CROSS-REFERENCES TO RELATED APPLICATIONS
This application is related to U.S. Patent No. 5,591,631; U.S. Patent No.
5,677,274; and USSN 08/937,276, filed September 15, 1997; each herein incorporated by
reference in its entirety. This application claims priority to USSN 60/155,961, filed
September 24, 1999, which is herein incorporated by reference in its entirety.
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER
FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT
Not applicable.
BACKGROUND OF THE INVENTION
Anthrax toxin is a three-part toxin secreted by Bacillus anthracis consisting of
protective antigen (PA, 83 kDa), lethal factor (LF, 90 kDa) and edema factor (EF, 89 kDa)
(Smith, H., et al., J. Gen. Microbiol., 29:517-521 (1962); Leppla, S.H., Sourcebook of
bacterial protein toxins, p. 277-302 (1991); Leppla, S.H., Handb. Nat. Toxins, 8:543-572
(1995)), which are individually non-toxic. The mechanism by which individual toxin
components interact to cause toxicity was recently reviewed (Leppla, S.H., Handb. Nat.
Toxins, 8:543-572 (1995)). Protective antigen, recognized as central, receptor-binding
component, binds to an unidentified receptor (Escuyer, V., et al., Infect. Immun., 59:3381-3386
(1991)) and is cleaved at the sequence RKKR167 (SEQ ID NO:1) by cell-surface furin or
furin-like proteases (Klimpel, K.R., et al., Proc. Natl. Acad. Sci. USA, 89:10277-10281
(1992); Molloy, S.S., et al., J. B. Chem., 267:16396-16402 (1992)) into two fragments: PA63,
a 63 kDa C-terminal fragment, which remains receptor-bound; and PA20, a 20 kDa N-terminal
fragment, which is released into the medium (Klimpel, K.R., et al., Mol. Microbiol.,
13:1094-1100 (1994)). Dissociation of PA20 allows PA63 to form heptamer (Milne, J.C., et
al., J. Biol. Chem., 269:20607-20612 (1994); Benson, E.L., et al., Biochemistry, 37:3941-3948
(1998)) and also bind LF or EF (Leppla, S.H., et al., Bacterial protein toxins, p. 111-112
(1988)). The resulting hetero-oligomeric complex is internalized by endocytosis
(Gordon, V.M., et al., Infect. Immun., 56:1066-1069
(1988)), and acidification of the vesicle causes insertion of the PA63 heptamer into
the endosomal membrane to produce a channel through which LF or EF translocate to the
cytosol (Friedlander, A.M., J. Biol. Chem., 261:7123-7126 (1986)), where LF and EF
induce cytotoxic events.
Thus, the combination of PA + LF, named anthrax lethal toxin, kills
animals (Beal, F.A., et al., J. Bacteriol., 83:1274-1280 (1962); Ezzell, J.W., et al., Infect.
Immun., 45:761-767 (1984)) and certain cultured cells (Friedlander, A.M., J. Biol. Chem.,
261:7123-7126 (1986); Hanna, P.C., et al., Mol. Biol. Cell., 3:1267-1277 (1992)), due to
intracellular delivery and action of LF, recently proven to be a zinc-dependent
metalloprotease that is known to cleave at least two targets, mitogen-activated protein
kinase kinase 1 and 2 (Duesbery, N.S., et al., Science, 280:734-737 (1998); Vitale, G., et
al., Biochem. Biophys. Res. Commun., 248:706-711 (1998)). The combination ofPA+EF,
named edema toxin, disables phagocytes and probably other cells, due to the intracellular
adenylate cyclase activity of EF (Leppla, S.H., Proc. Natl. Acad. Sci. USA., 79:3162-3166
(1982)).
LF and EF have substantial sequence homology in amino acid (aa) 1-250
(Leppla, S.H., Handb. Nat. Toxins, 8:543-572 (1995)), and a mutagenesis study showed
this region constitutes the PA-binding domain (Quinn, C.P., et al., J. Biol. Chem.,
166:20124-20130 (1991)). Systematic deletion of LF fusion proteins containing the
catalytic domain of Pseudomonas exotoxin A established that LF aa 1-254 (LFn) are
sufficient to achieve translocation of "passenger" polypeptides to the cytosol of cells in a
PA-dependent process (Arora, N., et al., J. Biol. Chem., 267:15542-15548 (1992); Arora,
N., et al., J. Biol. Chem., 268:3334-3341 (1993)). A highly cytotoxic LFn fusion to the
ADP-ribosylation domain of Pseudomonas exotoxin A, named FP59, has been developed
(Arora, N., et al., J. Biol. Chem., 268:3334-3341 (1993)). When combined with PA,
FP59 kills any cell type which contains receptors for PA by the mechanism of inhibition
of initial protein synthesis through ADP ribosylating inactivation of elongation factor 2
(EF-2), whereas native LF is highly specific for macrophages (Leppla, S.H., Handb. Nat.
Toxins, 8:543-572 (1995)). For this reason, FP59 is an example of a potent therapeutic
agent when specifically delivered to the target cells with a target-specific PA.
The crystal structure of PA at 2.1 Å was solved by X-ray diffraction (PDB
accession 1ACC) (Petosa, C., et al., Nature, 385:833-838 (1997)). PA is a tall, flat
molecule having four distinct domains that can be associated with functions previously
defined by biochemical analysis. Domain 1 (aa 1-258) contains two tightly bound
calcium ions, and a large flexible loop (aa 162-175) that includes the sequence RKKR167
(SEQ ID NO:1), which is cleaved by furin during proteolytic activation. Domain 2 (aa 259-487)
contains several very long β-strands and forms the core of the membrane-inserted
channel. It is also has a large flexible loop (aa 303-319) implicated in membrane insertion.
Domain 3 (aa 488-595) has no known function. Domain 4 (aa 596-735) is loosely associated
with the other domains and is involved in receptor binding. For cleavage at RKKR167 (SEQ
ID NO:1) is absolutely required for the subsequent steps in toxin action, it would be of great
interest to engineer it to the cleavage sequences of some disease-associated proteases, such as
matrix metalloproteinases (MMPs) and proteases of the plasminogen activation system (e.g.,
t-PA, u-PA, etc., see, e.g., Romer et al., APMIS 107:120-127 (1999)), which are typically
overexpressed in tumors.
MMPs and plasminogen activators are families of enzymes that play a leading
role in both the normal turnover and pathological destruction of the extracellular matrix,
including tissue remodeling (Birkedal-Hansen, H., Curr Opin Cell Biol, 7:728-735 (1995);
Alexander, C.M., et al., Development, 122:1723-1736 (1996)), angiogenesis (Schnaper, H.W,
et al., J Cell Physiol, 156:235-246 (1993); Brooks, P.C., et al., Cell, 92:391-400 (1998)),
tumor invasion and metastasis formation. The members of the MMP family are multidomain,
zinc-containing, neutral endopeptidases and include the collagenases, stromelysins,
gelatinases, and membrane-type metalloproteinases (Birkedal-Hansen, H., Curr Opin Cell
Biol., 7:728-735 (1995)). It has been well documented in recent years that MMPs and
proteins of the plasminogen activation system, e.g., plasmiogen activator receptors and
plasminogen activators, are overexpressed in a variety of tumor tissues and tumor cell lines
and are highly correlated to the tumor invasion and metastasis (Crawford, H.C., et al.,
Invasion Metastasis, 14:234-245 (1995); Garbisa, S., et al., Cancer Res., 47:1523-1528
(1987); Himelstein, B.P., et al., Invest. Methods, 14:246-258 (1995); Juarez, J., et al., Int. J.
Cancer, 55:10-18 (1993); Kohn, E.C., et al., Cancer Res., 55:1856-1862 (1995); Levy, A.T.,
et al., Cancer Res., 51:439-444 (1991); Mignatti, P., et al., Physiol. Rev., 73:161-195 (1993);
Montgomery, A.M., et al., Cancer Res., 53:693-700 (1993); Stetler-Stevenson, W.G., et al.,
Annu Rev Cell Biol, 9:541-573 (1993); Stetler-Stevenson, W.G., Invest. Methods, 14:4664-4671
(1995); Davidson, B., et al., Gynecol. Oncol., 73:372-382 (1999); Webber, M.M., et al.,
Carcinogenesis, 20:1185-1192 (1999); Johansson, N., et al., Am J Pathol, 154:469-480
(1999); Ries, C., et al., Clin Cancer Res., 5:1115-1124 (1999); Zeng, Z.S., et al.,
Carcinogenesis, 20:749-755 (1999); Gokaslan, Z.L., et al., Clin Exp Metastasis, 16:721-728
(1998); Forsyth, P.A., et al., Br J
Cancer, 79:1828-1835 (1999); Ozdemir, E., et al., J Urol, 161:1359-1363 (1999);
Nomura, H., et al., Cancer. Res., 55:3263-3266 (1995); Okada, Y., et al., Proc. Natl.
Acad. Sci. USA., 92:2730-2734 (1995); Sato, H., et al., Nature, 370:61-65 (1994); Chen,
W.T., et al., Ann N Y Acad Sci, 878:361-371 (1999); Sato, T., et al., Br J Cancer,
80:1137-43 (1999); Polette, M., et al., Int J Biochem cell Biol., 30:1195-1202 (1998);
Kitagawa, Y., et al., J Urol., 160:1540-1545; Nakada, M., et al., Am J Pathol., 154:417-428
(1999); Sato, H., et al., Thromb Haemost, 78:497-500 (1997)).
Among the MMPs, MMP-2 (gelatinase A), MMP-9 (gelatinase B) and
membrane-type 1 MMP (MT1-MMP) are reported to be most related to invasion and
metastasis in various human cancers (Crawford, H.C., et al., Invasion Metastasis, 14:234-245
(1995); Garbisa, S., et al., Cancer Res., 47:1523-1528 (1987); Himelstein, B.P., et
al., Invest. Methods, 14:246-258 (1995); Juarez, J., et al., Int. J. Cancer, 55:10-18 (1993);
Kohn, E.C., et al., Cancer Res., 55:1856-1862 (1995); Levy, A.T., et al., Cancer Res.,
51:439-444 (1991); Mignatti, P., et al., Physiol. Rev., 73:161-195 (1993); Montgomery,
A.M., et al., Cancer Res., 53:693-700 (1993); Stetler-Stevenson, W.G., et al., Annu Rev
Cell Biol, 9:541-573 (1993); Stetler-Stevenson, W.G., Invest. Methods, 14:4664-4671
(1995); Davidson, B., et al., Gynecol. Oncol., 73:372-382 (1999); Webber, M.M., et al.,
Carcinogenesis, 20:1185-1192 (1999); Johansson, N., et al., Am J Pathol, 154:469-480
(1999); Ries, C., et al., Clin Cancer Res., 5:1115-1124 (1999); Zeng, Z.S., et al.,
Carcinogenesis, 20:749-755 (1999); Gokaslan, Z.L., et al., Clin Exp Metastasis, 16:721-728
(1998); Forsyth, P.A., et al., Br J Cancer, 79:1828-1835 (1999); Ozdemir, E., et al., J
Urol, 161:1359-1363 (1999); Nomura, H., et al., Cancer. Res., 55:3263-3266 (1995);
Okada, Y., et al., Proc. Natl. Acad. Sci. USA., 92:2730-2734 (1995); Sato, H., et al.,
Nature, 370:61-65 (1994); Chen, W.T., et al., Ann N Y Acad Sci, 878:361-371 (1999);
Sato, T., et al., Br J Cancer, 80:1137-43 (1999); Polette, M., et al., Int J Biochem cell
Biol., 30:1195-1202 (1998); Kitagawa, Y., et al., J Urol., 160:1540-1545; Nakada, M., et
al., Am J Pathol., 154:417-428 (1999); Sato, H., et al., Thromb Haemost, 78:497-500
(1997)). The important role of MMPs during tumor invasion and metastasis is to break
down tissue extracellular matrix and dissolution of epithelial and endothelial basement
membranes, enabling tumor cells to invade through stroma and blood vessel walls at
primary and secondary sites. MMPs also participate in tumor neoangiogenesis and are
selectively upregulated in proliferating endothelial cells in tumor tissues (Schnaper, H.W,
et al., J Cell Physiol, 156:235-246 (1993); Brooks, P.C., et al., Cell, 92:391-400 (1998);
Chambers, A.F., et al., J Natl Cancer Inst, 89:1260-1270 (1997)). Furthermore, these
proteases can contribute to the sustained growth of established tumor foci by the
ectodomain cleavage of membrane-bound pro-forms of growth factors, releasing peptides
that are mitogens for tumor cells and/or tumor vascular endothelial cells (Arribas, J., et
al., J Biol Chem, 271:11376-11382 (1996); Suzuki, M., et al., J Biol Chem, 272:31730-31737
(1997)).
However, catalytic manifestations of MMP and plasminogen activators are
highly regulated. For example, the MMPs are expressed as inactive zymogen forms and
require activation before they can exert their proteolytic activities. The activation of
MMP zymogens involves sequential proteolysis of N-terminal propeptide blocking the
active site cleft, mediated by proteolytic mechanisms, often leading to an autoproteolytic
event (Springman, E.B., et al., Proc Natl Acad Sci USA, 87:364-368 (1990); Murphy, G.,
et al., APMIS, 107:38-44 (1999)). Second, a family of proteins, the tissue inhibitors of
metalloproteinases (TIMPs), are correspondingly widespread in tissue distribution and
function as highly effective MMP inhibitors (Ki ∼ 10-10 M) (Birkedal-Hansen, H., et al.,
Crit Rev Oral Biol Med, 4:197-250 (1993)). Though the activities of MMPs are tightly
controlled, invading tumor cells that utilize the MMP's degradative capacity somehow
circumvent these negative regulatory controls, but the mechanisms are not well
understood.
The contributions of MMPs in tumor development and metastatic process
lead to the development of novel therapies using synthetic inhibitors of MMPs (Brown,
P.D., Adv Enzyme Regul, 35:293-301 (1995); Wojtowicz-Praga, S., et al., J Clin Oncol,
16:2150-2156 (1998); Drummond, A.H., et al., Ann N Y Acad Sci, 30:228-235 (1999)).
Among a multitude of synthetic inhibitors generated, Marimastat is already clinically
employed in cancer treatment (Drummond, A.H., et al., Ann N Y Acad Sci, 30:228-235
(1999)).
Here, as an alternate to the use of MMP inhibitors, we explored a novel
strategy using modified PAs which could only be activated by MMPs or plasminogen
activators to specially kill MMP- or and plasminogen activators-expressing tumor cells.
PA mutants are constructed in which the furin recognition site is replaced by sequences
susceptible to cleavage by MMPs or and plasminogen activators. When combined with
LF or an LF fusion protein comprising the PA binding site, these PA mutants are
specifically cleaved by cancer cells, exposing the LF binding site and translocating the LF
or LF fusion protein into the cell, thereby specifically delivering a compounds, e.g., a
therapeutic or diagnostic agent, to the cell.
SUMMARY OF THE INVENTION
Matrix metalloproteinases ("MMPs") and proteins of the plasminogen
activation system (e.g., t-PAR, u-PAR, u-PA, t-PA) are overexpressed in a variety of tumor
tissues and tumor cell lines and are highly correlated to tumor invasion and metastasis. In
addition, these proteins are overexpressed in other cells such as inflammatory cells. Here we
constructed anthrax toxin protective antigen (PA) mutants, in which the furin site is replaced
by sequences specifically cleaved by plasminogen activators. The
plasminogen activator targeted PA mutants are only activated by plasminogen activator-
expressing tumor cells, so as to specifically deliver a toxin, a diagnostic, or a
therapeutic agent. The activation occurs primarily on the cell surface, resulting in
translocation and delivery of the compounds. The compounds can be diagnostic or
therapeutic agents. Preferably the compounds are delivered to the cells of a human subject
suffering from cancer, thereby killing the cancer cells and treating the cancer.
In one aspect, the present invention provides a method of targeting a
compound to a cell over-expressing a plasminogen activator,
the method comprising the steps of: (i) administering to the
cell a mutant PA protein comprising a plasminogen activator-recognized
cleavage site in place of the native PA furin-recognized cleavage site, wherein the
mutant PA is cleaved by a plasminogen activator; and (ii)
administering to the cell a compound comprising an LF polypeptide comprising a PA binding
site; wherein the LF polypeptide binds to cleaved PA and is translocated into the cell, thereby
delivering the compound to the cell.
In one embodiment, the cell overexpresses a matrix metalloproteinase. In
another embodiment, the matrix metalloproteinase is selected from the group consisting of
MMP-2 (gelatinase A), MMP-9 (gelatinase B) and membrane-type 1 MMP (MT1-MMP). In
another embodiment, the matrix metalloproteinase-recognized cleavage site is selected from
the group consisting of GPLGMLSQ (SEQ ID NO:2) and GPLGLWAQ (SEQ ID NO:3).
In one embodiment, the cell overexpresses a plasminogen activator or a
plasminogen activator receiptor. In another embodiment, the plasminogen activator is
selected from the group consisting of t-PA (tissue-type plasminogen activator) and u-PA
(urokinase-type plasminogen activator). In another embodiment, the plasminogen
activator-recognized cleavage site is selected from the group consisting of PCPGRVVGG
(SEQ ID NO:4), PGSGRSA (SEQ ID NO:5), PGSGKSA (SEQ ID NO:6), and PQRGRSA
(SEQ ID NO:7).
In one embodiment, the cell is a cancer cell. In another embodiment, the
cancer is selected from the group consisting of lung cancer, breast cancer, bladder cancer,
thyroid cancer, liver cancer, lung cancer, pleural cancer, pancreatic cancer, ovarian cancer,
cervical cancer, colon cancer, fibrosarcoma, neuroblastoma, glioma, melanoma, monocytic
leukemia, and myelogenous leukemia. In another embodiment, the cell is an inflammatory
cell. In another embodiment, the cell is a human cell.
In one embodiment, the lethal factor polypeptide is native lethal factor. In
another embodiment, the compound is native lethal factor.
In one embodiment, the lethal factor polypeptide is linked to a heterologous
compound. In another embodiment, the compound is a diagnostic or a therapeutic agent. In
another embodiment, the compound is shiga toxin, A chain of diphtheria toxin, or
Pseudomonas exotoxin A. In another embodiment, the compound is a detectable moiety or a
nucleic acid.
In one embodiment, the compound is covalently linked to lethal factor via a
chemical bond. In another embodiment, the heterologous compound is recombinantly linked
to lethal factor.
In one embodiment, the mutant PA protein is a fusion protein comprising a
heterologous receptor binding domain. In another embodiment, the heterologous receptor
binding domain is selected from the group consisting of a single chain antibody and a growth
factor.
In one aspect, the present invention provides an isolated mutant protective
antigen protein comprising a matrix metalloproteinase or a plasminogen activator-recognized
cleavage site in place of the native protective antigen furin-recognized cleavage site, wherein
the mutant protective antigen is cleaved by a matrix metalloproteinase or a plasminogen
activator.
In one embodiment, the matrix metalloproteinase or a plasminogen activator-recognized
cleavage site is selected from the group consisting ofPCPGRVVGG (SEQ ID
NO:4), PGSGRSA (SEQ ID NO:5), PGSGKSA (SEQ ID NO:6), PQRGRSA (SEQ ID
NO:7), GPLGMLSQ (SEQ ID NO:2) and GPLGLWAQ (SEQ ID NO:3).
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1. Generation of PA mutants can be specifically processed by MMPs.
(A). Schematic representation of MMP substrate PA mutants. The furin
cleavage site RKKR (SEQ ID NO:1) was replaced with gelatinase favorite substrate
sequences GPLGMLSQ (SEQ ID NO:2) in PA-L1 and GPLGLWAQ (SEQ ID NO:3) in PAL2.
The arrows show the cleavage sites of furin or MMPs as indicated. (B). Cleavage of
PA-L1 by MMP-2, MMP-9 and soluble form furin. As described in Materials and Methods,
PA-L1 was incubated with MMP-2, MMP-9 and furin, respectively, aliquots were withdrawn
at the time points indicated, and the samples were analyzed by western blotting with the
rabbit polyclonal antibody against PA. (C). Cleavage of PA-L2 by MMP-2, MMP-9 and
soluble form furin. PA-L2 was treated as in B. (D). Cleavage of WT-PA by MMP-2, MMP-9
and soluble form furin. WT-PA was treated as in B.
Fig. 2. Zymographic analysis of the gelatinases associated with serum-free
conditioned media (A) or Triton X-100 extracts (B) of Vero cells, HT1080 cells and A2058
cells. 1 mg of cell extract protein, or volumes of conditioned medium (3-4 ml) normalized to
the protein concentration of the corresponding cell extracts were analyzed by gelatin
zymography as described in Materials and Methods.
Fig. 3. Cytotoxicity of PA-L1 and PA-L2 (A) or nicked form of them (B) to
the MMP non-expressing Vero cells. As described in Materials and Methods, Vero cells
were cultured in 96-well plates to 80-100% confluence washed and replaced with serum-free
DMEM medium. Then different concentrations (from 0 to 1000 ng/ml) of WT-PA, PA-L1
and PA-L2, or MMP-2 nicked PA-L1 and PA-L2 combined with FP59 (constant at 50 ng/ml)
were separately added to the cells. The toxins were left in the medium for 48 hours, or
removed and replaced with fresh serum-containing DMEM after 6 hour. MTT was added to
determined cell viability at 48 hours. Nicked PA-L1 and PA-L2 were prepared by cleavage
of PA-L1 and PA-L2 by active MMP-2 at 37oC for 3 hours as described in Materials and
Methods.
Fig. 4. Cytotoxicity of PA-L1 and PA-L2 to the MMP expressing tumor
HT1080 cells (A), A2058 cells (B) and MDA-MB-231 cells. As described in Materials and
Methods, HT1080 and A2058 cells were cultured to 80-100% confluence, washed and
replaced with serum-free DMEM medium. Then different concentrations (from 0 to 1000
ng/ml) of WT-PA, PA-L1 and PA-L2 combined with FP59 (constant at 50 ng/ml) were
separately added to the cells and incubated for 6 hours and 48 hours. MTT was added to
determined cell viability at 48 hours.
Fig. 5. Effect of MMP inhibitors on cytotoxicity of PA-L1 and PA-L2 to
HT1080 cells. HT1080 cells were cultured to 80% confluence in a 96-well plate, and
washed twice with serum-free DMEM. Then MMP inhibitors GM6001, BB94 and
BB2516 were added to the cells at final concentration of 10 µM in serum-free DMEM.
After 300 min pre-incubation with the MMP inhibitors, WT-PA, PA-L1 and PA-L2 (300
ng/ml) combined with FP59 (50 ng/ml) were separately added to the cells and incubated
for 6 hours. After that, the medium containing the toxins and MMP inhibitors were
removed, and fresh serum-containing medium was added and incubation continued to 48
hours. MTT was added to determine cell viability as described in Materials and Methods.
Fig. 6. PA-L1 and PA-L2 selectively killed MMP-expressing tumor cells
in a co-culture model. As described in Materials and Methods, Vero, HT1080, MDA-MB-231
and A2058 cells were cultured in the separate chambers of 8-chamber slides to
80 to 100 % confluence. Then the slides with partitions removed were put into 100 mm
petri dishes with serum-free medium, so that the different cells were in the same culture
environment. WT-PA, PA-L1 or PA-L2 (300 ng/ml) each combined with FP59 (50
ng/ml) were separately added to the cells, and incubated to 48 hours. MTT was added to
determine cell viability. Insert, after 48 hours toxin challenge MTT was added to the
cells, live cells converted MTT to blue dye, which precipitated in cytosol, while dead
cells remained colorless.
Fig. 7. Binding and activation processing ofPA, PA-L1 and PA-L2 on
the cell surface of Vero (A) and HT1080 (B) cells. As described in Materials and
Methods, Vero and HT1080 cells were cultured in 24-well plates to 80-100% of
confluence, washed and changed serum-free media. Then PA, PA-L1 and PA-L2 were
added to the cells with a final concentration of 1000 ng/ml, incubated for different times
(0, 10 min, 40 min, 120 min and 360 min). The cell lysates were prepared for western
blotting analysis using rabbit anti-PA polyclonal antibody (#5308) to check the
processing status of PA and PA mutants.
Fig. 8. The role of transfected MT1-MMP in cytotoxicity of PA-L1 and
PA-L2 to COS-7 cells. A. Cytotoxicity of PA-L1 and PA-L2 to COS-7 cells. As
described in Materials and Methods, COS-7 cells were cultured to 80-100% of
confluence, washed and replaced with serum-free DMEM medium. Then different
concentrations (from 0 to 1000 ng/ml) of WT-PA, PA-L1 and PA-L2 combined with
FP59 (constant at 50 ng/ml) were separately added to the cells and incubated for 6 hours
and 48 hours. MTT was added to determined cell viability at 48 hours. Insert:
Zymographic analysis of cell extracts and culture supernatants of COS-7 as described in
Materials and Methods, using supernatant of HT1080 as control. B. Cytotoxicity of PA-L1
and PA-L2 to CosgMT1. CosgMT1 cells were treated the same as in A. Insert:
Comparison expression of MT1-MMP from COS-7 and CosgMT1 cells by western
blotting using a rabbit anti-MT1-MMP antibody (AB815, CHEMICON International,
Inc.).
Fig. 9. Generation of mutated PA proteins which can be specifically
cleaved by uPA or tPA. Cleavage of PA and mutated PA proteins by soluble form of
furin (in panel a), uPA (in panel b) or tPA (in panel c). Proteins were incubated with
furin, uPA or tPA, for the times indicated and samples were analyzed by SDS-PAGE and
Commassie staining in panel a, or diluted and analyzed by Western blotting with rabbit
polyclonal antibody against PA in panel b and c.
Fig. 10. Binding and processing of pro-uPA by different cell lines. Vero
cells, Hela cells, A2058 cells, and Bowes cells were cultured in 24-well plate to
confluence, washed and incubated in serum-free media with 1 µg/ml of pro-uPA and 1
µg/ml of glu-plasminogen for 1 h, then the cell lysates were prepared for Western blotting
analysis with monoclonal antibody against uPA B-cahin (#394).
Fig. 11. Cytotoxicity of mutated PA proteins for uPAR expressing tumor
cells, Hela cells (in panel a), A2058 cells (in panel b), and Bowes cells (in panel c) were
cultured to 50% confluence, washed and replaced with serum-free DMEM containing 100
ng/ml of pro-uPA and 1 µg/ml of glu-plasminogen. Then different concentrations (from
0 to 1000 ng/ml) of PA, PA-U1, PA-U2, PA-U3, PA-U4, and PA-U7 together with FP59
(constant at 50 ng/ml) were incubated with the cells for 6 h. Then the toxins were
removed and replaced with fresh serum-containing DMEM. MTT was added to
determined cell viability at 48 h.
Fig. 12. Cytotoxicity of mutated PA proteins for uPAR non-expressing
Vero cells. a. Vero cells were cultured in 96-well plates to 50% confluence, washed and
replaced with serum-free DMEM containing 100 ng/ml of pro-uPA and 1 µg/ml of glu-plasminogen.
Then the cells were treated with toxins as above. B. Vero cells were
treated as in panel a, except that nicked PA-U2 was used for the cytotoxicity assay.
Nicked PA-U2 was prepared by cleavage of PA-U2 with uPA at 37°C for 1 h as described
in Materials and Methods.
Fig. 13. Binding and proteolytic activation of PA and PA-U2 on the
surface of Vero cells (in panel a) and Hela (in panel b) cells. Vero and Hela cells were
cultured in 24-well plates to confluence, washed and changed serum-free medium
containing 100 ng/ml of pro-uPA and 1 µg/ml of plasminogen with or without PAI-1 (2
µg/ml). Then PA and PA-U2 were added to the cells with a final concentration of 1000
ng/ml, incubated for 30 min or 120 min. The cell lysates were prepared for Western
blotting analysis using rabbit anti-PA polyclonal antibody (#5308) to check the
processing status of PA and PA-U2 and the effect of PAI-1 on it.
Fig. 14. Effects of PAI-1 on cytotoxicity of PA-U2 to tumor cells. Hela
cells (in panel a), A2058 cells (in panel b), and Bowes cells (in panel c) were cultured to
50% confluence in a 96-well plate, washed and incubated with serum-free DMEM
containing 100 ng/ml of pro-uPA and 1 µg/ml of glu-plasminogen with or without 2
µg/ml of PAI-1, for 30 min. Then different concentrations of PA and PA-U2 (from 0 to
1000 ng/ml) combined with FP59 (50 ng/ml) were separately added to the cells and
incubated for 6 hours. After that, the toxins were removed and replaced with fresh
serum-containing DMEM. MTT was added to determined cell viability at 48 h.
Fig. 15. Effects of blocking uPAR on cytotoxicity of PA-U2 to the tumor
cells. a. Effects of ATE on cytotoxicity of PA-U2 to Hela, A2058, and Bowes cells. b.
Effects of uPAR blocking antibody R3 on cytotoxicity of PA-U2 to Hela, A2058, and
Bowes cells. Cells were cultured to 50% confluence, washed and incubated with serum-free
DMEM containing 100 ng/ml of pro-uPA and 1 µg/ml of glu-plasminogen, and
different concentrations of ATF or uPAR blocking antibody R3. Then PA and PA-U2
(300 ng/ml each) combined with FP59 (50 ng/ml) were added to the cells and incubated
for 6 hours. After that, the toxins were removed and replaced with fresh serum-containing
DMEM. MTT was added to determined cell viability at 48 h.
Fig. 16. PA-U2 selectively killed uP AR-expressing Hela cells in a co-culture
model. Vero and Hela cells were cultured in the separate chambers of 8-chamber
slides to confluence. Then the slides with partitions removed were put into 100 mm petri
dishes with serum-free medium containing 100 ng/ml of pro-uP A and 1 µg/ml of glu-plasminogen,
so that the different cells were in the same culture environment. PA and
PA-U2 (1000 ng/ml) each combined with FP59 (50 ng/ml) were separately added to the
cells, and incubated to 48 hours. MTT was added to determine cell viability. Insert, PA-U2
was selectively proteolytically activated on Hela cells in a co-culture model. The
cells were treated the same as in A, except that after 2 h incubation with toxins the cells
were washed and lysed, and the processing status of PA proteins were detected by anti-PA
antibody as in Fig. 14.
Fig. 17. Cytotoxicity of PA-U2, PA-U3, and PA-U4 on tPA expressing
cells. Bowes cells (a) and HUVEC cells (b) were cultured to 50% confluence, washed
and replaced with serum-free DMEM without pro-uPA and glu-plasminogen. Then the
cells were treated with different concentrations (from 0 to 1000 ng/ml) of PA, PA-U2,
PA-U3, and PA-U4 together with FP59 (constant at 50 ng/ml) for 12 h. MTT was added
to determine cell viability at 48 h.
DETAILED DESCRIPTION
I. Introduction
Proteolytic degradation of the extracellular matrix plays a crucial role both
in cancer invasion and non-neoplastic tissue remoldeling, and in both cases it is
accomplished by a number of proteases. Best known are the plasminogen activation
system that leads to the formation of the serine protease plasmin, and a number of matrix
metalloproteinase, including collagenases, gelatinases and stromelysins (Dano, K., et al.,
APMIS, 107:120-127 (1999)). The close association between MMP and plasminogen
activator overexpression and tumor metastasis has been noticed for a decade. For
example, the contributions of MMPs in tumor development and metastatic process lead to
the development of novel therapies using synthetic inhibitors of MMPs (Brown, P.D., Adv
Enzyme Regul, 35:293-301 (1995); Wojtowicz-Praga, S., et al., J Clin Oncol, 16:2150-2156
(1998); Drummond, A.H., et al., Ann N Y Acad Sci, 30:228-235 (1999)). However,
these inhibitors only slow growth and do not eradicate the tumors. The present study is
the first effort to use bacterial toxins modified to target MMPs and plasminogen
activators, which are highly expressed and employed by tumor cells for invasion. Mutant
PA molecules in which the furin cleavage site is replaced by an MMP or plasminogen
activator target site can be used to deliver compounds such as toxins to the cell, thereby
killing the cell. The compounds have the ability to bind PA through their interaction with
LF and are translocated by PA into the cell. The PA and LF-comprising compounds are
administered to cells or subjects, preferably mammals, more preferably humans, using
techniques known to those of skill in the art. Optionally, the PA and LF-comprising
compounds are administered with a pharmaceutically acceptable carrier.
The compounds typically are either native LF or an LF fusion protein, i.e.,
those that have a PA binding site (approximately the first 250 amino acids of LF, Arora et
al., J. Biol. Chem. 268:3334-3341 (1993)) fused to another polypeptide or compound so
that the protein or fusion protein binds to PA and is translocated into the cell, causing cell
death (e.g., recombinant toxin FP59, anthrax toxin lethal factor residue 1-254 fusion to
the ADP-ribosylation domain of Pseudomonas exotoxin A). The fusion is typically
chemical or recombinant. The compounds fused to LF include, e.g., therapeutic or
diagnostic agent, e.g., native LF, a toxin, a bacterial toxin, shiga toxin, A chain of
diphtheria toxin, Pseudomonas exotoxin A, a protease, a growth factor, an enzyme, a
detectable moiety, a chemical compound, a nucleic acid, or a fusion polypeptide, etc.
The mutant PA molecules of the invention can be further targeted to a
specific cell by making mutant PA fusion proteins. In these mutant fusion proteins, the
PA receptor binding domain is replaced by a protein such as a growth factor or other cell
receptor ligand specifically expressed on the cells of interest. In addition, the PA receptor
binding domain may be replaced by an antibody that binds to an antigen specifically
expressed on the cells of interest.
These proteins provide a way to specifically kill tumor cells without
serious damage to normal cells. This method can also be applied to non-cancer
inflammatory cells that contain high amounts of cell-surface associated MMPs or
plasminogen activators. These PA mutants are thus useful as therapeutic agents to
specifically kill tumor cells.
We constructed two PA mutants, PA-L1 and PA-L2, in which the furin
recognition site is replaced by sequences susceptible to cleavage by MMPs, especially by
MMP-2 and MMP-9. When combined with FP59, these two PA mutant proteins
specifically killed MMP-expressing tumor cells, such as human fibrosarcoma HT1080
and human melanoma A2058, but did not kill MMP non-expressing cells. Cytotoxicity
assay in the co-culture model, in which all the cells were in the same culture environment
and were equal accessible to the toxins in the supernatant, showed PA-L1 and PA-L2
specifically killed only MMP-expressing tumor cells HT1080 and A2058, not Vero cells.
This result demonstrated activation processing of PA-L1 and PA-L2 mainly occurred on
the cell surfaces and mostly contributed by the membrane-associated MMPs, so the
cytotoxicity is restricted to MMP-expressing tumor cells. TIMPs are widely present in
extracellular milieu and inhibit MMP activity in supernatants. PA proteins bind to the
cells very quickly with maximum binding happened within 60 min. In contrast to
secreted MMPs, membrane-associated MMPs express their proteolytic activities more
efficiently by anchoring on cell membrane and enjoying two distinct advantageous
properties, which are highly focused on extracellular matrix substrates and more resistant
to proteinase inhibitors present in extracellular milieu.
Recently it has been shown physiological concentrations of plasmin can
activate both MMP-2 and MMP-9 on cell surface of HT1080 by a mechanism
independent of MMP or acid proteinase activities (Mazzieri, R., et al., EMBO J.,
16:2319-2332 (1997)). In contrast, in soluble phase plasmin degrades both MMP-2 and
MMP-9 (Mazzieri, R., et al., EMBO J., 16:2319-2332 (1997)). Thus, plasmin may
provide a mechanism keeping gelatinase activities on cell surface to promote cell
invasion. It has been well established MT1-MMP functions as both activator and receptor
of MMP-2, but has no effect on MMP-9 (see review Polette, M., et al., Int J Biochem cell
Biol., 30:1195-1202 (1998); Sato, H., et al., Thromb Haemost, 78:497-500 (1997)). A
MMP-2/TIMP-2 complex binds to MT1-MMP on cell surface, which serves as a high-affinity
site, then be proteolytically activated by an adjacent MT1-MMP, which serves as
an activator. Recent works have shown that adhesion receptors, such as αvβ3 integrin
(Brooks, P.C., et al., Cell, 85:683-693 (1996)) and cell surface hyaluronan receptor CD44
(Tu, Q., et al, Gene Development, 13:35-48 (1999)), may provide means to retain soluble
active MMP-2 or MMP-9 to invasive tumor cell surface, where their proteolytic activities
are most likely to promote cell invasion. For MMP activities involved in tumor invasion
and metastasis are localized and/or modulated on the cell surface in insoluble phase, this
makes MMPs an ideal target for tumor tissues.
It was originally thought that the role of MMPs and plasminogen
activators was simply to break down tissue barriers to promote tumor invasion and
metastasis. It is now understood, for example, that MMPs also participate in tumor
neoangiogenesis and are selectively upregulated in proliferating endothelial cells.
Therefore, these modified bacterial toxins may have the advantageous properties that
targeted to not only tumor cells themselves but may also the dividing vascular endothelial
cells which essential to neoangiogenesis in tumor tissues. Therefore, the MMP targeted
toxins may also kill tumor cells by starving the cells of necessary nutrients and oxygen.
The mutant PA molecules of the invention can also be specifically targeted
to cells using mutant PA fusion proteins. In these fusion proteins, the receptor binding
domain of PA is replaced with a heterologous ligand or molecule such as an antibody that
recognizes a specific cell surface protein. PA protein has four structurally distinct
domains for performing the functions of receptor binding and translocation of the
catalytic moieties across endosomal membranes (Petosa, C., et al., Nature, 385:833-838
(1997)). Domain 4 is the receptor-binding domain and has limited contacts with other
domains (Petosa, C., et al., Nature, 385:833-838 (1997)). Therefore, PA can be
specifically targeted to alternate receptors or antigens specifically expressed by tumors by
replacing domain 4 with the targeting molecules, such as single-chain antibodies or a
cytokines used by other immuntoxins (Thrush, G.R., et al., Annu Rev Immunol, 14:49-71
(1996)). For example, PA-L1 and PA-L2 are directed to alternate receptors, such as GM-CSF
receptor, which is highly expressed in leukemias cells and solid tumors including
renal, lung, breast and gastrointestinal carcinomas (Thrush, G.R., et al., Annu Rev
Immunol, 14:49-71 (1996); 74-79). It should be highly expected that the combination of
these two independent targeting mechanism should allow tumors to be more effectively
targeted, and side effects such as hepatotoxicity and vascular leak syndrome should be
significantly reduced.
With respect to the plasminogen activation system, two plasminogen
activators are known, the urokinase-type plasminogen activator (uPA) and the tissue-type
plasminogen activator (tPA), of which uPA is the one primarily involved in extracellular
matrix degradation (Dano, K., et al., APMIS, 107:120-127 (1999)). uPA is a 52 kDa
serine protease which is secreted as an inactive single chain proenzyme (pro-uPA)
(Nielsen, L. S., et al., Biochemistry, 21:6410-6415 (1982); Petersen, L. C., et al., J. Biol.
Chem., 263:11189-11195 (1988)). The binding domain of pro-uPA is the epidermal
growth factor-like amino-terminal fragment (ATF; aa 1-135, 15 kDa) that binds with high
affinity (Kd = 0.5 mM) to urokinase-type plasminogen activator receptor (uPAR)
(Cubellis, M. V., et al., Proc. Natl. Acad. Sci. U.S.A., 86:4828-4832 (1989)), a GPI-linked
receptor. uPAR is a 60 kDa three domain glycoprotein whose N-terminal domain 1
contains the high affinity binding site for ATF of pro-uPA (Ploug, M., et al., J. Biol.
Chem., 266:1926-1933 (1991); Behrendt, N., et al., J. Biol. Chem., 266:7842-7847
(1991)). uPAR is overexpressed on a variety of tumors, including monocytic and
myelogenous leukemias (Lanza, F., et al., Br. J. Haematol., 103:110-123 (1998); Plesner,
T., et al., Am. J. Clin. Pathol., 102:835-841 (1994)), and cancers of the breast (Carriero,
M. V., et al., Clin. Cancer Res., 3:1299-1308 (1997)), bladder (Hudson, M. A., et al., J.
Natl. Cancer Inst., 89:709-717 (1997)), thyroid (Ragno, P., et al., Cancer Res., 58:1315-1319
(1998)), liver (De Petro, G., et al., Cancer Res., 58:2234-2239 (1998)), pleura
(Shetty, S., et al., Arch. Biochem. Biophys., 356:265-279 (1998)), lung (Morita, S., et al.,
Int. J. Cancer, 78:286-292 (1998)), pancreas (Taniguchi, T., et al., Cancer Res., 58:4461-4467
(1998)), and ovaries (Sier, C. F., et al., Cancer Res., 58:1843-1849 (1998)). Pro-uPA
binds to uPAR by ATF, while the binding process does not block the catalytic,
carboxyl-terminal domain. By association with uPAR, pro-uPA gets near to and
subsequently activated by trace amounts of plasmin bound to the plasma membrane by
cleavage of the single chain pro-uPA within an intra-molecular loop held closed by a
disulfide bridge. Thus the active uPA consists of two chains (A + B) held together by this
disulfide bond (Ellis, V., et al., J. Biol. Chem., 264:2185-2188 (1989)).
Plasminogen is present at high concentration (1.5-2.0 µM) in plasma and
interstitial fluids (Dano, K., et al., Adv.Cancer Res., 44:139-266 (1985)). Low affinity,
high capacity binding of plasminogen to cell-surface proteins through the lysine binding
sites of plasminogen kringles enhances considerably the rate of plasminogen activation by
uPA (Ellis, V., et al., J. Biol. Chem., 264: 2185-2188 (1989); Stephens, R. W., et al., J.
Cell Biol., 108:1987-1995 (1989)). Active uPA has high specificity for Arg560-Val561
bond in plasminogen, and cleavage between these residues gives rise to more plasmin that
is referred to as "reciprocal zymogen activation" (Petersen, L. C., Eur. J. Biochem.,
245:316-323 (1997)). The result of this system is efficient generation of active uPA and
plasmin on cell surface. In this context, uPAR serves as a template for binding and
localization of pro-uPA near to its substrate plasminogen on plasma membrane.
Unlike uPA, plasmin is a relatively non-specific protease, cleaving many
glycoproteins and proteoglycans of the extracellular matrix, as well as fibrin (Liotta, L.A.,
et al., Cancer Res., 41:4629-4636 (1981)). Therefore, cell surface bound plasmin
mediates the non-specific matrix proteolysis which facilitates invasion and metastasis of
tumor cells through restraining tissue structures. In addition, plasmin can activate some
of the matrix metalloproteases which also degrade tissue matrix (Werb, Z., et al., N. Engl.
J. Med., 296:1017-1023 (1977); DeClerck, Y. A., et al., Enzyme Protein, 49:72-84
(1996)). Plasmin can also activate growth factors, such as TGF-β, which may further
modulate stromal interactions in the expression of enzymes and tumor neo-angiogenesis
(Lyons, R. M., et al., J. Cell Biol., 106:1659-1665 (1988)). Plasminogen activation by
uPA is regulated by two physiological inhibitors, plasminogen activator inhibitor-1 and 2
(PAI-1 and PAI-2) (Cubellis, M. V., et al., Proc. Natl. Acad. Sci. U.S.A., 86:4828-4832
(1989); Ellis, V., et al., J. Biol. Chem., 265:9904-9908 (1990); Baker, M. S., et al.,
Cancer Res., 50:4676-4684 (1990)), by formation 1:1 complex with uPA. Plasmin
generated in the cell surface plasminogen activation system is relatively protected from its
principle physiological inhibitor α2-antiplasmin (Ellis, V., et al., J. Biol. Chem.,
266:12752-12758 (1991)).
Cancer invasion is essentially a tissue remodeling process in which normal
tissue is substituted with cancer tissue. Accumulated data from preclinical and clinical
studies strongly suggested that the plasminogen activation system plays a central role in
the processes leading to tumor invasion and metastasis (Andreasen, P. A., et al., Int. J.
Cancer, 72:1-22 (1997); Chapman, H. A., Curr. Opin. Cell Biol., 9:714-724 (1997);
Schmitt, M., et al., Thromb. Haemost., 78:285-296 (1997)). High levels of uPA, uPAR
and PAL-1, but decreased PAI-2 are associated with poor disease outcome (Schmitt, M.,
et al., Thromb. Haemost., 78:285-296 (1997)). In situ hybridization studies of the tumor
tissues have shown usually cancer cells highly expressed uPAR, while tumor stromal
cells expressed pro-uPA, which subsequently binds to uPAR on the surface of cancer
cells where it is activated and thereby generating plasmin (Pyke, C., et al., Am. J. Pathol.,
138:1059-1067 (1991)). For the activation of pro-uPA is highly restricted to the tumor
cell surface, it may be an ideal target for cancer treatment.
uPA and tPA possess an extremely high degree of structure similarity
(Lamba, D., et al., J. Mol. Biol., 258:117-135 (1996); Spraggon, G., et al., Structure,
3:681-691 (1995)), share the same primary physiological substrate (plasminogen) and
inhibitors (PAI-1 and PAI-2) (Collen, D., et al., Blood, 78:3114-3124 (1991)), and exhibit
restricted substrate specificity. By using substrate phage display and substrate subtraction
phage display approaches, recent investigations had identified substrates that discriminate
between uPA and tPA, showing the consensus substrate sequences with high selectivity
by uPA or tPA (Ke, S. H., et al., J. Biol. Chem., 272:20456-20462 (1997); Ke, S. H., et
al., J. Biol. Chem., 272:16603-16609 (1997)). To exploit the unique characteristics of the
uPA plasminogen system and anthrax toxin in the design of tumor cell selective
cytotoxins, in the work described here, mutated anthrax PA proteins were constructed in
which the furin site is replaced by sequences susceptible to specific cleavage by uPA.
These uPAR/uPA-targeted PA proteins were activated selectively on the surface of
uPAR-expressing tumor cells in the present of pro-uPA, and caused internalization of a
recombinant cytotoxin FP59 to selectively kill the tumor cells. Also, a mutated PA
protein was generated which selectively killed tissue-type plasminogen activator
expressing cells.
II. Methods of producing PA and LF constructs
A. Construction nucleic acids encoding PA mutants, LF, and PA and LF
fusion proteins
PA includes a cellular receptor binding domain, a translocation domain,
and an LF binding domain. The PA polypeptides of the invention have at least a
translocation domain and an LF binding domain. In the present invention, mature PA (83
kDa) is one preferred embodiment. In addition to full length recombinant PA, amino-terminal
deletions up to the 63 kDa cleavage site or additions to the full length PA are
useful. A recombinant form of processed PA is also biologically active and could be used
in the present invention. PA fusion proteins in which the receptor binding domain have
been deleted can also be constructed, to target PA to specific cell types. Although the
foregoing and the prior art describe specific deletion and structure-function analysis of
PA, any biologically active form of PA can be used in the present invention.
Amino-terminal residues 1-254 of LF are sufficient for PA binding
activity. Amino acid residues 199-253 may not all be required for PA binding activity.
One embodiment of LF is amino acids 1-254 of native LF. Any embodiment that
contains at least about amino acids 1-254 of native LF can be used in the present
invention, for example, native LF. Nontoxic embodiments of LF are preferred.
PA and LF fusion proteins can be produced using recombinant nucleic
acids that encode a single-chain fusion proteins. The fusion protein can be expressed as a
single chain using in vivo or in vitro biological systems. Using current methods of
chemical synthesis, compounds can be also be chemically bound to PA or LF. The fusion
protein can be tested empirically for receptor binding, PA or LF binding, and
internalization following the methods set forth in the Examples.
In addition, functional groups capable of forming covalent bonds with the
amino- and carboxyl- terminal amino acids or side groups of amino acids are well known
to those of skill in the art. For example, functional groups capable of binding the terminal
amino group include anhydrides, carbodiimides, acid chlorides, and activated esters.
Similarly, function-al groups capable of forming covalent linkages with the terminal
carboxyl include amines and alcohols. Such functional groups can be used to bind
compound to LF at either the amino- or carboxyl-terminus. Compound can also be
bound to LF through interactions of amino acid residue side groups, such as the SH group
of cysteine (see, e.g., Thorpe et al., Monoclonal Antibody-Toxin Conjugates: Aiming the
Magic Bullet, in Monoclonal Antibodies in Clinical Medicine, pp. 168-190 (1982);
Waldmann, Science, 252: 1657 (1991); U.S. Patent Nos. 4,545,985 and 4,894,443). The
procedure for attaching an agent to an antibody or other polypeptide targeting molecule
will vary according to the chemical structure of the agent. As example, a cysteine residue
can added at the end of LF. Since there are no other cysteines in LF, this single cysteine
provides a convenient attachment point through which to chemically conjugate other
proteins through disulfide bonds. Although certain of the methods of the invention have
been described as using LF fusion proteins, it will be understood that other LF
compositions having chemically attached compounds can be used in the methods of the
invention.
Protective antigen proteins can be produced from nucleic acid constructs
encoding mutants, in which the naturally occurring furin cleavage site has been replaced
by an MMP or a plasminogen activator cleavage site. In addition, LF proteins, and LF
and PA fusion proteins can also be expressed from nucleic acid constructs according to
standard methodology. Those of skill in the art will recognize a wide variety of ways to
introduce mutations into a nucleic acid encoding protective antigen or to construct a
mutant protective antigen-encoding nucleic acid. Such methods are well known in the art
(see Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd ed. 1989); Kriegler,
Gene Transfer and Expression: A Laboratory Manual (1990); and Current Protocols in
Molecular Biology (Ausubel et al., eds., 1994)). In some embodiments, nucleic acids of the
invention are generated using PCR (see, e.g., Examples I and III). For example, using
overlap PCR protective antigen encoding nucleic acids can be generated by substituting the
nucleic acid subsequence that encodes the furin site with a nucleic acid subsequence that
encodes a matrix metalloproteinase (MMP) site (e.g., GPLGMLSQ (SEQ ID NO:2) and
GPLGLWAQ (SEQ ID NO:3)) (see, e.g., Example I). Similarly, an overlap PCR method can
be used to construct the protective antigen proteins in which the furin site is replaced by a
plasminogen activator cleavage site (e.g., the uPA and tPA physiological substrate sequence
PCPGRVVGG (SEQ ID NO:4), the uPA favorite sequence PGSGRSA (SEQ ID NO:5), the
uPA favorite sequence PGSGKSA (SEQ ID NO:6), or the tPA favorite sequence PQRGRSA
(SEQ ID NO:7)) (see, e.g., Example III).
B. Expression of LF, PA and LF and PA fusion proteins
To obtain high level expression of a nucleic acid (e.g., cDNA, genomic DNA,
PCR product, etc. or combinations thereof) encoding a native (e.g., PA) or mutant protective
antigen protein (e.g., PA-L1, PA-L2, PA-U1, PA-U2, PA-U3, PA-U4, etc.), LF, or a PA or
LF fusion protein, one typically subclones the protective antigen encoding nucleic acid into
an expression vector that contains a strong promoter to direct transcription, a
transcription/translation terminator, and if for a nucleic acid encoding a protein, a ribosome
binding site for translational initiation. Suitable bacterial promoters are well known in the art
and described, e.g., in Sambrook et al. and Ausubel et al. Bacterial expression systems for
expressing the protective antigen encoding nucleic acid are available in, e.g., E. coli, Bacillus
sp., and Salmonella (Palva et al., Gene 22:229-235 (1983)). Kits for such expression systems
are commercially available. Eukaryotic expression systems for mammalian cells, yeast, and
insect cells are well known in the art and are also commercially available.
In some embodiment, protective antigen containing proteins are expressed in
non-virulent strains of Bacillus using Bacillus expression plasmids containing nucleic acid
sequences encoding the particular protective antigen protein (see, e.g., Singh, Y., et al., J Biol
Chem, 264:19103-19107 (1989)). The protective antigen containing proteins can be isolated
from the Bacillus culture using protein purification methods (see, e.g., Varughese, M., et al.,
Infect Immun, 67:1860-1865 (2999)).
The promoter used to direct expression of a protective antigen encoding
nucleic acid depends on the particular application. The promoter is preferably positioned
abour the same distance from the heterologous transcription start site as it is from the
transcription start site in its natural setting. As is known in the art, however, some
variation in this distance can be accommodated without loss of promoter function. The
promoter typically can also include elements that are responsive to transactivation, e.g.,
Gal4 responsive elements, lac repressor responsive elements, and the like. The promoter
can be constitutive or inducible, heterologous or homologous.
In addition to the promoter, the expression vector typically contains a
transcription unit or expression cassette that contains all the additional elements required
for the expression of the nucleic acid in host cells. A typical expression cassette thus
contains a promoter operably linked, e.g., to the nucleic acid sequence encoding the
protective antigen containing protein, and signals required for efficient expression and
termination and processing of the transcript, ribosome binding sites, and translation
termination. The nucleic acid sequence may typically be linked to a cleavable signal
peptide sequence to promote secretion of the encoded protein by the transformed cell.
Such signal peptides would include, among others, the signal peptides from bacterial
proteins, or mammalian proteins such as tissue plasminogen activator, insulin, and neuron
growth factor, and juvenile hormone esterase of Heliothis virescens. Additional elements
of the cassette may include enhancers and, if genomic DNA is used as the structural gene,
introns with functional splice donor and acceptor sites.
In addition to a promoter sequence, the expression cassette should also
contain a transcription termination region downstream of the structural gene to provide
for efficient termination and processing, if desired. The termination region may be
obtained from the same gene as the promoter sequence or may be obtained from different
genes.
The particular expression vector used to transport the genetic information
into the cell is not particularly critical. Any of the conventional vectors used for
expression in eukaryotic or prokaryotic cells may be used. Standard bacterial expression
vectors include plasmids such as pBR322 based plasmids, pSKF, pET23D, and fusion
expression systems such as GST and LacZ. Epitope tags can also be added to
recombinant proteins to provide convenient methods of isolation, e.g., c-myc.
Expression vectors containing regulatory elements from eukaryotic viruses
are typically used in eukaryotic expression vectors, e.g., SV40 vectors, papilloma virus
vectors, and vectors derived from Epstein-Barr virus. Other exemplary eukaryotic
vectors include pMSG, pAV009/A+, pMTO10/A+, pMAMneo-5, baculovirus pDSVE,
and any other vector allowing expression of proteins under the direction of the SV40
early promoter, SV40 later promoter, metallothionein promoter, murine mammary tumor
virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters
shown effective for expression in eukaryotic cells.
Some expression systems have markers that provide gene amplification
such as thymidine kinase, hygromycin B phosphotransferase, and dihydrofolate reductase.
Alternatively, high yield expression systems not involving gene amplification are also
suitable, such as using a baculovirus vector in insect cells, with a protective antigen
encoding nucleic acid under the direction of the polyhedrin promoter or other strong
baculovirus promoters.
The elements that are typically included in expression vectors also include
a replicon that functions in E. coli, a gene encoding antibiotic resistance to permit
selection of bacteria that harbor recombinant plasmids, and unique restriction sites in
nonessential regions of the plasmid to allow insertion of heterologous sequences. The
particular antibiotic resistance gene chosen is not critical, any of the many resistance
genes known in the art are suitable. The prokaryotic sequences are preferably chosen
such that they do not interfere with the replication of the DNA in eukaryotic cells, if
necessary.
Standard transfection methods are used to produce bacterial, mammalian,
yeast or insect cell lines that express large quantities of protein, which are then purified
using standard techniques (see, e.g., Colley et al., J. Biol. Chem. 264:17619-17622
(1989); Guide to Protein Purification, in Methods in Enzymology, vol. 182 (Deutscher,
ed., 1990)). Transformation of eukaryotic and prokaryotic cells are performed according
to standard techniques (see, e.g., Morrison, J. Bact. 132:349-351 (1977); Clark-Curtiss &
Curtiss, Methods in Enzymology 101:347-362 (Wu et al., eds, 1983).
Any of the well known procedures for introducing foreign nucleotide
sequences into host cells may be used. These include the use of calcium phosphate
transfection, polybrene, protoplast fusion, electroporation, liposomes, microinjection,
plasma vectors, viral vectors and any of the other well known methods for introducing
cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into a host
cell (see, e.g., Sambrook et al., supra). It is only necessary that the particular genetic
engineering procedure used be capable of successfully introducing at least one gene into
the host cell capable of expressing the protein of choice.
After the expression vector is introduced into the cells, the transfected cells
are cultured under conditions favoring expression of the protective antigen containing
protein, which is recovered from the culture using standard techniques identified below.
III. Purification of polypeptides of the invention
Recombinant proteins of the invention can be purified from any suitable
expression system, e.g., by expressing the proteins in B. anthracis and then purifying the
recombinant protein via conventional purification techniques (e.g., ammonium sulfate
precipitation, ion exchange chromatography, gel filtration, etc.) and/or affinity
purification, e.g., by using antibodies that recognize a specific epitope on the protein or
on part of the fusion protein, or by using glutathione affinity gel, which binds to GST
(see, e.g., Scopes, Protein Purification: Principles and Practice (1982); U.S. Patent No.
4,673,641; Ausubel et al., supra; and Sambrook et al., supra). In some embodiments, the
recombinant protein is a fusion protein with GST or Gal4 at the N-terminus. Those of
skill in the art will recognize a wide variety of peptides and proteins that can be fused to
the protective antigen containing protein to facilitate purification (e.g., maltose binding
protein, a polyhistidine peptide, etc.).
A. Purification of proteins from recombinant bacteria
Recombinant and native proteins can be expressed by transformed bacteria
in large amounts, typically after promoter induction; but expression can be constitutive.
Promoter induction with IPTG is one example of an inducible promoter system. Bacteria
are grown according to standard procedures in the art. Fresh or frozen bacteria cells are
used for isolation of protein.
Proteins expressed in bacteria may form insoluble aggregates ("inclusion
bodies"). Several protocols are suitable for purification of inclusion bodies. For
example, purification of inclusion bodies typically involves the extraction, separation
and/or purification of inclusion bodies by disruption of bacterial cells, e.g., by incubation
in a buffer of 50 mM Tris/HCl pH 7.5, 50 mM NaCl, 5 mM MgCl2, 1 mM DTT, 0.1 mM
ATP, and 1 mM PMSF. The cell suspension can be lysed using 2-3 passages through a
French press, homogenized using a Polytron (Brinkman Instruments) or sonicated on ice.
Alternate methods of lysing bacteria are apparent to those of skill in the art (see, e.g.,
Sambrook et al., supra; Ausubel et al., supra).
If necessary, the inclusion bodies are solubilized, and the lysed cell
suspension is typically centrifuged to remove unwanted insoluble matter. Proteins that
formed the inclusion bodies may be renatured by dilution or dialysis with a compatible
buffer. Suitable solvents include, but are not limited to urea (from about 4 M to about 8
M), formamide (at least about 80%, volume/volume basis), and guanidine hydrochloride
(from about 4 M to about 8 M). Some solvents which are capable of solubilizing
aggregate-forming proteins, for example SDS (sodium dodecyl sulfate), 70% formic acid,
are inappropriate for use in this procedure due to the possibility of irreversible
denaturation of the proteins, accompanied by a lack of immunogenicity and/or activity.
Although guanidine hydrochloride and similar agents are denaturants, this denaturation is
not irreversible and renaturation may occur upon removal (by dialysis, for example) or
dilution of the denaturant, allowing re-formation of immunologically and/or biologically
active protein. Other suitable buffers are known to those skilled in the art. The protein of
choice is separated from other bacterial proteins by standard separation techniques, e.g.,
ion exchange chromatography, ammonium sulfate fractionation, etc.
B. Standard protein separation techniques for purifying proteins of the
invention
Solubility fractionation
Often as an initial step, particularly if the protein mixture is complex, an
initial salt fractionation can separate many of the unwanted host cell proteins (or proteins
derived from the cell culture media) from the recombinant protein of interest. The
preferred salt is ammonium sulfate. Ammonium sulfate precipitates proteins by
effectively reducing the amount of water in the protein mixture. Proteins then precipitate
on the basis of their solubility. The more hydrophobic a protein is, the more likely it is to
precipitate at lower ammonium sulfate concentrations. A typical protocol includes·adding
saturated ammonium sulfate to a protein solution so that the resultant ammonium sulfate
concentration is between 20-30%. This concentration will precipitate the most
hydrophobic of proteins. The precipitate is then discarded (unless the protein of interest
is hydrophobic) and ammonium sulfate is added to the supernatant to a concentration
known to precipitate the protein of interest. Alternatively, the protein of interest in the
supernatant can be further purified using standard protein purification techniques. The
precipitate is then solubilized in buffer and the excess salt removed if necessary, either
through dialysis or diafiltration. Other methods that rely on solubility of proteins, such as
cold ethanol precipitation, are well known to those of skill in the art and can be used to
fractionate complex protein mixtures.
Size differential filtration
The molecular weight of the protein, e.g., PA-U1, etc., can be used to
isolated the protein from proteins of greater and lesser size using ultrafiltration through
membranes of different pore size (for example, Amicon or Millipore membranes). As a
first step, the protein mixture is ultrafiltered through a membrane with a pore size that has
a lower molecular weight cut-off than the molecular weight of the protein of interest. The
retentate of the ultrafiltration is then ultrafiltered against a membrane with a molecular
cut off greater than the molecular weight of the protein of interest. The recombinant
protein will pass through the membrane into the filtrate. The filtrate can then be
chromatographed as described below.
Column chromatography
The protein of choice can also be separated from other proteins on the
basis of its size, net surface charge, hydrophobicity, and affinity for ligands. In addition,
antibodies raised against proteins can be conjugated to column matrices and the proteins
immunopurified. All of these methods are well known in the art. It will be apparent to
one of skill that chromatographic techniques can be performed at any scale and using
equipment from many different manufacturers (e.g., Pharmacia Biotech).
In some embodiments, the proteins are purified from culture supernatants
of Bacillus (see, e.g., Examples I and III). Briefly, the proteins are purified by making a
culture supernatant 5 mM in EDTA, 35% saturated in ammonium sulfate and 1% in
phenyl-Sepharose Fast Flow (Pharmacia). The phenyl-Sepharose Fast Flow is then
agitated and collected. The collected resin is washed with 35% saturated ammonium
sulfate and the protective antigens were then eluted with 10 mM HEPES-1 mM EDTA
(pH 7.5). The proteins can then be further purified using a MonoQ column (Pharmacia
Biotech). The proteins can be eluted using a NaCl gradient in 10 mM CHES (2-[N-cyclohexylamino]ethanesulfonic
acid)-0.06% (vol/vol) ethanolamine (pH 9.1). The
pooled MonoQ fractions can then be dialyzed against the buffer of choice for subsequent
analysis or applications.
IV. Assays for measuring changes in cell growth
The administration of a functional PA and LF combination of the
invention to a cell can inhibit cellular proliferation of certain cell types that overexpress
MMPs and proteins of the plasminogen activation system, e.g., cancer cells, cells
involved in inflammation, and the like. One of skill in the art can readily identify
functional proteins and cells using methods that are well known in the art. Changes in
cell growth can be assessed by using a variety of in vitro and in vivo assays, e.g., MTT
assay, ability to grow on soft agar, changes in contact inhibition and density limitation of
growth, changes in growth factor or serum dependence, changes in the level of tumor
specific markers, changes in invasiveness into Matrigel, changes in cell cycle pattern,
changes in tumor growth in vivo, such as in transgenic mice, etc.
The term "over-expressing" refers to a cell that expresses a matrix
metalloproteinase, a plasminogen activator or a plasminogen activator receptor mRNA or
protein in amounts at least about twice that normally produced in a reference normal cell
type, e.g., a Vero cell. Overexpression can result, e.g., from selective pressure in culture
media, transformation, activation of endogenous genes, or by addition of exogenous
genes. Overexpression can be analyzed using a variety of assays known to those of skill
in the art to determine if the gene or protein is being overexpressed (e.g., northems, RT-PCR,
westerns, immunoassays, cytotoxicity assays, growth inhibition assays, enzyme
assays, gelatin zymography, etc.). An example of a cell overexpressing a matrix
metalloproteinase are the tumor cell lines, fibrosarcoma HT1080, melanoma A2058 and
breast cancer MDA-MB-231. An example of a cell which does not overexpress a matrix
metalloproteinase is the non-tumor cell line Vero. An example of a cells that overexpress
a plasminogen activator receptor are the uP AR overexpressing cell types Hela, A2058,
and Bowes. An example of a cell which does not overexpress a plasminogen activator
receptor is the non-tumor cell line Vero. An example of a cells that overexpress a tissue-type
plasminogen activator are cell types human melanoma Bowes and human primary
vascular endothelial cells. An example of a cell which does not overexpress a
plasminogen activator receptor is the non-tumor cell line Vero.
A. Assays for changes in cell growth by administration of protective
antigen and lethal factor
One or more of the following assays can be used to identify proteins of the
invention which are capable of regulating cell proliferation. The phrase "protective
antigen constructs" refers to a protective antigen protein of the invention. Functional
protective antigen constructs identified by the following assays can then be used to treat
disease and conditions, e.g., to inhibit abnormal cellular proliferation and transformation.
Thus, these assays can be sued to identify protective antigen proteins that are useful in
conjunction with lethal factor containing proteins to inhibit cell growth of tumors,
cancers, cancerous cells, and other pathogenic cell types.
Soft agar growth or colony formation in suspension
Soft agar growth or colony formation in suspension assays can be used to
identify protective antigen constructs, which when used in conjunction with a LF
construct, inhibit abnormal cellular proliferation and transformation. Typically,
transformed host cells (e.g., cells that grow on soft agar) are used in this assay.
Techniques for soft agar growth or colony formation in suspension assays are described
in Freshney, Culture of Animal Cells a Manual of Basic Technique, 3rd ed., Wiley-Liss,
New York (1994), herein incorporated by reference. See also, the methods section of
Garkavtsev et al. (1996), supra, herein incorporated by reference.
Normal cells require a solid substrate to attach and grow. When the cells
are transformed, they lose this phenotype and grow detached from the substrate. For
example, transformed cells can grow in stirred suspension culture or suspended in semi-solid
media, such as semi-solid or soft agar. The transformed cells, when transfected with
tumor suppressor genes, regenerate normal phenotype and require a solid substrate to
attach and grow.
Administration of an active protective antigen protein and an active LF
containing protein to transformed cells would reduce or eliminate the host cells' ability to
grow in stirred suspension culture or suspended in semi-solid media, such as semi-solid or
soft. This is because the transformed cells would regenerate anchorage dependence of
normal cells, and therefore require a solid substrate to grow. Therefore, this assay can be
used to identify protective antigen constructs that can function with a lethal factor protein
to inhibit cell growth. Once identified, such protective antigen constructs can be used in a
number of diagnostic or therapeutic methods, e.g., in cancer therapy to inhibit abnormal
cellular proliferation and transformation.
Contact inhibition and density limitation of growth
Contact inhibition and density limitation of growth assays can be used to
identify protective antigen constructs which are capable of inhibiting abnormal
proliferation and transformation in host cells. Typically, transformed host cells (e.g.,
cells that are not contact inhibited) are used in this assay. Administration of a protective
antigen construct and a lethal factor construct to these transformed host cells would result
in cells which are contact inhibited and grow to a lower saturation density than the
transformed cells. Therefore, this assay can be used to identify protective antigen
constructs which are useful in compositions for inhibiting cell growth. Once identified,
such protective antigen constructs can be used in disease therapy to inhibit abnormal
cellular proliferation and transformation.
Alternatively, labeling index with [3H]-thymidine at saturation density can
be used to measure density limitation of growth. See Freshney (1994), supra. The
transformed cells, when treated with a functional PA/LF combination, regenerate a
normal phenotype and become contact inhibited and would grow to a lower density. In
this assay, labeling index with [3H]-thymidine at saturation density is a preferred method
of measuring density limitation of growth. Transformed host cells are treated with a
protective antigen construct and a lethal factor construct (e.g., LP59) and are grown for
24 hours at saturation density in non-limiting medium conditions. The percentage of cells
labeling with [3H]-thymidine is determined autoradiographically. See, Freshney (1994),
supra. The host cells treated with a functional protective antigen construct would give
arise to a lower labeling index compared to control (e.g., transformed host cells treated
with a non-functional protective antigen construct or non-functional lethal factor
construct).
Growth factor or serum dependence
Growth factor or serum dependence can be used as an assay to identify
functional protective antigen constructs. Transformed cells have a lower serum
dependence than their normal counterparts (see, e.g., Temin, J. Natl. Cancer Insti.
37:167-175 (1966); Eagle et al., J. Exp. Med. 131:836-879 (1970)); Freshney, supra.
This is in part due to release of various growth factors by the transformed cells. When a
tumor suppressor gene is transfected and expressed in these transformed cells, the cells
would reacquire serum dependence and would release growth factors at a lower level.
Therefore, this assay can be used to identify protective antigen constructs which are able
to act in conjunction with a lethal factor to inhibit cell growth. Growth factor or serum
dependence of transformed host cells which are transfected with a protective antigen
construct can be compared with that of control (e.g., transformed host cells which are
treated with a non-functional protective antigen or non-functional lethal factor).
Transformed host cells treated with a functional protective antigen would exhibit an
increase in growth factor and serum dependence compared to control.
Tumor specific markers levels
Tumor cells release an increased amount of certain factors (hereinafter
"tumor specific markers") than their normal counterparts. For example, tumor
angiogenesis factor (TAF) is released at a higher level in tumor cells than their normal
counterparts. See, e.g., Folkman, Angiogenesis and cancer, Sem Cancer Biol. (1992)).
Tumor specific markers can be assayed for to identify protective antigen
constructs, which when administered with a lethal factor construct, decrease the level of
release of these markers from host cells. Typically, transformed or tumorigenic host cells
are used. Administration of a protective antigen and a lethal factor to these host cells
would reduce or eliminate the release of tumor specific markers from these cells.
Therefore, this assay can be used to identify protective antigen constructs are functional
in suppressing tumors.
Various techniques which measure the release of these factors are
described in Freshney (1994), supra. Also, see, Unkless et al., J. Biol. Chem. 249:4295-4305
(1974); Strickland & Beers, J. Biol. Chem. 251:5694-5702 (1976); Whur et al., Br.
J. Cancer 42:305-312 (1980); Gulino, Angiogenesis, tumor vascularization, and potential
interference with tumor growth. In Mihich, E. (ed): "Biological Responses in Cancer."
New York, Plenum (1985); Freshney Anticancer Res. 5:111-130 (1985).
Cytotoxicity assay with MTT
The cytotoxicity of a particular PA/LF combination can also be assayed
using the MTT cytotoxicity assay. Cells are seeded and grown to 80 to 100% confluence.
The cells are then were washed twice with serum-free DMEM to remove residual FCS
and contacted with a particular PA/LF combination. MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium
bromide) is then added to the cells and oxidized MTT (indicative
of a live cell) is solubilized and quantified.
Invasiveness into Matrigel
The degree of invasiveness into Matrigel or some other extracellular
matrix constituent can be used as an assay to identify protective antigen constructs which
are capable of inhibiting abnormal cell proliferation and tumor growth. Tumor cells
exhibit a good correlation between malignancy and invasiveness of cells into Matrigel or
some other extracellular matrix constituent. In this assay, tumorigenic cells are typically
used. Administration of an active protective antigen/lethal factor protein combination to
these tumorigenic host cells would decrease their invasiveness. Therefore, functional
protective antigen constructs can be identified by measuring changes in the level of
invasiveness between the tumorigenic cells before and after the administration of the
protective antigen and lethal factor constructs.
Techniques described in Freshney (1994), supra, can be used. Briefly, the
level of invasion of tumorigenic cells can be measured by using filters coated with
Matrigel or some other extracellular matrix constituent. Penetration into the gel, or
through to the distal side of the filter, is rated as invasiveness, and rated histologically by
number of cells and distance moved, or by prelabeling the cells with 125I and counting the
radioactivity on the distal side of the filter or bottom of the dish. See, e.g., Freshney
(1984), supra.
G0/G1 cell cycle arrest analysis
G0/G1 cell cycle arrest can be used as an assay to identify functional
protective antigen construct. PA/LF construct administration can cause G1 cell cycle
arrest. In this assay, cell lines can be used to screen for functional protective antigen
constructs. Cells are treated with a putative protective antigen construct and a lethal
factor construct. The cells can be transfected with a nucleic acid comprising a marker
gene, such as a gene that encodes green fluorescent protein. Administration of a
functional protective antigen/lethal factor combination would cause G0/G1 cell cycle
arrest. Methods known in the art can be used to measure the degree of G1 cell cycle
arrest. For example, the propidium iodide signal can be used as a measure for DNA
content to determine cell cycle profiles on a flow cytometer. The percent of the cells in
each cell cycle can be calculated. Cells exposed to a functional protective antigen would
exhibit a higher number of cells that are arrested in G0/G1 phase compared to control
(e.g., treated in the absence of a protective antigen).
Tumor growth in vivo
Effects of PA/LFon cell growth can be tested in transgenic or immune-suppressed
mice. Transgenic mice can be made, in which a tumor suppressor is disrupted
(knock-out mice) or a tumor promoting gene is overexpressed. Such mice can be used to
study effects of protective antigen as a method of inhibiting tumors in vivo.
Knock-out transgenic mice can be made by insertion of a marker gene or
other heterologous gene into a tumor suppressor gene site in the mouse genome via
homologous recombination. Such mice can also be made by substituting the endogenous
tumor suppressor with a mutated version of the tumor suppressor gene, or by mutating the
endogenous tumor suppressor, e.g., by exposure to carcinogens.
A DNA construct is introduced into the nuclei of embryonic stem cells.
Cells containing the newly engineered genetic lesion are injected into a host mouse
embryo, which is re-implanted into a recipient female. Some of these embryos develop
into chimeric mice that possess germ cells partially derived from the mutant cell line.
Therefore, by breeding the chimeric mice it is possible to obtain a new line of mice
containing the introduced genetic lesion (see, e.g., Capecchi et al., Science 244:1288
(1989)). Chimeric targeted mice can be derived according to Hogan et al., Manipulating
the Mouse Embryo: A Laboratory Manual, Cold Spring Harbor Laboratory (1988) and
Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, Robertson, ed.,
IRL Press, Washington, D.C., (1987).
These knock-out mice can be used as hosts to test the effects of various
protective antigen constructs on cell growth. These transgenic mice with a tumor
suppressor gene knocked out would develop abnormal cell proliferation and tumor
growth. They can be used as hosts to test the effects of various protective antigen
constructs on cell growth. For example, introduction of protective antigen constructs and
lethal factor constructs into these knock-out mice would inhibit abnormal cellular
proliferation and suppress tumor growth.
Alternatively, various immune-suppressed or immune-deficient host
animals can be used. For example, genetically athymic "nude" mouse (see, e.g.,
Giovanella et al., J. Natl. Cancer Inst. 52:921 (1974)), a SCID mouse, a thymectomized
mouse, or an irradiated mouse (see, e.g., Bradley et al., Br. J. Cancer 38:263 (1978);
Selby et al., Br. J. Cancer 41:52 (1980)) can be used as a host. Transplantable tumor
cells (typically about 106 cells) injected into isogenic hosts will produce invasive tumors
in a high proportions of cases, while normal cells of similar origin will not. In hosts
which developed invasive tumors, cells are exposed to a protective antigen
construct/lethal factor combination (e.g., by subcutaneous injection). After a suitable
length of time, preferably 4-8 weeks, tumor growth is measured (e.g., by volume or by its
two largest dimensions) and compared to the control. Tumors that have statistically
significant reduction (using, e.g., Student's T test) are said to have inhibited growth.
Using reduction of tumor size as an assay, functional protective antigen constructs which
are capable of inhibiting abnormal cell proliferation can be identified. This model can
also be used to identify functional mutant versions of protective antigen.
V. Pharmaceutical Compositions Administration
Protective antigen containing proteins and lethal factor containing proteins
can be administered directly to the patient, e.g., for inhibition of cancer, tumor, or
precancer cells in vivo, etc. Administration is by any of the routes normally used for
introducing a compound into ultimate contact with the tissue to be treated. The
compounds are administered in any suitable manner, preferably with pharmaceutically
acceptable carriers. Suitable methods of administering such compounds are available and
well known to those of skill in the art, and, although more than one route can be used to
administer a particular composition, a particular route can often provide a more
immediate and more effective reaction than another route.
Pharmaceutically acceptable carriers are determined in part by the
particular composition being administered, as well as by the particular method used to
administer the composition. Accordingly, there is a wide variety of suitable formulations
of pharmaceutical compositions of the present invention (see, e.g., Remington's
Pharmaceutical Sciences, 17th ed. 1985)). For example, if in vivo delivery of a
biologically active protective antigen protein is desired, the methods described in
Schwarze et al. (see Science 285:1569-1572 (1999)) can be used.
The compounds, alone or in combination with other suitable components,
can be made into aerosol formulations (i.e., they can be "nebulized") to be administered
via inhalation. Aerosol formulations can be placed into pressurized acceptable
propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like.
Formulations suitable for parenteral administration, such as, for example,
by intravenous, intramuscular, intradermal, and subcutaneous routes, include aqueous and
non-aqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers,
bacteriostats, and solutes that render the formulation isotonic with the blood of the
intended recipient, and aqueous and non-aqueous sterile suspensions that can include
suspending agents, solubilizers, thickening agents, stabilizers, and preservatives. In the
practice of this invention, compositions can be administered, for example, by intravenous
infusion, orally, topically, intraperitoneally, intravesically or intrathecally. The
formulations of compounds can be presented in unit-dose or multi-dose sealed containers,
such as ampules and vials. Injection solutions and suspensions can be prepared from
sterile powders, granules, and tablets of the kind previously described.
The dose administered to a patient ("a therapeutically effective amount"),
in the context of the present invention should be sufficient to effect a beneficial
therapeutic response in the patient over time. The dose will be determined by the efficacy
of the particular compound employed and the condition of the patient, as well as the body
weight or surface area of the patient to be treated. The size of the dose also will be
determined by the existence, nature, and extent of any adverse side-effects that
accompany the administration of a particular compound or vector in a particular patient
In determining the effective amount of the compound(s) to be administered
in the treatment or prophylaxis of cancer, the physician evaluates circulating plasma
levels of the respective compound(s), progression of the disease, and the production of
anti-compound antibodies. In general, the dose equivalent of a compound is from about 1
ng/kg to 10 mg/kg for a typical patient. Administration of compounds is well known to
those of skill in the art (see, e.g., Bansinath et al., Neurochem Res. 18:1063-1066 (1993);
Iwasaki et al., Jpn. J. Cancer Res. 88:861-866 (1997); Tabrizi-Rad et al., Br. J.
Pharmacol. 111:394-396 (1994)).
For administration, compounds of the present invention can be
administered at a rate determined by the LD-50 of the particular compound, and its side-effects
at various concentrations, as applied to the mass and overall health of the patient.
Administration can be accomplished via single or divided doses.
All publications and patent applications cited in this specification are
herein incorporated by reference as if each individual publication or patent application
were specifically and individually indicated to be incorporated by reference.
Although the foregoing invention has been described in some detail by
way of illustration and example for purposes of clarity of understanding, it will be readily
apparent to one of ordinary skill in the art in light of the teachings of this invention that
certain changes and modifications may be made thereto without departing from the spirit
or scope of the appended claims.
EXAMPLES
The following examples are provided by way of illustration only and not by
way of limitation. Those of skill in the art will readily recognize a variety of noncritical
parameters that could be changed or modified to yield essentially similar results.
Example I: Construction of mutant PA with matrix metalloproteinase cleavage sites
A. Materials
Enzymes for DNA manipulation and modification were purchased from New
England Biolabs (Beverly, MA). FP59 and soluble form furin were prepared in our
laboratory according to standard methodology.. Active MMP-2 was a kind gift from Dr.
William Stetler-Stevenson, active form MMP-9 was purchased from CALBIOCHEM (San
Diego, CA). MMP inhibitors BB-94 (Batimastat) and BB-2516 (Marimastat) were kind gifts
from British Biotechnology Limited, GM6001 was a kind gift from Dr. Richard E. Galardy
prepared as described (Grobelny, D., et al., Biochemistry, 31:7152-7154 (1992)). Rabbit
anti-PA polyclonal antibody (#5308) was made in our laboratory. Rabbit anti-MT-MMP1
(AB815) was purchased from CHEMICON International, Inc. (Temecula, CA). The
sequence for LF can be found, e.g., in Robertson & Leppla, Gene 44: 71-78 (1986). The
sequence for PA is described, e.g., in Singh et al., J. Biol. Chem. 264: 19103-19107 (1989)
(expression vector pYS5); Leppla, in Methods in Enzymology, vol. 165, pp. 103-116
(Harshman ed., 1988). Site-directed mutagenesis of PA molecules has been previously
described (Singh et al., J. Biol. Chem. 269: 29039-29046 (1994)
Construction of PA MMP substrate mutants
Overlap PCR was used to construct the PA mutants with the furin site replaced
by MMP substrate octapeptide GPLGMLSQ (SEQ ID NO:2) in PA-L1 and GPLGLWAQ
(SEQ ID NO:3) in PA-L2. Wild type PA (WT-PA) expression plasmid pYS5 (Singh, Y., et
al., J Biol Chem, 264:19103-19107 (1989)) was used as template. We used 5' primer F
(AAAGGAGAACGTATATGA (SEQ ID NO:8), underlined are SD sequence and start codon
of PA) and the phosphorylated primer R1 (pTGAGTTCGAAGATTTTTGTTTTAATTCTGG
(SEQ ID NO:9), annealing to the sequence corresponding to P154 -S163) to amplify the
fragment N. We used the mutagenic phosphorylated primer H1
(pGGACCATTAGGAATGTGGAGTCAAAGTACAAGTGCTGGACCTACGGTTCCA
G (SEQ ID NO:10), encoding MMP substrate GPLGMLSQ (SEQ ID NO:2) and S168-P176)
and reverse primer R2 ACGTTTATCTCTTATTAAAAT (SEQ ID NO:1 11), annealing to the
sequence compassing I589-R595) to amplify the mutagenic fragment M1. We used a
phosphorylated mutagenic primer H2
(pGGACCATTAGGATTATGGGCACAAAGTACAAGTGCTGGACCTACGGTTCCAG
(SEQ ID NO:12), encoding MMP substrate GPLGLWAQ (SEQ ID NO:3) and S168-P176) to
amplify mutagenic fragment M2. Then used primer F and R2 to amplify the ligation products
of N and M1, N and M2, respectively, resulting in the mutagenic fragments L1 and L2, in
which the coding sequence for furin site (RKKR167; SEQ ID NO:1) were replaced by MMP
substrate sequence GPLGMLSQ (SEQ ID NO:2) and GPLGLWAQ (SEQ ID NO:3),
respectively. The HindIII/PstI digests of L1 and L2, which included the mutation sites, were
cloned between HindIII and PstI site of pYS5. The resulting expression plasmids were
named pYS-PA-L1 and pYS-PA-L2, their expression products, the PA mutated proteins,
were accordingly named PA-L1 and PA-L2.
Expression and Purification of WT-PA, PA-L1 and PA-L2
To express WT-PA, PA-L1 and PA-L2, expression plasmids pYS5, pYS-PA-L1
and pYS-PA-L2 were transformed into non-virulent strain B. anthracis UM23C1-1, and
grown in FA medium (Singh, Y., et al., J Biol Chem, 264:19103-19107 (1989)) with 20
µg/ml of kanamycin for 16 h at 37°C, PA proteins were purified by ammonium sulfate
precipitation followed by monoQ column (Pharmacia Biotech) chromatography, as described
previously (Varughese, M., et al., Infect Immun, 67:1860-1865 (1999)).
In vitro cleavage of WT-PA, PA-L1 and PA-L2 by furin, MMP-2 and MMP-9
To test whether PA-L1 and PA-L2 had the ability to be processed by MMP-2
and MMP-9 rather than furin, in vitro cleavage of WT-PA, PA-L1 and PA-L2 were
performed. For furin cleavage, 50 µl volume of reaction in PBS, pH 7.4,25 mM HEPES, 0.2
mM EDTA, 0.2 mM EGTA, 100 µg/ml ovalbumin, 1.0 mM CaCl2, 1.0 mM MgCl2, including
5 µg of WT-PA, PA-L1 and PA-L2, respectively. Digestion was started by addition 0.1µg of
soluble form of furin and incubated at 37°C, aliquots (5 µl) were withdrawn at different time
points. Cleavage was detected by western blotting with a rabbit anti-PA antibody. For
western blotting, the sample aliquots were separated by PAGE using 10-20% gradient Tris-glycine
gel (Novex, San Diego, CA) and
electroblotted to a nitrocellulose membrane (Novex, San Diego, CA). The membrane
was blocked with 5% (w/v) non-fat milk and hybridized by using rabbit anti-PA
polyclonal antibody (#5308). Blot was washed and incubated with an HRP-conjugated
goat anti-rabbit antibody (sc-2004, Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and
was visualized by TMB Stabilized Substrate for HRP (Promega, Madison, WI). For
MMP-2 and MMP-9 cleavage, 5 µg each of WT-PA, PA-L1 and PA-L2 was incubated
with 0.2 µg active NEAP-2 or 0.2 µg active MMP-9, respectively, in 50 µl of reactions
including 50 mM HEPES, pH 7.5, 10 mM CaCl2, 200 mM NaCl, 0.05% (v/v) Brij-35 and
50 µM ZnSO4. Aliquots (5 µl) were withdrawn at different time points and were
analyzed by western blotting with rabbit anti-PA polyclonal antibody (#5308) as
described above.
Cells and culture medium
Vero cells, COS-7 cells, human fibrosarcoma HT1080 cells, human
melanoma A2058 cells and human breast cancer MDA-MB-231 cells were obtained from
ATCC (Rockville, Maryland). All cells were grown in Dulbecco' Modified Eagle's
Medium (DMEM) with 0.45% glucose, 10% fetal bovine serum, 2 mM glutamine. Cells
were maintained at 37°C in a 5% CO2 incubator. Cells were dissociated with a solution
of 0.05% trypsin, 0.02% EDTA, 0.01 M sodium phosphate, pH 7.4, and were usually
subcultured at a split ratio of 1:4.
Preparation of cell extracts and condition media for gelatin zymography
Cells were cultured in 75 cm2 flask to 80-100% of confluence at 37°C in
DMEM supplemented with 10% FCS. Then the cells were washed twice with serum-free
DMEM to remove residual FCS, and lysed for 10 min on ice with 1 ml/flask of 0.5%
(v/v) Triton X-100 in 0.1 M Tris-HCl, pH 8.0, and scraped with a rubber policeman. The
cell lysates were centrifuged at 10,000 rpm for 10 min at 4°C, the concentrations of the
proteins were determined by BCA Protein Assay Kit (PIERCE, Rockford, IL), and was
adjusted to 1 mg/ml by lysis buffer. For collection the conditioned media, the cells were
incubated for 24 h with 4 ml/flask of serum-free DMEM. The culture supernatants were
harvested, and cellular debris removed by centrifugation at 10,000 rpm for 10 min at 4°C.
Cell lysates and conditioned media were frozen at -70°C or immediately processed for
zymographic analysis.
Gelatin zymography
Cell extracts (1 ml) or conditioned media normalized to protein
concentrations of the corresponding cell extract (3-4 ml) were incubated at 4°C for 1 h in
an end-over-end mixer with 50 µl of gelatin-sepharose 4B (Pharmacia Biotech AB)
equilibrated with 50 mM Tris-HCl, 150 mM NaCl, 5 mM CaCl2, 0.02% (v/v) Tween-20,
10 mM EDTA, pH 7.5. After 4 washes with 1 ml of equilibration buffer containing 200
mM NaCl, the beads were resuspended in 30 µl 4X non-reducing sample buffer,
centrifuged to collect the supernatants and loaded on 10% gelatin zymogram gel (Novex,
San Diego, CA). After electrophoresis, the gel was soaked in Renaturing Buffer (Novex,
San Diego, CA) for twice with 30 min each to renature gelatinases at room temperature.
The gel was then equilibrated in Developing Buffer (Novex, San Diego, CA), which
added back a divalent metal cation required for enzymatic activity, first for 30 min at
room temperature and then in new buffer at 37°C for overnight. The gel was then stained
overnight with 0.5% (w/v) Commassie Brilliant Blue R-250 in 45% (v/v) methanol, 10%
acetic acid and destained in the same solution without dye.
Cytotoxicity assay with MTT
Cytotoxicity of WT-PA, PA-L1 and PA-L2 to the test cells were
performed in 96-well plates. Cells were properly seeded into 96-well plates so that they
reached 80 to 100% of confluence the next day. The cells were washed twice with
serum-free DMEM to remove residual FCS. Then serially diluted WT-PA, PA-L1 or PA-L2
(from 0 to 1000 ng/ml) combined with FP59 (50 ng/ml) in serum-free DMEM were
added to the cells to give a total volume of 200 µl/well. One group of cells was
challenged with the toxins for 6 hours, then removed the toxins replaced with fresh
DMEM supplemented with 10% FCS. For the cytotoxic action of FP59 relies on
inhibition of initial protein synthesis by ADP ribosylating EF-2 and usually need 24-48
hours to show the toxicity, cytotoxicity was allowed to develop for 48 hours. After that
cell viability was assayed by adding 50 µl of 2.5 mg/ml MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium
bromide). The cells were incubated with MTT for 45 min at
37°C, live cells oxidized MTT to blue dye precipitated in cytosol while dead cells
remained colorless. Then removed media and solubilized the blue precipitate with 100
µl/well of 0.5% (w/v) SDS, 25 mM HCl, in 90% (v/v) isopropanol. The plates were
vortexed and the intensity of the oxidized MTT read at 570 nm using the microplate
reader. Another group of cells was challenged with the toxins for 48 hours in serum-free
DMEM, then viability was determined by cytotoxicity assay with MTT as described
above
Cytotoxicity assay in the co-culture model
We designed a co-culture model to mimic the in vivo condition to verify
whether PA-L1 and PA-L2 specifically killed MMP expressing tumor cells, not MMP
non-expressing cells. Vero, HT1080, A2058 and MDA-MB-231 cells were cultured into
the different chambers of 8-chamber slide (Nalge Nunc International, Naperville, IL) to
80-100% of confluence. Then the cells were washed twice with serum-free DMEM, the
chamber partition was removed, and the slide was put into a petri culture dish with serum
free medium, so that the different cells were in the same culture environment. PA, PA-L1
or PA-L2 (300 ng/ml) each plus FP59 (50 ng/ml), or FP59 (50 ng/ml) alone were added
to the cells and incubated to 48 hours. Then MTT (0.5 mg/ml) was added for 45 min at
37°C, the partition was remounted, the oxidized MTT was dissolved as described above
to determine cell viability for each chamber.
Cell binding and processing assay of WT-PA, PA-L1 and PA-L2
Binding and processing of WT-PA, PA-L1 and PA-L2 on the surface of
Vero cells and HT1080 cells was assayed. Vero and HT1080 cells were grown in 24-well
plate to 80-100% of confluence and washed twice with serum-free DMEM to remove
residual FCS. Then the cells were incubated with 1000 ng/ml of WT-PA, PA-L1 and
PA-L2, respectively, for different length of time (0, 10 min, 40 min, 120 min and 360
min) at 37°C in serum-free DMEM. The cells were washed three times to remove
unbound PA proteins. Cells were lysed in 100 µl/well modified RIPA lysis buffer (50
mM Tris-HCl, pH 7.4, 1% NP40, 0.25 Na-deoxycholate, 150 mM NaCl, 1 mM EDTA, 1
mM PMSF, 1 mg/ml each of aprotinin, leupeptin and pepstatin) on ice for 10 min. Equal
amounts of protein from cell lysates were separated by PAGE using 10-20% gradient
Tris-glycine gels (Novex, San Diego, CA). After transfer to nitrocellulose membranes,
blocking was done with 5% non-fat milk. Western blotting used rabbit anti-PA
polyclonal antibody (#5308). Blot was washed and incubated with an HRP-conjugated
goat anti-rabbit antibody (sc-2004) (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and
was visualized by EL (PIERCE, Rockford, IL).
Construction and Transfection of MT1-MMP into COS-7 cells
MT1-MMP cDNA was a generous gift of J. Windsor, AB. The pEGFPN1
(Clontech Laboratories, Inc., Palo Alto, CA) mammalian expression vector was used for
fusing the C-terminus of MT1-MMP to the N-terminus of EGFP (red shifted variant of green
fluorescent protein). The MT1-MMP coding sequence was isolated with Tth III and then
filled in with Pfu and inserted into the Smal site of pEGFPN1. COS-7 Cells (2 x 105 per
dish) were transfected with expression vectors (2 µg) by means of SuperFect (10 ml)
(Qiagen). Cells were incubated for 3 h. with the DNA-SuperFect complex in the presence
of serum and antibiotic containing medium. The complex containing medium was removed
and cells grown in fresh serum containing medium for 48h. Thereafter cells were grown in
G418 (Life Technologies, Inc.) containing medium. Cells expressing the MT1-MMP/GFP
fusion protein, named COSgMT1, were sorted from non-expressing cells by flowcytometry
with a FACstar Plus (Becton Dickinson), excitation at 488 nm.
B. Results
Generation of PA mutants which can be activated by MMPs
Crystal structure of PA showed that the furin cleavage site RKKR167 (SEQ ID
NO:1) is in the middle of a surface flexible, solvent exposed loop composed of aa 162 to 175
(Petosa, C., et al., Nature, 385:833-838 (1997)). Cleavage in this loop by furin-like proteases
is essential to toxicity. To construct PA mutants specifically processed by MMPs, especially
MMP-2 and MMP-9, instead of furin, the furin site RKKR167 (SEQ ID NO:1) was replaced
by MMP-2 and MMP-9 favorite sequences, GPLGMLSQ (SEQ ID NO:2) and GPLGLWAQ
(SEQ ID NO:3), respectively, resulting in two PA mutants, PA-L1 and PA-L2 (Fig. 1a).
These two MMP substrate octapeptides were designed based on the studies of Netzel-Arneet
et al (Netzel-Arnett, S., et al., J Biol Chem, 266:6747-6755 (1991); Netzel-Arnett, S., et al.,
Biochemistry, 32:6427-6432 (1993)), in which the sequence specificity of human MMP-2,
MMP-9, matrilysin, MMP-1 and MMP-8 had been examined by measuring the rate of
hydrolysis of over 50 synthetic oligopeptides. These two octapeptides are favorite substrates
of MMP-2 and MMP-9, but also overlap to other MMP species (Netzel-Arnett, S., et al., J
Biol Chem, 266:6747-6755 (1991); Netzel-Arnett, S., et al., Biochemistry, 32:6427-6432
(1993)). They are also potential substrates for MTl-MMP (Will, H., et al., J Biol Chem,
271:17119-17123 (1996)). PA-L 1 and PA-L2 coding sequences were constructed by overlap
PCR, cloned into E. coli-Bacillus shuttle vector pYS5, and efficiently expressed in non-virulent
Bacillus Anthracis UM23C1-1. The expression products were secreted into the
culture supernatants and reached to 20 to 50 mg/L. These two mutated PA proteins were
roughly purified by ammonium sulfate precipitation, followed by mono Q chromatography.
The purified mutated PA proteins PA-L1 and PA-L2 commiserated with WT-PA in SDS-PAGE,
but migrated faster than WT-PA in native gel because of the four positively charged
residues RKKR (SEQ ID NO:1) of the furin site were replaced into non-charged MMP
octapeptides (data not shown).
To characterize WT-PA and these two PA mutants in susceptibility to
proteases, they were subjected to the cleavage with soluble form furin, active form MMP-2
and MMP-9 in vitro. WT-PA was very sensitive to furin, but complete resistant to MMP-2
and MMP-9 (Fig. 1b). In contrast, PA-L1 and PA-L2 were completely resistant to furin, but
got the new feature to be efficiently processed into two fragments, PA63 and PA20, by MMP-2
and MMP-9 (Fig. I c and 1d). There was no apparent difference between the two PA
mutants in respect to the processing patterns by furin, MMP-2 and MMP-9. However, it
seemed PA-L1 and PA-L2 were processed more efficiently by MMP-2 than by MMP-9.
PA-L1 and PA-L2 killed MMP expressing tumor cells but not MMP non-expressing
cells
To test the hypothesis that PA-L1 and PA-L2 only kill MMP expressing tumor
cells, but not MMP non-expressing normal cells, three human tumor cell lines, fibrosarcoma
HT1080, melanoma A2058 and breast cancer MDA-MB-231, and one non-tumor cell line
Vero, were employed in cytotoxicity assay. Gelatin zymography showed that HT1080
expressed both MMP-2 and MMP-9, A2058 only expressed MMP-2, MDA-MB-231 only
expressed MMP-9, in both conditioned serum-free media and cell extracts, reflecting the
gelatinases expressed by these three tumor cell lines were secreted into the media and may
also associated with the cell surface (Fig. 2). In contrast, Vero cells had very low background
of MMP expression (Fig. 2).
Cytotoxicity of WT-PA and the PA mutants to these cells were performed
onto 96-well plates. When cells grew to 80 to 100% confluence, different concentrations
(from 0 to 1000 ng/ml) of WT-PA, PA-L1 and PA-L2 combined with FP59 (constant at
50 ng/ml) were separately added to the cells and challenged the cells for 6 hours and 48
hours. For the PA dependent cytotoxicity of FP59 relies on inhibition of initial protein
synthesis by ribosylating EF-2, cytotoxicity was allowed to develop for 48 hours. The
EC
50 (concentration needed to kill half of the cells) of PA and the PA mutants were
summarized in Table 1. Fig. 3a showed MMP non-expressing Vero cells were quite
resistant to PA-L1 and PA-L2, but very sensitive to wild-type PA with dose-dependent
manner. However, the PA-L1 and PA-L2 nicked by MMP-2
in vitro efficiently killed
Vero cells even with 6 hours toxin challenge in dose-dependent manner (Fig. 3b),
demonstrating the non toxicity of PA-L1 and PA-L2 to Vero cells was due to Vero cells
lack the ability of processing them into the active form PA63. We will show later (in Fig.
7) that WT-PA, PA-L1 and PA-L2 quickly bound to Vero cells, but only WT-PA could
be processed by Vero cells to the active form PA63, while PA-L1 and PA-L2 not. In
contrast to Vero cells, the two MMP expressing tumor cells, HT1080, A2058 and MDA-MB-231,
were quite susceptible to WT-PA as well as PA-L1 and PA-L2 (Fig. 4a, 4b and
4c), and the sensitivity to these PA mutants seemed directly correlated with the overall
expression levels of MMPs of these tumor cells (Fig. 2).
EC50 (ng/ml) of wild type and mutated PA proteins (plus 50 ng/ml FP59) on target cells |
| Vero | HT1080 | A2058 | MDA-MB-231 | COS-7 | COSgMTI |
WT-PA | 5 (6) | 2.5(5.5) | 2(6) | 1(2) | 6(15) | 20(30) |
PA-L1 | >>1000(>>1000) | 2(10) | 4(20) | 3(15) | >>1000(>>1000) | 20(40) |
PA-L2 | >>1000(>>1000) | 2(10) | 7(25) | 4(30) | >>1000(>>1000) | 20(20) |
Nicked PA-L1 | 20 |
Nicked PA-L2 | 20 |
To further demonstrate the cytotoxicity of the PA mutants to the tumor
cells was dependent on MMP activity expressed by the target cells, we characterized the
effects of the well described MMP inhibitors, BB94 (Batimastat), BB-2516
(Marimastat)), and GM6001, on cytotoxicity of WT-PA, PA-L1 and PA-L2 to HT1080
cells. All these MMP inhibitors, especially GM6001, conferred clear protection to
HT1080 cells against the challenge with PA-L1 and PA-L2 plus FP59, but did not protect
the cells against WT-PA plus FP59 (Fig. 5). Thus, killing the tumor cells by PA-L1 and
PA-L2 was really dependent on MMP activity expressed by the target cells.
PA-L1 and PA-L2 specifically killed MMP expressing tumor cells in a co-culture
model
We designed a co-culture model to mimic the in vivo condition to verify
whether PA-L1 and PA-L2 specifically kill MMP expressing tumor cells, not MMP non-expressing
cells. Vero, HT1080, MDA-MB-231 and A2058 cells were cultured into the
different chambers of 8-chamber slides. When the cells reached confluence, the chamber
partition was removed and the slide was put into a petri culture dish with serum free
medium, so that the different cells were in the same culture environment. PA, PA-L1 or
PA-L2 (300 ng/ml) plus FP59 (50 ng/ml), or FP59 (50 ng/ml) alone were separately
added to the cells and incubated for 48 hours for cytotoxicity assay as described in
Materials and Methods. The result showed WT-PA unselectively killed all cells,
meanwhile PA-L1 and PA-L2 only killed HT1080, MDA-MB-231 and A2058 cells, but
did not hurt MMP non-expressing Vero cells (Fig. 5). This result defined the relative
contributions of membrane-associated versus soluble MMPs, indicated the activation
processing of the PA mutants mainly happened on the surface of the tumor cells instead
of in the supernatant. Binding and processing of WT-PA, PA-L1 and PA-L2 on the
surface of MMP non-expressing Vero cells and MMP expressing HT1080 cells were also
directly assessed. Vero and HT1080 cells were incubated with WT-PA, PA-L1 and PAL2
for 0, 10 min, 40 min, 120 min and 360 min at 37°C, respectively. Then the cells were
washed and cell lysates were prepared for western blotting analysis to check the
transformation of WT-PA and PA mutants to the active form PA63. The data showed
WT-PA, PA-L1 and PA-L2 could be detected in the Vero and HT1080 cell lysates as
soon as 10 min after incubation, demonstrating WT-PA and PA mutants could quickly
bound to the cell surface (Fig. 7a, 7b). WT-PA was processed by both of these two cell
lines. In contrast, PA-L1 and PA-L2 were only processed by MMP expressing HT1080
cells but not MMP non-expressing Vero cells (Fig. 7a, 7b), being consistent with the
previous results that PA-L1 and PA-L2 could only be processed by MMPs (Fig. 1b and
1c) and selectively killed MMP-expressing tumor cells (Fig. 6). Though HT1080 cells
processed WT-PA, PA-L1 and PA-L2, but the results showed the cells processed WT-PA
more efficiently than PA-L1 and PA-L2 (Fig. 7b), reflecting the activity of furin or furin-like
proteases was higher than that of MMPs on the cell surface. We also analyzed the
processing status of PA-L1 and PA-L2 in the culture supernatants of HT1080 cells, and could
not detect their active form PA63 in the overnight culture supernatants, but with time
increasing the randomly breakdown products showed up (data not shown).
MT1-MMP played a role in activation of PA-L1 and PA-L2
Zymographic analysis showed COS-7 cells expressed very negligible amount
gelatinases (Fig. 8a insert). Thus, just as expected, COS-7 cells were resistant to PA-L1 and
PA-L2 plus FP59, but susceptible to WT-PA plus FP59 (Fig. 8a). To examine the role of
MT1-MMP in activation of PA-L1 and PA-L2, encoding sequence of MT1-MMP was
transfected into COS-7 cells, resulting in a stable transfectant COSgMT1 in which expression
of MT1-MMP was detected by western blotting (Fig. 8b insert). In contrast to COS-7 cells,
COSgMT1 became very sensitive to PA-L1 and PA-L2 (Fig. 8b), indicating MT1-MMP
played a role in activation of these PA mutants, either by directly processing the cell bound
PA mutants, or by indirect way that activated pro-MMP-2 or other MMPs first, which in turn
processed PA mutants to their active form PA63. It seemed unlikely the later one, for COS-7
cells expressed negligible amount of MMPs.
Example II: Construction of mutant PA with matrix metalloproteinase cleavage sites
Mutant PA proteins were constructed and tested as described in Example I,
substituting one of the following plasminogen activator cleavage sites of Table 2 for the
MMP cleavage sites described above. Phage display libraries were used to identify
sequences having specificity for a particular protease (
see, e.g., Coombs
et al.,
J.
Biol. Chem.
273:4323-4328 (1998); Ke
et al.,
J.
Biol.
Chem. 272:20456-20462 (1997); Ke
et al.,
J.
Biol.
Chem. 272:16603-16609 (1997)). These libraries can be used by one of skill in the art to
select sequences specifically recognized by MPP and plasminogen activator proteases.
u-TP and t-PA cleavage sites |
Substrate sequence | u-PA Kcat/Km | t-PA Kcat/Km | a-PA:t-PA selectivity | SEQ ID NO: |
PCPGRVVGG | 0.88 | 0.29 | 3.0 | 4 |
PGSGRSA | 1200 | 60 | 20 | 5 |
PGSGKSA | 193 | 1.6 | 121 | 6 |
PQRGRSA | 45 | 850 | 0.005 | 7 |
Example III.: Construction of mutant PA with plasminogen activator cleavage sites
A. Materials
Enzymes for DNA manipulation and modification were purchased from New
England Biolabs (Beverly, MA). FP59 and a soluble form of furin were prepared in our
laboratory as described (Gordon, V. M., et al., Infect. Immun., 65:4130-4134 (1997)). Rabbit
anti-PA polyclonal antibody (#5308) was made in our laboratory. Pro-uPA (single-chain
uPA, #107), uPA (#124), tPA (#116), human urokinase amino-terminal fragment (ATF)
(#146), human glu-plasminogen (#410), human PAI-1 (#1094), human plasmin (#421),
monoclonal antibody against human uPA B-chain (#394) were purchased from America
Diagnostica inc (Greenwich, CT). Goat polyclonal antibody against human t-PA (sc-5241)
was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). uPAR monoclonal
antibody R3 was a gift
Construction of mutated PA proteins
A modified overlap PCR method was used to construct the mutated PA
proteins in which the furin site is replaced by the uPA and tPA physiological substrate
sequence PCPGRVVGG (SEQ ID NO:4) in PA-U1, uPA favorite sequences PGSGRSA
(SEQ ID NO:5) and PGSGKSA (SEQ ID NO:6) in PA-U2 and PA-U3, respectively, tPA
favorite sequence PQRGRSA (SEQ ID NO:7) in PA-U4. The PA expression plasmid pYS5
(Singh, Y., et al., J Biol Chem, 264:19103-19107 (1989)) was used as template. A 5' primer
F, AAAGGAGAACGTATATGA (SEQ ID NO:8) (Shine-Dalgarno and start codons are
underlined), and the phosphorylated reverse primer R1,
pTGGTGAGTTCGAAGATTTTTGTTTTAATTCTGG (SEQ ID NO:13) (the first three
nucleotides encodes P, the others anneal to the sequence corresponding to P154 - S163), were
used to amplify a fragment designated "N". A mutagenic phosphorylated primer H1,
pTGTCCAGGAAGAGTAGTTGGAGGAAGTACAAGTGCTGGACCTACGGTTCCA
G (SEQ ID NO:14), encoding CPGRVVGG (SEQ ID NO:15) and S168-P176, and reverse
primer R2, ACGTTTATCTCTTATTAAAAT (SEQ ID NO:11), annealing to the sequence
encoding I589-R595, were used to amplify a mutagenic fragment "M1". A phosphorylated
mutagenic primer H2,
pGGAAGTGGAAGATCAGCAAGTACAAGTGCTGGACCTACGGTTCCAG (SEQ ID
NO:16), encoding GSGRSA (SEQ ID NO:17) and S168-P176, and reverse primer R2 were used
to amplify a mutagenic fragment "M2". A phosphorylated mutagenic primer H3,
pGGAAGTGGAAAATCAGCAAGTACAAGTGCTGGACCTACGGTTCCAG (SEQ ID
NO:18), encoding GSGKSA (SEQ ID NO:19) and S168-P176, and reverse primer R2, were
used to amplify a mutagenic fragment "M3". A phosphorylated mutagenic primer H4,
pCAGAGAGGAAGATCAGCAAGTACAAGTGCTGGACCTACGGTTCCAG (SEQ ID
NO:20), encoding QRGRSA (SEQ ID NO:21) and S168-P176, and reverse primer R2, were
used to amplify a mutagenic fragment "M4". Primers F and R2 were used to amplify the
ligated products of N + M1, N + M2, N + M3, and N + M4, respectively, resulting in the
mutagenized fragments U1, U2, U3, and U4 in which the coding sequence for the furin site
(RKKR167; SEQ ID NO:1) is replaced by uPA or tPA substrate. The HindIII/PstI digests of
U1, U2, U3, and U4 were cloned between the HindIII and PstI sites of pYS5. The resulting
expression plasmids were named pYS-PA-U1, pYS-PA-U2, pYS-PA-U3, and pYS-PA-U4,
and their expression products, the mutated PA proteins, were accordingly named PA-U1, PA-U2,
PA-U3, and PA-U4. One expression plasmid encoded a mutant in which RKKR167 (SEQ
ID NO:1) is replaced by PGG, expected not to be cleaved by any protease. Its expression
plasmid and expression product were named pYS-PA-U7 and PA-U7, respectively.
Expression and purification of PA and mutated PA proteins
To express PA, PA-U1, PA-U2, PA-U3, PA-U4, and PA-U7, the expression
plasmids pYS5, pYS-PA-U1, pYS-PA-U2, pYS-PA-U3, pYS-PA-U4, and pYS-PA-U7, were
transformed into non-virulent strain B. anthracis UM23Cl-1 and grown in FA medium
(Singh, Y., et al., J. Biol. Chem., 264:19103-19107 (1989)) with 20 µg/ml of kanamycin for
16 h at 37°C. The expression products were secreted into the culture supernatants. The
mutated PA proteins were concentrated and purified by chromatography on a MonoQ column
(Amersham Pharmacia Biotech, Piscataway, NJ), as described previously (Varughese, M., et
al., Mol. Med., 4:87-95 (1998)).
In vitro cleavage of PA and mutated PA proteins by uPA, tPA, and furin
Reaction mixtures of 50 µl containing 5 µg of the PA proteins were incubated
at 37°C with 5 µl of soluble furin or 0.5 µg of uPA or tPA. Furin cleavage was done in 25
mM HEPES, pH 7.4, 150 mM NaCl, 0.2 mM EDTA, 0.2 mM EGTA, 100 µg/ml ovalbumin,
1.0 mM CaCl2, and 1.0 mM MgCl2. Aliquots (5 µl) withdrawn at intervals were separated
by polyacrylamide gel electrophoresis (PAGE) using 10-20% gradient Tris-glycine gel
(Novex, San Diego, CA) and visualized by Commassie staining.
Cleavage with uPA or tPA was done in 150 mM NaCl, 10 mM Tris-HCl (pH 7.5).
Aliquots withdrawn at intervals were diluted 1:1000 and separated by PAGE using 10-20%
gradient Tris-glycine gel (Novex, San Diego, CA) and electroblotted to a
nitrocellulose membrane (Novex, San Diego, CA). Cleavage was assessed by Western
blotting with a rabbit anti-PA antibody. Membranes were blocked with 5% (w/v) non-fat
milk, incubated sequentially with rabbit anti-PA polyclonal antibody (#5308) and horse
radish peroxidase-conjugated goat anti-rabbit antibody (sc-2004, Santa Cruz
Biotechnology, Inc., Santa Cruz, CA), and visualized by ECL (Pierce, Rockford, IL).
Cells and culture medium
Vero cells, human cervix adenocarcinoma Hela cells, human melanoma
A2058 cells, human melanoma Bowes cells, and human fibrosarcoma HT1080 cells were
obtained from American Type Culture Collection (Manassas, Virginia). All cells were
grown in Dulbecco's Minimal Essential Medium (DMEM) with 0.45% glucose, 10%
fetal bovine serum, 2 mM glutamine, and 50 µg/ml gentamicin. Human primary vascular
endothelial cells were obtained and cultured according to standard methodology. Cells
were maintained at 37°C in a 5% CO2 environment.
Binding and processing of pro-PA by cultured cells
Vero cells, Hela cells, A2058 cells, and Bowes cells were cultured in 24-well
plate to confluence, washed and incubated in serum-free media with 1 µg/ml of pro-uPA
and 1 µg/ml of glu-plasminogen for 1 h, then the cell lysates were prepared for
Western blotting analysis with monoclonal antibody against uPA B-cahin (#394).
Cytotoxicity assay with MTT
Cells were seeded into 96-well plates at approximately 25% confluence.
The next day, cells were washed twice with serum-free DMEM to remove residual serum.
Serial dilutions of PA, mutated PA proteins (0 to 1000 ng/ml) combined with FP59 (50
ng/ml) in serum-free DMEM (If targeting urokinase plasminogen activation system, 100
ng/ml pro-uPA and 1 µg/ml of glu-plasminogen were added) to the cells to give a total
volume of 200 µl/well. In some experiments, PAI-1 was added 30 min prior to toxin
addition. Cells was incubated with the toxins for 6 h, after which the medium was
replaced with fresh DMEM supplemented with 10% FCS. Cell viability was then assayed
by adding 50 µl of 2.5 mg/ml MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium
bromide). The cells were incubated with MTT for 45 min at 37°C, the medium was
removed, and the blue pigment produced by viable cells was solubilized with 100 µl/well
of 0.5% (w/v) SDS, 25 mM HCl, in 90% (v/v) isopropanol. The plates were vortexed and
the oxidized MTT was measured as A570 using a microplate reader.
Binding and processing of PA and PA-U2 by cultured cells
Cells were grown in 24-well plates confluence and washed twice with
serum-free DMEM to remove residual serum. Then the cells were incubated with 1
µg/ml of PA and PA-U2 at 37°C in serum-free DMEM containing 100 ng/ml of pro-uPA
and 1 µg/ml of glu-plasminogen for different lengths of time. When PAI-1 was tested, it
was incubated with cells for 30 min prior to the addition of PA proteins. The cells were
washed five times to remove unbound PA proteins. Cells were lysed in 100 µl/well
modified RIPA lysis buffer (50 mM Tris-HCl, pH 7.4, 1% NP40, 0.25% Na-deoxycholate,
150 mM NaCl, 1 mM EDTA, 1 mM phenylmethyl sulfonyl fluoride, 1
µg/ml each of aprotinin, leupeptin and pepstatin) on ice for 10 min. Equal amounts of
protein from cell lysates were separated by PAGE using 10-20% gradient Tris-glycine
gels (Novex, San Diego, CA). Western blotting to detect PA and its cleavage products
was performed as described above.
Cytotoxicity assay in a co-culture system
A co-culture model was designed to mimic the in vivo condition to verify
whether PA-U2 kill uP AR-overexpressing tumor cells while not affecting uP AR non-expressing
cells. Vero, Hela cells were cultured in separate chambers of 8-chamber slides
(Nalge Nunc International, Naperville, IL) to 80-100% confluence. The cells were
washed twice with serum-free DMEM, the chamber partition was removed, and the slide
was put into a culture dish with serum-free medium containing 100 ng/ml pro-uPA and 1
µg/ml of Glu-plasminogen, so that all the cells were bathed in the same medium. PA and
PA-U2 (300 ng/ml) and FP59 (50 ng/ml) were added individually or in combination and
cells were exposed for 48 h. Then MTT (0.5 mg/ml) was added for 45 min at 37°C, the
partitions were remounted, and the oxidized MTT in each chamber was dissolved as
described above to determine the viability of each cell type. The cell lysates from
different chambers were also prepared for Western blotting to detect PA proteins and their
cleavage product PA63 species.
B. Results
Directing uPA or tPA sequence-specific proteolysis to anthrax PA
The crystal structure of PA shows that the furin site, RKKR167 (SEQ ID
NO:1), is in a surface-exposed, flexible loop composed of aa 162 to 175 (Petosa, C., et al.,
Nature, 385:833-838 (1997)). Cleavage in this loop by furin or furin-like proteases is
essential to toxicity. Mutated PA proteins were constructed in which the furin-sensitive
sequence RKKR167 (SEQ ID NO:1) is replaced by uPA or tPA substrate sequences. In
mutated PA protein PA-U1, PCPGRVVGG (SEQ ID NO:4), a peptide from P5 to P4' in the
physiological substrate plasminogen, was used to replace RKKR167 (SEQ ID NO:1). In PA-U2,
RKKR167 (SEQ ID NO:1) was replaced by a peptide, PGSGRSA (SEQ ID NO:5),
containing the consensus sequence SGRSA (SEQ ID NO:22) from P3 to P2', which was
recently identified as the minimized best substrate for uPA (Ke, S. H., et al., J. Biol. Chem.,
272:20456-20462 (1997)). Because the peptide SGRSA (SEQ ID NO:22) is cleaved 1363-fold
times more efficiently than a control peptide containing the physiological cleavage site
present in plasminogen by uPA, and exhibits a uPA/tPA selectivity of 20 (Ke, S. H., et al., J.
Biol. Chem., 272:20456-20462 (1997)), PA-U2 was expected to be a favorite substrate of
uPA. uPA/tPA selectivity of the peptide SGRSA (SEQ ID NO:22) can be further enhanced
by placement of lysine in the P1 position (Ke, S. H., et al., J. Biol. Chem., 272:20456-20462
(1997)), thus, the peptide PGSGKSA (SEQ ID NO:6), which exhibits a uPA/tPA selectivity
of 121 (Ke, S. H., et al., J. Biol. Chem., 272:20456-20462 (1997)), was used to replace
RKKR167 (SEQ ID NO:1) to construct a mutated PA protein, PA-U3, with even higher uPA
selective activity than PA-U2. The investigation showed P3 and P4 residues were the
primary determinants of the ability of a substrate to discriminate between tPA and uPA, and
mutation of both P4 glycine and P3 serine of the most labile uPA substrate (GSGRSA; SEQ
ID NO:17) to glutamine and arginine, respectively, decreased the uPA/tPA selectivity by a
factor of 1200 and actually converted the peptide into a tPA-selective substrate (Ke, S. H., et
al., J. Biol. Chem., 272:20456-20462 (1997)). Based on this study, a mutated PA protein,
PA-U4, was constructed. PA-U4 is expected to be a tPA favorite substrate, in which the
peptide PQRGRSA was used to replace RKKR167 (SEQ ID NO:1). A mutated PA protein
PA-U7, was also constructed in which RKKR167 (SEQ ID NO:1) was replaced by random
sequence PGG, expected not to be cleaved by any known proteases, was used a control
protein in this study. The
designations of the mutated PA proteins along with the expected properties were
summarized in Table 3.
Plasmids encoding these mutated PA proteins were constructed by a
modified overlap PCR method, cloned into the E. coli-Bacillus shuttle vector pYS5, and
efficiently expressed in B. anthracis UM23C1-1. The expression products were secreted
into the culture supernatants at 20-50 mg/L. The mutated PA proteins were concentrated
and purified by MonoQ chromatography to one prominent band at the expected molecular
mass of 83 kDa which co-migrated with PA in SDS-PAGE. Thus, using a production
protocol that is now standard for PA, these mutated PA proteins could be expressed and
purified easily, in high yield and purity.
To verify that the mutated PA proteins had the expected susceptibility to
proteases, they were subjected to cleavage with a soluble form of furin, uPA and tPA. As
expected, these mutated PA proteins, had completely lost the susceptibility to furin. In
contrast, wild-type PA was very sensitive to furin and processed to the active form PA63
(Fig. 9a). The cleavage profiles of these mutated PA proteins by uPA and tPA were quite
consistent with that obtained from the peptide substrates (Fig. 9b, 9c). PA-U2 was
efficiently cleaved by uPA, which was followed by PA-U3. PA-U3 could only be
cleaved by uPA, but not tPA, showing high uPA specificity. However, PA-U2 was also
slightly cleaved by tPA, being a week substrate for tPA. In contrast, PA-U4 was a very
week substrate for uPA, but a good substrate for tPA. PA-U7 as well as PA-U1 were
both completely resistant to uPA and tPA. PA was completely resistant to tPA, but was a
week substrate for uPA (Fig. 9b). These results implicated PA-U2 and PA-U3 which can
be selectively activated by uPA may be useful to target tumor cell surface-associated
plasminogen activation system for tumor therapy, while PA-U4 may be toxic to tPA
expressing cells which usually occurred in neuroblastomas.
PA-U2 and PA-U3 selectively kill tumor cells by targeting tumor cell
surface-associated plasminogen activation system
uPAR is typically overexpressed in tumor cell lines and tumor tissues, and
is the central part of cell surface-associated plasminogen activation system which is
essential to tumor invasion and metastasis. To test the hypothesis that PA-U2 and PA-U3
would preferentially kill uPAR-overexpressing tumor cells, cytotoxicity assays were
performed with three human tumor cell lines: cervix adenocarcinoma Hela, melanoma
A2058, and melanoma Bowes. A non-tumor monkey cell line, Vero, was used as control.
The expression of uPAR by these three tumor cell lines but not by Vero cells was
evidenced by binding and processing of pro-uP A to the active form two-chain uPA by
these three tumor cells but not by Vero cells. Figure 10 showed that after 1 h incubation
with the cells, pro-uPA and the processed form uPA B-chain could be detected from these
three tumor cell lysates but not from Vero cells.
Cytotoxicity of PA and the mutated PA proteins to these cells was
measured in 96-well plates. In tumor tissues, tumor cells typically overexpress uPAR,
while tumor stromal cells express pro-uPA which binds and thereby is activated on the
tumor cell surface, therefore in the cytotoxicity assay 100 ng/ml of pro-uPA was added to
the tumor cells to mimic the role of tumor stromal cells in vivo. In addition, plasminogen
is an important component of plasminogen activation system, and present at high
concentration (1.5-2.0 µM) in plasma and interstitial fluids, representing potential
plentiful source of plasmin activity. Therefore. 1 µg/ml of glu-plasminogen was also
added in the cytotoxicity assay. PA and the mutated PA proteins combined with FP59
were incubated with cells for 6 h, and the viability was measured after 48 h. The EC50
values (concentrations needed to kill half of the cells) for PA and the mutated PA proteins
are summarized in Table 4. The three uPAR-expressing tumor cells, Hela, A2058, and
Bowes were very susceptible to PA as well as to PA-U2 and PA-U3, and less susceptible
to PA-U4 (Fig. 11a, b, c). In contrast, these tumor cells were completely resistant to PA-U1
and PA-U7 (Fig. 11a, b, c). The order of the cytotoxicity of mutated PA proteins to
these tumor cells: PA-U2> PA-U3 > PA-U4 >>PA-U1, PA-U7, was well correlated with
the uPA cleavage profile showed in Fig. 9b. In contrast to the tumor cells, the uPAR non-expressing
Vero cells were completely resistant to all the mutated PA proteins, but
sensitive to PA in a dose-dependent manner (Fig. 12a). However, PA-U2 that was first
nicked by uPA in vitro efficiently killed Vero cells (Fig. 11b). This demonstrated that the
resistance of Vero cells to PA-U2 was due to the inability of the cells to proteolytically
activate the mutated PA proteins.
Binding and proteolytically processing of PA and PA-U2 on cell surface
were also assessed. Vero and Hela cells were incubated with PA and PA-U2 for various
length of times. After that the cell lysates were prepared and examined by Western
blotting to detect binding and processing status of the PA proteins to the active PA63
species. PA was processed by both cell types, and this could not be inhibited by PAI-1
(Fig. 13a, b). In contrast, PA-U2 was processed by Hela cells but not by Vero cells, and
this could be completely blocked by PAI-1 (Fig. 13a, b), demonstrating the cleavage of
PA-U2 on Hela cell surface was due to uPA activated on the surface. Although Hela cells
proteolytically processed PA as well as PA-U2, the later was cleaved slower apparently
due to its cleavage was secondary to pro-uPA activation (Fig. 13b).
To further demonstrate that the cytotoxicity of the mutated PA proteins for
tumor cells was dependent on the tumor cell surface-associated plasminogen activation
system, the effects of the specific inhibitor and blockers of the system were characterized.
PAI-1 conferred strong protections to all these three tumor cells against challenge with
PA-U2 plus FP59, but did not protect the cells from PA plus FP59 (Fig. 14a, b, c). ATF,
the animo-terminal fragment and uPAR binding domain of uPA, which competes the
binding site on uPAR with pro-uPA, protected all three tumor cells from PA-U2 plus
FP59 with dose-dependent manner (Fig. 15a). Similarly, uPAR blocking monoclonal
antibody R3 which specifically interferes the binding between pro-uPA and uPAR, also
protected the tumor cells in all three cases from PA-U2 plus FP59 (Fig. 15b). These
results demonstrated killing of these tumor cells by PA-U2 was dependent on tumor cell
surface-associated plasminogen activation system.
PA-U2 retained selectivity for uPAR-expressing cells in a co-culture
model
A co-culture model was designed to mimic in vivo conditions, to test
whether PA-U2 can selectively kill Hela cells but not the bystander cells. Vero and Hela
cells were cultured in separate compartments of 8-chamber slides. When the cells
reached confluence, the chamber partitions were removed and the slides were put into
culture dishes with serum-free medium containing 100 ng/ml of pro-uPA and 1 µg/ml of
glu-plasminogen so that all cells on the slide were bathed in the same medium. PA and
PA-U2 (each at 300 ng/ml) plus FP59 (50 ng /ml), or FP59 alone were added to the
culture dishes and incubated for 48 h before measuring viability. The results showed that
PA was processed to active PA63 by and killed both cells, whereas PA-U2 was processed
to active PA63 by and killed only Hela cells, while not affecting the uPAR non-expressing
Vero cells (Fig. 16. inset). These results showed that PA-U2 is not activated
in the tissue culture medium by uPAR unbound uPA, nor do PA proteins proteolytically
activated on the surface of one cell dissociate and rebind on other cells. Activate uPA in
the culture supernatant would have led to killing of the Vero cells, because Fig. 12b
showed that PA-U cleaved in solution became cytotoxic.
PA-U4 was toxic to tPA expressing cells while PA-U2 and PA-U3 are not
Fig. 9 showed PA-U4 is a good substrate of tPA among these mutated PA
proteins and expected to be toxic to tPA expressing cells. To test this hypothesis,
cytotoxicity assay was performed on two tPA expressing cells: human melanoma Bowes,
and human primary vascular endothelial cells (HUVEC). The expression of tPA by these
cells was evidenced by Western blotting analysis of the culture supernatants by using a
polyclonal antibody against human tPA (data not shown). The cells were cultured to 50%
confluence, then cytotoxicity assay were done in serum-free DMEM not containing pro-uPA
and glu-plasminogen. Different concentrations (from 0 to 1000 ng/ml) of PA, PA-U2,
PA-U3, and PA-U4 combined with FP59 (50 ng/ml) were incubated with cells for
12 h, and viability was measured after 48 h. The EC50 values for the PA proteins were
summarized in Table 5. PA-U4 was toxic to the two tPA expressing cells, while PA-U2
and PA-U3 showed a very low toxicity to them (Fig. 17a, b and Table 5). These and the
above results clearly showed that uPA and tPA susceptibility differentiate among these
mutated PA proteins. PA-U2 and PA-U3 which specifically target tumor cell surface-associated
plasminogen activation system may be very useful for tumor therapy. While
PA-U4 which could be activated by tPA may be applied for some neurosystem tumors
which usually overexpress tPA.
Discussion
Increasing evidence has been accumulated that the components of the
urokinase plasminogen activation system are involved in tumor cell proliferation,
invasion, and metastasis since 1976 when it was discovered that uPA was produced and
released from cancer cells (Schmitt, M., et al., Thromb. Haemost., 78:285-296 (1997)).
Recent data suggested that invasion factors may also serve as targets for new treatments
to prevent cancer invasion and metastasis (Schmitt, M., et al., Thromb. Haemost., 78:285-296
(1997)). Various different approaches to interfere with the expression or the activity
of uPA, uPAR, and PAI-1 at gene or protein level were successfully tested in vitro or in
mice including antisense oligonucleotides, antibodies, inhibitors, and recombinant or
synthetic uPA and uPAR analogues (Schmitt, M., et al., Thromb. Haemost., 78:285-296
(1997)). However, it is expected that these approaches should only slow the growth of
tumors, without having a direct cytotoxic action that could eradicate the malignant cells.
The present study is the first to exploit the tumor cell surface associated plasminogen
system to achieve cell-type selective targeting of cytotoxic bacterial toxin fusion proteins.
In this study, mutated anthrax toxin protective antigen (PA) proteins, PA-U2, PA-U3, and
PA-U4, were constructed in which the furin recognition site is replaced by susceptible
sequences cleaved by uPA (PA-U2 and PA-U3) or tPA (PA-U4) more efficiently than
control peptides containing the physiological target sequence present in plasminogen.
More interestingly is that the susceptibility toward uPA and tPA differentiated among
these mutated PA proteins, i. e., PA-U2 and PA-U3 were mainly activated by uPA, while
PA-U4 was mainly activated by tPA. Thus, when combined with FP59, a recombinant
fusion toxin derived from anthrax lethal factor and Pseudomonas exotoxin A, PA-U2 and
PA-U3 selectively killed uPAR-overexpressing tumor cells in the present of pro-uPA, and
meanwhile showed very low toxicity to tPA expressing cells such as vascular endothelial
cells. Because tPA is secreted as an active enzyme mainly by vascular endothelial cells in
vivo (Mann, K., et al., Annu. Rev. Biochem., 57:915-956 (1988)), the cytotoxicity
differentiation among these mutated PA proteins to uPA and tPA expression cells is so
important to avoid the damage to the vascular endothelial cells when PA-U2 and PA-U3
are used in vivo.
The following lines of evidence clearly demonstrate that the proteolytic
activation of these uPA-activated mutated PA proteins occurred on the tumor cell surface
that was dependent upon the activity of tumor cell surface associated plasminogen
activation system: 1. Pro-uPA could only bind and thereby proteolytically activated on
uPAR-expressing tumor cell surface but not on uPAR non-expressing Vero cells; 2. PA-U2
could only be proteolytically processed to the active form PA63 on uP AR-expressing
cells (such as Hela cells) but not on uPAR non-expressing Vero cells, and this processing
could be completely inhibited by uPA specific inhibitor PAI-1; 3. The toxicity of PA-U2
to the tumor cells was eliminated by uPAR specific blocking reagent ATF, uPAR
blocking antibody R3, and PAI-1, demonstrating the activation of PA-U2 was entirely
dependent upon the activation of pro-uPA on tumor cell surface; 4. Cytotoxicity assays
in a co-culture model, in which the cells were equally accessible to the toxins in the
supernatant, showed that PA-U2 killed only uPAR-overexpressing Hela cells and not the
bystander Vero cells, demonstrating that activation of uPA-activated mutated PA proteins
occurred principally on cell surfaces, because the active form of PA proteins in solution
could also kill the Vero cells.
PA proteins bind to cells rapidly and with high affinity (Kd approx. 1 nM),
therefore, even at low PA concentrations, PA receptors will be highly occupied. As a
result, if there were any PA which became activated in the supernatant or dissociated
from a cell after cleavage would be unable to locate a free receptor by which to bind to
cells and internalize FP59.
Thus, the cytotoxicity of these cytotoxins was directed selectively to the
uPAR-overexpressing tumor cells. PA-U4, which could be activated by tPA, can be
applied for intratumoral therapy of some unresectable neurosystem tumors which usually
overexpress tPA.
Tumor-cell selective cytotoxins have been created by replacing the
receptor-recognition domains of bacterial and plant protein toxins with cytokines, growth
factors, and antibodies (Kreitman, R. J.,
Curr.
Opin. Immunol., 11:570-578 (1999)). The
protein toxins used contain an enzymatic domain that acts in the cytosol to inhibit protein
synthesis and a domain which achieves translocation of this catalyst from a vesicular
compartment to the cytosol, as well as the cell-targeting domain that is replaced or altered
so as to achieve tumor cell specificity. Certain of these "immunotoxins" derived from
diphtheria toxin,
Pseudomonas exotoxin A, and ricin have shown efficacy and have been
approved for clinical use. However, a recurrent problem with these materials is that
therapeutic doses typically damage other tissues and cells (Frankel, A. E.,
et al.,
Semin.
Cancer Biol., 6:307-317 (1995)). This is not surprising because very few of the tumor
cell surface receptors or antigens that are targeted are totally absent from normal tissue.
Therefore, even in the best cases, some toxin uptake will occur in normal bystander cells.
Because these toxins act catalytically, even a small amount of internalized toxin can
seriously damage normal tissue. Even a single molecule delivered to the cytosol can kill
a cell (Yamaizumi, M.,
et al.,
Cell, 15:245-250 (1978)). Previous efforts to develop
anthrax toxin fusion proteins as therapeutic agents have focused on modification of
domain 4, the receptor-binding domain of PA. Work is ongoing to create cell-type
specific cytotoxic agents by modifying or replacing
domain 4 to direct PA to alternate
receptors (Varughese,
M., et al.,
Mol.
Med., 4:87-95 (1998); Varughese, M.,
et al.,
Infect.
Immun., 67:1860-1865 (1999). This work follows the example of the development of
immunotoxins from other protein toxins, as cited earlier (Kreitman, R. J.,
Curr.
Opin.
Immunol., 11:570-578 (1999)). We suggest that combining two conceptually distinct
targeting strategies in a single PA protein will yield agents having higher therapeutic
indices. A protein that is both retargeted to a tumor cell surface protein and dependent on
cell surface plasminogen activation system for activation may achieve therapeutic effects
while being free of the side effects observed with many of the existing immunotoxins.
PA proteins generated in this study |
Designation | Sequence at the "furin loop" | SEQ ID NO: | Kcar/Km | uPA:tPA selectivity | Protease expected to cleave |
| | | uPA | tPA |
PA | NS RKKR↑ | STSAGPTV | 23 | | | | Furin |
PA-U1 | NSPCPGR↑ VVGG | STSAGPTV | 24 | 0.88 | 0.29 | 3 | uPA/tPA |
| | | | | | | (weakly) |
PA-U2 | NSPGSGR↑ SA | STSAGPTV | 25 | 1200 | 60 | 20 | uPA |
PA-U3 | NSPGSGK↑ SA | STSAGPTV | 26 | 193 | 1.6 | 121 | uPA |
PA-U4 | NSPQRGR↑ SA | STSAGPTV | 27 | 7.3 | 670 | 0.005 | tPA |
PA-U7 | NSPGG | STSAGPTV | 28 | | | | None |
Toxicities (EC50 in µg/ml) of PA proteins to various cells |
Cell line | Cell type | PA | PA-U2 | PA-U3 | PA-U4 |
Hela | Human cervix adenocarcinoma cell line | 12 | 14 | 30 | 200 |
A2058 | Human melanoma cell line | 10 | 13 | 18 | 50 |
Bowes | Human melanoma cell line | 7 | 8 | 15 | 50 |
Vero | Monkey kidney normal epithelial cell line | 15 | >1000 | >1000 | >1000 |
EC50 is the concentration of toxin required to kill half of the cells. EC50 values are interpolated from Fig. 11 and 12. |
Toxicities (EC50 in ng/ml) of PA proteins to tPA expressing cells |
Cell line | Cell type | PA | PA-U2 | PA-U3 | PA-U4 |
HUVEC | Human primary vascular endothelial cells | <1 | >1000 | >1000 | 25 |
Bowes | Human melanoma cell line | 3 | 600 | >1000 | 12 |
EC50 is the concentration of toxin required to kill half of the cells. EC50 values are interpolated from Fig. 17. |