACTGCC-3' (SEQ ID NO 27) reverse PCR primer 5'-TGCCTTTCTAGGAGGCΛGAGCTCC-3* (SEQ ID NO 28) hybndization probe (SEQ ID NO 29)
5'-GGACCCAGAAATGTGTCCTGAGAATGGATCTTGTGTACCTGATGGTCCAG-3'
G Isolation of cDNA clones Encoding Human PRQ235 (UNQ209) Use of the ECD homology procedure descπbed above in a human fetal liver library resulted in the isolation of the full-length DNA sequence for DNA35558 (Figure 13 SEQ ID NO 30) and the deπved
PR0235 native sequence protein UNQ209 (Fig 14, SEQ ID NO 31)
The entire nucleotide sequence of DNA35558 is shown in Figure 13 (SEQ ID NO 30) The
DNA35558 clone shown in Figure 13 contains a single open reading frame with an apparent translation initiation site at nucleotide positions 667-669 and ending at the stop codon (TGA) at nucieotide positions 2323-
2325, as indicated bv bolded underline The predicted PR0235 polypeptide precursor (i e UNQ209 SEQ ID
NO 31 ) is 552 ammo acids long has a calculated molecular weight of 61 674 daltons and a pi of 6 95 (Figure
14) A cDNA clone containing DNA35558 has been deposited with ATCC on October 16, 1997 and is assigned ATCC deposit no 209374 The PCR pnmers (forward and reverse) and hybndization probe synthesized for use in the above procedure were forward PCR primer 5'-TGGAATACCGCCTCCTGCAG-3' (SEQ ID NO 32) reverse PCR pπmer 5'-CTTCTGCCCTTTGGAGAAGATGGC-3' (SEQ ID NO 33) hybndization probe 5'-GGACTCACTGGCCCAGGCCTTCAATATCACCAGCCAGGACGAT-3' (SEQ ID NO 34) H. Isolation of cDNA Clones Encoding Human PRQ245 (UNQ219)
Use of the ECD homology procedure descπbed above m a human fetal liver library resulted in the isolation of the full-length DNA sequence for DNA35658 (Figure 15, SEQ ID NO:35) and the denved PR0245 native sequence protem UNQ219 (Figure 16, SEQ ID NO:36). The PCR pnmers (forward and reverse) and hybndization probes synthesized for use with the above- descπbed method were the following: forward PCR pπmer 5'-ATCGTTGTGAAGTTAGTGCCCC-3' (SEQ ID NO:37) reverse PCR pnmer 5,-ACCTGCGATATCCAACAGAATTG-3' (SEQ ID NO:38) hybndization probe (SEQ ID NO:39) 5'-GGAAGAGGATACAGTCACTCTGGAAGTATTAGTGGCTCCAGCAGTTCC-3'
The entire nucleotide sequence of DNA35638 (SEQ ID N0 35) is shown in Figure 15. Clone DNA35638 contains a single open reading frame with an apparent translation mitiation site at nucleotide positions 89-91 and endmg at the stop codon (TAG) at nucleotide positions 1025-1027 (Fig. 15; SEQ ID NO-35) The predicted PR0245 polypeptide precursor (i e , UNQ219, SEQ ID NO.36) is 312 ammo acids long, has a calculated molecular weight of 34.554 daltons and a pi of 9 39 (Fig. 36) A clone containing DNA35638 (SEQ ID NO 35). designated as DNA35638- 1 141 , has been deposited with ATCC on September 16. 1997 and is assigned ATCC deposit no 209265.
I Isolation of cDNA clones Encoding Human PROl 72 (UNQ146) Use of the ECD homology procedure descnbed above m a human fetal kidney library resulted in the isolation of the full-length DNA sequence for DNA35916 (Fig. 17; SEQ ID NO 40) and the deπved PR0172 native sequence protein UNQ146 (Fig. 18, SEQ ID NO:41).
Clone DNA35916 (SEQ ID NO 40) contams a single open reading frame with an apparent translation initiation site at nucleotide positions 38-40 and ending at the stop codon (TAA) at nucleotide positions 2207- 2209, as indicated by bolded underline in Fig. 17 The predicted PRO 172 polypeptide precursor (i e.,
UNQ 146. SEQ ID NO 41) is 723 amino acids long, has a calculated molecular weight of 78.055 daltons and a pi of 6 17 (Fig. 18). A cDNA clone containing DNA35916 (SEQ ID NO 40) has been deposited with ATCC on October 28, 1997 (designated as DNA35916-1 161) and has been assigned ATCC deposit no. 209419. The oligonucleotide sequences used in the above procedure were the following: 28765.p (OLI633)
5'-AAATCTGTGAAπGAGTGCCATGGACCTGTTGCGGACGGCCCTTGCTT-3' (SEQ ID NO:42)
28765.f(OLI644)
5'-GGATCTCGAGAACAGCTACTCC-3' (SEQ ID NO:43)
28765.r (OLI645) 5'-TCGTCCACGTTGTCGTCACATG-3' (SEQ ID NO:44) J Isolation of cDNA clones Encoding Human PRQ273 (UNQ240)
Use of the ECD homology procedure descπbed above m a human fetal kidney library resulted in the isolation of the full-length DNA sequence for DNA39523 (Fig 19, SEQ ID NO 45) and the deπved PR0273 native sequence protein UNQ240 (Fig 20, SEQ ID NO 46) The PCR pnmers (forward and reverse) and hybπdization probe synthesized were the following forward PCR pπmer 5'-CAGCGCCCTCCCCATGTCCCTG-3' (SEQ ID NO 47) reverse PCR pπmer 5'-TCCCAACTGGTTTGGAGTTTTCCC-3' (SEQ ID NO 48) hybπdization probe 5'-CTCCGGTCAGCATGAGGCTCCTGGCGGCCGCTGCTCCTGCTGCTG-3' (SEQ ID NO 49) Clone DNA39523 (SEQ ID NO 45) contains a single open readmg frame with an apparent translation initiation site at nucleotide positions 167-169 and ending at the stop codon (TAG) at nucleotide positions 500- 502 (Figure 19), as mdicated by bolded underline The predicted PR0273 polypeptide precursor (i e , UNQ240, SEQ ID NO 46) is 111 amino acids long, has a calculated molecular weight of 13,078 daltons and a pi of 10 37 (Figure 20) A cDNA clone including DNA39523 (SEQ ID NO 45) has been deposited with ATCC on October 31 1997 and is assigned ATCC deposit no 209424
K Isolation of cDNA clones Encoding Human PRQ272 (UNQ239)
Use of the ECD homology procedure descπbed above m a human fetal lung tissue in combination with an in vno cloning procedure using the probe oligonucleotide and one of the pπmer pairs resulted in the identification of the full length DNA sequence for DNA40620 (Fig 21, SEQ ID NO 50) and the deπved
PR0272 native sequence protem UNQ239 (SEQ ID NO 51)
The forward and reverse PCR pnmers and hybπdization probes synthesized and used to isolate the
PR0272 encoding DNA sequences were the following forward PCR pπmer ( fl) 5'-CGCAGGCCCTCATGGCCAGG-3' (SEQ ID NO 52) forward PCR pπmer ( f2) 5'-GAAATCCTGGGTAATTGG-3' (SEQ ID NO 53) reverse PCR pπmer 5'-GTGCGCGGTGCTCACAGCTCATC-3' (SEQ ID NO 54) hybπdization probe
5'-CCCCCCTGAGCGACGCTCCCCCATGATGACGCCCACGGGAACTTC-3' (SEQ ID NO 55)
Clone DNA40620 (SEQ ID NO 50) contams a single open readmg frame with an apparent translation initiation site at nucleotide positions 35-37 and endmg at the stop codon (TGA) at nucleotide positions 1020-
1022 (Figure 21), as indicated by bolded underline The predicted polypeptide precursor is 328 ammo acids long (Figure 22), has a calculated molecular weight of 37,493 daltons and a pi of 4 77 A cDNA clone containing DNA40620 (SEQ ID NO 50) has been deposited with ATCC on October 17, 1997 and is assigned
ATCC deposit no 209388
L Isolation of cDNA clones Encoding Human PRQ332 (UNQ293)
Use of the ECD homology procedure descπbed above in a human fetal liver library resulted in the identification of the full-length DNA sequence for DNA40982 (Fig 23, SEQ ID NO 56) and the deπved PR0332 native sequence protem UNQ293 (Fig 24, SEQ ID NO 57) The PCR pnmers (forward and reverse) and hybndization probe synthesized for use m the above procedure were:
5'-GCATTGGCCGCGAGACTTTGCC-3' (SEQ ID N0 58)
5'-GCGGCCACGGTCCTTGGAAATG-3' (SEQ ID NO:59)
5'-TGGAGGAGCTCAACCTCAGCTACAACCGCATCACCAGCCCACAGG-3' (SEQ ID NO:60)
The entire nucleotide sequence of DNA40982 (SEQ ID NO:56) is shown in Figure 23. Clone DNA40982 (SEQ ID NO:56) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 342-344 and ending at the stop codon (TAG) at nucleotide positions 2268-2270, as indicated in Figure 23 by bolded underline. The predicted PR0332 polypeptide precursor (i.e., UNQ293, SEQ ID NO:57, Fig. 24) is 642 ammo acids long, and has a calculated molecular weight of 72,067, and a pi of 6.60. A cDNA clone containmg DNA40982 (SEQ ID NO:56) (designated as DNA40982-1235) has been deposited with ATCC on November 7, 1997 and is assigned ATCC deposit no. 209433.
M. Isolation of cDNA clones Encoding Human PRQ526 (UNQ330)
Use of the ECD homology procedure described above in a human fetal liver library resulted m the identification of the full-length DNA sequence DNA44184 (Fig. 25, SEQ ID NO-61) and the derived PR0526 native sequence protein UNQ330 (Fig. 26, SEQ ID NO:62).
The PCR pnmers (forward and reverse) and hybridization probes synthesized were the following: forward PCR pπmer: 5'-TGGCTGCCCTGCAGTACCTCTACC-3' (SEQ ID NO:63) reverse PCR pπmer: 5'-CCCTGCAGGTCATTGGCAGCTAGG-3' (SEQ ID NO:64) hybridization probe: (SEQ -D NQ.65)
5'-AGGCACTGCCTGATGACACCTTCCGCGACCTGGGCAACCTCACAC-3' .
Clone DNA44184 (SEQ ID NO:61 ) contains a single open reading frame with an apparent translation initiation sue at nucleot.de positions 514-516 and ending at the stop codon (TGA) at nucleotide positions 1933- 1935 (Figure 61 ), as indicated by bolded underline. The predicted PR0526 polypeptide precursor (i.e . UNQ330, SEQ ID N0.62) is 473 ammo acids long (Figure 62). The UNQ330 (SEQ ID NO.62) protein shown in Figure 62 has an estimated molecular weight of about 50708 daltons and a pi of about 9.28. A cDNA clone containmg DNA44184 has been deposited with the ATCC on 26 March 1998 (under the designation DNA44184- 1319) and is assigned deposit number 209704.
Analysis of UNQ330 (SEQ ID NO:62) revels that the signal peptide sequence is at about ammo acids 1-26. A leucine zipper pattern is at about ammo acids 135-156. A glycosammoglycan attachment is at about amino acids 436-439. N- lycosylation sites are at about ammo acids 82-85, 179-182, 237-240 and 423-426. A von Willebrand factor (VWF) type C domain(s) is found at about ammo acids 411-425. The skilled artisan can understand which nucleotides correspond to these ammo acids based on the sequences provided herein.
N. Isolation of cDNA clones Encoding Human PRQ7Q1 (UNQ365)
Use of the ECD homology procedure described above in a human fetal liver library resulted in the identification of the full-length DNA sequence DNA44205 (Fig. 27, SEQ ID NO:66) and the derived PR0526 native sequence protein UNQ365 (Fig. 28, SEQ ID NO:67). The PCR pnmers (forward and reverse) and hybridization probe synthesized for use in the above procedure were:
5'-GGCAAGCTACGGAAACGTCATCGTG-3' (SEQ ID NO:68)
5'-AACCCCCGAGCCAAAAGATGGTCAC-3' (SEQ ID NO:69) 5'-GTACCGGTGACCAGGCAGCAAAAGGCAACTATGGGCTCCTGGATCAG-3' (SEQ ID NO.70)
Clone DNA44205 (SEQ ID NO:66) contains a single open reading frame (with an apparent translation initiation site at nucleotide positions 50-52 and ending at the stop codon (TAG) at nucleotide positions 2498- 3000, as indicated by bolded underline in Figure 27 The predicted PRO701 polypeptide precursor (i.e , Fig. 28, UNQ365, SEQ ID N0 67) is 816 ammo acids long, and has a calculated molecular weight of 91.794 Da (pl. 5.88) A cDNA clone contaming DNA44205 (SEQ ID NO-66) (designated as DNA44205-1285) has been deposited with ATCC on March 31 , 1998 and is assigned ATCC deposit no 209720.
UNQ365 (SEQ ID NO 67) contains a potential signal peptide cleavage site at about amino acid position 25 There are potential N-glycosylation sites at about ammo acid positions 83, 511, 716 and 803. The carboxylesterases type-B signature 2 sequence is at about residues 125 to 135 Regions homologous with carboxylesterase type-B are also at about residues 54-74 197-212 and 221 -261 A potential transmembrane region corresponds approximately to amino acids 671 through about 700 The corresponding nucleic acids can be routinely determmed from the sequences provided herem.
O Isolation of cDNA clones Encoding Human PRQ361 (UNQ316) Use of the ECD homology procedure descπbed above m combination with an in vivo cloning procedure using the probe oligonucleotide and one of the pπmer pairs in a human fetal kidney library resulted in the identification of the full-length DNA sequence DNA45410 (Fig. 29, SEQ ID N0 71) and the denved PR0361 native sequence protein UNQ316 (Fig 30, SEQ ID N0 72).
The forward and reverse PCR pnmers and a hybπdization probe were synthesized for use in the above-descπbed method forward PCR pπmer ( fl)
5'-AGGGAGGATTATCCTTGACCTTTGAAGACC-3' (SEQ ID NO 73) forward PCR pπmer (,f2) 5'-GAAGCAAGTGCCCAGCTC-3' (SEQ ID NO 74) forward PCR pπmer ( O)- 5'-CGGGTCCCTGCTCTTTGG-3' (SEQ ID NO 75) reverse PCR pπmer (.rl) 5'-CACCGTAGCTGGGAGCGCACTCAC-3' (SEQ ID N0 76) reverse PCR pπmer (,r2): 5'-AGTGTAAGTCAAGCTCCC-3' (SEQ ID NO:77) hybπdization probe:
5'- GCTTCCTGACACTAAGGCTGTCTGCTAGTCAGAATTGCCTCAAAAAGAG-3' (SEQ ID NO:78) Clone DNA45410 (SEQ ID NO 71) contains a single open readmg frame with an apparent translation initiation site at nucleotide positions 226-228 and ending at the stop codon (TAA) at nucleotide positions 1519- 1521 (Figure 29), as indicated by bolded underline. The predicted PR0361 polypeptide precursor (/ e., UNQ316, SEQ ID NO:72) is 431 amino acids long (Figure 30). The native sequence PR0361 protein shown in Figure 30 as UNQ316 has an estimated molecular weight of about 46810 and a pl of about 6.45. In addition, regions mdicattve of the arginase family protems are present at about residues F3 to V14 and again at 139 to T57, while a transmembrane domam exists at about residues P380 to S409. A cDNA clone contaming DNA45410 (SEQ ID NO 71) has been deposited with ATCC on February 5. 1998 and is assigned ATCC deposit no 209621
P- Isolation of cDNA clones Encoding Human PRQ362 (UNQ317)
Use of the ECD homology procedure descπbed above in a human fetal brain library resulted in the isolation of the full-length DNA sequence DNA45416 (Fig 31, SEQ ID NO 79) and the derived PR0362 native sequence protein UNQ317 (Fig. 32, SEQ ID NO 80)
The PCR pnmers (forward and reverse) and hybndization probe synthesized for use m the above procedure were- forward PCR pπmer 1 - S'-TATCCCTCCAATTGAGCACCCTGG-S' (SEQ ID NO 81 ) forward PCR pπmer 2 S'-GTCGGAAGACATCCCAACAAG-S' (SEQ ID NO 82) reverse PCR pπmer I 5'-CTTCACAATGTCGCTGTGCTGCTC-3' (SEQ ID NO 83) reverse PCR pπmer 2 5'-AGCCAAATCCAGCAGCTGGCTTAC-3' (SEQ ID NO 84) hybπdization probe
5--TGGATGACCGGAGCCACTACACGTGTGAAGTCACCTGGCAGACTCCTGAT-3' (SEQ ID NO 85)
Clone DNA45416 (SEQ ID NO 79) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 1 19- 121 and ending at the stop codon (TAA) at nucleotide positions 1082-
1084 (Figure 31), as indicated by bolded underline. The predicted PR0362 polypeptide precursor (i c .
UNQ317, SEQ ID NO 80) is 321 amino acids long (Figure 32) The UNQ317 protem (SEQ ID NO 80) shown in Figure 32 has an estimated molecular weight of about 35,544 daltons and a pl of about 8 51 Analysis of the
UNQ317 polypeptide as shown in Figure 32 evidences the presence of a glycosaminoglycan attachment site at about amino acid 149 to about amino acid 152 and a transmembrane domam from about ammo acid 276 to about amino acid 306 A cDNA clone containing DNA45416 (SEQ ID NO 79) has been deposited with ATCC on February 5, 1998 and is assigned ATCC deposit no 209620
Q Isolation of cDNA clones Encoding Human PRQ363 (UNQ318) Use of the ECD homology descπbed above m a human fetal kidney library resulted in the isolation of the full-length DNA sequence DNA45419 (Fig. 33, SEQ ID N0.86) and the deπved PR0363 native sequence protem UNQ318 (Fig. 34, SEQ ID NO 87)
The PCR pnmers (forward and reverse) and hybndization probe synthesized for use in the above procedure were: forward PCR pπmer-
5'-CCAGTGCACAGCAGGCAACGAAGC-3' (SEQ ID NO:88) reverse PCR pπmer:
5'-ACTAGGCTGTATGCCTGGGTGGGC-3' (SEQ ID NO:89) hybridization probe: 5'-GTATGTACAAAGCATCGGCATGGTTGCAGGAGCAGTGACAGGC-3' (SEQ ID NO.90) Clone DNA45419 (SEQ ID NO:86) contams a single open reading frame with an apparent translation initiation site at nucleotide positions 190-192 and ending at the stop codon (TGA) at nucleotide positions BO - IS 11 (Figure 33), as mdicated by bolded underline. The predicted PR0363 polypeptide precursor (i.e., UNQ318, SEQ ID N0:87) is 373 amino acids long (Figure 34). The UNQ318 protem (SEQ ID NO:87) shown in Figure 34 has an estimated molecular weight of about 41,281 daltons and a pi of about 8.33. Analysis of the UNQ318 polypeptide as shown in Figure 34 evidences the presence of a transmembrane domain at about ammo acid residue 221 to about residue 254. A cDNA clone contammg DNA45419 (SEQ ID NO:86) has been deposited with ATCC on February 5, 1998 and is assigned ATCC deposit no. 209616.
R. Isolation of cDNA clones Encoding Human PRQ364 (UNQ319)
Use of the ECD homology procedure descπbed above a human small intestine library resulted in the identification of an expressed sequence tag (EST) (Incyte EST No. 3003460) that encoded a polypeptide which showed homology to members of the tumor necrosis factor receptor (TNFR) family of polypeptides.
A consensus DNA sequence was then assembled relative to the Incyte 3003460 EST in a manner similar to that used in the ECD homology procedure which resulted in the isolation of the full-length DNA sequence DNA47365 (Fig 35, SEQ ID NO 91) and the deπved PR0364 native sequence protein UNQ319
(Fig. 36, SEQ ID NO:92).
The PCR pnmers (forward and reverse) and hybndization probes synthesized for use in the above- descπbed screening procedure were: forward PCR pπmer (44825.fl). 5'-CACAGCACGGGGCGATGGG-3' (SEQ ID NO:93) forward PCR pπmer (44825.Q): 5'-GCTCTGCGTTCTGCTCTG-3' (SEQ ID NO:94) forward PCR pπmer (44825.GITR.Q:
5'-GGCACAGCACGGGGCGATGGGCGCGTTT-3' (SEQ ID NO:95) reverse PCR pnmer (44825.rl ). 5'-CTGGTCACTGCCACCTTCCTGCAC-3' (SEQ ID NO:96) reverse PCR pπmer (44825.r2). 5'-CGCTGACCCAGGCTGAG-3' (SEQ ID NO:97) reverse PCR pπmer (44825.GITR.rV
5'-GAAGGTCCCCGAGGCACAGTCGATACA-3' (SEQ ID NO:98) hybπdization probe (44825.pl ):
5'-GAGGAGTGCTGTTCCGAGTGGGACTGCATGTGTGTCCAGC-3' (SEQ ID NO:99) hybridization probe (44825. GITR.p):
5'-AGCCTGGGTCAGCGCCCCACCGGGGGTCCCGGGTGCGGCC-3' (SEQ ID NO: 100)
Clone DNA47365 (SEQ ID NO:91 ) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 121-123 and ending at the stop codon (TGA) at nucleotide positions 844-
846 (Figure 35). as indicated by bolded underline. The predicted PR0364 polypeptide precursor (i.e., UNQ319, SEQ ID NO:92) is 241 amino acids long (Figure 36). The UNQ319 (SEQ ID NO:92) protem shown in Figure 36 has an estimated molecular weight of about 26.000 daltons and a pi of about 6.34. A potential N- glycosylation sites exists between amino acids 146 and 149 of the amino acid sequence shown in Figure 36. A putative signal sequence is from amino acids 1 to 25 and a potential transmembrane domain exists between amino acids 162 to 180 of the sequence shown in Figure 36. A cDNA clone containing DNA47365 (designated DNA47365-1206) has been deposited with ATCC on November 7, 1997 and is assigned ATCC Deposit No. ATCC 209436.
S. Isolation of cDNA clones Encodmg Human PRQ356 (UNQ 13)(NL4) An expressed sequence tag (EST) DNA database (LIFESEQ* Incyte Pharmaceuticals, Palo Alto, CA) was searched and an EST (#2939340) was identified which showed homology to human TIE-2 LI and TIE-2 L2.
Based on the EST, a pan of PCR pnmers (forward and reverse), and a probe were synthesized: NL4.5-1 5'-TTCAGCACCAAGGACAAGGACAATGACAACT-3' (SEQ ID NO- 103)
NL4,3-1 5'-TGTGCACACTTGTCCAAGCAGTTGTCATTGTC-3' (SEQ ID NO. 104)
NL4,3-3 S'-GTAGTACACTCCATTGAGGTTGG ' (SEQ ID NO: 105).
Oligo dT pruned cDNA libranes were prepared from uterus mRNA purchased from Clontech, Inc. (Palo Alto. CA, USA, catalog # 6537-1) in the vector pRK5D using reagents and protocols from Life Technologies, Gaithersburg, MD (Super Script Plasmid System) pRK5D is a cloning vector that has an sp6 transcnption initiation site followed by an Sfil restπction enzyme site preceding the Xhol/Notl cDNA cloning sites The cDNA was pnmed with oligo dT contammg a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized to greater than 1000 bp appropπately by gel electrophoresis. and cloned in a defined oπentation into XhoI Notl-cleaved pRK5D In order to screen several libranes for a source of a full-length clone. DNA from the libranes was screened by PCR amplification with the PCR pnmer pair identified above A positive library was then used to isolate clones encoding the PR0356 gene using the probe oligonucleotide and one of the PCR pnmers.
DNA sequencing of the clones isolated as descπbed above gave a full-length DNA sequence encoding the native sequence PR0356 (NL4) (i e , DNA47470, SEQ ID NO 101 ) and the deπved PR0356 protem sequence UNQ313 (SEQ ID NO 102)
The entire nucleotide sequence of DNA47470 is shown in Figure 37 (SEQ ID NO 101 ) Clone DNA47470 (SEQ ID NO 101) contams a single open reading frame with an apparent translation initiation site at nucleotide positions 215-217. and a TAA stop codon at nucleotide positions 1038-1040, as indicated by bolded underline. The predicted PR0356 polypeptide is 346 ammo acids long (i e , UNQ313 (SEQ ID NO:102), has a calculated molecular weight of 40.018 daltons and a pl of 8.19. A cDNA clone containing DNA47470 (SEQ ID NO 101) has been deposited with ATCC on October 28, 1997 and is assigned ATCC deposit no. 209422.
T. Isolation of cDNA clones Encoding Human PRQ531 (UNQ332) Use of the ECD homology procedure identified above in a human fetal brain library resulted in the isolation of the full-length DNA sequence DNA48314 (Fig. 39, SEQ ID NO.106) and the deπved PR0531 native sequence protem UNQ332 (Fig. 40, SEQ ID NO: 107) .
The PCR pnmers (forward and reverse) and hybridization probe synthesized were: forward PCR pπmer: 5'-CTGAGAACGCGCCTGAAACTGTG-3' (SEQ ID NO: 108) reverse PCR pπmer: 5VAGCGTTGTCATTGACATCGGCG-3' (SEQ ID NO.109) hybπdization probe (SEQ ID NO 1 10)
S'-TTAGTTGCTCCATTCAGGAGGATCTACCCTTCCTCCTGAAATCCGCGGAA-y
Clone DNA48314 (SEQ ID NO 106) contains a smgle open readmg frame with an apparent translation initiation site at nucleotide positions 171-173 and endmg at the stop codon (TGA) at nucleotide positions 2565-2567 (Figure 39), as mdicated by bolded underime The predicted PR0531 polypeptide precursor (i e , UNQ332, SEQ ID NO 107) is 789 ammo acids long The UNQ332 protem (SEQ ID NO 107) shown in Figure 39 has an estimated molecular weight of about 87552 daltons and a pi of about 4 84 A clone contammg DNA48314 (SEQ ID NO 106) has been deposited with the ATCC on 26 March 1998, and has been assigned deposit number 209702
Analysis of the UNQ332 ammo acid sequence of SEQ ID NO 107 reveals a cadhenn extracellular repeated domam signature at about amino acids 122-132, 231-241 , 336-346 439-449 and 549-559 An ATP/GTP-bmding site motif A (P-loop) is found at about amino acids 285-292 of SEQ ID NO 107 N- glycosvlation sites are found at least at about amino acids 567-570, 786-790, 418-421 and 336-339 the signal peptide is at about amino acids 1 -26 and the transmembrane domain is at about ammo acids 685-712 of SEQ ID NO 107
U Isolation of cDNA clones Encoding Human PRQ533 (UNQ334)
The EST sequence accession number AF007268. a muπne fibroblast growth factor (FGF- 15) was used to search vaπous public EST databases (e g , GenBank, Dayhoff, etc ) The search was performed using the computer program BLAST or BLAST2 [Altschul et al Methods in Enzvmology, 266 460-480 ( 1996)] as a compaπson of the ECD protem sequences to a 6 frame translation of the EST sequences The search resulted m the identification of GenBank EST AA220994 which has been identified as stratagene NT2 neuronal precursor 937230
Based on this sequence oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest and 2) for use as probes to isolate a clone of the full-length coding sequence In order to screen sev eral libranes tor a source ot a full-length clone DNA from the libranes was screened bv PCR amplification as per Ausubel et al Current Protocols m Molecular Biology , with the PCR primer pair A positive library was then used to isolate clones encoding the PR0533 gene of mterest by an in vivo clonmg procedure using the probe oligonucleotide and one of the PCR pnmers RNA for construction of the cDNA libranes was isolated from human fetal retina The cDNA libranes used to isolated the cDNA clones were constructed by standard methods using commercially available reagents (e g , Invitrogen, San Diego, CA, Clontech, etc ) The cDNA was pnmed with oligo dT containing a
Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropπately by gel electrophoresis, and cloned m a defined oπentation mto a suitable clonmg vector (such as pRKB or pRKD, PRK5B is a precursor of pRK5D that does not contain the Sfil site, Holmes et al , Science. 253 1278-1280
(1991 )) m the unique Xhol and Notl sites
A cDNA clone was sequenced m its entirety The full length nucleotide sequence DNA49435 (SEQ ID NO 1 11) is shown in Figure 41 Clone DNA49435 (SEQ ID NO 1 1 1) contams a smgle open reading frame with an apparent translation initiation site at nucleotide positions 464-466 and endmg at the stop codon (TAA) at nucleotide positions 649-651. as indicated by bolded underline m Fig 41 The predicted PR0533 polypeptide precursor (i.e.. UNQ334, SEQ ID NO: 112) is 216 ammo acids long, has a calculated molecular weight of 24,003 daltons and a pl of 6.99. Clone DNA49435-1219 has been deposited with ATCC (under the designation DNA49435-1219) on November 21, 1997 and is assigned ATCC deposit no. 209480.
The oligonucleotide sequences used in the above procedure were the following: FGF15.f: 5'-ATCCGCCCAGATGGCTACAATGTGTA-3' (SEQ ID NO 113)
FGF15.p: 5'-GCCTCCCGGTCTCCCTGAGCAGTGCCAAACAGCGGCAGTGTA-3' (SEQ ID NO 114)
FGF15.r: 5'-CCAGTCCGGTGACAAGCCCAAA-3' (SEQ ID NO 115)
V. Isolation of cDNA clones Encoding Human PRO 1083 (UNQ540)
Use of the amylase yeast screen procedure descπbed above on tissue isolated from human fetal kidney tissue resulted in an EST sequence which served as the template for the creation of the oligonucleotides below and screenmg as descπbed above m a human fetal kidney library resulted in the isolation of the full length DNA sequence DNA50921 (Fig. 43, SEQ ID NO: 116) and the deπved PRO 1083 native sequence protein UNQ540 (SEQ ID NO. l 17).
The PCR pnmers (forward and reverse) and hybndization probes synthesized for use in the above procedure were the following: forward pnmer: (43422.fi ): 5'-GGC ATTGGAGC AGTGCTGGGTG-3' (SEQ ID NO: 1 18) forward pπmer: (43422.C): 5'-AGAGCAACTCAGACAGCG-3' (SEQ ID NO: 1 19) reverse pπmer: (43422.rl ): 5'-TGGAGGCCTAGATGCGGCTGGACG-3' (SEQ ID NO: 120) reverse pπmer: (43422.r2): 5'-CGAGGAGACCATCAGCAC-3' (SEQ ID NO: 121) hybridization probe: (43422.pl): (SEQ ID NO: 122)
5'-CCCAAACATCCTGCTTCTGCAACCACTTGACCTACTTTGCAGTGC-3' Clone DNA50921 (SEQ ID NO: 116) contams a single open reading frame with an apparent translation initiation sue at nucleotide positions 154-156 and ending at the stop codon (TAG) at nucleotide positions 2233-2235 (Figure 43). as indicated by bolded underline. The predicted PRO 1083 polypeptide precursor (i.e., UNQ540, SEQ ID NO.117, Figure 44) is 693 ammo acids long. The UNQ540 (SEQ ID NO: l 17) protein shown m Figure 44 has an estimated molecular weight of about 77738 and a pi of about 8.87. A clone contammg DNA50921 has been deposited with the ATCC on May 12, 1998 and has been assigned deposit number 209859.
Analysis of the ammo acid sequence UNQ540 (SEQ ID NO: 1 17) reveals the putative signal peptide is at about ammo acids 1-25, transmembrane domams are at about amino acids 382-398, 402-420, 445-468, 473- 491, 519-537, 568-590 and 634-657, a microbodies C-terminal targeting signal at about ammo acids 691-693, cAMP- and cGMP-dependent protein kinase phosphorylation sites at about ammo acids 198-201 and 370-373, N-glycosylation sites at about ammo acids 39-42, 148-151, 171-174, 234-237, 303-306. 324-227 and 341-344 and a G-protein coupled receptor family domain at about ammo acids 475-504.
W. Isolation of cDNA clones Encoding Human PRQ865 (UNQ434) Use of the amylase yeast screen procedure descnbed above on tissue isolated from human fetal kidney tissue resulted m an EST sequence which served as the template for the creation of the oligonucleotides below and screening as descπbed above m a human fetal kidney library resulted in the isolation of the full length
DNA sequence DNA53974 (Fig. 45, SEQ ID NO: 123) and the denved PR0865 native sequence protein UNQ434 (SEQ ID NO: 124).
The PCR pnmers (forward and reverse) and hybridization probes synthesized for use in the above procedure were the following: forward pπmer: (48615.fl): 5'-AAGCTGCCGGAGCTGCAATG-3' (SEQ ID NO: 125) forward pπmer: (48615.G): S'-TTGCTTCTTAATCCTGAGCGC-S' (SEQ ID NO: 126) forward pnmer: (48615.D): 5'-AAAGGAGGACTTTCGACTGC-3' (SEQ ID NO: 127) reverse pnmer: (486I5.rl): 5'-AGAGATTCATCCACTGCTCCAAGTCG-3' (SEQ ID NO: 128) reverse pπmer: (48615.r2): 5'-TGTCCAGAAACAGGCACATATCAGC-3' (SEQ ID NO: 129) hybπdization probe: (43422.pl): (SEQ ID NO: 130)
5'-AGACAGCGGCACAGAGGTGCTTCTGCCAGGTTAGTGGTTACTTGGATGAT-3' Clone DNA53974 (SEQ ID NO: 123) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 173-175 and ending at the stop codon (TAA) at nucleotide positions 1577- 1579 (Figure 45). as indicated by bolded underline. The predicted PR0865 polypeptide precursor (i.e.. UNQ865. SEQ ID NO: 124) is 468 amino acids long. The UNQ434 (SEQ ID NO: 124) protein shown in Figure 46 has an estimated molecular weight of about 54,393 and a pi of about 5.63. A clone containing DNA53974 (SEQ ID NO.123) has been deposited with the ATCC on April 14, 1998 and has been assigned deposit number 209774
Analysis of the ammo acid sequence UNQ434 (SEQ ID NO: 124) reveals the putative signal peptide at about amino acid residues 1-23, potential N-glycosylation sites at about amino acids residue 280 and at about 384, a potential amidation site from about amino acid residue 94 to about residue 97. glycosaminogiycan attachment sites from about amino acid residue 20 to about 23 and from about residue 223 to about residue 226. an aminotransferase class-V pyπdoxyl-phosphate amino acid sequence block trom about amino acid residue 216 to about residue 222 and an amino acid sequence block similar to that found in the ιnterleukιn-7 protein from about ammo acid residue 338 to about residue 343.
X. Isolation of cDNA clones Encoding Human PRO770 (UNQ408)
A public expressed sequence tag (EST) DNA database (Merck/Washington University) was searched with the full-length muπne m-FIZZl DNA (DNA53517), and an EST, designated AA524300 was identified, which showed homology with the m-FIZZl DNA.
The full-length clone corresponding to the EST AA524300 was purchased from Incyte (Incyte Pharmaceuticals, Palo Alto, CA) and sequenced in entirety.
The entire nucleotide sequence of the resulting PRO770-encoding full-length clone is shown m
Figure 47. This full-length clone, designated DNA54228 (SEQ ID NO: 133), contains a single open reading frame with an apparent translation initiation site at nucleotide positions 100-102 (Fig.47; SEQ ID NO: 133) and ending at the stop codon (TGA) at residues 433-435, as indicated by bolded underime. The predicted PRO770 polypeptide precursor (including a putative signal sequence of 20 amino acids) (i.e., UNQ408, SEQ ID NO: 134) is 11 1 ammo acids long, has a calculated molecular weight of 1 1,730 daltons and a pl of 7 82. Based upon its homology to m-FIZZl (50%, using the ALIGN software), the protein is believed to be the human homolog of m-FIZZl, and has been designated h-FIZZl. A cDNA clone contammg DNA54228 (SEQ ID
NO: 133) has been deposited with ATCC and is assigned ATCC deposit no. 209801. Identification and clonmg of m-FIZZl (DNA53517)
Mouse asthma model Female Balb/C mice, 6 to 8 weeks of age, were separated into two expeπmental groups: controls and asthmatics. The asthmatic group was immunized intrapentoneally with 10 μg ovalbumm -i- 1 mg alum, while the control group was not. Two weeks later, mice were exposed daily to an aerosol of 10 mg/ml ovalbumm in PBS aerosolized with a UlrraNeb nebulizer (DeVilbiss) at the rate of 2 ml/mm for 30 mm each day. for 7 consecutive days One day after the last aerosol challenge, whole blood, serum and bronchoalveolar lavage (BAL) samples were collected and the lungs were harvested and preserved for histological exammation, immuno-histochemistry and in situ hybndization.
Gel electrophoresis of BAL of the BAL samples by gel electrophoresis on a 16%
Tπcine gel shows that a low molecular weight protein is expressed in the BAL samples from asthmatic mice but not in the BAL samples from control mice This low molecular weight protein was termed m-FIZZl and was seen to co-migrate with a 8300 Dalton marker protein.
Partial protein sequence The protein of interest was transferred upon a PVDF membrane and sequenced by Edman degradation Tins sequence served as a template for the preparation of various cloning ohgos as descπbed below. Partial cDNA sequence We designed two degenerate oligonucleotide PCR primers corresponding to the putative DNA sequence for the first 7 and the last 7 ammo acids of the partial protein sequence..
Ohgo #l
5'-ACA AAC GCG TGA YGA RAC NAT HGA RAT-3' (SEQ ID NO 135)
Ohgo # 2 5'-TGG TGC ATG CGG RTA RTT NGC NGG RTT-3' (SEQ ID NO 136) cDNA prepared from the lungs ot normal mice was used as a template for the PCR reaction which yielded an 88 bp product. This 88 bp product contained 54 known base pairs, encoding the PCR primers, and
34 novel base pairs, and encoded another partial mFIZZ- 1 sequence.
Full length cDNA clone This second partial sequence was used to design pnmers which were ultimately successful in obtaining the full length FIZZ clone (DNA53517) by RT-PCR of mouse lung poly(A)*
RNA.
Oligo #3.
5'-ACA AAC GCG TGC TGG AGA ATA AGG TCA AGG-3' (SEQ ID NO:137)
This oligo was used as an RT-PCR pπmer in combination with 5' and 3' amphmers from Clontech. Ohgo #4-
5'-ACT AAC GCG TAG GCT AAG GAA CTT CTTGCC-3' (SEQ ID NO: 138)
This oligo was used as an RT-PCR pπmer in combination with oligo d(T).
Y. Isolation of cDNA clones Encoding Human PRQ769 (UNQ407) A public expressed sequence tag (EST) DNA databases (Merck/Washington University) was searched with the full-length murine m-FIZZl DNA (DNA 53517) described above and the EST W42069 was identified
The full-length clones corresponding to the EST fragment W42069 was obtained from Incyte Pharmaceuticals (Palo Alto. California), and sequenced in the entirety, which ultimately resulted in the identification of the full length nucleotide sequence DNA54231 (SEQ ID NO 139)
The nucleotide sequence corresponding to the full length, native sequence PR0769 clone is shown in Figure 49 This clone, designated DNA 54231 (SEQ ID NO 139) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 75-77 and ending at the stop codon (TGA) at residues 417-419 as indicated by bolded underline (Fig 49) The predicted PR0769 polypeptide precursor (mcludmg a signal sequence ot 10 ammo acιds)(; e , UNQ407, SEQ ID NO 140) is 1 14 amino acids long, has a calculated molecular weight of 12,492 daltons and a pi of 8 19 Based on its homology to m-FIZZl (34%, using the ALIGN software) the protein was designated m-FIZZ3 A clone containing DNA54231 (designated DNA54231-1366) has been deposited with ATCC on Apπl 23. 1998 and has been assigned ATCC deposit no 209802
Z Isolation of cDNA clones Encoding Human PRQ788 (UNQ430)
Use of the ECD homology procedure identified above resulted in the identification of the partial length EST sequence 2777282 Further analysis of the coπesponding full-length sequence resulted in the identification of DNA56405 (SEQ ID NO 141) and the deπved native sequence PR0788 protein UNQ430 (SEQ ID NO 142)
Clone DNA56405 (SEQ ID NO 141 ) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 84-86 and ending at the stop codon (TAG) at nucleotide positions 459-461 (Figure 51 ) as indicated by bolded underline The predicted native sequence PR0788 polypeptide precursor (; c UNQ430 SEQ ID NO 142) is 125 ammo acids long (Figure 52). has a calculated molecular weight of 13,1 15 daltons and a pi of 5 90 The UNQ430 (SEQ ID NO 142) protein shown in Figure 52 has an estimated molecular weight of about 13115 and a pi of about 5 90 A clone containing DNA56405 (SEQ ID NO 142) has been deposited with the ATCC on May 6, 1998 and has been assigned deposit number209849 In the event of a discrepancy in the nucleotide sequence of the deposit and the sequences disclosed herein, it is understood that the deposited clone contams the correct sequence It is further understood that the methodology of sequencmg for the sequences provided herein are based on known sequencing techniques
Analysis of UNQ430 (SEQ ID NO 52) shown in Figure 52 reveals a signal peptide at about ammo acids 1-17 and an N-glycosylation site is at about ammo acids 46
AA Isolation of cDNA clones Encoding Human PROl 114 (UNQ557)
Use of the amylase yeast screen procedure descπbed above on tissue isolated from human fetal kidney tissue resulted in an EST sequence which served as the template for the creation of the oligonucleotides below and screenmg as descπbed above m a human breast carcmoma library resulted in the isolation of the full length DNA sequence DNA57033 (Fig 53, SEQ ID NO.143) and the denved PROl 114 native sequence protem UNQ557 (Fig. 54, SEQ ID NO- 144)
The PCR pnmers used in the isolation screen descnbed m the previous paragraph were: forward pnmer: (48466.fl): 5'-AGGCTTCGCTGCGACTAGACCTC-3' (SEQ ID NO: 145) reverse pπmer: (48466.rl): 5'-CCAGGTCGGGTAAGGATGGTTGAG-T (SEQ ID NO: 146) hybndization probe- 48466 pl )
5'-TTTCTACGCATTGATTCCATGTTTGCTCACAGATGAAGTGGCCATTCTGC-3' (SEQ ID NO: 147)
Clone DNA57033 (SEQ ID NO.143) contains a single open reading frame with an apparent translation initiation site at nucleot.de positions 250-252 and ending at the stop codon (TAG) found at nucleot.de positions 1 183-1 185 (Figure 53. SEQ ID N0.143), as indicated by bolded underline. The predicted PROl 1 14 polypeptide precursor (, e , UNQ557, SEQ ID NO 144) ,s 31 1 ammo acids long, has a calculated molecular weight of approximately 35,076 daltons and an estimated pl of approximately 5 04 Analysis of the full-length PROl 1 14 sequence shown in Figure 54 (SEQ ID NO 144) evidences the presence of the following: a signal peptide from about ammo acid 1 to about ammo acid 29. a transmembrane domain from about ammo acd 230 to about ammo acid 255. potential N-glycosylation sites from about ammo acid 40 to about ammo acid 43 and from about ammo acd 134 to about ammo acd 137. an ammo acd sequence block havmg homology to tissue factor proteins from about ammo acd 92 to about ammo acd 1 19 and an ammo acd sequence block having homology to integπn alpha chain proteins from about ammo acd 232 to about am.no acd 262 A cDNA clone containing DNA57033 (SEQ ID NO 143) has been deposited with ATCC on May 27, 1998 and is assigned ATCC deposit no 209905
AB. Isolation of cDNA clones Encoding Human PRO 1007 (UNQ491 )
Use of the ECD homology procedure described above resulted in the identification of an EST sequence designated Merck EST T70513, which was deπved from human liver tissue (clone 83012 from library 341 ) was further examined The corresponding full-length clone was further examined and sequenced, resulting in the isolation ot the full-length DNA sequence DNA57690 (Fig 55, SEQ ID NO 145) and the denved PRO 1007 native sequence protein UNQ491 (Fig 56. SEQ ID NO 146)
Clone DNA57690 (SEQ ID NO 145) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 16- 18 and endmg at the stop codon (TGA) at nucleotide positions 1054-1056 (Figure 55), as indicated by bolded underline. The predicted PRO1007 polypeptide precursor (, «,, UNQ491 , SEQ ID NO- 146) is 346 ammo acids long (Figure 56), has a calculated molecular weight of 35,971 daltons and a pi of 8.17 The UNQ491 (SEQ ID NO 146) protein shown in Figure 56 has an estimated molecular weight of about 35971 daltons and a pl of about 8.17. A cDNA clone containing DNA57690 (SEQ ID NO.145) has been deposited w„h the ATCC on 9 June 1998, and has been assigned deposit number 209950.
Analysis of the ammo acd sequence of UNQ491 (SEQ ID NO: 146) reveals the putative signal peptide at about ammo acd residues 1-30, a transmembrane domain at about ammo acid residues 325-346, N- glycosylation sites at about ammo acd residues 118, 129, 163, 176, 183 and 227 and a Ly-6/u-Par domain proteins at about amino acid residues 17-36 and 209-222. The corresponding nucleotides of the amino acids presented herein can be routinely determined given the sequences provided herem. AC Isolation of cDNA clones Encoding Human PROl 184 (UNQ598)
Use of the signal algoπthm procedure descπbed above resulted m the identification of Incyte EST 1428374 which was denved from an lleum tissue library (39, SINTBST01) Further exammation of the £ II- length clone coπesponding to this sequence resulted m the isolation of the full-length DNA59220 (Fig. 57, SEQ ID NO 147) and the denved PROl 184 native sequence prote UNQ598 (Fig 58, SEQ ID NO 148)
UNQ598 (SEQ ID NO 148), as shown in Figure 58 exhibits an apparent translation initiation site at nucleotide positions 106-108 and ending at the stop codon (TGA) found at nucleotide positions 532-534, as indicated by bolded underline The predicted PROl 184 polypeptide precursor (i e UNQ598, SEQ ID NO 148) is 142 amino acids long, has a calculated molecular weight of approximately 15690 daltons and an estimated pi of approximately 9 64 Analysis of UNQ598 (SEQ ID NO 148) evidences the presence of a signal peptide at about ammo acids 1-38 A cDNA clone containing DNA59220 (SEQ ID NO 147) has been deposited with the ATCC on 9 June 1998, and has been assigned deposit number 209962 It is understood that the deposited clone has the actual sequences and that representations are presented herem
AD Isolation of cDNA clones Encoding Human PRO 1031 (UNQ516)
Use ot the ECD homology procedure descπbed above resulted in the identification of the EST sequence Merck W74558 (clone 344649) The corresponding full-length clone was exammed and sequenced resulting in the isolation of DNA sequencing gave the full length DNA sequence DNA59294 (Fig 59, SEQ ID NO 149) and the deπved PRO 1031 native sequence protein UNQ516 (Fig 60 SEQ ID NO 150)
Clone DNA59294 (SEQ ID NO 149) contains a single open readmg frame with an apparent translation initiation sue at nucleotide positions 42-44 and endmg at the stop codon (TGA) at nucleotide positions 582-584 (Figure 59) as indicated by bolded underline The predicted PRO1031 polypeptide precursor (/ e UNQ516 SEQ ID NO 150) is 180 ammo acids long (Figure 60) The UNQ516 protein shown in Figure 60 has an estimated molecular weight of about 20437 and a pi of about 9 58 Clone DNA59294 (SEQ ID NO 149) has been deposited with the ATCC on Mav 14 1998 and has been assigned deposit number 209866 Regarding the sequence it is understood that the deposited clone contams the coπect sequence, and the sequences provided herein are based on known sequencing techniques
Analysis of the amino acid sequence of UNQ516 (SEQ ID NO 150) reveals the putative signal peptide at about ammo acid residues 1-20, an N-glycosylation site is at about amino acid residue 75 A region havmg sequence identity with IL-17 is at about am o acd residues 96-180 The coπesponding nucleotides can be routinelv determmed given the sequences provided herein
AE Isolation of cDNA clones Encoding Human PRO 1346 (UNQ701) Use of the ECD homology procedure descnbed above m a human fetal kidney library resulted in the isolation of the full-length DNA sequence DNA59776 (Fig 61, SEQ ID NO 151) and the denved PR01346 native sequence protem UNQ701 (Fig 62, SEQ ID NO 152)
The PCR pnmers (forward and reverse) and hybπdization probe used m the isolation of DNA59776
(SEQ ID NO 151) were the following forward PCR pπmer (45668 fl) 5'-CACACGTCCAACCTCAATGGGCAG-3' (SEQ ID NO 153) reverse PCR pπmer (45668.rl ): 5'-GACCAGCAGGGCCAAGGACAAGG-3' (SEQ ID NO: 154) hybridization probe (45668.pl): (SEQ ID NO: 155)
5'-GTTCTCTGAGATGAAGATCCGGCCGGTCCGGGAGTACCGCTTAG-3'
Clone DNA59776 (SEQ ID NO: 151) contams a single open reading frame with an apparent translation initiation site at nucleotide positions 1 -3 (ATG), and an apparent stop codon (TAG) at nucleotide positions 1384-1386 (TAG). The predicted PR01346 polypeptide precursor (i.e., UNQ701. SEQ ID NO: 152) is 461 ammo acids long. The protein contains an apparent type II transmembrane domain at amino acid positions from about 31 to about 50, fibπnogen beta and gamma chains C-terminal domain signature at about ammo acid positions 409-421 and a leucine zipper patterns at about ammo acd positions 140-161, 147-168. 154-175 and 161-182.
A cDNA clone containing DNA59776, designated as DNA59776-1600, has been deposited with ATCC on August 18. 1998 and is assigned ATCC deposit no. 203128. The UNQ701 (SEQ ID NO: 152) protein shown in Figure 62 has an estimated molecular weight of about 50744 daltons and a pl of about 6.38.
AF Isolation of cDNA clones Encoding Human PRO l 155 (UNQ585)
Use of the signal algorithm procedure described above resulted in the identification of Incyte EST 2858870 which was derived from an lleum tissue library (39, SININOT03) Further examination of the full- length clone corresponding to this sequence resulted in the isolation of the full-length DNA sequence DNA59849 (Fig. 63, SEQ ID NO 156) and the derived PROl 155 native sequence protem UNQ585 (Fig. 64, SEQ ID NO: 157).
The UNQ585 (SEQ ID NO: 157) polypeptide shown in Figure 64 contains a single open reading frame with an apparent translation initiation site at nucleotide positions 158-160 and ending at the stop codon (TAA) found at nucleotide positions 563-565, as indicated by bolded underline. The predicted PROl 155 polypeptide precursor (i e , UNQ585. SEQ ID NO- 157) is 135 ammo acids long, and signal peptide appears at about am o acids residues 1 to about 18. a leucine zipper pattern appears at about amino acd residues 43 to 64 and a tachykinin family signature appears at about amino acid residues 86 to about 91 UNQ585 (SEQ ID NO: 157) has a calculated molecular weight of approximately 14833 daltons and an estimated pi of approximately 9.78 A cDNA clone containing DNA59849 (SEQ ID NOT56), designated as DNA59849-1504, has been deposited with ATCC on June 16, 1998 and is assigned ATCC deposit no. 209986.
AG. Isolation of cDNA clones Encoding Human PRO1250 (UNQ633)
Use of the signal algoπthm procedure descπbed above resulted in the identification of an EST cluster sequence from the Incyte database, designated Incyte EST cluster sequence no. 56523. This sequence was then compared to a vaπety of vaπous EST databases as described under the signal algoπthm procedure above, and further resulted in the identification of Incyte EST 3371784. Further examination and sequencing of the full- length clone coπesponding to this EST sequence resulted in the isolation of the full-length DNA sequence DNA60775 (Fig. 65, SEQ ID NO: 158) and the deπved PRO 1250 native sequence protem UNQ633 (Fig. 66, SEQ ID NO: 159).
Clone DNA60775 (SEQ ID NO: 158) contains a single open reading frame with an apparent translation mitiation site at nucleotide positions 74-76 and ending at the stop codon (TAG) at nucleotide positions 2291-2293 (Figure 65). The predicted PRO1250 polypeptide precursor (i e., UNQ633, SEQ ID NO: 159) is 739 ammo acids long (Figure 66). The UNQ633 (SEQ ID NO: 159) protem shown in Figure 66 has an estimated molecular weight of about 82,263 daltons and a pi of about 7.55. Analysis of UNQ633 (SEQ ID NO: 159) evidences the presence of the following: a type II transmembrane domam from about ammo acid residues 61 to about 80, a putative AMP-bmding domain signamre sequence from about amino acid residue 314 to about 325, and potential N-glycosylation sites from about ammo acid residues 102 to about 105, from about amino acid residues 588 to about 591 and from about amino acid residues 619 to about 622. A cDNA clone containmg DNA60775 (SEQ ID NO: 158) has been deposited with the ATCC on September 1. 1998 and is assigned ATCC deposit no. 203173.
AH. Isolation of cDNA clones Encoding Human PRQ1312 (UNQ678)
An EST (DNA55773) was identified in a human fetal kidney cDNA library using a yeast screen, that preferentially represents the 5' ends of the pπmary cDNA clones. Based on the DNA55773 sequence, oligonucleotides were synthesized for use as probes to isolate the full-length DNA sequence DNA61873 (Fig. 67. SEQ ID NO 160) and the derived PRO 1312 native sequence UNQ678 (SEQ ID NO: 161 ).
The full length DNA61 73 clone shown m Figures 67 (SEQ ID NO: 160) contains a single open reading frame with an apparent translation initiation site at about nucleotide positions 7-9 and ending at the stop codon (TGA) found at about nucleotide positions 643-645. as indicated by bolded underline. The predicted PR01312 polypeptide precursor (/ e., UNQ678, SEQ ID NO 161) is 212 ammo acids long. UNQ678 (SEQ ID NO.161 ) has a calculated molecular weight of approximately 24,024 daltons and an estimated pi of approximately 6.26. Other features include a signal peptide at about am o acids 1-14, a transmembrane domain at about am o acids 141-160, and potential N-glycosylation sites at about amino acids 76-79 and 93- 96. A clone containing DNA61873 (SEQ ID NO 160) has been deposited with the ATCC on August 18. 1998, under the designation DNA61873- 1312, and has been assigned deposit number 203132.
Al Isolation of cDNA clones Encoding Human PROl 192 (UNQ606)
Use of the ECD homology procedure descπbed above in a human fetal liver library resulted in the isolation of the full-length DNA sequence DNA62814 (Fig. 69, SEQ ID NO: 162) and the deπved PR01192 native sequence protein UNQ606 (Fig. 70, SEQ ID NO: 163). The PCR primers (forward and reverse) and hybridization probe used in the isolation of DNA62814
(SEQ ID NO: 162) were the following: forward PCR pπmer (35924.Ω): 5'-CCGAGGCCATCTAGAGGCCAGAGC-3' (SEQ ID NO: 164) reverse PCR pπmer (35924.rl ): 5'-ACAGGCAG AGCC AATGGCCAGAGC-3' (SEQ ID NO: 165). hybridization probe (35924.pl): (SEQ ID NO: 166). 5'-GAGAGGACTGCGGGAGTTTGGGACCTTTGTGCAGACGTGCTCATG-3'
Clone DNA62814 (Fig. 69, SEQ ID NO: 162) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 121-123, and an apparent stop codon (TAA) at nucleotide positions 766-768, as indicated by bolded underline. The predicted PROl 192 polypeptide precursor (i.e., UNQ606, SEQ ID NO: 163) is 215 amino acids long. The UNQ606 (SEQ ID NO: 163) polypeptide precursor shown in Figure 70 has a signal peptide at about amino acids 1-21; a transmembrane domain at about ammo acids 153-176; potential N-glycosylation sites at about ammo acids 39-42 and 1 18-121, and homology with myelin P0 proteins at about ammo acids 27-68 and 99-128. The UNQ606 (SEQ ID NO: 163) shown in Figure 70 has an estimated molecular weight of about 24,484 Daltons and a pl of about 6.98.
A cDNA clone containing DNA62814 (SEQ ID NO: 162), designated as DNA62814-1521, was deposited with the ATCC on August 4, 1998, and is assigned ATCC deposit no. 203093.
AJ. Isolation of cDNA clones Encoding Human PRO 1246 (UNQ630)
Use of the signal algoπthm procedure descπbed above resulted in the identification of an EST cluster sequence from the Incyte database, designated Incyte EST cluster sequence no. 56853. This sequence was then compared to a variety of vaπous EST databases as described under the signal algorithm procedure above, and further resulted in the identification of Incyte EST 2481345. Further examination and sequencing of the full- length clone coπesponding to this EST sequence resulted in the isolation of the full-length DNA sequence DNA64885 (Fig. 71, SEQ ID NO: 167) and the deπved PR01246 native sequence protein UNQ630 (Fig. 72, SEQ ID NO: 168). Clone DNA64885 (SEQ ID NO: 167) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 1 19- 121 and ending at the stop codon (TGA) at nucleotide positions 1727- 1729 (Figure 71 ). as indicated by bolded underline. The predicted PRO 1246 polypeptide precursor (i.e., UNQ630. SEQ ID NO: 168) is 536 ammo acids long (Figure 72). has an estimated molecular weight of about 61,450 daltons and a pi of about 9.17. Analysis of UNQ630 (Fig. 72, SEQ ID NO: 168) reveals the following: a signal peptide from about amino acd 1 to about am o acid 15, potential N-glycosylation sites from about ammo acid 108 to about am o acid H I, from about amino acid 166 to about ammo acid 169, from about amino acid 193 to about ammo acid 196, from about ammo acd 262 to about ammo acd 265, from about ammo acid 375 to about ammo acid 378. from about ammo acid 413 to about ammo acid 416 and from about ammo acid 498 to about ammo acd 501 and amino acid sequence blocks having homology to sulfatase proteins from about amino acd 286 to about amino acd 315. from about ammo acd 359 to about am o acd 369 and from about ammo acid 78 to about amino acid 97 A cDNA containing DNA64885 (SEQ ID NO: 167). designated DNA64885-1529. has been deposited with ATCC on November 3, 1 98 and is assigned ATCC deposit no. 203457.
AK. Isolation of cDNA clones Encoding Human PRQ1283 (UNQ653)
Use of the ECD homology procedure descπbed above in a human breast tumor tissue library resulted in the isolation of the full-length DNA sequence DNA65404 (Fig. 73, SEQ ID NO: 169) and the derived PR01283 native sequence protein UNQ653 (Fig. 74, SEQ ID NO: 170).
The PCR pnmers (forward and reverse) and hybridization probes used in the isolation of DNA65404 (SEQ ID NO: 169) were the following: forward PCR primer (28753.fi): 5'-GGAGATGAAGACCCTGTTCCTG-3' (SEQ ID NO: 171) forward PCR primer (28753.fi 1): 5'-GGAGATGAAGACCCTGTTCCTGGGTG-3' (SEQ ID NO:172) reverse PCR primer (28753.rl): S'-GTCCTCCGGAAAGTCCTTATC-S' (SEQ ID NO: 173) reverse PCR primer (28753.rl 1 ): 5'-GCCTAGTGTTCGGGAACGCAGCTTC-3' (SEQ ID NO: 174) hybridization probe (28753.p I ): (SEQ ID NO: 175) 5,-CAGGGACCTGGTACGTGAAGGCCATGGTGGTCGATAAGGACTTTCCGGAG-3' hybridization probe (28753.pl 1): (SEQ ID NO:176)
5'-CTGTCCTTCACCCTGGAGGAGGAGGATATCACAGGGACCTGGTAC-3'
Clone DNA65404 (SEQ ID NO: 169) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 45-47 and ending at the stop codon (TAG) at nucleotide positions 555-557 (Figure 73), as indicated by bolded underline. The predicted PR01283 polypeptide precursor (i.e., UNQ653, SEQ ID NO: 170) is 170 amino acids long (Figure 74). The UNQ653 (SEQ ID NO: 170) protein shown in Figure 74 has an estimated molecular weight of about 19,457 daltons and a pi of about 9.10. Analysis of the UNQ653 (SEQ ID NO: 170) evidences the presence of the following: a signal peptide from about amino acd 1 to about amino acid 17. A cDNA clone contammg DNA65404 (SEQ ID NO: 169). designated DNA65404-1551. has been deposited with ATCC on September 9, 1998 and is assigned ATCC deposit no. 203244.
AL. Isolation of cDNA clones Encoding Human PROl 195 (UNQ608) Use of the signal algoπthm procedure descπbed above resulted in the identification of an EST cluster sequence 32204 from the Incyte database. This sequence was then compared to a variety of various EST databases as descπbed under the signal algorithm procedure above, and further resulted in the identification of Incyte EST352980. Further examination and sequencing of the full-length clone coπesponding to this EST sequence resulted in the isolation of the full-length DNA sequence DNA65412 (Fig. 75, SEQ ID NO: 177) and the denved PROl 195 native sequence protein UNQ608 (Fig. 76, SEQ ID NO: 178).
The full length clone DNA65412 (SEQ ID NO: 177) contams a single open reading frame with an apparent translation initiation site at nucleotide positions 58-60 and ending at the stop codon (TAG) found at nucleotide positions 511-513 (Figure 75). as indicate by bolded underline. The predicted PROl 195 polypeptide precursor (; e., UNQ608, Figure 76, SEQ ID NO: 178) is 151 ammo acids long, has a calculated molecular weight of 17.227 daltons and a pi of 5.33. Analysis of UNQ608 (SEQ ID NO: 178) reveals a signal sequence at about ammo acids 1 -22. a calculated molecular weight of approximately 17277 daltons and an estimated pi of approximately 5 33. A cDNA clone containing DNA65412 (SEQ ID NO: 177). designated as DNA65412-1523, was deposited with the ATCC on August 4. 1998 and is assigned ATCC deposit no. 203094.
AM. Isolation of cDNA clones Encoding Human PRO 1343 (UNQ698)
Use of the amylase yeast screen procedure described above on tissue isolated from human smooth muscle cell tissue resulted in an EST sequence which served as the template for the creation of the oligonucleotides below and screening as descπbed above in a human smooth muscle cell tissue library resulted in the isolation of the full length DNA sequence DNA66675 (Fig. 77, SEQ ID NO: 179) and the derived PR01343 native sequence protein UNQ698 (Fig. 78, SEQ ID NO: 180). The oligonucleotide probes employed were as follows: forward PCR primer (4892 l.fl) 5'-CAATATGCATCTTGCACGTCTGG-3' (SEQ ID NO:181) reverse PCR primer (4892 l.rl) 5'-AAGCTTCTCTGCTTCCTTTCCTGC-3' (SEQ ID NO: 182) hybridization probe (48921.p 1 ) 5'-TGACCCCATTGAGAAGGTCATTGAAGGGATCAACCGAGGGCTG-3' (SEQ ID NO: 183) The full length clone DNA66675 (SEQ ID NO.179) contains a single open readmg frame with an apparent translation mitiation site at nucleotide positions 71-73, and a stop signal (TAA) at nucleotide positions 812-814 (Figure 77). as indicated by bolded underime. The predicted PR01343 polypeptide precursor (i.e.. UNQ698, SEQ ID NO.180, Fig. 78) is 247 amino acids long, has a calculated molecular weight of approximately 25,335 daltons and an estimated pi of approximately 7 0. Analysis of the UNQ698 sequence shown in Figure 78 (SEQ ID NO: 180) evidences the presence of the following: a signal peptide from about ammo acid 1 to about ammo acid 25 and a homologous region to circu sporozoite repeats from about ammo acid 35 to about ammo acid 225. A cDNA clone contaming DNA66675 (SEQ ID NO: 179), designated DNA66675-1587. has been deposited with ATCC on September 22, 1998 and is assigned ATCC deposit no. 203282.
Alternatively, a compaπson of the yeast EST sequence isolated from the amylase screen above was screened against vanous EST databases, both public and pπvate (e.g , see ECD homology procedure, above) resulting in the identification of Incyte EST clone no. 4701 148. Further analysis and sequencing of the coπesponding full-length clone resulted in isolation of the DNA66675 sequence (SEQ ID NOT79) shown in Figure 77
AN Isolation of cDNA clones Encoding Human PRQ1418 (UNQ732)
Use of the signal algorithm procedure descπbed above resulted in the identification of an EST cluster sequence 10698 (Incyte cluster 121480). This sequence was then compared to a vaπety of vaπous EST databases (including those deπved from a placenta tissue library) as descπbed under the signal algoπthm procedure above, and further resulted in the identification of Incyte EST1306026 Further examination and sequencing of the full-length clone coπesponding to this EST sequence resulted in the isolation of the full- length DNA sequence DNA68864 (Fig. 79, SEQ ID NO.184) and the deπved PRO 1418 native sequence protein UNQ732 (Fig. 80, SEQ ID NO: 185) The full length clone shown in Figure 79 (DNA68864, SEQ ID NO 184) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 138- 140 and ending at the stop codon (TAA) found at nucleotide positions 1 188-1190. as indicated by bolded underline. The predicted PR01418 polypeptide precursor (i e , UNQ732, SEQ ID NOT85) is 350 amino acids long with a signal peptide at about ammo acids 1-19, a calculated molecular weight of approximately 39003 daltons and an estimated pi of approximately 5.59 A cDNA clone containing DNA68864 (SEQ ID NO: 184), designated as DNA68864-1629 was deposited with the ATCC on September 22, 1998 and is assigned ATCC deposit no. 203276.
AO. Isolation of cDNA clones Encoding Human PRQ1387 (UNQ722) Use of the signal algoπthm procedure descπbed above resulted in the identification of an EST cluster sequence 10298. This sequence was then compared to a vaπety of various EST databases as descπbed under the signal algoπthm procedure above, and further resulted in the identification of Incyte EST3507924. Further examination and sequencing of the full-length clone coπesponding to this EST sequence resulted in the isolation of the full-length DNA sequence DNA68872 (Fig. 81, SEQ ID NO: 186) and the derived PR01387 native sequence protem UNQ722 (Fig. 82, SEQ ID NO: 187). Clone DNA68872 (SEQ ID NO 186) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 76-78 and endmg at the stop codon (TGA) at nucleotide positions 1258-1260 (Figure 81), as indicated by bolded underline The predicted PR01387 polypeptide precursor (/ e , UNQ722, SEQ ID NO 187) is 394 ammo acids long The UNQ722 (SEQ ID NO 187) protem shown in Figure 82 has an estimated molecular weight of about 44,339 daltons and a pi of about 7 10 UNQ722 (SEQ ID NO 187) further contains a signal peptide from about ammo acid residues 1 to about residue 19, a transmembrane domam from about residue 275 to about residue 296, potential N-glycosylation sites at about residues 76, 231. 302, 307 and 376 and ammo acid sequence blocks having homology to myehn pO protein from about ammo acid residue 210 to about residue 239 and from about ammo acd residue 92 to about residue 121 A cDNA clone containing DNA68872, designated as DNA68872- 1620. has been deposited with the ATCC on August 25, 1998 and is assigned ATCC deposit no 203160
AP Isolation of cDNA clones Encoding Human PRO1410 (UNQ728)
Use of the signal algonthm procedure descπbed above resulted in the identification of an EST cluster sequence 98502 This sequence was then compared to a vaπetv of various EST databases as descnbed under the signal algorithm procedure above and further resulted in the identification of Incvte EST1257046 further examination and sequencing of the full-length clone coπesponding to this EST sequence resulted in the isolation of the full-length DNA sequence DNA68874 (Fig 83, SEQ ID NO 188) and the derived PRO 1387 native sequence protein UNQ728 (Fig 84, SEQ ID NO 189) Clone DNA68874 (SEQ ID NO 188) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 152 154 and ending at the stop codon (TGA) at nucleotide positions 866-868 (Figure 83) as indicated by bolded underline The predicted PRO1410 polypeptide precursor (i e UNQ728, SEQ ID NO 189) is 238 ammo acids long (Figure 84) The UNQ728 protein (SEQ ID NO 189) shown in Figure 84 has an estimated molecular weight of about 25 262 daltons and a pl of about 644, a signal peptide from about amino acid residue 1 to about residue 20 a transmembrane domain from about amino acid residue 194 to about residue 220 and a potential N-glvcosvlation site at about am o acid residue 132 A clone containing DNA68874 (SEQ ID NO 188) has been deposited with ATCC on September 22. 1998 and is assigned ATCC deposit no 203277
AQ Isolation of cDNA clones Encoding Human PRO 1917 (UNQ900)
Use of the signal algorithm procedure descπbed above resulted in the identification of an EST cluster sequence 85496 This sequence was then compared to a vaπefy of vaπous EST databases as descπbed under the signal algoπthm procedure above, and further resulted m the identification of Incyte EST3255033 This EST was deπved from an ovaπan tumor library Further exammation and sequencing of the full-length clone coπesponding to this EST sequence resulted in the isolation of the full-length DNA sequence DNA76400 (Fig 85, SEQ ID NO 190) and the deπved PRO 1917 native sequence protem UNQ900 (Fig 86, SEQ ID NO 191)
The full length clone DNA76400 (SEQ ID NO 190) shown in Figure 85 contams a smgle open readmg frame with an apparent translation initiation site at nucleotide positions 6 to 9 and endmg at the stop codon (TGA) found at nucleotide positions 1467 to 1469 as indicated by bolded underline The predicted PR01917 polypeptide precursor (i e , UNQ900, SEQ ID NO 191) is 487 ammo acids long UNQ900 (SEQ ID NO: 191) has a calculated molecular weight of approximately 55,051 daltons and an estimated pi of approximately 8.14. Additional features include: a signal peptide at about ammo acid residues 1-30; potential N-glycosylation sites at about ammo acid residues 242 and 481, protein kinase C phosphorylation sites at about ammo acd residues 95-97, 182-184, and 427-429: N-mynstoylation sites at about amino acid residues 107- 1 12, 113-1 18, 117-122, 118-123, and 128-133; and an endoplasmic reticulum targeting sequence at about amino acid residues 484-487
AR. Isolation of cDNA clones Encoding Human PRO 1868 (UNQ859)
Use of the ECD homology procedure descπbed above in a human fetal liver library resulted in the identification of EST clone no. 2994689. Further analysis and sequencing of the coπesponding full-length clone resulted m the isolation of DNA77624 (Fig. 87, SEQ ID NO: 192) and the denved PR01868 native sequence protein UNQ859 (Fig. 88, SEQ ID NO: 193).
Clone DNA77624 (Fig. 88, SEQ ID NO: 193) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 51-53 and ending at the stop codon (TGA) at nucleotide positions 981 -983. as indicated by bolded underline The predicted PR01868 polypeptide precursor (i e , UNQ859. SEQ ID NO 193. Fig. 89) is 310 amino acids long. The UNQ859 (SEQ ID NO- 193) protein shown in Figure 89 has an estimated molecular weight of about 35.020 daltons and a pi of about 7.90. a transmembrane domain from about amino acid residue 243 to about residue 263. potential N-glycosylation sites at about amino acd residues 104 and 192. a cAMP- and cGMP-dependent protein kinase phosphorylation site from about ammo acid residues 107 to about residue 1 10. casein kinase II phosphorylation sites from about amino acid residues 106 to about residue 109 and from about amino acd residue 296 to about residue 299, a tyrosine kinase phosphorylation site from about amino acid residue 69 to about residue 77 and potential N- myπstolation sites from about amino acid residue 26 to about residue 31 , from about residue 215 to about residue 220. from about residue 226 to about residue 231. from about residue 243 to about residue 248. from about residue 244 to about residue 249 and from about residue 262 to about residue 267. A cDNA clone containing DNA77624 (SEQ ID NO: 193) has been deposited with ATCC on December 22. 1998 and is assigned ATCC deposit no 203553
AS. Isolation of cDNA clones Encoding Human PRO205 (UNQ 179)
Use of the ECD procedure above resulted in the identification of an EST sequence deπved from a human retinal library. Additional effort to identify the full length clone using an in vitro cloning procedure were unable to identify another PRO205 encoding DNA sequence.
DNA sequence encodmg other polypeptide of substantial homology to the UNQ 179 (SEQ ID NO:229) polypeptide of Figure 90 may be found as GenBank submissions AB033089 and HSM802147J .
Clone DNA30868 (SEQ ID NO:89) contains what is believed to be an mcomplete open reading frame with an apparent translation initiation site at nucleotide positions 405-407 as indicated by bolded underline in Figure 89. The predicted partial length PR01868 polypeptide precursor (i.e., UNQ179, SEQ ID NO:229) is 343 amino acids long, has a calculated molecular weight of 39285 daltons and a pl of 6.06. Analysis of the UNQ 179 (SEQ ID NO:229) shown in Figure 90 reveals a signal peptide at about ammo acid residues 1 to 20, an N-glycosylation site at about ammo acd residues 318-322, tyrosine kinase phosphorylation sites at about amino acids residues 21-29 and 211-220, N-myπstolation sites at about residues 63-69, 83-89 and 317-323 and a prokaryotic membrane lipoprotem lipid attachment site at about residues 260- 271. A cDNA clone contammg DNA30868 (SEQ ID NO:228) has been deposited with the ATCC on March 2, 2000 under the designation DNA30868-1 156 and has been assigned ATCC deposit no. .
AT. Isolation of cDNA clones Encoding Murine PRQ21 (UNQ21 )
The isolation of DNA36638 (Fig. 91, SEQ ID NO:230), which encodes the native sequence PR021 polypeptide UNQ21 (Fig. 92, SEQ ID NO:231) has been previously described in U.S.P. 5,955,420. Additional cloning and characteπzing information can be found in Schneider et al, Cell 54 (6): 787-93 (1988) and in Manfioletti et al, Mol Cell Biol J_3 (8): 4976-85 (1993).
Clone DNA36638 contains a single open reading frame with an apparent translation initiation site at nucleotide residues 168-170 and ending at the stop codon (TAG) at nucleotide residues 2187-2189 (Figure 91), as indicated by bolded underline. The predicted PR021 polypeptide precursor (i e . UNQ21 , SEQ ID NO'231 ) is 673 amino acids long, has a calculated molecular weight of 74,512 daltons and a pi of 5.45. A cDNA clone containing DNA36638 has been deposited with the ATCC under the designation DNA36638-1056 on November 12, 1997 and has been assigned ATCC deposit number 209456
Analysis of the UNQ21 polypeptide of Figure 92 (SEQ ID NO:231 ) reveals a signal sequence at about amino acd residues 1-27, a transmembrane domain at about am o acd residues 619-635, N-glycosylation sites at about residues 417-421 and 488-492, N-myπstolation sites at about amino acid residues 126-132, 135- 141, 146-152, 173- 179. 214-220, 253-259, 346-352, 374-380, 440-446. 479-485, 497-503, 517-523, 612-618, aspartic acd and asparagine hydroxylation sites at about ammo acid residues 130-142. 168-180, 209-221 and 248-260, a vitamin K-dependent carboxylation domain and an EGF-like domain cysteine pattern signature at about amino acid residues 139-151.
AU Isolation of cDNA clones Encoding Human PRQ269 (UNQ236)
Use of the ECD homology procedure descπbed above m a human fetal kidney library in combination with an m vitro clonmg procedure using the probe oligonucleotide and one of the pπmer pairs below resulted in the identification of the full length DNA sequence DNA38260 (Fig. 93, SEQ ID NO:232) and the deπved
PR0269 native sequence protein UNQ236 (Fig. 94, SEQ ID NO:233).
The forward and reverse PCR primers and the hybridization probe used were the following: forward PCR pπmer (,f ): (SEQ ID NO:234)
5'-TGGAAGGAGATGCGATGCCACCTG -3' forward PCR primer (,f2): (SEQ ID NO:235)
5'-TGACCAGTGGGGAAGGACAG-3' forward PCR primer (.0): (SEQ ID NO:236)
5'-ACAGAGCAGAGGGTGCCTTG-3' reverse PCR primer (.rl): (SEQ ID NO:237) 5'-TCAGGGACAAGTGGTGTCTCTCCC-3' reverse PCR pπmer(.r2): (SEQ ID NO:238)
S'-TCAGGGAAGGAGTGTGCAGTTCTG-S' hybridization probe: (SEQ ID NO:239)
5'-ACAGCTCCCGATCTCAGTTACTTGCATCGCGGACGAAATCGGCGCTCGCT-3' Clone DNA38260 (SEQ ID NO:232) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 314-316 and ending at the stop codon (TAG) at nucleotide positions 1784-1786 (Fig. 93), as indicated by bolded underline. The predicted PR0269 polypeptide precursor is 490 ammo acids long (i.e., UNQ236, Fig. 94, SEQ ID NO:233), has a calculated molecular weight of 51,636 daltons and a pi of 6.29. A cDNA clone containing DNA38260 (SEQ ID NO.232) has been deposited with ATCC on October 17, 1997 and is assigned ATCC deposit no. 209397.
Analysis of the UNQ236 polypeptide of Figure 94 (SEQ ID NO:223) reveals a signal sequence at about ammo acd residues 1- 16, a transmembrane domam at about residues 399-418, N-glycosylation sites at about am o acid residues 189- 193 and 381 -385, a glycosaminoglycan attachment site at about ammo acid residues 289-293, cAMP- and cGMP-dependent protein inase phosphorylation sites at about amino acid residues 98- 102 and 434-438, N-myπstolation sites about amino acid residues 30-36, 35-41. 58-64. 59-65, 121- 127, 151 - 157. 185- 191. 209-215. 267-273. 350-356. 374-380. 453-459. 463-469 and 477-483 and an aspartic acid and asparagine hydroxylation site at about am o acid residues 262-274
AV. Isolation of cDNA Encoding Human PRQ344 (UNQ303) Use of the ECD homology procedure descπbed above in a human fetal kidney library in combination with an in vitro clonmg procedure using the probe oligonucleotide and one of the primer pairs below resulted in the identification of the full length DNA sequence DNA40592 (Fig. 95, SEQ ID NO:240) and the derived
PR0344 native sequence protein UNQ303 (Fig. 96, SEQ ID NO:241 ).
The forward and reverse PCR primers and the hybridization probe used were the following: forward PCR primer (34398. f ): (SEQ ID NO:242)
5'-TACAGGCCCAGTCAGGACCΛGGGG-3' forward PCR pπmer (34398. f2). (SEQ ID NO.243)
5'-AGCCAGCCTCGCTCTCGG-3' forward PCR pπmer (34398.0): (SEQ ID NO:244) 5'-GTCTGCGATCAGGTCTGG-3' reverse PCR pπmer (34398.rl): (SEQ ID NO:245)
5'-GAAAGAGGCAATGGATTCGC-3' reverse PCR primer (34398.r2): (SEQ ID NO:246)
5'-GACTTACACTTGCCAGCACAGCAC-3' hybridization probe (34398.pl): (SEQ ID NO:247)
S'-GGAGCACCACCAACTGGAGGGTCCGGAGTAGCGAGCGCCCCGAAG^'
Clone DNA40592 (SEQ ID NO:240) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 227-229 and ending at the stop codon (TAG) at nucleotide positions 956-958 (Figure 95). The predicted PR0344 polypeptide precursor (i.e., UNQ303, SEQ ID NO:241) is 243 am o acids long (Figure 96), has a calculated molecular weight of 25,298 daltons and a pl of 6.44. Analysis of the UNQ303 polypeptide of Figure 96 (SEQ ID NO 241 ) reveals a signal peptide at about ammo acid residue 1-15, N-myπstolation sites at about ammo acid residues 1 1-17. 68-74. and 216-222 and a cell attachment site at about ammo acid residues 77-80 A cDNA clone containmg DNA40592 (SEQ ID NO 240) has been deposited with ATCC on November 21, 1997 and is assigned ATCC deposit no 209492
AX Isolation of cDNA clones Encoding Human PRQ333 (UNQ294)
Use of the ECD homology procedure in combination with an in vivo cloning procedure resulted in the identification of the partial length sequence DNA41374 (SEQ ID NO 248, Figure 97)
Clone DNA41374 (SEQ ID NO 248) contains an incomplete open reading frame with an apparent translation termination site (; e , stop codon, TGA) at nucleotide residues 1 185-1 187. as indicated in bolded underime The predicted partial length PR0333 polypeptide (; c UNQ294, SEQ ID NO 249) is 394 ammo acids long, a calculate molecular weight of 43,725 daltons and a pi of 8 36
Analysis of the UNQ294 (SEQ ID NO 249) polypeptide of Figure 98 reveals a signal sequence at about ammo acd residues 1- 14 a transmembrane domam at about residues 359-376, N-mvπstovlation sites at about amino acid residues 166- 172 206-212. 217-223. 246-252, 308-314 312-318 361 -367 and an immunoglobulin and major histocompatibilitv complex proteins signature at amino acid residues 315-323. A cDNA clone containing DNA41374 has been deposited with the ATCC on and as assigned
ATCC deposit number
AY Isolation of cDNA clones Encoding Human PRQ381 (UNQ322)
Use of the ECD homology procedure descπbed above in a human fetal kidney library resulted in the identification of the full length DNA sequence DNA44194 (Fig 99, SEQ ID NO 250) and the derived PR0381 native sequence protein UNQ322 (Fig 100. SEQ ID NO 251) The forward and reverse PCR pnmers and the hybπdization probe used were the following Torward PCR pnmer (39651 f 1 ) (SEQ ID NO 252)
5'-CTTTCCTTGCTTCAGCAACATGΛGGC-3'
Reverse PCR pnmer (39651 rl ) (SEQ ID NO 253)
5'-GCCCAGAGCAGGAGGAATGATGAGC-3' hybndization probe (39651 pl) (SEQ ID NO 254) 5'-GTGGAACGCGGTCTTGACTCTGTTCGTCACTTCTTTGATTGGGGCTTTG-3'
Clone DNA44194 (SEQ ID NO 250) contams a single open readmg frame with an apparent translation initiation site at nucleotide positions 174-176 and ending at the stop codon (TAG) at nucleotide positions 807-809 (Fig 99), as indicated by bolded underline The predicted PR0381 polypeptide precursor (t e , UNQ322, Fig. 100, SEQ ID NO 251) is 211 amino acids long, has a calculated molecular weight of 24,172 daltons and has a pl of 5 99 The UNQ322 (SEQ ID NO 251) protein shown m Figure 100 has the following features a signal peptide from about amino acid residues 1 to about 20, a potential N-glycosylation site at about ammo acid residue 156, potential casern kmase phosphorylation sites from about ammo acid residues 143 to about 146, about residues 156 to about 159, about residues 178 to about 181, about residues 200 to about 203, an endoplasmic reticulum targetmg sequence from about ammo acid residues 78 to about 114 and from about residues 118 to about 131, EF-hand calcium binding domam from about amino acid residues 140 to about 159, and an S-100/ICaBP type calcium binding domain from about amino acd residues 183 to about 203. A cDNA clone contammg DNA44194 (SEQ ID NO:250) has been deposited with the ATCC on April 28. 1998 and is assigned deposit number 209808.
AZ. Isolation of cDNA clones Encoding Murme PRO720 (UNQ388)
The preparation of DNA53517 (SEQ ID NO:255) is described above under "X. Isolation of cDNA clones Encoding Human PRO770 (UNQ408)." Clone DNA53517 (SEQ ID NO:255) contains a single open reading frame with an apparent translation initiation site at nucleotide residues 36-38 and ending at the stop codon (TAA) at 369-371 (Figure 101), as indicated by bolded underline. The predicted PRO720 polypeptide precursor (i.e., UNQ388, SEQ ID NO:256) is 1 1 1 ammo acids long (Figure 102), has a calculated molecular weight of 11.936 daltons and a pl of 5.21.
Analysis of the UNQ388 (SEQ ID NO:256) polypeptide of Figure 102 reveals a signal sequence at about amino acid residues 1-23, N-myπstolation sites at about ammo acids residues 70-76 and 75-81 and prokaryotic membrane lipoprotem lipid attachment sites at 66-77 and 68-79. A cDNA clone contammg DNA53517 (SEQ ID N0.255) has been deposited with the ATCC on Apnl 23. 1998 and is assigned deposit number 209802.
BA. Isolation of cDNA clones Encoding Human PRQ866 (UNQ435)
Use of the ECD homology procedure described above in a human fetal kidney library resulted in the identification of the full length DNA sequence DNA53971 (Fig. 103, SEQ ID NO:257) and the deπved PRO866 native sequence protem UNQ435 (Fig. 104. SEQ ID NO:258). The forward and reverse PCR pnmers and the hybπdization probe used were the following: Forward PCR pπmer (44708.fi): (SEQ ID NO:259)
5'-CAGCACTGCCAGGGGAAGAGGG-3' Forward PCR pnmer (44708. f2): (SEQ ID NO:260)
5'-CAGGACTCGCTACGTCCG-3'
Forward PCR primer (44708.D). (SEQ ID NO:261 )
5'-CAGCCCCTTCTCCTCCTTTCTCCC-3'
Reverse PCR pnmer (44708.rl): (SEQ ID NO:262) 5'-GCAGTTATCAGGGACGCACTCAGCC-3'
Reverse PCR pnmer (44706.r2): (SEQ ID NO:263)
5'-CCAGCGAGAGGCAGATAG-3'
Reverse PCR pπmer (44706.r3): (SEQ ID NO:264)
5'-CGGTCACCGTGTCCTGCGGGATG-3' hybridization probe (44708.pl): (SEQ ID NO:265)
5'-CAGCCCCTTCTCCTCCTTTCTCCCACGTCCTATCTGCCTCTC-3'
The clone DNA53971 (SEQ ID NO:257) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 275-277 and ending at the stop codon (TAA) at nucleotide positions 1268-1270 (Figure 103), as indicated by bolded underline. The predicted native sequence PRO866 polypeptide precursor (i.e., UNQ435, SEQ ID NO:258) is 331 ammo acids (Figure 104), has a calculated molecular weight of 35,844 daltons and a pl of 5 45 The UNQ435 (SEQ ID N0.258) protein shown in figure 104 has an estimated molecular weight of about 35,844 daltons and a pi of about 5.45. Further analysis reveals a signal peptide from about ammo acid residue 1 to about residue 26, glycosaminoglycan attachment sites at about ammo acid residues 131-135, cAMP- and cGMP-dependent protein kmase phosphorylation sites at about amino acid residues 144-148 and N-myπstoylation sites at ammo acid residues 26-32, 74-80, 132-138, 134- 140, 190-196, 287-293 and 290-296 A cDNA clone contaming DNA53971 (SEQ ID NO 257) has been deposited with the ATCC on Apπl 6, 1998 and is assigned deposit no. 209750
BB. Isolation of cDNA clones Encoding Human PRO840 (UNQ433) The use of a yeast screen procedure on tissue isolated from a human thyroid library resulted an EST sequence which served as the template for the creation of PCR oligonucleotides which ultimately resulted in the isolation of DNA53987 (SEQ ID NO 266, Figure 105) and the derived PRO840 native sequence protein UNQ433 (SEQ ID NO 267, Figure 106)
A nucleotide sequence encoding a polypeptide of substantial homology with UNQ433 (SEQ ID NO 267) of Figure 106 is also available from GenBank as accession number HEEPSSARC 1
DNA53987 (SEQ ID NO 266) as shown in Figure 105 contains an open readmg frame with a translation initiation site at about nucleotide residues 18-20 and endmg at the stop codon (TGA) at nucleotide residues 1329-1331 , as indicated by bolded underline The second methionine codon at nucleotide residues 90- 92 could possibly also be the actual translation initiation site - alternatively, this codes for an internal methionine. The predicted PRO840 polypeptide (i e . the longer translation) has been termed UNQ433 (SEQ ID NO 267) and is 437 ammo acids long (Figure 106), has a calculated molecular weight of 49,851 daltons and a pi of 6 47
A cDNA clone containing DNA53987 (SEQ ID NO 266) has been deposited with the ATCC on May 12, 1998 under ATCC deposit number 209858 Analysis ot the UNQ433 polypeptide of Figure 106 (SEQ ID NO 267) reveals a signal sequence at about amino acid residues 1 -46. a transmembrane domam at about amino acid residues 319-338. an N- glycosylation site at about residues 200-204, a cAMP and cGMP-dependent protein kinase phosphorylation sites at ammo acid residues 23-27, tyrosine kinase phosphorylation sites at amino acid residues 43-52 and N- myπstolylation sites at residues 17-23, 112- 118, 1 16-122 and 185-191
BC. Isolation of cDNA clones Encoding Human PRQ982 (UNQ483)
Use of the signal algonthm procedure descπbed above resulted in the identification of an EST cluster sequence no 43715. This sequence was then compared to a variety of vaπous EST databases as descπbed under the signal algoπthm procedure above, and further resulted in the identification of Merck EST No. AA024389 The full-length clone coπesponding to this EST resulted in the identification of the full-length sequence DNA57700 (Fig 107, SEQ ID NO 268) and the deπved PR0982 native sequence protein UNQ483 (Fig. 108, SEQ ID NO:269).
The DNA57700 sequence of Figure 107 (SEQ ID NO:268) contams a single open reading frame with an apparent translation mitiation site at nucleotide positions 26-28 and endmg at the stop codon (TAA) found at nucleotide positions 401-403, as indicated by bolded underime. The prediced PR0982 polypeptide precursor (l e , UNQ982 SEQ ID NO 191) is 124 am o acids in length, has a calculated molecular weignt ot approximately 14 198 daltons and an estimated pl of approximately 9 01 (Fig 108) Further analysis of the UNQ483 (SEQ ID NO 269) polypeptide of Figure 108 reveals a signal peptide from about amino acid residues 1 to about 21 and potential anaphylatoxm domain from about amino acd residue 1 to about residue 59 A cDNA clone contammg DNA57700 (SEQ ID NO 268) was deposited with the ATCC on January 12, 1999 and is assigned ATCC deposit No 203583
BD Isolation of cDNA clones Encoding Human PRQ836 (UNQ545)
Use of the signal algoπthm procedure descπbed above resulted in the identification of EST clusters which were then compared to a vaπety of various EST databases as descnbed under the signal algoπthm procedure above, and further resulted in the identification of Incyte EST 2610075, an EST deπved from colon tumor tissue The full-length clone coπesponding to this EST resulted in the identification of the full-length sequence DNA59620 (Fig 109 SEQ ID NO 270) and the derived PR0836 native sequence protein UNQ545 The nucleotide sequence DNA59620 (SEQ ID NO 270) shown in Figure 109 contains a single open reading frame with an apparent translation initiation site at nucleotide positions 65-67 and ending at the stop codon (TGA) at nucleotide positions 1448- 1450 (Fig 109) as indicated by bolded underline The predicted PR0836 polypeptide precursor (i t UNQ545, Fig 1 10 SEQ ID NO 271) is 461 amino acids in length UNQ545 (SEQ ID NO 271 ) shown in Figure 1 10 has an estimated molecular weight of about 52,085 daltons and a pi of about 5 36 Further analysis reveals a signal peptide at about ammo acid residues 1 to about 29, N- glycosylation sites at about ammo acd residues 193 and 236 and N-mynstoylation sites at about residues 15, 19, 234. 251 402 and 451 , a domain conserved in the YJL126w/YLR351c/yhcX family of proteins at about ammo acid residues 364 to about 372, and a region having sequence identity with SLS 1 protein at about am o acid residues 68 to about 340 A cDNA clone contaming DNA59620 (SEQ ID NO 270) has been deposited with the ATCC on 16 June 1998 and is assigned deposit number 209989 BE Isolation of cDNA clones Encoding Human PROl 159 (UNQ589)
Use of the signal algoπthm procedure descπbed above resulted in the identification of EST cluster sequence 77245, which was then compared to a vaπety of vaπous EST databases as descπbed under the signal algoπth procedure above, and further resulted in the identification of Incyte EST no 376776 Analysis of the full-length clone coπesponding to this EST resulted the identification of the full-length sequence DNA60627 (Fig 1 11. SEQ ID NO 272) and the denved PROl 159 native sequence protem UNQ589 (Fig 112, SEQ ID NO 273)
Clone DNA60627 (SEQ ID NO 272) contams a single open readmg frame with an apparent translation initiation site at nucleotide positions 92-94 and endmg at the stop codon (TAG) at nucleotide positions 362-364 (Figure 11 1), as indicated by bolded underime The predicted PROl 159 polypeptide precursor (t e , UNQ589, SEQ ID NO 273) is 90 ammo acids long (Figure 112) The UNQ589 (SEQ ID N0.273) protem shown in Figure 1 12 has an estimated molecular weight of about 9,840 daltons and a pl of about 10 13 Analysis of the UNQ589 (SEQ ID NO 273) sequence shown in Figure 1 12 evidences the presence ot the following a signal peptide from about am o acid residue 1 to about residue 15 and a potential N- glycosylation site at about amino acid residue 38 Clone DNA60627 (SEQ ID NO 272) has been deposited with ATCC on August 4, 1998 and is assigned ATCC deposit no 203092
BF Isolation of cDNA clones Encoding Human PRO 1358 (UNQ707)
Use of the signal algoπthm procedure descnbed above resulted m the identification of an EST cluster sequence, which was then compared to a variety of vaπous EST databases as descπbed under the signal algoπthm procedure above, and further resulted in the identification of Incyte EST 088718. a fragment derived from a liver tissue library Analysis of the full-length clone coπesponding to the EST resulted in the identification of the full-length sequence DNA64890 (Fig 1 13, SEQ ID NO 274) and the derived PR01358 native sequence protein UNQ707 (Fig 1 14, SEQ ID NO 275)
The DNA64890 (SEQ ID NO 274) clone shown in Figure 113 contains a single open reading frame with an apparent translation initiation site at nucleotide positions 86 through 88 and ending at the stop codon (TAA) found at nucleotide positions 1418 through 1420 (Figure 1 13) as indicated bv bolded underline The predicted PRO 1358 polypeptide precursor (; t UNQ707, SEQ ID NO 275) is 444 amino acids long and a signal peptide is at about amino acid residues 1 18 UNQ707 (SEQ ID NO 275) has a calculated molecular weight of approximately 50719 daltons and an estimated pi of approximately 8 82 A cDNA clone containing DNA64890 (SEQ ID NO 274) designated as DNA64890-1612 was deposited with the ATCC on August 18, 1998 and is assigned ATCC deposit no 203131
BG Isolation of cDNA clones Encoding Human PRO 1325 (UNQ685)
Use of the signal algorithm procedure descπbed above resulted in the identification of the EST cluster sequence no 139524, which was then compared to a vaπety of vaπous EST databases as descnbed under the signal algoπthm procedure above, and further resulted in the identification of Incyte EST 3744079 Analysis of the full-length clone corresponding to the EST resulted in the identification of the full-length sequence DNA66659 (Fιg 1 15 SEQ ID NO 276) and the deπved PR01325 native sequence protein UNQ685 (Fig 1 16, SEQ ID NO 277)
Clone DNA66659 (Fig 1 15. SEQ ID NO 276) contains a single open readmg frame with an apparent translation initiation site at nucleotide positions 51-53 and endmg at the stop codon (TAG) at nucleotide positions 2547-2549, as mdicated by bolded underline The predicted PRO 1325 polypeptide precursor (i e , UNQ685, SEQ ID NO 227) is 832 ammo acids long The UNQ685 (SEQ ID NO 227) protem shown Figure 116 has an estimated molecular weight of about 94,454 daltons and a pl of about 6 94 Further analysis of UNQ685 (SEQ IDNO 227) reveals a signal peptide from about ammo acd 1 to about amino acid 18, transmembrane domams from about ammo acid 292 to about amino acid 317, from about ammo acd 451 to about amino acid 470, from about ammo acd 501 to about ammo acid 520, from about ammo acid 607 to about ammo acid 627 from about ammo acid 751 to about ammo acd 770, a leucine zipper pattern sequence from about ammo acid 497 to about amino acid 518 and potential N-glycosylation sites from about amino acid 27 to about ammo acid 30, from about ammo acid 54 to about ammo acid 57, from about ammo acid 60 to about ammo acid 63, from about ammo acid position 123 to about ammo acid position 126, from about ammo acid position 141 to about ammo acd position 144. from about amino acid position 165 to about ammo acid position 168, from about ammo acd position 364 to about ammo acd position 367, from about ammo acid position 476 to about amino acid position 479. from about ammo acid position 496 to about ammo acid position 499, from about ammo acd position 572 to about ammo acid position 575, from about amino acid position 603 to about amino acid position 606 and from about amino acid position 699 to about ammo acid position 702 A cDNA clone contaming DNA66659 (SEQ ID NO.276)) has been deposited with ATCC on September 22, 1998 and is assigned ATCC deposit no 203269
BH. Isolation of cDNA clones Encoding Human PRQ1338 (UNQ693) The use of yeast screens resulted in EST sequences which were then compared to vaπous public and pπvate EST databases in a manner similar to that descπbed above under ECD homology resulted in the identification of Incyte EST2615184, an EST derived from cholecystitis gall bladder tissue. Analysis of the coπesponding full-length sequence ultimately resulted in the isolation of DNA66667 (SEQ ID NO 278, Figure 117) and the deπved PR01338 native sequence protem UNQ693 (SEQ ID NO 279, Figure 1 18) DNA66667 (SEQ ID NO 278) as shown in Figure 1 17 contains a single open reading frame with a translation initiation site at about nucleotide residues 1 15- 1 17 and ending at the stop codon (TAA) at nucleotide positions 2263-2265. as indicated by bolded underline The predicted PRO 1338 polypeptide precursor (i t , UNQ693. SEQ ID NO 1 18) is 716 am o acids in length (Figure 118), has a calculated molecular weight of 80.716 daltons and a pi of 6 06 Analysis of the UNQ693 polypeptide (SEQ ID NO 278) of Figure 118 reveals a signal sequence at about amino acd residues 1 to 25, a transmembrane domain at about ammo acid residues 629-648, N- glycosylation sites at about ammo acd residues 69-73, 96-100, 106-110, 117-121, 385-389, 517-521. 582-586 and 61 1 -615, a tyrosine kinase phosphorylation site at about residues 573-582 and N-myπstoylation sites at about ammo acid residues 16-22, 224-230. 464-470, 637-643 and 698-704 A cDNA contaming DNA66667 (SEQ ID NO 278) has been deposited with the ATCC under the designation DNA66667-1596 on September 22. 1998 and has been assigned ATCC deposit number 203267
BI Isolation of cDNA clones Encoding Human PRQ1434 (UNQ739)
Use of ECD homology procedure described above in a human retina tissue library resulted in the identification of the full-length DNA sequence DNA68818 (Fig. 1 19, SEQ ID NO 280) and the deπved
PRO 1434 native sequence protem UNQ739 (Fig. 120, SEQ ID NO.281).
The PCR pnmers (forward and reverse) and hybπdization probe synthesized in this procedure were the following- forward PCR pnmer: 5'-GAGGTGTCGCTGTGAAGCCAACGG-3' (SEQ ID N0.282) reverse PCR pnmer:
5,-CGCTCGATTCTCCATGTGCCTTCC-3' (SEQ ID NO:283) hybridization probe: (SEQ ID N0.284)
5'-GACGGAGTGTGTGGACCCTGTGTACGAGCCTGATCAGTGCTGTCC-3' Clone DNA68818 (SEQ ID NO:280) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 581-583 and ending at the stop codon (TAG) at nucleotide positions 1556-1558 (Figure 1 19), as indicated by bolded underline. The predicted PR01434 polypeptide precursor (i.e., UNQ739, SEQ ID NO:281) is 325 ammo acids long (Figure 120). The UNQ739 (SEQ ID NO:281) protein shown in Figure 120 has an estimated molecular weight of about 35,296 daltons and a pi of about 5.37. Further analysis reveals a signal sequence at about amino acid residues 1-27, a glycosaminoglycan attachment site at about amino acd residues 80-84. M-myπstoylation sites at about ammo acd residues 10-16, 102-108, 103-109, a cell attachment sequence at about amino acd residues 114-117 and an EGF-Iike domain cysteine pattern signature at about am o acid residues 176-188. A clone contammg DNA68818 (SEQ ID NO:280) has been deposited with ATCC under the designation DNA68818-2536 on February 9, 1999 and is assigned ATCC deposit no. 203657.
BJ. Isolation of cDNA clones Encoding Human PRQ4333 (UNQ1888)
An expressed sequence tag (EST) DNA database (LIFESEQ* Incyte Pharmaceuticals, Palo Alto, CA) was searched in a manner similar to that descπbed above under the ECD homology procedure described above and an EST was identified which showed homology to lymphotoxin-beta receptor.
The EST served as the template to create oligonucleotide pnmers and probes to screen a human fetal kidney library in a manner similar to that descπbed above under the ECD homology procedure. The oligonucleotides created for the above procedure were the following: forward PCR pπmer: (SEQ ID NO:287)
5'-GCAAGAATTCAGGGATCGGTCTGG-3' probe: (SEQ ID N0.288)
S'-CTGTGTTCCCTGCAACCAGTGTGGGCCAGGCATGG AGTTGTCTAAGG-3' reverse: (SEQ ID NO:289) 5'-AGATGGCATCACTG GTGGCTGAAC-3' forward: (SEQ ID NO:290)
5'-CAGAAGGCAAATTGTTCAGCCACCAG-3' reverse: (SEQ ID NO:291)
5'-ACAGTTTCCAGACCGATCCCTGAATTC-3' The result was the isolation of the full-length DNA sequence DNA84210 (SEQ ID NO:285, Figure
121). The DNA84210 (SEQ ID NO:285) clone depicted in Figure 121 contams a single open reading frame with an apparent translation initiation site at nucleotide positions 185-187, and a stop codon (TAA) at nucleotide positions 1436-1438. as indicated by bolded underline. The predicted PR04333 polypeptide precursor (i.e., UNQ1888, SEQ ID NO:286) is 417 amino acids long. The UNQ1888 protem (SEQ ID NO:286) shown in Figure 121 has an estimated molecular weight of about 45305 daltons and a pi of about 5.12.
Analysis of the UNQ1888 polypeptide (SEQ ID NO:286) of Figure 121 reveals a signal peptide at about amino acid residues 1-25, a transmembrane domain at about residues 169-192, N-glycosylation sites about residues 105-109, 214-218, 319-323, 350-354, 368-372, 379-383, cAMP- and cGMP-dependent protein kinase phosphorylation sites at about residues 200-204 and 238-242, a tyrosine kinase phosphorylation site at about residues 207-214, an N-mynstoylation site at about residues 55-61, 215 218 and 270-276, a prokaryotic membrane poprotein lipid attachment site at about residues 259-270 and a TNFR/NGFR family cysteme-πch region at about residues 89-96
A cDNA clone contammg DNA84210 (SEQ ID NO 285), designated as DNA84210-2576, has been deposited with ATCC on March 2, 1999 and is assigned ATCC deposit no 203818
BK Isolation of cDNA clones Encoding Human PRO4302 (UNQ 1866)
Use of the amylase screen procedure descπbed above on tissue isolated from human tissue resulted in an EST sequence which was then compared against various EST databases to create a consensus sequence by a methodology as descπbed above under the amvlase yeast screen procedure and or the ECD homology procedure Further analysis of this consensus sequence resulted in the identification of Incyte EST no 2408081H1 Analysis of the full-length clones coπesponding to EST no 2408081H1 resulted in the isolation of the full length native sequence clones DNA92218 (SEQ ID NO 292) and the derived PRO4302 full-length native sequence protein UNQ1866 (SEQ ID NO 293) The full length clone DNA92218 (SEQ ID NO 292) shown in Figure 123 has a single open reading frame with an apparent translational initiation site at nucleotide positions 174-176 and a stop signal (TAG) at nucleotide positions 768-770, as indicated by bolded underline The predicted PRO4302 polypeptide precursor (i e . UNQ 1866 SEQ ID NO 293) is 198 amino acids long, has a calculated molecular weight of approximately 22,285 daltons and an estimated pl of approximately 9 35 Analysis of UNQ 1866 (Fig 124, SEQ ID NO 293) reveals a signal peptide from about amino acid residue 1 to about residue 23, a transmembrane domain from about amino acid residue 1 1 1 to about residue 130, a cAMP and cGMP-dependent protem kmase phosphorylation sites at residues 26-30. casein kinase II phosphorylation sites at residues 44-47 and 58-61, a tyrosine mase phosphorylation site at residues 36-43 and N-myπstoylation sites at residues 124-130, 144-150 and 189-195 A cDNA clone containing DNA92218 (SEQ ID NO 292), designated DNA92218-2554, was deposited with the ATCC on March 9 1999 and has been assigned deposit number 203834
BL Isolation of cDNA clones Encoding Human PRO4430 (UNQ 1947)
Use of the signal algorithm procedure described above resulted in the identification of an EST cluster sequence, which was then compared to a vaπefy of vaπous EST databases as descπbed under the signal algoπthm procedure above, and further resulted in the identification of a consensus sequence Further analysis of the consensus sequence resulted m the identification of the full-length sequence DNA96878 (Fig 125, SEQ ID NO 294) and the denved PRO4430 native sequence protem UNQ 1947 (Fig 126, SEQ ID N0.295)
The native sequence DNA sequence DNA96878 (SEQ ID NO 294) shown in Figure 125 contams a smgle open reading frame with an apparent translation initiation site at nucleotide positions 56-58 and ending at the stop codon (TGA) found at nucleotide positions 431-433, as indicated by bolded underline The predicted PRO4430 polypeptide precursor (UNQ1947, Fig. 126, SEQ ID NO 295) is 125 ammo acids long. The UNQ4430 protem (SEQ ID NO 295) of Figure 126 has a calculated molecular weight of approximately 13821 daltons and an estimated pi of approximately 8 6 Further analysis reveals the presence of a signal sequence at about ammo acid residues 1 to about 18, N-glycosylation sites at about residues 77-80 and agam at about residues 88-91, a casein kmase II phosphorylation site at about residues 67-70, an N-myπstoylation site at about residues 84-89 and a Lys-6/u-PAR domam at about residues 85-98.
A clone contaming DNA96878 (SEQ ID NO:294), designated DNA96878-2626, was deposited with the ATCC on May 4, 1999 and is assigned ATCC deposit no. 23-PTA.
BM. Isolation of cDNA clones Encoding Human PRQ5727 (UNQ2448)
Vaπous known TNF-receptors were used to screen public and pπvate EST databases (e.g., see ECD homology procedure, above) resulting in the identification Incyte clone 509151 IH. This EST sequence, which was derived from uteπne tumor tissue, then served as a template for the construction of the cloning oligos indicated below which were then used to identify by PCR a human thymus cDNA library that contained the sequence of interest. These oligonucleotides were:
Forward pπmer (509-1):
5'-GAGGGGGCTGGGTGAGATGTG-3' (SEQ ID NO:298)
Reverse pπmer (509-4AS): 5--TGCTTπGTACCTGCGAGGAGG-3- (SEQ ID NO'299)
To isolate the DNA sequence encoding the full-length DNA98853 polypeptide. an inverse long distance PCR procedure was earned out (Figure 129). The PCR primers generally ranged from 20 to 30 nucleotides. For inverse long distance PCR, primer pairs were designed in such a way that the 5' to 3' direction of each primer pointed away from each other. A pair of inverse long distance PCR primers for cloning DNA98853 were synthesized:
Primer 1 (left primer) (509-P5):
5'-pCATGGTGGGAAGGCCGGTAACG-3' (SEQ ID NO.300)
Primer 2 (right primer) (509-P6):
5'-pGATTGCCAAGAAAATGAGTACTGGGACC-3' (SEQ ID NO:301 ) In the inverse long distance PCR reaction, the template is the plasmid cDNA library. As a result, the
PCR products contain the entire vector sequence in the middle with insert sequences of interest at both ends.
After the PCR reaction, the PCR mixture was treated with Dpn I which digests only the template plasmids, followed by agarose gel purification of PCR products of larger than the size of the library cloning vector.
Since the pnmers used in the inverse long distance PCR were also 5'-phosphorylated, the purified products were then self-ligated and transformed into E.coli competent ceils. Colonies were screened by PCR usmg 5' vector pπmer and proper gene specific pπmer to identify clones with larger 5' sequence. Plasmids prepared from positive clones were sequenced. If necessary, the process could be repeated to obtain more 5' sequences based on new sequence obtained from the previous round.
The purpose of inverse long distance PCR is to obtain the complete sequence of the gene of interest. The clone containing the full length coding region was then obtained by conventional PCR.
The pπmer pair used to clone the full length coding region of DNA98853 (SEQ ID NO:296) were the following:
Forward primer (Cla-MD-509):
S'-GGAGGATCGATACCATGGATTGCCAAGAAAATGAG-S' (SEQ ID NO:302) Reverse primer (509.TAA.not): 5'-GGAGGAGCGGCCGCTTAAGGGCTGGGAACTTCAAAGGGCAC-3' (SEQ ID NO:303)
For clonmg purposes, a Cla I site and a Not I site were included in the forward pπmer and reverse pπmer respectively.
To ensure the accuracy of the PCR products, independent PCR reactions were performed and several cloned products were sequenced.
DNA sequencmg of the clones isolated as descπbed above gave the full-length DNA sequence for DNA98853 (SEQ ID N0.296, Figure 127) and the deπved PR05727 native sequence protein UNQ2448 (SEQ ID N0:297, Figure 128).
Clone DNA98853 (SEQ ID NO 296) contains a single open reading frame with an apparent translation initiation site at nucleotide positions 1-3 and ending at the stop codon (TAA) at nucleotide positions
901-903 (Figure 127), as mdicated by bolded underline. The predicted PR05727 polypeptide precursor (i.e.,
UNQ2448. SEQ ID NO 297) is 299 ammo acids long (Figure 128), has a calculated molecular weight of
32,929 daltons and a pi of 4 95 The UNQ2448 polypeptide (SEQ ID NO 297) shown m Figure 128 has an estimated molecular weight of about 3.3 kilodaltons and a pi of about 4 72 A potential N-glycosylation site exists between ammo acids 74 and 77 of the ammo acid sequence shown in Figure 128 A potential N- myπstoylation site exists between amino acids 24 and 29 of the amino acid sequence shown in Figure 128.
Potential casein kinase II phosphorylation sites exist between amino acids 123-126, 185-188, 200-203, 252-
255. 257-260, 271-274, and 283-286 of the ammo acid sequence shown in Figure 128. A potential transmembrane domain exists between am o acids 137 to 158 of the sequence shown in Figure 128. It is presently believed that the polypeptide does not include a signal sequence.
A cDNA clone containing DNA98853 (SEQ ID NO 296, designated DNA98853-1739, has been deposited with ATCC on Apπl 6, 1999 and is assigned ATTC Deposit No. Apπl 6, 1999.
EXAMPLE 2 Stimulatory Activity in Mixed Lymphocyte Reaction (MLR) Assay (no.24)
This example shows that the polypeptides of the invention are active as a stimulator of the proliferation of stimulated T-lymphocytes Compounds which stimulate proliferation of lymphocytes are useful therapeutically where enhancement of an immune response is beneficial. A therapeutic agent may take the form of antagonists of the polypeptide of the mvention, for example, muπne-human chimenc, humanized or human antibodies against the polypeptide.
The basic protocol for this assay is described in Current Protocols in Immunology, unit 3.12, edited by J. E. Coligan, A. M. Kruisbeek, D. H. Marghes, E. M. Shevach, W Strober, National Institutes of Health, Published by John Wiley & Sons, Inc.
More specifically, in one assay vaπant. peπpheral blood mononuclear cells (PBMC) are isolated from mammalian individuals, for example a human volunteer, by leukopheresis (one donor will supply stimulator
PBMCs, the other donor will supply responder PBMCs). If desired, the cells are frozen in fetal bovine serum and DMSO after isolation. Frozen cells may be thawed overnight in assay media (37°C, 5% CO2 )and then washed and resuspended to 3 x IO6 cells/ml of assay media (RPMI; 10% fetal bovine serum, 1% penicillin/streptomycin, 1% glutamine, 1% HEPES, 1% non-essential ammo acids, 1% pyruvate). The stimulator PBMCs are prepared by lπadiatmg the cells (about 3000 Rads) The assay is prepared by plating m tπphcate wells a mixture of: lOOμl of test sample diluted to 1% or to 0.1%; 50 μl of irradiated stimulator cells and 50 μl of responder PBMC cells 100 microhters of cell culture media or 100 microliter of CD4-IgG is used as the control. The wells are then incubated at 37°C, 5% CO2 for 4 days. On day 5 and each well is pulsed with tπtiated thymidine (1.0 mC/well, Amersham). After 6 hours the cells are washed 3 times and then the uptake of the label is evaluated.
In another vaπant of this assay, PBMCs are isolated from the spleens of Balb/c mice and C57B6 mice. The cells are teased from freshly harvested spleens in assay media (RPMI; 10% fetal bovine serum, 1% penicillin/streptomycin, 1% glutamine, 1% HEPES, 1% non-essential ammo acids. 1% pyruvate) and the PBMCs are isolated by overlaying these cells over Lympholyte M (Organon Teknika), centπfuging at 2000 rpm for 20 minutes, collecting and washing the mononuclear cell layer m assay media and resuspendmg the cells to 1 x 107 cells/ml of assay media The assay is then conducted as descπbed above. The results of this assay for compounds of the invention are shown below Positive increases over control are considered positive with increases of greater than or equal to 180% being prefeπed. However, any value greater than control indicates a stimulatory effect for the test protein
Table 7
PRO PRO Concentration Percent Increase Over Control
PR0356 0.1% 133.8
PR0356 0.1% 208.9
PR0356 1.0% 251.6
PR0356 1.0% 332.1
PR0273 12.4 nM 112
PR0273 124 nM 192.7
PR0769 23 86 nM 76.3
PR0769 238.6 nM 226
PROl 184 16 88 nM 81.6
PROl 184 168.82 nM 194.4
PRO 1346 3.34 nM 86.6
PRO 1346 33.41 nM 188.5
PRO 1246 0 07 nM 145
PRO 1246 0.7 nM 180.9
PR0269 0.1% 122.4
PR0269 1% 194.1
PR0344 0.1% 148.6
PR0344 1% 259.9
PR0333 0.1% 187.8
PR0333 1% 220
PR0381 14.5 nM 87.3
PR0381 14.5 nM 135.4 PR0381 145 nM 248 1 PR0381 145 nM 290 8 PR0533 006 nM 163 PR0533 0 61 nM 382 9 PRO720 0 I nM 198 4 PRO720 1 O nM 293.5 PR0866 0 I nM 131 8 PR0866 1 04 nM 223.2
EXAMPLE 3 Hairless Guinea pig Proinflammatorv Assay (no 32)
This assay is designed to determine whether the PRO polypeptides show the ability to induce vascular permeability Polypeptides testing positive in this assay are expected to be useful for the therapeutic treatment of conditions which would benefit from enhanced vascular permeability mcludmg, for example, conditions which may benefit from enhanced local immune svstem cell infiltration
Hairless guinea pigs weighing 350 grams or more were anesthetized with Ketamme (75 80 mg/kg) and 5 mg/kg Xylazine intramuscularly Test samples contammg the PRO polypeptide or a physiological buffer without the test polypeptide are injected into skin on the back of the test animals with 100 μl per injection sue lntradermally There were approximately 16 24 injection sites per animal One ml of Evans blue dve (1% in PBS) is then injected intracardially Skin vascular permeability responses to the compounds (; e blemishes at the injection sites of injection) are visually scored by measuπng the diameter (in mm) of blue-colored leaks from the site of injection at 1, 6 and/or 24 hours post administration of the test matenals The mm diameter of blueness at the site of injection is observed and recorded as well as the seventy of the vascular leakage for values scoπng above 4 standard deviations over the same animal control Blemishes of at least 5 mm m diameter are considered positive for the assav when testing punfied proteins being indicative of the ability to induce vascular leakage or permeability A response greater than 7 mm diameter is considered positive for conditioned media samples Human VEGF is used as a positive control inducing a response of 4-8 mm diameter at 0 1 μg/100 μl , and 15-23 mm diam at I μg/100 μl
The tested polypeptide are diluted to 1% of the initial stock solution UNQ 585 was diluted mto 10 mM HEPES/140 mM NaCl 4% mannιtol/1 mg/ml BSA pH 6 8, while UNQ334 was diluted into 140 mM NaCl, 10 mM Hepes, 4% Mannitol pH 7 4
Table 8
UNQ polypeptide Stock solution concentration Time (hr) dialation (mm)
PRO 1155 20,384 nM 1 6
PROH55 20,384 nM 6 6
PR0533 1024 nM 1 5.4
PR0533 1024 nM 6 7
PR021 22,000 nM 1 2.0
PR021 22,000 nM 6 140 EXAMPLE 4 Skm Vascular Permeability Assay (no 64)
This assay shows that certain PRO polypeptides stimulate an immune response and induce inflammation by inducing mononuclear cell, eosmophil and PMN infiltration at the site of injection of the animal This skm vascular permeability assay is conducted as follows. Hau-less guinea pigs weighmg 350 grams or more are anesthetized with ketamine (75-80 mg/Kg) and 5 mg/Kg Xylazme intramuscularly (IM) A sample of puπfied PRO polypeptide or a conditioned media test sample is injected intradermally onto the backs of the test animals with 100 uL per injection site It is possible to have about 10-30, preferably about 16-24, injection sites per animal. One mL of Evans blue dye (1% physiologic buffered saline) is injected intracardially Blemishes at the injection sites are then measured (mm diameter) at lhr, 6 hrs and 24 hrs post injection Animals were sacπficed at 6 hrs after injection. Each skm injection site is biopsied and fixed m paraformaldehyde. The skms are then prepared for histopathalogic evaluation Each site is evaluated for inflammatory cell infiltration into the skin. Sites with visible inflammatory cell inflammation are scored as positive Inflammatory cells may be neutrophilic. eosinophilic. monocytic or lymphocytic
At least a minimal peπvascular infiltrate at the injection site is scored as positive, no infiltrate at the site of injection is scored as negative
Table 9
UNQ Time (hrs) Infiltrate
PRO 172 24 positive
PRO200 24 positive
PRO200 24 positive
PR0216 24 positive
PR0272 24 positive
PR0362 24 positive
PRO 1007 24 positive
PRO 1031 24 positive
PR01283 24 positive
PRO 1343 24 positive
PR01358 6 positive
PR01325 6 positive
PRO 1434 24 positive
PR04333 6 positive
EXAMPLE 5
Inhibitory Activity m Mixed Lymphocyte Reaction (MLR) Assay (no. 67) This example shows that one or more of the PRO polypeptides are active as inhibitors of the proliferation of stimulated T-lymphocytes. Compounds which inhibit proliferation of lymphocytes are useful therapeutically where suppression of an immune response is beneficial. The basic protocol for this assay is descnbed in Current Protocols in Immunology, unit 3.12, edited by J E Coligan, A M Kruisbeek, D H Marghes, E M Shevach, W Strober, National Institutes of Health, Published by John Wiley & Sons, Inc
More specifically, in one assay vaπant, peπpheral blood mononuclear cells (PBMC) are isolated from mammalian individuals, for example a human volunteer, by leukopheresis (one donor will supply stimulator PBMCs, the other donor will supply responder PBMCs) If desired, the cells are frozen in fetal bovme serum and DMSO after isolation Frozen cells may be thawed overnight m assay media (37°C, 5% C02) and then washed and resuspended to 3xl06 cells/ml of assay media (RPMI, 10% fetal bovme serum, 1% penicillin/streptomycin, 1% glutamine, 1% HEPES, 1% non-essential amino acids. 1% pyruvate) The stimulator PBMCs are prepared by lπadiating the cells (about 3000 Rads) The assay is prepared by plating in triplicate wells a mixmre of 100 1 of test sample diluted to 1% or to 0 1%, 50 1 of nradiated stimulator cells, and 50 1 of responder PBMC cells 100 microhters of cell culmre media or 100 microliter of CD4-IgG is used as the control The wells are then incubated at 37"C, 5% C02 for 4 davs On day 5, each well is pulsed with tπtiated thvmidine ( 1 0 mC/well, Amersham) After 6 hours the cells are washed 3 times and then the uptake of the label is evaluated
In another vaπant of this assay. PBMCs are isolated from the spleens of Balb/c mice and C57B6 mice The cells are teased from freshly harvested spleens in assay media (RPMI, 10% fetal bovme serum, 1% penicillin/streptomycin. 1% glutamine, 1% HEPES, 1% non-essential ammo acids, 1% pyruvate) and the PBMCs are isolated by overlaying these cells over Lympholyte M (Organon Teknika), centπfuging at 2000 rpm for 20 minutes, collecting and washing the mononuclear cell layer m assay media and resuspending the cells to 1 10 cells/ml of assay media The assay is then conducted as descπbed above
Any decreases below control is considered to be a positive result for an inhibitory compound, with decreases of less than or equal to 80% being prefeπed However, any value less than control indicates an inhibitor/ effect for the test protem
Table 10
PRO PRO Concentration Percent Decrease Below Control PRO204 0 1% 86
PRO204 1 0% 35
PR0212 0 59 nM 0
PR0212 5 9 nM 52.6
PR0212 0.87 nM 82.7 PR0212 8 7 nM 66
PR0212 1.9 nM 81.6
PR0212 19 nM 61.5
PR0212 0.46 nM 66.1
PR0212 46 nM 59.5 PR0212 2.1 nM 0
CN ro ro OS VO VO r- CN CN CN os vO CN CN CN CN csi Tf rO o co od OO CN © OS Tf 00 © r ro vo vo SO Tf oo vO o s 00 Tf OO SO vO CN VO vO s vo
co m
V)
CN CN CN. vO VO VO VO VO m o o o VO O VO 1/1 o VO ro rO CN CN rN CN _ M ro ro ro ro Tf Tf Tf Tf Tf Tf VO VO o --, -— CN CN ro CO Tf Tf Tf T Tf T Tf Tf Tf Tf t r^ CO ro ro ro O vO VO VO O O VO VO VO VO VO VO CN CN O
CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CO CO ro ro ro ro CO CO CO ro ro ro ro CO ro CO IO VO n O o o O o o o o o o o O o o o o o o O O o O O o O O O O o o o O o O
Oi oi oi oi oi oi oi o o O o Q o o oUi e Oi 0, oi α. β! P, ft. 0, Oi ai oi , oi Oi oi i Oi Oi Oi i Cύ 0. Oi
CU cu cu CU cu eu cu Cu C oi i oi Oi i i
0, CL, CL. . cu u Cu Cu Cu Cu Cu CU CU α. CU Cu cu Cu, cu cu Cu cu CU CU oi oi i
C 0, α. CU CU
PR0531 2 nM 54.3
PR0531 0.2 nM 70.4
PR0531 2 nM 68.4
PRO701 0.74 nM 72.5
PRO701 0.74 nM 90.2
PRO701 7.4 nM 64.8
PRO701 7.4 nM 69
PRO770 0.69 nM 65.8
PRO770 6.9 nM 67.4
PR0788 12.96 nM 88.4
PR0788 129.6 nM 57.7
PR0788 2.9 nM 64.4
PR0788 29 nM 67.4
PR0865 0.27 nM 67.9
PR0865 2.7 nM 63.7
PRO 1083 7.1 nM 80.5
PRO 1083 71 nM 63.7
PRO1083 7.1 nM 40.9
PRO1083 71 nM 65
PROl 1 14 0.37 nM 44.9
PROl 1 14 3.7 nM 42.4
PROl 192 12.1 nM 31.6
PROl 192 121 nM 32.6
PROl 195 0.5 nM 67
PROl 195 5 nM 66.8
PRO 1250 0.05 nM 75.4
PRO1250 0.5 nM 57.2
PRO1250 0.05 nM 94.6
PRO 1250 0.5 nM 61.2
PR01312 8.5 nM 52
PR01312 85 nM 49.3
PR01312 14.2 nM 73.1
PR01312 142 nM 62.9
PR01287 0.8 nM 79.1
PR01387 8 nM 52.3
PRO1410 4 nM 89
PRO1410 40 nM 64.8
PR01418 6.4 nM 67.7
PR01418 6.4 nM 81.1
PR01418 64 nM 56.3 PR01418 64 nM 64.9
PROl 868 39.4 nM 65.8
PRO 1868 394 nM 50
PR01917 2.1 nM 70.7
PR01917 2.1 nM 82.5
PR01917 21 nM 60.7
PR01917 21 nM 62.6
PRO205 0.7 nM 71.5
PRO205 7 nM 3.5
PRO840 24.4 nM 137.2
PR0982 244 nM 58.9
PR0836 2.5 nM 60.7
PR0836 25 nM 60.6
PROl 159 11.06 nM 80.4
PROl 159 1 10.55 nM 57.6
PROl 159 l l.Oό nM 81.9
PROl 159 110.55 nM 46.2
PR01338 0.14 nM 80.7
PR01338 1.4 nM 65.5
PRO4302 13.56 nM 1 15.8
PRO4302 135.57 nM 2.4
PRO4430 24.2 nM 55.9
PRO4430 242 nM 49.9
PR05727 19.6 nM 69.2
PR05727 196 nM 54.5
EXAMPLE 6
In situ Hvbπdization
In situ hybndization is a powerful and versatile technique for the detection and localization of nucleic acd sequences withm cell or tissue preparations. It may be useful, for example, to identify sites of gene expression, analyze the tissue distπbution of transcπption. identify and localize viral infection, follow changes in specific mRNA synthesis and aid in chromosome mapping.
In situ hybridization was performed following an optimized version of the protocol by Lu and Gillett, Cell Vision J. : 169-176 (1994), using PCR-generated 33P-labeled riboprobes. Briefly, formalin-fixed, paraffin-embedded human tissues were sectioned, deparaffinized, deproteinated in protemase K (20 g/ml) for 15 minutes at 37°C, and further processed for in situ hybridization as described by Lu and Gillett, supra. A
[JJP] UTP-labeled antisense riboprobe was generated from a PCR product and hybridized at 55 °C overnight. The slides were dipped in Kodak NTB2 nuclear track emulsion and exposed for 4 weeks. 33p-Riboprobe synthesis 6.0 μl (125 mCi) of 33P-UTP (Amersham BF 1002, SA<2000 Ci/mmol) were speed vac dried. To each tube contammg dπed33P-UTP, the following mgredients were added: 2.0 μl 5x transcπption buffer; 1.0 μl DTT (100 mM); 2.0 μl NTP mix (2.5 mM 10 μl, each of 10 mM GTP, CTP & ATP + 10 μl H20); 1.0 μl UTP (50 μM), 1.0 μl Rnasin, 1.0 μl DNA template (lμg), 1.0 μl H20. The tubes were incubated at 37°C for one hour. 1.0 μL RQ1 DNase were added, followed by incubation at 37°C for 15 minutes. 90 μL TE (10 mM Tns pH 7.6/lmM EDTA pH 8.0) were added, and the mixmre was pipetted onto DE81 paper. The remaining solution was loaded m a Mιcrocon-50 ultrafiltration unit, and spun using program 10 (6 mmutes) The filtration unit was inverted over a second tube and spun using program 2 (3 minutes) After the final recovery spm, 100 μL TE were added. 1 μL of the final product was pipetted on DE81 paper and counted in 6 ml of Biofluor II.
The probe was run on a TBE/urea gel 1 -3 μL of the probe or 5 μL of RNA Mrk III were added to 3 μL of loading buffer After heating on a 95°C heat block for three minutes, the gel was immediately placed on ice The wells of gel were flushed, the sample loaded, and run at 180-250 volts for 45 mmutes The gel was wrapped in saran wrap and exposed to XAR film with an intensifying screen in -70°C freezer one hour to overnight
3 P-Hybπdιzatιon
Pretreatment of frozen sections The slides were removed from the freezer, placed on aluminum trays and thawed at room temperamre for 5 minutes The trays were placed in 55 °C incubator for five minutes to reduce condensation. The slides were fixed for 10 minutes in 4% paraformaldehyde on ice m the fume hood, and washed in 0 5 x SSC for 5 minutes, at room temperamre (25 ml 20 x SSC + 975 ml SQ H 0) After deproteination in 0.5 μg/ml protemase K for 10 mmutes at 37°C (12.5μL of 10 mg/ml stock in 250 ml prewarmcd RNase-free RNAse buffer), the sections were washed m 0.5 x SSC for 10 minutes at room temperamre The sections were dehydrated in 70%. 95%. 100% ethanol. 2 minutes each.
Pretreatment of paraffin-embedded sections The slides were deparaffinized, placed in SQ H20, and rinsed twice in 2 x SSC at room temperamre. for 5 minutes each time The sections were deproteinated in 20 μg ml protemase K (500 μL of 10 mg/ml in 250 ml RNase-free RNase buffer; 37C, 15 mmutes ) - human embryo, or 8 x protemase K (100 μL in 250 ml Rnase buffer, 37°C, 30 mmutes) - formalin tissues. Subsequent πnsing m 0 5 x SSC and dehydration were performed as descπbed above.
Prehybridizatton The slides were laid out in plastic box lined with Box buffer (4 x SSC, 50% formamide) - samrated filter paper. The tissue was covered with 50 μL of hybπdization buffer (3 75g Dextran Sulfate + 6 ml SQ H20), vortexed and heated in the microwave for 2 mmutes with the cap loosened. After cooling on ice, 18.75 ml formamide, 3.75 ml 20 x SSC and 9 ml SQ H20 were added, the tissue was vortexed well, and incubated at 42°C for 1-4 hours.
Hybridization 1.0 x IO6 cp. probe and 1.0 μL RNA (50 mg/ml stock) per slide were heated at 95°C for 3 mmutes. The slides were cooled on ice, and 48 μL hybridization buffer were added per slide. After vortexmg, 50 μL 33P mix were added to 50 μL prehybridization on slide. The slides were mcubated overnight at 55C. Washes Washing was done 2x 10 mmutes with 2xSSC, EDTA at room temperamre (400 ml 20 x SSC + 16 ml 0 25M EDTA, Vf=4L), followed by RNaseA treatment at 37°C for 30 mmutes (500 μL of 10 mg ml in
250 ml Rnase buffer - 20 μg/ml), The slides were washed 2x10 minutes with 2 x SSC, EDTA at room temperamre The stπngency wash conditions were as follows 2 hours at 55°C. 0 1 x SSC, EDTA (20 ml 20 x SSC + 16 ml EDTA, Vf=4L)
Alternatively, multi-tissue blots containing poly A+ RNA (2 μg per lane) from various human tissues were purchased from Clontech (Palo Alto, CA) DNA probes were labeled with [α- P]dCTP by random pπming DNA labeling Beads (Pharmacia Biotech) Hybπdization was performed with Expresshyb (Clontech) at 68°C for 1 hr The blots were then washed with 2X SSC/0 05%o SDS solution at room temperamre for 40 min, followed by washes in 0 IX SSC/0 1%SDS solution at 55°C for 40 mm with one change ot fresh solution The blots were exposed in a phosphoπmager
DNA 29101 (VEGFB9)
DNA29101 (SEQ ID NO 1 ) was examine in three separate in situ studies wherem the following probes were used
VEGFB9-pl (SEQ ID NO 194)
5'-GGATTCTAATACGACTCACTATAGGGCGGCGGAATCCAACCTGAGTAG-3'
VEGFB9-p2 (SEQ ID NO 195)
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA GCG GCT ATC CTC CTG TGC TC-3'
IS97-029
Expression observed in the developing lower fetal limb bones at the edge of the cartilagenous anlage
(i e , around the outside edge), in developing tendons in vascular smooth muscle and in cells embracing developing skeletal muscle m ocvtes and myotubes Expression also observed in the following tissues epiphyseal growth plate lymph nodes - marginal sinus thvmus subcapsular region of the thvmic cortex. possibly representing either the subcapsular epithelial cells or the proliferating, double negative, thymocytes that are found in this region, tracheal smooth muscle, bra
(cerebral cortex) - focal expression m cortical neurones, small intestine - smooth muscle, thyroid - thyroid epithelium, liver - ductal plates, stomach - mural smooth muscle, fetal skin - basai layer of squamous epithelium, placenta - interstitial cells in trophoblastic villi. spinal cord - no expression except m wall of arteπes and veins No expression was observed in the spleen and adrenals
The above expression pattern suggests that DNA29101 may be involved in cell differentiation
/proliferation
IS97-037
Expression in superovulated rat ovaπes were negative in all sections with both antisense and sense probes Either the message is not expressed m this model, or the human probe does not cross react with rat
IS97-087 High expression levers were observed at the following sites: chimp ovary - granulosa cells of maturing follicles, lower intensity signal observed over thecai cells; chimp parathyroid - high expression over chief cells; human fetal testis - moderate expression over stromal cells suπounding developing tubules: human fetal lung - high expression over chondrocytes in developmg bronchial tree, and low level expression over branchmg bronchial epithelium.
Fetal tissues examined (E12-E16 weeks) include: placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eye, spinal cord, body wall, pelvis and lower limb. Adult tissues examined include liver, kidney, adrenal, myocardium, aorta, spleen, lymph node, pancreas, lung, skin, cerebral cortex (rm), hippocampus(rm), cerebellum(rm), penis, eye, bladder, stomach, gastric carcinoma, colon, colonic carcinoma and chondrosarcoma. Also examined were acetaminophen mduced liver injury and hepatic ciπhosis
DNA30871
IS97-044 In fetal tissues, strong signals were observed over neurones in fetal cerebral cortex, spinal cord, spinal ganglia as well as enteπc neurones in the wall of the fetal stomach. Signal also observed over cells around the root of the aorta (possibly the conducting system), adrenal medulla, mesenchymal cells in neurovascular bundle, renal parenchyma and cells lying between skeletal muscle myocytes. All other fetal tissues negative.
No expression was observed in adult tissue. Fetal tissues (12-16 weeks) examined include: placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, esophagus, stomach, small intestine, spleen, thymus. pancreas, brain, eye. spinal cord, body wall, pelvis and lower limb. Adult tissues examined include: liver, kidney, adrenal, myocardium, aorta, spleen, lymph node, pancreas, lung and skin. The probes used in the above analysis were the following: DNA30871 -pl (SEQ ID NO: 196)
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CTC CCG TCT CCT CCT GTC CTC-3' DNA30871-p2 (SEQ ID NO:197): 5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA CCT CGG CAT CTT CGT CAC ATT-3"
DNA30942:
DNA30942 (SEQ ID NO: 13) was examined in four separate in situ smdies (including two in the diseased tissue study of Example 7 using the following probes: DNA30942-pl (SEQ ID NO: 198) 5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC TCG CTG CTG TGC CTG GTG TTG-3' DNA30942-p2: (SEQ ID NO: 199) 5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA CCG CTG CAG CCT CTT GAT GGA-3'
IS97-043: No expression was observed in fetal tissues The fetal tissues exammed mcluded. placenta, umbilical cord, brain, spmal cord, eye, optic nerve, trachea, lung, heart, thymus, liver, spleen, esophagus, small mtestme, pancreas, adrenal, thyroid, body wall and lower limb
No expression was observed in adult tissues The adult tissues exammed included liver, kidney, adrenal, myocardium, aorta, spleen, lymph node, pancreas, lung and skm
DNA33087 (IS97-051)
In fetal tissue, expression of DNA33087 (SEQ ID NO 18) was observed in osteoblasts at all sites of enchondrai and penosteal new bone formation, the developing pulmonary arteπal and aortic trunks The fetal tissues examined included, placenta, umbilical cord, brain, spinal cord, eye, optic nerve, trachea, lung, heart, thymus. liver, spleen, esophagus, small intestine, pancreas, adrenal, thyroid, body wall and lower limb
No expression was observed in the adult tissues examined mcludmg Liver, kidnev. adrenal, myocardium, aorta, spleen, lymph node, pancreas, lung and skm The probable role in control of bone matπx deposition and or osteoblast growth All adult tissues in the multiblock were positive for beta-actin
The probes used in this procedure were the following
DNA33087-pl (SEQ ID NO 200)
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CCC GAG TGT TTT CCA AGA-3' DNA33087-p2 (SEQ IDNO 201 )
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA CAA GTT TAC TAG CCC ATC CAT-3'
DNA33087-p3 (SEQ ID NO 202)
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC TGG ATG GGC TAG TAA ACT TGA-3'
DNA33087-p4 (SEQ ID NO 203) V CTA TGA AAT TAA CCC TCA CTA AAG GGA CCC TTC TGC TCC TTC TTG TT-3'
DNA34387 (IS97-109)
The expression pattern of DNA34387 (SEQ ID NO 25) was observed in fetal and adult human tissues at the following sites Fetal - thyroid epithelium, small intestinal epithelium, gonad, pancreatic epithelium, hepatocytes in liver and renal tubules Expression also seen in vascular tissue in developmg long bones
Adult - Moderate signal in placental cytotrophoblast, renal tubular epithelium, bladder epithelium, parathyroid and epithelial tumors
The fetal (E12-E16 weeks) tissues exammed included placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, esophagus, stomach, small mtestme, spleen, thymus, pancreas, bram, eye, spinal cord, body wall, pelvis and lower limb
The adult human tissues exammed. kidney (normal and end-stage), adrenal, myocardium, aorta, spleen, lymph node, gall bladder, pancreas, lung, skm, eye (inc. retma), prostate, bladder, liver (normal, curhotic, acute failure) The non-human pπmate tissues examined included the following- Chimp tissues: Salivary gland, stomach, thyroid, parathyroid, skin, thymus. ovary, lymph node. Rhesus Monkey Tissues: Cerebral cortex, hippocampus, cerebellum, penis.
The probes used in this procedure were the following: DNA34387-pl (SEQ ID NO:206): 5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CCG AGA TAT GCA CCC AAT GTC-3' DNA34387-p2 (SEQ ID NO:207): 5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA TCC CAG AAT CCC GAA GAA CA-3'
DNA35638: IS97-078:
Expression of DNA35638 (SEQ ID NO:35) was observed in the endothelium lining a subset of fetal and placental vessels. Endothelial expression was confined to these tissue blocks. Expression also observed over intermediate trophoblast cells of placenta.
The fetal tissues exammed (E12-E16 weeks) included: placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, esophagus, stomach, small intestine, spleen, thymus. pancreas. brain, eye. spinal cord, body wall, pelvis and lower limb.
The adult tissues examined included: liver, kidney, adrenal, myocardium, aorta, spleen, lymph node, pancreas. lung, skin, cerebral cortex (rm), hιppocampus(rm). cerebellum(rm), penis, eye, bladder, stomach, gastπc carcinoma, colon, colonic carcinoma, thyroid (chimp), parathyroid (chimp) ovary (chimp) and chondrosarcoma. Also examined was tissue derived from acetaminophen induced liver injury and hepatic cπhosis.
The oligos used for the above procedure were the following:
DNA35638-pl (SEQ ID NO:208):
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC GGG AAG ATG GCG AGG AGG AG-3' DNA35638-p2 (SEQ ID NO:209)-
5'-CTA TGA AATTAA CCC TCA CTA AAG GGA CCA AGG CCA CAA ACG GAA ATC-3'
DNA39523:
The following probes were used in the in situ smdies below: DNA39523-pl (SEQ ID NO:210):
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC AGC GCA CGG CCA CAG ACA-3'
DNA39523-p2 (SEQ ID NO:211):
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA GAC CCT GCG CTT CTC GTT CCA-3"
198-052:
DNA39523 (SEQ ID NO:45) in normal human skin (neonatal foreskin) and adult psoriatic skin both exhibited specific strong expression in the epithelial cells of the stratum basale - the single layer along the basement membrane which is the progenitor for all of the overlying epidermal cells in the skin.
There was no expression in epidermal cells in the overlying layers (stratum spinosum, straum granulosum, etc.). The intensify of the signal was slightly increased in psoπatic skin. Expression was also apparent in the dermis (the connective tissue immediately underlymg the epidermis) of both normal and psoπatic skin Expression here was most apparent in spmdle shape cells within the collagen matπx - the stromal fibroblasts
In the bram, sections of cerebrum had strong specific expression in a subset of superficial cortical neurons - a distmct pattern suggestive of a specific population of cortex neurons
In inflamed and normal bowel Normal human large bowel and bowel with either Crohns's disease or ulceranve colitis had specific moderate to strong expression in a multifocal pattern withm the lamma propπa of villi The cells labeled bv in situ were spindloid stromal cells best delineated as fibroblasts There was no expression by intestinal epithelial cells and there was no apparent increased expression (intensity or frequency) in diseased bowel Specifically there was also no coπelation of expression and lesions m the inflamed bowel
In human fetal kidney, there was specific weak to moderate expression in multifocal developing tubules, expression was in the tubular epithelium in these foci
The expression of DNA39523 (SEQ ID NO 45) in the skm and specific localization to the basal epithelial cells of the epidermis cells suggests a potential role in differentiation/maintenance of the basal epidermal cells Tins expression pattern in combmation with the tact that expression occurs m cells that are directly adjacent to the basement lamina, suggests that the cells regulate trafficking of leukocytes into the epidermis As a result DNA39523 (SEQ ID NO 45) may be a constitutively expressed signal for the trafficking of dendπtic/Langerhan cells or lymphocvtes into the epidermis Such trafficking is a normal physiologic e\ ent that occurs in normal skm and is thought to be involved in lmmunosurveillance of the skin
The expression of DNA39523 (SEQ ID NO 45) in inflammatory bowel disease was not increased from normal tissue, and there was no coπelation of its expression to inflammatory lesions Similarly, its expression in the basal epidermal cells in psoπatic skin lesions was equivalent to or only slightly greater than that seen in normal neonatal skin (but age matched control adult skin was not available at the time of the study)
IS97-128
The expression of DNA39523 (SEQ ID NO 45) was observed m the epithelium of mouse embryo skm as well as the basal epithelium and dermis of human fetal skin The basal epithelial pegs of the squamous mucosa of the chimp tongue are also positive Expression was also observed m a subset of cells in developmg glomeru of fetal kidney, adult renal tubules, and over "thyroidized" epithelium m end-stage renal disease However low expression was also seen in a renal cell carcinoma probably over the epithelial cells Expression was also observed in the stromal cells both (1) at low levels in fetal lung, and (2) in the apical portion of gastπc glands High expression was indicated in the lamina propπa of the fetal small intestinal villi, normal colonic mucosa and over stromal cells in a colonic carcinoma Strong expression occuπed in benign connective tissue cells m the hylanized stroma of a sarcoma Expression also occuπed m stromal cells in the placental villi and the splenic red pulp In the bram, expression occuπed in cortical neurones
DNA39523 (SEQ ID NO 45) was also expressed in the connective tissue suπounding developmg bones and over nerve sheath cells in the fetus The fetal tissues exammed (E12-E16 weeks) included: placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eye, spinal cord, body wall, pelvis and lower limb. The adult tissues examined included: liver, kidney, adrenal, myocardium, aorta, spleen, lymph node, pancreas, lung, skin, cerebral cortex (rm), hιppocampus(rm), eye, stomach, gastπc carcinoma, colon, colonic carcinoma, thyroid (chimp), parathyroid (chimp) ovary (chimp) and chondrosarcoma. Also examined included acetammophen mduced liver injury and hepatic ciπhosis.
IS98-092:
The expression of DNA39523 (SEQ ID NO:45) was present in many cells m the outer layers (I and II) of the monkey cerebral cortex. A small subset of cells in the deeper cortical layers also expressed mRNA for the chemokine homolog. Scattered cells within the molecular layers of the hippocampus and bordeπng the inner edge of the dentate gyrus showed expression of DNA39523 (SEQ ID NO:45). No expression was detected within the cerebellar cortex. Expression of DNA39523 (SEQ ID NO:45) was not observed in infarcted bram, where cell death has occuπed in the regions where the chemokine homolog normally is expressed DNA39523 (SEQ ID NO.45) could possibly serve as a marker of a subset of neurons of outer layers of the cerebral cortex and could possibly reveal neuronal migration disorders. Abnormal neuronal migration is a possible cause of some seizure disorders and schizophrenia.
IS98-128:
DNA39523 (SEQ ID NO:45) showed intriguing and specific patterns of hybridization within postnatal day (P) 10 and adult mouse brains. In one sagittal section of P10 mouse brain, strong signal was observed scattered withm the molecular layer of the hippocampus and inner edges of the dentate gyrus. Cells in the presubiculum were moderately labeled, the signal extended in a strong band through outer layers of the retrosplenial cones to the occipital cortex, where the signal diminished to background levels. A small set of positive neurons were detected in deeper regions of P 10 motor cortex: neurons in outer layers of P 10 cortex did not exhibit signal above background levels. Moderate hybndization signal was also detected m the infeπor colliculus. Chemokine homolog signal in the adult mouse bram was evaluated in three coronal sections at different levels. Strong signal was detected in the sepmm and in scattered neurons in the pontme nuclei and motor root of the tπgeminal nerve; moderate signal was seen in the molecular layers of the hippocampus and outer layers of the retrosplenial cortex.
IS99-027: Bolekine (also known as BRAK - the chemokine to which DNA39523 (SEQ ID NO:45) bear significant homology) belongs to a chemokine subgroup charactenzed by a cys-x-cys (CXC) motif and absence of an ammo-terminal glu-leu-arg (ELR). Non-ELR CXC chemokines (includingSDF-1, IP 10, Mig and PF4) are chemotactic for subsets of leukocytes including B and T lymphocytes. They also have angiostatic activity.
DNA39523 (SEQ ID NO:45) was detected in Postnatal day (P) 1 mouse brain, bolekine signal was detected in the hippocampus (stramm lacunosum moleculare and hilus of the dentate gyrus) and anterior olfactory nucleus, but not in the developing cerebral cortex or cerebellum By P10, signal is present in a subset of cells m layers 1 & 2 of the cerebral cortex. A small population of cells in the deeper layers also express DNA39523 (SEQ IDN0.45) The pattern m the hippocampus resembled the Pl brain. Weak signal is present m the cerebellum, especially lobules IX and X. Signal is also present m the dorsal stnatum and collicuh In the adult mouse bram, bolekine-positive cells were difficult to detect in the adult cerebral cortex, but signal is present m the anteπor olfactory nucleus and hippocampus In ischemic mouse brains, however, bolekine signal is induced m the penumbra
In the developing cerebral cortex, bolekme expression coπelates with final stages of neuronal migration and the establishment of axonal projections and synaptogenesis Other CXC chemokmes have roles in neuronal migration and patterning in the central nervous system (SDF-l) and modulation of neuronal activity (IL-8 and GRO-a).
Bolekine expression is induced in ischemic -reperfusion injury in the brain, but not in other inflammatory states.
DNA47365 (1S97-142) In fetal tissues, the expression ot DNA47635 (SEQ ID NO 91 ) was observed in the fascia lining the anteπor surface of the vertebral bodv There is expression over the fetal retina Low level expression over fetal neurones
The following probes were used in the above analysis
DNA47365-pl (SEQ ID NO 214) 5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC AAC CCG AGC ATG GCA CAG CAC-3'
DNA47365-p2 (SEQ ID NO 215)
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA TCT CCC AGC CGC CCC TTC TC-3'
DNA49435 (IS97-136) Moderate expression of DNA49435 (SEQ ID NO 1 1 1 ) was observed over cortical neurones in the fetal brain Expression was also present over the inner aspect of the fetal retina, possible expression in the developing lens Expression was seen over fetal skin, cartilage, small intestine, placental v illi and umbilical cord. In adult tissues there is an extremely high level of expression over the gallbladder epithelium Moderate expression of DNA49435 (SEEQ ID NO 1 1 1) was seen over the adult kidney, gastπc and colonic epitheha. The human fetal tissues examined (E12-E16 weeks) mcluded. placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, esophagus, stomach, small mtestme, spleen, thymus, pancreas, bram, eye, spinal cord, body wall, pelvis, testis and lower limb. The adult human tissues examined included, kidney (normal and end-stage), adrenal, spleen, lymph node, pancreas, lung, eye (inc retina), bladder, liver (normal, cπhotic. acute failure). The non-human pπmate tissues examined mcluded the adrenal glands from chimp tissues and the cerebral cortex, hippocampus and cerebellum of rhesus monkey tissues.
The probes used in the above analysis were the following: DNA49435-pl (SEQ ID NO:218): 5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC GGA TCC TGG CCG GCC TCT G-3' DNA49435-p2 (SEQ ID NO:219): 5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA GCC CGG GCA TGG TCT CAG TTA-3'
DNA54228 (IS98-WS)
Expression of DNA54228 (SEQ ID NO 133) was observed m bone spicules fetal metaphyseal bone, fetal calvanum (skull) and bone tissue m human neoplasm (osteosarcoma and chondrosarcoma) There is weak but consistent signal m small bone spicules m the metaphysis of fetal bone and in ossified spicules m a chondrosarcoma and an osteosarcoma No signal was detected in human lung, liver, thymus, kidney, thyroid, brain, spleen, fetal tissues including adrenal, brain, cartilage, lung, liver, mtestme. gonad, heart and skin The probes used m the above procedure were the following hmDETl-p 1 (SEQ ID NO 220)
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC ACC ACC ACC CAG GAG C-3' hmDETI-p2 (SEQ IDNO 221)
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA AAT GAA GTG GGA CGTTTG AGT-3'
DNA54228-pl (SEQ ID NO 222) 5 GGA TTC TAA TAC GAC TCA CTA TAG GGC CTT CTT TCC TTC ACC ACC ACC-3'
DNA54228 p2 (SEQ ID NO 223)
5 -CTA TGA AAT TAA CCC TCA CTA AAG GGA TCT GCC TTG GCT TTT GAC AC-3'
DNA54231 (mFIZZ3) IS98-070
DNA54231 (SEQ ID NO 139) showed a moderate signal that is specific to adipocytes This signal was present in mesenteπc fat and in interstitial fat m the neck around the trachea The expression pattern appears to be specific for adult fat
IS98-109
The expression of DNA54231 (SEQ ID NO 139) was specific to adipocvtes and was present wherever such cells were found which in this study included the pentoneal mesentery, peπrenal fat m the renal pelvis, and the mammary fat pad There was no expression in any other cell type in normal munne brain, liver, kidney, mammary gland, pancreas, spleen, pancreas, bone marrow, stomach, duodenum, jejunum, lleum, colon. cecum. testis, skin, or lung
The selective distπbution of this molecule to adipocytes suggests a role m either fat metabolism or the production/ genesis of adipocytes, either of which is important in obesity
The probes used for the above procedure were the following DNA54231-pl (SEQ ID NO 224) 5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CGA GGG GGA CAG GAG CTA ATA-3' DNA54231-p2 (SEQ ID NO 225) 5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA GTC CCA CGA GCC ACA GG-3'
DNA59294 (IS98-138) DNA 59294 (SEQ ID NO 149) was evaluated in a panel consistmg of normal adult and letal tissues and tissues with inflammation, predommantly chronic lymphocytic inflammation. In summary, the expression was specific to muscle, certain types of smooth muscle in the adult and in skeletal and smooth muscle in the human ferns. The expression in adult human was m smooth muscle of tubular organs evaluated including colon and gall bladder. There was no expression in the smooth muscle of vessels or bronchi. No adult human skeletal muscle was evaluated. In fetal tissues there was moderate to high diffuse expression in skeletal muscle the axial skeleton and limbs. There was weak expression in the smooth muscle of the intestinal wall but no expression m cardiac muscle.
In adult tissues, the colon showed a low level of diffuse expression m the smooth muscle (tunica musculaπs) in 5 specimens with chronic inflammatory bowel disease. In the gall bladder, there was weak to low level expression in the smooth muscle of the gall bladder.
In fetal human tissues, there was moderate diffuse expression in skeletal muscle and weak to low expression in smooth muscle. However expression was not detected in the fetal heart or any other fetal organ including liver, spleen, CNS, kidney, gut, lung. The additional human tissues tested with no detectable expression included, lung with chronic granulomatous inflammation and chronic bronchitis (5 patients), peripheral nerve, prostate, heart, placenta, liver (disease multiblock including acetomihopin induced injury and ciπhosis), bram (cerebrum and cerebellum), tonsil (reactive hyperplasia). peripheral lymph node, thymus. The probes used in the above procedure were the following. 626 pl (SEQ ID N0.226).
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CGG AAT GGA CTG GCC TCA CAA-3'
626.p2 (SEQ ID N0.227).
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA AGG ATG GTC TCG GGC TGC TG-3'
DNA30868 (IS97-044)
DNA30868 expression was found in the following fetal tissues, spinal cord, autonomic ganglia, enteπc nerves, sacral plexus, peripheral and cranial nerves
The fetal tissues exammed were the following- Placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, esophagus, stomach, small intestine, spleen, thymus, pancreas, bram. eye, spinal cord, body wall, pelvis and lower limb.
The adult tissues exammed included. Liver, kidney, adrenal, myocardium, aorta, spleen, lymph node, pancreas, lung and skm.
The probes used for the above procedure were the following:
DNA30868.pl (Clll-G): (SEQ ID NO.304) 5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC AGA GAC AGG GCA AGC AGA ATG-3'
DNA30868.p2 (Cl l l-H): (SEQ ID NO:305)
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA GAA GGG GAT GAC TGG AGG AAC-3'
DNA53517: IS98-070: DNA53517 (SEQ ID NO 255) expression in the normal adult muπne lung was patchy, with expression m a subset of mucosal epithelial cell in the large airway (bronchi/bronchioles) There is also expression within the rare discrete cells m the submucosal interstitium adjacent to the large airways These cells, typically 1 -3 withm a positive focus, are adjacent to large vessels and may represent smooth muscle cells, penpheral nerves or Schwann cells, or lymphatics.
In the munne adult lung with allergic inflammation (eosinophilic. lymphocytic vascuhtis. bronchiohtis and pneumomtis), there was diffuse strong expression in all mucosal epithelial cells of all of the large airways (bronchi/bronchioles) of the lung There was also strong expression in discrete cells that represent a subset of epithelial cells that line the alveoli, these cells are type II pneumocytes There is also expression, as in normal lung, present within rare discrete cells in the submucosal interstitium adjacent to the large airways
In normal adult munne small and large intestine, there is strong expression within multifocal few discrete single cells that are present in the submucosa. the tunica musculaπs and the mesentery The cells that express the signal are almost always associated with nerve, vein, artery tπads within these areas These cells are spindle shaped and may be either a penpheral nerves. Schwann cells associated with such nerves or some type of support cell associated with vessel or lymphatics Interestingly, there is no expression within identifiable mventeπc plexi that are present withm the tunica musculaπs
In inflamed large bowel (from an IL10R KO mouse) the pattern of expression is similar but expression level is significantly decreased
IS98-093
The distπbution of DNA53715 (SEQ ID NO 255) was further evaluated in a broad screen of normal muπne tissues In normal lung, expression is vanable but when present was restπcted to murine bronchial epithelial cells and type II alveolar cells in the lung There is a marked increase in expression in these cells m inflamed lung (allergic inflammation with bronchial mucosal hypertrophy/hyperplasia. asthma model) The expression of DNA53715 (SEQ ID NO 255) in the bowel is most prominent m the colon and is present in few discrete cells within the submucosa and mucosa musculaπs. the thin, well vasculaπzed tissue laver between the muscle wall of the bowel and the mucosa proper The exact identity of these cells has not been delineated, however, their spindloid morphology and close association to capillanes and small vessels in the submucosa suggest the following possibilities a subset of vascular peπcytes or non-myehnated nerve fibers
The expression of DNA53715 (SEQ ID N0.255) m discrete cells m the bowel submucosa was restπcted to the colon and was not seen in sections of jejunum, lleum, proximal duodenum or stomach. Expression was not detected m the following normal muπne tissues liver, kidney, spleen, bone marrow, lung, pancreas, stomach, proximal duodenum, jejunum, eum. bram, skin, testis, or mammary glands. It is possible that DNA53715 (SEQ ID NO 255) has a role m enhancing or stimulating mucosal immunity in the lung.
The probes used for the above procedure were the following:
DNA53517.pl (C301-P)- (SEQ ID NO:308)
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CCC AGG ATG CCA ACT TTG A-3' DNA53517.p2(C301-Q) (SEQ ID NO:309) 5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA AGG AGG CCC ATC TGTTCA TAG-3'
EXAMPLE 7
In situ Hybndization in Cells and Diseased Tissues The in situ hybndization method of Example 6 is used to determine gene expression, analyze the tissue distπbution of transcπption, and follow changes in specific mRNA synthesis for the genes/DNAs and the proteins of the invention m diseased tissues isolated from human individuals suffering from a specific disease. These results show more specifically where in diseased tissues the genes of the mvention are expressed and are more predictive of the particular localization of the therapeutic effect of the inhibitory or stimulatory compounds of the invention (and agonists or antagonists thereof) in a disease. Hybπdization is performed according to the method of Example 6 using one or more of the following tissue and cell samples:
(a) lymphocytes and antigen presenting cells (dendritic cells. Langherhans cells, macrophages and monocytes, NK cells);
(b) lymphoid tissues, normal and reactive lymph node, thymus. Bronchial Associated Lymphoid Tissues. (BALT). Mucosal Associated Lymphoid Tissues (MALT),
(c) human disease tissues
• Synovium and joint of patients with Arthntis and Degenerative Joint Disease.
• Colon from patients with Inflammatory Bowel Disease mcludmg Ulceranve Colitis and Crohns' disease. • Skin lesions from Psoπasis and other forms of dermatitis,
• Lung tissue including BALT and tissue lymph nodes from chronic and acute bronchitis, pneumonia, pneumomtis. pleuπtis:
• Lung tissue including BALT and tissue lymph nodes from Asthma;
• nasal and sinus tissue from patients with rhinitis or sinusitis; • Bram and Spinal cord from Multiple Sclerosis Alzheimer's Disease and Stroke.
• Kidney trom Nephπtis. Glomerulonephπtis and Systemic Lupus Ervthematosis.
• Liver from Infectious and non-infectious Hepatitis and acetaminophen-mduced liver ciπhosis,
• Tissues from Neoplasms/Cancer.
Expression is observed in one or more cell or tissue samples indicating localization of the therapeutic effect of the compounds of the mvention (and agonists or antagonists thereof) in the disease associated with the cell or tissue sample.
The sequences of the oligonucleotides used, where expression overlaps with the non-diseased tissue distribution reported earlier is recited in Example 6.
DNA30942:
IS98-02I: Expression was observed m mononuclear phagocytes m the normal chimp thymus, as well as in a gastric carcinoma (1/1) colorectal cancer (1/1), breast cancer (2/5) and a lung cancer (1/4). Expressed by malignant cells in an osteosarcoma and a poorly differentiated liposarcoma. Possible signal in the malignant cells of a testicular teratoma and breast cancers (1/5). In one of the lung cancers scattered signal is seen over a high endothelial venule within pulmonary lymphoid tissue The fetal tissues exammed (E12-E16 weeks) included placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, esophagus, stomach, small mtestme, spleen, thymus, pancreas, brain, eye, spinal cord, body wall, pelvis and lower limb.
The adult human tissues examined included liver, kidney, adrenal, myocardium, aorta, spleen, lung, skm, chondrosarcoma, eye, stomach, gastπc carcmoma. colon, colonic carcinoma, renal cell carcinoma, prostate, bladder mucosa and gall bladder Also examined was tissue deπved from acetaminophen induced liver injury and hepatic cπhosis The rhesus tissues exammed include cerebral cortex (rm), hιppocampus(rm) The chimp tissues examined included thyroid, parathyroid, ovary, nerve, tongue, thymus. adrenal, gastnc mucosa and salivary gland IS98-08S Expression was observed in eight adenocarcinomas and seven squamous lung carcmomas Actins were strongly positive in all tumors, indicating that all are suitable for in situ hybndization analysis
Expression of DNA30942 was observed in 6 of the tumors as follows
6727-95 / squamous carcinoma - Strongly expressed over neoplastic epithelium,
9558-95 / squamous carcmoma - Expression over neoplastic epithelium, 12235-95 / adenocarcinoma - Expression over in situ and infiltrating tumor cells
6545-95 &. 4187-96 / squamous carcinomas - Expression over cells in tumor stroma. no expression seen over tumor cells.
12954-94 / squamous carcinoma - possible weak expression over stromal cells
IS99-U2
The in situ expression of DNA30942 (SEQ ID NO 13) was evaluated numerous chronic inflammatory conditions and lymphoid organs In summary, DNA30942 (SEQ ID NO 13) was strongly expressed m high endothelial venules (HEV) in the tonsil, hilar lymph node, bronchial mucosal-assocated lymphoid tissue (BALT) in chronic asthma, patchy expression in colonic mucosa and weak inconsistent expression in gut- mucosal associated lymphoid tissues (GALT) HEV
In lvmphoid tissues, there was observed strong specific expression in single sections of tonsil, hilar lymph node, bronchial mucosal-assocated lymphoid tissue BALT) in a case of chronic asthma, and m gut mucosal associated lymphoid tissues in sections of IBD (GALT/MALT) In each of these lymphoid organs expression specifically was present in high-endothehal venules (HEV) In tissue in a chronic asthmatic lung, additionally to expression in BALT HEVs, specific expression was observed in small capillanes lined with high or reactive swollen endothelial cells in the submucosa of inflamed bronchi This region was not intimately associated with BALT but was specific to the submucosal site for inflammatory cell trafficking to the bronchi There was a significant submucosal infiltrate of eosinophils in these areas In other sections of diseased lung (COPD and chronic interstitial pneumonia) there was not any expression of DNA30942 (SEQ ID NO 13), these sections had some artifact (loss of tissue from slide).
In psoπatic tissue, there was weak expression m some small dermal capillanes m psoπatic plaques In tonsilar tissue, additional to expression in HEVs associated with follicles, there was also strong expression withm the reticulated tonsillar crypt epithelium. Expression here was also in vessels m the small intra-epithelial capillanes present Expression was also withm some of the epithelial cells This is an important immunological site and is involved with antigen presentation and may play a role m tolerance mduction.
In tissue isolated from patients suffeπng from Crohns' Disease and ulcerative colitis, colonal expression was present m the mucosa with patchy distπbution in some but not m all cases. Expression in HEV in GALT was present as a significantly weaker signal than seen in other lymphoid tissues and was not consistently present even m sections where there was strong but patchy expression in the mucosa
In tissue isolated from acetaminophen induced liver injury and ciπhosis, there was weak expression m small capillanes within areas in the portal tracts with chronic lymphocytic inflammation.
DN A33460 (IS98-0I5)
The expression of DNA33460 (SEQ ID NO 20) was observed over cells in loose connective tissue immediately adjacent to developing extra ocular muscle in the fetal eye Moderate expression over soft-tissue sarcoma The fetal tissues examined (E12-E16 weeks) included- placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, esophagus, stomach, small intestine, spleen, thymus, pancreas. bram. eye. spinal cord, bodv wall, pelvis and lower limb The adult tissues examined included the liver, kidnev. renal cell carcmoma. adrenal, aorta, spleen, lymph node, pancreas, lung, myocardium, skin, cerebral cortex (rm), hippocampus (rm). cerebellum (rm), bladder, prostate, stomach, gastnc carcinoma, colon, colonic carcmoma. thyroid (chimp), parathyroid (chimp) ovary (chimp) and chondrosarcoma Also examined was tissue extracted from acetam ophen induced liver injury and hepatic cirrhosis The probes used in this procedure were the following
DNA33460-pl (SEQ ID NO 204)
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CAG CAC TGC CGG GAT GTC AAC-3' DNA33460-p2 (SEQ ID NO 205) 5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA GTT TGG GCC TCG GAG CAC TG-3'
DNA343 7 (IS98-083)
Expression observed in lung cancer tumors and was positive m all eight squamous carcmomas and in 6/8 adenocarcinomas Expression levels are low to moderate in the adenocarcmomas and very strong the squamous carcinomas No expression was seen in the tumor stroma, alveoli or normal respiratory epithelium. Possible low level expression m the lymph nodes.
Expression was observed in lung cancer The gene was amplified in Taqman analysis of a lung tumor panel. Expression was observed in eight squamous carcmomas and in 6/8 adenocarcmomas. Expression was seen in in situ and mfiltratmg components. Expression levels were low to moderate in the adenocarcinomas. In general expression was higher m the squamous carcinomas and in two the expression was strong. Possible low level expression m lymph nodes.
DNA35638: IS98-I24:
This study exammed the expression of DNA35638 (SEQ ID N0.35) n mflamed human tissues (psoπasis, IBD, inflamed kidney, inflamed lung, hepatitis (liver block), normal tonsil, adult and chimp multiblocks) DNA35638 (SEQ ID NO 35) has been shown elsewhere m this application to have lmmunostimulatory (enhances T lymphocyte proliferation in the MLR and costimulation) and proinflammatory properties (mduces a neutrophil infiltrate in vivo)
This study evaluated the differential expression of this molecule in vessels of mflamed human tissues as compared to non-mflamed tissues In summary, expression was present m the endothelium intima of large vessels m the lung afflicted with chronic inflammation, m the superficial dermal vessels of the psoπatic skin, in artenoles in a specimen of chronic sclerosmg nephπtis, and in capillanes including the peπfollucular smuses of tonsil DNA35638 (SEQ ID NO 35) was not expressed (as detectable by this methodology) m normal skm (human foreskin specimens), normal lung, mflamed (8 IBD specimens) or normal large bowel, chronically inflamed or cπhotic liver, normal adult cardiac tissue, or adrenal gland
DNA39523
198-052
DNA39523 (SEQ ID NO 45) in normal human sk (neonatal foreskin) and adult psoπatic skin both exhibited specific strong expression in the epithelial cells of the stramm basale - the single laver along the basement membrane w hich is the progenitor for all of the overlying epidermal cells in the skin
There was no expression in epidermal cells in the overlying layers (stratum spinosum. straum granulosum. etc ) The intensify of the signal was shghtlv increased in psoπatic skin Expression was also apparent in the dermis (the connective tissue immediately underlying the epidermis) of both normal and psoπatic skin Expression here was most apparent in spindle shape cells withm the collagen matπx - the stromal fibroblasts
In inflamed and normal bowel Normal human large bowel and bowel with either Crohns's disease or ulcerative colitis had specific moderate to strong expression in a multifocal pattern within the lamma propπa of villi The cells labeled by in situ were spmdloid stromal cells best delineated as fibroblasts There was no expression by intestinal epithelial cells and there was no apparent increased expression (intensity or frequency) in diseased bowel Specifically there was also no coπelation ot expression and lesions in the inflamed bowel
The expression of DNA39523 (SEQ ID NO 45) in the skin and specific localization to the basal epithelial cells of the epidermis cells suggests a potential role in differentiation/maintenance of the basal epidermal cells This expression pattern in combmation with the fact that expression occurs m cells that are directly adjacent to the basement lamma, suggests that the cells regulate trafficking of leukocytes into the epidermis As a result DNA39523 (SEQ ID NO 45) may be a constitutively expressed signal for the trafficking of dendntic/Langerhan cells or lymphocytes into the epidermis Such trafficking is a normal physiologic event that occurs m normal skin and is thought to be mvolved in lmmunosurveillance of the skm. The expression of DNA39523 (SEQ ID NO 45) m inflammatory bowel disease was not mcreased from normal tissue, and there was no coπelation of its expression to inflammatory lesions Similarly, its expression in the basal epidermal cells in psoπatic skm lesions was equivalent to or only slightly greater than that seen m normal neonatal skm (but age-matched control adult skm was not available at the tune of the study) DNA45416 (IS98-140).
The expression of DNA45416 (SEQ ID NO.79) was evaluated in a variety of human and non-human pnmate tissues and was found to be highly specific. Expression was present only in alveolar macrophages in the lung and in Kupffer cells of the hepatic sinusoids. Expression in these cells was significantly increased when these distinct cell populations were activated. Though these two subpopulations of tissue macrophages are located m different organs, they have similar biological functions. Both types of these phagocytes act as biological filters to remove mateπal from the blood stream or airways including pathogens, senescent cells and protems and both are capable of secreting a wide vanety of important proinflammatory cytokines.
In inflamed lung (7 patient samples) expression was prominent m reactive alveolar macrophage cell populations defined as large, pale often vacuolated cells present singly or in aggregates withm alveoli and was weak to negative in normal, non-reactive macrophages (single scattered cells of normal size). Expression m alveolar macrophages was increased duπng inflammation when these cells were both mcreased in numbers and size (activated). Despite the presence of histocytes m areas of interstitial inflammation and peπbronchml lymphoid hyperplasia m these tissues, expression was restπcted to alveolar macrophages. Many of the inflamed lungs also had some degree of suppurative inflammation, expression was not present m neutrophilic granuiocytes.
In liver, there was strong expression in reactive/activated Kupffer cells in livers with acute centnlobular necrosis (acetaminophen toxicity) or fairly marked peπportal inflammation However there was weak or no expression m Kupffer cells in normal liver or in liver with only mild inflammation or mild to moderate lobular hyperplasia/hypertrophy Thus, as in the lung, there was increased expression in acivated reactive cells.
There was no expression of this molecule in histiocytes/macrophages present in inflamed bowel, hyperplastic/reactive tonsil or normal lymph node. The lack of expression in these tissues which all contained histiocytic inflammation or resident macrophage populations strongly supports restπcted expression to the unique macrophage subset populations defined as alveolar macrophage and hepatic Kupffer cells However. the expression of DNA454216 (SEQ ID NO 79) spleen or bone maπow was not available for evaluation
Human tissues evaluated which had no detectable expression included: Inflammatory Bowel disease (7 patient samples with moderate to severe disease), tonsil with reactive hyperplasia, penpheral lymph node, psoπatic skin (2 patient samples with mild to moderate disease), heart, penpheral nerve. Chimp tissues evaluated which had no detectable expression included: tongue, stomach, thymus.
The probes used for the above smdies were the following: 628.pl (SEQ ID N0.212):
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CTC CAA GCC CAC AGT GAC AA-3' 628.p2(SEQIDNO:213): 5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA CCT CCA CATTTC CTG CCA GTA-3'
DNA41374: IS-98-077:
DNA41374 (SEQ ID N0:248) was expressed m thymic T lymphocytes Summary: In numerous tissues evaluated there expression was only detected as weak diffuse expression in thymic T lymphocytes. The limited distribution pattern suggests expression by T lymphocytes or ceils closely associated with T lymphocytes such as antigen presenting cells (dendntic cell populations, etc). In mflamed human tissue with significant lymphocytic inflammation and presence of reactive follicle formation (inflammatory bowel disease and chronic lymphocytic interstitial pneumonia/bronchitis) there was no detectable expression in areas which contained significant numbers of T lymphocytes. The tissues tested for which there was no detectable expression included: human normal tissues: placenta, lung, spleen, adrenal gland, skm. kidney, eye, liver; human diseased tissue: liver disease: chronic hepatitis, chronic cholangitis. acute centπlobular necrosis (acetammophen toxicity); Neoplasm (tumor multiblock): osteosarcoma. squamous cell carcinoma; human fetal tissues: brain, spinal cord, lung, heart, kidney, axial and limb musculoskeleton vessels, umbilical cord; non- human pπmate: tongue, thyroid gland, parathyroid gland, stomach, salivary gland.
IS98-125
DNA41374 (SEQ ID NO 248) has low level expression in non-human pπmate thymus and in human tonsil in T lymphocyte specific regions. The limited distπbution pattern suggests expression by T lymphocytes or cells closely associated with T lymphocytes such as antigen presenting cells (dendntic cell populations, etc). In mflamed tissue with significant lymphocytic inflammation and presence of reactive follicle formation (inflammatory bowel disease and chronic lymphocytic interstitial pneumonia/bronchitis) there was no detectable expression in areas which likely contain significant numbers of T lymphocytes.
Inflamed lung: (chronic lymphocytic and granulomatous pneumomtis): weak to negative signal in the interstitium compared to the control sense probe. There was weak expression in normal chimp thymus (human thymus not available) and in human tonsil. In the latter the expression was predominantly in T lymphocyte areas of this structure including the penfolhcular marginal zone and in the paracortex. There a no detectable expression in the following human tissues: inflammatory bowel disease (8 patient specimens ), chronically inflamed and normal lung (6 patient specimens), chronic sclerosmg nephπtis ( 1 ). chronically and acutelv inflamed and ciπhotic liver ( 10 specimen multiblock). normal and psonatic skin, penpheral lymph node (non-reactive). The probes used for the above procedures were the following: 41374.pl (C337-G). (SEQ ID NO.306)
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CTC CAC AGA ACC TCG CCA TCA-3' 41374.p2(C337-H): (SEQ ID NO:307)
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA TGG GGC AAG ACT CAC AAG CAG-3'
DNA53517: IS98-070.
DNA53517 (SEQ ID NO:255) expression in the normal adult muπne lung was patchy, with expression in a subset of mucosal epithelial ceil in the large airway (bronchi bronchioles). There is also expression within the rare discrete cells in the submucosal interstitium adjacent to the large airways. These cells, typically 1 -3 withm a positive focus, are adjacent to large vessels and mav represent smooth muscle cells, penpheral nerves or Schwann cells, or lymphatics.
In the munne adult lung with allergic inflammation (eosinophihc, lymphocytic vascuhtis,. bronchiohtis and pneumomtis), there was diffuse strong expression in all mucosal epithelial cells of all of the large airways (bronchi bronchioles) of the lung. There was also strong expression discrete cells that represent a subset of epithelial cells that lme the alveoli, these cells are type II pneumocytes There is also expression, as in normal lung, present within rare discrete cells in the submucosal interstitium adjacent to the large airways
In normal adult muπne small and large intestine, there is strong expression within multifocal few discrete smgle cells that are present in the submucosa, the tunica musculaπs and the mesentery The cells that express the signal are almost always associated with nerve, vein, artery tπads within these areas. These cells are spindle shaped and may be either a penpheral nerves. Schwann cells associated with such nerves or some type of support cell associated with vessel or lymphatics Interestingly, there is no expression withm identifiable mventeπc plexi that are present within the tunica musculaπs In mflamed large bowel ( from an IL 10R KO mouse) the pattern of expression is similar but expression level is significantly decreased
IS98-135
DNA53715 (SEQ ID NO 255, mouse FIZZ- 1 ) was used as a detection probe in die following human tissues gastπc carcinoma, inflamed lung (3 patients) (vessels, alveoli, large airways and mucous glands), aorta, heart, placenta and gall bladder
Expression of mouse DNA53715 (SEQ ID NO 255) was present in normal mouse lung in large airway epithelium and had marked increased expression m inflamed murine lung (airway epithelium, type II alveolar pneumocytes) It was also expressed in discrete cells in the submucosa of the large bowel along v ascular channels
DNA84210
The following probes were used in the in situ studies indicated below
84210 p KF-79619) (SEQ ID NO 310) 5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC GCG GTC GCA GGA CAT TCA GTA-3'
84210 p2 (F-79620). (SEQ ID NO 31 1 )
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA ACT CTT TGG GTT CCA GCA CAC-3'
DNA84210 (SEQ ID NO 285) is expressed in fetal kidney, pnmaπlv developing glomeruh and tubules of the cortical zone and also weakly m fetal lung and spinal cord. There is also expression in stromal cells adjacent to developing cartilage and bone In adult tissues, weak expression is seen in noπnal bronchial epithelium, m one (adenocarcinoma) of five lung tumors (2 squamous and 3 adenocarcinomas) and m a chondrosarcoma. There is possibly expression m the skm and its appendages, however, the section is folded and difficult to evaluate.
IS99-I02 Expression of DNA84210 (SEQ ID NO:285) in malignant melanoma, lung tumor, colon tumor, cell pellet, mouse tissues, fetal tissues.
Expression of DNA84210 (SEQ ID NO:285) is seen m several adult (neoplastic and non-neoplastic) and fetal tissues. As far as normal adult tissues are concerned. DNA84210 (SEQ ID NO:285) is seen in the epidermis of skm (mostly m basally located cells) and in skm appendages, such as hair follicles and sebaceous glands associated with them. Expression is also seen in bronchial epithelium and submucosal bronchial glands. In human fetal tissues, expression of DNA84210 (SEQ ID N0.285) is seen m skm and skm appendages, lung, renal cortex and pancreatic ducts. It is also seen m mesenchymal cells adjacent to developing bone and cartilage. There is no hybridization signal seen m mouse embryos Expression of DNA84210 (SEQ ID NO:285) is seen in one of six colorectal adenocarcinomas (weak), 2 of 3 lung adenocarcinomas (one shows strong, but very focal expression, one is very weakly positive), 0 of 3 lung squamous cell carcmomas and 1 of 1 chondrosarcomas (weak) Expression is also seen in 5 of 5 malignant melanomas, the intensity of expression ranges from very weak to strong. These sections also demonstrate expression of DNA84210 (SEQ ID NO:285) in normal epidermis and skin appendages. EXAMPLE S
Use ot the PRO polypeptides as a hybndization probe The following method describes use of a nucleotide sequence encoding the PRO polypeptides as a hybndization probe.
DNA comprising the coding sequence of full-length or mature PRO polypeptides is employed as a probe to screen for homologous DNAs (such as those encoding naturally-occurπng vaπants) in human tissue cDNA libraries or human tissue genomic libranes.
Hybndization and washing of filters containing either library DNAs is performed under the following high stringency conditions. Hybridization of radiolabeled PRO - denved probe (e.g, PRO200. PRO204.
PR0212. PR0216. PR0226. PRO240. PR0235. PR0245. PRO 172. PR0273. PR0272. PR0332. PR0526. PRO701. PR0361. PR0362. PR0363. PR0364. PR0356. PR0531 , PR0533. PRO1083. PR0865. PRO770.
PR0769. PR0788. PROl 1 14. PRO1007. PRO l 184. PRO1031. PR01346. PR01 155. PRO1250. PR01312.
PROl 192. PR01246. PR01283. PRO l 195. PR01343. PR01418, PR01387. PRO 1410. PR01917. PR01868.
PRO205. PR021. PR0269. PR0344. PR0333. PR0381. PRO720. PR0866, PRO840, PR0982. PR0836.
PROl 159. PR01358. PR01325. PR01338. PR01434. PR04333, PRO4302, PRO4430 or PR05727) to the filters is performed in a solution of 50% formamide. 5x SSC, 0.1% SDS. 0.1% sodium pyrophosphate. 50 mM sodium phosphate. pH 6.8. 2x Denhardt's solution, and 10% dextran sulfate at 42°C for 20 hours. Washing of the filters is performed m an aqueous solution of 0. lx SSC and 0.1% SDS at 42°C.
DNAs having a desired sequence identity with the DNA encoding full-length native sequence PRO polypeptide can then be identified using standard techniques known in the art.
EXAMPLE 9 Expression of the PRO polypeptide in E. coli This exatnple illustrates preparation of an unglycosylated form of the PRO polypeptides by recombinant expression m E. coli.
The DNA sequence encoding the PRO polypeptide is initially amplified using selected PCR primers. The pnmers should contam restπction enzyme sites which coπespond to the restπction enzyme sites on the selected expression vector. A vaπety of expression vectors may be employed. An example of a suitable vector is pBR322 (deπved from E. coli; see Bolivar et al. Gene, 2:95 (1977)) which contams genes for ampicillin and tetracycline resistance. The vector is digested with restπction enzyme and dephosphorylated. The PCR amplified sequences are then ligated into the vector. The vector will preferably include sequences which encode for an antibiotic resistance gene, a tip promoter, a polyhis leader (including the first six STII codons, polyhis sequence, and enterokinase cleavage site), the PRO polypeptide coding region, lambda transcriptional terminator, and an argU gene.
The ligation mixmre is then used to transform a selected E. coli strain using the methods descπbed in Sambrook et al . supra. Transformants are identified by their ability to grow on LB plates and antibiotic resistant colonies are then selected. Plasmid DNA can be isolated and confirmed by restπction analysis and DNA sequencing. Selected clones can be grown overnight in liquid culture medium such as LB broth supplemented with antibiotics The overnight culture mav subsequently be used to inoculate a larger scale culture The cells are then grow n to a desired optical density, during which the expression promoter is turned on.
After cultunng the cells for several more hours, the cells can be harvested by cenmfugation Tlie cell pellet obtained by the centrifugation can be solubilized using various agents known in the art. and the solubilized PRO polypeptide protein can then be purified using a metal chelating column under conditions that allow tight binding of the protein.
The PRO polypeptides may also be expressed in E. coli in a poly-His tagged form, using the following procedure Tlie DNA encoding a PRO polypeptide is initially amplified using selected PCR pnmers. Tlie pnmers contain restπction enzyme sites which correspond to the restnction enzyme sites on the selected expression vector, and other useful sequences providing for efficient and reliable translation initiation, rapid puπfication on a metal cheiation column, and proteolvtic removal with enterokinase. Tlie PCR-amplitied. poly-His tagged sequences are then ligated into an expression vector, which is used to transform an E coli host based on strain 52 (W31 10 tuhA(tonA) Ion galE rpoHts(htpRts) clpP(ladq). Transformants are first grown in LB containmg 50 mg/ml carbenicillin at 30'C with shaking until an O.D.600 of 3-5 is reached. Cultures are then diluted 50- 100 fold into CRAP media (prepared by mixing 3.57 g (NH4)2S0 , 0.71 g sodium cιtrate-2H20. 1.07 g KC1. 5.36 g Difco yeast extract, 5.36 g Sheffield hycase SF in 500 mL water, as well as 1 10 mM MPOS, pH 7.3. 0.55% (w/v) glucose and 7 mM MgS04) and grown for approximately 20-30 hours at 30'C with shaking. Samples are removed to verify expression by SDS-PAGE analysis, and the bulk culmre is centπfuged to pellet the cells. Cell pellets are frozen until purification and refolding. E. coli paste from 0.5 to 1 L fermentations (6- 10 g pellets) is resuspended in 10 volumes (w/v) in 7 M guanidine, 20 mM Tris, pH 8 buffer. Solid sodium sulfite and sodium tetrathionate is added to make final concentrations of 0.1 M and 0.02 M, respectively, and the solution is stiπed overnight at 4*C. This step results in a denatured protein with all cysteine residues blocked by sulfitolization. The solution is centrifuged at 40,000 rpm m a Beckman Ultracentifuge for 30 min. The supernatant is diluted with 3-5 volumes of metal chelate column buffer (6 M guanidine. 20 mM Tris. pH 7.4) and filtered through 0.22 micron filters to clarify. Depending on condition the claπfied extract is loaded onto a 5 ml Qiagen Ni-NTA metal chelate column equilibrated in the metal chelate column buffer. The column is washed with additional buffer containing 50 mM imidazole (Calbiochem. Utrol grade), pH 7.4 The protein is eluted with buffer contaming 250 mM imidazole. Fractions containing the desired protein was pooled and stored at 4'C. Protein concentration is estunated by its absorbance at 280 nm using the calculated extinction coefficient based on its ammo acid sequence.
The proteins are refolded by diluting sample slowly into freshly prepared refolding buffer consisting of: 20 mM Tris, pH 8.6. 0.3 M NaCl, 2.5 M urea, 5 mM cysteine. 20 mM glycine and 1 mM EDTA. Refolding volumes are chosen so that the final protem concentration is between 50 to 100 micrograms/ml. The refolding solution is stiπed gently at 4°C for 12-36 hours. The refolding reaction is quenched by the addition of TFA to a final concentration of 0.4% (pH of approximately 3). Before further puπfication of the protein, the solution is filtered through a 0.22 micron filter and acetonitπle is added to 2- 10% final concentration. Tlie refolded protem is chromatographed on a Poros Rl H reversed phase column using a mobile buffer of 0.1% TFA with elution with a gradient of acetonitnle from 10 to 80%. Aliquots of fractions with A280 absorbance are analyzed on SDS polyacrylamide gels and fractions containing homogeneous refolded protein are pooled. Generally, the properly refolded species of most proteins are eluted at the lowest concentrations of acetonitnle since those species are the most compact with their hydrophobic inteπors shielded from interaction with the reversed phase resin Aggregated species are usually eluted at higher acetonitnle concentrations In addition to resolving misfoldcd forms of proteins from the desired form, the reversed phase step also removes endotoxin from the samples.
Fractions containing the desired folded PRO polypeptide proteins are pooled and the acetonitnle removed using a gentle stream of nitrogen directed at the solution. Proteins are formulated into 20 mM Hepes, pH 6.8 with 0.14 M sodium chloride and 4% mannitol by dialysis or by gel filtration using G25 Superfine (Pharmacia I resins equilibrated in the formulation buffer and steπle filtered.
EXAMPLE 10 Expression of the PRO polypeptides in mammalian cells This example illustrates preparation of a potentially glycosylated form of the PRO polypeptide in recombinant expression in mammalian cells. The vector. pRK5 (see EP 307,247, published March 15, 1989), is employed as the expression vector.
Optionally, the PRO DNA is ligated into pRK5 with selected restπction enzymes to allow insertion of the respective PRO DNA usmg ligation methods such as descπbed in Sambrook et al, supra. The resulting vector is called, for example, pRK5-PRO.
In one embodiment, the selected host cells may be 293 cells. Human 293 cells (ATCC CCL 1573) are grown to confluence in tissue culmre plates m medium such as DMEM supplemented with fetal calf serum and optionally, nutπent components and/or antibiotics. About 10 μg of the pRK5-PRO DNA is mixed with about 1 μg DNA encoding the VARNA gene [Thimmappaya et al, Cell, 3__:543 (1982)] and dissolved in 500 uL of 1 mM Tris-HCl, 0.1 mM EDTA, 0.227 M CaCk To this mixture is added, dropwise, 500 μL of 50 mM HEPES (pH 7.35), 280 mM NaCl, 1.5 mM NaPO„, and a precipitate is allowed to form for 10 mmutes at 25°C. The precipitate is suspended and added to the 293 cells and allowed to settle for about four hours at 37°C. The culmre medium is aspirated off and 2 ml of 20% glycerol in PBS is added for 30 seconds. Tlie 293 cells are then washed with serum free medium, fresh medium is added and the cells are incubated for about 5 days.
Approximately 24 hours after the transfections, the culture medium is removed and replaced with culture medium (alone) or culmre medium contammg 200 uCi/ml ,5S-cysteιne and 200 uCi/ml '5S-methιonιne. 5 After a 12 hour mcubation. the conditioned medium is collected, concentrated on a spin filter, and loaded onto a 15% SDS gel. The processed gel may be dned and exposed to film for a selected penod of time to reveal the presence of the polypeptide of the invention polypeptide. The cultures contaming transfected cells may undergo further mcubation (m serum free medium) and the medium is tested in selected bioassays.
In an alternative technique, pRK5-PRO may be mtroduced into 293 cells transiently using the dextran
10 sulfate method descπbed by Somparyrac et al . Proc. Natl. Acad. Sci.. 12.7575 ( 1981 ). 293 cells are grown to maximal density in a spinner flask and 700 μg pRK5-PRO is added. The cells are first concentrated from the spinner flask by centπfugation and washed with PBS. The DNA-dextran precipitate is incubated on the cell pellet for four hours. The cells are treated with 20% glycerol for 90 seconds, washed with tissue culmre medium, and re-introduced into the spinner flask containing tissue culmre medium. 5 μg/ml bovine insulin and
1 5 0 1 ug'ml bovine transtemn After about tour days, the conditioned media is centnfu ed and filtered to remove cells and debπs Tlie sample containing the expressed polypeptide of the invention can then be concentrated and punfied by any selected method, such as dialysis and'or column chromatography
In another embodiment, the polypeptides of the invention can be expressed in CHO cells The pRK5- PRO can be transfected into CHO cells using known reagents such as CaP04 or DEAE-dextran. As descπbed 0 above, the cell cultures can be incubated, and the medium replaced with culmre medium (alone) or medium containing a radiolabel such as 1sS-methιonιne. After determining the presence of a polypeptide of the invention polypeptide. the culmre medium may be replaced with serum free medium. Preferably, the cultures are incubated for about 6 days, and then the conditioned medium is harvested. The medium containing the expressed polypeptide of the invention can then be concentrated and purified by any selected method 5 Epitope-tagged polypeptide of the invention may also be expressed in host CHO cells The DNA encoding the desired polypeptide of the invention may be subcioned out of the pRK5 v ector Tlie subclone insert can undergo PCR to fuse in frame w ith a selected epitope tag such as a poly-his tag into a Baculov irus expression vector. Tlie poly-his tagged polypeptide of the mvention insert can then be subcioned into a SV40 dπven vector containing a selection marker such as DHFR for selection of stable clones. Finally, the CHO 0 cells can be transfected (as described above) with the SV40 driven vector. Labeling may be performed, as descπbed above, to veπfy expression. Tlie culmre medium contammg the expressed poly-His tagged polypeptide of the invention can then be concentrated and punfied by any selected method, such as by Nι2+- chelate affinity chromatography. EXAMPLE 1 1 Expression of PRO in Yeast
The following method descπbes recombinant expression of PRO in yeast.
First, yeast expression vectors are constructed for mtracellular production or secretion of the PRO polypeptide from the ADH2/GAPDH promoter. DNA encoding a polypeptide of the invention and the promoter is inserted into suitable restπction enzyme sites the selected plasmid to direct mtracellular expression of the PRO. For secretion. DNA encoding the PRO can be cloned into the selected plasmid, together with DNA encoding the ADH2/GAPDH promoter, a native sequence PRO signal peptide or other mammalian signal peptide. or. for example, a yeast alpha-factor or mvertase secretory signal/leader sequence, and linker sequences (if needed) for expression of the polypeptide of the invention.
Yeast cells, such as yeast strain AB 1 10. can then be transformed with the expression plasmids descπbed above and cultured in selected fermentation media. Tlie transformed veast supematants can be analyzed by precipitation with 10% tnchloroacetic acid and separation by SDS-PAGE, followed by staining of the gels with Coomassie Blue stain. Recombinant PRO can subsequently be isolated and punfied by removing the yeast cells from the fermentation medium bv centrifugation and then concentrating the medium using selected cartridge filters. The concentrate containing the polypeptide of the invention may further be punfied using selected column chromatography resins
EXAMPLE 12
Expression ot PRO in Baculovirus-lnfected Insect Cells The following method descπbes recombinant expression of PRO in Baculovirus-infccted insect cells. The sequence coding for PRO is fused upstream of an epitope tag contained within a baculovirus expression vector. Such epitope tags include poly-his tags and immunoglobulin tags (like Fc regions of IgG). A vaπery of plasmids may be employed, including plasmids deπved from commercially available plasmids such as pVL1393 (Novagen) Briefly, the sequence encoding a polypeptide of the invention or the desired portion of the coding sequence ot the DNA encodmg a PRO polypeptide [such as the sequence encoding the extracellular domain of a transmembrane protein or the sequence encoding the mature protem if the protem is extracellular] is amplified by PCR with pnmers complementary to the 5' and 3' regions. The 5' pnmer may incorporate flanking (selected) restπction enzyme sites. The product is then digested with those selected restπction enzymes and subcioned mto the expression vector.
Recombinant baculovirus is generated by co-transfecting the above plasmid and BaculoGold™ virus DNA (Pharmingen) into Spodoptera frugiperda ("Sf9") cells (ATCC CRL 171 1) using pofectin (commercially available from GIBCO-BRL). After 4 - 5 days of mcubation at 28°C, the released viruses are harvested and used for further amplifications. Viral mfection and protem expression are performed as described by O'Reilley et al, Baculovirus expression vectors: A Laboratory Manual. Oxford: Oxford University Press ( 1994).
Expressed poly-his tagged polypeptide of the invention can then be punfied, for example, by Ni2+- chelate affinity chromatography as follows. Extracts are prepared from recombinant virus-infected Sf9 cells as described by Rupert et al, Nature, 362: 175-179 (1993). Bπefly, Sf9 cells are washed, resuspended in somcation buffer (25 mL Hepes. pH 7 9 12 5 mM MgCL, 0 1 mM EDT \, 10% glycerol. 0 1% NP-40 0 4 M KC1), and sonicated twice for 20 seconds on ice The sonicates are cleared by centπfugation. and the supernatant is diluted 50-fold in loading buffer (50 mM phosphate, 300 mM NaCl. 10% glycerol. pH 7 8) and filtered through a 0 45 urn filter A Nι2+-NTA agarose column (commercially available from Qiagen) is prepared with a bed volume ot 5 mL, washed with 25 mL of water and equilibrated with 25 mL of loadmg buffer The filtered cell extract is loaded onto the column at 0 5 mL per mmute The column is washed to baseline A280 with loading buffer, at which point fraction collection is started Next, the column is washed with a secondary wash buffer (50 mM phosphate. 300 mM NaCl. 10% glycerol. pH 6 0) which elutes nonspecificallv bound protein After reaching A28o baseline agam, the column is developed with a 0 to 500 mM Imidazole gradient in the secondary wash buffer One mL fractions are collected and analyzed bv SDS- PAGE and silver staining or Western blot with Nι2*-NTA-conjugated to alkaline phosphatase (Qiagen) Fractions containing the eluted Hιs,0-tagged- polypeptide of the invention are pooled and dmlvzed against loading buffer
Alternativ elv puπfication of the IgG tagged (or Fc tagged) PRO polypeptide can be performed using known chromatography techniques including tor instance Protein A or protein G column chromatography
EXAMPLE 13 Preparation oi Antibodies that Bind PRO This example illustrates preparation ot monoclonal antibodies which can specifically bind the polypeptides of the invention
Techniques for producing the monoclonal antibodies are known in the art and are descπbed. for instance in Goding, s pi a Immunogens that mav be employed include the punfied polypeptide of the invention itself fusion proteins containing the respectiv e polypeptide of the invention, and cells expressing recombinant polypeptide of the invention on the cell surface Selection of the immunogen can be made bv the skilled artisan without undue experimentation
Mice such as Balb/c are immunized with the polypeptide ot die inv ention immunogen emulsified in complete i reund s and injected subcutaneously or intrapeπtoneallv in an amount from 1 - 100 micrograms Alternativelv the immunogen is emulsified in MPL-TDM adjuvant (Ribi Immunochemical Research Hamilton MT) and injected into the animal's hind foot pads The immunized mice are then boosted 10 to 12 days later with additional immunogen emulsified in the selected adjuvant Thereafter, for several weeks, the mice may also be boosted w ith additional immunization injections Serum samples mav be peπodicallv obtained from the mice by retro-orbital bleeding for testing m ELISA assays to detect antibodies specific to the respective polypeptide of the invention
After a suitable antibody titer has been detected, the animals "positive" for antibodies can be injected with a final intravenous injection of the respective polypeptide of the invention Three to four days later, the mice are sacnficed and the spleen cells are harvested The spleen cells are then fused (using 35% polyethylene glycol) to a selected muπne myeloma cell Ime such as P3X63AgU.l, available from ATCC, No. CRL 1597 The fusions generate hybπdoma cells which can then be plated m 96 well tissue culmre plates contammg HAT (hypoxanthine, aminopteπn, and thymidine) medium to inhibit proliferation of non-fused cells, myeloma hybπds, and spleen cell hybπds The hybndoma cells are screened in an ELISA for reactivity against the respective polypeptide of the invention Determination of "positive" hybndoma cells secretmg the desired monoclonal antibodies against the polypeptides of the mvention is withm the skill m the art.
The positive hybndoma cells can be injected intrapeπtoneally into syngeneic Balb/c mice to produce ascites containing the antι-PRO200, antι-PRO204, antι-PR0212, antι-PR0216, antι-PR0226. antι-PRO240, antι-PR0235. antι-PR0245, anti-PRO 172, antι-PR0273. antι-PR0272. antι-PR0332, antι-PR0526, anti- PRO701. antι-PR0361, antι-PR0362. antι-PR0363. antι-PR0364, antι-PR0356, antι-PR0531, antι-PR0533, antι-PRO 1083. antι-PR0865, antι-PRO770, antι-PR0769, antι-PR0788. anti-PROl 1 14. antι-PRO1007, anti- PROl 184, antι-PRO1031, antι-PR01346, anti-PRO l 155, antι-PRO 1250, antι-PR01312, anti-PRO l 192, anti- PR01246, antι-PR01283, anti-PRO l 195, antι-PR01343, antι-PR01418, antι-PR01387. antι-PRO 1410, anti- PR01917, antι-PR01868. antι-PRO205, antι-PR021. antι-PR0269, antι-PR0344. antι-PR0333, antι-PR0381 , antι-PRO720, antι-PR0866. antι-PRO840. antι-PR0982, antι-PR0836, anti-PRO l 159, antι-PRO!358, anti- PR01325, antι-PR01338, antι-PR01434, antι-PR04333, antι-PRO4302, antι-PRO4430 or antι-PR05727 monoclonal antibodies Alternatively, the hybndoma cells can be grown in tissue culmre flasks or roller bottles Puπfication of the monoclonal antibodies produced in the ascites can be accomplished using ammonium sulfate precipitation followed by gel exclusion chromatography Alternativ ely affinity chromatography based upon binding of antibody to protein A or protein G can be employed
Deposit of Mateπal The following matenals have been deposited with the Anieπcan Type Culmre Collection. 10801
University Blv d . Manassas. VA 201 10-2209, USA (ATCC)
Mateπal UNQ PRO ATCC# ATCC Deposit Date DNA29101 - 1276 174 200 209653 March 5, 1998 DNA30871 - 1 157 178 204 209380 October 16, 1997 DNA30942- 1 134 186 212 209254 September 16. 1997 DNA33087 1 158 190 216 209381 October 16, 1997 DNA33460- 1 166 200 226 209376 October 16, 1997 DNA34387-1 133 214 240 209260 September 16, 1997 DNA35558-1 167 209 235 209374 October 16, 1997 DNA35638-1 141 219 245 209265 September 16, 1997 DNA35916-1 161 146 172 209419 October 28, 1997 DNA39523-1 192 240 273 209424 October 31, 1997 DNA40620-1 183 239 272 209388 October 17, 1997 DNA40982-1235 293 332 209433 November 17, 1997 DNA44184-1319 330 526 209704 March 26, 1998 DNA44205-1285 365 701 209720 March 31, 1998 DNA45410-1250 316 361 209621 February 5, 1998 DNA45416-1251 317 362 209620 February 5, 1998 DNA45419-1252 318 363 209616 February 5, 1998 DNA47365-1206 319 364 209436 November 7, 1997
DNA47470-1 130 313 356 209422 October 28, 1997
DNA48314-1320 332 531 209702 March 26, 1998
DNA49435-1219 334 533 209480 November 21 , 1997
DNA50921-1458 540 1083 209859 May 12, 1998
DNA53974- 1401 434 865 209774 April 14, 1998
DNA54228- 1366 408 770 209801 April 23. 1998
DNA54231-1366 407 769 209802 April 23. 1998
DNA56405-1357 430 788 209849 May 6, 1998
DNA57033-1403 557 1 1 14 209905 May 27, 1998
DNA57690-1374 491 1007 209950 June 9, 1998
DNA59220- 1514 598 1 184 209962 June 9, 1998
DNA59294-1381 516 1031 209866 May 14, 1998
DNA59776- 1600 701 1346 203128 August 18, 1998
DNA59849- 1504 585 1 155 209986 June 16. 1998
DNA60775- 1532 633 1250 203173 September 1. 1998
DNA61873- 1574 678 1312 203132 August 18. 1998
DNA62814- 1521 606 1 192 203093 August 4. 1998
DNA64885- 1529 630 1246 203457 November 3, 1998
DNA65404-1551 653 1283 203244 September 9, 1998
DNA65412- 1523 608 1 195 203094 August 4. 1998
DNA66675-1587 698 1343 203282 September 22, 1998
DNA68864- 1629 732 1418 203276 September 22, 1998
DNA68872- 1620 722 1387 203160 August 25. 1998
DNA68874- 1622 728 1410 203277 September 22. 1998
DNA76400-2528 900 1917 203573 January 12. 1999
DNA77624-2515 859 1868 203553 December 22. 1998
DNA30868- 1 156 179 205 March 2, 2000
DNA36638-1056 21 21 209456 November 12, 1997
DNA38260- 1 180 236 269 209397 October 17, 1997
DNA40592-1242 303 344 209492 November 21, 1997
DNA41374-1312 294 333
DNA44194-1317 322 381 209808 April 28. 1998
DNA53517-1366 388 720 209802 April 23. 1998
DNA53971-1359 435 866 209750 April 7, 1998
DNA53987-1438 433 840 209858 May 12, 1998
DNA57700-1408 483 982 203583 January 12, 1999
DNA59620-1463 545 836 209989 June 16, 1998
DNA60627-1508 589 1 159 203092 August 4, 1998
DNA64890-1612 707 1358 203131 August 18, 1998 DNA66659- 1593 685 1325 203269 September 22. 1998 DNA66667- 1596 693 1338 203267 September 22, 1998 DNA68818-2536 739 1434 203657 February 9, 1999 DNA84210-2576 1888 4333 203818 March 2, 1999 DNA92218-2554 1866 4302 203834 March 9, 1999 DNA96878-2626 1947 4430 23-PTA May 5, 1999 DNA98853- 1739 2448 5727 203906 April 6, 1999
These deposits was made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure and the Regulations thereunder (Budapest Treaty). This assures maintenance of a viable culmre of the deposit for 30 years from the date of deposit. The deposit will be made available by ATCC under the terms of the Budapest Treaty, and subject to an agreement between Genentech, Inc. and ATCC, which assures permanent and unrestπcted availability of the progeny of the culmre of the deposit to the public upon issuance of the pertinent U.S. patent or upon laying open to the public of anv U.S or foreign patent application, whichever comes first, and assures availability of the progeny to one determined by the U.S. Commissioner of Patents and Trademarks to be entitled thereto according to 35 USC 122 and the Commissioner's rules pursuant thereto (including 37 CFR 1.14 with particular reference to 886 OG 638).
The assignee of the present application has agreed that if a culmre of the matenals on deposit should die or be lost or destroyed when cultivated under suitable conditions, the matenals will be promptly replaced on notification with another of the same. Av ailability of the deposited mateπal is not to be construed as a license to practice the invention in contravention of the rights granted under the authonfy of any government in accordance with its patent laws
The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. The present invention is not to be limited in scope by the construct deposited, since the deposited embodiment is intended as a single illustration of certain aspects of the invention and any constructs that are functionally equivalent are within the scope ot this invention. Tlie deposit of material herein does not constitute an admission that the written description herein contained is inadequate to enable the practice of any aspect of the invention, including the best mode thereof, nor is it to be construed as limiting the scope of the claims to the specific illustrations that it represents. Indeed, vaπous modifications of the invention in addition to those shown and descπbed herem will become apparent to those skilled in the art from the foregoing descπption and fall withm the scope of the appended claims.

Claims

What is claimed:
1. A composition useful for the treatment of immune related diseases, compπsing a PRO200,
PRO204. PR0212, PR0216, PR0226, PRO240. PR0235, PR0245, PR0172, PR0273, PR0272, PR0332, PR0526, PRO701, PR0361, PR0362, PR0363. PR0364. PR0356, PR0531, PR0533, PRO1083. PR0865, PRO770, PR0769. PR0788, PROl 1 14, PRO1007, PROl 184, PRO1031, PR01346, PROl 155, PRO1250. PR01312, PROl 192, PR01246, PR01283. PROl 195. PR01343, PR01418. PR01387, PROI410, PR01917, PR01868. PRO205. PR021. PR0269, PR0344. PR0333. PR0381, PRO720, PRO866, PRO840, PR0982. PR0836, PROl 159, PR01358. PR01325, PR01338. PR01434, PR04333, PRO4302, PRO4430 or PR05727 polypeptide, agonist or fragment thereof and a earner or excipient. having the properties of: (a) increasing infiltration of inflammatory cells into a tissue of a mammal m need thereof,
(b) stimulating or enhancing an immune response m a mammal in need thereof, or
(c) increasing the proliferation of T-lymphocytes in a mammal in need thereof in response to an antigen
2 The composition of claim 1 compπsing an effective amount of a PRO200. PRO204.
PR0212. PR0216. PR0226. PRO240. PR0235. PR0245, PR0172. PR0273. PR0272. PR0332. PR0526.
PRO701. PR0361. PR0362. PR0363. PR0364. PR0356. PR0531. PR0533. PRO1083. PR0865. PRO770.
PR0769. PR0788. PROl 1 14, PRO 1007. PROl 184. PRO 1031. PR01346, PR01155. PRO1250. PR01312.
PROl 192. PR01246. PR01283. PROl 195, PR01343. PR01418, PR01387, PRO 1410, PR01917, PR01868, PRO205. PR021 , PR0269. PR0344. PR0333. PR0381. PRO720, PR0866, PRO840, PR0982. PR0836.
PROl 159. PR01358, PR01325, PR01338. PR01434, PR04333, PRO4302, PRO4430 or PR05727 polypeptide. agonist, antagonist or fragment thereof.
3. The composition of claim 2 further compπsing a growth inhibitory agent, cytotoxic agent or chemotherapeutic agent
4 Use ot a PRO200. PRO204. PR0212. PR0216. PR0226. PRO240. PR0235. PR0245.
PR0172. PR0273. PR0272. PR0332, PR0526. PRO701 , PR0361 , PR0362. PR0363, PR0364. PR0356. PR0531. PR0533, PRO1083. PR0865, PRO770. PR0769, PR0788. PROl 1 14, PRO1007. PROl 184. PRO1031. PR01346. PROl 155, PRO1250. PR01312. PROl 192, PR01246, PR01283. PROl 195. PR01343, PR01418, PR01387, PRO1410, PR01917, PR01868. PRO205, PR021, PR0269, PR0344, PR0333, PR0381 , PRO720, PR0866. PRO840. PR0982. PR0836, PROl 159, PR01358, PR01325. PR01338, PR01434, PR04333, PRO4302. PRO4430 or PR05727 polypeptide. agonist or a fragment thereof to prepare a composition having the properties of: (a) increasing infiltration of inflammatory cells into a tissue of a mammal m need thereof,
(b) stimulating or enhancing an immune response in a mammal m need thereof, or
(c) increasing the proliferation of T-lymphocytes in a mammal in need thereof in response to an antigen.
5. The use of claims 4 compπsmg an effective amount of a PRO200, PRO204, PR0212, PR0216, PR0226. PRO240, PR0235, PR0245, PR0172, PR0273, PR0272, PR0332. PR0526, PRO701, PR0361, PR0362, PR0363. PR0364, PR0356, PR0531, PR0533, PRO1083, PR0865, PRO770, PR0769, PR0788, PROl 1 14, PRO1007, PROH 84, PRO1031, PR01346, PROH55, PRO1250, PR01312, PROH92, PR01246. PR01283, PROl 195, PR01343, PR01418, PR01387, PRO1410, PR01917, PR01868, PRO205, PR021, PR0269, PR0344, PR0333, PR0381, PRO720, PR0866, PRO840, PR0982, PR0836, PROl 159, PR01358. PR01325, PR01338. PR01434, PR04333, PRO4302, PRO4430, PR05727 polypeptide. agonist, antagonist or fragment thereof
6 The composition of claim 2 further compπsing a growth inhibitory agent, cvtotoxic agent or chemotherapeutic agent
7 A method of treating an immune related disorder, such as a T cell mediated disorder, a mammal in need thereof, compπsing administeπng to the mammal an effective amount of a PRO200. PRO204, PR0212. PR0216, PR0226 PRO240, PR0235, PR0245, PR0172, PR0273, PR0272. PR0332 PR0526 PRO701 PR0361 PR0362 PR0363 PR0364 PR0356, PR0531 PR0533. PRO1083 PR0865 PRO770 PR0769 PR0788. PROl 1 14 PRO1007 PR01 184 PRO1031 , PR01346, PROl 155 PRO1250, PR01312, PROl 192 PR01246 PR01283, PROl 195 PR01343. PR01418, PR01387 PRO1410, PR01917 PR01868. PRO205 PR021. PR0269 PR0344 PR0333, PR0381 , PRO720. PR0866, PRO840, PR0982. PR0836, PROl 159 PR01358. PR01325, PR01338, PR01434, PR04333. PRO4302, PRO4430 or PR05727 polypeptide. an agonist antibody thereof, an antagonist antibody thereto, or a fragment thereof
8 The method of claim 7, wherein the disorder is selected from systemic lupus ervthematosis, rheumatoid arthntis. osteoarthπtis juvenile chronic arthntis, spondyloarthropathies systemic sclerosis, idiopathic inflammatory mvopathies Sjogren's syndrome, systemic vascuhtis, sarcoidosis. autoimmune hemolvtic anemia, autoimmune thrombocytopenia. thyroiditis. diabetes melhms. immune-mediated renal disease demvehnating diseases ot the central and penpheral nervous systems such as multiple sclerosis, idiopathic demvehnating polyneuropathy or Guillain-Baπe syndrome, and chronic inflammatory demyehnating polyneuropathy, hepatobilmry diseases such as mfectious, autoimmune chronic active hepatitis, pπmarv biliary cπhosis, granulomatous hepatitis, and sclerosmg cholangitis. inflammatory bowel disease. gluten-sensitive enteropathy. and Whipple's disease, autoimmune or immune-mediated skm diseases including bullous skm diseases, erythema multiforme and contact dermatitis, psoπasis, allergic diseases such as asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urticaπa, lmmunologic diseases of the lung such as eosmophilic pneumonias, idiopathic pulmonary fibrosis and hypersensitivity pneumomtis, transplantation associated diseases mcludmg graft rejection and graft -versus-host-disease.
9 The composition or use of any of the preceding claims, wherein the agonist or antagonist is a monoclonal antibody
10. The composition or use of any of the preceding claims, wherem the agonist or antagonist is an antibody fragment or a smgle-cham antibody
1 1. The composition or use of claims 9 or 10, wherem the antibody has nonhuman complementaπty determining region (CDR) residues and human framework region (FR) residues.
12. A method for determining the presence of a PRO200, PRO204, PR0212. PR0216, PR0226,
PRO240. PR0235, PR0245, PR0172, PR0273, PR0272, PR0332, PR0526. PRO701. PR0361 , PR0362, PR0363. PR0364, PR0356, PR0531 , PR0533, PRO 1083. PR0865. PRO770, PR0769, PR0788, PROl 1 14, PRO1007, PR01 184, PRO1031 , PR01346, PR01 155. PRO 1250, PR01312. PR0U92. PR01246, PR01283, PROl 195, PR01343, PR01418, PR01387, PRO1410, PR01917, PR01868. PRO205. PR021 , PR0269, PR0344. PR0333. PR0381 , PRO720, PRO866, PRO840, PR0982, PR0836, PROl 159, PR01358, PR01325, PR01338, PR01434, PR04333, PRO4302, PRO4430, PR05727 polypeptide. compπsing exposing a ceil suspected of contaming the polypeptide to an anti- PRO200, antι-PRO204, antι-PR0212, antι-PR0216, anti- PR0226. antι-PRO240, antι-PR0235, antι-PR0245, anti-PRO 172, antι-PR0273, antι-PR0272, antι-PR0332, antι-PR0526. antι-PRO701 , antι-PR0361 , antι-PR0362, antι-PR0363, antι-PR0364. antι-PR0356, anti- PR053 1 antι-PR0533. antι-PRO 1083. antι-PR0865. antι-PRO770. antι-PR0769, antι-PR0788. anti- PROl 1 14 antι-PRO 1007, anti-PRO l 184. antι-PRO1031. antι-PR01346 anti-PRO l 155. antι-PRO 1250. anti- PR013 12. anti-PROl 192. antι-PR01246. antι-PR01283. anti-PRO l 195. antι-PR01343. antι-PR01418. anti- PR01387. antι-PRO l410, antι-PR01917, antι-PR01868, antι-PRO205, antι-PR021 , antι-PR0269, anti- PR0344. antι-PR0333, antι-PR0381 , antι-PRO720, antι-PR0866, anti-PRO840, antι-PR0982. antι-PR0836, anti-PROl 159. antι-PR01358. antι-PR01325, antι-PR01338, antι-PR01434, antι-PR04333, antι-PRO4302, antι-PRO4430. antι-PR05727 antibody, respectively, and determining binding of the antibody to the cell
13 A method of diagnosing an immune related disease in a mammal, compπsing detecting the level of expression of a gene encodmg a PRO200, PRO204, PR0212, PR0216, PR0226. PRO240. PR0235, PR0245 PR0172. PR0273, PR0272. PR0332. PR0526. PRO701. PR0361. PR0362. PR0363. PR0364. PR0356. PR053 1 , PR0533. PRO 1083. PR0865. PRO770. PR0769. PR0788. PRO l 1 14 PRO 1007. PR01 184. PRO 1031. PRO 1346. PRO l 155. PRO 1250 PR01312. PRO l 192. PR01246. PR01283. PRO l 195, PR01343, PR01418, PR01387, PRO1410, PR01917. PR01868, PRO205, PR021, PR0269, PR0344, PR0333. PR0381 , PRO720. PRO866. PRO840. PR0982, PR0836. PROl 159, PR01358. PR01325, PR01338. PR01434, PR04333, PRO4302, PRO4430 or PR05727 polypeptide (a) in a test sample of tissue cells obtained from the mammal, and (b) in a control sample of known normal tissue cells of the same cell type, wherem a higher or lower expression level m the test sample as compared to the control mdicates the presence of immune related disease in the mammal from which the test tissue cells were obtained.
14. A method of diagnosing an immune related disease in a mammal, compπsing (a) contactmg an antι-PRO200. antι-PRO204, antι-PR0212, antι-PR0216. antι-PR0226, antι-PRO240. antι-PR0235, anti- PR0245, antι-PR0172, antι-PR0273, antι-PR0272, antι-PR0332, antι-PR0526, antι-PRO701, antι-PR0361, anti-PR0362, antι-PR0363, antι-PR0364, antι-PR0356, antι-PR0531, antι-PR0533, antι-PRO1083, anti- PR0865, antι-PRO770, antι-PR0769, antι-PR0788, anti-PROl 1 14, antι-PRO1007, anti-PROl 184, anti- PRO1031, antι-PR01346, anti-PROl 155, antι-PRO1250, antι-PR01312, antι-PR01192, antι-PR01246, anti- PR01283. anti-PRO l 195, antι-PR01343. antι-PR01418, antι-PR01387. antι-PRO1410, antι-PR01917, anti- PROI868, antι-PRO205, antι-PR021 , antι-PR0269. antι-PR0344, antι-PR0333, antι-PR0381. antι-PRO720, antι-PR0866, antι-PRO840. antι-PR0982. antι-PR0836. anti-PROl 159, antι-PR01358, antι-PR01325, anti- PR01338, antι-PR01434. antι-PR04333, antι-PRO4302. antι-PRO4430 or antι-PR05727 antibody with a test sample of tissue cells obtained from the mammal, and (b) detecting the formation of a complex between the antibody and the polypeptide in the test sample.
15. An immune related disease diagnostic kit. compπsing an antι-PRO200, antι-PRO204, anti-
PR0212. antι-PR0216. antι-PR0226. antι-PRO240. antι-PR0235. antι-PR0245, antι-PR0172, antι-PR0273. antι-PR0272, antι-PR0332. antι-PR0526, antι-PRO701 , antι-PR0361. antι-PR0362, antι-PR0363, anti- PR0364, antι-PR0356. antι-PR0531 , antι-PR0533. antι-PRO1083. antι-PR0865, antι-PRO770, antι-PR0769, antι-PR0788, anti-PROl 1 14, antι-PRO 1007, anti-PROl 184. antι-PRO1031. antι-PR01346. antι-PR01 155, antι-PRO1250, antι-PR01312, anti-PROl 192, antι-PR01246, antι-PR01283, anti-PROl 195, antι-PR01343, antι-PR01418. antι-PR01387. antι-PRO 1410. antι-PR01917, antι-PR01868, antι-PRO205. antι-PR021 , anti- PR0269. antι-PR0344. antι-PR0333. antι-PR0381. antι-PRO720. antι-PR0866. antι-PRO840. antι-PR0982. antι-PR0836. anti-PROl 159. antι-PR01358. antι-PR01325. antι-PR01338. antι-PR01434. antι-PR04333. antι-PRO4302. antι-PRO4430 or antι-PR05727 antibody or fragment thereof and a earner in suitable packaging
16 The kit of claim 15, further compπsing instructions for using the antibody to detect a
PRO200, PRO204. PR0212. PR0216, PR0226. PRO240. PR0235. PR0245, PR0172. PR0273, PR0272, PR0332. PR0526. PRO701. PR0361. PR0362. PR0363. PR0364. PR0356, PR0531 , PR0533. PRO1083, PR0865, PRO770. PR0769. PR0788, PRO l 1 14. PRO 1007, PROl 184, PRO1031. PR01346. PROl 155, PRO1250. PR013 12. PRO l 192. PR01246. PR01283. PRO l 195. PR01343. PR01418, PR01387. PRO1410, PR01917, PR01868. PRO205. PR021 , PR0269. PR0344. PR0333. PR0381 , PRO720. PR0866. PRO840, PR0982. PR0836. PRO l 159 PR01358. PR01325. PR01338, PRO I 434. PR04333. PRO4302. PRO4430 or PR05727 polypeptide
17 An article of manufacture, compπsing: a container; an instruction on the container; and a composition compnsing an active agent contained within the contamer: wherem the composition is effective for inhibiting or reducmg an immune response m a mammal, the instruction on the contamer indicates that the composition can be used for treating an immune related disease, and the active agent in the composition is an agent inhibiting the expression and or activity of a PRO200, PRO204. PR0212, PR0216, PR0226. PRO240. PR0235, PR0245, PR0172. PR0273. PR0272, PR0332, PR0526, PRO701 , PR0361 , PR0362, PR0363, PR0364. PR0356, PR0531 , PR0533, PRO1083, PR0865, PRO770, PR0769, PR0788, PROl 1 14, PRO1007, PR01184, PRO1031 , PR01346, PROH55, PRO1250, PR01312, PR01 192, PR01246, PR01283, PROl 195, PR01343, PR01418, PR01387, PRO1410, PR01917, PR01868, PRO205, PR021, PR0269, PR0344, PR0333. PR0381, PRO720, PR0866, PRO840, PR0982. PR0836, PROl 159, PR01358, PRO 1325. PRO 1338. PRO 1434. PR04333. PRO4302, PRO4430 or PR05727 polypeptide.
18. The article of manufacture of ciaim 17 wherem said active agent is an antι-PRO200, anti- PRO204, antι-PR0212, antι-PR0216, antι-PR0226, antι-PRO240, antι-PR0235. antι-PR0245, antι-PR0172, antι-PR0273, antι-PR0272, antι-PR0332, antι-PR0526, antι-PRO701, antι-PR0361, antι-PR0362, anti- PR0363, antι-PR0364. antι-PR0356, antι-PR0531 , antι-PR0533, antι-PRO1083, antι-PR0865. antι-PRO770, antι-PR0769, antι-PR0788. anti-PROl 1 14, antι-PRO1007, anti-PROl 184. antι-PRO1031, antι-PR01346, anti-PROl 155, antι-PROl250, antι-PR01312, anti-PROl 192. antι-PR01246. antι-PR01283, anti-PROl 195, antι-PR01343. antι-PR01418, antι-PR01387. antι-PRO1410, antι-PR01917. antι-PR01868, antι-PRO205, antι-PR021, antι-PR0269, antι-PR0344. antι-PR0333, antι-PR0381, antι-PRO720, anπ-PR0866. anti- PRO840, antι-PR0982, antι-PR0836, anti-PROl 159, antι-PR01358, antι-PR01325. antι-PR01338, anti- PR01434. antι-PR04333, antι-PRO4302, ant -PRO4430 or antι-PR05727 antibody.
19. A method for identifying a compound capable of inhibiting the expression or activity of a PRO200 PRO204. PR0212. PR0216, PR0226. PRO240. PR0235. PR0245. PR0172. PR0273, PR0272,
PR0332. PR0526. PRO701 , PR0361. PR0362. PR0363. PR0364, PR0356. PR0531, PR0533. PRO1083, PR0865. PRO770. PR0769, PR0788, PROl 1 14. PRO1007. PROl 184. PRO1031. PR01346. PROl 155. PRO1250. PR01312. PROl 192. PR01246. PR01283, PROl 195, PR01343. PR01418. PR01387. PRO 1410. PR01917. PRO 1868. PRO205. PR02 I , PR0269, PR0344, PR0333, PR0381. PRO720, PRO866, PRO840, PR0982. PR0836. PROl 159, PR01358, PR01325, PR01338, PR01434, PR04333. PRO4302, PRO4430 or PR05727 polypeptide, compπsing contacting a candidate compound with the polypeptide under conditions and for a tune sufficient to allow these rwo components to interact.
20. The method of claim 19 wherem the candidate compound or the PRO200. PRO204, PR0212. PR0216. PR0226. PRO240, PR0235. PR0245. PR0172. PR0273. PR0272. PR0332. PR0526,
PRO701 PR0361. PR0362. PR0363. PR0364. PR0356. PR0531 , PR0533. PRO1083. PR0865. PRO770. PR0769. PR0788. PROl 1 14. PRO1007 PROl 184. PRO103 I . PR01346. PROl 155. PRO 1250. PR01312. PROl 192. PR01246, PR01283, PROl 195. PR01343, PR01418. PR01387. PRO1410. PR01917, PR01868, PRO205. PR021, PR0269, PR0344, PR0333. PR0381, PRO720. PR0866, PRO840, PR0982, PR0836, PROl 159, PR01358. PR01325, PR01338. PR01434, PR04333, PRO4302, PRO4430 or PR05727 polypeptide is immobilized on a solid support.
21. The method of claim 20. wherein the non-immobilized component carπes a detectable label.
22- Isolated nucleic acd havmg at least 80% nucleic acid sequence identity to a nucleotide sequence that encodes an ammo acid sequence selected from the group consisting of the amino acid sequence shown in Figure 1 (SEQ ID NO: l), Figure 3 (SEQ ID NO.l l), Figure 5 (SEQ ID NO:13), Figure 7 (SEQ ID NO: 18), Figure 9 (SEQ ID NO:20), Figure 11 (SEQ ID NO:25), Figure 13 (SEQ ID NO:30), Figure 15 (SEQ ID N0.35), Figure 17 (SEQ ID NO:40), Figure 19 (SEQ ID NO:45), Figure 21 (SEQ ID NO:50), Figure 23 (SEQ ID NO:56), Figure 25 (SEQ ID NO:61), Figure 27 (SEQ ID N0:66), Figure 29 (SEQ ID NO:71), Figure 31 (SEQ ID NO:79), Figure 33 (SEQ ID NO:86), Figure 35 (SEQ ID NO:91), Figure 37 (SEQ ID NO: 101), Figure 39 (SEQ ID NO: 106), Figure 41 (SEQ ID N0: 111), Figure 43 (SEQ ID N0:116), Figure 45 (SEQ ID NO: 123), Figure 47 (SEQ ID NO: 133), Figure 49 (SEQ ID NO: 139), Figure 51 (SEQ ID NO: 141), Figure 53 (SEQ ID NO: 143), Figure 55 (SEQ ID NO: 145), Figure 57 (SEQ ID NO:147), Figure 59 (SEQ ID NO:149), Figure 61 (SEQ ID NO:151), Figure 63 (SEQ ID NO: 156), Figure 65 (SEQ ID NO:158), Figure 67 (SEQ ID NO:160), Figure 69 (SEQ ID NO: 162), Figure 71 (SEQ ID NO:167), Figure 73 (SEQ ID NO: 169), Figure 75 (SEQ ID NO: 177), Figure 77 (SEQ ID NO: 179), Figure 79 (SEQ ID NO: 184), Figure 81 (SEQ ID NO: 186), Figure 83 (SEQ ID NO: 188), Figure 85 (SEQ ID NO: 190), Figure 87 (SEQ ID NO: 192), Figure 89 (SEQ ID NO:228), Figure 91 (SEQ ID NO:230), Figure 93 (SEQ ID NO:232), Figure 95 (SEQ ID NO:240), Figure 97 (SEQ ID NO:248), Figure 99 (SEQ ID NO:250), Figure 101 (SEQ ID NO:255), Figure 103 (SEQ ID NO:257), Figure 105 (SEQ ID NO:266), Figure 107 (SEQ ID NO:268), Figure 109 (SEQ ID NO:270), Figure 1 1 1 (SEQ ID NO:272), Figure 1 13 (SEQ ID NO:274), Figure 1 15 (SEQ ID NO:276), Figure 1 17 (SEQ ID NO:278), Figure 1 19 (SEQ ID NO:280), Figure 121 (SEQ ID NO:285), Figure 123 (SEQ ID NO:292), Figure 125 (SEQ ID NO:294) or Figure 127 (SEQ ID NO:296.
23. Isolated nucleic acd having at least 80% nucleic acd sequence identity to a nucleotide sequence selected from the group consisting of the nucleotide sequence shown in Figure 1 (SEQ ID NO. l), Figure 3 (SEQ ID NO: l 1), Figure 5 (SEQ ID NO: 13), Figure 7 (SEQ ID NO: 18), Figure 9 (SEQ ID NO:20), Figure 1 1 (SEQ ID NO:25), Figure 13 (SEQ ID NO:30), Figure 15 (SEQ ID NO:35), Figure 17 (SEQ ID NO:40), Figure 19 (SEQ ID NO:45), Figure 21 (SEQ ID NO:50), Figure 23 (SEQ ID NO:56), Figure 25 (SEQ ID NO:61), Figure 27 (SEQ ID NO:66), Figure 29 (SEQ ID NO:71), Figure 31 (SEQ ID NO:79), Figure 33 (SEQ ID NO:86), Figure 35 (SEQ ID NO:91), Figure 37 (SEQ ID NO: 101), Figure 39 (SEQ ID NO: 106), Figure 41 (SEQ ID NOT 1 1), Figure 43 (SEQ ID NO:l 16), Figure 45 (SEQ ID NO: 123), Figure 47 (SEQ ID NO: 133), Figure 49 (SEQ ID NO: 139), Figure 51 (SEQ ID NO: 141 ), Figure 53 (SEQ ID NO: 143), Figure 55 (SEQ ID NO: 145), Figure 57 (SEQ ID NO: 147), Figure 59 (SEQ ID NO: 149), Figure 61 (SEQ ID NO: 151), Figure 63 (SEQ ID NO: 156), Figure 65 (SEQ ID NO: 158), Figure 67 (SEQ ID NO: 160), Figure 69 (SEQ ID NO: 162), Figure 71 (SEQ ID NO: 167), Figure 73 (SEQ ID NO: 169), Figure 75 (SEQ ID NO: 177), Figure 77 (SEQ ID NO: 179), Figure 79 (SEQ ID NO: 184), Figure 81 (SEQ ID NO: 186), Figure 83 (SEQ ID NO: 188), Figure 85 (SEQ ID NO: 190), Figure 87 (SEQ ID NO: 192), Figure 89 (SEQ ID NO:228), Figure 91 (SEQ ID NO:230), Figure 93 (SEQ ID NO:232), Figure 95 (SEQ ID NO:240), Figure 97 (SEQ ID NO:248), Figure 99 (SEQ ID NO:250), Figure 101 (SEQ ID NO:255), Figure 103 (SEQ ID NO:257), Figure 105 (SEQ ID NO:266), Figure 107 (SEQ ID NO:268), Figure 109 (SEQ ID NO:270), Figure 111 (SEQ ID NO:272), Figure 113 (SEQ ID NO:274), Figure 115 (SEQ ID NO:276), Figure 117 (SEQ ID NO:278), Figure 119 (SEQ ID NO:280), Figure 121 (SEQ ID NO:285), Figure 123 (SEQ ID NO:292), Figure 125 (SEQ ID NO:294) or Figure 127 (SEQ ID NO:296.
24. Isolated nucleic acid having at least 80% nucleic acid sequence identity to a nucleotide sequence selected from the group consisting of the full-length coding sequence of the nucleotide sequence shown in Figure 1 (SEQ ID NO:l), Figure 3 (SEQ ID NO: 11), Figure 5 (SEQ ID NO: 13), Figure 7 (SEQ ID NO:18), Figure 9 (SEQ ID NO:20), Figure 11 (SEQ ID NO:25), Figure 13 (SEQ ID NO:30), Figure 15 (SEQ ID NO:35), Figure 17 (SEQ ID NO:40), Figure 19 (SEQ ID NO:45), Figure 21 (SEQ ID NO:50), Figure 23 (SEQ ID NO:56), Figure 25 (SEQ ID NO:61), Figure 27 (SEQ ID NO:66), Figure 29 (SEQ ID N0:71), Figure 31 (SEQ ID NO:79), Figure 33 (SEQ ID NO:86), Figure 35 (SEQ ID N0:91), Figure 37 (SEQ ID NO: 101), Figure 39 (SEQ ID NO: 106), Figure 41 (SEQ ID NOT 11), Figure 43 (SEQ ID NOT 16), Figure 45 (SEQ ID NO:123), Figure 47 (SEQ ID NO: 133), Figure 49 (SEQ ID NO: 139), Figure 51 (SEQ ID NO: 141), Figure 53 (SEQ ID NO: 143), Figure 55 (SEQ ID NO: 145), Figure 57 (SEQ ID NO: 147), Figure 59 (SEQ ID NO: 149), Figure 61 (SEQ ID NO: 151), Figure 63 (SEQ ID NO: 156), Figure 65 (SEQ ID NO: 158), Figure 67 (SEQ ID NO:160), Figure 69 (SEQ ID NO: 162), Figure 71 (SEQ ID NO: 167), Figure 73 (SEQ ID NO: 169), Figure 75 (SEQ ID NO: 177), Figure 77 (SEQ ID NO: 179), Figure 79 (SEQ ID NO: 184), Figure 81 (SEQ ID NO: 186), Figure 83 (SEQ ID NO: 188), Figure 85 (SEQ ID NO: 190), Figure 87 (SEQ ID NO: 192), Figure 89 (SEQ ID NO:228), Figure 91 (SEQ ID NO:230), Figure 93 (SEQ ID NO:232), Figure 95 (SEQ ID NO:240), Figure 97 (SEQ ID NO:248), Figure 99 (SEQ ID NO:250), Figure 101 (SEQ ID NO:255), Figure 103 (SEQ ID NO:257), Figure 105 (SEQ ID NO:266), Figure 107 (SEQ ID NO:268), Figure 109 (SEQ ID NO:270), Figure 1 11 (SEQ ID N0.272), Figure 1 13 (SEQ ID NO:274), Figure 1 15 (SEQ ID NO:276), Figure 1 17 (SEQ ID NO:278), Tigure 1 19 (SEQ ID NO:280), Figure 121 (SEQ ID NO:285), Figure 123 (SEQ ID NO:292), Figure 125 (SEQ ID NO 294) or Figure 127 (SEQ ID N0.296.
25. Isolated nucleic acid having at least 80% nucleic acid sequence identity to the full-length coding sequence of the DNA deposited under ATCC accession number 209653, 209380, 209254, 209381, 209376, 209260, 209374. 209265, 209419, 209424, 209388, 209433. 209704, 209720, 209621, 209620,
209616, 209436, 209422, 209702, 209480, 209859, 209774, 209801, 209802, 209849, 209905. 209950,
209962, 209866, 203128, 209986, 203173, 203132, 203093, 203457, 203244, 203094, 203282, 203276,
203160, 203277, 203573, 203553, , 209456, 209397, 209492, , 209808. 209802, 209750. 209858,
203583, 209989, 203092, 203131, 203269. 203267, 203657. 203818, 203834, 23-PTA, 203906.
26. A vector compπsing the nucleic acid of any one of Claims 22 to 25.
27. The vector of Claim 26 operably linked to control sequences recognized by a host cell transformed with the vector.
28. A host cell comprising the vector of Claim 26.
29. The host cell of Claim 28, wherem said cell is a CHO cell.
30. The host cell of Claim 28, wherein said cell is an E. coli.
31. The host cell of Claim 28 , wherein said cell is a yeast cell.
32. A process for producing a PRO200, PRO204, PR0212, PR0216, PR0226, PRO240, PR0235, PR0245, PR0172, PR0273, PR0272, PR0332, PR0526, PRO701, PR0361, PR0362, PR0363, PR0364, PR0356, PR0531, PR0533, PRO1083, PR0865, PRO770, PR0769, PR0788, PROl 114, PRO1007, PROl 184, PRO1031, PR01346, PROl 155, PRO1250, PR01312, PROl 192, PR01246, PR01283, PROl 195, PR01343, PR01418. PR01387, PRO1410, PR01917, PR01868, PRO205, PR021, PR0269, PR0344, PR0333, PR0381, PRO720, PR0866, PRO840, PR0982, PR0836, PR01159, PR01358, PR01325, PR01338, PR01434, PR04333, PRO4302, PRO4430 or PR05727 polypeptide compπsmg culmπng the host cell of Claim 28 under conditions suitable for expression of said polypeptide and recovering said polypeptide from the cell culture
33 An isolated polypeptide having at least 80% ammo acid sequence identify to an amino acid sequence selected from the group consisting of the amino acd sequence shown m Figure 2 (SEQ ID NO 2), Figure 4 (SEQ ID NO 12), Figure 6 (SEQ ID NO 14), Figure 8 (SEQ ID NO 19), Figure 10 (SEQ ID NO 21), Figure 12 (SEQ ID NO 26), Figure 14 (SEQ ID NO 31), Figure 16 (SEQ ID NO 36), Figure 18 (SEQ ID NO 41), Figure 20 (SEQ ID NO 46), Figure 22 (SEQ ID NO 51), Figure 24 (SEQ ID NO 57), Figure 26 (SEQ ID NO 62), Figure 28 (SEQ ID NO 67), Figure 30 (SEQ ID NO 72), Figure 32 (SEQ ID NO 80), Figure 34 (SEQ ID NO 87) Figure 36 (SEQ ID NO 92) Figure 38 (SEQ ID NO 102), Figure 40 (SEQ ID NO 107), Figure 42 (SEQ ID NO 1 12) Figure 44 (SEQ ID NO 1 17), Figure 46 (SEQ ID NO 124), Figure 48 (SEQ ID NO 134), Figure 50 (SEQ ID NO 140), Figure 52 (SEQ ID NO 142), Figure 54 (SEQ ID NO 144), Figure 56 (SEQ ID NO 146), Figure 58 (SEQ ID NO 148), Figure 60 (SEQ ID NO 150), Figure 62 (SEQ ID NO 152), Figure 64 (SEQ ID NO 157), Figure 66 (SEQ ID NO 159), Figure 68 (SEQ ID NO 161), Figure 70 (SEQ ID NO 163), Figure 72 (SEQ ID NO 168), Figure 74 (SEQ ID NO 170), Figure 76 (SEQ ID NO 178), Figure 78 (SEQ ID NO 180), Figure 80 (SEQ ID NO 185), Figure 82 (SEQ ID NO 187), Figure 84 (SEQ ID NO 189), Figure 86 (SEQ ID NO 191), Figure 88 (SEQ ID NO 193), Figure 90 (SEQ ID NO 229), Figure 92 (SEQ ID N0.2 1 ), Figure 94 (SEQ ID NO 233), Figure 96 (SEQ ID NO 241), Figure 98 (SEQ ID NO 249), Figure 100 (SEQ ID NO 251 ), Figure 102 (SEQ ID NO 256), Figure 104 (SEQ ID NO 258), Figure 106 (SEQ ID NO 267), Figure 108 (SEQ ID NO 269), Figure 1 10 (SEQ ID NO 271), Figure 1 12 (SEQ ID NO 273), Figure 114 (SEQ ID NO 275), Figure 1 16 (SEQ ID NO 277), Figure 1 18 (SEQ ID NO 279), Figure 120 (SEQ ID NO 281 ), Figure 122 (SEQ ID NO 286), Figure 124 (SEQ ID NO 293), Figure 126 (SEQ ID NO 295) or Figure 128 (SEQ ID NO 297)
34 An isolated polypeptide scoπng at least 80% positives when compared to an ammo acid sequence selected from the group consisting of the ammo acid sequence shown in Figure 2 (SEQ ID NO 2), Figure 4 (SEQ ID NO 12), Figure 6 (SEQ ID NO 14), Figure 8 (SEQ ID NO 19), Figure 10 (SEQ ID NO 21), Figure 12 (SEQ ID NO 26), Figure 14 (SEQ ID NO 31), Figure 16 (SEQ ID NO 36), Figure 18 (SEQ ID NO:41), Figure 20 (SEQ ID NO 46), Figure 22 (SEQ ID NO 51), Figure 24 (SEQ ID NO 57), Figure 26 (SEQ ID NO 62), Figure 28 (SEQ ID NO 67), Figure 30 (SEQ ID NO 72), Figure 32 (SEQ ID NO 80), Figure 34 (SEQ ID NO 87), Figure 36 (SEQ ID NO 92), Figure 38 (SEQ ID NO 102), Figure 40 (SEQ ID NO 107), Figure 42 (SEQ ID NO 112), Figure 44 (SEQ ID NO 117), Figure 46 (SEQ ID NO.124), Figure 48 (SEQ ID NO: 134), Figure 50 (SEQ ID NO 140), Figure 52 (SEQ ID NO.142), Figure 54 (SEQ ID NO: 144), Figure 56 (SEQ ID NO 146), Figure 58 (SEQ ID NO 148), Figure 60 (SEQ ID NO 150), Figure 62 (SEQ ID NO:152), Figure 64 (SEQ ID NO 157), Figure 66 (SEQ ID NO 159), Figure 68 (SEQ ID NO 161), Figure 70 (SEQ ID NO:163), Figure 72 (SEQ ID NO: 168), Figure 74 (SEQ ID NO: 170), Figure 76 (SEQ ID NO: 178), Figure 78 (SEQ ID NO: 180), Figure 80 (SEQ ID NO: 185), Figure 82 (SEQ ID NO: 187), Figure 84 (SEQ ID NO:189), Figure 86 (SEQ ID NO: 191), Figure 88 (SEQ ID NO: 193), Figure 90 (SEQ ID NO:229), Figure 92 (SEQ ID NO:231), Figure 94 (SEQ ID NO:233), Figure 96 (SEQ ID NO:241), Figure 98 (SEQ ID NO:249), Figure 100 (SEQ ID NO:251), Figure 102 (SEQ ID NO:256), Figure 104 (SEQ ID NO:258), Figure 106 (SEQ ID NO:267), Figure 108 (SEQ ID NO:269), Figure 110 (SEQ ID NO:271), Figure 112 (SEQ ID NO:273), Figure 114 (SEQ ID NO:275), Figure 1 16 (SEQ ID NO:277), Figure 118 (SEQ ID NO:279), Figure 120 (SEQ ID NO:281), Figure 122 (SEQ ID NO:286), Figure 124 (SEQ ID NO:293), Figure 126 (SEQ ID NO:295) or Figure 128 (SEQ ID NO.297).
35. An isolated polypeptide having at least 80% ammo acd sequence identity to an ammo acid sequence encoded by the full-length codmg sequence of the DNA deposited under ATCC accession number 209653, 209380, 209254, 209381 , 209376, 209260, 209374, 209265, 209419, 209424, 209388, 209433, 209704, 209720. 209621 , 209620, 209616, 209436. 209422, 209702. 209480, 209859. 209774. 209801, 209802. 209849. 209905. 209950, 209962, 209866. 203128, 209986. 203173, 203132. 203093. 203457, 203244, 203094. 203282. 203276, 203160, 203277. 203573. 203553. ----- . 209456, 209397. 209492, ----- , 209808. 209802. 209750, 209858, 203583. 209989. 203092, 203131, 203269, 203267, 203657, 203818, 203834, 23-PTA. 203906.
36. A chimenc molecule compπsing a polypeptide according to any one of Claims 33 to 35 fused to a heterologous ammo acd sequence.
37. The chimenc molecule of Claim 36, wherein said heterologous ammo acd sequence is an epitope tag sequence.
38. The chimenc molecule of Claim 36. where said heterologous ammo acd sequence is a Fc region of an immunoglobulin.
39. An antibody which specifically binds to a polypeptide according to any one of Claims 33 to 35.
40. The antibody of Claim 39, wherem said antibody is a monoclonal antibody, a humanized antibody or a smgle-cham antibody.
41 • Isolated nucleic acid having at least 80% nucieic acid sequence identity to:
(a) a nucleotide sequence encoding the polypeptide shown m Figure 2 (SEQ ID NO:2), Figure 4
(SEQ ID NO:12), Figure 6 (SEQ ID NO:14), Figure 8 (SEQ ID NO:19), Figure 10 (SEQ ID NO:21), Figure 12 (SEQ ID NO:26), Figure 14 (SEQ ID NO:31), Figure 16 (SEQ ID NO:36), Figure 18 (SEQ ID NO:41), Figure 20 (SEQ ID NO:46), Figure 22 (SEQ ID NO:51), Figure 24 (SEQ ED NO:57), Figure 26 (SEQ ID NO:62), Figure 28 (SEQ ID NO:67), Figure 30 (SEQ ID NO:72), Figure 32 (SEQ ID NO:80), Figure 34 (SEQ ID NO:87), Figure 36 (SEQ ID NO:92), Figure 38 (SEQ ID NO: 102), Figure 40 (SEQ ID NO: 107), Figure 42 (SEQ ID NO: 112), Figure 44 (SEQ ID NO: 117), Figure 46 (SEQ ID NO: 124), Figure 48 (SEQ ID NO:134), Figure 50 (SEQ ID NO: 140), Figure 52 (SEQ ID NO: 142), Figure 54 (SEQ ID NO: 144), Figure 56 (SEQ ID NO: 146), Figure 58 (SEQ ID NO: 148), Figure 60 (SEQ ID NO: 150), Figure 62 (SEQ ID NO: 152), Figure 64 (SEQ ID NO: 157), Figure 66 (SEQ ID NO: 159), Figure 68 (SEQ ID NO: 161), Figure 70 (SEQ ID NO: 163), Figure 72 (SEQ ID NO: 168), Figure 74 (SEQ ID NO: 170), Figure 76 (SEQ ID NO: 178), Figure 78 (SEQ ID NO: 180), Figure 80 (SEQ ID NO: 185), Figure 82 (SEQ ID NO: 187), Figure 84 (SEQ ID NO: 189), Figure 86 (SEQ ID NOT 91), Figure 88 (SEQ ID NOT93), Figure 90 (SEQ ID NO:229), Figure 92 (SEQ ID NO:231), Figure 94 (SEQ ID NO:233), Figure 96 (SEQ ID NO:241), Figure 98 (SEQ ID NO:249), Figure 100 (SEQ ID NO:251), Figure 102 (SEQ ID NO:256), Figure 104 (SEQ ID NO:258), Figure 106 (SEQ ID NO:267), Figure 108 (SEQ ID NO:269), Figure 110 (SEQ ID NO:271), Figure 1 12 (SEQ ID NO:273), Figure 114 (SEQ ID NO:275), Figure 116 (SEQ ID NO:277), Figure 1 18 (SEQ ID NO:279), Figure 120 (SEQ ID NO:281), Figure 122 (SEQ ID NO:286), Figure 124 (SEQ ID NO:293), Figure 126 (SEQ ID NO:295) or Figure 128 (SEQ ID NO:297) lacking its associated signal peptide; (b) a nucleotide sequence encoding an extracellular domam of the polypeptide shown in Figure
2 (SEQ ID NO:2), Figure 4 (SEQ ID NO: 12), Figure 6 (SEQ ID NO: 14), Figure 8 (SEQ ID NO: 19), Figure 10 (SEQ ID NO:21), Figure 12 (SEQ ID NO:26), Figure 14 (SEQ ID NO:31), Figure 16 (SEQ ID NO:36), Figure 18 (SEQ ID NO:41), Figure 20 (SEQ ID NO:46), Figure 22 (SEQ ID NO:51), Figure 24 (SEQ ID NO:57), Figure 26 (SEQ ID NO:62), Figure 28 (SEQ ID NO:67), Figure 30 (SEQ ID NO:72), Figure 32 (SEQ ID NO:80), Figure 34 (SEQ ID NO:87), Figure 36 (SEQ ID NO:92), Figure 38 (SEQ ID NO: 102), Figure 40 (SEQ ID NO: 107), Figure 42 (SEQ ID NOT 12), Figure 44 (SEQ ID NOT 17), Figure 46 (SEQ ID NO: 124), Figure 48 (SEQ ID NO: 134), Figure 50 (SEQ ID NO: 140), Figure 52 (SEQ ID NO: 142), Figure 54 (SEQ ID NO: 144), Figure 56 (SEQ ID NO: 146), Figure 58 (SEQ ID NO: 148), Figure 60 (SEQ ID NO: 150), Figure 62 (SEQ ID NO: 152), Figure 64 (SEQ ID NO: 157), Figure 66 (SEQ ID NO: 159), Figure 68 (SEQ ID NO: 161), Figure 70 (SEQ ID NO: 163), Figure 72 (SEQ ID NO: 168), Figure 74 (SEQ ID NO: 170), Figure 76 (SEQ ID NO: 178), Figure 78 (SEQ ID NO: 180), Figure 80 (SEQ ID NO: 185), Figure 82 (SEQ ID NO: 187), Figure 84 (SEQ ID NO: 189), Figure 86 (SEQ ID NOT91), Figure 88 (SEQ ID NO: 193), Figure 90 (SEQ ID NO:229), Figure 92 (SEQ ID NO:231), Figure 94 (SEQ ID NO:233), Figure 96 (SEQ ID NO:241), Figure 98 (SEQ ID NO:249), Figure 100 (SEQ ID NO:251), Figure 102 (SEQ ID NO:256), Figure 104 (SEQ ID NO:258), Figure 106 (SEQ ID NO:267), Figure 108 (SEQ ID NO:269), Figure 110 (SEQ ID NO:271), Figure 1 12 (SEQ ID NO:273), Figure 1 14 (SEQ ID NO:275), Figure 1 16 (SEQ ID NO:277), Figure 118 (SEQ ID NO:279), Figure 120 (SEQ ID NO:281), Figure 122 (SEQ ID NO:286), Figure 124 (SEQ ID NO:293), Figure 126 (SEQ ID NO:295) or Figure 128 (SEQ ID NO:297) with its associated signal peptide; or
(c) a nucleotide sequence encoding an extracellular domain of the polypeptide shown in Figure 2 (SEQ ID NO:2), Figure 4 (SEQ ID NO: 12), Figure 6 (SEQ ID NO: 14), Figure 8 (SEQ ID NO: 19), Figure 10 (SEQ ID NO:21), Figure 12 (SEQ ID NO:26), Figure 14 (SEQ ID NO:31), Figure 16 (SEQ ID NO:36), Figure 18
(SEQ ID NO:41), Figure 20 (SEQ ID NO:46), Figure 22 (SEQ ID NO:51), Figure 24 (SEQ ID NO:57), Figure 26 (SEQ ID NO:62), Figure 28 (SEQ ID NO:67), Figure 30 (SEQ ID NO:72), Figure 32 (SEQ ID NO:80), Figure 34 (SEQ ID NO:87), Figure 36 (SEQ ID NO:92), Figure 38 (SEQ ED NO: 102), Figure 40 (SEQ ID NO:107), Figure 42 (SEQ ID NOT 12), Figure 44 (SEQ ID NOT 17), Figure 46 (SEQ ID NO: 124), Figure 48 (SEQ ID NO: 134), Figure 50 (SEQ ID NO: 140), Figure 52 (SEQ ID NO: 142), Figure 54 (SEQ ID NO: 144), Figure 56 (SEQ ID NO: 146), Figure 58 (SEQ ID NO: 148), Figure 60 (SEQ ID NO: 150), Figure 62 (SEQ ID NO: 152), Figure 64 (SEQ ID NOT57), Figure 66 (SEQ ID NO: 159), Figure 68 (SEQ ID NO:161), Figure 70 (SEQ ID NOT63), Figure 72 (SEQ ID NOT68), Figure 74 (SEQ ID NOT70), Figure 76 (SEQ ID NO: 178), Figure 78 (SEQ ID NO: 180), Figure 80 (SEQ ID NO: 185), Figure 82 (SEQ ED NO: 187), Figure 84 (SEQ ID NOT89), Figure 86 (SEQ ID NOT91), Figure 88 (SEQ ID NO: 193), Figure 90 (SEQ ID NO:229), Figure 92 (SEQ ID NO:231), Figure 94 (SEQ ID NO:233), Figure 96 (SEQ ID NO:241), Figure 98 (SEQ ID NO:249), Figure 100 (SEQ ID NO:251), Figure 102 (SEQ ID NO:256), Figure 104 (SEQ ID NO:258), Figure 106 (SEQ ID NO:267), Figure 108 (SEQ ID NO:269), Figure 110 (SEQ ID NO:271), Figure 112 (SEQ ID NO:273), Figure 1 14 (SEQ ID NO:275), Figure 1 16 (SEQ ID NO:277), Figure 1 18 (SEQ ID NO:279), Figure 120 (SEQ ID NO:281), Figure 122 (SEQ ID NO:286), Figure 124 (SEQ ID NO:293), Figure 126 (SEQ ID NO:295) or Figure 128 (SEQ ID NO:297) lacking its associated signal peptide.
42. An isolated polypeptide having at least 80% ammo acid sequence identity to: (a) the polypeptide shown in Figure 2 (SEQ ID NO:2), Figure 4 (SEQ ID NO: 12), Figure 6
(SEQ ID NO: 14), Figure 8 (SEQ ID NO: 19), Figure 10 (SEQ ID NO:21), Figure 12 (SEQ ID NO:26), Figure 14 (SEQ ID NO:31), Figure 16 (SEQ ID NO:36), Figure 18 (SEQ ID NO:41), Figure 20 (SEQ ID NO:46), Figure 22 (SEQ ID NO:51), Figure 24 (SEQ ID NO:57), Figure 26 (SEQ ID NO:62), Figure 28 (SEQ ID NO:67), Figure 30 (SEQ ID NO:72), Figure 32 (SEQ ID NO:80), Figure 34 (SEQ ID NO:87), Figure 36 (SEQ ID NO:92), Figure 38 (SEQ ID NO: 102), Figure 40 (SEQ ID NO: 107), Figure 42 (SEQ ID NO: 112), Figure 44 (SEQ ID NO: 117), Figure 46 (SEQ ID NO: 124), Figure 48 (SEQ ID NO: 134), Figure 50 (SEQ ID NO: 140), Figure 52 (SEQ ID NO: 142), Figure 54 (SEQ ID NO: 144), Figure 56 (SEQ ID NO: 146), Figure 58 (SEQ ID NO: 148), Figure 60 (SEQ ID NO: 150), Figure 62 (SEQ ID NO: 152), Figure 64 (SEQ ID NO: 157), Figure 66 (SEQ ID NO: 159), Figure 68 (SEQ ID NO: 161), Figure 70 (SEQ ID NO: 163), Figure 72 (SEQ ID NO: 168), Figure 74 (SEQ ID NOT70), Figure 76 (SEQ ID NOT78), Figure 78 (SEQ ID NOT80), Figure 80 (SEQ ID NO: 185), Figure 82 (SEQ ID NO: 187), Figure 84 (SEQ ID NO: 189), Figure 86 (SEQ ID NO: 191), Figure 88 (SEQ ID NO: 193), Figure 90 (SEQ ID NO:229), Figure 92 (SEQ ID NO:231 ), Figure 94 (SEQ ID NO:233), Figure 96 (SEQ ID NO:241), Figure 98 (SEQ ID NO:249), Figure 100 (SEQ ID NO:251), Figure 102 (SEQ ID NO:256), Figure 104 (SEQ ID NO:258), Figure 106 (SEQ ID NO:267), Figure 108 (SEQ ID NO:269), Figure 1 10 (SEQ ID NO:271), Figure 112 (SEQ ID NO:273), Figure 114 (SEQ ID NO:275), Figure 116 (SEQ ID NO:277), Figure 1 18 (SEQ ID NO:279), Figure 120 (SEQ ID NO:281), Figure 122 (SEQ ID NO:286), Figure 124 (SEQ ID NO:293), Figure 126 (SEQ ID NO:295) or Figure 128 (SEQ ID NO:297), lacking its associated signal peptide;
(b) an extracellular domain of the polypeptide shown in Figure 2 (SEQ ID NO:2), Figure 4 (SEQ ID NO: 12), Figure 6 (SEQ ID NO: 14), Figure 8 (SEQ ID NO: 19), Figure 10 (SEQ ID NO:21), Figure 12 (SEQ ID NO:26), Figure 14 (SEQ ID NO:31), Figure 16 (SEQ ID NO:36), Figure 18 (SEQ ID NO:41), Figure 20 (SEQ ID NO:46), Figure 22 (SEQ ID NO:51), Figure 24 (SEQ ID NO:57), Figure 26 (SEQ ID NO:62), Figure 28 (SEQ ID NO:67), Figure 30 (SEQ ID NO:72), Figure 32 (SEQ ID NO:80), Figure 34 (SEQ ID NO:87), Figure 36 (SEQ ID NO:92), Figure 38 (SEQ ID NO: 102), Figure 40 (SEQ ID NO: 107), Figure 42 (SEQ ID NO: 112), Figure 44 (SEQ ID NO: 117), Figure 46 (SEQ ID NO: 124), Figure 48 (SEQ ID NO: 134), Figure 50 (SEQ ID NO 140), Figure 52 (SEQ ID NO 142), Figure 54 (SEQ ID NO 144), Figure 56 (SEQ ID NO 146), Figure 58 (SEQ ID NO 148), Figure 60 (SEQ ID NO 150), Figure 62 (SEQ ID NO 152), Figure 64 (SEQ ID NO: 157), Figure 66 (SEQ ID NO 159), Figure 68 (SEQ ID NO 161), Figure 70 (SEQ ID NO 163), Figure 72 (SEQ ID NO 168), Figure 74 (SEQ ID NO 170), Figure 76 (SEQ ID NO 178), Figure 78 (SEQ ID NO 180), Figure 80 (SEQ ID NO 185), Figure 82 (SEQ ID NO 187), Figure 84 (SEQ ID NO 189), Figure 86 (SEQ ID N0.191), Figure 88 (SEQ ID NO 193), Figure 90 (SEQ ID NO 229), Figure 92 (SEQ ID NO 231), Figure 94 (SEQ ID NO 233), Figure 96 (SEQ ID NO 241), Figure 98 (SEQ ID NO 249), Figure 100 (SEQ ID NO 251), Figure 102 (SEQ ID NO 256), Figure 104 (SEQ ID NO 258), Figure 106 (SEQ ID NO 267), Figure 108 (SEQ ID NO 269), Figure 110 (SEQ ID NO 271), Figure 112 (SEQ ID NO 273), Figure 114 (SEQ ID NO 275), Figure 1 16 (SEQ ID NO 277), Figure 1 18 (SEQ ID NO 279), Figure 120 (SEQ ID NO 281), Figure 122 (SEQ ID NO 286), Figure 124 (SEQ ID NO 293), Figure 126 (SEQ ID NO 295) or Figure 128 (SEQ ID NO 297), with its associated signal peptide, or
(c) an extracellular domain of the polypeptide shown in Figure 2 (SEQ ID NO 2), Figure 4 (SEQ
ID NO 12), Figure 6 (SEQ ID NO 14), Figure 8 (SEQ ID NO 19), Figure 10 (SEQ ID NO 21), Figure 12 (SEQ ID NO 26), Figure 14 (SEQ ID NO 31), Figure 16 (SEQ ID NO 36), Figure 18 (SEQ ID NO 41), Figure 20 (SEQ ID NO 46), Figure 22 (SEQ ID NO 51 ), Figure 24 (SEQ ID NO 57), Figure 26 (SEQ ID NO 62), Figure 28 (SEQ ID NO 67), Figure 30 (SEQ ID NO 72), Figure 32 (SEQ ID NO 80), Figure 34 (SEQ ID NO 87), Figure 36 (SEQ ID NO 92), Figure 38 (SEQ ID NO 102), Figure 40 (SEQ ID NO 107), Figure 42 (SEQ ID NO. l 12), Figure 44 (SEQ ID NO 1 17), Figure 46 (SEQ ID NO 124), Figure 48 (SEQ ID NO 134), Figure 50 (SEQ ID NO 140), Figure 52 (SEQ ID NO 142), Figure 54 (SEQ ID NO 144), Figure 56 (SEQ ID NO 146), Figure 58 (SEQ ID NO 148), Figure 60 (SEQ ID NO 150), Figure 62 (SEQ ID NO 152), Figure 64 (SEQ ID NO: 157), Figure 66 (SEQ ID NO 159), Figure 68 (SEQ ID NO 161), Figure 70 (SEQ ID NO 163), Figure 72 (SEQ ID NO 168), Figure 74 (SEQ ID NO 170), Figure 76 (SEQ ID NO 178), Figure 78 (SEQ ID NO 180), Figure 80 (SEQ ID NO 185), Figure 82 (SEQ ID NO 187), Figure 84 (SEQ ID NO 189), Figure 86 (SEQ ID NO 191 ), Figure 88 (SEQ ID NO 193), Figure 90 (SEQ ID NO 229), Figure 92 (SEQ ID NO 231), Figure 94 (SEQ ID NO 233), Figure 96 (SEQ ID NO 241), Figure 98 (SEQ ID NO 249), Figure 100 (SEQ ID NO 251), Figure 102 (SEQ ID NO 256), Figure 104 (SEQ ID NO 258), Figure 106 (SEQ ID NO 267), Figure 108 (SEQ ID NO 269), Figure 110 (SEQ ID NO 271), Figure 1 12 (SEQ ID NO 273), Figure 1 14 (SEQ ID NO 275), Figure 1 16 (SEQ ID NO 277), Figure 1 18 (SEQ ID NO 279), Figure 120 (SEQ ID NO 281), Figure 122 (SEQ ID NO 286), Figure 124 (SEQ ID NO 293), Figure 126 (SEQ ID NO 295) or Figure 128 (SEQ ID NO 297), lackmg its associated signal peptide
43 A method of affecting the proliferation of T-cells compπsing contacting PBMC cells with an effective amount of a PRO200, PRO204, PR0212, PR0216, PR0226, PRO240, PR0235, PR0245, PR0172, PR0273, PR0272, PR0332, PR0526, PRO701, PR0361, PR0362, PR0363, PR0364, PR0356, PR0531, PR0533, PRO1083, PR0865, PRO770, PR0769, PR0788, PROl 114, PRO1007, PROl 184, PRO1031, PR01346, PROl 155, PRO1250, PR01312, PROl 192, PR01246, PR01283, PROl 195, PR01343, PR01418, PR01387, PRO1410, PR01917, PR01868, PRO205, PR021, PR0269, PR0344, PR0333, PR0381, PRO720, PR0866, PRO840, PR0982, PR0836, PROl 159, PR01358, PR01325, PR01338, PR01434, PR04333, PRO4302, PRO4430 or PR05727 polypeptide and measuπng the change m proliferation from control levels.
44. A method of affecting vascular permeability comprising injecting a test animal with an effective amount of a PRO200, PRO204, PR0212, PR0216, PR0226, PRO240, PR0235, PR0245, PR0172, PR0273, PR0272, PR0332, PR0526, PRO701, PR0361, PR0362, PR0363, PR0364, PR0356, PR0531, PR0533, PRO1083, PR0865, PRO770, PR0769, PR0788, PROH 14, PRO1007, PROH84, PRO1031, PR01346, PROl 155, PRO1250, PR01312, PROl 192, PR01246, PR01283, PROl 195, PR01343, PR01418, PR01387, PRO1410, PR01917, PR01868, PRO205, PR021, PR0269, PR0344, PR0333, PR0381, PRO720, PRO866, PRO840, PR0982, PR0836, PROl 159, PR01358, PR01325, PR01338, PR01434, PR04333, PRO4302, PRO4430 or PR05727 polypeptide, and measuring the resulting extent of vascular permeability.
EP00913764A 1999-03-08 2000-03-02 Composition and methods for the treatment of immune related diseases Withdrawn EP1220905A2 (en)

Applications Claiming Priority (79)

Application Number Priority Date Filing Date Title
WOPCT/US99/05028 1999-03-08
PCT/US1999/005028 WO1999046281A2 (en) 1998-03-10 1999-03-08 Novel polypeptides and nucleic acids encoding the same
US12361899P 1999-03-10 1999-03-10
US123618P 1999-03-10
US12395799P 1999-03-12 1999-03-12
US123957P 1999-03-12
US12577599P 1999-03-23 1999-03-23
US125775P 1999-03-23
US12884999P 1999-04-12 1999-04-12
US128849P 1999-04-12
PCT/US1999/008615 WO1999055868A2 (en) 1998-04-24 1999-04-20 Fizz proteins
WOPCT/US99/08615 1999-04-20
US13144599P 1999-04-28 1999-04-28
US131445P 1999-04-28
US13237199P 1999-05-04 1999-05-04
US132371P 1999-05-04
US13428799P 1999-05-14 1999-05-14
US134287P 1999-05-14
WOPCT/US99/12252 1999-06-02
PCT/US1999/012252 WO1999063088A2 (en) 1998-06-02 1999-06-02 Membrane-bound proteins and nucleic acids encoding the same
US14103799P 1999-06-23 1999-06-23
US141037P 1999-06-23
US14475899P 1999-07-20 1999-07-20
US144758P 1999-07-20
US14569899P 1999-07-26 1999-07-26
US145698P 1999-07-26
US14622299P 1999-07-28 1999-07-28
US146222P 1999-07-28
PCT/US1999/020111 WO2000012708A2 (en) 1998-09-01 1999-09-01 Further pro polypeptides and sequences thereof
WOPCT/US99/20111 1999-09-01
PCT/US1999/020594 WO2000015666A2 (en) 1998-09-10 1999-09-08 Compositions and methods for the treatment of tumors
WOPCT/US99/20594 1999-09-08
WOPCT/US99/20944 1999-09-13
PCT/US1999/020944 WO2000015792A2 (en) 1998-09-14 1999-09-13 Promotion or inhibition of angiogenesis and cardiovascularization
WOPCT/US99/21090 1999-09-15
PCT/US1999/021090 WO2000015796A2 (en) 1998-09-16 1999-09-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
PCT/US1999/021547 WO2000015797A2 (en) 1998-09-17 1999-09-15 Compositions and methods for the treatment of immune related diseases
WOPCT/US99/21547 1999-09-15
WOPCT/US99/23089 1999-10-05
PCT/US1999/023089 WO2000021996A2 (en) 1998-10-13 1999-10-05 Methods and compositions for inhibiting neoplastic cell growth
US16250699P 1999-10-29 1999-10-29
US162506P 1999-10-29
WOPCT/US99/28214 1999-11-29
PCT/US1999/028214 WO2001019987A1 (en) 1999-09-13 1999-11-29 Promotion or inhibition of angiogenesis and cardiovascularization
WOPCT/US99/28409 1999-11-30
PCT/US1999/028409 WO2000032778A2 (en) 1998-12-01 1999-11-30 Methods and compositions for inhibiting neoplastic cell growth
WOPCT/US99/28313 1999-11-30
PCT/US1999/028313 WO2000032221A2 (en) 1998-12-01 1999-11-30 Promotion or inhibition of angiogenesis and cardiovascularization
WOPCT/US99/28301 1999-12-01
WOPCT/US99/28634 1999-12-01
PCT/US1999/028301 WO2000032776A2 (en) 1998-12-01 1999-12-01 Secreted amd transmembrane polypeptides and nucleic acids encoding the same
PCT/US1999/028634 WO2000036102A2 (en) 1998-12-16 1999-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
PCT/US1999/028565 WO2000037638A2 (en) 1998-12-22 1999-12-02 Methods and compositions for inhibiting neoplastic cell growth
PCT/US1999/028564 WO2000055319A1 (en) 1999-03-12 1999-12-02 Methods and compositions for inhibiting neoplastic cell growth
WOPCT/US99/28551 1999-12-02
PCT/US1999/028551 WO2000053750A1 (en) 1999-03-08 1999-12-02 Compositions and methods for the treatment of tumors
WOPCT/US99/28565 1999-12-02
WOPCT/US99/28564 1999-12-02
WOPCT/US99/30095 1999-12-16
PCT/US1999/030095 WO2000037640A2 (en) 1998-12-22 1999-12-16 Compositions and methods for the treatment of tumor
PCT/US1999/030999 WO2001005836A1 (en) 1999-07-20 1999-12-20 Polypeptidic compositions and methods for the treatment of tumors
WOPCT/US99/30999 1999-12-20
PCT/US1999/031274 WO2000053752A2 (en) 1999-03-08 1999-12-30 Promotion or inhibition of angiogenesis and cardiovascularization
WOPCT/US99/31274 1999-12-30
WOPCT/US00/00219 2000-01-05
PCT/US2000/000219 WO2000053753A2 (en) 1999-03-08 2000-01-05 Promotion or inhibition of angiogenesis and cardiovascularization
PCT/US2000/000277 WO2000053754A1 (en) 1999-03-08 2000-01-06 Compositions and methods for the treatment of tumor
WOPCT/US00/00376 2000-01-06
PCT/US2000/000376 WO2000053755A2 (en) 1999-03-08 2000-01-06 Compositions and methods for the treatment of tumor
WOPCT/US00/00277 2000-01-06
WOPCT/US00/03565 2000-02-11
PCT/US2000/003565 WO2001053486A1 (en) 1999-03-08 2000-02-11 Compositions and methods for the treatment of tumor
WOPCT/US00/04342 2000-02-18
PCT/US2000/004341 WO2000053756A2 (en) 1999-03-08 2000-02-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
PCT/US2000/004342 WO2000078961A1 (en) 1999-06-23 2000-02-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
WOPCT/US00/04341 2000-02-18
WOPCT/US00/04414 2000-02-22
PCT/US2000/004414 WO2001004311A1 (en) 1999-07-07 2000-02-22 Secreted and transmembrane polypeptides and nucleic acids encoding the same
PCT/US2000/005841 WO2000053758A2 (en) 1999-03-08 2000-03-02 Compositions and methods for the treatment of immune related diseases

Publications (1)

Publication Number Publication Date
EP1220905A2 true EP1220905A2 (en) 2002-07-10

Family

ID=32831300

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00913764A Withdrawn EP1220905A2 (en) 1999-03-08 2000-03-02 Composition and methods for the treatment of immune related diseases

Country Status (6)

Country Link
EP (1) EP1220905A2 (en)
JP (1) JP2004516227A (en)
KR (1) KR20010103046A (en)
AU (1) AU3514400A (en)
CA (1) CA2362427A1 (en)
WO (1) WO2000053758A2 (en)

Families Citing this family (63)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6590088B1 (en) 1996-07-19 2003-07-08 Human Genome Sciences, Inc. CD33-like protein
US7285267B2 (en) 1997-01-14 2007-10-23 Human Genome Sciences, Inc. Tumor necrosis factor receptors 6α & 6β
DE69837996T2 (en) 1997-01-14 2008-02-28 Human Genome Sciences, Inc. TUMOR NECROSE FACTOR RECEPTORS 6 ALPHA & 6 BETA
JP3492999B2 (en) 1997-08-26 2004-02-03 ザイモジェネティクス,インコーポレイティド Homologs of adipocyte-specific proteins
WO1999012963A2 (en) 1997-09-12 1999-03-18 Biogen, Inc. Cysteine rich receptors: trail
PT1015587E (en) 1997-09-18 2008-07-31 Genentech Inc Dcr3 polypeptide, a tnfr homolog
US6689607B2 (en) 1997-10-21 2004-02-10 Human Genome Sciences, Inc. Human tumor, necrosis factor receptor-like proteins TR11, TR11SV1 and TR11SV2
US6503184B1 (en) 1997-10-21 2003-01-07 Human Genome Sciences, Inc. Human tumor necrosis factor receptor-like proteins TR11, TR11SV1 and TR11SV2
US8088386B2 (en) 1998-03-20 2012-01-03 Genentech, Inc. Treatment of complement-associated disorders
US7192589B2 (en) 1998-09-16 2007-03-20 Genentech, Inc. Treatment of inflammatory disorders with STIgMA immunoadhesins
US7419663B2 (en) 1998-03-20 2008-09-02 Genentech, Inc. Treatment of complement-associated disorders
US8007798B2 (en) 1997-11-21 2011-08-30 Genentech, Inc. Treatment of complement-associated disorders
ES2389387T3 (en) 1998-03-17 2012-10-25 Genentech, Inc. Homologous VEGF and BMP1 polypeptides
AU4682999A (en) 1998-06-16 2000-01-05 Human Genome Sciences, Inc. 94 human secreted proteins
US20030187191A1 (en) * 1998-09-01 2003-10-02 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US6924355B2 (en) * 1998-09-01 2005-08-02 Genentech, Inc. PRO1343 polypeptides
US7026448B2 (en) * 1998-09-01 2006-04-11 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US6972186B2 (en) * 1998-09-23 2005-12-06 Genentech, Inc. Nucleic acid encoding pro 1410 polypeptides
US7083946B2 (en) * 1998-09-23 2006-08-01 Genentech, Inc. PRO1343 nucleic acids
US6960433B1 (en) 1998-10-19 2005-11-01 Diadexus, Inc. Method of diagnosing, monitoring, staging, imaging and treating prostate cancer
US6432673B1 (en) 1998-12-07 2002-08-13 Zymogenetics, Inc. Growth factor homolog ZVEGF3
CA2365913C (en) 1999-04-12 2015-03-03 Genentech, Inc. Tumor necrosis factor receptor homologs and nucleic acids encoding the same
US7034132B2 (en) 2001-06-04 2006-04-25 Anderson David W Therapeutic polypeptides, nucleic acids encoding same, and methods of use
US6951738B2 (en) 1999-07-16 2005-10-04 Human Genome Sciences, Inc. Human tumor necrosis factor receptors TR13 and TR14
WO2001023553A2 (en) * 1999-09-29 2001-04-05 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Metastasis-associated antigen c4.4a
CA2391820A1 (en) 1999-10-22 2001-05-03 Zymogenetics, Inc. Umlr polypeptides
US7119165B2 (en) 2000-01-12 2006-10-10 Yale University Nogo receptor-mediated blockade of axonal growth
HUP0203863A3 (en) * 2000-01-12 2008-03-28 Univ Yale Nogo receptor-mediated blockade of axonal growth
AU2001241166A1 (en) * 2000-03-16 2001-09-24 Kyowa Hakko Kogyo Co. Ltd. Kidney repairing factor
EP1325130B1 (en) 2000-10-06 2010-02-24 Yale University Nogo receptor homologs
US20020111302A1 (en) * 2000-11-30 2002-08-15 Y. Tom Tang Novel nucleic acids and polypeptides
JP2005502317A (en) * 2001-03-22 2005-01-27 ジェネンテック・インコーポレーテッド Borkine polypeptide and nucleic acid
EP2280030A3 (en) 2001-04-10 2011-06-15 Agensys, Inc. Nucleic acids and corresponding proteins useful in the detection and treatment of various cancers
JP4181032B2 (en) 2001-05-25 2008-11-12 アムジェン インコーポレーテッド B7-related protein-2 molecule and use thereof
AU2002315404A1 (en) * 2001-07-16 2003-03-03 Eli Lilly And Company Extracellular junctional adhesion molecules
WO2003013583A1 (en) * 2001-08-10 2003-02-20 Genset S.A. Faxigen agonists and antagonists in the treatment of metabolic disorders
EP1541677A4 (en) 2002-07-10 2007-06-27 Takeda Pharmaceutical NEW PROTEINS AND THEIR USE
EP2277532A1 (en) 2002-09-11 2011-01-26 Genentech, Inc. Novel composition and methods for the treatment of immune related diseases
US20050283842A1 (en) * 2002-10-02 2005-12-22 Karsten Eulenberg Mipp1 homologous nucleic acids and proteins involved in the regulation of energy homeostatis
EP1576137A4 (en) * 2002-10-29 2010-06-30 Genentech Inc COMPOSITIONS AND METHODS FOR TREATING DISEASES RELATED TO THE IMMUNE SYSTEM
EP1578367A4 (en) * 2002-11-01 2012-05-02 Genentech Inc COMPOSITIONS AND METHODS FOR THE TREATMENT OF DISEASES RELATED TO THE IMMUNE SYSTEM
WO2005051988A2 (en) * 2003-03-03 2005-06-09 Genentech, Inc. Compositions and methods for the treatment of systemic lupus erythematosis
EP1744620A2 (en) * 2004-05-12 2007-01-24 Genentech, Inc. Novel gene disruptions, compositions and methods relating thereto
WO2006017673A2 (en) 2004-08-03 2006-02-16 Biogen Idec Ma Inc. Taj in neuronal function
JP4897690B2 (en) * 2004-10-12 2012-03-14 ジェネンテック, インコーポレイテッド CRIg polypeptide for prevention and treatment of complement related disorders
WO2007008732A2 (en) 2005-07-07 2007-01-18 Yale University Compositions and methods for suppressing axonal growth inhibition
PT2500030E (en) 2005-11-04 2015-09-24 Genentech Inc Use of complement pathway inhibitors to treat ocular diseases
PL2907827T3 (en) 2006-11-02 2019-03-29 Genentech, Inc. Humanized anti-factor D antibodies and uses thereof
AR066660A1 (en) 2007-05-23 2009-09-02 Genentech Inc PREVENTION AND TREATMENT OF EYE CONDITIONS ASSOCIATED WITH THEIR COMPLEMENT
EP3208612B1 (en) 2008-04-09 2019-09-18 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
CR20170001A (en) 2008-04-28 2017-08-10 Genentech Inc ANTI FACTOR D HUMANIZED ANTIBODIES
WO2009137605A2 (en) 2008-05-06 2009-11-12 Genentech, Inc. AFFINITY MATURED CRIg VARIANTS
EP2494351B1 (en) * 2009-10-26 2016-06-08 Externautics S.p.A. Colon and rectal tumor markers and methods of use thereof
WO2011051271A2 (en) 2009-10-26 2011-05-05 Externautics S.P.A. Prostate tumor markers and methods of use thereof
EP2494361B2 (en) 2009-10-26 2019-01-09 Externautics S.p.A. Ovary tumor markers and methods of use thereof
TWI888366B (en) 2013-07-16 2025-07-01 美商建南德克公司 Methods of treating cancer using pd-1 axis binding antagonists and tigit inhibitors
CR20160132A (en) 2013-08-12 2016-08-25 Genentech Inc COMPOSITIONS AND METHOD TO TREAT CONDITIONS ASSOCIATED WITH THE COMPLEMENT
KR20160147855A (en) 2014-05-01 2016-12-23 제넨테크, 인크. Anti-factor d antibody variants and uses thereof
MA41044A (en) 2014-10-08 2017-08-15 Novartis Ag COMPOSITIONS AND METHODS OF USE FOR INCREASED IMMUNE RESPONSE AND CANCER TREATMENT
PH12022553648A1 (en) 2015-09-25 2024-03-11 Genentech Inc Anti-tigit antibodies and methods of use
EP3368074A2 (en) 2015-10-30 2018-09-05 Hoffmann-La Roche AG Anti-factor d antibodies and conjugates
HK1257422A1 (en) 2015-10-30 2019-10-18 豪夫迈‧罗氏有限公司 Anti-factor d antibody variant conjugates and uses thereof
JP7589982B2 (en) 2020-12-25 2024-11-26 学校法人北里研究所 Peptides and their uses

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995014772A1 (en) * 1993-11-12 1995-06-01 Kenichi Matsubara Gene signature
US6066322A (en) * 1995-03-03 2000-05-23 Millennium Pharmaceuticals, Inc. Methods for the treatment of immune disorders
US5874230A (en) * 1996-07-10 1999-02-23 Tularik, Inc. Assays using TRAF2-associated protein kinase polypeptides
WO1998011138A1 (en) * 1996-09-12 1998-03-19 Human Genome Sciences, Inc. Chemokine alpha-4
WO1999046281A2 (en) * 1998-03-10 1999-09-16 Genentech, Inc. Novel polypeptides and nucleic acids encoding the same
AU5383498A (en) * 1996-12-05 1998-06-29 Human Genome Sciences, Inc. Human chemokine beta-13
WO1999037671A1 (en) * 1998-01-27 1999-07-29 Eli Lilly And Company Vegf related gene and protein
ES2389387T3 (en) * 1998-03-17 2012-10-25 Genentech, Inc. Homologous VEGF and BMP1 polypeptides
JP2002520068A (en) * 1998-07-15 2002-07-09 ヒューマン ジノーム サイエンシーズ, インコーポレイテッド Bone morphogenetic protein
CA2354325C (en) * 1998-12-07 2011-08-16 Zymogenetics, Inc. Growth factor homolog zvegf3

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0053758A2 *

Also Published As

Publication number Publication date
AU3514400A (en) 2000-09-28
WO2000053758A3 (en) 2001-02-08
WO2000053758A2 (en) 2000-09-14
KR20010103046A (en) 2001-11-17
JP2004516227A (en) 2004-06-03
CA2362427A1 (en) 2000-09-14

Similar Documents

Publication Publication Date Title
WO2000053758A2 (en) Compositions and methods for the treatment of immune related diseases
AU768230B2 (en) Methods and compositions for inhibiting neoplastic cell growth
AU2003270439B2 (en) Novel composition and methods for the treatment of immune related diseases
CA2503125C (en) Novel composition and methods for the treatment of immune related diseases
CA2586615C (en) Pro87299 (btla), and variants thereof, for treating immune related disorders
CA2503390A1 (en) Compositions and methods for the treatment of immune related diseases
CA2503748A1 (en) Compositions and methods for the treatment of natural killer cell related diseases
CA2476518A1 (en) Compositions and methods for the treatment of immune related diseases
CA2373915A1 (en) Methods and compositions for inhibiting neoplastic cell growth
WO2000073452A2 (en) Compositions and methods for the treatment of immune related diseases
WO2000070050A1 (en) Compositions and methods for the treatment of immune related diseases
CA2497334A1 (en) Novel compositions and methods for the treatment of immune related diseases
WO2001005972A1 (en) Compositions and methods for the treatment of immune related diseases
ZA200103885B (en) Methods and compositions for inhibiting neoplastic cell growth.
AU2003267096B2 (en) Novel compositions and methods for the treatment of immune related diseases
ZA200401536B (en) Compositions and methods for the treatment of immune related diseases
AU3107000A (en) Methods and compositions for inhibiting neoplastic cell growth
CA2390786A1 (en) Compositions and methods for the treatment of immune related diseases
WO2000015797A2 (en) Compositions and methods for the treatment of immune related diseases
CA2503759A1 (en) Compositions and methods for the treatment of rheumatoid arthritis
WO2001066740A2 (en) Compositions and methods for the treatment of immune related diseases
CA2384055A1 (en) Compositions and methods for the treatment of immune related diseases
WO2001019991A1 (en) Compositions and methods for the treatment of immune related diseases
US7307153B2 (en) Antibodies that bind PRO9912
EP1114154A2 (en) Compositions and methods for the treatment of immune related diseases

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20010820

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Withdrawal date: 20020815