EP1200614A1

EP1200614A1 - Herbicide resistant transgenic plants with mutated alpha-tubulin

Info

Publication number: EP1200614A1
Application number: EP00954581A
Authority: EP
Inventors: Peter Nick; Diego Breviario
Original assignee: Albert Ludwigs Universitaet Freiburg
Current assignee: Albert Ludwigs Universitaet Freiburg
Priority date: 1999-08-03
Filing date: 2000-08-01
Publication date: 2002-05-02
Also published as: WO2001009354A1; DE19936412A1

Abstract

The invention relates to DNA constructs possessing a mutated C-terminal alpha-tubulin sequence. The invention also relates to plant cells and to plants containing said constructs. The invention further relates to methods for the production of said plants.

Description

HERBICIDE-RESISTANT TRANSGENIC PLANTS WITH MUTATED ALPHA TUBULIN

The present invention relates to DNA constructs which code for mutated tubulins, and to plants and plant cells which contain these constructs. The invention further relates to processes for the production of plants with increased herbicide resistance and altered sensitivity to cold.

The occurrence of harmful herbs, for example red rice, leersia, echinocl or the like, heteranthera in crops of useful plants such as rice, barley or rye, poses a major problem in agriculture with far-reaching economic consequences For some of these harmful herbs (especially for the infestation of rice fields with red rice) there is as yet no approach to control. So far, for example, red rice has mainly been tried to prevent the initial infection of rice fields. This is complicated by the fact that the red rice has a perfect mimicry, so that it is practically impossible to keep the seeds clean. Another approach is based on the fact that pseudo sowing is carried out, that is plowing over without sowing, so that the seeds of the red rice that persist in the soil are germinated. The germs are then killed by treatment with trichloroacetic acid. However, since the seeds of this harmful plant can survive in the soil for up to five years, this approach is not very effective, apart from the ecological burden. On average, it takes three years from the initial infection of a rice field to the complete breakdown of rice cultivation in this field. The losses are now 30% of the harvest.

When using herbicides to control harmful herbs, it would be desirable for the herbicide to selectively prevent only the harmful herbs and not the useful plants from growing. It is therefore an object of the present invention to provide a plant which is insensitive to certain herbicides, as well as starting materials and methods for producing such plants.

Various herbicides attack microtubules. Microtubules are polymers made up of heterodimers of alpha and beta tubulin. Plant microtubules play an important role in the control of plant development, for example in the control of growth, tuber formation, branching, leaf and root formation, in the formation of wood, in gravitropism and in the reaction to light, wind, pathogens and cold. Nevertheless, they have so far not used biotechnologically, although numerous tubulin genes with diverse regulatory patterns are known. The reason is essentially that there has been no possibility to manipulate the behavior of the tubulin proteins and thus the function.

A certain class of substances, the so-called dinitro-anilines, is believed to bind to the N-terminus of the tubulin. Resistance to these herbicides from the species Eleusine indica, where this resistance had occurred spontaneously, has been successfully transferred to maize (Nature 393, 1998, 260-262).

It has now surprisingly been found that another class of herbicides, the carbamate herbicides, binds to the C-terminus of plant alpha-tubulins. This causes depolymerization of the microtubules, which leads to growth inhibition.

The invention relates to transgenic plants which express alpha-tubulins whose C-terminus is modified in such a way that certain herbicides can no longer bind. The exogenous alpha-tubulin gives the microtubules of the transgenic plants increased resistance to certain herbicides.

In the context of this invention, the "C-terminus of an alpha tubulin" encompasses that C-terminal amino acid region of an alpha tubulin that can be deleted without losing the ability of the alpha tubulin to be incorporated into microtubules.

One aspect of the invention is DNA constructs which are suitable for expressing a C-terminally modified alpha tubulin in plant cells. The alpha tubulin for which the DNA sequence encoded has an N-terminal part, which is unchanged to the extent that the alpha-tubulin can still be incorporated into microtubules. The C-terminal part of the encoded alpha-tubulin has a mutation compared to the wild-type tubulin from which the DNA sequence is derived. The DNA construct according to the invention also has at least one DNA sequence which controls the expression of the alpha tubulin DNA sequence in plant cells.

The DNA construct according to the invention also contains at least one DNA sequence which codes for a resistance factor which allows the selection of transfected plant cells. Resistance factors are often proteins with enzymatic activity that can convert or break down certain compounds. Consequently, genes which code for these proteins are used as DNA sequences. DNA sequences which code for the resistance factor neomycin phosphotransferase II are preferably used. This conveys resistance to kanamycin.

This DNA sequence coding for a resistance factor is also under the control of a DNA sequence which regulates the expression of the sequence in plant cells. It is preferably a promoter which is suitable for the expression of DNA sequences in plant cells.

A special feature of the present invention is that the resistance factor can be the C-terminally modified alpha tubulin itself. Expression of the modified alpha tubulin can confer resistance to certain herbicides. It is therefore possible to select transfected cells by culturing in the presence of the herbicides.

One embodiment of the invention is therefore a DNA construct which has a DNA sequence which is for a C-terminal modified alpha-tubulin, but no additional DNA sequence that codes for a resistance factor. In this special case, the DNA sequence coding for a resistance factor is the alpha-tubulin sequence itself.

The DNA constructs according to the invention are preferably circular plasmids which encode a C-terminally mutated alpha-tubulin under the control of a promoter active in plant cells and have a resistance gene under the control of a promoter active in plant cells.

Ti plasmids which are derived from the Ti plasmid from Agrobacterium tumefaciens and are suitable for the production of transgenic plants are also conceivable. However, they can also be "naked" DNA constructs or constructs with viral components.

The DNA construct according to the invention is at least partially produced in vitro. This means that at least one step in the production of the DNA construct took place outside of a plant cell. As a result, the DNA constructs according to the invention differ from naturally occurring sequences. The DNA sequence coding for the alpha tubulin can either have been isolated from a gene library, but it can also be produced by polymerase chain reaction (PCR) or by chemical synthesis. A combination of these methods is also conceivable. As a rule, the alpha-tubulin sequence is cloned into the "multiple cloning site" of an expression vector which is suitable for the expression of DNA sequences in plant cells.

The C-terminal mutation of the alp a-tubulin gene can be obtained in different ways. For example, part of an alpha tubulin that already has the corresponding one Mutation carries, be cloned into the desired alpha tubule gene. The mutated starting sequence can originate, for example, from a herbicide-resistant plant line in which the alpha-tubulin gene has been isolated and sequenced and a corresponding mutation has been found. However, the mutation is preferably introduced by in vitro mutagenesis. Point mutations are specifically introduced into the DNA of the alpha tubulin gene. Suitable methods for this can be based on the PCR technique. The alpha-tubulin DNA sequence into which the mutation is to be introduced is used as the template. The PCR primers carry a corresponding base exchange with respect to the template sequence. The mutation is also amplified via the primers.

Preferably, the C-terminal mutation of the alpha-tubulin is at an amino acid position that is within the amino acid range that corresponds to the amino acid positions 414 to 451 of the alpha-tubulin TUBA1 from rice. Most preferably, however, the C-terminal mutation of the alpha-tubulin is located at an amino acid position which lies within the 15 C-terminal amino acids of the corresponding wild-type alpha-tubulin from which the DNA sequence is derived.

The mutations can be of different types. At the DNA level, deletions, insertions, or one or more point mutations can be involved. At the amino acid level, there can be point mutations, so that the mutated alpha-tubulin has at least one amino acid position a different amino acid than the corresponding wild-type alpha-tubulin from which the tubulin sequence is derived. However, mutations are preferred which lead to a shortened C-terminus in the expressed alpha-tubulin. This is achieved in that a codon which codes for an amino acid in the corresponding wild-type alpha-tubulin is converted into a stop codon. Conceivable are, however, also mutations which lead to a shift in the reading frame so that "foreign amino acids" are encoded which are not part of a tubulin sequence.

The most preferred is a DNA construct in which, in the mutated DNA sequence, the codon which corresponds to codon 414 of the TUBA1 alpha-tubulin gene from rice is a stop codon.

The DNA sequence coding for the alpha tubulin is usually derived from a plant alpha tubulin gene. However, this is not mandatory, since due to the very high degree of conservation of the tubulins, alpha-tubulin genes from non-plant organisms in plants could also be functional. Chimeric tubulin sequences that are composed of sections of different tubulin genes are even conceivable. As a rule, the alpha-tubulin-DNA sequence of the DNA construct is a DNA sequence which codes for an alpha-tubulin of a useful plant. It is preferably a DNA sequence which codes for an alpha tubulin of rice, most preferably at least a part of the gene TUBA1 of rice. Also preferred are DNA constructs that contain a DNA sequence that codes for an alpha tubulin of the potato.

In addition to a DNA sequence which codes for a C-terminally modified alpha-tubulin, the DNA construct according to the invention can also have a DNA sequence which codes for a beta-tubulin. This is advantageous if high expression levels are reached, since the ratio of alpha to beta tubulin could then be disturbed by expression of the alpha tubulin alone. This is avoided by the simultaneous expression of a beta tubulin. Alpha and beta tubulin sequences are preferably located in succession as a "tandem construct". For example, the DNA construct can complete sequence of the OSTBB16 gene (coding for beta-tubulin) from rice.

The most important control sequences for regulating the expression of the alpha-tubulin sequence are promoters. The following promoters are preferably used: The 35S promoter of the cauliflower mosaic virus (CaMV) allows constitutive expression in plant cells. The maize ubiquitin promoter achieves very strong expression in cereal cells. The rice TUBA1 promoter is suitable for expressing DNA sequences in growing cells, while the rice OSTBB16 promoter is suitable for constitutive expression. Finally, specific promoters can be used to achieve expression that is limited in time and space. An example of this is the use of the potato patatin promoter. He ensures that sequences under his control are only expressed in the tubers. This limits the effects of expression on certain parts of plants or cell types.

The control sequences mentioned can also control the expression of the resistance factor.

Another aspect of the invention are plant cells which contain at least part of a DNA construct according to the invention. As a rule, this part is firmly integrated into the genome of the plant cell. It is preferably the cell of a useful plant, for example wheat, barley, rye, oats, corn, tobacco, cotton, rice, brassicaceae, cherries, plums, potatoes.

The invention further relates to a method for producing plants, in which a DNA construct according to the invention is introduced into a plant cell, so that at least a part of this construct is stable in the genome of the plant cell is integrated. To do this, a suspension of plant cells can be transfected, after which a selection of the successfully transfected cells takes place. According to the invention, the transfected cells are multiplied and cultivated, which leads to the growth of a complete plant. The exogenous tubulin sequence is expressed in the plant cells.

Various transfection methods can be used to introduce the DNA construct into plant cells. "Silicon carbide" -mediated gene transfer, infection by Agrobacterium tumefaciens and electroporation are possible, but bombardment of cells with DNA-coated gold beads ("particle-inflow gun") is preferred.

After transfection, the cells are grown and cultured.

A callus culture is preferably generated from mature embryos and this is then transfected on agar plates which contain the selection factor (for example kanamycin or carbamate herbicides) with the "particle-inflow gun" using DNA-coated gold particles. According to the invention, the transfected cells are grown on the agar plates under selection pressure and then treated with cytokinins so that shoots form from the callus. These are then cut off after a few weeks and rooted on auxin-containing agar medium. The resulting plantlets can then be transferred to soil and flowered after one to two months. The resulting seeds are then sown and checked for the presence of the modified tubulin gene and the resulting resistance to carbamate. The positive lines can then be propagated in a conventional manner. Another aspect of the invention is plants which are produced by the method according to the invention. These plants express a C-terminally modified tubulin. This alpha-tubulin is built into the cellular microtubules and hybrid microtubules are formed which have both native and modified alpha-tubulin. It is also possible that the microtubules contain predominantly modified alpha-tubulin, since the expression of the native alpha-tubulin is down-regulated. The hybrid microtubules have changed properties. Since certain herbicides bind to the C-terminus of alpha-tubulin, the microtubules of the plants according to the invention can no longer be bound by these herbicides and consequently can no longer be depolymerized. The modified alpha-tubulin thus gives the plant according to the invention increased resistance to certain herbicides. These are preferably carbamate herbicides, most preferably ethyl N-phenyl carbamate, isopropyl N-phenyl carbamate (Propham) and 3-chloroisopropyl N-phenyl carbamate (chlorpropham).

The hybrid microtubules can also give the plants other advantageous properties. A specialty of microtubules is their sensitivity to cold, which leads to depolymerization below certain temperatures. This behavior of the microtubules is considered to be responsible for the inhibition of plant growth in the cold. Cold is understood to mean temperatures of 0-10 ° C. In this context, cold resistance is to be separated from frost resistance. The loss of harvest in cold summers has far-reaching economic consequences. There are indications that the C-terminus of alpha-tubulin is responsible for the sensitivity to microtubules to cold. The plant according to the invention can thus have cellular microtubules with altered sensitivity to cold. Crop plants containing an alpha tubulin are conceivable express, the C-terminus is changed so that the microtubules are more stable against cold and thus the growth of the plant is less inhibited by low temperatures.

Plants are also conceivable that have an increased sensitivity to cold. Early germination is undesirable when storing potatoes. This is currently being countered by using chemical germ inhibitors such as propham or chlorpropham. In addition, attempts are being made to prevent germination by very low temperatures below 4 ° C. However, this leads to the conversion of starch into sugar and thus to a change in taste. Discoloration also occurs. For example, one aspect of the invention is a potato plant that expresses a C-terminally modified alpha-tubulin under the control of the tuber-specific patatin promoter. The alpha-tubulin is modified in such a way that the resulting hybrid microtubulins have an increased sensitivity to low temperatures, i.e. depolymerize even at higher temperatures. This could prevent germination in potatoes by storing and transporting them at the appropriate temperature without the undesirable effects of extremely low temperatures. Therefore chemical germ inhibitors could be dispensed with. The modified alpha-tubulin is advantageously not expressed in plant parts except in the tubers, thereby minimizing any side effects.

The invention also relates to propagation agents of the plants according to the invention, especially their seeds. Other propagation agents are, for example, the seed tubers of potatoes.

Another aspect of the invention is the use of C-terminally mutated alpha-tubulins or of nucleic acids containing them code for the production of the plants according to the invention mentioned above or their propagation agents. Nucleic acids include in particular single or double stranded DNA and RNA.

All aspects of the present invention, particularly those relating to plants and methods of making them, are applicable to many different plants and plant varieties. The present invention is therefore not restricted to a specific plant variety. The invention therefore relates to genetically modified plants according to the invention, but not individual plant cultivars.

FIG. 1 shows a comparison of the nucleotide sequences of the TUBA1 gene from Arborio (Arb .; SEQ ID NO: 3), Nihonmasari wild type (Nihmas WT; SEQ ID NO: 5) and Nihonmasari ER31 (Nihmas ER31; SEQ ID NO: 7). Nucleotide 1353 of ER31 has a mutation that leads to a stop codon. The corresponding amino acid sequences for Arborio (SEQ ID NO: 4), Nihonmasari wild type (SEQ ID NO: 6) and Nihonmasari ER31 (SEQ ID NO: 8) are given below the nucleotide sequences. The corresponding experiments are explained in Example 2.

FIG. 2 shows the increased resistance of the line ER31, which expresses the C-terminally modified TUBAl gene, to the herbicide ethyl N-phenylcarbamate (EPC) in comparison with the wild type. Coleoptile and mesocotyl growth as a function of the EPC concentration were determined. The corresponding experiments are explained in Example 3.

The following examples are intended to illustrate the invention:

Example 1: Binding of carbamate herbicides to the C-terminus of alpha tubulin

First, carboxy derivatives of the carbamate herbicides ethyl N-phenyl carbamate and isopropyl N-phenyl carbamate were prepared and coupled to Sepharose 4B. This matrix was now incubated with various alpha-tubulins and C-terminal peptides from various alpha-tubulins. Specifically, the following were used: the gene products of the rice alpha tubulin genes TUBAl, TUBA2 and TUBA3, an alpha tubulin consisting of amino acids 1 to 413 of the gene product of the rice alpha tubulin gene TUBAl, three peptides, each having amino acids 437 to 451 of the gene products of the rice alpha tubulin genes correspond to TUBAl to TUBA3. The native alpha-tubulins were obtained in the following way: Rice coleoptiles (grown for 6 days at 25 ° C in complete darkness) were harvested in safety green light, snap frozen in liquid nitrogen and ground to a fine powder in liquid nitrogen. The powder was mixed with ice-cold microtubule stabilizing buffer (1 part by weight powder: 1 part by weight buffer) and slowly thawed on ice. The microtubule-stabilizing buffer contains 25 mM MES, 5 mM EGTA, 1mM MgS0 ₄ , 1% w / v glycerol, 1mM GTP, 1mM PMSF and 10 μg / ml pepstatin A, aprotinin and leupeptin, pH 6.9. The mixture was then filtered through two layers of 80 μm nylon fabric, ultracentrifuged for 10 min at 4 ° C. with 300000 g, the precipitate was discarded and the supernatant was filtered through a 0.22 μm membrane filter. This supernatant is highly enriched in tubulin and microtubule-associated proteins. The carbamate-resistant rice line ER31 was used as the starting material to obtain the mutated TUBA1 protein (amino acids 1 to 413). The peptides were made by chemical synthesis. The peptides and proteins mentioned were incubated with the matrix so that they could bind. They were then eluted with a potassium chloride gradient. The individual fractions were precipitated with trichloroacetic acid and then examined for the presence of the respective tubulin isotype after gel electrophoresis by Western blot with isotype-specific antibodies against rice alpha-tubulin. The intensity of the bands was determined using a gel scanning quantification program. The following table shows the relative intensities of the bands as a function of the potassium chloride concentration:

Table 1:

M KC1 0 0.05 0.1 0.2 0.25 0.3 0.35 0.4 0.5 0.6 0.7 native rice TUBAl 0 0 0 0 4 9 22 25 19 15 6

native rice TUBA2 0 0 0 4 4 32 28 20 12 0 0

native rice TUBA3 0 0 10 17 32 31 10 0 0 0 0

mutated rice TUBAl 15 16 0 21 29 2 8 2 7 0 0

TUBAl peptide 0 0 0 0 0 11 18 28 12 19 12

TUBA 2 peptide 0 0 0 7 12 33 27 14 7 0 0

TUBA 3 peptide 0 0 4 19 41 29 7 0 0 0 0

Native rice TUBAl protein binds to the matrix material much more firmly than native rice TUBA3 protein. C-terminal shortened rice TUBAl protein binds much weaker. This shows that the C-termmus of TUBAl is necessary for binding to carbamate herbicides. The C-terminal 15 amino acids of the TUBAl protein bind to the matrix material with the same strength as the total protein. This shows that the C-termmus of the TUBAl protein is also sufficient for binding to carbamate herbicides.

Example 2:

Cloning of the mutant rice TUBAl gene

Isotype-specific PCR primers were produced (see FIG. 1). The 5 'primer had the sequence "GAGACTGCAGCGTCGCAGCATCAACCCAAT" (SEQ ID NO: 1), the 3' primer had the sequence "GAGAATTCCCAGACGACGACGACTCCTC" (SEQ ID NO: 2). For wild type (Kultivar Nihonmasari) and the carbamate-resistant line ER31, different, independent sister lines were cultivated for six days in complete darkness (at 25 ° C), of which the coleoptiles were harvested in a safety green light and then according to the method described by Ehmann et al. (Planta 183, 416-422, 1991) published method isolated the mRNA. The mRNA was transcribed with reverse transcriptase (available from Röche Diagnostics) according to the manufacturer's protocol into cDNA and then the cDNA for TUBAl was amplified by means of PCR using the isotype-specific primers. A recognition sequence for the restriction enzymes EcoRI and PstI was synthesized on the primers, the PCR was carried out with 35 cycles at an "annealing temperature" of 55 ° C. with the particularly error-free "ExTaq" polymerase from TaKaRa. The PCR product was separated on an agarose gel according to standard methods, the amplified band was cut out and eluted with the aid of the "Qiagen Gel Extraction Kit" (available from Qiagen) and according to the manufacturer cleaned up. After digestion with EcoRI and PstI according to the manufacturer (Gibco), the TUBAl cDNA fragment was ligated into the vector pUC19 and transformed into E. coli by the usual method. Five independent clonings were performed for the wild type and six independent clonings for the carbamate resistant line ER31. Finally, the amplified DNA sequences were determined.

The sequences obtained were compared with the sequence for TUBAl published for the rice cultivar Arborio. The comparison (see FIG. 1) shows that the two cultivars differ in several places. Two differences were found both in the wild type and in the carbamate-resistant line, so they are cultivar-specific. It is the exchange of a serine (arborio) in position 52 for a phenylalanine (Nihonmasari) and the exchange of a serine (arborio) in position 437 for an alanine. In addition, there is a base exchange G to T in the carbamate-resistant lines at position 1353, which causes the triplet GAG (gutamate) to be converted into the triplet TAG (stop), which shortens the resulting C-terminal protein from 451 to 413 amino acids.

Example 3:

Resistance of the ER31 line to ethyl N-phenyl carbamate

ER31 and wild-type rice caryopses were grown in complete darkness for six days at 25 ° C. on aqueous solutions of ethyl N-phenylcarbamate. For this purpose, 20 caryopses were placed equidistantly on a fine plastic net, which floated on the solution with the help of polystyrene blocks. The length of the coleoptile and mesocotyl was measured after cultivation and the corresponding mean values against the logarithm of the concentration of ethyl-N- phenyl carbamate applied. The degree of resistance can be determined as a factor from the shift in the dose-response curve for the mutant to higher concentrations. The result is shown in Figure 2.

Example 4:

Production of a transgenic rice plant.

Ripe rice seeds, from which callus is made, serve as the starting material. This step is described in P. Nick, 0. Yatou, M. Furuya, A.M. Lambert (1994) Auxin-dependent microtubule responses and seedling development are affected in a rice mutant resistant to EPC. Plant J. 6, 651-663.

The callus tissue is now a week after subculture on MS-A agar (Hartke, S. and Lörz, H. - 1989 Somatic embryogenesis and plant regeneration from various incfica rice ("Oryza sativa L.") genotypes. J.Genet. Breeding 43 , 205-214) using the "particle inflow gun".

For this purpose, the callus tissue is distributed on MS-A agar, which is complemented with 0.3 M mannitol and sorbitol, and incubated for 3 hours at 25 ° C. The cells are then transformed under sterile conditions with 10 μl of DNA-coated gold particles per shot and left on the agar plates containing mannitol / sorbitol for a further 12 hours at 25 ° C. Then they are transferred to selection medium (MS-A agar with 1 mM ethyl-N-phenylcarbamate), with the bombarded surface of the callus pointing upwards. Newly formed callus tissue is transferred to fresh selection medium after two weeks in the dark at 25 ° C until compact and opaque callus nodules form. These are removed sterile and placed on pre-regeneration medium (selection medium, in which the 2.4 D is replaced by 2 ppm 6-benzylaminopurine, 1 ppm alpha-naphthylacetic acid and 5 ppm abscisic acid). After a further week of cultivation in the dark, the compact and opaque callus is again removed and transferred to regeneration medium (selection medium in which the 2,4 D is replaced by 3 ppm of 6-benzylaminopurine and 0.5 ppm of alpha-naphthylacetic acid) and cultivated further in daylight, regenerate until rung. After several weeks, the shoots are transferred to selection medium without hormones and cultivated further at 10000 Lx / m ² until roots have formed. The rice plants are then grown on soil and seeds are produced from them as described in Nick et al. (1994) (see above).

Claims

Expectations

1) DNA construct which is suitable for expressing a DNA sequence in plant cells and which is at least partially produced in vitro, comprising the following constituents:

a) a DNA sequence coding for a mutated alpha tubulin, wherein

aa) the N-terminal part of the alpha tubulin is obtained in such a way that the alpha tubulin can be incorporated into microtubules;

bb) the C-terminal part of the ^' alpha-tubulin has a mutation towards the wild-type tubulin from which the DNA sequence is derived;

b) at least one DNA sequence which controls the expression of the alpha-tubulin DNA sequence in plant cells;

c) at least one DNA sequence which codes for a resistance factor which allows the selection of successfully transfected plant cells, this DNA sequence being under the control of a DNA sequence according to b).

2) DNA construct according to claim 1, characterized in that the mutation of the alpha-tubulin in the C-terminal third of the alpha-tubulin.

3) DNA construct according to claim 1, characterized in that the mutation of the alpha-tubulin is at an amino acid position which is within the amino acid range which the Corresponds to amino acid positions 414-451 of the alpha tubulin TUBAl from rice.

4) DNA construct according to claim 1, characterized in that the mutation of the alpha-tubulin is at an amino acid position which is within the 15 C-terminal amino acids of the corresponding wild-type alpha-tubulin.

5) DNA construct according to any one of claims 1-4, characterized in that the mutated alpha-tubulin has at least one amino acid position a different amino acid than the corresponding wild-type alpha-tubulin.

6) DNA construct according to any one of claims 1-4, characterized in that the mutated alpha-tubulin is shortened C-terminal compared to the corresponding wild-type alpha-tubulin.

7) DNA construct according to one of claims 1 -3, characterized in that in the mutated DNA sequence the codon, which corresponds to codon 414 in the alpha-tubulin gene TUBAl from rice, is a stop codon.

8) DNA construct according to one of claims 1 to 7, characterized in that the alpha tubulin is an alpha tubulin of a crop.

9) DNA construct according to one of claims 1 to 8, characterized in that the alpha tubulin is an alpha tubulin of rice.

10) DNA construct according to claim 9, characterized in that the DNA sequence comprises at least a part of the gene TUBAl of rice.

11) DNA construct according to one of claims 1 to 8, characterized in that the DNA sequence codes for an alpha tubulin of the potato. 12) DNA construct according to one of claims 1 to 10, characterized in that it has the promoter of the TUBAl gene from rice as a control sequence.

13) DNA construct according to claim 11, characterized in that it has the tuber-specific patatin promoter of the potato as a control sequence.

14) Plant cell containing at least part of a DNA construct according to one of claims 1 to 13.

15) Plant cell according to claim 14, characterized in that it is the cell of a useful plant.

16) Process for the production of plants, comprising the following steps:

a) provision of a DNA construct according to one of claims 1 to 13,

b) introducing this DNA construct into a plant cell so that at least part of the construct is stably integrated into the genome of the plant cell,

c) multiplication and cultivation of the transformed plant cells, the exogenous tubulin sequence being expressed.

17) Plant, producible by a method according to claim 16, and propagating agent of this plant.

18) Plant according to claim 17, characterized in that the plant has resistance to at least one herbicide, and propagating agent of this plant. 19) Plant according to claim 18, characterized in that the plant has resistance to at least one carbamate herbicide, and propagating agents of this plant.

20) Plant according to claim 19, characterized in that the plant has resistance to at least one of the herbicides ethyl-N-phenylcarbamate, isopropyl-N-phenylcarbamate (Propham) and 3-chloroisopropyl-N-phenylcarbamate (chlorpropham), and propagating agents of this plant ,

21) Plant according to claim 17, characterized in that the plant has increased cold resistance to the corresponding wild type plant, and propagating agent of this plant.

22) Plant according to claim 17, characterized in that the plant has increased sensitivity to the cold compared to the corresponding wild type plant, and propagating agent of this plant.

23) Use of C-terminally mutated alpha-tubulins or of nucleic acids encoding them for the production of herbicide-resistant plants or their propagation agents.

24) Use of C-terminally mutated alpha-tubulins or of nucleic acids encoding them for the production of plants with increased resistance to cold or their propagation agents.

25) Use of C-terminally mutated alpha-tubulins or of nucleic acids encoding them for the production of plants with increased sensitivity to cold or their propagation agents.