EP1210448A1 - Recombinant hsv-1 and live viral vaccines - Google Patents

Recombinant hsv-1 and live viral vaccines

Info

Publication number
EP1210448A1
EP1210448A1 EP20000949877 EP00949877A EP1210448A1 EP 1210448 A1 EP1210448 A1 EP 1210448A1 EP 20000949877 EP20000949877 EP 20000949877 EP 00949877 A EP00949877 A EP 00949877A EP 1210448 A1 EP1210448 A1 EP 1210448A1
Authority
EP
European Patent Office
Prior art keywords
sep
hsv
dna
recombinant virus
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
EP20000949877
Other languages
German (de)
French (fr)
Inventor
Yechiel Becker
Yael Asher
Sergey Bujanover
Tamir Ben-Hur
Gholamreza Ruprecht Karls U. Heidelberg DARAI
Roland Ruprecht Karls Universität Heidelberg KEHM
Michal Moyal
Angela Rosen-Wolff
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hadasit Medical Research Services and Development Co
Yissum Research Development Co of Hebrew University of Jerusalem
Original Assignee
Hadasit Medical Research Services and Development Co
Yissum Research Development Co of Hebrew University of Jerusalem
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hadasit Medical Research Services and Development Co, Yissum Research Development Co of Hebrew University of Jerusalem filed Critical Hadasit Medical Research Services and Development Co
Publication of EP1210448A1 publication Critical patent/EP1210448A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • A61K39/245Herpetoviridae, e.g. herpes simplex virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • A61P31/22Antivirals for DNA viruses for herpes viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5254Virus avirulent or attenuated
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/54Medicinal preparations containing antigens or antibodies characterised by the route of administration
    • A61K2039/541Mucosal route
    • A61K2039/543Mucosal route intranasal
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16611Simplexvirus, e.g. human herpesvirus 1, 2
    • C12N2710/16632Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16611Simplexvirus, e.g. human herpesvirus 1, 2
    • C12N2710/16634Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16611Simplexvirus, e.g. human herpesvirus 1, 2
    • C12N2710/16641Use of virus, viral particle or viral elements as a vector
    • C12N2710/16643Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

The invention concerns a recombinant herpes simplex virus which genome has been altered by mutations or deletions in the unique small (US) 8 and 12 genes. The invention further concerns vaccines comprising said recombinant herpes simplex virus.

Description


  
 



  RECOMBINANT   HSV-1    AND LIVE VIRAL VACCINES
FIELD OF THE INVENTION
 The present invention is in the field of live viral vaccines, in particular
Herpes Simplex Virus (HSV) vaccine. The present invention also concerns viral vectors carriers of heterologous or therapeutic genes for infection purposes.



  BACKGROUND OF THE INVENTION
 Herpes viruses are a large group of intranuclear, double-stranded DNA viruses that are remarkably capable of establishing a latent infection for many years after primary infection. The herpes virus group is responsible for such human diseases as fever blisters and keratoconjunctivitis (Herpes Simplex Virus Type 1) venereal diseases (Herpes Simplex Virus Type 1 and 2), Chickenpox (Varicella) and
Shingles (Herpes Zoster) cytomegalic inclusion disease (Cytomegalovirus) infectious mononucleosis (Epstein-Barr virus), Exanthem subitum (roseola) (Human Herpes virus 6 and 7) and Kaposi's sarcoma (HHV8).



   HSV-1 and HSV2 are related immunologically, but most of their proteins carry distinguishing characteristics which allow them to be differentiated. HSV is characterized by its ability to establish latent infection in the central nervous system (CNS) of its host specifically in the neural ganglia. The infection or reactivation may result in encephalitis.



   There have been several attempts to develop a live   HSV-1    vaccine.



   U. S. 5,328,688 discloses a herpes simplex virus which has been rendered
 avirulent by prevention of the expression of an active product of a gene which is
 designated as   y, 34.5.     



   U. S. discloses a recombinant herpes virus for use as a vaccine, both against a virulent HSV-1 and against HSV-2. The virus was prepared by taking an HSV-1 like virus recombinant from which a portion of the genome, responsible for neurovirulence, was deleted, and a gene from HSV-2 genome, responsible for coding an   immunity-inducing    glycoprotein, was inserted into the mutated virus genome.



   U. S. 4,554,159 discloses a live viral vaccine against herpes simplex virus types 1 and 2 which includes at least one vaccinal   intertypic      (HSV-1    x HSV-2) recombinant virus strain prepared by crossing two prototypic   HSV-1    and HSV2 parental virus strain in order to obtain a recombinant progeny. The parental strains have distinguishing genetic markers so that it is possible to distinguish the recombinant progeny from the parenteral strains on the basis of these markers, and at least one of the parenteral strains is also temperature sensitive.



   U. S. 5,641,651 discloses a synthetic herpes simplex virus promoter which comprises the herpes simplex virus   a    gene promoter fragment operatively 5'-linked to the herpes simplex virus   y    gene promoter fragment.



   U. S. 5,837,532 discloses a viral expression vector which comprises a herpes simplex virus type 1 with a DNA sequence which has an alteration in the gene coding for the Vmw65 protein, the alteration being a transition or transversion
 alteration of 1 to 72 base pairs or a deletion of 3 to 72 base pairs, or alternatively,
 an insertion of an oligonucleotide sequence, wherein the alteration is carried out in the position in the gene coding for the probe in between the amino acid 289 and
 412 of the protein. The viral expression vector further comprises a heterologous
 gene which is inserted in the region of the   HSV-1    genome which is a region non
 essential for culture of the virus, together with a suitable promoter. Typically, the
 heterologous gene is a therapeutic gene which is inserted in the viral TK gene
 (UL23).



   U. S. 5,066,492 discloses a method for treating or preventing infection of
 human   HSV-1    infections using inoculation by a live bovine mammillitis virus.  



   U. S. 4.024,836 discloses lyophilized live herpes virus vaccine that comprises from about 0.5% to about 8% moisture.



   The above HSV-1 virus vaccines are either mutants in one pathogenecity gene (such as the   y,      34.5    gene in U. S. 5,328,688 and the VMW 64 in U. S.



  5,837,532) or the intertypic recombinant between HSV-1 and HSV-2 (U. S.



  4,554,159). However, none of these publications led to the development of a single anti-HSV-1 vaccine for human use. One of the main obstacles is the property of the live   HSV-1    vaccine viruses of these publications to enter into the nervous system of the immunized animals and to establish a latent infection therein. To date, the only live herpes virus vaccine that is being used to immunize humans is the OKA strain of Varicells-Zoster virus (VZV) which is an attenuated virus obtained from a VZV patient.



  SUMMARY OF THE INVENTION
 The present invention is based on a development of a unique HSV-1 recombinant virus termed   hereinafter"HSV-1 R15".    This recombinant virus was prepared by obtaining a parent virus, being   HSV-1    HFEM originally isolated from a patient with a mild   HSV-1    infection.   HSV-1    HFEM was shown to have a deletion in the internal repeat of UL (IRL) so that this virus was known to be apathogenic to adult mice. However this virus was still unsuitable for human immunization purposes since it retained its pathogenecity to suckling   mice ('). The    HSV-1 R15 recombinant has the HFEM DNA genome in which a BamHI-B DNA fragment
 from a pathogenic virus HSV was inserted by recombination (').



   The HSV-1 R15 recombinant of the present invention was found to have
 several advantageous properties as follows:
 (1) it was found to be unpathogenic to adults and suckling mice;
 (2) the replication of the apathogenic   HSV-1    R15 recombinant of the invention
 in the skin or nose epithelium of the immunized subject (mouse) is
   self-limited    and consequently the viral DNA disappears from the site of
 inoculation within 3-4 days post infection;   (3) the recombinant of the invention is incapable of penetrating into the
 peripheral and central nervous system and thus in fact overcomes one of the
 main obstacles of prior art proposed live-viral based vaccines; (4) inoculation with the recombinant of the invention prevents, in immunized
 mice, the entry of other pathogenic   HSV-1    into the nervous system;

   (5) the   HSV-1    recombinant of the invention is highly immunogenic and is
 capable of inducing, in immunized mice, an antiviral humoral immune
 response; (6) the recombinant of the invention is not pathogenic as a result of a stereotaxic
 injection; (7) the recombinant of the invention, after being injected into mouse and rat
 brains did not activate the hypothalmic-pituary adrenocortical axis (HPA),
 did not increase the production of prostaglandin E2, did not induce   IL-1   
 gene expression outside of the hypothalamus in the injection site, in contrast
 to the condition caused by pathogenic   HSV-IF;

     
 (8) infection of mouse astrocytes under in vitro conditions with the recombinant
 of the invention did not induce the expression of the IL-1 gene, contrary to
 the situation where infection was caused with pathogenic   HSV-1    Synl7 that
 induced the   IL-1    genes within three hours post infection;
 (9) the recombinant HSV-1 R15 of the invention, has an active UL23 gene
 coding for tyrosine kinase (TK) and thus, the virus is highly sensitive to
 treatment with anti-herpetic drug acyclovir, so that if desired, its infection
 may be controlled.



   The   HSV-1    R15 recombinant carries a number of deleted of genes, genomic
 rearrangements and changes in gene expression which contribute to its lack of
 pathogenicity and high   immunogenicity    in use as a vaccine. The fact that several
 gene deletions and mutations occur simultaneously, prevents spontaneous
 revertants mutations, thus eliminating the possibility of the recombinant of the
 invention mutating back to produce a virulent virus.  



     Furthennore,    the positions where genomic deletions in the HSV-1 R15 recombinant of the invention took place may be used for insertion of heterologous genes into these DNA sequences. The heterologous genes may be genes which code for immunogenic proteins from other human herpes viruses (i. e. HSV-2 to
HHV-8) for example genes coding for HSV-2 to HHV-8 glycoproteins immediate early genes.



   Alternatively, the heterologous genes may be obtained from other pathogenic human RNA and DNA viruses, such as genes coding for HIV-1 gag and envelope genes and minigenes; Hepatitis C virus genes or structural proteins; influenza virus genes and Dengue virus genes for structural proteins.



   In the above two examples the recombinant of the invention is used as an effective carrier of genes coding for immunogenic proteins of a desired virus for the purpose of vaccination against said virus.



   The   HSV-1    R15 recombinant of the invention may also be used as a carrier for various heterologous genes, for purposes other than immunization, for example for therapeutic purposes utilizing gene therapy techniques. In that case the recombinant of the invention is used as a carrier for genes which expressions brings about beneficial therapeutic effect, for example, the genes may be human genes coding for cytokines and chemokines, genes coding for a missing enzyme, a missing metabolite and the like, as well as genes involved with cell death.

   An
 example of the latter heterologous genes is apoptosis and tumor suppressor genes
 such as p53 to be inserted into cancer cells
 By another option, the property of   HSV-1    R15 recombinant of the invention
 to be able to replicate in the brain astrocyte cell cultures, while being incapable of
 affecting nerve cells, can be used to selectively transfect only tumor astrocytes
 (astrocytoma) while leaving nerve cells uninfected. This property may be used to
 cure astrocytoma brain tumors, either by simply injecting HSV-1 R15 of the
 invention stereotactically to the tumor so its natural replication will destroy the
 tumor, or inserting in the genome of the recombinant virus of the invention various  heterologous cytotoxic genes, which then can selectively destroy only the astrocytoma tumor while leaving the nerve cells undamaged.



   The present invention thus concerns a recombinant herpes simplex virus, the genome of which comprises a mutant of the genome of   HSV-1    with the following alterations:
 a deletion or mutation in the unique small (US) 8 gene region resulting
 either in expression of a non-functional gE protein or in no expression of the
 gE protein; and
 a deletion or mutation in the US 12 gene region resulting either in
 expression of a non-functional ICP47 protein or in no expression of the
 ICP47 protein.



   The   term"non-functional"refers    to a protein which is incapable of carrying out this normal physiological activity. In the case of US 8 gene, the normal expression product of the gene is a protein termed"truncated gE"and an unfunctional product is a protein which cannot form a dimer with gI protein. In the case of US 12 gene the normal expression product of the protein ICP47, which binds to and inhibits transport of nonapeptides by   TAP1/TAP2    dimer to HLA (MHC) Class I polypeptides in endoplasmic reticulum (ER) of infected cells. A
 "non-functional"US 12 expression product is a product which cannot carry out said inhibition of transport.



   Within the scope of the invention are any mutations or deletions in the genes which results in an unfunctional protein or results in no expression of viral proteins altogether. The mutations or deletions may be in the coding region of the gene or in the control regions thereof, resulting in the above non-expression or expression of non-functional proteins.



   The term"deletion"can refer to partial deletion or complete deletion of the gene sequence. Where partial deletion occurs it should be of a length sufficient to avoid expression of the protein or of a length required to produce a non-functional protein. The term"mutation"refers to an addition, replacement or rearrangement of at least one nucleic acid, as compared to the native HSV-1, resulting either in  production of a non-functional expression product or in complete lack of production of expression product as explained above. Again, mutation and alteration may be in the coding or non-coding regions of the gene.



   Preferably, the recombinant virus of the invention should contain, in addition to the above two alternatives, at least one additional deletion or mutation in a gene selected from the group consisting   of :    US 9; US 10; and US 11 tegument proteins, said deletion or mutation either eliminating production of the expression product of these genes or alternatively producing non-functional expression products as explained above, i. e. a product which is unable to carry out the normal physiological activites of its unmutated counterparts.



   Most preferably, the recombinant of the invention should have said deletion or mutation simultaneously in US 9 and US 10 and US 11 so that either none of the expression products of these genes are produced, or the expression products produced are non-functional expression products as explained above or a combination of non-expression and non-functional expression.



   US 9 codes for the synthesis of tegument phosphorylated protein, US 10 codes for another tegument protein. US 11 codes for a tegument protein that binds the 60 S ribosomal subunits in infected cells and also binds to   mRNA    transcripts of the gene UL 34 (membrane-associated phsophorylated virion protein).



   Non-functional products of the above are products which cannot carry out their usual physiological activity of the unmutated counterpart.



   In accordance with the preferred embodiment of the invention, the recombinant of the invention completely lacks the US 12 region, the US 9 region, the US 10 region and the US 11 region, by deletion of the full sequence of these
 genes; and the US 8 region is mutated by reverse splicing and recombination so that
 it codes for a shorter non-functional product   of gE    having 188aa (as compared to a
 functional gE having   550aa    in HSV-1 Synl7), which protein is identical to the
 N-terminus 170aa   of gE    protein of   HSV-1      Synl7.    The product of the mutated US 8
 gene, i. e.

   the truncated gE protein, does not form a heterodimer with the gI coded  by US 7, and without said heterodimer   HSV-1      R15    is incapable of penetrating and infecting nerve cells.



   By another preferred embodiment, the recombinant herpes virus of the invention contains a duplicate of at least one of the following genes: the   US1    gene coding for ICP 22 (IE4) and US2 gene coding for ORF   291 aa.    The presence of two
US genes is a special feature of   HSV-1    R15. The function of ICP22 is regulation of   y2    gene expression and viral gene transcription that allows the virus to produce high titers of infectious virions.



   Most preferably, the duplication should be so that at least one and preferably both of these genes appear both in the Internal Repeat of S (IRS) and Terminal
Repeat of S (TRS).



   By an additional preferred embodiment, the recombinant of the invention does not express UL54, and the gene products ICP27 and   y134.5    gene product
ICP34.5, which is a   neuro-virulence    factor. It was reported that deletions or mutations near the US 12 gene may affect the expression of the above mentioned genes by an unknown mechanism. However, it may be that non-expression of these
 products is an event independent of the deletion in the US 12.



   By a yet further additional embodiment the recombinant of the invention
 carries an active UL23 gene coding for tyrosine kinase (TK). This results in a
 recombinant virus that is sensitive to treatment with the anti-herpetic drug
 acyclovir. Thus, where it is desired to control replication of the recombinant of the
 invention, for example where the vaccinated individual develops   defficiency   
 syndrome, control may be achieved by administration of acyclovir,.



   By the most preferred embodiment the present invention concerns a
 recombinant as shown in Figs. 10,11 and 12 under R15.



   The present invention further concerns an anti-HSV-1 vaccine comprising
 as an active ingredient the recombinant R15 herpes simplex virus of the invention,
 optionally together with an immunologically acceptable carrier. By another
 alternative, the invention concerns DNA vaccine expressing a viral glycoprotein  
B gene. Immunization with HSV DNA vaccines before or together with HSV-1   R15    will increase the protection of the vaccinees.



   By another embodiment the present invention concerns an anti-herpes 2, herpes 3, herpes 4, herpes 5, herpes 6, herpes 7 or herpes 8 vaccine, comprising as an active ingredient the recombinant virus of the invention having in its genome a heterologous sequence obtained from herpes virus 2 to herpes virus 8, respectively, said heterologous sequence coding an immunogenic protein of said virus.



  Preferably, the immunogenic protein should be the appropriate herpes virus glycoprotein obtained from the relevant herpes   sepecies.   



   The present invention also concerns a method for immunizing a subject against herpes simplex 1, or any one of herpes viruses 2-8 as described above by administering to said subject an immunologically effective amount recombinant herpes simplex virus as described above. For example, the immunization may be by infecting a superficial scratch in the skin of the upper arm of the immunized subject.



   Another embodiment of the invention is based on the realization that the recombinant HSV-1 R15 of the invention is capable of replicating selectively in
 brain astrocytes while not infecting nerve cells. Thus, the present invention further
 concerns a pharmaceutical composition for the treatment of astrocytoma brain
 tumor comprising as an active ingredient the recombinant virus of the invention.



   The HSV-1 R15may reach the brain by stereotactic injection, into the brain tumor.



   Whilst within the brain, the recombinant herpes virus of the invention will replicate
 only in the astrocytoma tumor cells, and thus destroy them by its natural replication,
 while maintaining nerve cells undamaged.



   By another alternative, the HSV-1 R15 of the invention may comprise also
 heterlogous sequences which are known to be cytotoxic, such as genes that induce
 apoptosis.



   Then, the pharmaceutical composition of the invention would contain said
 cytotoxic-containing recombinant viruses. These sequences responsible for
 cytotoxicity will be expressed only in cells infected with the recombinant virus of  the invention, i. e. only astrocytes while other brain cells which were unaffected by the virus will not be damaged. In addition, the pharmaceutical composition of the invention can be used for the treatment of solid tumors in the skin and internal organs, either   utilizing    recombination of the invention without heterologous sequences, or such recombinants having also cytotoxic heterologous sequences.



   By yet another embodiment, the herpes simplex recombinant of the invention may be used to prepare other pharmaceutical compositions for treatment of diseases, disorders or pathological conditions wherein a beneficial effect may be evident by expression of a desired gene in cells, for example, genes that will inhibit tumor cell-cycle by expressing the human PML gene in-situ in gene therapy. The present invention also concerns such recombinant virus having heterologous sequences inserted therein which upon expression, for example, in gene therapy, provide beneficial therapeutic effects such as inhibition of tumor growth.



   The heterologous sequences, either for preparing vaccines for immunizing against herpes virus or other DNA or RNA viruses inserted for the purpose of treatment of astrocytoma or for any other gene therapy purposes, should preferably
 be inserted into HSV R15 genome at the site of the deletion of the genes (such as in
 sites of deletion of the US 9, US 10, US 11 or US 12 genes or that are not essential
 for the virus replication. The expression of the heterologous sequence can be under
 the control of any one of known control elements, such as HSV-1 or CMV
 promoters.



   BRIEF DESCRIPTION OF THE TABLES
 Table   1A    Pathogenicity of different   HSV-1    strains to adult mice;
 Table 1B Pathogenicity of different   HSV-1    strains to suckling mice;
 Table 2 Distribution of   HSV-1      Rl 5    DNA in brain tissues of adult mice after
 intranasal immunization in comparison with the apathogenic strain
 HSV-1 vhs (UL41);
 Table 3 the penetration of HSV-1 R15 into the spinal cord and adrenal
 glands after infection in the mouse footpad skin;  
Table 4 Pathogenicity of   HSV-1    in mouse strain A/J which were inoculated
 intracerebrally   (50. l/animal)    or intraperitoneally; and
Table 5 Inhibition of HSV-1 R15 and HFEM plaque formation by
 acyclovir.



  Table 6 ICV inoculation with R-15 and monitoring of aggressive behavior,
 fever, PGE2 production and the challenge with strain Syn 17+.



  BRIEF DESCRIPTION OF THE DRAWINGS
 In order to understand the invention and to see how it may be carried out in practice, a preferred embodiment will now be described, by way of non-limiting example only, with reference to the accompanying drawings, in which:
 Fig.   1A    shows survival of adult Sabra mice immunized with apathogenic   HSV-1    strains after challenge with the pathogenic   HSV-1    F;
 Fig 1B shows survival of suckling Sabra mice immunized with apathogenic   HSV-1    strains after challenge with the pathogenic   HSV-1    F;

  
 Fig 2 shows PCR test to detect the presence of   HSV-1    F DNA in the
 olfactory bulbs, amygdala and trigeminal ganglia of intranasally infected mice
 that were immunized with   HSV-1    R15 by the footpad route;
 Fig 3 shows neutralizing anti-HSV-1 antibodies in sera of mice,
 immunized with HSV-1 R15, prior to and after challenge with the pathogenic
   HSV-1    F;
 Fig 4 shows a scheme of the recombination experiment in which BamHI B
 DNA fragment from the pathogenic HSV-1 F was recombined with HSV-1
 HFEM genomic DNA.

   From this experiment HSV-1 R15 was isolated;
 Fig 5 shows a map of the genes and their RNA transcripts in the
 IRS-US-TRS DNA of   HSV-1    Synl7 and   HSV-1    R15;
 Fig 6 shows Northern blot analyses of RNA transcripts of genes in the
 IRS-US-TRS DNA of HSV-1 R15;
 Fig 7 shows Southern blot analyses of HSV-1 Synl7, HFEM and R15
 IRS-US-TRS DNA with OriS and US 12 probes;  
 Fig 8 shows Southern blot analyses of the BamHI DNA fragments from   HSV-1      Syn 17, R15    and HFEM DNA;
 Fig   9    shows nucleotide sequence analysis of the 4182 bp of HSV-1 R15
DNA fragment   Hpal-EcoRl    (coordinates 141611-146693);
 Fig 10 shows rearrangements in   HSV-1    R15 IRS-US-TRS DNA;

  
 Fig 11 shows comparative maps of IRS-US-TRS regions of   HSV-1    Synl7
 and   HSV-1    R15 US DNA;
 Fig 12 shows rearrangements of the genes in the   HSV-1    R15 IRS-US-TRS
DNA compared to gene arrangement in   HSV-1    Synl7 DNA;
 Fig 13 shows a PCR test to differentiate   HSV-1    R15 DNA from DNA of pathogenic   HSV-1    strains;
 Fig 14 shows FACS analysis of the HLA class I molecules on the cellular membrane of human fibroblasts after infection with   HSV-1    Synl7 and R15;
 Fig 15 shows a map of part of   UL-IRL-IRS    of HSV-1 Synl7 and the deletion in HFEM BamHI-B DNA;
 Fig 16 shows a western blot analysis to detect ICP 34.5 protein in cells infected with HSV-1 strains;

  
 Fig. 17A, 17B and 17C shows survival of mice challenged with   HSF-1    w. t. F and immunized by ocular route (17A); skin route (17B) or lung
 route   (17C);   
 Fig. 18 shows ICP27 protein detection in HEK 293 cells infected with
   HSF-1    F;   R15 and Moch;   
 Fig. 19 shows the replication rates of   R15,    P-17, R-19 in astrocytes; and
 Fig. 20 shows induction of IL-IB gene expression (as determined by
 RT-PCT induction) in astrocytes by   HSV-1    strain   Synl7+    and by R-15.  



  DETAILED DESCRIPTION OF THE INVENTION
EXPERIMENTAL PROCEDURES 1. Mice
 Mice of the Sabra strain (outbred) were supplied by the breeding facility of the Hebrew University. Ten mice inhabited each cage. They received standard nutritional and water supplies in the SPF of the Animal Containment Facility of
HUJ.



  2. Cells and medium
 The cell lines Vero   (kidney    epithelium cells of the green monkey) and
HeLa (Human) were grown in a medium   of DMEM    (GIBCO) enriched with 10% fetal calf serum (Beit HaEmek) and supplemented with 40 units/ml penicillin and 160mg/ml streptomycin. The cells were grown in culture dishes   (NUNC,   
Denmark) at   37 C    with 5%   C02tand    in 100% relative humidity. The cells were transferred from the dishes by immersing them in a 1: 5 solution of 0.25% trypsin (w/v) and 0.2% EDTA, and inoculated under the same conditions described above and grown to confluent monolayers.



   Primary astrocyte cultures were prepared from newborn rat cerebral hemispheres. Following dissection and removal of meninges, the tissue was enzymatically (trypsin) and mechanically dispersed, centrifuged through 4% BSA
 layer, and 3-3.5xl07tcells were seeded onto poly-D-lysine coated T-75 flasks.



   After 1-week growth, microglia and oligodendrocyte lineage cells were separated
 by the shaking method and the remaining astrocytes were passaged once,
 resulting in 95% pure astrocyte cultures.



   3. Viruses
 3.1 Virus strains and recombinants.



   The HSV-1 virus strains used in this study were KOS, HFEM, F (kindly
 provided by Prof. Rapp, Pennsylvania, USA), the mutant   vhs-1    (kindly provided  by Dr. Nitza   Frenkel,    Tel Aviv University), and Synl7 (provided by Prof.



     Subak-Sharpe,      Glasgow,    Scotland).



   The recombinants HSV-1 R15 and   R19    were prepared by Dr. A.



     Rosen-Wolf    and Prof. G. Darai, Heidelberg University, Heidelberg, Germany.



  They were produced by recombining the BamHI-B DNA fragment (coordinates 113,322-123,464) from   HSV-1    F strain with the   HSV-1    HFEM DNA genome.



   The recombinant HSV-M-lacZ (F blue) was also prepared by Dr. A.



  Rosen-Wolf in the laboratory of Prof. G. Darai. The DNA fragment coding for the UL56 gene (coordinates 116,030-121,753) of the HSV-1 F strain was exchanged with a DNA fragment containing the bacterial gene for   p-galactosidase    under the control of the RSV promoter.



   The pathogenic recombinant viral strains P42 and P71 were prepared by
Dr. T. Ben-Hur in the laboratory of Prof. Y. Becker, Jerusalem, Israel. These strains were the result of the recombination between the NruI-BamHI DNA fragment (coordinates 111,290-113,322) from the virulent HSV-1 R19 recombinant with the avirulent   HSV-1    R15 recombinant DNA genome.

 

   TK mutants were produced in the laboratory of Prof. Becker using BUDR (F TK, F blue TK, R15 TK, KOS TK Syn-17 TK).



   The viruses were grown in Vero cells until a full cytopathic effect was obtained. The virus titer was examined using standard plaque assay and the virus stocks were kept   at-70 C.    Sonicated suspensions of uninfected cells (Mock) served as a negative control in the mice infection trials.



  3.2 Determination of the virus titer.



   Vero cells were infected with 10 fold dilutions of the newly prepared virus
 stock. After one-hour adsorption, the cells were coated with an overlayer
 containing 0.7% agar in DMEM and incubated in a   C02    incubator   37 C.    After 3
 days the cells were fixed with 25%   formalin    solution and stained with gentian
 violet. Virus plaques 



  4. Infection of mice with virus
 Three-to-four-week-old male Sabra mice were infected with the HSV-1 strains and recombinants at different titers. Each mouse received 30-50   pt1    of diluted virus stock introduced into the nose. Suckling mice (7 days old) were infected by the same methods with 10   p1    of the diluted virus stock. In the preliminary experiments the mice were anesthetized with Halothane vapors for 10-20 seconds before virus infection. It was found that the virus infection in these mice caused pathological changes not only in CNS, but also in the lungs.
Therefore the mice were not anaesthetized before infection. Progression of the disease was monitored for 4-6 weeks. Mice of the control groups (Mock) were treated by the same mode. The   follow-up    was done every day by two neutral investigators.

   The results were registered and compared.



   The major stages of the developing HSV-1 viral disease (Herpetic encephalitis), in murine model, are: 1. Adynamia-Lack of movement; 2. Flexia of the body; 3. Hair-raising; 4. Conjunctivitis (eye infection); 5. Acrocyanosis (body appendages turn blue); 6. Convulsions of the muscles; 7. Paralysis; 8.



     Death.   



   The degree of severity of the symptoms is graded from (-) (no disease manifestation) to (++++) (most extreme expression of the disease symptom).



  5. Extraction of tissue sample s from infected mice
 The mice were sacrificed by cervical dislocation and the tissues required for the analysis were removed by dissection. The tissue samples (nose epithelium, trigeminal ganglia, olfactory bulb, spinal cord and adrenal glands) were transferred to test tubes and kept   at-70 C    for further analysis.



   6. Preparation of the serum
 The HSV-1 infected mice were sacrificed by cervical dislocation and the
 thoraces of the mice were immediately surgically opened and the heart was
 exposed. Blood was extracted with a Pasteur pipette, transferred to an Eppendorf  test tube. incubated for two hours at room temperature and centrifuged for 10
 minutes at 14000rpm. The upper part of the liquid (sera) containing the
 antibodies was transferred to Eppendorf test tubes and kept   at-20 C    for further
 analysis.



   7. Determination of the titers of neutralizing antibody in sera from
 infected and immunized mice
 100   p1 serum    (in appropriate dilution) was mixed with 100   p1    viral stock
 (in a titer of   103pfu/ml)    and with 50   ul    of growth medium DMEM and incubated
 for 2 hrs at 4"C. This mixture was added to the Vero cell monolayer incubated at
   37"C    with 5% CO ? and standard plaque assay was performed.



   The level of neutralizing antibodies was calculated according to the
 percentage of viral plaque inhibition.



   8. Detection of infective virus in mouse tissues
 Tissue samples were homogenized in a Dounce homogenizer in 1 ml PBS.



   After homogenization,   200 jj. l    of the sample was sonicated and added to Vero cell
 monolayer. The cells were incubated at   37 C    with 5% C02 for several days and
 the cytopathic effect of the virus was observed.



   9. Preparation of high molecular HSV-1 DNA
 9.1 Preparation of purified HSV-1 virions
 Virus-infected cells   (109)    were washed in TBS buffer, scraped into a minimal volume of the buffer, sonicated for 2 min and mounted onto a sucrose gradient (12%-52% w/w sucrose in TBS buffer) in nitrocellulose test tubes. The gradients were centrifuged for one hour at 25000 rpm in rotor TST-28. The band of virions was transferred to polyalomer tubes and diluted in TBS. The tubes were centrifuged again under the same conditions and the virion pellet was resuspended in lml TE buffer.  



  9.2 Preparation of hiah molecular viral DNA from purified virus (9.1). from
 the virus-infected cells or from tissue samples.



     0.5m !    or   1.0ml    of TE buffer was added to a sample in the presence of
Proteinase K (Sigma) (final concentration   of 0. 5mg/ml)    and 1% SDS (Sigma).



  The samples were incubated for 2 hours at   55 C    or at room temperature (R. T.) overnight. with gentle shaking. The sample lysate was extracted twice with phenol and then with chloroform containing 4%   isoamyl    alcohol. The DNA was precipitated from the aqueous phase with ethanol, dissolved in   400ml    of TE buffer and kept at 4 C.



  10. Indirect   immunofluorescent    stainings
 Subconfluent monolayer cell cultures that were grown on coverslides were infected with   HSV-1    virus (or treated by another way). Suspension cultures were attached to coverslides using poly-L-Lysine solution 1: 10 (Sigma). Cells were fixed with   4%      formaldehyde    (10', R. T.) and rehydrated with PBS (5'x 2, R. T.) with gentle shaking. Cells were washed with 50mM   NH4C1    (5', R. T.) and   afterwards    withtPBS (5', x 2 R. T.) (At this stage the procedure may be interrupted and the slides can be frozen   at-20 C).   



   For blocking of the Fc receptors on the cells, slides were incubated with 5% Normal Goat Serum (20', R. T.) and then washed with PBS (5', R. T., x3).



  Then cells were incubated with a primary antibody (lhr, R. T.), washed with PBS (5', R. T. x3), incubated with secondary antibody (45', R. T., in darkness), and washed with PBS (5'R. T. in darkness). Slides were prepared using antibleaching medium   (45ml    glycerol pH 8.5,5ml PBS pH   0.5g    DABCO (Sigma) and   0.05g    NaN3) and kept at   +4 C    in the dark.



   When working with paraffin-embedded slides, the deparafinization procedure is necessary prior to fixation. Slides washed with xylene (5', R. T. x3),
 then with 100% ethanol (5', R. T., x 2 (3)), then with 96% ethanol (5', R. T. x2 (3)
 and finally with doubly distilled water (DDW) (5', R. T.   xl).     



   In some cases the use of 0.01% triton x100 solution prior to incubation with a primary antibody is recommended.



  11. Investigation of RNA expression in cells 11.1 Extraction of total RNA from cells using CsCi method.



   RNA was extracted from infected cells or uninfected cells by suspending the cell pellet in a solution containing 25mM sodium citrate, 4.5M   guanidium    thiocyanate, 0.5% sodium lauryl sarcosine, 0.1% antifoam, and 47mM mercaptoethanol. Cell lysates were centrifuged for 14 hours at 36000rpm in rotor   TST-55.5    of the   Beckman    preparative centrifuge, through a layer of CsCI, at a concentration of 5.7M. The RNA that was centrifuged to the bottom of the test tube was suspended in 0.3M NaAcetate, precipitated with ethanol, and dissolved in RNase   free    DDW.



   11.2 Electrophoresis of RNA in   glyoxal    gels
 RNA was added to a solution that contained   IOmM    Sodium phosphate at pH6.5,50% DMSO, 1M de-ionized glyoxal and was incubated for 30 min at
 50 C. The RNA was electrophoresed in the presence of loading buffer   (lOmM   
EDTA, 0.05% Bromophenol blue and 60% glycerol) in agarose gel (1.5%) that
 contained   IOmM    Sodium phosphate at pH 6.5. The gel was run in a Sodium phosphate buffer at pH 6.5. Each gel contained a sample of RNA with Ethidium
 bromide (EtBr), for the determination of the position of the 18S and the 28S
 RNA as molecular weight markers.



   11.3 Fixing RNA to a nylon filter (Northern blot)
 The RNA from the gel was transferred by the capillary blot method to a
 nylon filter (0.2   um),    by placing the gel on an absorption paper (Whatman   3MM)   
 soaked in 25mM sodium phosphate at pH 6.5. A nylon filter, 8 layers of
 absorption paper in a phosphate buffer, 8 layers of dry absorption paper, many  layers of paper towels and a one-kilogram weight were placed on the gel. After 12-18 hr the nylon filter was dried and baked in   80 C    oven for one and a half hrs.



     11.4    Preparation of specific DNA probes
 11.4.1 Purification of DNA from agarose
 Viral DNA fragments that were cloned in plasmids served as a
 source for molecular probe preparation. The plasmid DNA was cleaved by
 restriction enzymes (which were used in the cloning) and the DNA was
 electrophoresed in agarose gels. The band containing the viral DNA
 fragment that will be used as a probe was excised and transferred to an
 Eppendorf tube. To obtain an agarose-free DNA fragment, the DNA was
 purified by Gel extraction kit (Jetsorb, Promega), suspended in TE buffer
 and kept   at-20 C.   



   11.4.2   Labeling    of DNA with radioactive phosphate by Nick translation
 Viral DNA, serving as a probe in hybridization experiments, was
 labeled by the Nick translation method using the BRL kit. The reaction
 was carried out in the presence of   100pci of dCTP (Ct32P)    together with the
 other 3 unlabeled deoxyribonucleotides. After incubation for 90 min at
   14 C    the reaction was stopped and the labeled DNA was separated from
 the free nucleotides on a G-50 sephadex column that was washed with TE
 buffer. The reaction products were loaded onto the column; the fraction of
 labeled probe was collected. The radioactivity was measured with a
 scintillation counter. The labeled probe was used in the Southern or
 Northern hybridization experiments.



   11.5 Hybridization of RNA with DNA probes.



   The nylon filter was put in a bag or hybridization bottle and incubated 3
 hrs at   42 C    in the presence of 50% formamide, 5 x Denhardt buffer, 50mM    Tris-HCL.    pH 7M   NaCl    0.1% sodium pyrophosphate, 1% SDS, 10%
Dextrane sulfate. 400mg/ml of   salmon    sperm DNA that   underwent    denaturation.



  The labeled DNA probe (2 x   106cpm)    was added to the bag or bottle and the filter was incubated for 16 additional hours. The filter was washed twice for 10 min at room temperature in a solution of 2 x SSC and 0.1% sodium pyrophosphate, once for 30 min at   60 C    in a solution of 2 x SSC, 0.1% sodium pyrophosphate and 0.1% SDS, and once for 30 min at   60 C    in a solution of 2 x
SSC and 0.1% SDS. The filter was exposed to Agfa X-ray film in a cassette with enhancing screen and kept   at-70 C    for several hours.



  12. Identification of specific DNA by hybridization to a DNA probe 12.1 DNA electorphoresis in agarose gels
 High molecular DNA   (8u. g)    prepared from   HSV-1-infected    cells or from   HSV-1    purified virions was incubated with 5   units/ > g    DNA restriction enzymes in final volume of   100} il    overnight in   37 C.    The samples of the restricted DNA were electrophoresed in 0.8% agarose gel in TEAN buffer at 25 volts   (35v/150mAmp)    overnight.



   12.2 Denaturation and neutralization
 The gel was placed on glass in a bowl and shaken gently with a solution of   0.5N      NaOH    and 1.5M   NaCl    in room temperature for one hour. The neutralization
 is achieved by substitution of the alkaline solution with a neutralizing solution of
 1M Tris pH8.0 and 1.5M   NaCl    at room temperature while gently shaking for 30
 min.



   12.3 Fixation of DNA to the nylon filter (Southern blot)
 Same procedure as for RNA.



   12.4 Hybridization of DNA with DNA probes
 Same procedure as for RNA with the following changes:  
 a) Hybridization buffer contained 50% formamide, 10 x Denhardt,
 5 x SSPE, 1% SDS and 400mg/ml denaturated salmon sperm DNA.
 b) The filter was washed twice for 15 minutes at R. T. in a solution of
 2 x SSC and 1% SDS and once for 2 hours at   65 C    in a solution of
 0.1   x SSC and 1% SDS.   



  13.   Cloning    of viral DNA and sequence analysis 13.1 Preparation of the viral DNA fragments and plasmid vector
Viral DNA fragments and the plasmids cleaved with suitable restriction enzymes were purified from agarose gel (see also Section 11.4).



  13.2   Ligation   
 Plasmid and viral DNA were mixed in a molar ratio of 1: 10 in the presence of the enzyme T4 DNA ligase (Promega), an appropriate buffer and incubated at 16 C overnight.



  13.3 Bacterial transformation
 An E.   Coli bacterial    colony of the   dHaS    strain or the JM109 strain was grown overnight at   37 C    in LB medium. The next day a culture of competent bacteria was prepared by the   CaCl2/RuCl2    method (Kushner 1978). 50ng of plasmid DNA after ligation was added to   100p1    competent bacterial culture for 20 minutes packed on ice. The bacteria were transferred to   42 C    for one minute, then to ice for two minutes and immediately afterwards   Iml    LB was added and the bacteria were incubated for one hour at   37 C.    The bacteria were seeded onto a
LB plate containing 1.5% agar and 100   u. g/ml    of ampicillin.

   When necessary 40   pt1 of 2% X-Gal    (sigma) solution and 40   p1    of 2% IPTG (Sigma) was added to
 the bacteria during the seeding. The plate was incubated overnight at   37 C.     



  13.4 Colonv hvbridization
 The bacterial transformed colonies that were transferred to nitrocellulose filters, BA-85 0.4   y, 80mu    diameter (Schleicher and Schuell). In order to enable compatibility between the colonies on the filter that were indicated by a specific probe and the same colonies on the agar plate, the filter and the plate were designated in the same manner. Four trays are prepared upon which four layers of no. 3 Whatman paper soaked with one of the following four solutions:
 Tray   1-0.2NNaOH,      1.5NaCl   
 Tray 2-0.4MTris pH 7.6, SSC x 2
 Tray 3-0.4MTris pH 7.0, SSC x 2    Tray 4-SSC x 2   
 In the first stage the filter is placed on the bacterial plate for one minute and then transferred to the four trays in the above numerical order in each tray for one minute.

   The filter was placed in each tray upon a wet Whatman paper so the colonies face up. The filter is air-dried and then baked in a vacuum oven at   80 C    for two hours. At this point the procedure is as in Southern blotting: Nick translation of probe, hybridization, and washing as specified: one half hour at room temperature in SSC x 2 + 1% SDS and twice for ten minutes at   65 C    in
SSC x 0.5 +   1% SDS.   



   13.5 Rapid preparation of plasmid DNA
 Bacterial colonies were grown in LB liquid culture overnight, then precipitated and suspended in 100p1 solution of 50mM glucose,   10mM    EDTA, 25mMTris pH 8.0 and 4mg/ml lysosome. After 5 minutes,   200p1 solution    of 0.2MNaOH and 1% SDS were added and incubated for 5 minutes on ice. 150   u. l    solution of   SMKAc    at pH5.6 were added for 5 additional minutes, then centrifuged and the DNA was extracted with phenol/chloroform. The aqueous phase was precipitated with ethanol and the DNA was dissolved in TE buffer.  



  13.6 Determination of DNA nucleotide sequence
 The plasmid DNA was purified using Promega's Wizard plus sv miniprep
DNA purification system (Promega). Determination of the sequence is carried out on   10yg    of DNA in the DNA Analysis Unit of the Life Sciences Institute of the
Hebrew University of Jerusalem (ABI-PRISM, Model 377). Several of the plasmids containing cloned HSV-1 were sent for sequence determination to the laboratory of Prof. G. Darai, Heidelberg, Germany.



  13.7 Computer analysis of the DNA sequences
 Computer analyses of amino acid sequences and proteins was carried out using the program package UWGCG of the University of Wisconsin. The nucleotide sequence of   HSV-1    Synl7 DNA was obtained from Genbank.



  14. Identification of viral DNA by the PCR method
 14.1 Identification of HSV-1 viral DNA by PCR
 The primers used in the PCR experiments were synthesized according to the sequence of HSV-1   UL53    (gK) essential gene.



   Direct primer 5'TCATCGTAGGCTGCGAGTTGAT 3' (22 mer)
 Reverse primer 5'CTCTGGATCTCCTGCTCGTAGT 3' (22 mer)
 Origin of the sequence: Synl7 strain of HSV-1. Size of fragment: 353bp.



  The PCR reaction was carried out in a programmable thermal controller (M. J.



  Research Inc. USA) in the presence of   5pM    of each primer, 50M of each deoxyribonucleotide, and   1.5mM      MgCl2    on the template of sample DNA.



  Reaction was performed in a volume of   50pL1    DNA was denaturated   (98 C,    10'), then the temperature was lowered to   65 C    for 10'and 2.5 units of Taq
 polymerase Diamond (Bioline) in   5p1    of Taq buffer x 10 (Bioline) was added.



   The steps of the reaction were melting   (95 C,    30") annealing   (65 C,    30") and
 elongation   (72 C,      1').    Total 35 cycles and a last step of elongation   (72 C,    10').



   The products of the PCR reaction were run on 1.8% agarose gel in the presence
 of PCR marker (Promega). Additional primers used in the PCR experiments were  synthesized according to the sequence of HSV-1 (US 6) gene that codes for glycoprotein D (gD).



   Direct primer   5'TTCGGTGTACTCCATGACCGTGAT3'(24    mer)
 Reverse primer   5'GCCGTGTGACACTATCGTCCATAC 3' (24    mer)
 Origin of the sequence: Syn 17 strain of HSV-1. Size of fragment: 620 bp.



   The PCR reaction was carried out as described above.



     14.2 Identification of R15 recombinant DNA by PCR   
 The primers were synthesized according to unique sequence   of R15    in the right part of the US region.



   Direct primer   5'TCAGCACGAACGTCTCCATC 3' (20    mer)
 Reverse primer 5'GAACCTCTCGTGGCTCCAGCA 3' (21 mer)
 Origin of sequence: R15 strain of HSV-1. The size of the fragment is 319bp. The PCR reaction was performed under the same conditions (see 14.1) except that the deoxyribonucleotides were used at final concentration of   200 pM.   



  The steps of the reaction were: Melting   (94 C,      1'),    annealing   (65 C,      1')    and elongation   (72 C,      1').    There was a total 25 cycles ending with the last step of elongation (72 C, 10').



   The products of the PCR reaction were identified by electrophoresis in
 1.8% agarose gel in the presence of PCR marker (Promega).



   15. RT-PCT
 RNA was purified from rat brain tissue and from astrocytes with the
 Qiagen kit, reverse transcribed with   MuLV    RT, and then PCR was done with
 various gene specific primers.  



  16. Determination of serum corticosterone and ACTH levels and of
 prostaglandin synthesis
 Serum corticosterone and ACTH were determined by RIA, using commercial antibodies.   Prostaglandin    E2 (PGE2) synthesis was determined by
RIA in brain slices   ex-vivo.   



  Example 1 Screening HSV-1 isolates
 To   determine    which of the HSV-1 viruses of the HSV-1 strains shown in
Table IA lacks pathogenicity to adult mice, each of the viruses were used to infect 4 week old Sabra mice by instilling   50pLI      of    107   pfu/ml    virus stock into the nostrils of each mouse. The infected and control mice were inspected for 2-4 weeks and the mortality of the infected mice was recorded. It was found that five virus strains (F, KOS, Synl7, and recombinants P42, and P71) were highly pathogenic to Sabra mice and killed all the infected animals. Four TK-mutants (F TK-,   F    blue TK-, R15   TK-,    and Synl7   TK-)    were devoid of pathogenicity to adult mice.

   Three additional HSV-1 isolates, were apathogenic to adult mice:
HFEM,   HSV-1      R15    and   HSV-1    vhs, a mutant with a mutation in the UL41 gene.



  The TK-virus mutants cannot be used for vaccine development since they are resistant to Acyclovir. It was reported that HSV-1 TK-mutants retain pathogenicity to newborn mice The results of the experiments presented in
Table   1A    and Table 1B led to the conclusion that HSV-1 R15 recombinant may have the properties required for development of a live HSV-1 virus vaccine.



  Other HSV-1 recombinants, such as the HSV-1 R19, that were isolated from the
 same recombination event were highly pathogenic to adult mice.



   The parental strain HSV-1 (HFEM) that was used for the recombination
 experiment was found to be apathogenic to adult mice but was pathogenic to
 suckling mice as shown in Table 1B and its   TK-mutant    had a residual
 pathogenicity to suckling mice so that the parental strain was unsuitable for
 human vaccination. HSV-1 R15, Fblue and Fblue   TK-were    apathogenic to the
 suckling mice (Table 1B).  



   Based on the above results, HSV-1 R15 recombinant was selected for further studies to determine its biological, immunological, and molecular properties.



  Example 2 Protection by HSV-1   R15    inoculation from challenge with
 HSV-1 F
 Groups of 10 adult mice were inoculated intranasally (i. n.) with each of the apathogenic viruses (HSV-1 R15, HSV-1 R15 TK, HSV-1 vhs, HSV-1 F blue) an additional group was used as a control. Fourteen days after the infection the mice were infected by the i. n. route with the pathogenic virus HSV-1 F. The results are shown in Fig.   1A.    As can be seen 90% of the unimmunized control mice died from the virus infection up to 23 day p. i. All the mice in the four groups that were immunized with the four apathogenic HSV-1 strains survived the challenge with the pathogenic   HSV-1    (F) virus (Fig.   1A).   



   The immunization of suckling mice was performed with four apathogenic strains of   HSV-1      (HSV-1    R15, Fblue, Fblue TK-, HFEM   TK-).    Litters of suckling mice were immunized by the i. n. route with the apathogenic virus strains and two weeks later the suckling mice were challenged with the pathogenic HSV-1 (F) and were followed for two weeks. The results shown in Fig. 1B indicate that all (100%) of the suckling mice that were immunized with HSV-1 R15 recombinant survived the challenge infection with the pathogenic virus 90% of the suckling mice that were immunized with HSV-1 F blue survived the challenge infection but only 40% of the suckling mice that were immunized with Fblue TK-survived the infection.

   All the suckling mice that were immunized with   HSV-1    HFEM TK
 died due to infection with the pathogenic virus as did the control mice.



   It was concluded that   HSV-1    R15 should be studied to define its molecular
 makeup and the reasons for its apathogenicity.  



  Example 3 Determination of penetration of HSV-1 R15 into nerve cells
 Adult Sabra mice (4 week old) were immunized by i. n. route with two apathogenic viruses:   HSV-1    R15 and   HSV-1    vhs (UL41-). At 2,4, and 7 days p.   i.    the mice were sacrificed and tissue samples from the nose epithelium (NE), olfactory bulbs (OB), brain amygdala (AM) and trigeminal ganglia (TG) were removed and pooled from 4 mice at each time point. The DNA was extracted from each tissue sample and subjected to a PCR test using primers that detect the presence of HSV-1 DNA. The results shown in Table 2A indicate that in mice that were immunized with   HSV-1    R15 recombinant the viral DNA was detected only in the nose epithelium in samples taken at days 2 and 4 p. i.

   Viral DNA was not found in the nose epithelium at 7 days p. i.   HSV-1    R15 recombinant DNA was not found in the olfactory bulbs (OB), amygdala (Am) and trigeminal ganglia (TG) of the immunized mice. It was concluded that   HSV-1    is unable to penetrate into the nervous system of the immunized mice.



   In tissue samples that were removed from mice immunized by the i. n. route with HSV-1 UL41- (vhs) mutant viral DNA was detected in the nose epithelium at days 2 and 4 p. i. but not at day 7 p. i.. However, at day 2,4, and 7 p. i. the viral DNA was detected in the olfactory bulbs (OB) and in the trigeminal ganglia (TG) and the virus DNA persisted in these tissues on days 4 and 7. It was concluded that this virus mutant was able to penetrate into the olfactory bulbs and trigeminal ganglia but not into the amygdala in the central nervous system (CNS) of the infected mice as indicated in Table 2B.



   It was concluded from these studies that HSV-1 R15 recombinant may have genetic modifications that render it incapable of penetration into the type C
   fibers    in the nose epithelium and as a result the viral DNA was unable to
 penetrate the trigeminal ganglia, olfactory bulbs and the amygdala in the CNS.



   The   HSV-1    R15 persisted in the nose epithelium for only 4 days p. i. and was not
 detected on day 7 p. i.  



  Example 4 Immunization of adult mice by injection of HSV-1 R15
 recombination
 Three groups of 10 mice each were used: Groups A and B were immunized by injection of HSV-1 R15 into the mouse footpad and Group C was not immunized. After two weeks Groups B and C were challenged with   HSV-1    F and group A was injected with uninfected cell homogenate (Mock). Fourteen days post challenge, the mice were sacrificed and the tissues of the olfactory bulbs (OB), amygdala (Am) and trigeminal ganglia (TG) were removed at days 2 and 4 p.   i.,    the DNA was extracted and analyzed by the PCR technique with primers that detect   HSV-1    DNA.



   The results shown in Fig. 2 indicate that group A mice, that were immunized with   HSV-1      R15    by the footpad route and were mock challenged, did not have HSV-1 R15 DNA in their olfactory bulbs, amygdala or the trigeminal ganglia (Fig 2,   lanesl-3).    Mice of group B that were immunized with R15 and challenged with HSV-1 F by the i. n. route, survived the challenge with the pathogenic virus but HSV-1 F DNA was not detectable in the olfactory bulbs, trigeminal ganglia and the CNS amygdala (Fig. 2, lanes 4-6).

 

   The unimmunized mice (Group C) that were infected with   HSV-1    F by the i. n. route died as a result of the infection and the PCR analyses revealed the presence of viral DNA in the olfactory bulbs and the amygdala but not in the trigeminal ganglia (Fig. 2, lanes 7-9).



   This study revealed that immunization of mice with HSV-1 R15 in the
 footpad efficiently protects against infection with a wild type HSV-1 (F) by the
 i. n. route and prevents the penetration of the pathogenic virus into the nervous
 system of the mice.  



  Example 5 Determination of HSV-1 R15 penetration to the spinal cord and
 adrenal glands
 One group of 10 adult Sabra mice was injected subcutaneously (s. c.) into the footpad skin with HSV-1 R15 and the second group was infected with the pathogenic HSV-1 F. At 2, and 4 days p. i. the mice were sacrificed and the footpad skin, spinal cord and adrenal glands were removed, the DNA was extracted from each pooled tissue sample and tested by PCR to detect the presence of   HSV-1    DNA. Table 3 shows that   HSV-1    R15 DNA was detected in the footpad skin tissue of the infected mice at day 2 p. i. but not at day 4 p. i. The
HSV-R15 DNA was not detected in the spinal cord and the adrenal glands.

   It was concluded that   HSV-1    R15 is unable to penetrate into the spinal cord of the mice and therefore the adrenal glands of the mice were not infected.



   In contrast, the pathogenic   HSV-1    (F) DNA was found to be present in the footpad skin tissue at day 2 and 4 p. i. and at day 4 the viral DNA was detected in the spinal cord and the adrenal glands of the infected mice (Table 3).



   These experiments revealed that in the footpad skin   HSV-1    R15 replicated at the site of injection for 2-3 days only and was unable to penetrate into and
 infect the spinal cord and the adrenal glands as did the pathogenic virus. The
 results of this experiment are taken as an indication that   HSV-1    R15 had lost the
 ability to penetrate into the peripheral type C fibers in the skin epidermis and
 therefore is incapable of penetration and infection of the spinal cord nervous
 system and the adrenal glands in the infected adult mice.



   Example 6 Apathogenicity of HSV-1 R15 to strain A/J mice inoculated
 intracerebrally or intraperitoneally
 HSV-1 R15 (50   il/animal)    was inoculated intracerebrally (i. c.) into the
 brains of A/J mice (4 weeks old) at various concentrations ranging from 10
 pfu/mouse to   101 pfu/mouse.    The results are shown in Table 4. It was found that
 all mice survived the infection while mice that were inoculate with   HSV-1    (F) or
   HSV-1    HFEM at   1    x   102 pfu/ml    died (Table 4).  



   Mice that were infected intraperitoneally with   HSV-1      R15    at virus titers of 1   x'i 10'or 1    x   106 pfu/ml    survived the infection similar to mice that were infected with HSV-1 (HFEM) at 1   x      107    pfu/ml. HSV-1 (F) at 1.0   x    106 pfu/mouse   killed    9 out of 10 mice (Table 4).



   The results of the experiment revealed the apathogenicity of HSV-1 R15 recombinant (HSV-R-Fehx-C15) to A/J mice in i. c. and i. p. routes of infection.



  Example 7 Determination of neurovirulance of HSV-1 K15
 Inoculation of 5 x   107    pfu/ml by the nasal or corneal routes or direct intracerebroventricular inoculation of up to   107    pfu of HSV-1 R-15 did not induce clinical signs of disease, or fever. Low virus titers were found at the site of infection at 3 days after stereotaxic injection to the hypothalamus, but no infectious virus could be isolated in other brain regions, as compared to dissemination of virulent strains. This non-virulent phenotype was stable over many passages of the virus. This suggests that spontaneous neurovirulent revertants are not existent, or occur in frequency less than 1.



   Following ICV inoculation neurovirulent HSV-1 strains cause activation of the hypothalamic-pituitary-adrenocortical axis as measured by serum corticosterone and ACTH (by RIA). In addition, the virus induces an increase in the synthesis of prostaglandin E2 in the brain, as measured by ex-vivo production in brain slices form various regions. Neurovirulent strains induce the expression of   interleukin-1    gene in various brain regions. HSV-1 R-15 as a non-neurovirulent strain, did not activate the HPA axis, did not increase PGE2 production, and did not induce IL-1 gene expression outside from the
 hypothalamus, which was the site of inoculation
 In a one-step replication experiment, strain HSV-1 R-15 infected and
 replicated in cultured astrocytes to titers 10-100 fold lower than the neurovirulent
 HFEM strain.

   HSV-1 R-15 titers in infected astrocytes peaked at   106 pfu/ml    as
 compared to   107-108    pfu/ml of the pathogenic recombinants   R-19    and   p71.   



   Infection of the astrocytes by the neurovirulent strain Synl7 induced rapid  expression of the   IL-1    gene (within 3 hours postinfection), as detected by
RT-PCR.   HSV-1    R-15 recombinants did not induce   IL-1    expression in astrocytes at the same timepoint.



  Example 8 Determination of antibodies after immunization of adult mice
 with HSV-1 R15
 To study the immune response of adult mice to immunization with by
HSV-1 R15 the mice were infected by the i. n. Route and at different time intervals (2,4,7,14 and 16 days p. i.) two mice were sacrificed, the blood was collected and the serum was prepared. The content of the antiviral neutralizing antibodies in the serum was measured. At day 14 the immunized mice were challenged with the pathogenic   HSV-1    F.



   Fig. 3 shows that at day 7 p. i. the   HSV-1    R15 immunized mice had not yet responded with the synthesis of antiviral neutralizing antibodies, but at day 14 p. i. neutralizing antibodies were present in the sera of immunized mice diluted up to
 1: 128. With a serum dilution of 1: 8,33-inhibition of HSV-1 F plaques was found. At day 16 p. i. the titer of the neutralizing antibodies decreased. However at day 21 post immunization (one week after the challenge infection with the pathogenic HSV-1 F) 100% of the virus plaques were neutralized by the serum antiviral antibodies, at serum dilution of 1: 16.



  Example 9 HSV-1 R15 expresses the UL 23 gene that codes for the viral
 thymidine kinase (TK) and is sensitive to acyclovir
 The HSV-1 R15 has an active UL23 gene that codes for the viral thymidine kinase (TK) and therefore can be inhibited by the antiviral drug
 acyclovir.



   HSV-1 R15 (100   pfu/plate)    was used to infect vero cell cultures in the
 presence and absence of different concentrations of acyclovir. It was found that
 acyclovir at concentrations of 10,50 and 100   pg/ml      effectively    inhibited HSV-1
   R15    replication (Table 5).  



  Molecular analysis of the IRS-US-TRS DNA in HSV-1 R15 genome compared to the gene arrangements in HSV-1 Synl7 DNA
 The biological properties of HSV-1 R15 indicated that changes may have occurred in the viral DNA genome and affected some of the viral genes that are involved in the pathogenicity of this virus recombinant. Molecular analyses of the viral Unique Small (US) DNA and its flanking repeats and part of the gene in the
Unique Long (UL) DNA and its interval repeat (IRL) of the   HSV-1    R15 genomic
DNA were undertaken.



  Example 10 Recombination events between BamHI-B DNA fragments from
 the pathogenic HSV-1 F with HSV-1 HFEM genomic DNA
 yielded the apathogenic HSV-1 R15 recombinant
 HFEM DNA genome harbors a 4 Kbp deletion (coordinates 117088120641) in BamHI B sequence (coordinates 113322-123456) that affected exon 3 of the Immediate Early 1 (IE1) gene coding for Infected Cell Protein (ICP) 0 (IE 110) and also deleted the promoter sequence   of UL56    gene.



   Cells were transfected with the HFEM genomic DNA together with
HSV-1 F BamHI B DNA fragment and the progeny of the transfection was collected. The results are shown in Fig. 4. Many virus plaques were isolated from the virus progeny of the recombination experiment and all the plaques, except   HSV-1      R15,    yielded pathogenic viruses.



     HSV-1    R15 recombinant   (HSV-R-Fehx-C15)    was found to be apathogenic to adult and suckling Sabra and A/J mice while other recombinants (for example,
HSV-1 R19) were highly pathogenic to mice. Recombination events that introduce BamHI B DNA fragments of HSV-1 F into the BamHI B DNA sequence of HFEM genome may have lead to multiple changes in the   HSV-1    R15 genes adjacent to the BamHI B DNA recombination sites.  



  Example 11 Changes in the expression of genes present in the US DNA of
 HSV-1 R15
 The organizational map of the US 1 to US 12 genes in the US DNA of   HSV-1    Synl7 that serves as a model in the present studies is based on its published complete nucleotide sequence and is presented as Fig. 5. For each of the US genes the RNA transcripts are also shown.



   To study the expression of the US genes in HSV-1 R15 infected cells,
RNA was isolated from the infected cells and identified by hybridization to restriction enzyme cleaved DNA fragments of the HSV-1 US DNA (Northern blot analysis) and the results are presented in Fig. 6. The   HSV-1    DNA fragments that were used as probes for the hybridization are as indicated in Fig 7.



   It was found that the US genes US 4 (gG), US 8 (gE), and US 12 coding for the immediate early protein IE-5 were not expressed in the HSV-1 R15 infected cells (Fig. 6).



   These findings were taken to indicate that a major change had occurred in viral genes (marked dark in Fig. 5) near the Terminal Repeat of the US (TRS)
DNA.



  Example 12 Southern blot analyses of HSV-1 R15 US DNA.



   To define the nature of the changes that occurred in the US genomic DNA of HSV-1 R15 near the TRS, two probes were used: Us 12 gene probe (coordinates   145312-145576)    and OriS probe (coordinates 146008-146592) that contains the origin of DNA replication (shown in Fig. 7A). For hybridization analyses, DNA genomes of several HSV-1 strains were cleaved with BamHI restriction enzymes.



   The OriS probe detected in Synl7 DNA (Fig. 7Ba) two fragments: one of
 1953 bp that is the BamHI-X DNA fragment containing the OriS nucleotide
 present in sequence the TRS. The second DNA band of 4840 bp is the BamHI-N
 fragment containing the OriS sequence present in the internal repeat of US (IRS).  



   In HFEM DNA the OriS probe detected a faint BamHI-X band and a ladder of bands (Fig 7Ba). The bands in the ladder contain the BamHI-X DNA fragment and multiple repeats of the 472 bp sequences containing the OriS from
TRS (Fig. 9). The BamHI-N was detected by the OriS probe and also a ladder of bands that contain the BamHI-N sequence and multiple repeats of the 472 bp
OriS containing a fragment that is present in IRS.



   In HSV-1 R15 DNA the OriS probe did not detect the BamHI-X DNA band (1953 bp) but detected a new, wide band of about 10,000 bp. This result indicates that the OriS 472 bp fragment present in the BamHI-X may be part of a large BamHI DNA fragment. The ladder pattern of BamHI-N fragment with multiple repeats of 472 bp OriS is the same as in HSV-1 HFEM (Fig. 7 Ba).



   The US 12 probe (present in the US DNA) detected only the BamHI-X band in HSV-1 F and its recombinants 601 and 602 (Fig. 7 Bb). The probe detected the ladder of bands in HFEM and recombinant R19. However, US 12 gene was not detected in   HSV-1    R15.



   To study the molecular changes in the US and TRS DNA of   HSV-1    R15 the probes Y, X, Z,   J1135,    and J1 in Southern blot analyses (Fig. 8 A, B). The results shown in Fig. 8B indicate the following:
 (a) Probe Y detected an 1840 bp fragment in   HSV-1    Synl7 HFEM and    R15 DNAs;   
 (b) Probe X detected a 1953 bp fragment in HSV-1 Synl7 and HFEM
 but not in R15;
 (c) Probe Z detected an 1841 bp fragment in HSV-1 Synl7 and HFEM
 but not in R15;
 (d) Probe J1135 detected a 6400 bp fragment in HSV-1 Synl7 and
 HFEM but detected   a-10000    bp fragment in   HSV-1    R15;
 (e) Probe J1 detected a 2055 bp fragment in Synl7, HFEM and R15    DNAs.   



   These findings revealed that fragments BamHI-X+Z are missing from the
 US and TRS DNA of HSV-1 R15. The HpaI-EcoRl fragment (coordinates    141611-146693)    was cloned in pGEM-7 vector (Promega). The cloned DNA fragment in the pGEM-2 was identified in bacterial extracts with the probes
J1135 and OriS and the cloned viral DNA was sequenced in an automatic sequencer.



  Example 13 The nucleotide sequence of HSV-1 R15 DNA fragment
   Hpal-EcoRI    (coordinates 141611-146693) revealed
 rearrangement
 The nucleotide sequence of the HSV-1 R15 DNA fragment of 4182 bp is presented in Fig. 9. By comparison to the nucleotide sequence of HSV-1 Synl7
US and TRS DNA it was possible to identify the molecular rearrangements in
HSV-1 R15 DNA as shown in Fig. 10 as follows:
 (a) The sequence EcoRl (coordinates 146693) near the start of the
 TRS sequence (145583) in Synl7 is unchanged in the HSV-1 R15
 DNA fragment. This sequence is identical but in the opposite
 orientation to the sequence in the IRS coordinates 131534-132605.



   (b) The DNA fragment from US DNA of HSV-1 Synl7 coordinates
 132605-134892 was found in HSV-1 R15 DNA fragment in an
 opposite orientation ligated to the start of the TRS coordinate
 145583-142046.



   (c) The HSV-1 Synl7 DNA sequence coordinates 141611-14204 is
 changed in   HSV-1    R15 DNA.



   (d) HSV-1 R15 DNA contains two tandem repeats of the 472 bp
 sequence that contains the OriS sequence.



   The sequence of HpaI-EcoRl (coordinates 141611-146693) of HSV-1
 Synl7 is 5082 bp while the HSV-1 R15 DNA fragment   HpaI-EcoRl    is 3710 bp
 the cloned DNA fragment of   HSV-1    R15 is 4182 bp with two repeats of 472 bp.



   Since the HSV-1 Synl7 has only one 472 bp sequence, the relevant size of the
 cloned   HSV-1    R15 fragment is   3710    bp. Therefore, the   HSV-1    R15 US sequence  is shorter than the same sequence in   HSV-1    Synl7 US DNA by   1372    nucleotides (Fig 11).



  Example 14 Rearrangements of the genes in the IRS-US-TRS DNA of
 HSV-1 R15
 The molecular changes that were identified in HSV-1 R15 DNA had changed the organization of the viral genes are shown in Fig. 12 and are as follows
 (a) US 1 gene (IE-4 gene coding for a nuclear phosphoprotein is
 duplicated and appears in IRS and TRS.



   (b) US 2 gene (ORF 291aa) is duplicated and appears in IRS and TRS.



   (c) US 8 gene (gE,   550aa    in   HSV-1      Synl7)    in   HSV-1    R15 codes for a
 shorter polypeptide of 188aa, identical to the N-terminus 170aa of
 gE protein of HSV-1 Synl7. The truncated gE protein in HSV-1
   R15    infected cells will not form a heterodimer with   gI    that is coded
 by US 7 and therefore HSV-1 R15 is incapable of infecting nerve
 cells
 (d) US 9,10 and 11 genes (coding for tegument proteins) are deleted.



   (e) US 12 gene (IE5) is deleted.



  Example 15 PCR test
 To be able to distinguish between HSV-1 R15 and pathogenic viruses a
PCR test was developed using primers designed according to the charged nucleotide sequence in the R15 US DNA. The results presented in Fig. 13 reveal that under the conditions of the reaction the primers allow amplification   of 319bp   
DNA only from HSV-1 R15 DNA.



  The biological implications of the gene rearrangements in the IRS-US-TRS
DNA of HSV-1 R15.  



   The molecular changes in the genes markedly modify the biological properties   of HSV-1 R15    that lead to its apathogenicity.



  Example 16 Effects of deletion of US 12 on HSV-1 R15 immunogenicity in
 mice
 The US 12 gene codes for ICP 47 that binds to and inhibits the transport of nonapeptides by TAP1/TAP2 dimers to HLA (MHC) class I polypeptides in the endoplasmic reticulum (ER) of infected cells. In the absence of ICP 47 in   HSV-1    R15 infected cells, the transport of viral nonapeptides to HLA class I molecules is not affected and therefore the induction of the host (human) immune system will start immediately after immunization with   HSV-1      R15.   



   Fig. 14 compares the results of FACS analyses that determine the fluorescence of cells that were stained with fluorescent anti-HLA antibodies. The fluorescence of HLA class I molecules present on the cell surface of human fibroblasts and fibroblasts infected with HSV-1 Synl7 or HSV-1 R15 strains, determines the transport of HLA class I molecules from the cytoplasm to the cell surface during the early stage of viral infection. It was found that between 2 hr. p. i. to 4.5 hr. p. i. (the time of ICP47 activity), the fluorescence of the HLA class I molecules on the outer cell membrane of fibroblasts infected with HSV-1
 Synl7   was-50%    lower than in cells infected with HSV-1 R15. This result
 indicated that HSV-1 R15 from which the US 12 gene was deleted is unable to
 inhibit the HLA class I translocation to the cell surface.

   Thus, the presentation of viral nonapeptide antigens by HLA class I molecules to the immune system is
 unaffected contrary to pathogenic HSV-1 Synl7 that inhibits translocation of
 HLA class I molecules to the cell membrane.



   Confocal microscopy of HeLa cells that were infected with HSV-1 F,
 HFEM and R15, fixed at 3 and 6 hr p. i. and stained with antibodies to human
 HLA class I molecules revealed that in HeLa cells infected with HSV-1 F or
 HFEM the HLA class I molecules were retained in the cell cytoplasm and were  almost absent from the outer cell membrane. In R15 infected cells HLA class I molecules were evenly distributed on the outer cell membrane (not shown).



   Confocal microscopy of HeLa cells infected with HFEM, Synl7 or   HSV-1      R15    and treated with rabbit antibodies prepared against a synthetic polypeptide derived from ICP47 amino acid sequence, revealed that ICP47 is absent from   HSV-1    R15 infected cells. Inhibition of HLA class I translocation occurs in cells infected with HFEM or   Syn 17    (not shown).



  Example 17 The deletion in the US 8 gene prevents HSV-1 R15 from
 infecting neurons in mice
 In the absence of US 8 gene expression, the complex   gE/gI    cannot be formed, hence HSV-1 R15 is unable to penetrate into the nervous system of infected mice. It was   reported (3)    that glycoprotein   gE/gI    heterodimer facilitates neuron to neuron spread of pathogenic HSV-1 strains. The inability of HSV-1   R15    to infect the nervous system of infected mice is one of the molecular changes that are responsible for the apathogenicity of this recombinant.



  Example 18 The deletion of US 9, US 10 and US 11 genes does not affect the
 replication of HSV-1 R15 in the mouse nose epithelium, skin
 and CNS
 These genes code for   y,    tegument proteins:
 (a) US 9 codes for the synthesis of tegument phosphorylated protein,
 (b) US 10 codes for another tegument protein. US 11 codes for a
 tegument protein that binds the 60 S ribosomal subunits in infected
 cells and also binds to   mRNA    transcripts of the gene UL 34
 (membrane-associated phosphorylated virion protein).



   It was observed that HSV-1 R15 replicates in vivo cells to titers of   108   
 pfu/ml indicating that the deletion of the three tegument genes does not affect
 virus replication in cell cultures in agreement with published   results (5).    The ability  of HSV-I R15 to replicate to high titers in cultured cells assures the production of this virus for vaccine purposes.



  Example 19 Modifications in the expression   of UL54    and   yl34.5    genes in the
 UL and   Internal    Repeat of UL (IRL), respectively, of HSV-1
 R15 DNA
 Figure 15 presents a map of the HSV-1 Synl7 genes that are located near and in the BamHI B DNA fragment: UL 53, UL54, UL 55 and UL56 latency genes that code for LATs   mRNA,    IE   110    gene and the y 34.5 gene that codes for
ICP 34.5.



   A 4Kbp deletion in the 5'end of the IRL was identified in the DNA genome of HSV-1 HFEM (the parental virus of HSV-1 R15). Since the HSV-1
R15 DNA genome resulted from a recombination between HSV-1 HFEM DNA and BamHI B DNA fragment from HSV-1 F. It was decided to study two genes near the recombination sites that are important to the pathogenicity of HSV-1: UL 54 and   y) 34.5    genes in HSV-R15 DNA (Fig. 15).



  Example 20 Absence of detectable ICP27 (IE-2 protein) coded by UL 54 in
 HSV-1 R15 infected cells
 The UL 54 codes for ICP27 (IE-2) protein of   HSV-1    that shuttles between the cytoplasm and the nucleus of infected cells
 Anti-ICP27 rabbit antibodies were prepared in the laboratory and used to detect ICP27 protein in   HSV-1    infected cells by confocal microscopy. HeLa cells infected with   HSV-1    F but not with   HSV-1    R15 revealed the presence of ICP27 protein cytoplasm and nucleus of the infected cell (not shown).



   Since the ICP27 protein was not detected in HSV-1 R15 infected cells we
 cloned the UL54 gene in pCi expression vector (Promega) was cloned. The
 pCi-UL 54 plasmid was transfected into cell-line 293 and stained with the
 anti-ICP27 antibodies. It was found that in the transfected cells the UL 54 gene of
 HSV-1 R15 was expressed and ICP27 was detected by the rabbit anti-ICP 27  antibodies. In addition, the nucleotide sequence of the UL54 gene promoter was cloned, sequenced and was found to be identical to the promoter sequence of the
UL   54    gene promoter in   HSV-1    Syn 17.



   Since ICP27 was not detected in HSV-1 R15 infected cells while the
UL54 gene was expressed when cloned in an expression vector. It may be possible that the UL54 gene expression in the infected cells is under influence of or regulated by other genes.



  Example 21 The expression of the y134.5 gene in HSV-1 R15 infected cells as
 compared to the pathogenic viruses HSV-1 Synl7 and HFEM
 The   y, 34.5    gene in the IRL of HSV-1 DNA codes for two proteins: The
ICP 34.5 and ORF B (Fig. 15). The ICP 34.5 is responsible for the CNS pathogenicity of HSV-1 when injected intracerebrally (7). To detect ICP 34.5 in infected cells, a rabbit antibody was prepared against a peptide derived from the amino acid sequence of the protein coded by the y, 34.5 gene. By Western blot analysis the ICP 34.5 (43 KDa) was detected in HSV-1 F infected cells while in   HSV-1    Syn 17 and HFEM infected cells the ICP 34.5 has a MW of 37KDa. (Fig.



   16). The HSV-1 recombinants 601 and 602 that contain inserts of the bacterial
LacZ gene in the two   alleles    of the   y, 34.5    genes in the TRL and IRL did not express the, 34.5 gene.



   The Western blot of ICP 34.5 in HSV-1 R15 infected cell homogenate gave an unclear result due to the unspecific staining of cellular proteins. It is suggested that y, 34.5 was expressed at a lower level than in cells infected by   HSV-1    HFEM or Syn 17.



   Example 22 Survival of mice immunized with HSV-1 Rl recombinant
 through ocular skin or lungs route after challenge with the
 pathogenic   HSV-1    (F)
 Sabra mice were immunized with HSV-1 R15 recombinant (30   p1    from a
 stock of   107      pfu/ml)    by 3 different routes: (1) infection of the eyes (10 mice);   (2) subcutaneous infection in the skin (10 mice); and (3) and infection to the lungs of 10 mice that were slightly anesthetized.



   Two weeks later all three groups of mice were infected with the pathogenic   HSV-1    (F) (30   pt1    from   10 pfu/ml    stock) by the nasal route. The animals were followed for three weeks and the survival of the immunized mice and the control mice (injected with 30   ul    of an uninfected cell homogenate by the same route of infection as the mice that were immunized) was documented, the results are shown in Fig. 17A, 17B and 17C.



  Results
 22.1 Immunization of Sabra mice bv the ocular route
 Fig. 17A revealed that 90% of the R15 immunized mice survived
 the challenge with   HSV-1    (F). About 50% of the control mice survived the
 challenge virus. This may be taken to indicate that the challenge virus
   HSV-1    (F) may not have infected half of the mice since in the two
 additional control mice groups the survival rate was 30% (see Fig. 17C)
 and 20% (Fig. 17D).



   22.2 Immunization of Sabra mice bv the subcutaneous route
 Fig. 17B shows that injection of R15 subcutaneously to the mouse
 skin fully (about 100%) protects the mice from a challenge with
 pathogenic HSV-1 (F). Of the control group only 30% of the mice
 survived.



   22.3 Immunization of mice by the lung route
 Fig. 17C revealed that inhalation of R15 into the anesthasized mice
 fully protected the mice from intranasal challenge with HSV-1 (F). The
 control group succumbed to the infection and only 20% of the mice
 survived.  



  Conclusions
 It is concluded that HSV-1 R15 recombinant protects mice against challenge with HSV-1 F when immunized by the ocular, by the skin and the lung routes.



  Example 23 HSV-1 R15 UL54 gene is not expressed in infected cells
 The UL54 gene of pathogenic HSV-1 strains F and Synl7 is expressed early (2-4 hrs post infection) and codes for the viral Immediate Early Protein designated ICP27. This protein causes rearrangements of molecules in the nucleus of the infected cells. In the previous example it was demonstrated that in   HSV-1    R15 UL54 gene is not functional.



   In the present experiment HEK293 cells were treated with uninfected cell
 homogenate (Fig. 18 Mock) and infected HEK 293 cells treated with   HSV-1    R15
 (Fig 18, R15) or HSV-1 (F) (Fig. 17F). Antibodies were raised in rabbits against
 a synthetic peptide attached to KLH. The rabbits'sera was obtained and the
 antiICP27 antibodies were used to stain the control and the virus infected cells.



   Results
 It can be seen in Fig. 18 in HEK cells infected with   HSV-1    (F) the cells
 were stained with the immune serum indicating that ICP27 protein was
 synthesized from the UL54 gene transcript. However, in the cells that were
 infected with HSV-1 R15 the viral protein ICP27 was missing. The control cells
 were negative. The results indicate that the   HSV-1    R15 recombinant is unable to
 synthesize   mRNA    from Immediate Early gene UL54.  



  Example 24 Effects of apathogenic HSV-1 R15 recombinant injected by the
 intracerebral route on the brain functions and behavior of
 infected rats   Behavioral    studies:
 Aggressive behavior was assessed 3 days post-infection by examining the responsiveness of the animal to cage opening and insertion of a gloved hand into the cage. Aggression was scored on a scale of 0-2 as follows:   0=no    response ;
I=overt startle response and attempt to   attack    the hand; 2=extreme irritability, fierce   attack    and attempt to bite the hand and/or jump out of the cage. Startle reaction was observed in response to scratching the cage.



  * It was previously shown that immunization with R15 fully protected both mice and rats from lethal doses of virulent strains. In this experiment it was examined whether immunization with R-15 may protect the rats from the clinical signs of acute infection with virulent HSV-1 and whether acute or chronic infection with R-15 have any clinical implications. For this purpose, the following parameters were monitored: body temperature; aggressive behavior; and brain prostaglandin E2 (PGE2) synthesis in 5 experimental groups as follows:
   I.  



  Results
 The results of this experiment are given in Table 6. As can be seen acute
ICV inoculation with synl7+ caused significant hyperthermia and aggressive behavior as well as increased production of   PGEZ    in the brain. Acute ICV inoculation with R-15 or s. c. immunization with R-15 did not induce any rise in body temperature, or PGE2 production or aggressive behavior different than that observed for control animals. Immunization with R-15 fully protected the animals from the Synl7+ induced aggressive behavior. These animals responded to this ultimate ICV challenge with syn 17+ by intermediate values of body temperature and   PGEZ    production between the control and Syn 17+ infected animals.



  Conclusion
 Although HSV-1 R15 recombinant, when injected intracerebrally, replicates in the brain it does not affect the normal behavior of the infected rats and does not kill them. This is another marker of the apathogenicity of HSV-1
R15 recombinant since infection with the pathogenic HSV-1 (F) makes the rats very aggressive until they die of the infection.



  Example 25   Defining    the target cells in the rat brain in which HSV-1 R15
 replicates
 One step replication of R-15 in purified primary newborn rat glial cultures:
 Figure 19 shows that   R-15    replicates to 1-2 log lower titers than virulent strains.



   This attenuated replication in brain cells is comparable to that in other cells types.



   The virulent   HSV-1    strain   Synl7+    induced   interleukin-lp    gene expression
 in infected astrocytes as determined by RT-PCR (Figure 20 first line on left). In
 correlation, this virulent strain caused translocation of NFKB to the nucleus in the
 astrocytes. In comparison, strain R-15 did not induce   IL-1 gene    expression
 (Figure 20)  
Conclusions
 HSV-1 R15 recombinant and progeny from brain cells is by two logs lower than the progeny of a pathogenic   HSV-1    The later induces the transcription of the gene for   IL I ss    while HSV-2   R15    is unable to induce IL-1ss gene.  



  Table 1A. Pathogenicity of different   HSV-1    strains to adult mice
EMI46.1     


 <SEP> Virus <SEP> strain <SEP> Genetic <SEP> modification <SEP> N <SEP> of <SEP> exp. <SEP> N <SEP> of <SEP> mice <SEP> % <SEP> of
<tb>  <SEP> mortality
<tb>  <SEP> F <SEP> w. <SEP> t <SEP> 13 <SEP> 118 <SEP> 100
<tb>  <SEP> KOS <SEP> w. <SEP> t <SEP> 1 <SEP> 9 <SEP> 100
<tb>  <SEP> Synl7 <SEP> w.

   <SEP> t <SEP> 1 <SEP> 5 <SEP> 100
<tb>  <SEP> R19 <SEP> 6 <SEP> 53 <SEP>  > 50
<tb>  <SEP> recombinant <SEP> of <SEP> HFEM
<tb>  <SEP> BamH-Bgenomewith <SEP> 
<tb>  <SEP> P42 <SEP> 1 <SEP> 5 <SEP> 100
<tb>  <SEP> DNA <SEP> from <SEP> F
<tb>  <SEP> P71 <SEP> recombinant <SEP> of <SEP> R <SEP> 15 <SEP> genome <SEP> 1 <SEP> 5 <SEP> 100
<tb>  <SEP> with <SEP> UL53 <SEP> DNA <SEP> from <SEP> R19
<tb>  <SEP> F <SEP> blue <SEP> recombinant <SEP> of <SEP> R15 <SEP> genome <SEP> 6 <SEP> 64 <SEP> 0
<tb>  <SEP> with <SEP> UL53 <SEP> DNA <SEP> from <SEP> R19
<tb>  <SEP> LacZ <SEP> inserted <SEP> into <SEP> UL56 <SEP> gene
<tb> F <SEP> TK- <SEP> 1 <SEP> 9 <SEP> 0
<tb>  <SEP> of <SEP> HSV-1 <SEP> (F)

  
<tb>  <SEP> KOS <SEP> TK-TK-mutant <SEP> 1 <SEP> 9 <SEP> 33
<tb>  <SEP> Syn <SEP> 17 <SEP> TK'TK-mutant <SEP> 1 <SEP> 5 <SEP> 0
<tb>  <SEP> F <SEP> blue <SEP> TK-TK-mutant <SEP> 1 <SEP> 16 <SEP> 0
<tb> R15 <SEP> TK- <SEP> 1 <SEP> 9 <SEP> 0
<tb>  <SEP> TK- <SEP> mutant
<tb>  <SEP> HFEM <SEP> 50 <SEP> 0
<tb>  <SEP> TK- <SEP> mutant
<tb>  <SEP> R15 <SEP> w.t., <SEP> with <SEP> a <SEP> 4ktb <SEP> deletion <SEP> in <SEP> 6 <SEP> 86 <SEP> 0
<tb>  <SEP> BamHI-Bfragment
<tb>  <SEP> genomerecombinantHFEM <SEP> 
<tb> Vhs <SEP> 2 <SEP> 18 <SEP> 0
<tb>  <SEP> with <SEP> BamH-B <SEP> DNA <SEP> from <SEP> F
<tb>  <SEP> UL41-mutant
<tb>   
Table 1B.

   Pathogenicity of different   HSV-1    strains to suckling mice
EMI47.1     


<tb> Virus <SEP> strain <SEP> Genetic <SEP> modification <SEP> N <SEP> of <SEP> exp. <SEP> N <SEP> of <SEP> mice <SEP> % <SEP> of
<tb>  <SEP> mortality
<tb>  <SEP> HFEM <SEP> w. <SEP> t. <SEP> with <SEP> a <SEP> 4 <SEP> kbp <SEP> deletion <SEP> 2 <SEP> 14 <SEP> 100
<tb>  <SEP> in <SEP> BamHI-B <SEP> fragment
<tb> HFEM <SEP> TK'TK-mutant <SEP> 1 <SEP> 10 <SEP> 10
<tb>  <SEP> R15 <SEP> Recombinant <SEP> of <SEP> HFEM <SEP> genome <SEP> 4 <SEP> 67 <SEP> 4*
<tb>  <SEP> with <SEP> BamH-B <SEP> fDNA <SEP> from <SEP> F
<tb>  <SEP> F <SEP> blue <SEP> LacZ <SEP> inserted <SEP> into <SEP> UL56 <SEP> gene <SEP> 2 <SEP> 15 <SEP> 6*
<tb>  <SEP> of <SEP> HSV-I <SEP> (F)

  
<tb> F <SEP> blue <SEP> TK-1 <SEP> 7 <SEP> 0
<tb>  <SEP> TK-mutant
<tb>  * Six and four suckling mice died 1-2 days after infection with   HSV-1    F
 blue and R15, respectively, possibly due to rejection by the mothers.  



  Table 2. Distribution of HSV-1 DNA in brain of adult mice after intranasal
 immunization in comparison with the apathogenic strain   HSV-1    vhs
 (UL41-)
A. HSV-I   R15 recombinant:   
EMI48.1     


<tb>  <SEP> 2 <SEP> days <SEP> p. <SEP> i. <SEP> 4 <SEP> days <SEP> p. <SEP> i. <SEP> 7 <SEP> days <SEP> p. <SEP> i.
<tb>



   <SEP> Sample <SEP> Tissue <SEP> Viral <SEP> Sample <SEP> Tissue <SEP> Viral <SEP> Sample <SEP> Tissue <SEP> Viral
<tb>  <SEP> number <SEP> DNA <SEP> number <SEP> DNA <SEP> number <SEP> DNA
<tb>  <SEP> 1 <SEP> N. <SEP> E. <SEP> + <SEP> 5 <SEP> N. <SEP> E. <SEP> + <SEP> 9 <SEP> N. <SEP> E.
<tb>



   <SEP> 2 <SEP> OB-6 <SEP> OB-10 <SEP> OB
<tb> 3 <SEP> Am-7 <SEP> Am-11 <SEP> Am
<tb>  <SEP> 4 <SEP> TG-8 <SEP> TG-12 <SEP> TG 
B. HSV-1 vhs (UL41-)
EMI48.2     


<tb>  <SEP> 2 <SEP> days <SEP> p. <SEP> i. <SEP> 4 <SEP> days <SEP> p. <SEP> i. <SEP> 7 <SEP> days <SEP> p. <SEP> i.
<tb>



  ViralSampleTissueViralSampletissueSampleTissue <SEP> Viral
<tb> numberDNAnumberDNAnumberDNA <SEP> 
<tb>  <SEP> +5N.E.+9N.E.-1N.E. <SEP> 
<tb>



   <SEP> 2 <SEP> OB <SEP> + <SEP> 6 <SEP> OB <SEP> + <SEP> 10 <SEP> OB <SEP> +
<tb>  <SEP> 3 <SEP> Am-7 <SEP> Am-11 <SEP> Am
<tb>  <SEP> 4 <SEP> TG-8 <SEP> TG <SEP> 12 <SEP> TG
<tb>   
Table 3: HSV-1 R15 does not penetrate into the spinal cord and adrenal
 glands after infection in the mouse foodpad skin.
EMI49.1     





   <SEP> Time <SEP> after <SEP> infection <SEP> 2 <SEP> days <SEP> 4 <SEP> days
<tb>  <SEP> Virus <SEP> strain <SEP> F <SEP> R15 <SEP> F <SEP> R15
<tb> Tissue
<tb> Foodpad <SEP> + <SEP> + <SEP> +
<tb> Spinal <SEP> cord--+
<tb> Adrenal <SEP> gland--+   
Table 4
 Pathogenicity of HSV-1 in mouse strain A/Ja which were inoculated
 intracerebrally (50  l/animal) or intraperitoneally)
EMI50.1     


<tb> Virus <SEP> strain"PFU <SEP> of <SEP> No. <SEP> animals <SEP> dead/Sign <SEP> of <SEP> Days <SEP> of <SEP> death
<tb>  <SEP> inoculated <SEP> No. <SEP> of <SEP> animals <SEP> illness <SEP> at <SEP> Post <SEP> infection
<tb>  <SEP> virus/animal <SEP> infected <SEP> 1st <SEP> to <SEP> 3rd <SEP> [No. <SEP> of <SEP> animals]
<tb>  <SEP> (% <SEP> survival) <SEP> days <SEP> post
<tb>  <SEP> infection
<tb> A:

  Intracerebrallv
<tb> x1060/10(100)10/10HSV-R-Fehx-C151.0 <SEP> 
<tb> x1050/10(100)9/10HSV-R-Fehx-C152.0 <SEP> 
<tb> x1040/10(90)9/106[1]HSV-R-Fehx-C153.0 <SEP> 
<tb> HSV-R-Fehx-C15 <SEP> 4.0 <SEP> 0/10103 <SEP> (100) <SEP> 6/10
<tb> HSV-R-Fehx-C15 <SEP> 5.0 <SEP> x <SEP> (100)4/100/10 <SEP> 
<tb> HSV-R-Fehx-C15 <SEP> 1010/10(100)2/10x <SEP> 
<tb> Mock <SEP> BME)0/10(100)0/10  <SEP> 
<tb> HSV-I-F <SEP> 1.0 <SEP> x <SEP> l <SEP> o2 <SEP> 10/10 <SEP> (0) <SEP> 10/10 <SEP> 3 <SEP> 2 <SEP> ,4 <SEP> 1
<tb> 1.0x10210/10(0)10/106#1#,7#4#,9#3##,HSV-1HFEM <SEP> 
<tb>  <SEP> 1#12# <SEP> 
<tb> B:Intraneritoneallv
<tb> HSV-R-Fehx-C15 <SEP> 1.0 <SEP> x <SEP> (100)2/100/10 <SEP> 
<tb> HSV-R-Fehx-C15 <SEP> 2.0 <SEP> 0/10(100)1/10106 <SEP> 
<tb> 1.0x1069/10(10)4/106#1#,7#5#,8#2#,HSV-1F <SEP> 
<tb>  <SEP> 1#13# <SEP> 
<tb> 1.0x1070/10(100)0/10HSV-1HFEM <SEP> 
<tb> C:

   <SEP> Intranasal
<tb> 27.10.1996
<tb> HYSV-R-Fehx-C151060/10(100)0/10x <SEP> 
<tb> 1.0x1063/10(70)10/1010#1#,12#1#,16#1#HSV-1F <SEP> 
<tb>    a Mice    A/J strain were infected at the age of four weeks (32 days), animals were purchased by
   Harlan-Winkelmann    GmbH, D-33178 Borchen, Germany.



     HSV-1    strains were propagated on   CV-I    cell cultures.  



  Table 5: Inhibition of   HSV-1    R15 and HFEM plaque formulation
 By acyclovir
EMI51.1     


<tb> Virus <SEP> strain <SEP> Acyclovir <SEP> No. <SEP> of <SEP> % <SEP> Inhibition
<tb>  <SEP> concentration <SEP> (/mol) <SEP> plaques/plate
<tb>  <SEP> HFEM <SEP> 0 <SEP> 100 <SEP> 0
<tb>  <SEP> 10 <SEP> 10 <SEP> 90
<tb>  <SEP> 50 <SEP> 0 <SEP> 100
<tb>  <SEP> 100 <SEP> 0 <SEP> 100
<tb>  <SEP> R15 <SEP> 0 <SEP> 175 <SEP> 0
<tb>  <SEP> 10 <SEP> 0 <SEP> 100
<tb>  <SEP> 50 <SEP> 0 <SEP> 100
<tb>  <SEP> 1000100
<tb> 
Table 6: ICV inoculation with R-15 does not induce aggressive
 behavior, fever or increased PGE2 production above
 control levels.

   Immunication with R-15 protects rats
 from the behavioral changes induced by an ICV challenge
 with strain Syn17+
EMI51.2     


<tb> Immunization <SEP> Acute <SEP> Aggression <SEP> Mean <SEP> rectal <SEP> Ex-vivo <SEP> Ex-vivo
<tb>  <SEP> infection <SEP> index <SEP> score <SEP> temperature <SEP> PGE2 <SEP> PGE2
<tb>  <SEP> production <SEP> production
<tb>  <SEP> (Cortex)
<tb>  <SEP> No <SEP> Syn17+ <SEP> 1.6 <SEP> ¯ <SEP> 0. <SEP> 4 <SEP> 249 <SEP> 50 <SEP> 220 <SEP> 53
<tb> immunization <SEP> ICV
<tb> Immunization <SEP> Synl7+ <SEP> 0 <SEP> 38.2 <SEP> ¯ <SEP> 0.

   <SEP> 4 <SEP> 166 <SEP> 19 <SEP> 199 <SEP> ¯ <SEP> 56
<tb>  <SEP> with <SEP> R-15 <SEP> ICV
<tb>  <SEP> No <SEP> R-15 <SEP> 0 <SEP> 100 <SEP> 25 <SEP> 104 <SEP> 27
<tb> immunization <SEP> ICV
<tb> Immunization <SEP> Vehicle <SEP> 0 <SEP> 36.8 <SEP> 0.4 <SEP> 94 <SEP> 16 <SEP> 123 <SEP> 20
<tb>  <SEP> withR-15
<tb>  <SEP> No <SEP> 0 <SEP> 36.4 <SEP> ¯ <SEP> 0.4 <SEP> 80 <SEP> ¯ <SEP> 35 <SEP> 91 <SEP> ¯ <SEP> 28
<tb>  <SEP> Vehicle
<tb>  <SEP> immunization
<tb>   
REFERENCES   1.    Rosen, A., Ernst, F., Koch, H-G., Gelderblom, H., Darai, G., Hadar, J.,
 Tabor, E., Ben-Hur, T. and Becker, Y. Replacement of the deletion in
 the genome   (0. 762-0.789    mu) of avirulent HSV-1 HFEM using cloned
 MluI DNA fragment (0.7615-0.796 mu) of virulent HSV-1 F leads to
 generation of virulent intratypic recombinant. Virus Res. 5 : 157-175
 (1986).



  2. Ben-Hur T., Rosenthal J., Itzik A. and Weidenfeld J. Rescue of HSV-1
 neurovirulence is associated with induction of brain   interleukin-1   
 expression, prostaglandin synthesis and neuroendocrine responses.



     J.    Neurovirol 2: 279-288, (1996).



  3. Dingwell K. S., Doering L. C., and Johnson D. C. Glycoproteins E. and I
 facilitate neuron-to-neuron spread of Herpes simplex virus. J. Virol.



   69: 7087-7098, (1995).



  4. Neumann L., Kraas W., Nebel S., Jung G., and Tampe R. The active
 domain of the Herpes Simplex virus protein ICP 47: A potent inhibitor of
 the transporter associated with antigen processing   (TAP).    J.   Mol. Biol.   



   272: 484-492, (1997).



  5. Nishiyama Y., Kurachi R., Daikoku T., and Umene K. The US 9,10,11
 and 12 genes of Herpes simplex virus type 1 are of no importance for its
 neurovirulence and latency in mice.   Virology    194:   419-423,    (1993).



  6. Mears W. E. and Rice S. A. The Herpes simplex virus immediate early
 protein ICP 27 shuttles between nucleus and cytplasm. Virology
 242: 128-137, (1998).



   7. He B., Gross M. and   Roizman B. The 34.5    protein of herpes simplex
 virus-1 complexes with protein phosphatase la to dephosphorylate the a
 subunit of the eukaryotic translation initiation factor 2 and preclude the
 shutoff of protein synthesis by double stranded RNA-activated protein
 kinase. Proc. Natl. Acad. Science USA   94 : 843-848,    (1997).
  

Claims

CLAIMS: 1. A recombinant herpes simplex virus, the genome of which comprises a mutant of the genome of HSV-1, with the following alterations: a deletion or mutation in the unique small (US) 8 gene region resulting either in expression of a non-functional gE protein or in no expression of the gE protein; and a deletion or mutation in the US 12 gene (IE-5) region resulting either in expression of a non-functional ICP47 protein or in no expression of the ICP 47 protein.
2. A recombinant virus according to Claim 1, further comprising a mutation or deletion in at least one of US 9, US 10 or US 11, said mutation or deletion resulting either in production of a non-functional expression product of the respective gene, or in no expression of the product.
3. A recombinant virus according to Claim 2, comprising a mutation or deletion in US 9, US 10 and US 11.
4. A recombinant virus according to Claim 3, comprising deletion of the full sequence of US 9, US 10 and US 11.
5. A recombinant virus according to Claim 1, comprising a deletion of the full sequence of US 12.
6. A recombinant virus according to Claim 1, wherein the US 8 region is mutated by reverse splicing and recombination resulting in an expression product of said region being a non-functional expression product identical to the N'-terminal amino acids of gE protein of HSV-1 Synl7.
7. A recombinant virus according to any one of the preceding claims, comprising a duplication of the sequence of at least one of US 1 or US2.
8. A recombinant virus according to Claim 7, comprising a duplication of both US 1 and US 2 genes.
9. A recombination virus according to Claim 8, wherein US 1 and US 2 appear both in the TRS and TR5 regions.
10. A recombinant virus according to any one of the preceding claims, having a non-functional or featuring non-expressing of at least one of the proteins: ICP27 or ICP34.5.
11. A recombinant virus according to Claim 10, featuring essentially no expression of ICP27 and ICP34.5 12. A recombinant virus according to any one of the preceding claims, having an UL23 gene coding for a physiologically active tyrosine kinase (TK).
13. A recombinant virus according to Claims 1 to 12, as depicted in Fig. 10.
14. A recombinant virus according to Claims 1 to 13, further comprising a heterologous sequence.
15. A recombinant virus according to Claim 14, wherein the heterologous sequence is inserted in the position of the genes US 9, US 10, US 11 or US 12.
16. A recombinant virus according to Claim 14, wherein the heterologous sequence is selected from the group consisting of : (a) a sequence coding for an immunogenic protein from human herpes virus 2; (b) a sequence coding for an immunogenic protein from human herpes virus 3; (c) a sequence coding for an immunogenic protein from human herpes virus 4; (d) a sequence coding for an immunogenic protein from human herpes virus 5; (e) a sequence coding for an immunogenic protein from human herpes virus 6; (f) a sequence coding for an immunogenic protein from human herpes virus 7; and (g) a sequence coding for an immunogenic protein from human herpes virus 8.
17. A recombinant virus according to Claim 14, comprising as a heterologous sequence a cytotoxic gene.
18. A recombinant virus according to Claim 14, comprising as a heterologous sequence an apoptosis gene.
19. An anti HSV-1 vaccine comprising as an active ingredient a recombinant virus according to any one of Claims 1 to 13, optionally together with an immunologically acceptable carrier. 20. An anti-HSV-1 vaccine according to Claim 19, further comprising a recombinant virus according to Claims 14 to 18.
21. An anti-HSV-1 vaccine according to Claim 20, further comprising recombinant virus according to Claim 16.
22. An anti herpes vaccine comprising as an active ingredient a recombinant virus according to Claim 16.
23. A pharmaceutical composition of gene therapy comprising as an active ingredient a recombinant virus according to Claim 14,17 or 18.
24. A pharmaceutical composition for the treatment of astrocytoma brain tumor and/or solid tumors in other organs, comprising as an active ingredient any one of the recombinant virus of Claims 1-14,16 or 17.
EP20000949877 1999-08-03 2000-08-03 Recombinant hsv-1 and live viral vaccines Ceased EP1210448A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
IL13121299A IL131212A0 (en) 1999-08-03 1999-08-03 Recombinant virus and live-virus vaccines
IL13121299 1999-08-03
PCT/IL2000/000469 WO2001009361A1 (en) 1999-08-03 2000-08-03 Recombinant hsv-1 and live viral vaccines

Publications (1)

Publication Number Publication Date
EP1210448A1 true EP1210448A1 (en) 2002-06-05

Family

ID=11073099

Family Applications (1)

Application Number Title Priority Date Filing Date
EP20000949877 Ceased EP1210448A1 (en) 1999-08-03 2000-08-03 Recombinant hsv-1 and live viral vaccines

Country Status (6)

Country Link
EP (1) EP1210448A1 (en)
JP (1) JP2003505103A (en)
AU (1) AU6313000A (en)
CA (1) CA2381056A1 (en)
IL (1) IL131212A0 (en)
WO (1) WO2001009361A1 (en)

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE312189T1 (en) 2000-01-21 2005-12-15 Biovex Ltd VIRUS STRAINS FOR ONCOLYTIC TREATMENT OF CANCER
JP2004532849A (en) * 2001-04-20 2004-10-28 カイロン コーポレイション Delivery of polynucleotide drugs to the central nervous system
JP2004099584A (en) 2002-05-02 2004-04-02 Keio Gijuku Anti-tumor agent using HSV
US7592169B2 (en) 2003-04-25 2009-09-22 Medimmune, Llc Methods and compositions for treatment and prevention of HSV-2 infections and conditions
CN101583381B (en) * 2006-09-08 2014-05-07 宾夕法尼亚大学董事会 HSV-1 and HSV-2 vaccines and methods of use thereof
US8865185B2 (en) 2006-09-08 2014-10-21 The Trustees Of The University Of Pennsylvania Methods of use for HSV-1 and HSV-2 vaccines
US8057804B2 (en) 2006-12-28 2011-11-15 The Trustees Of The University Of Pennsylvania Herpes simplex virus combined subunit vaccines and methods of use thereof
AU2007342345B9 (en) 2006-12-28 2013-09-12 The Trustees Of The University Of Pennsylvania Herpes Simplex Virus combined subunit vaccines and methods of use thereof
US10478490B2 (en) 2006-12-28 2019-11-19 The Trustees Of The University Of Pennsylvania Herpes simplex virus combined subunit vaccines and methods of use thereof
CN102657861A (en) * 2010-08-16 2012-09-12 郑州金森生物科技工程有限公司 Herpes simplex virus I-type gene recombinant attenuated live vaccine and preparation method thereof
HRP20182194T1 (en) 2011-09-08 2019-02-22 New York University ONCOLYTIC HERPES SIMPLEX VIRUS AND ITS THERAPEUTIC USE
US10967015B2 (en) 2015-06-15 2021-04-06 New York University Method of treatment using oncolytic viruses
US12480097B2 (en) 2019-03-14 2025-11-25 Research Institute At Nationwide Children's Hospital Syncytial oncolytic herpes simplex mutants as potent cancer therapeutics
CN111635913B (en) * 2020-06-16 2022-03-04 广东东阳光药业有限公司 Constructs and their applications

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9102126D0 (en) * 1991-01-31 1991-03-13 Smithkline Beecham Biolog Novel vaccine
US5804413A (en) * 1992-07-31 1998-09-08 University Of Pittsburgh Of The Commonwealth System Of Higher Education Herpes simplex virus strains for gene transfer
US5998174A (en) * 1997-05-12 1999-12-07 University Of Pittsburgh Of The Commonwealth System Of Higher Education Multigene vectors

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0109361A1 *

Also Published As

Publication number Publication date
WO2001009361A1 (en) 2001-02-08
CA2381056A1 (en) 2001-02-08
IL131212A0 (en) 2001-01-28
AU6313000A (en) 2001-02-19
JP2003505103A (en) 2003-02-12

Similar Documents

Publication Publication Date Title
Ludwig Bovine herpesviruses
KR100372934B1 (en) Virus Defect Vaccines Generated by Transgenic Complementary Cell Lines
Turin et al. BHV-1: new molecular approaches to control a common and widespread infection
Matsumura et al. An equine herpesvirus type 1 recombinant with a deletion in the gE and gI genes is avirulent in young horses
Kimman et al. Inactivation of glycoprotein gE and thymidine kinase or the US3-encoded protein kinase synergistically decreases in vivo replication of pseudorabies virus and the induction of protective immunity
Da Costa et al. Construction and characterization of a replication-defective herpes simplex virus 2 ICP8 mutant strain and its use in immunization studies in a guinea pig model of genital disease
Spector et al. Evaluation of a live attenuated recombinant virus RAV 9395 as a herpes simplex virus type 2 vaccine in guinea pigs
JPH08507784A (en) Virus vaccine
WO2001009361A1 (en) Recombinant hsv-1 and live viral vaccines
Aurelian et al. Vaccine potential of a herpes simplex virus type 2 mutant deleted in the PK domain of the large subunit of ribonucleotide reductase (ICP10)
Abendroth et al. Varicella‐zoster virus immune evasion
Ghiasi et al. Vaccination with a cocktail of seven recombinantly expressed HSV-1 glycoproteins protects against ocular HSV-1 challenge more efficiently than vaccination with any individual glycoprotein
JP4044131B2 (en) Herpesvirus vaccine
US20100291142A1 (en) Bacterial Artificial Chromosome Containing Feline Herpes Virus Type 1 Genome and Uses Thereof
Brehm et al. Immunogenicity of herpes simplex virus type 1 mutants containing deletions in one or more α-genes: ICP4, ICP27, ICP22, and ICP0
US11305009B2 (en) Recombinant virus with diminished latency and methods of using same
Kinchington Latency of varicella zoster virus; a persistently perplexing state
White et al. An animal model of varicella virus infection
Cohen Varicella-zoster virus: the virus
US20040185056A1 (en) Vaccines containing bovine herpesvirus 1 attenuated by mutation in latency-related gene
Holman et al. Neurovirulent factor ICP34. 5 uniquely expressed in the herpes simplex virus type 1 Δγ134. 5 mutant 1716
Boldogköi et al. Replication and virulence of early protein 0 and long latency transcript deficient mutants of the Aujeszky′ s disease (pseudorabies) virus
JP5177927B2 (en) gM negative EHV mutant
Thompson et al. Partial rescue of herpes simplex virus neurovirulence with a 3.2 kb cloned DNA fragment
ES2324406T3 (en) MUTANTS OF HERPESVIRUS EQUINO (EHV) GM-NEGATIVES WITHOUT HETEROLOGICAL ELEMENTS.

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020304

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

17Q First examination report despatched

Effective date: 20040720

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED

18R Application refused

Effective date: 20061124