EP1200623A2 - Diagnostic method comprising wt1 sequences - Google Patents

Diagnostic method comprising wt1 sequences

Info

Publication number
EP1200623A2
EP1200623A2 EP20000946122 EP00946122A EP1200623A2 EP 1200623 A2 EP1200623 A2 EP 1200623A2 EP 20000946122 EP20000946122 EP 20000946122 EP 00946122 A EP00946122 A EP 00946122A EP 1200623 A2 EP1200623 A2 EP 1200623A2
Authority
EP
European Patent Office
Prior art keywords
nucleotide sequence
wtl
subject
specific
tumour
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP20000946122
Other languages
German (de)
French (fr)
Inventor
Karim Malik
Keith Brown
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Bristol
Original Assignee
University of Bristol
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB9916669.6A external-priority patent/GB9916669D0/en
Priority claimed from GBGB9926293.3A external-priority patent/GB9926293D0/en
Application filed by University of Bristol filed Critical University of Bristol
Publication of EP1200623A2 publication Critical patent/EP1200623A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/154Methylation markers

Definitions

  • This invention relates to a diagnostic method, to a nucleotide sequence comprising a Wilms' tumour suppressor gene (WTl) antisense regulatory region, and to a method of disease detection and prognosis based on the methylation state of the regulatory region.
  • WTl Wilms' tumour suppressor gene
  • WT Wilms' tumour
  • the human WTl gene resides on chromosome l lpl3 (Call et al, (1990) Cell 60, p 509-520; Gessler et al, (1990) Nature 343, p774-778; Call et al, (1994), US5,350,840) and is genomically organised as 10 exons spanning a 60 kilobase chromosomal region. Intragenic deletions and mutations of the tumour suppressor gene, WTl, have been detected in approximately 10% of Wilms' tumours.
  • WTl gene expression is controlled in a highly specific manner, increasing as metanephric mesenchymal cells progress towards immature epithelial cells, and attenuating as the cells become more phenotypically mature.
  • the inverse correlation between WTl expression and the differentiation status of human leukaemic cells along with evidence of expression in ovary and testis and the spinal chord and brain strongly suggest that the function of the WTl gene product may be pivotal in growth and/or differentiation in a variety of cell types.
  • the WTl protein which includes four zinc fingers, is expressed as four isoforms arising from two alternative splice sites (I and ⁇ ) in the gene.
  • Splice II occurs within the zinc finger domain, inserting or omitting three amino-acids (KTS) between zinc fingers 3 and 4.
  • KTS three amino-acids
  • WTl -KTS specifically binds to the EGR site consensus sequence (5'-GCGGGGGCG-3') whereas the WTl protein with KTS (WTl+KTS) does not.
  • EGR early growth response gene
  • IGF-II insulin-like growth factor type II
  • PDGF-A platelet derived growth factor A
  • CSF-1 colony stimulating factor- 1
  • EGF-R epidermal growth factor receptor
  • the human WTl promoter region has been characterised and found to belong to the family of TATA-less, CCAAT-less, GC-rich promoters with multiple responsive sites for the transcription factor Spl. EGR/WTl consensus sequences were also identified upstream and downstream of the major transcriptional start site (Hofmann et al, (1993) Oncogene 8, 3123-3132) and the suggestion that these sites may allow WTl autorepression was subsequently verified using transient transfection assays with the human promoter (Malik et al, (1994) FEBS Letters 349, 75-78)
  • WTl function is crucial in the normal development of the urogenital system, as demonstrated in WAGR (Wilms tumour, Aniridia, Genitourinary abnormalities and mental Retardation) syndrome and in Denys-Drash syndrome (DDS), diseases characterised by renal and genital abnormalities together with a predisposition to Wilms' tumour (reviewed in Coppes et al, (1993) FASEB J. 7, 886-895.)
  • antisense WTl mRNA transcripts with no apparent open reading frames have been detected in foetal kidney and WTs, suggesting a regulatory role for these mRNAs (Campbell et al, (1994) Oncogene 9, 583-595; Eccles et al, (1994) Oncogene 9, 2059-2063).
  • One such function of these mRNAs may be the formation of RNA heteroduplexes with sense WTl mRNA, thereby modulating the finite levels of cellular WTl protein.
  • the inventors reported the identification of an antisense WTl promoter located in intron 1 which is activated by WTl.
  • the WTl antisense transcript may upregulate the levels of WTl protein (Moorwood et al, (1998) J. Pathol 185, 352-359), and aberrations of the control mechanisms for antisense RNA transcription may result in inappropriate temporal and spatial expression of WTl protein, in turn contributing to tumourigenesis.
  • WTl can increase the tumour growth rate of adenovirus-transformed baby rat kidney cells (Menke et al, (1996) Oncogene 12, 537-546).
  • WTl antisense promoter locus was identified as a hypermethylated sequence in human breast cancers (Huang et al, (1996) Cancer Res. 57, 1030-1034) and breast cancers have been shown to have decreased expression of WTl (Silberstein et al, (1997) Proc. Natl Acad. Sci. USA 94, 8132-8137).
  • the inventors have identified an antisense regulatory region (ARR) of the WTl antisense promoter, and have demonstrated that the ARR is part of a differentially methylated region.
  • the WTl ARR characterised and utilized as the basis of the invention is structurally and functionally distinct from previously described WTl gene sequences (for example Call et al, (1994), US patent 5,350,840).
  • the inventors have found a correlation between the levels of ARR methylation, and the pathological state of human cells, Specifically, a variety of cancer cells are shown to differ from their normal counterparts on the basis of epigenetic changes.
  • a first aspect of the invention provides a nucleotide sequence encoding a WTl antisense regulatory region comprising at least a portion of, or consisting of, the sequence shown in SEQ1, or at least a portion of a variant, due to base substitutions, deletions and/or additions, of the sequence shown in SEQ.l.
  • a second aspect of the invention provides a nucleotide sequence encoding a WTl antisense regulatory region comprising or consisting of the sequence shown in SEQ2, or at least a portion of a variant, due to base substitutions, deletions and/or additions, of the sequence shown in SEQ.2.
  • the WTl antisense regulatory region may be limited to the portion of sequence shown in bold in SEQ. 2, or variants of such a sequence due to base substitutions, deletions and/or additions.
  • a third aspect of the invention provides a nucleotide sequence encoding a WTl antisense regulatory region negative regulatory element (NRE) comprising at least a portion of the sequence shown in SEQ.l or at least a portion of a variant, due to base substitutions, deletions, and/or additions, of the sequence shown in SEQ.l .
  • the nucleotide sequence shown in SEQ.1 may contain several WTl antisense regulatory region negative regulatory elements.
  • a nucleotide sequence according to the first, second or third aspects of the invention is a DNA or RNA sequence. Portions of any sequences are preferably functional i.e. they have a biological function of a corresponding native sequence.
  • a fourth aspect of the invention provides a method of disease detection, diagnosis or prognosis in a subject with cancer, using the differentially methylated state of specific nucleotide sequences, such as the nucleotide sequences in the WTl ARR region.
  • Genomic epigenetic changes are often regional, for example affecting a variety of gene loci on chromosome l lpl5 (Feinberg (1999) Cancer Research (suppl.) 59, p 1743-1746).
  • the inventors' identification of the chromosome 1 lpl3 region as a target for epigenetic changes by methylation therefore suggest that other DNA probes/DNA sequences from the l ip 13 region, including those derived from the l ip 13 genes reticulocalbin and PAX6, may also be utilized for detection purposes in methods according to the invention.
  • the specific nucleotide sequence(s) may be one or more regulatory elements preferably one or more negative regulatory elements (NRE), for example, one or more NREs within the ARR.
  • the NRE sequence or sequences may be part of the WTl gene, or part of the chromosome l lpl3 region, such that a method of disease diagnosis and prognosis in a subject diagnosed with cancer, comprises determining the methylation state of a NRE, or an ARR, of the WTl gene or chromosome 1 lpl3 region DNA sequence in the subject, and correlating the methylation state of the NRE with the diagnosis and expected long-term recovery prognosis of the subject.
  • hypermethylation of the NRE indicates that the subject has a positive long term recovery prognosis
  • hypomethylation of the NRE indicates that the subject is predisposed to relapsing after treatment
  • hypermethylation of the NRE indicates that the subject has a positive long term recovery prognosis
  • hypomethylation of the NRE indicates that the subject is predisposed to relapsing after treatment.
  • hypomethylation is detected specifically in tumours, and in colorectal cancer cell lines, hypomethylation correlates with tumouri genie potential.
  • hypermethylation of the specific nucleotide sequence or sequences may indicate the presence of cancer cells and/or a predisposition of the subject to relapsing after treatment
  • hypomethylation of the specific nucleotide sequence or sequences may indicate the absence of cancer cells and/or that the subject has a positive long term recovery prognosis
  • the diagnostic application is underlined by the hypomethylation in WTs, as opposed to the hypermethylation of other renal tumours, such as primitive neuroectodermal tumour (PNET) and clear cell sarcoma of the kidney (CCSK) (see figure ID).
  • PNET primitive neuroectodermal tumour
  • CCSK clear cell sarcoma of the kidney
  • the methylation state may be determined by restriction of the WTl antisense regulatory region using enzymes such as ifoA 12361, Spel and Kpnl in combination.
  • Bshl236I is an isoschizomer of Bst UI. Bshl236I cuts at the restriction sequence CGCG only when there is no CpG methylation. Methylated sequences are not restricted by 2?.sA 12361. Therefore, the restriction pattern obtained for a nucleotide sequence which has been restricted with Bshl236I gives a different band pattern depending on whether the Bshl236I sites in the nucleotide sequence are methylated or not. Other commercially available enzymes may also be used, with one or more being able to distinguish between methylated and unmethylated DNA.
  • the methylation state may be determined using a PCR-based assay system.
  • a PCR-based assay system may involve the use of sodium-metabisulphite. This has the effect of converting all unmethylated cytosine residues to uracil residues.
  • the PCR reaction uses the following primers to amplify at least a portion of the WTl antisense regulatory region:
  • Tf 5 '-GGGTGGAGAAGAAGGATATATTTAT-3 ' .
  • Tr 5'-TAAATATCAAATTAATTTCTCATCC-3'.
  • TfN 5'-GATATATTTATTTATTAGTTTTGGT-3' (nested primer).
  • TrN 5'-AAACCCCTATAATTTACCCTCTTC-3' (nested primer).
  • the conditions used in the PCR reaction are the same as the conditions mentioned later in the specification.
  • the PCR products obtained from the PCR reaction, as described below, may then be cloned and sequenced.
  • the PCR products may be cloned into a vector such as pGEM-T (Promega).
  • the PCR products may be sequenced directly. Once sequenced, any methylated cytosine residues will remain readable as 'C in the nucleotide sequence, whereas unmethylated cytosines will appear as T residues in the sequence.
  • the nested PCR reaction involves the following primers.
  • Tf 5 ' -GGGTGGAGAAG AAGG AT ATATTT AT-3 ' .
  • Tr 5'-TAAATATCAAATTAATTTCTCATCC-3'.
  • a fifth aspect of the invention provides a method of cancer detection in cells derived from a subject comprising detection of tumour-specific alteration of genomic imprinting. Any bi-allelic expression of tumour-specific genes may indicate the presence of tumourgenic cell proliferation if the normal tissue expresses the gene monoallelically. Alternatively, with some cancers, the normal tissue may be biallelic, and the cancer monoallelic. Additionally, methylation changes may be accompanied by changes in gene expression through silencing or enhanced gene expression, irrespective of allelic contributions to gene dosage (reviewed in Jones (1996), Cancer Research 56, p2463-2467)
  • tumour-specific alteration of genomic imprinting may be detected by reverse transcription PCR (RT-PCR).
  • RT-PCR reverse transcription PCR
  • the method may be used in the detection of WT in a subject, and may detect alteration of genomic imprinting of WT-specific genes such as the WT-1 gene.
  • the altered genomic imprinting detected may be relaxation of genomic imprinting, loss of imprinting, or gain of imprinting.
  • the RT-PCR may use two primers designed to anneal to a tumour-specific gene sequence on opposite sides of an allelic polymophism which introduces a restriction-site in one allele only.
  • the RT-PCR may use the following primers:
  • Primer 1 WTl 8 [CTTAGCACTTTCTTCTTGGC]
  • Primer 2 WITKBF2 [TTGCTCAGTGATTGACCAGG]
  • a sixth aspect of the invention provides a method of treating a subject with a specific cancer, comprising altering the genomic imprinting of a tumour-specific gene. This may involve relaxation of the genomic imprinting, or reversal of relaxed genomic imprinting.
  • a seventh aspect of the invention provides a diagnostic kit, assay or monitoring method using a method according to a fifth aspect of the invention.
  • An eighth aspect of the invention provides a method of detection of the methylation state of a WTl antisense regulatory region comprising detection of a tumour-specific alteration in genomic imprinting using a method according to a preceding aspect of the invention, and correlating a detected alteration in genomic imprinting with differential methylation of the WTl antisense regulatory region. For example, relaxation of genomic imprinting may be correlated with hypomethylation of the WTl antisense regulatory region.
  • Figure 1(A) shows the probe used for the detection of methylation for Southern blotting
  • Figure 1(B) shows a Southern blot of three acute myelogenous leukaemia (AML) DNAs and a normal peripheral blood lymphocyte DNA; and
  • Figure 1(C) shows a Southern blot of DNAs from a non-tumourogenic and a highly- tumourgenic colorectal cell line
  • Figure 1(D) shows a Southern blot of matched normal kidney and WT samples, matched normal kidney and PNET or CCSK DNAs and a foetal kidney control
  • Figure 1(E) shows Southern blot analysis of breast tumour DNAs for changes in the ARR methylation status.
  • Figure 2 shows the nucleotide sequence of a WTl ARR, with the primer hybridisation sites indicated by arrows;
  • Figure 3(A) is a schematic diagram showing the primers on either side of the antisense
  • Figure 3(B) shows a southern blot of the antisense WTl RNA RT-PCR products
  • SEQ.l shows a nucleotide sequence of the WTl ARR
  • SEQ.2 shows a nucleotide sequence of a negative regulatory element of a gene encoding
  • SEQ.3 shows the nucleotide sequence of a WTl antisense region (Gessler, M & Bruns
  • the WTl cDNA and WTl promoter region were cloned from a human foetal kidney cDNA library (Clontech) and a human B-cell genomic library ( ⁇ Sha2001, kindly supplied by T. H. Rabbitts, Medical Research Council, Cambridge) respectively.
  • Plaque screen filters Du Pont
  • Genomic clones corresponding to the 5 '-end of the WTl gene were subcloned and characterised by restriction analysis according to standard methodology (Sambrook, J., et al (1989). Molecular Cloning, Vols 1 and 2, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y.). DNA sequences were determined by the dideoxy chain terminator method (Sanger, F., et al (1977). Proc. Natl Acad. Sci. USA, 74, 5463-5467) and by ⁇ taq cycle-sequencing according to the manufacturers instructions (USB- Amersham).
  • Figure 1(D) shows a Southern blot of matched normal kidney and Wilms' tumour samples. All WT samples were confirmed as having no loss of heterozygosity. Also shown are matched normal kidney and PNET or CCSK DNAs.
  • hypomethylation of specific nucleotide sequences correlates with the tumour state. However, in other cancers, this correlation may be inverted, such that hypermethylation of specific nucleotide sequences corresponds to the methylation status of tumour cells, and hypomethylation may indicate normal cells.
  • FIG 1(E) An example of this is shown in figure 1(E) , with Southern blot analysis of normal breast tissue DNA and breast tumour DNAs for changes in the ARR methylation status.
  • Four infiltrating ductal carcinomas of varying aggressiveness all showed increased methylation of the WTl ARR compared to the normal breast tumour DNA. Therefore the relative differential methylation comparing normal tissue and tumour tissue may be utilised diagnostically.
  • Tumour cells and normal cells may be distinguished by their epigenotype as previously outlined.
  • Knowledge of the DNA sequence of the WTl antisense regulatory region has made it possible to develop a PCR-based assay system to allow the determination of the methylation status of samples, which will require less biological material.
  • This method involves introducing CpG dinucleotides which are not part of a restriction enzyme recognition sequence by treatment of genomic DNA samples with sodium-metabisulphite (Merck), thereby converting all unmethylated cytosine residues to uracil (Merck), thereby converting all unmethylated cytosine residues to uracil (Merck), thereby converting all unmethylated cytosine residues to uracil (Paulin, R., et al (1998) Nucleic Acids Research 8, 4777-4790). Specific regions of interest in the WTl intronic sequence can then be amplified using primers specific for both strands of DNA.
  • PCR bands obtained can be directly sequenced or cloned using a commercially available vector such as pGEM-T (Promega) and analysed by DNA sequencing. Any methylated cytosine residues will remain readable as 'C in the DNA sequence, whereas unmethylated cytosines will appear as 'T'.
  • nested primers which include one specific for the methylated Bshl236I site shown to be commonly differentially methylated (boxed in Figure 2), or one specific for the unmethylated Bsh 12361 site (i.e. specific for C— » conversion) may be employed, permitting discrimination between methylated and non-methylated sequences by visualisation of the PCR products, i.e. if a primer specific for the methylated Bsh 12361 site is used, a PCR product will only be observed if the Bsh 12361 site in the sample is methylated, otherwise, no PCR amplification will occur.
  • Illustrative primers which may be used for methylation-specific PCR are shown below, and their hybridisation positions to the WTl sequence are shown by arrows in Figure 2 for top-strand amplification. Allowing for C— »T conversion, these are:
  • Tf 5'-GGGTGGAGAAGAAGGATATATTTAT-3 '.
  • TfN 5'-GATATATTTATTTATTAGTTTTGGT-3' (nested primer).
  • TrN 5'-AAACCCCTATAATTTACCCTCTTC-3' (nested primer).
  • Typical primary amplifications are conducted with Amplitaq (Perkin-Elmer) with 100 ng. of bisulphite-treated DNA in buffer supplemented with 3mM MgCI 2 .
  • Amplification conditions are 3 mins. denaturation at 94°C, followed by 35 cycles of denaturation at 94°C for 30 sees, annealing at 50°C for 30 sees, and extension at 72°C for 90 sees. A final extension of 5 mins at 72°C completes the reaction.
  • Secondary PCR with the nested primers employs the same conditions, but using l/lOO" 1 of the primary PCR reaction and 24 cycles.
  • the inventors have detected a correlation between the methylation state of the ARR and the diagnosis and long term disease prognosis in subjects with cancer.
  • the diagnostic potential is shown by the hypomethylation in WTs, as opposed to the hypermethylation of other renal tumours, such as primitive neuroectodermal tumour (PNET) and clear cell sarcoma of the kidney (CCSK) (see figure ID).
  • PNET primitive neuroectodermal tumour
  • CCSK clear cell sarcoma of the kidney
  • the methylation state of the NRE can be used as a potential early indicator of the long term diseased prognosis.
  • Subjects who have an unmethylated NRE can be kept under closer observation for early detection of relapse. This will maximise their chances for recovery.
  • the expense of such close observation post-treatment is not necessary with subjects with unmethylated NRE, as these patients are expected to respond well to treatment once any relapse has been detected by normal routine checking.
  • hypomethylation of specific nucleotide sequences corresponds to a predicted positive long term prognosis of the subject with the AML
  • hypomethylation corresponds to a predisposition of the subject to relapsing after treatment.
  • this correlation may be inverted, such that hypermethylation of specific nucleotide sequences corresponds with a predisposition to relapsing after treatment, and hypomethylation may indicate a positive long term prognosis for recovery. Therefore, decisions on the best methods of therapy to suit the subject can be made in the light of an educated expectation of how the subject is expected to respond to treatment in the event of a relapse of their cancer condition.
  • WTl ARR/NRE Antisense Regulatory Region/Negative Regulatory Region
  • Genomic imprinting is the phenomenon by which maternal or paternal copies of a gene can be selectively expressed, with methylation of DNA serving as the regulatory signal. Loss of such a signal can lead to an altered dosage of gene expression that can be deleterious to normal cell growth.
  • the IGF2 gene exhibits loss of genomic imprinting control of IGF2 and is overexpressed in WTs (Feinberg, A. P. (1999) Cancer Res. (suppl), 59: 1743s- 1746s). As IGF2 is a growth factor, this may easily contribute to uncontrolled proliferation associated with tumourigenesis.
  • RT-PCR reverse transcription-PCR
  • Typical reaction conditions used for the RT-PCR were annealing of the reverse primer to 1 ⁇ g of total RNA by heating to 60°C for 5 mins, followed by quenching on ice, followed by reverse transcription carried out with Super RT (HT Biotechnologies, Cambridge, U.K.) reverse transcriptase at 50°C for 60 mins. This was followed by PCR cycling as follows:
  • PCR products obtained were digested by adding the restriction enzyme Mnll directly to the PCR mix and incubating for 60 minutes at 37°C.
  • the PCR products were then separated on 2% agarose gels and then alkali blotted onto Hybond N + membrane and hybridised with a 32 P-labelled antisense cDNA probe.
  • the sequence of the probe is shown in bold between WTl 8 and WITKBP2 in SEQ. 3.
  • the following primers were used as DNA controls:
  • Primer 1 WITKBF2 [TTGCTCAGTGATTGACCAGG]
  • Primer 2 WITKBR2 [TTGGCTGGAAAGCTTGCAGC]
  • the Mnll polymorphism (Grubb, G. R. et al (1995) Oncogene, 10: 1677-1681) utilised is marked by an asterisk in figure 3 A, and results in RT-PCR products of 286 and 222bp for biallelic expression, or alternatively major allelic bands of 286bp or 222bp for monoallelic expression.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Oncology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Hospice & Palliative Care (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

This invention provides a method of detection of cancer in a subject by detecting altered genomic imprinting and a method determining the long term prognosis of a subject diagnosed with cancer, using the differential methylation state of a specific nucleotide sequence to predict the long term prognosis.

Description

Diagnostic Method
This invention relates to a diagnostic method, to a nucleotide sequence comprising a Wilms' tumour suppressor gene (WTl) antisense regulatory region, and to a method of disease detection and prognosis based on the methylation state of the regulatory region.
Wilms' tumour (WT) is a childhood embryonal kidney tumour arising from the malignant transformation of renal stem cells. WT occurs in about 1 in 10,000 children, making it one of the commonest solid childhood tumours.
The human WTl gene resides on chromosome l lpl3 (Call et al, (1990) Cell 60, p 509-520; Gessler et al, (1990) Nature 343, p774-778; Call et al, (1994), US5,350,840) and is genomically organised as 10 exons spanning a 60 kilobase chromosomal region. Intragenic deletions and mutations of the tumour suppressor gene, WTl, have been detected in approximately 10% of Wilms' tumours.
During nephro genesis i.e. kidney development, WTl gene expression is controlled in a highly specific manner, increasing as metanephric mesenchymal cells progress towards immature epithelial cells, and attenuating as the cells become more phenotypically mature. The inverse correlation between WTl expression and the differentiation status of human leukaemic cells along with evidence of expression in ovary and testis and the spinal chord and brain strongly suggest that the function of the WTl gene product may be pivotal in growth and/or differentiation in a variety of cell types. The WTl protein, which includes four zinc fingers, is expressed as four isoforms arising from two alternative splice sites (I and π) in the gene. Splice II occurs within the zinc finger domain, inserting or omitting three amino-acids (KTS) between zinc fingers 3 and 4. The WTl protein without KTS amino acids (WTl -KTS) specifically binds to the EGR site consensus sequence (5'-GCGGGGGCG-3') whereas the WTl protein with KTS (WTl+KTS) does not. By binding to the early growth response gene (EGR) type site(s) in the promoter regions of genes such as insulin-like growth factor type II (IGF-II), platelet derived growth factor A (PDGF-A), colony stimulating factor- 1 (CSF-1), and epidermal growth factor receptor (EGF-R) WTl acts as a transcriptional repressor (reviewed in Hastie (1994) Ann. Rev. Genet 28, 523-558, and Menke et al (1998) Int. Rev. Cytol. 181, 151-212).
The human WTl promoter region has been characterised and found to belong to the family of TATA-less, CCAAT-less, GC-rich promoters with multiple responsive sites for the transcription factor Spl. EGR/WTl consensus sequences were also identified upstream and downstream of the major transcriptional start site (Hofmann et al, (1993) Oncogene 8, 3123-3132) and the suggestion that these sites may allow WTl autorepression was subsequently verified using transient transfection assays with the human promoter (Malik et al, (1994) FEBS Letters 349, 75-78)
WTl function is crucial in the normal development of the urogenital system, as demonstrated in WAGR (Wilms tumour, Aniridia, Genitourinary abnormalities and mental Retardation) syndrome and in Denys-Drash syndrome (DDS), diseases characterised by renal and genital abnormalities together with a predisposition to Wilms' tumour (reviewed in Coppes et al, (1993) FASEB J. 7, 886-895.)
The evidence for the involvement of WTl in non-renal tissue differentiation is accumulating. A role in haematopoiesis is suggested by the downregulation of WTl expression during chemically induced differentiation of HL60 cells (Sekiya et al, (1994) Blood 83, 1876-1882) and K562 cells (Phelan et al, (1994) Cell Growth Differ. 5, 677-686) Elevated WTl expression in leukaemic cells relative to normal haematopoeitic progenitor cells (Inoue et al, (1997) Blood 89, 1405-1412) and the detection of WTl mutations in leukaemias (King-Underwood et al, (1996) Blood 87, 2171-2179; King-Underwood and Pritchard-Jones, (1998) Blood 91, 2961-2968) strongly implicate the involvement of the WTl gene in leukaemogenesis. Altered WTl expression has also been shown in breast cancers (Silberstein et al, (1997) Proc. Natl Acad. Sci. USA 94, 8132-8137)
Furthermore, antisense WTl mRNA transcripts with no apparent open reading frames have been detected in foetal kidney and WTs, suggesting a regulatory role for these mRNAs (Campbell et al, (1994) Oncogene 9, 583-595; Eccles et al, (1994) Oncogene 9, 2059-2063). One such function of these mRNAs may be the formation of RNA heteroduplexes with sense WTl mRNA, thereby modulating the finite levels of cellular WTl protein. Previously the inventors reported the identification of an antisense WTl promoter located in intron 1 which is activated by WTl. This effect of WTl is reciprocal to that observed on the WTl promoter, suggesting that the antisense promoter activity is involved in WTl gene regulation (Malik et al, (1995) Oncogene 11, 1589-1595). In addition, it has been demonstrated that expression of ectopic exon 1 RNA can affect the cellular levels of WTl in an in vitro system (Malik et al, (1995) Oncogene 11, 1589-1595; Moorwood et al, (1998) J. Pathol 185, 352-359) , supporting a regulatory role for antisense WTl RNAs.
The WTl antisense transcript may upregulate the levels of WTl protein (Moorwood et al, (1998) J. Pathol 185, 352-359), and aberrations of the control mechanisms for antisense RNA transcription may result in inappropriate temporal and spatial expression of WTl protein, in turn contributing to tumourigenesis. In this regard, it is interesting to note that WTl can increase the tumour growth rate of adenovirus-transformed baby rat kidney cells (Menke et al, (1996) Oncogene 12, 537-546). The association between epigenetic modification of WTl antisense regulatory regions, WTl overexpression and renal tumourigenesis remains unclear, but preliminary studies have indicated that there is a correlation between hypermethylation of WTl antisense regulatory regions and low WTl protein, and the converse for hypomethylation. Interestingly, the WTl antisense promoter locus was identified as a hypermethylated sequence in human breast cancers (Huang et al, (1996) Cancer Res. 57, 1030-1034) and breast cancers have been shown to have decreased expression of WTl (Silberstein et al, (1997) Proc. Natl Acad. Sci. USA 94, 8132-8137).
The inventors have identified an antisense regulatory region (ARR) of the WTl antisense promoter, and have demonstrated that the ARR is part of a differentially methylated region. The WTl ARR characterised and utilized as the basis of the invention is structurally and functionally distinct from previously described WTl gene sequences (for example Call et al, (1994), US patent 5,350,840). In addition, the inventors have found a correlation between the levels of ARR methylation, and the pathological state of human cells, Specifically, a variety of cancer cells are shown to differ from their normal counterparts on the basis of epigenetic changes.
Accordingly, a first aspect of the invention provides a nucleotide sequence encoding a WTl antisense regulatory region comprising at least a portion of, or consisting of, the sequence shown in SEQ1, or at least a portion of a variant, due to base substitutions, deletions and/or additions, of the sequence shown in SEQ.l.
A second aspect of the invention provides a nucleotide sequence encoding a WTl antisense regulatory region comprising or consisting of the sequence shown in SEQ2, or at least a portion of a variant, due to base substitutions, deletions and/or additions, of the sequence shown in SEQ.2. The WTl antisense regulatory region may be limited to the portion of sequence shown in bold in SEQ. 2, or variants of such a sequence due to base substitutions, deletions and/or additions.
A third aspect of the invention provides a nucleotide sequence encoding a WTl antisense regulatory region negative regulatory element (NRE) comprising at least a portion of the sequence shown in SEQ.l or at least a portion of a variant, due to base substitutions, deletions, and/or additions, of the sequence shown in SEQ.l . The nucleotide sequence shown in SEQ.1 may contain several WTl antisense regulatory region negative regulatory elements.
Preferably, a nucleotide sequence according to the first, second or third aspects of the invention is a DNA or RNA sequence. Portions of any sequences are preferably functional i.e. they have a biological function of a corresponding native sequence.
A fourth aspect of the invention provides a method of disease detection, diagnosis or prognosis in a subject with cancer, using the differentially methylated state of specific nucleotide sequences, such as the nucleotide sequences in the WTl ARR region. Genomic epigenetic changes are often regional, for example affecting a variety of gene loci on chromosome l lpl5 (Feinberg (1999) Cancer Research (suppl.) 59, p 1743-1746). The inventors' identification of the chromosome 1 lpl3 region as a target for epigenetic changes by methylation therefore suggest that other DNA probes/DNA sequences from the l ip 13 region, including those derived from the l ip 13 genes reticulocalbin and PAX6, may also be utilized for detection purposes in methods according to the invention.
The specific nucleotide sequence(s) may be one or more regulatory elements preferably one or more negative regulatory elements (NRE), for example, one or more NREs within the ARR. The NRE sequence or sequences may be part of the WTl gene, or part of the chromosome l lpl3 region, such that a method of disease diagnosis and prognosis in a subject diagnosed with cancer, comprises determining the methylation state of a NRE, or an ARR, of the WTl gene or chromosome 1 lpl3 region DNA sequence in the subject, and correlating the methylation state of the NRE with the diagnosis and expected long-term recovery prognosis of the subject. For example, in the case of acute myeloid leukaemias (AMLs), hypermethylation of the NRE indicates that the subject has a positive long term recovery prognosis, and hypomethylation of the NRE indicates that the subject is predisposed to relapsing after treatment. In the case of Wilms tumours, hypermethylation of the NRE indicates that the subject has a positive long term recovery prognosis, and hypomethylation of the NRE indicates that the subject is predisposed to relapsing after treatment. In Wilms' tumours, hypomethylation is detected specifically in tumours, and in colorectal cancer cell lines, hypomethylation correlates with tumouri genie potential. However, in other cancers, hypermethylation of the specific nucleotide sequence or sequences may indicate the presence of cancer cells and/or a predisposition of the subject to relapsing after treatment, whereas hypomethylation of the specific nucleotide sequence or sequences may indicate the absence of cancer cells and/or that the subject has a positive long term recovery prognosis For example, see figure 1(e). The diagnostic application is underlined by the hypomethylation in WTs, as opposed to the hypermethylation of other renal tumours, such as primitive neuroectodermal tumour (PNET) and clear cell sarcoma of the kidney (CCSK) (see figure ID).
The methylation state may be determined by restriction of the WTl antisense regulatory region using enzymes such as ifoA 12361, Spel and Kpnl in combination. Bshl236I is an isoschizomer of Bst UI. Bshl236I cuts at the restriction sequence CGCG only when there is no CpG methylation. Methylated sequences are not restricted by 2?.sA 12361. Therefore, the restriction pattern obtained for a nucleotide sequence which has been restricted with Bshl236I gives a different band pattern depending on whether the Bshl236I sites in the nucleotide sequence are methylated or not. Other commercially available enzymes may also be used, with one or more being able to distinguish between methylated and unmethylated DNA.
The methylation state may be determined using a PCR-based assay system. Such a PCR-based assay system may involve the use of sodium-metabisulphite. This has the effect of converting all unmethylated cytosine residues to uracil residues. Preferably, the PCR reaction uses the following primers to amplify at least a portion of the WTl antisense regulatory region:
Tf : 5 '-GGGTGGAGAAGAAGGATATATTTAT-3 ' . Tr: 5'-TAAATATCAAATTAATTTCTCATCC-3'.
TfN: 5'-GATATATTTATTTATTAGTTTTGGT-3' (nested primer). TrN: 5'-AAACCCCTATAATTTACCCTCTTC-3' (nested primer).
The conditions used in the PCR reaction are the same as the conditions mentioned later in the specification. The PCR products obtained from the PCR reaction, as described below, may then be cloned and sequenced. The PCR products may be cloned into a vector such as pGEM-T (Promega). Alternatively, the PCR products may be sequenced directly. Once sequenced, any methylated cytosine residues will remain readable as 'C in the nucleotide sequence, whereas unmethylated cytosines will appear as T residues in the sequence.
The nested PCR reaction involves the following primers.
Tf : 5 ' -GGGTGGAGAAG AAGG AT ATATTT AT-3 ' . Tr: 5'-TAAATATCAAATTAATTTCTCATCC-3'.
TfN: 5'-GATATATTTATTTATTAGTTTTGGT-3' (nested primer). TrN: 5'-AAACCCCTATAATTTACCCTCTTC-3' (nested primer). A fifth aspect of the invention provides a method of cancer detection in cells derived from a subject comprising detection of tumour-specific alteration of genomic imprinting. Any bi-allelic expression of tumour-specific genes may indicate the presence of tumourgenic cell proliferation if the normal tissue expresses the gene monoallelically. Alternatively, with some cancers, the normal tissue may be biallelic, and the cancer monoallelic. Additionally, methylation changes may be accompanied by changes in gene expression through silencing or enhanced gene expression, irrespective of allelic contributions to gene dosage (reviewed in Jones (1996), Cancer Research 56, p2463-2467)
The tumour-specific alteration of genomic imprinting may be detected by reverse transcription PCR (RT-PCR). This allows relatively fast detection of altered genomic imprinting by visual analysis of the RT-PCR products on an electrophoretic gel.
The method may be used in the detection of WT in a subject, and may detect alteration of genomic imprinting of WT-specific genes such as the WT-1 gene.
The altered genomic imprinting detected may be relaxation of genomic imprinting, loss of imprinting, or gain of imprinting.
The RT-PCR may use two primers designed to anneal to a tumour-specific gene sequence on opposite sides of an allelic polymophism which introduces a restriction-site in one allele only. For example, in the case of WT, the RT-PCR may use the following primers:
Primer 1 : WTl 8 [CTTAGCACTTTCTTCTTGGC] Primer 2: WITKBF2 [TTGCTCAGTGATTGACCAGG]
A sixth aspect of the invention provides a method of treating a subject with a specific cancer, comprising altering the genomic imprinting of a tumour-specific gene. This may involve relaxation of the genomic imprinting, or reversal of relaxed genomic imprinting.
A seventh aspect of the invention provides a diagnostic kit, assay or monitoring method using a method according to a fifth aspect of the invention. An eighth aspect of the invention provides a method of detection of the methylation state of a WTl antisense regulatory region comprising detection of a tumour-specific alteration in genomic imprinting using a method according to a preceding aspect of the invention, and correlating a detected alteration in genomic imprinting with differential methylation of the WTl antisense regulatory region. For example, relaxation of genomic imprinting may be correlated with hypomethylation of the WTl antisense regulatory region.
Nucleotide sequences, and methods of disease diagnosis, detection and prognosis in accordance with the invention will now be described, by way of example only, with reference to accompanying Figures 1(A) to 3(B), and SEQ.l to SEQ. 3 in which;
Figure 1(A) shows the probe used for the detection of methylation for Southern blotting; and
Figure 1(B) shows a Southern blot of three acute myelogenous leukaemia (AML) DNAs and a normal peripheral blood lymphocyte DNA; and
Figure 1(C) shows a Southern blot of DNAs from a non-tumourogenic and a highly- tumourgenic colorectal cell line; and
Figure 1(D) shows a Southern blot of matched normal kidney and WT samples, matched normal kidney and PNET or CCSK DNAs and a foetal kidney control; and
Figure 1(E) shows Southern blot analysis of breast tumour DNAs for changes in the ARR methylation status.
Figure 2 shows the nucleotide sequence of a WTl ARR, with the primer hybridisation sites indicated by arrows; and
Figure 3(A) is a schematic diagram showing the primers on either side of the antisense
WTl RNA splice used for RT-PCR; and
Figure 3(B) shows a southern blot of the antisense WTl RNA RT-PCR products; and
SEQ.l shows a nucleotide sequence of the WTl ARR; and
SEQ.2 shows a nucleotide sequence of a negative regulatory element of a gene encoding
WT-1; and
SEQ.3 shows the nucleotide sequence of a WTl antisense region (Gessler, M & Bruns
(1993) Genomics 17: 499-501) with the RT-PCR primers shown as arrows and the exonic sequences indicated in bold. 1. Cloning and characterisation of WTl genomic sequences
The WTl cDNA and WTl promoter region were cloned from a human foetal kidney cDNA library (Clontech) and a human B-cell genomic library (λSha2001, kindly supplied by T. H. Rabbitts, Medical Research Council, Cambridge) respectively. For each library, Plaque screen filters (Du Pont) were prepared in situfrom 1 x 106phage (Benton, W. D. and Davis, R. W. (1977). Science, 196, 180-182). Filters were hybridized in 6x SSC (lx SSC = 0.15 M NaCl, 0.015 M sodium citrate), 5x Denhardts solution, 0.5% SDS and 100 μg/ml salmon sperm DNA at 65°C. Washing was performed at high stringency (O.lx SSC, 0.5% SDS, 65°C). For the cDNA library, a partial WTl cDNA obtained by PCR amplification was used as probe. The DNA sequence of a full-length cDNA isolated from the cDNA library was determined by the dideoxy chain terminator method (Sanger, F., et al (1977). Proc. Natl Sci. USA, 74, 5463-5467), and a 700 bp fragment from the 5' terminus of the cDNA was used for probing the genomic library. Probes were radiolabelled with [α-32P]dCTP (Amersham) according to the random primer method (Feinberg, A. P. and Vogelstein, B. (1983). Biochem. Biophys. Res. Commun., Ill, 47-54).
Genomic clones corresponding to the 5 '-end of the WTl gene were subcloned and characterised by restriction analysis according to standard methodology (Sambrook, J., et al (1989). Molecular Cloning, Vols 1 and 2, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y.). DNA sequences were determined by the dideoxy chain terminator method (Sanger, F., et al (1977). Proc. Natl Acad. Sci. USA, 74, 5463-5467) and by Δtaq cycle-sequencing according to the manufacturers instructions (USB- Amersham). The functional assessment of DNA from intron 1 of the WTl gene was carried out by transient transfection of reporter gene constructs with various WTl intronic sequences directing gene expression (Malik, K., et al (1995) Oncogene, 11, 1589-1595).
2. Differential Methylation assays
Human genomic DNAs are purified by standard phenol-chloroform extraction procedures (Sambrook, J., et al (1989). Molecular Cloning, Vols 1 and 2, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). Based on the DNA sequence of the intronic region (see Figure 2), digestion by restriction enzyme Bshl236I (MBI Fermentas) has been selected to examine methylation of the intronic region. This enzyme cuts at the restriction sequence CGCG only when there is no CpG methylation; methylated sequences are not restricted. Our work has established that differential methylation is conveniently detected within a Kpnl - Spel (New England Biolabs) fragment of 850 bp, which contains 4 potential Bshl236I sites (see Figure 1) . Depending on whether these sites are methylated or unmethylated, a characteristic banding pattern is observed after digestion of genomic DNAs with a combination of Kpnl, Spel, and Bshl236I, Southern blotting and hybridisation with a radiolabelled DNA probe (Sambrook, J., et al (1989). Molecular Cloning, Vols 1 and 2, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y.) defined by the Kpnl and Spel sites in the intronic sequence (Figures 1 and 2).
Figure 1(D) shows a Southern blot of matched normal kidney and Wilms' tumour samples. All WT samples were confirmed as having no loss of heterozygosity. Also shown are matched normal kidney and PNET or CCSK DNAs.
As shown in Figure 1 (D), the pattern of differential methylation successfully distinguishes between normal kidney DNA and Wilms' tumour DNA (panel A), leukaemic cells from patients with varying prognosis and normal lymphocytes (panel B) and also highly tumourigenic and non-tumourigenic colonic cell-lines (panel C). The results shown in panel C suggest that this change may be associated with the tumourigenic process and may therefore be relevant to cancers other than only Wilms' tumour.
In Wilms' tumours, hypomethylation of specific nucleotide sequences correlates with the tumour state. However, in other cancers, this correlation may be inverted, such that hypermethylation of specific nucleotide sequences corresponds to the methylation status of tumour cells, and hypomethylation may indicate normal cells. An example of this is shown in figure 1(E) , with Southern blot analysis of normal breast tissue DNA and breast tumour DNAs for changes in the ARR methylation status. Four infiltrating ductal carcinomas of varying aggressiveness all showed increased methylation of the WTl ARR compared to the normal breast tumour DNA. Therefore the relative differential methylation comparing normal tissue and tumour tissue may be utilised diagnostically. 3. PCR-based assay system
Tumour cells and normal cells may be distinguished by their epigenotype as previously outlined. Knowledge of the DNA sequence of the WTl antisense regulatory region has made it possible to develop a PCR-based assay system to allow the determination of the methylation status of samples, which will require less biological material. This method involves introducing CpG dinucleotides which are not part of a restriction enzyme recognition sequence by treatment of genomic DNA samples with sodium-metabisulphite (Merck), thereby converting all unmethylated cytosine residues to uracil (Paulin, R., et al (1998) Nucleic Acids Research 8, 4777-4790). Specific regions of interest in the WTl intronic sequence can then be amplified using primers specific for both strands of DNA. The PCR bands obtained can be directly sequenced or cloned using a commercially available vector such as pGEM-T (Promega) and analysed by DNA sequencing. Any methylated cytosine residues will remain readable as 'C in the DNA sequence, whereas unmethylated cytosines will appear as 'T'.
Alternatively, after the first round of PCR on bisulphite-treated DNA, nested primers which include one specific for the methylated Bshl236I site shown to be commonly differentially methylated (boxed in Figure 2), or one specific for the unmethylated Bsh 12361 site (i.e. specific for C— » conversion) may be employed, permitting discrimination between methylated and non-methylated sequences by visualisation of the PCR products, i.e. if a primer specific for the methylated Bsh 12361 site is used, a PCR product will only be observed if the Bsh 12361 site in the sample is methylated, otherwise, no PCR amplification will occur.
Illustrative primers which may be used for methylation-specific PCR are shown below, and their hybridisation positions to the WTl sequence are shown by arrows in Figure 2 for top-strand amplification. Allowing for C— »T conversion, these are:
Tf: 5'-GGGTGGAGAAGAAGGATATATTTAT-3 '.
Tr: 5'-TAAATATCAAATTAATTTCTCATCC-3'.
TfN: 5'-GATATATTTATTTATTAGTTTTGGT-3' (nested primer). TrN: 5'-AAACCCCTATAATTTACCCTCTTC-3' (nested primer).
Typical primary amplifications are conducted with Amplitaq (Perkin-Elmer) with 100 ng. of bisulphite-treated DNA in buffer supplemented with 3mM MgCI2. Amplification conditions are 3 mins. denaturation at 94°C, followed by 35 cycles of denaturation at 94°C for 30 sees, annealing at 50°C for 30 sees, and extension at 72°C for 90 sees. A final extension of 5 mins at 72°C completes the reaction. Secondary PCR with the nested primers employs the same conditions, but using l/lOO"1 of the primary PCR reaction and 24 cycles.
4. Correlation of the methylation state of the (NRE) with long term disease prognosis
The inventors have detected a correlation between the methylation state of the ARR and the diagnosis and long term disease prognosis in subjects with cancer. The diagnostic potential is shown by the hypomethylation in WTs, as opposed to the hypermethylation of other renal tumours, such as primitive neuroectodermal tumour (PNET) and clear cell sarcoma of the kidney (CCSK) (see figure ID). AML subjects with hypermethylated ARR, responded well to treatment and made a full recovery. However, subjects who had an unmethylated NRE, and relapsed, were refractory to treatment.
Therefore, the methylation state of the NRE can be used as a potential early indicator of the long term diseased prognosis. Subjects who have an unmethylated NRE can be kept under closer observation for early detection of relapse. This will maximise their chances for recovery. However, the expense of such close observation post-treatment is not necessary with subjects with unmethylated NRE, as these patients are expected to respond well to treatment once any relapse has been detected by normal routine checking.
In pilot studies with AMLs, hypermethylation of specific nucleotide sequences corresponds to a predicted positive long term prognosis of the subject with the AML, and hypomethylation corresponds to a predisposition of the subject to relapsing after treatment. However, in other cancers, this correlation may be inverted, such that hypermethylation of specific nucleotide sequences corresponds with a predisposition to relapsing after treatment, and hypomethylation may indicate a positive long term prognosis for recovery. Therefore, decisions on the best methods of therapy to suit the subject can be made in the light of an educated expectation of how the subject is expected to respond to treatment in the event of a relapse of their cancer condition.
Therefore, it is the differential methylation that is the determinant in developing long term prognosis for subjects diagnosed with cancer.
5. Genomic imprinting of the WTl gene
The WTl allele specific methylation pattern observed in normal kidney cells strongly indicates that there is genomic imprinting of the WTl ARR/NRE (Antisense Regulatory Region/Negative Regulatory Region) and tumour-specific relaxation of genomic imprinting in Wilms' tumours.
Genomic imprinting is the phenomenon by which maternal or paternal copies of a gene can be selectively expressed, with methylation of DNA serving as the regulatory signal. Loss of such a signal can lead to an altered dosage of gene expression that can be deleterious to normal cell growth. For example, the IGF2 gene exhibits loss of genomic imprinting control of IGF2 and is overexpressed in WTs (Feinberg, A. P. (1999) Cancer Res. (suppl), 59: 1743s- 1746s). As IGF2 is a growth factor, this may easily contribute to uncontrolled proliferation associated with tumourigenesis.
In order to determine whether the differential methylation of the WTl ARR/NRE is accompanied by allele specific expression of the WTl antisense RNA (WT1-AS), reverse transcription-PCR (RT-PCR) analysis was conducted on foetal and normal kidney cells, and WT cells. Primers either side of the antisense WTl RNA splice (see SEQ3 and Figure 3A) (Gessler, M., and Bruns (1993), Genomics, 17: 499-501, 1993) were used for RT-PCR:
Primer 1 : WTl 8 [CTTAGCACTTTCTTCTTGGC]
Primer 2: WITKBF2 [TTGCTCAGTGATTGACCAGG].
Typical reaction conditions used for the RT-PCR were annealing of the reverse primer to 1 μg of total RNA by heating to 60°C for 5 mins, followed by quenching on ice, followed by reverse transcription carried out with Super RT (HT Biotechnologies, Cambridge, U.K.) reverse transcriptase at 50°C for 60 mins. This was followed by PCR cycling as follows:
95°C, 3 mins. (1 cycle);
94°C, 15 sees., 60°C, 30 sees., 72°C, 60 sees. (2 cycles);
94°C, 15 sees., 58°C, 30 sees., 72°C, 60 sees. (2 cycles);
94°C, 15 sees., 56°C, 30 sees., 72°C, 60 sees. (10 cycles, 20 for antisense product); and
94°C, 15 sees., 56°C, 30 sees., 72°C, 60 secs.with 20 sees, extension per cycle (20 cycles).
The PCR products obtained were digested by adding the restriction enzyme Mnll directly to the PCR mix and incubating for 60 minutes at 37°C. The PCR products were then separated on 2% agarose gels and then alkali blotted onto Hybond N+ membrane and hybridised with a 32P-labelled antisense cDNA probe. The sequence of the probe is shown in bold between WTl 8 and WITKBP2 in SEQ. 3. The following primers were used as DNA controls:
Primer 1 : WITKBF2 [TTGCTCAGTGATTGACCAGG] Primer 2: WITKBR2 [TTGGCTGGAAAGCTTGCAGC]
The Mnll polymorphism (Grubb, G. R. et al (1995) Oncogene, 10: 1677-1681) utilised is marked by an asterisk in figure 3 A, and results in RT-PCR products of 286 and 222bp for biallelic expression, or alternatively major allelic bands of 286bp or 222bp for monoallelic expression.
As shown in figure 2B, expression of WTl -AS in normal kidney samples that have one methylated and one unmethylated allele, only occurs from one allele, confirming genomic imprinting. However, WTs display biallelic expression of WTl -AS, thus revealing a relaxation of imprinting control in WTs. The net increase arising from expression of both WTl -AS alleles may thus serve as an additional marker of the differential methylation pattern detected in Wilms' tumours.
This altered imprinting is likely to be present in cancers other than WT, and therefore, altered imprinting control of specific genes may provide a marker for the detection or diagnosis of various cancer types in a patient. Furthermore, as epigenetic modifications of DNA are reversible, detection of altered imprinting control and/or the diagnosis of methylation changes should also facilitate therapeutic strategies based on enzymes such as DNA methyltransferases and demethylases, or by chemical compounds (Jones P. A. and Laird P.W. (1999), Nature Genetics, 21, pl63-167). This would enable control of gene expression and permit therapies that are contingent on appropriate gene control. SEQ.l
CTCGAGGATCCAGAGACGGCCTTGATCCTCTCCCCTGGGGTTTGGCCTTGGCGCTCTGAT GGCCATTTCCACATTTTTGAGAGTTGATGCCCTTGCCTCTCACAGCCCAAGTCTTGGGCC AGGCCCTGCATTCCTGGGGAAGCAGCAGGAACCCTGGAAATCCAAAGAATAAACCCAGAA TCTCGAGGGCCACCCTTGCCCACTCCAGGATAGCAGCCGGAGCGCTTCTCACATCCAAGC TGCCCAATGAGCCTCAAGGGCTGGGTAAGATGGACCCATCTGTTTTCACTGCAAGACAAA ACTTAAACCTGGAGATGGTGCTTCCAGGCTATATGACTTGAATCTAGGGCCCTCTCTCCA TTGGGCTTTTTCTCCAGGGTGGAGAAGAAGGATACATTCACCTACTAGTCCTGGTCCCCT TTTAACTTTTTCTCCATGGCAGCCACGCCTGTATATTACAGAAGAATCCAGATATTTTCC AGAAGTGTAATACCTGCTGGCTGCAAAACCCACAGTCCCACCCCCCACGACATGTGATAA GATCCCAGGCACCAGACCTGCCCTGAAAAGGGCTGGACAAGGGACCCAAACGAAGCGACA GAACCCAGGTTTCAAAAATCCCCTAGAAGTACTAAAAAGATAATGGCGTAGTAGTATTTT GTGCCCCAGGGGCATGGATTCGATGGTTTCTCAACCGCCTCCAAATAGCACACATGCAGA CAGTGCTCTCGGATTCATTGTTTCTCAGTCACAGATGTTTAGATGGGTTGCCGAGTTCCA TATTTAAAGCCCCAAGAGGGTGGTGGGTAGCGCTTCTGCATCTATGGAGTATAACTTCAA GCCGGACCCAATCTCCAGGTTGCCCATCTCAGCTGTCCTCTTATAGACGGGGACACTGAG ACCTAGAAACTCCCCAAAAGTAACACCAGCCTGCTAAACAAAGGTGGCGCGATCTGATCA AAGAACACAAGCCTCAGCGATTAGTAAGTTGTCCAACGCCCCTTGAGTAGAAACACTAAT TTACTAACTAAAAGCATAGAGTGGAGGCTTCCCTTGGGTCTGCTTGCGGTTCCTCCACAG GACAGTGATCCCAGATTCTCCCGAAGAAAAGGGCGGTTTCGATTTCTCCAAGGCTTCGCG GGGGCCGGGTGCTCCTGGTTAAACTAAGGTAGGAGCGGCCTGAAGACGCGCGTTTAGAAG GCGCCGGGTGAAGGCGGGCAACAAGGCAGAGCCCTTCTCCCGAGCCTTGGGCGAAGGTAC CTCCTGCAAAAGATACACTCTGCTTCCCACGCATTCCAAAAACATCCCGGTCCCTAGGCC CTCGAGTAATTTTGCTCCAGGAAAAGCATCCGCCATTGTATTAGTAAAGCGTTTACTAAA TTACCGAATCAAACCGAACTGGCTTAGGTTCTCAATAGCGTGGAAATCCACTGAAAATAA ATGAAGAGGGCAAACTACAGGGGCTCCGCAGGTTCGGGTCCGCGCCGCCCAGGCGAAAGA GAGGTGGGCGGGCATCGGCGCGGGATGAGAAACCAACCTGATACTTATCGTGTGCCGAGT TCCCTCCTTGTATCCTGACTAAGCACAGCGAATAACCCTGTCCTTGTTCTAACCCCAGGT CTTGAAGAAATACTGTCCCAGCTGAGCCCCGCGTTTACAAGATGAAGAGGCGCCCCAGAT GCGCTGAAAGAAAGGCCAAAGCTCGTGCCTCCTTCCACTGCCTGCGGTAGAACCTGGTCC CGCATAGCTTGGAATCGGATAAGTCAAGTTCTCTTCCATCCCCAGAACCTGCGTGGCCGC CGCCTGAGCGAAGCCCAGTGAAGATCCACTTCTGTATTACCATACGGGGG
SEQ.2
TTCTGCATCTATGGAGTATAACTTCAA GCCGGACCCAATCTCCAGGTTGCCCATCTCAGCTGTCCTCTTATAGACGGGGACACTGAG ACCTAGAAACTCCCCAAAAGTAACACCAGCCTGCTAAACAAAGGTGGCGCGATCTGATCA AAGAACACAAGCCTCAGCGATTAGTAAGTTGTCCAACGCCCCTTGAGTAGAAACACTAAT TTACTAACTAAAAGCATAGAGTGGAGGCTTCCCTTGGGTCTGCTTGCGGTTCCTCCACAG GACAGTGATC
SEQ.3
1 TTCCTGTCGG GTCCCTGGGG TCCTCCGACT GCGGCTCCTC AGCTTAGCAC
51 TTTCTTCTTG GCCCCGCAGG CTGCAGGGAA CTCCTCCCAC CTCTTTAGTC ►
WT18
101 GGAGAAGTCC AAGTCGGGCG AGGGGGCACC CCGGGGTTCG CACCGGTGCT
151 CTTCCCCTCC CCGCCCCCAC AAGGATTCTG AGAAAATAAA TGGCAGAGGA
201 GAGAGGAGTT CTACATTTGC TTGGCTCTCC TTTCCTCCTA TCCACCCCTA
251 CATCCCTCAC CCCGGN CAA AAACTTATTT TTGAAAAATG TTGGCAGAGA
301 TTTACGTGTC TTTGCCTTAC CTGGGTTTCA CAAACACAAC GACTCACATT
351 CAAGCCAGCC TCCCTTCAGA TAACCTCCTC TCCCCCCGCT AAAAGTGCCA
401 AGGATGGTAA AAGAAGAAAC AATCTCAATC TTTTCGTTTG GAAATGAAAG
451 TCCCCGGCTT TTCATAAAGG GCTCCTCGCC CCTCACAGTT GAGTCCTAGT
501 TAAGAAAAAC GACTTCCAAG TAGAAATAAT AGGCGGGGAG AAGGAAGGGA
551 GATACAGGGA TCTGGGGNGT TCTTAGGGCA ACTGGCAGTG AATTTTGTCT
601 CGAGAGTCCT TTCTCCACTC AAAAAACCAA ACGCGCGAGC CCCGCGAAAG
651 GTTTAGGGAT AGATCGTGTG GGAGAGGACT GAGCAGAGAG CGTGGGGGCA
701 GTGTCTTGTA GAATCTTTCT TTTCTTAATA ATAATTTTAA AAGCTTCTGA
751 GTGGAGACGA CGCAAAGTCA AGCAGCAAAG GTGGCCTGGG AGGCAAGCGG
801 AGGGCTCAAG TGCCGCATCT TTACCCTCAG GGTCTCCTGC GCCTACGGGA
851 TGCGCATTCC CAAGAAGTGC GCCCTTCGAG TAAGTCCTGG GCCCGCACAC
901 ACTTCGGGTC CGCAGCCAGA ATTTAATGGC GACAACGTTT ATGCAATGCA
951 AGCTAAAAAC CAAAGCGTAA AAAATTACTA TGTCATTTAT TGAAACGCCA
1001 TTCTTTGTCA AACTGCAACT ACTTTGCTTC ACATAAGTTT GGCTGGAAAG
1051 CTTGCAGCCC CAGCCCGGGC CAGCCAGGTA CAGGAGGCCG GACTGCAACC
1101 GGTTGCTTCC CTCCCGTCGC GCCTGGCCGT CCCACGCTGC GCCGTCGCTG
1151 CTGCCTCCTG GCGCCCCTGG GATTTTATAC GCACCTCTGA AAC ACGCTCC
1201 GCTCCGGCCC CCGGTTCTTC TCCTTGCCTA GGGGTTGTTT CCCAATAGAT
1251 ACTGACTCCT TTAGAAGATC CAAAAACCAA ACCAAAACAC CCCCTACCCG 1301 CCCCAAACAC CTGCTCTGGG GCGCGGGGGCO TGCCAAACAG AGACTAGACG
1351 AAGGGAGTCA GATTTAGCGA AGCTCTTCGA GCTCCCAAAG ATTCGAACAC 1401 TAACTCGCGC CCGTGGGCCG ATGGAGGTTC TCCCTACTCC ACTCCTTGGT
1451 CCCCTTAACT GGCTTCCGCC TCCTGGTCAA TCACTGAGCA ACCAGAATGG
<
WITKBF2
1501 TATCCTCGAC CAGGGCCACA GGCAGTGCTC GGCGGAGTGG CTCCAGGAGT 1551 TACCCGCTCC CTGCCGGGCT TCGTATCCAA ACCCTCCCCT TCACCCCTCC 1601 TCCCCAAACT GGGCGCCAGG

Claims

Claims
1. A nucleotide sequence encoding a WTl antisense regulatory region comprising at least a portion of the sequence shown in SEQ.1 or at least a portion of a variant, due to base substitutions, deletions, and or additions, of the sequence shown in SEQ.l.
2. A nucleotide sequence according to claim 1 which encodes a WTl antisense regulatory region negative regulatory element (NRE).
3. A WTl antisense regulatory region negative regulatory element (NRE) comprising at least a portion of the nucleotide sequence shown in SEQ.2 or at least a portion of a variant, due to base substitutions, deletions, and/or additions, of the sequence shown in SEQ.2.
4. A WTl antisense regulatory region NRE according to claim 3 wherein the NRE comprises the sequence shown in bold in SEQ. 2, or variants of such a sequence due to base substitutions, deletions and/or additions.
5. A nucleotide sequence or NRE according to any preceding claim wherein the nucleotide sequence is a DNA sequence.
6. An RNA sequence encoded by a nucleotide sequence according to any preceding claim.
7. A method of disease diagnosis and prognosis in a subject diagnosed with a Wilms' tumour cancer, the method comprising determining the differentially methylated state of a specific nucleotide sequence or sequences in the subject, or in a sample derived from the subject.
8. A method according to claim 7 wherein the specific nucleotide sequence or sequences form part of the WTl antisense regulatory region (ARR).
9. A method according to claim 7 or claim 8, comprising determining the methylation state of a negative regulatory element (NRE) or an ARR of a WTl gene in a sample isolated from the subject, and correlating the methylation state of the NRE or ARR with the diagnosis and expected long-term recovery prognosis of the subject.
10. A method according to claim 9 wherein hypermethylation of the NRE or ARR indicates that the subject has a positive long term recovery prognosis, and hypomethylation of the NRE or ARR indicating that the subject is predisposed to relapsing after treatment.
11. A method according to claim 7 or 8, wherein hypomethylation of the specific nucleotide sequence or sequences indicates that the subject has a positive long term recovery prognosis, and hypermethylation of the specific nucleotide sequence or sequences indicates that the subject is predisposed to relapsing after treatment.
12. A method according to any one claims 7 to 11 wherein the NRE is a nucleotide sequence according to any one of claims 1 to 6.
13. A method according to any one of claims 7 to 12 wherein the methylation state is detected by restriction digest analysis.
14. A method according to claim 13 wherein at least enzyme Bshl236I is used to restrict the NRE.
15. A method according to any one of claims 7 to 12 wherein the methylation state is detected using a PCR-based assay system.
16. A method according to claim 15 wherein the PCR assay system uses at least one of the following primers to amplify a region of nucleotide sequence:
Tf: 5 '-GGGTGGAGAAGAAGGATATATTTAT-3 ' . Tr: 5'-TAAATATCAAATTAATTTCTCATCC-3'. TfN: 5'-GATATATTTATTTATTAGTTTTGGT-3' (nested primer). TrN: 5'-AAACCCCTATAATTTACCCTCTTC-3' (nested primer).
17. A method according to claim 16 wherein the amplified nucleotide sequence is cloned and sequenced.
18. A probe comprising a nucleotide sequence according to any one of claims 1 to 6.
19. A diagnostic kit, assay, or monitoring method using a nucleotide sequence according to any one of claims 1 to 6 or a probe according to claim 18.
20. A diagnostic kit, assay, or monitoring method using a method according to any one of claims 7 to 17.
21. A method of cancer detection in a subject or in a sample isolated from the subject comprising detection of the methylation state of a specific nucleotide sequence or sequences.
22. A method according to claim 21 comprising correlating the methylation state of the specific nucleotide sequence or sequences with the presence or absence or cancer cells in the subject.
23. A method according to claim 22 wherein hypomethylation of the specific nucleotide sequence or sequences indicates the presence of cancer cells in the subject.
24. A method of cancer detection in cells derived from a subject comprising detection of tumour-specific alteration of genomic imprinting.
25. A method according to claim 24 comprising the detection of tumour-specific relaxation of genomic imprinting by determining the methylation state of a specific nucleotide sequence.
26. A method according to claim 24 or claim 25 wherein the tumour-specific alteration of genomic imprinting is detected by reverse transcription-PCR (RT-PCR).
27. A method according to any one of claims 24 to 26 wherein the cancer is Wilms' Tumour (WT).
28. A method according to claim 27 comprising detection of the relaxation of genomic imprinting of the antisense WT-1 RNA sequence.
29. A method according to claim 28 wherein the RT-PCR uses two primers, designed to anneal to the tumour-specific gene sequence on opposite sides of an allelic polymorphism which introduces a restriction site in one allele only.
30. A method according to claim 29 wherein the RT-PCR uses the following primer pair
Primer 1 : WTl 8 CTTAGCACTTTCTTCTTGGC Primer 2: WITKBF2 TTGCTCAGTGATTGACCAGG.
31. A method of treating a subject with a specific cancer comprising altering the genomic imprinting of a tumour-specific gene.
32. A method according to claim 31 wherein the genomic imprinting of a tumour-specific gene is altered by altering the methylation state of a specific nucleotide sequence.
33. A method according to claim 31 or claim 32 wherein the genomic imprinting is altered to relax the genomic imprinting of the tumour-specific gene.
34. A method according to claim 31 or claim 32 wherein the genomic imprinting is altered to reverse the relaxation of the genomic imprinting of the tumour-specific gene.
35. A diagnostic kit, assay or a monitoring method using a method according to any one of claims 24 to 30.
36. A method of detection of the methylation state of a WTl antisense regulatory region comprising detection of a tumour-specific alteration of genomic imprinting using a method according to any one of claims 21 to 30 and correlating adetected alteration in relaxed genomic imprinting with differential methylation of the WTl antisense regulatory region.
37. A method according to claim 36 wherein the alteration in genomic imprinting is a relaxation in genomic imprinting.
38. Method of treatment comprising selecting a particular course of therapy on the basis of the results of a method according to any preceding claim.
EP20000946122 1999-07-15 2000-07-17 Diagnostic method comprising wt1 sequences Withdrawn EP1200623A2 (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
GB9916669 1999-07-15
GBGB9916669.6A GB9916669D0 (en) 1999-07-15 1999-07-15 Diagnostic method
GB9926293 1999-11-05
GBGB9926293.3A GB9926293D0 (en) 1999-11-05 1999-11-05 Diagnostic method
PCT/GB2000/002741 WO2001006005A2 (en) 1999-07-15 2000-07-17 Diagnostic method comprising wt1 sequences

Publications (1)

Publication Number Publication Date
EP1200623A2 true EP1200623A2 (en) 2002-05-02

Family

ID=26315771

Family Applications (1)

Application Number Title Priority Date Filing Date
EP20000946122 Withdrawn EP1200623A2 (en) 1999-07-15 2000-07-17 Diagnostic method comprising wt1 sequences

Country Status (4)

Country Link
EP (1) EP1200623A2 (en)
JP (1) JP2003505035A (en)
AU (1) AU6000600A (en)
WO (1) WO2001006005A2 (en)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7214485B2 (en) 2000-08-25 2007-05-08 Lovelace Respiratory Research Institute Nested methylation-specific polymerase chain reaction cancer detection method
US20030211522A1 (en) * 2002-01-18 2003-11-13 Landes Gregory M. Methods for fetal DNA detection and allele quantitation
GB0209776D0 (en) * 2002-04-29 2002-06-05 Univ Bristol Diagnostic method
FR2854903A1 (en) * 2003-05-13 2004-11-19 Centre Nat Rech Scient USE OF LOCI BAGE (B MELANOMA ANTIGENS) AS TUMOR MARKERS
EP3194624B1 (en) 2014-09-15 2022-02-16 Garvan Institute of Medical Research Methods for diagnosis, prognosis and monitoring of breast cancer and reagents therefor

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP3393867B2 (en) * 1989-11-13 2003-04-07 マサチユーセツツ・インステイテユート・オブ・テクノロジー Localization and characterization of the Wilms oncogene
AU8381698A (en) * 1997-07-03 1999-01-25 Case Western Reserve University Compositions and methods for detection of genomic imprinting disorders

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0106005A2 *

Also Published As

Publication number Publication date
WO2001006005A3 (en) 2001-05-25
JP2003505035A (en) 2003-02-12
WO2001006005A2 (en) 2001-01-25
AU6000600A (en) 2001-02-05

Similar Documents

Publication Publication Date Title
Wong et al. Tissue factor pathway inhibitor‐2 as a frequently silenced tumor suppressor gene in hepatocellular carcinoma
Yamada et al. Detailed characterization of a homozygously deleted region corresponding to a candidate tumor suppressor locus at 21q11‐21 in human lung cancer
Lindqvist et al. DNA methylation pattern of the SLC25A43 gene in breast cancer
CA2810039A1 (en) Compositions and methods for detecting cancer metastasis
Troen et al. Cloning and expression of the gene for the major excreted protein of transformed mouse fibroblasts. A secreted lysosomal protease regulated by transformation.
JP2012501164A5 (en)
Rivenbark et al. DNA methylation-dependent silencing of CST6 in human breast cancer cell lines
Kang et al. Genetic integrity of transforming growth factor β (TGF‐β) receptors in cervical carcinoma cell lines: loss of growth sensitivity but conserved transcriptional response to TGF‐β
US20120207755A1 (en) Cancer
Gao et al. Semaphorin-3F functions as a tumor suppressor in colorectal cancer due to regulation by DNA methylation
Eriksson et al. Methylation changes in the human IGF2 p3 promoter parallel IGF2 expression in the primary tumor, established cell line, and xenograft of a human hepatoblastoma
Nikbakht et al. Aberrant promoter hypermethylation of selected apoptotic genes in childhood acute lymphoblastic leukemia among North Indian population
EP1200623A2 (en) Diagnostic method comprising wt1 sequences
Li et al. Molecular cloning and characterization of LCRG1, a novel gene localized to the tumor suppressor locus D17S800–D17S930
Park et al. DNA variants of DLC-1, a candidate tumor suppressor gene in human hepatocellular carcinoma
Manderson et al. Molecular genetic analysis of a cell adhesion molecule with homology to L1CAM, contactin 6, and contactin 4 candidate chromosome 3p26pter tumor suppressor genes in ovarian cancer
Cigognini et al. HIC gene, a candidate suppressor gene within a minimal region of loss at 7q31. 1 in myeloid neoplasms
WO1995032223A1 (en) cDNA CLONING OF POTENTIALLY TRANSFORMING HUMAN ras-RELATED ONCOGENES
Jung et al. Epigenetic regulation of the potential tumor suppressor gene, hLHX6. 1, in human cervical cancer
Qin et al. Methylation pattern of preferentially expressed antigen of melanoma in acute myeloid leukemia and myelodysplastic syndromes
Morioka et al. Aberrant methylation of the CHFR gene is frequently detected in non-invasive colorectal cancer
Forootan et al. Transcriptome sequencing of human breast cancer reveals aberrant intronic transcription in amplicons and dysregulation of alternative splicing with major therapeutic implications
Filip et al. Genetic mechanisms and molecular markers of neoplastic transformation in acute myeloid leukemia
KR100748185B1 (en) Anticancer composition comprising the LRCR3 gene and diagnostic method using the gene
WO2011131128A1 (en) Marker for colon cancer and method for detecting colon cancer

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020208

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

17Q First examination report despatched

Effective date: 20050412

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20070201