EP1218522A2 - Cloning vectors - Google Patents

Abstract

Disclosed are methods for isolating transformed host cells which contain a vector incorporating a nucleic acid insert comprising the steps of: (a) providing a vector which comprises (i) a cytotoxic gene permitting positive selection, (e.g. a methyltransferase such as MspI) arranged such as to be insertionally inactivated by the incorporation of a nucleic acid insert (ii) a gene which provides a host cell transformed with the vector with a protective effect against a selection agent, but which does not degrade the selection agent (e.g. an antibiotic resistance gene such as TetA(c); (b) cloning a nucleic acid insert into the vector; (c) transforming host cells with the vector; (d) selecting transformed host cells in a single homogenous selection step, which step does not include growing the host cells on an agar medium.

Description

CLONING VECTORS

TECHNICAL FIELD

The present invention relates generally to methods and materials, particularly vectors, for use in cloning and recovering nucleic acids .

PRIOR ART

The construction of recombinant DNA molecules lies at the heart of modern molecular biology and typically involves the ligation of one or more DNA fragments or other sequences into suitable vectors, such as plasmids or bacteriophage vectors (1) .

The DNA fragments to be cloned are usually generated either by restriction endonuclease cleavage of genomic DNA, chemical synthesis or via amplification of DNA or cDNA with a thermostable DNA polymerase (1) . The products of the subsequent ligation reaction are introduced into a bacterial host through a range of alternative chemical, biological or physical transformation procedures (2) . Typically these bacteria are then grown and observed as colonies on agar plates The vector almost always contains an antibiotic

(e.g. the ampicillin) resistance gene which when expressed by the host bacteria is associated with degradation of the agar medium's antibiotic in the vicinity of the cells. Cells containing the vector clear a zone around the colony which has a reduced level of antibiotic. Appropriate host cells

(i.e. those containing recombinant plasmids containing insert DNA) are selected by an appropriate procedure, isolated, and transferred for growth on a suitable culture medium, which is usually liquid.

Since the introduction of these pioneering methods, it has become possible to differentiate between recombinant and non- recombinant molecules through the development of cloning vectors such as the pUC series (3) . These plasmids incorporate the 5' end of the E. coli lacZ gene into a multiple cloning site and provide a simple colourimetric complementation screen for recombinant plasmids.

More recently, positive-selection cloning vectors containing cytotoxic genes (4-11) have simplified the selection of recombinant plasmids by the complete elimination of re- ligated plasmids following transformation of the appropriate bacterial host. Thus, in the case of those plasmids encoding the cytotoxic ccdB gene, when a wild-type E. cσli gyrA+ strain is transformed by such plasmids, the product of the ccdB gene abolishes cell growth (6,7) . This cytotoxic effect can be alleviated by insertional inactivation of the ccdB gene leading to restoration of cell viability: only those cells containing recombinant plasmids give rise to colonies (6) . In a similar manner, plasmids encoding cytosine (C-5) - specific DNA methyltransferases (C5 Mtases) are incompatible with E. coli strains proficient in Mcr-mediated restriction

(4,12). Thus insertional inactivation of both monospecific (13) and multispecific C5 Mtase genes (4) , followed by transformation of an Mcr+ host such as E. coli DH5α, has been invoked for the positive selection of recombinant plasmids.

Other specific examples of 'positive selection' cloning vector kits and systems of the prior art include the Zero Background™ Cloning Kit range from Invitrogen Corporation, 1600 Faraday Ave . , Carlsbad, CA, 92008 USA (see website www.invitrogen.com) . Also the CloneSure™ Cloning Kit from CPG (see website www.cpg-biotech.com) . This is said to permit selection of transformant colonies, apparently from a selection plate, in a single step. The 'pZilch' system described by Schneider et al (1997) Gene 197(1-2), 336-341 uses the lethal pheS allele to permit positive selection of transfected mammalian cells on p-CI-Phe plates. DISCLOSURE OF THE INVENTION

The present inventors have devised methods and materials for cloning nucleic acid fragments which can be employed to avoid the need for the two step (plating, culturing) methods which form the basis for the systems described above. The methods and materials of the present invention permit the selection of hosts containing recombinant plasmids without the necessity of an intermediate plating step and single colony isolation. The use of the single step, homogenous system (referred to as a 'non-plating' system) permits the rapid isolation of recombinant plasmids and their inserts.

Briefly, the inventors have constructed vectors that combine (i) a gene giving positive selection (e.g. an inactivatable cytotoxic gene) and (ii) a gene which provides a host with protective effect against a selection agent, but which does not significantly degrade the selection agent in a medium in which the host is present (e.g. an antibiotic resistance gene which encodes a product which operates an efflux mechanism) .

The present inventors appreciated that host cells containing a vector as described above can be used in single step cloning procedures because in appropriate media they have a selective advantage over, in particular, untransformed host cells, and that this advantage (by contrast with the vectors of the prior art) does not appreciably diminish over time.

As discussed above, vectors are known (e.g. the Zero Background™ Cloning Kit) which comprise a lethal gene (ccdB gene) and an antibiotic resistance marker (Zeocin or Kanamycin) . Instructions provided with these kits require that transformed cells are spread out on LB plates which include the antibiotic in question, which will subsequently be degraded. None of these vectors, or those based in

Ampicillin, are suitable for the single step cloning system of the present invention. Particular aspects of the invention will now be discussed in more detail.

Thus one aspect of the invention provides a method for isolating a transformed host cell which contains a vector incorporating a nucleic acid insert, which method comprises the steps of:

(a) providing a vector which comprises (i) a gene permitting positive selection, which gene is a cytotoxic gene arranged such as to be insertionally inactivated by the incorporation of a heterologous nucleic acid insert into the. vector (ii) a gene which provides a host cell transformed with the vector with a protective effect against a selection agent, but which does not significantly degrade the selection agent in a medium in which the host is present;

(b) cloning a heterologous nucleic acid insert into the vector;

(c) transforming a population of host cells with the vector; (d) selecting host cells transformed with the vector in a liquid propagation medium comprising the selection agent.

Thus the present invention provides methods for isolating a transformed host cell which contains a vector incorporating a nucleic acid insert, which method does not include the step of growing the host cell on an agar medium and selecting the host cell therefrom. Put another way, the method is one in which transformed host cells which contains a vector incorporating a nucleic acid insert are selected from other host cells in a single homogenous selection step.

For a typical protocol of the prior art the stages prior to plating may be performed in the following timescale. Plas id DNA (cleaved with an appropriate restriction enzyme) is added to an excess of the DNA insert and incubated in the presence of a DNA ligase and appropriate buffer etc. for between 1 and 16 hours, at a temperature of between 4 and 20 degrees C. The products of the reaction are then added to an ice cold suspension of competent E. coli cells, held on ice for between 20-60minuteε , "heat shocked" at 42 degrees C for 2 minutes, and cultured at 37 degrees C for between 30-60 minutes .

Plating is normally performed by spreading the colonies on an agar plate containing an appropriate antibiotic and incubating at 37 degrees C overnight. Using a vector of the present invention (e.g. pMTetl) the plating stage is omitted and micro- or milligram quantities of recombinant plasmid DNA for plasmid characterisation can be produced by broth culture of in several hours giving an appreciable time saving.

Additionally the direct culture method may facilitate direct storage of desired clones after the addition of glycerol, since there is no requirement for the expansion of selected single colonies into a liquid broth prior to storage.

As used herein, "vector" is defined to include, inter alia, any plasmid, cosmid, phage or the like which can transform a prokaryotic or eukaryotic host, generally by existing extrachromosomally within the host . Typically the vector used herein will be an autonomous replicating plasmid with an origin of replication recognised by the host. Generally speaking, in the light of the present disclosure, those skilled in the art will be well able to construct vectors of the present invention based on those of the prior art . Suitable vectors can be constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, and other sequences as appropriate. For further details see, for example, Molecular Cloning: a Laboratory- Manual : 2nd edition, 3 Volumes, Sambrook et al , 1989, Cold Spring Harbor Laboratory Press (or later editions of the same work) or Current Protocols in Molecular Biology, Second

Edition, Ausubel et al . edε . , John Wiley & Sons, 1992 both of which are specifically incorporated herein by reference.

"Positive selection" is a process whereby something (e.g. a host cell) is selected on the basis of the presence of a particular marker trait or attribute. A "cytotoxic" gene is one which can impart a lethal phenotype to an appropriate host cell in which it is expressed i.e. proves lethal to a vector-transformed host.

"Insertional inactivation" of a gene is the process whereby the introduction of a nucleic acid insert into the vector impairs the activity of the gene or its expression product. Although generally this will mean that the insertion occurs within the promoter or coding sequence of the gene, there is no absolute requirement that this be the case provided that the insertion has the desired effect. Thus if placement of the nucleic acid insert disables the action of the cytotoxic gene, then insertional activation is said to have occurred and restoration of viability (hence positive selection) achieved.

"Heterologous nucleic acid" in this aspect is heterologous to the vector used in the process i.e. foreign or external to it. Generally the nucleic acid will generally be DNA or modified DNA. Vectors which contain heterologous nucleic acid inserts may be termed "recombinant" herein.

The terms "cloning", "transforming" and "selecting" are used herein because they will be well understood by those skilled in the art (see e.g. Sambrook et al, or Ausubel et al supra) .

Generally speaking a typical protocol for steps (b) - (d) above can be achieved by exposing the vector to a source of heterologous nucleic acid such as to ligate or otherwise incorporate a heterologous nucleic acid insert into the vector at an appropriate cloning site; exposing the ligation product (recombinant vector) to host cells under conditions whereby the vector is taken up by the cells such as to generate a heterogenous population of host cells, some of which contain the vector; exposing the population of cells to a liquid propagation medium comprising the selection agent whereby transformed host cells which contain vector incorporating the nucleic acid insert are selectively grown or propagated in the medium.

Some preferred embodiments of the invention are as follows :

Vectors and components

One preferred vector of the present invention i.s the pMTetl vector shown in Fig2 , having a sequence shown in SEQ ID No. 1. This includes (i) a modified version of the gene encoding the cytosine specific DNA methyltransferase Mspl , and (ii) a modified form of the pBR322 te A(C) tetracycline resistance gene. The combination of these two genes facilitates the selection of recombinant plasmids in broth cultures, thereby eliminating the need for bacterial plating.

Other cytotoxic genes for use in a positive selection cassette may be nucleases which have a cytotoxic effect. Other examples of cytotoxic genes lude the ccdB gene, when used with a wild-type E. coli gyrA+ strain. Other examples, such as the M.AquI and M.Hhal, are discussed in patent application WO97/01639 which is incorporated herein by reference. WO97/01639 describes inter alia nucleic acid constructs (e.g. pREVENTl) which encode methyltransferase (e.g. M.AquI) into which inserts can be cloned leading to loss of functionality. One vector disclosed therein was deposited as pET βL at NCIMB, 23 St Machar Drive, Aberdeen, AB2 1RY, UK under deposit number 40812 on 26 June 1996.

Thus, most preferably the gene is a DNA methyltransferase, more preferably a cytosine (C-5) -specific DNA methyltransferase (C5 Mtase) such as a monospecific (13) or multispecific C5 Mtase gene (4) , when used with an Mcr+ host such as E. coli DH5α. Most preferably the gene is the CCGG- specific C5 Mtase gene M . MspI which, when active, elicits a potent mcrBC response (12) . An example of such a sequence is shown in SEQ ID No . 2.

Various strains of host cells which may be used in the invention will be known to those skilled in the art . Examples include mcrBC (in which an endonuclease excludes sequences methylated at the 5' position of the Cytosine ring adjacent to a 3' cytosine) or mcrA (excludes methylate.d cytosines followed by guanine bases) .

Genes which provide a host cell transformed with the vector with a protective effect against a selection agent, but which do not significantly degrade the selection agent in a medium in which the host is present, may be selected from those antibiotic resistance genes which encode products which do not break down the antibiotic in question, but (for instance) operate via a membrane associated antibiotic efflux pump mechanism to lower intracellular concentrations while maintaining, or substantially maintaining, intercellular concentrations . Put another way the gene maintains viability of the transformed cells by keeping the concentration of the liquid medium's antibiotic at a minimum in the cells themselves, while keeping the concentration of antibiotic in the medium relatively constant .

Preferably a TetA gene is used. Some of these e.g. TetA(A) to TetA(E) are discussed in (14) . Preferably the TetA(C) gene is used.

Tetracyclin resistance genes have been used in vectors in the past. Examples include EP0544467 (Eli Lilly and Co.) and EP0502637 (ICI pic) . However these were not positive selection vectors, and were not suitable for the non-plating applications of the present invention.

In all cases, as those skilled in the art will appreciate, derivatives or other variants of the sequences specified above may also be used in the present invention, provided that they encode the requisite activity (e.g. inactivatable cytotoxic activity; gene which provides a host cell transformed with the vector with a protective effect against a selection agent, but which does not significantly degrade the selection agent in a medium in which the host is present; origin of replication recognised by the host; regulatory sequences; polylinker etc). Some examples of TetA(c) mutants are discussed in (14) . Generally speaking such variants will be substantially homologous to the 'wild type' or other sequence specified herein i.e. will share sequence similarity or identity therewith. Similarity or identity may be at the nucleotide sequence and/or encoded amino acid sequence level, and will preferably, be at least about 60%, or 70%, or 80%, most preferably at least about 90%, 95%, 96%, 97%, 98% or 99%. Sequence comparisons may be made using FASTA and FASTP (see Pearson & Lipman, 1988. Methods in Enzymology 183: 63- 98) . Parameters are preferably set, using the default matrix, as follows: Gapopen (penalty for the first residue in a gap) : -12 for proteins / -16 for DNA; Gapext (penalty for additional residues in a gap) : -2 for proteins / -4 for DNA; KTUP word length: 2 for proteins / 6 for DNA. Analysis for similarity can also be carried out using hybridisation. One common formula for calculating the stringency conditions required to achieve hybridization between nucleic acid molecules of a specified sequence homology is: T_m = 81.5°C + 16.6Log [Na+] + 0.41 (% G+C) - 0.63 (% formamide) - 600/#bp in duplex (Sambrook et al . , supra) .

Nucleic acid inserts

These may derive from cDNA, genomic DNA (all or part of an intron or exon thereof), amplified portions of DNA (e.g. from a PCR reaction), libraries, artificial chromosomes etc. or fragments of any of these (e.g. from a restriction digest) . Alternatively the nucleic acid may have been synthesised directly e.g. using an automated synthesiser.

The nucleic acid molecule may be provided isolated and/or purified from its natural environment, in substantially pure or homogeneous form, or free or substantially free of other nucleic acids e.g. a selected DNA fragment separated from a mixture of DNA fragments . The use of DNA chromatography (such as reverse phase HPLC) to predetermine the size of fragments to be cloned can enhance the efficiency of, and selectivity for, cloning large fragments.

The insert may be blunt ended, for instance as obtained from a restriction digest or PCR using a proof reading polymerase such as Pfu (Stratagene) or Vent (New England Biolabs) . In such cases the vector may be adapted so as to facilitate the ligation therein of blunt ended fragments (e.g. may be based on an Invitrogen-TA vector) .

Thus, for instance, a selected heterologous nucleic acid DNA fragment, or group of fragments, for use in the methods of the present invention may be provided as follows: (a) providing a mixture of DNA fragments; (b) separating the mixture of DNA fragments using RPHPLC (preferably MIPC) on the basis of fragment length.

Details of processes and systems for performing MIPC (such as the Transgenomic, Inc. WAVE^R™ DNA Fragment Analysis System can be found in any of W098/48913; W098/48914; W098/56797 or W098/56798, each of which is specifically incorporated herein by reference) .

Other aspects

In a further aspect of the present invention there is disclosed a rapid method for cloning and/or amplifying a target heterologous nucleic acid (e.g. DNA fragment) which method includes the step of ligating the target fragment into a vector as described above, transforming cells with the ligation product, and growing the cells in a suitable medium. Such a method may therefore comprise the steps of: (a) providing a vector which comprises (i) a gene permitting positive selection, which gene is a cytotoxic gene arranged such as to be insertionally inactivated by the incorporation of a heterologous nucleic acid insert into the vector (ii) a gene which provides a host cell transformed with the vector with a protective effect against a selection agent, but which does not significantly degrade the selection agent in a medium in which the host is present;

(b) cloning a heterologous nucleic acid insert into the vector;

(c) transforming a population of host cells with the vector,-

(d) selecting host cells transformed with the vector in a liquid propagation medium comprising the selection agent;

(e) propagating the host cells; and optionally (f) recovering the heterologous nucleic acid from the propagated host cells.

In a further aspect of the present invention there is disclosed a vector, suitable for use in the methods disclosed herein, which vector comprises (i) a gene permitting positive selection, which gene is a cytotoxic gene arranged such as to be insertionally inactivated by the incorporation of a heterologous nucleic acid insert into the vector (ii) a gene which provides a host cell transformed with the vector with a protective effect against a selection agent, but which does not significantly degrade the selection agent in a medium in which the host is present. Optionally the vector may comprise the further components described above.

In one embodiment the vector comprises a heterologous nucleic acid (a gene of interest, which it is desired to select, clone and/or amplify) inserted therein as described above. In a further aspect of the present invention there is provided a host cell comprising a vector of the invention as described herein.

In a further aspect of the present invention there is provided a composition comprising (a) a host cell comprising the vector, and (b) a liquid propagation medium comprising a selection agent as described herein.

In a further aspect of the present invention there is provided a kit comprising a vector of the invention as described herein and at least one further component, which may optionally be selected from (a) a host cell for use with the vector; (b) a liquid propagation medium; (c) a selection agent for use with the medium; (d) one or more primers capable of amplifying or isolating heterologous nucleic acid which is desired to select, clone and/or amplify; (e) one or more test nucleic acid inserts (which may consist of blunt ended double stranded DNA) .

In a further aspect of the present invention there is provided a system for performing the methods of the invention disclosed herein, which system comprises (a) a vector as described herein and at least one further component, which may optionally be selected from (b) a host cell for use with the vector; (c) a liquid propagation medium; (d) a selection agent for use with the medium.

The system of the present invention, which does not require a 'colony picking' step, may be readily automated using standard liquid handling apparatus. The system could be an adjunct to a WAVE^R™ DNA Fragment Analysis System wherein fractionated fragments are collected, ligated into vectors as described above, and these are used in the methods of the present invention. In a further aspect of the present invention there is provided use of a gene which provides a host cell transformed with a vector comprising that gene with a protective effect against a selection agent, but which does not significantly degrade the selection agent in a medium in which the host is present, in any one or more of (a) a method disclosed herein; (b) a process for the preparation of a vector, host cell, kit or system disclosed herein.

In a further aspect of the present invention there is disclosed a process for preparing a vector as discussed which process comprises the step of ligating (i) a gene permitting positive selection, which gene is a cytotoxic gene arranged such as to be insertionally inactivated by the incorporation of a heterologous nucleic acid insert into the vector (ii) a gene which provides a host cell transformed with the vector with a protective effect against a selection agent, but which does not significantly degrade the selection agent in a medium in which the host is present; or in each case a precursor thereof.

Also provided are corresponding processes for preparing host cells, kits, systems etc.

The invention will now be further described with reference to the following non- limiting Figures and Examples. Other embodiments of the invention will occur to those skilled in the art in the light of these.

FIGURES

Figures 1A-1D

The 4 step construction of the positive selection vector pMspINTetA.

Figure 2 Restriction map of pMTetl . All unique restriction sites are indicated. The EcoRV site within the M.MspI gene is used for the insertion of blunt ended DNA molecules.

Figure 3

Analysis of recombinant pMTetl plasmids, following direct transformations in broth culture. Chromatogram of φX174 Haelll fragments separated using a WAVE^R™ DNA Fragment Analysis System (Transgenomic, San Jose, USA) fitted with a preparative DNASEP^R™ column (Transgenomic, San Jose, USA) . The fragments were eluted as described in Materials and Methods. Those fractions used for ligation into pMTetl eluted with the following retention times: 6mins (118bp) , 9.2mins (234bp) and 14.5mins (603bp) .

SEQUENCES

SEQ ID No. 1: Complete nucleotide sequence of pMTetl (5086 bp) . The Tet gene is located on the vector at position 92- 1279 (396 amino acids) .

SEQ ID No. 2 / SEQ ID No . 3: Nucleotide sequence and encoded polypeptide (418 amino acids) of modified M.MspI gene. This corresponds to positions 3829-5083 on the vector.

SEQ ID Nos. 4-17: Various primers of the invention.

EXAMPLES

General molecular cloning procedures

All manipulations were carried out either according to the manufacturer's instructions (where stated) or as described in Sambrook et al (1) . All restriction enzymes were obtained from either Kramel Biotech (Cramlington, U.K) or Fermentas (Vilnius, Lithuania), T4 DNA ligase was purchased from Fermentas and all other reagents of the highest available purity were obtained from Sigma. The recombinant plasmid pNRT2 (18) encoding wild type M.MspJ was used as the starting point for the construction of all M.MspI derivatives. The tetA (C) gene was obtained as described below from pBR322

(Kramel Biotech) . E. coli DH5 and DH5 MCR (for the propagation of modification proficient plasmids) were obtained from Gibco Life Technologies (Paisley, Scotland) . Transformation experiments were carried out as described elsewhere (2) and plasmids encoding M.MspJ were analysed for authentic DNA methylation by overnight digestion with Mspl as described in Landry et al (19) . For transformation reactions in liquid cultures, 4μl of a 20μl ligation reaction were added to 200μl competent cells as described earlier. The cells were then added to 0.8ml Luria broth at 37°C for 1 hour and 50μl were subsequently diluted to a final volume of 5ml with medium supplemented with lOμg/ml tetracycline for overnight culture at 37°C. Plasmids were recovered by the alkaline lysis procedure (1) and were analysed using the appropriate combination of restriction enzymes and 1% agarose gels (1) .

Example 1 - construction of pMTetl.

The first step in the cloning procedure (see Fig.lA, step 1) was to remove the unique EcoKV site from within the coding sequence of the tetA (C) gene in pBR322 to produce pBR322ΔRV.

The section of DNA between the unique EcoRV and Nhel sites was removed with the corresponding restriction enzymes and was replaced with a short oligonucleotide duplex (Tet linker) which restored the TetA(C) protein sequence but altered the lie codon (to ATA from ATC) lying at the EcoRV site.

(underlined below) : 5' -ATAGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTG-3 ' (SEQ ID No. 6)

3' -TATCAGGTAAGGCTGTCGTAGCGGTCAGTGATACCGCACGACGATC-5' (SEQ ID No. 7)

The M.MspJ coding sequence was excised from pNRT2 , a derivative of pGEX2T harbouring the M.MspI open reading frame between the unique BamHI and EcoRI sites (18) and was inserted into the same sites within the multiple cloning site of pUC19 to generate pUCMspI . The sequence, which includes a set of unique restriction sites in between the HindiII and

BamHI sites of pUCMspI, was then removed by digestion with these two enzymes (Fig. IB step 2) followed by insertion of a short DNA duplex which abolishes the HindiII site, restores the BamHI site and introduces a unique Notl . The resultant plasmid is referred to as pUCMspIN. The sequence of this inserted duplex (NotI linker) is given below (the NotI site is underlined) :

5' AGCTGCTGTGCGGCCGCAATG 3' (SEQ ID No . 8)

3' CGACACGCCGGCGTTACCTAG 5' (SEQ ID No. 9)

The tetA (C) gene was inserted into pUCMspI as follows (Fig.lC step 3) . pBR322ΔRV was digested with EcoRI and PvuII and the fragment containing the tetA (C) gene was ligated into pUCMspI that had been digested with EcoRI and Seal (both PvuII and Seal leave blunt ends) to produce the recombinant plasmid pMspITetA.

Next, in order to eliminate a number of unique restriction sites from the final vector, the plasmid pMspINTetA was produced by ligating the ApaLJ-EcoRI fragment encoding M.MspI from pUCMspIN with the tetA (C) encoding ApaLI-EcoRI fragment from pMspITetA (Fig. ID step 4) . The resultant plasmid, pMspINTetA now contains unique ApaLI, EcoRV, EcoRI , HindiII and Sail sites. The HindiII site which is upstream of the tetA (C) coding sequence and downstream of the M.MspI gene was removed by cutting the plasmid with HindiII followed by an end-filling reaction catalysed by the Klenow fragment of DNA Polymerase I in the presence of dNTPs and the linearised plasmid was subsequently religated. The Sail site (the altered sequence is underlined below) was removed without altering the corresponding TetA(C) primary structure, by site directed mutagenesis using the Quick Change method

(Stratagene) according to the manufacturer's instructions with the following pair of complementary mutagenic primers :

5' -GCATAAGGGAGAGCGACGACCGATGCCCTTG-3 ' (SEQ ID No. 10)

3 ' -CGTATTCCCTCTCGCTGCTGGCTACGGGAAC-5 ' (SEQ ID No . 11)

The final plasmid, which confers tetracycline resistance to the host and expresses an active Mspl DNA methyltransferase is pMTetl and is shown in Fig.2.

Example 2 - DNA amplification reactions

Human genomic DNA was a generous gift from Dr. Ann Dalton of the Human Genetics Laboratory at Sheffield and the following primers were designed to amplify sections of the BRCA1 and BRCA2 genes. For BRCA1, amplification reactions were carried out with four sets of primers that would in each case introduce HindiII and Kpnl sites (underlined, but not used in the experiments detailed here) into the PCR products.

BRCAl-15 ' -GCGCAAGCTTGGTACCAACAGCCTATGGGAAGTAGTC-3 ' (SEQ ID No . 12)

BRCA1-25 ' -GCGCAAGCTTGGTACCCTCTGTGTTCTTAGACAGACA-3 ' (SEQ ID No. 13)

BRCAl-3 5 ' -GCGCAAGCTTGGTACCAACGAAACTGGACTCATTACT-3 ' (SEQ ID No. 14)

BRCA1-4 5 ' -GCGCAAGCTTGGTACCTTCACCTAAGTTTGAATCCAT- ' (SEQ ID

No. 15)

For BRCA2 the following primers were used:

BRCA2 -1 5'-CAGTTAACTGCTACTAAAACGGAG-3 ' (SEQ ID No . 16) BRCA2-2 5' -ATGGCTAAAACTGGTGATTTC-3' (SEQ ID No. 17)

The various primer combinations will generate the following PCR products: BRCAl-1 +BRCA1-2 = 370bp BRCAl-1 +BRCA1-4 = 680bp BRCAl-3 +BRCA1-2 = 890bp and BRCA2-1 + BRCA2-2 = 460bp.

All PCRs were performed with Taq polymerase (Promega) using the following programme: 94°C for 90s, 52°C for 2min, 72°C for 3min (30 cycles) . Each 50 μl reaction comprised 200ng genomic DNA, both primers at a final concentration of 0.2 μM, 1 unit Taq polymerase and 2.5mM MgCl₂.

The products were then treated with Vent polymerase (New England Biolabs) to remove Taq polymerase-induced overhangs as follows. Each PCR product (in 50μl) was purified by centrifuging through a MoBiTec Sephacryl S300 cartridge

(Kramel Biotech) as described by the manufacturer. To 40μl containing the purified material, 1 μl of a lOmM stock of dNTPs was added and the final volume made up to 50 μl after the addition of 1 unit of Vent polymerase in the manufacturer's Vent buffer (New England Biolabs) . The mixture was then held at 72 C for 20 minutes. After a second chromatography step using a MoBiTec Sephacryl S300 cartridge as before.

Example 3 - Production of recombinants

The purified PCR product and the cloning vector were ligated in a 5:1 molar ratio using 4units of T4 DNA ligase: in all cases the cloning vector was linearised with EcoRV. Finally 4 μl out of the 20 μl ligation reaction were used to transform 200 μl of competent E. coli DH5 (2).

Analysis of pUCMspI recombinants following insertion of BRCA1- and BRCA2 -derived amplicons at the EcoRV site was achieved by a PCR using two primers (PMl and PM2 ) which flank the EcoRV site in pUCMspI :

PMl 5 ' -CCGGAGCATGACATTTTATGTGCACCATTTCCGTGTCAGC-3 ' (SEQ ID No. 4, reprise)

PM2 5' -TTCGCTATTACGCCAGCTGGCG-3' (SEQ ID No . 5, reprise)

The successful outcome of a ligation was established by an appropriate increase in the size of the amplified product. Non-recombinant pUCMspI as a template yields a product of 870bp. All PCR products were analysed on 1% agarose gels (1) .

The result of insertion of three blunt end BRCA1-derived and one BRCA2 -derived PCR products into the unique EcoRV site of pUCMspI, followed by the transformation of E. coli DH5 , revealed that only recombinant plasmids were obtained. In this experiment plasmids were recovered from single colonies on agar plates supplemented with ampicillin (1) .

More specifically, the recombinant nature of the plasmids was determined by amplification of an internal stretch of the M.MspJ gene obtained from the general cloning vector pUC19.

To do this, recombinant plasmids generated from amplified BRCA1 and BRCA 2 fragments in pUCMspI were analysed. Amplified, blunt ended DNA fragments were ligated with EcoRV digested plasmid and recombinant plasmids were analysed by the PCR. For each amplification two primers: PMl (5' -CCGGAGCATGACATTTTATGTGCACCATTTCCGTGTCAGC-3 ' ) (SEQ ID No. 4)

and

PM2 (5' -TTCGCTATTACGCCAGCTGGCG-3' ) (SEQ ID No . 5)

flanking the unique EcoRV restriction site were used to amplify the inserted DNA. In the absence of an inserted fragment, a product of 870bp was obtained, whilst the following sizes of PCR products were present in the recombinant plasmids. (BRCAl-3 + BRCA1-2), 176-Obp (870 + 890); (BRCAl-1 + BRCA1-2), 1240bp (870 + 370); (BRCAl-1 + BRCA1-4), 1550bp (870 + 680) and(BRCA2-l + BRCA2-2), 1330bp (870 + 460) . The molecular weight marker was a lkbp DNA ladder from Fermentas (Lithuania) (results not shown) . Thus all plasmids gave products larger than expected (compared with non-recombinant pUCMspI) consistent with the known sizes of the BRCA1- (or BRCA2-) derived amplicons.

The EcoRV site in pUCMspI lies within that region of the

M.MspI gene encoding the DNA sequence recognition domain of the enzyme. Therefore disruption of this section of the coding sequence, as expected, abolishes DNA methyltransferase activity of M.MspI. The consequence of this loss of phenotype is that the host encoded McrBC enzyme no longer targets the recombinant plasmid for nucleolytic attack. No colonies were recovered in parallel experiments in which pUCMspI was used to transform E. coli DH5α.

This experiment suggested that the M.MspI gene was one suitable candidate for the development of a positive selection vector and could be combined with tetracycline resistance in order to develop a cloning system that would eliminate the need for single colony isolation. The sequence of steps outlined in Figure 1 show how such a plasmid was assembled. The final plasmid is derived from the popular cloning vector pUC19 and combines the gene encoding the M.MspI gene with a modified form of the tetA (C) gene from pBR322. The final plasmid construct was modified in order to eliminate restriction sites flanking the M.MspI gene and within the tetA (C) gene. These modifications had no observable effect on the phenotypes associated with these two genes as judged by complete methylation of pMTetl isolated from E. coli DH5 MCR and the expected resistance of pMTetl transformants to tetracycline (unpublished results) .

The unique EcoRV site in the M.MspI gene was chosen as a general site for the insertion of blunt end DNA molecules generated either by proof-reading DNA polymerases or via restriction digestion with enzymes such as Haelll. Insertion of a range of blunt-end DNA fragments into the EcoRV site of pMTetl abolished the activity of the M.MspI gene, thereby enabling the recombinant (but not intact pMTetl) to escape McrBC-mediated restriction in E. coli DH5 . Expression of tetracycline resistance in liquid culture ensures that the intracellular level of the antibiotic, to which the host is exposed, is kept to a minimum and that the antibiotic concentration in the medium remains essentially constant. This is a consequence of the expression of the membrane- associated antibiotic efflux pump encoded by the tetA (C) gene

(14) . This represents a shift from the use of the more frequently employed ampicillin resistance gene in cloning vectors. The latter resistance phenotype is associated with b-lactamase mediated degradation of the drug in the culture medium. Thus, the combination of positive selection and tetracycline resistance in the pMTetl plasmid circumvents colony isolation.

The success of the combined use of positive selection and tetracycline selection can be seen clearly in the following experiment using agarose gel analysis of plasmids recovered from broth cultures following direct ligation of φX174 Haelll fragments into pMTetl. Plasmid preparations were digested to completion with Xbal and EcoRI . The samples run were pMTetl; a complex mixture of plasmids recovered following ligation of a mixture of φX174 DNA digested with Haelll and pMTetl; the product of the ligation of a purified 118bp Haelll fragment into pMTetl; a pMTetl recombinant containing a 234bp Haelll fragment and a 603bp Haelll fragment was ligated with pMTetl (plus molecular weight standards) .

The analysis of cells from broth cultures following the ligation of blunt ended restriction fragments clearly showed that only those cells harbouring recombinant plasmids are viable. No evidence of background non-recombinants was observed. It is likely that following a PCR, especially when a DNA polymerase lacking proofreading activity is employed, mutations and artifacts will occasionally arise. If this is a concern, then, (as demonstrated above) the combination of ampicillin resistance with the M.MspI gene can be used for the isolation of single colonies.

Example 4 - combination with nucleic acid chromatography

Size-dependent fractionation of Haelll digested φX174

(Promega) , blunt ended DNA fragments, was carried out using a DNASEP^R™ column. 2μg of the DNA fragments dissolved in water was injected on to a preparative scale (50mm x 7.8 mm ID) DNASEP^R™ column of bed volume 1.5ml (Transgenomic) and the fragments were eluted at a flow rate of 0.9ml/min. A linear gradient of acetonitrile in triethylammonium acetate (TEAA) was applied as follows: buffer A comprised 0. IM TEAA, pH 7.0 (100ml of IM TEAA with 0.25ml acetonitrile, in a total volume of 1 litre) and buffer B comprised 0. IM TEAA containing 25% acetonitrile (v/v) , pH 7.0 (100ml of IM TEAA with 250ml acetonitrile, in a final volume of 1 litre) . 90 μl fractions were collected and the acetonitrile removed by vacuum centrifugation for 30 mins and 14 μl were used for each ligation reaction.

The potential application of pMTetl in the construction of plasmid libraries is illustrated in using the experiment from Example 3 where DNA fragments generated from a Haelll digestion of φX174 DNA were ligated into pMTetl. In one experiment the blunt fragments were ligated as a mixture and in a second experiment, the fragments were initially size- fractionated using MIPC Sep chromatography prior to ligation of the individual DNA fragments . It is immediately apparent that when a pool of fragments, differing in length by an order of magnitude, are ligated with pMTetl, the smaller restriction fragments are selectively cloned. This is a commonly observed phenomenon in the construction of complex DNA libraries (1) .

This size bias can be overcome relatively simply by prior fractionation of the fragments to be cloned (Fig.3) . Indeed the size fractionation of φX174 DNA by denaturing HPLC followed by selective ligation eradicates the problem of size bias. It is likely however, that those recombinants that reduce the growth rate of the host will be under-represented using this all-liquid approach and therefore in such cases colony isolation may be preferred.

In conclusion, a positive selection vector based on a combination of a C5 Mtase gene and the tetA (C) gene derived from pBR322 permits the isolation of recombinant plasmids in liquid culture which for the first time eliminates the need to isolate single, antibiotic-resistant colonies and therefore significantly accelerates recombinant plasmid isolation. The plasmid particularly facilitates the rapid cloning of DNA molecules generated by proofreading DNA polymerases and restriction digests using enzymes that produce non- cohesive termini. Furthermore, this novel cloning vector can be readily employed in conjunction with chromatographic DNA fractionation (15-17) , for the construction of size-selected recombinant molecules.

REFERENCES

1. Sambrook, J. , Fritsch, E.F. and Maniatis, T. (1989) in Molecular Cloning: A Laboratory Manual , Second Edition. (Cold Spring Harbour Laboratory Press, New York) .

2. DNA Cloning Volume I (1985) Ed. Glover D. I-RL Press.

3. Vieira, J. and Messing, J. (1982) The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19, 259-68

4. Noyer-Weidner, M. and Reiners-Schramm, L. (1988) Highly efficient positive selection of recombinant plasmids using a novel r lB-based Escherichia coli K-12 vector system. Gene

66, 269-78

5. Arakawa, Y., Wacharotayankun, R. , Ohta, M. , Shoji, K., Watahiki, M., Horii, T. and Kato, N. (1991) Construction of a novel suicide vector: selection for Escherichia coli HB101 recombinants carrying the DNA insert. Gene 104, 81-4

6. Bernard, P., Gabant, P., Bahassi, E.M. and Couturier, M. (1994) Positive-selection vectors using the F plasmid ccdB killer gene Gene 148, 71-74

7. Bernard, P. 1995. New ccdB positive-selection cloning vectors with kanamycin or chloramphenicol selectable markers . Gene 162, 159-60 8. Deyev, S.M., Yazynin, S.A., Kuznetsov, D.A., Jukovich, M. and Hartley, R.W. (1998) Ribonuclease-charged vector for facile direct cloning with positive selection. Mol Gen Genet

259, 379-82

9. Schlieper, D., von Wilcken-Bergmann, B., Schmidt, M., Sobek, H. and Muller-Hill, B. (1998) A positive selection vector for cloning of long polymerase chain reaction fragments based on a lethal mutant of the crp gene of Escherichia coli . Anal Biochem 257, 203-9

10. Gal,J., Szekeres, S., Schnell, R., Pongor, S., Simoncsits, A. and Kalman, M. (1999) A positive selection cloning system based on the gl tS gene of Escherichia coli . Anal Biochem 266, 235-8

11. Yazynin, S., Lange, H., Mokros, T. , Deyev, S. and Lemke, H. (1999) A new phagemid vector for positive selection of recombinants based on a conditionally lethal barnase gene. FEBS Lett 452, 351-4

12. Raleigh, E. A. and Wilson, G. (1986). Escherichia coli K- 12 restricts DNA containing 5-methylcytosine. Proc Natl Acad Sci U S A 83, 9070-4.

13. Hornby, D.P. Selection of recombinant molecules (1998) U.K. Patent No. GB2316947.

14. McNicholas, P., Chopra, I. and Rothstein, D.M. (1992) Genetic analysis of the tetA(C) gene on plasmid pBR322. J

Bacteriol 174, 7926-33

15. Huber, C.G., Oefner, P.J., Preuεs, E. and G.K. Bonn

(1993) High-resolution liquid chromatography of DNA fragments on non-porous poly (styrene-divynilbenzene) particles Nucleic Acids Research 21, 1061-1066.

16. Huber, C.G., Oefner, P.J., and G.K. Bonn. (1995) Rapid and accurate sizing of DNA fragments by ion-pair chromatography on alkylated nonporous poly (styrene- divynilbenzene Analyti cal Chemistry 67, 578-585.

17. Kuklin, A., Davis, A. P., Hecker, K.H., Gjerde, D.T. and Taylor, P.D. (1999) A novel technique for rapid automated genotyping of DNA polymorphisms in the mouse. Mol Cell Probes

13, 239-242

18. Taylor, C, Ford, K. , Connolly, B.A. and Hornby, D. P. (1993) Determination of the order of substrate addition to MspJ DNA methyltransferaεe uεing a novel mechanism-based inhibitor. Biochem . J. 291, 493-504.

19. Landry, D., Barsomian, J. M., Feehery, G. R. and Wilson, G. G. (1992) Characterization of type II DNA- methyltransferaseε . Meth . Enzymol . 216, 244-259.

Claims

Claims

1 A method for isolating a transformed host cell which contains a vector incorporating a nucleic acid insert, which method comprises the steps of:

(a) providing a vector which comprises (i) a gene permitting positive selection, which gene is a cytotoxic gene arranged such as to be insertionally inactivated by the incorporation of a heterologous nucleic acid insert into the vector (ii) a gene which provides a host cell transformed with the vector with a protective effect against a selection agent, but which does not significantly degrade the selection ag-ent in a medium in which the host is present;

(b) cloning a heterologous nucleic acid insert into the vector;

(c) transforming a population of host cells with the vector;

(d) selecting host cells transformed with the vector in a single homogenous selection step, which step does not include growing the host cells on an agar medium.

2 A method as claimed in claim 1 wherein step (b) is carried out by exposing the vector to a source of heterologous nucleic acid such as to ligate or otherwise incorporate a heterologous nucleic acid insert into the vector at a cloning site in the vector to form a recombinant vector.

3 A method as claimed in claim 1 or claim 2 wherein step (c) is carried out by exposing the recombinant vector to host cells under conditions whereby the vector is taken up by the cells such as to generate a heterogenous population of host cells .

4 A method as claimed in any one of the preceding claims wherein step (d) is carried out by selecting host cells transformed with the vector in a liquid propagation medium compriεing the εelection agent. 5 A method as claimed in any one of the preceding claims wherein the selected cells are subsequently treated with glycerol .

6 A method for cloning and/or amplifying a target nucleic acid which method includes the step of performing a method aε claimed in any one of the preceding claims wherein the heterologous nucleic acid insert cloned into the vector comprises the target nucleic acid.

7 A method aε claimed in claim 6 which further comprises the steps of propagating the selected host cells and optionally recovering the target nucleic acid from the propagated host cells.

8 A method as claimed in any one of the preceding claimε wherein the heterologous nucleic acid insert is selected from the group conεisting of: cDNA; genomic DNA; amplified portions of DNA from a PCR reaction; a fragment of any of these from a restriction digest.

9 A method as claimed in claim 8 wherein the heterologous nucleic acid insert is blunt ended.

10 A method as claimed in claim 8 or claim 9 wherein the heterologous nucleic acid insert is obtained by uεe of DNA chromatography to predetermine itε εize.

11 A method aε claimed in claim 10 comprising the steps of:

(a) providing a mixture of DNA fragments;

(b) separating the mixture of DNA fragments on the basis of fragment length;

(c) performing a method aε claimed in claim 8 or claim 9 wherein the heterologous nucleic acid insert is obtained from the separated mixture of DNA fragments. 12 A vector adapted for use in the method of any one of the preceding claimε, which vector compriεeε (i) a gene permitting positive selection, which gene is a cytotoxic gene arranged such as to be insertionally inactivated by the incorporation of a heterologous nucleic acid insert into the vector (ii) a gene which provides a host cell transformed with the vector with a protective effect against a selection agent, but which does not significantly degrade the selection agent in a medium in which the host is preεent .

13 A vector as claimed in claim 12 which further comprises any one of more of the following: an origin of replication recognised by the hoεt; a promoter sequence,- a terminator sequence; a polyadenylation sequence; an enhancer sequence.

14 A vector as claimed in claim 12 or claim 13 wherein the cyotoxic gene encodes a nuclease .

15 A vector as claimed in any one of claims 12 to 14 wherein the cyotoxic gene encodes a DNA methyltransferase .

16 A vector as claimed in claim 15 wherein the cyotoxic gene encodes a cytosine (C-5) -specific DNA methyltransferase nuclease

17 A vector as claimed in claim 15 or claim 16 wherein the cyotoxic gene is selected from the group consisting of CCGG- specific C5 Mtase gene M.MspI; a modified version of the gene encoding the cytosine specific DNA methyltransferase Mspl ; ccdB gene,- M.AquI or M.Hhal

18 A vector as claimed in claim 17 wherein the modified M.MspI gene encodes the polypeptide sequence encoded by the nucleotide sequence shown in SEQ ID No . 2.

19 A vector aε claimed in claim 17 or claim 18 wherein the M.MspI gene is insertionally inactivatable by insertion a nucleic acid molecule into a unique EcoRV site therein.

20 A vector as claimed in any one of claims 12 to 19 wherein the gene which provides a host cell transformed with the vector with a protective effect against a selection agent, but which does not significantly degrade the selection agent in a medium in which the hoεt is present, is an antibiotic resistance gene which encodes a product which does not break down the selection agent and which operates aε a membrane associated antibiotic efflux pump capable of lowering the intracellular concentration of the selection agent while substantially maintaining the intercellular concentration thereof.

21 A vector as claimed in claim 20 wherein the antibiotic resistance gene iε the TetA gene or a modified form thereof.

22 A vector aε claimed in claim 21 wherein the antibiotic reεistance gene encodes encodes the polypeptide sequence encoded by the nucleotide sequence shown in SEQ ID No . 1 poεitionε 92-1279.

23 A vector as claimed in any one of claims 12 to 22 which is the pMTetl vector shown in SEQ ID No. 1.

24 A recombinant vector comprising the vector of claim 23 which further comprises a heterologous nucleic acid inserted therein.

25 A hoεt cell comprising the vector of any one of claims 12 to 24.

26 A host cell as claimed in claim 25 which iε selected from the group consisting of: E. coli gyrA+ strain; an Mcr+ hoεt εuch as E. coli DH5 . 27 A composition comprising (a) a host cell as claimed in claim 25 or claim 26, and (b) a liquid propagation medium comprising the selection agent.

28 A kit comprising a vector aε claimed in any one of claims 12 to 24 and at least one further component selected from (a) a host cell for use with the vector; (b) a liquid propagation medium; (c) a εelection agent for use with the medium; (d) one or more primers capable of amplifying or isolating heterologous nucleic acid which is desired to select, clone and/or amplify,- (e) one or more test nucleic acid inεerts .

29 A system for cloning and/or amplifying a target nucleic acid, which system comprises (a) a vector as claimed in any one of claims 12 to 24; (b) a host cell for use with the vector; (c) a liquid propagation medium; (d) a εelection agent for use with the medium.

30 A DNA fragment analysis system, which syεtem comprises

(a) means for separating a mixture of DNA fragments on the basis of fragment length to provide a target nucleic acid;

(b) a syεtem aε claimed in claim 29 for cloning and/or amplifying the target nucleic acid.

31 A proceεε for preparing the vector of any one of claimε 12 to 24 which process comprises the step of ligating (i) a gene permitting positive selection, which gene is a cytotoxic gene arranged such as to be insertionally inactivated by the incorporation of a heterologous nucleic acid insert into the vector (ii) a gene which provides a hoεt cell transformed with the vector with a protective effect against a selection agent, but which does not signi icantly degrade the selection agent in a medium in which the host is present; or in either caεe a precurεor thereof . with a vector comprising that gene with a protective effect against a selection agent, but which does not significantly degrade the selection agent in a medium in which the hoεt is present, in any of (a) a method as claimed in any one of claims 1 to 11; (b) a procesε aε claimed in claim 31.