EP1196572A1 - Axor21, a g-protein coupled receptor - Google Patents

Axor21, a g-protein coupled receptor

Info

Publication number
EP1196572A1
EP1196572A1 EP00948173A EP00948173A EP1196572A1 EP 1196572 A1 EP1196572 A1 EP 1196572A1 EP 00948173 A EP00948173 A EP 00948173A EP 00948173 A EP00948173 A EP 00948173A EP 1196572 A1 EP1196572 A1 EP 1196572A1
Authority
EP
European Patent Office
Prior art keywords
receptor
polypeptide
mmch
polynucleotide
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00948173A
Other languages
German (de)
French (fr)
Inventor
David Malcolm SmithKline Beecham Pharm DUCKWORTH
Jeffrey SmithKline Beecham Pharmaceuticals HILL
Alison Isobel SmithKline Beecham Pharmac. MUIR
Philip Graham SmithKline Beecham Pharm. SZEKERES
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SmithKline Beecham Ltd
Original Assignee
SmithKline Beecham Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB9917627.3A external-priority patent/GB9917627D0/en
Priority claimed from GBGB9920046.1A external-priority patent/GB9920046D0/en
Application filed by SmithKline Beecham Ltd filed Critical SmithKline Beecham Ltd
Publication of EP1196572A1 publication Critical patent/EP1196572A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C07K14/723—G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH receptor

Definitions

  • This invention relates to newly identified polypeptides and polynucleotides encoding such polypeptides, to their use in diagnosis and in identifying compounds that may be agonists, antagonists that are potentially useful in therapy, and to production of such polypeptides and polynucleotides.
  • the drug discovery process is currently undergoing a fundamental revolution as it embraces "functional genomics", that is, high throughput genome- or gene-based biology. This approach as a means to identify genes and gene products as therapeutic targets is rapidly superceding earlier approaches based on “positional cloning”. A phenotype, that is a biological function or genetic disease, would be identified and this would then be tracked back to the responsible gene, based on its genetic map position.
  • proteins participating in signal transduction pathways that involve G-proteins and/or second messengers, e.g., cAMP (Lefkowitz, Nature, 1991 , 351 :353-354).
  • these proteins are referred to as proteins participating in pathways with G-proteins or PPG proteins.
  • Some examples of these proteins include the GPC receptors, such as those for adrenergic agents and dopamine (Kobilka, B. ., et al., Proc. Natl Acad.
  • G-proteins themselves, effector proteins, e.g., phospholipase C, adenyl cyclase, and phosphodiesterase. and actuator proteins, e.g., protein kinase A and protein kinase C (Simon, M.I., et al., Science, 1991, 252:802- 8).
  • the effect of hormone binding is activation of the enzyme, adenylate cyclase, inside the cell.
  • Enzyme activation by hormones is dependent on the presence of the nucleotide GTP.
  • GTP also influences hormone binding.
  • a G-protein connects the hormone receptor to adenylate cyclase.
  • G-protein was shown to exchange GTP for bound GDP when activated by a hormone receptor.
  • the GTP-carrying form then binds to activated adenylate cyclase.
  • Hydrolysis of GTP to GDP catalyzed by the G-protein itself, returns the G-protein to its basal, inactive form.
  • the G-protein serves a dual role, as an intermediate that relays the signal from receptor to effector, and as a clock that controls the duration of the signal.
  • the membrane protein gene superfamily of G-protein coupled receptors has been characterized as having seven putative transmembrane domains. The domains are believed to represent transmembrane a- helices connected by extracellular or cytoplasmic loops
  • G-protein coupled l eceptoi s include a w ide range of biologically active receptors, such as hormone, ⁇ iral. growth factor and neui oreceptoi
  • G-piotein coupled leceptors (othei ⁇ vise known as 7TM l eceptoi s) hav e been characterized as including these seven conserved hydi ophobic stretches of about 20 to 30 amino acids connecting at least eight divergent hvdrophilic loops
  • the G-piotein family of coupled l eceptors includes dopamine receptors which bind to neuroleptic daigs used toi ti eating psychotic and neurological disordei s
  • Other examples of members of this fami lv include, but ai e not limited to. calcitonm. adrenei gic. endothe n.
  • G-protein coupled receptois contains potential phosphorylation sites within the third cytoplasmic loop and/or the carboxy terminus
  • G-protein coupled receptors such as the b-adrenoreceptor
  • phosphorylation by protein kinase A and or specific receptor kinases mediates receptor desensitization
  • the ligand binding sites of G-protein coupled receptors are believed to comprise hydrophilic sockets formed by several G-protein coupled receptor transmembrane domains, said socket being surrounded by hydrophobic residues of the G-protein coupled receptors.
  • the hydiophiltc side of each G- protein coupled receptoi transmembrane helix is postulated to face inward and form polar ligand binding site TM3 has been implicated in several G-protein coupled receptors as having a ligand binding site, such as the TM3 aspartate residue TM5 se ⁇ nes.
  • a TM6 asparagine and TM6 or TM7 phenylalanines or tyrosines are also implicated in ligand binding
  • G-protein coupled receptors can be lntracellularly coupled by heterotnme ⁇ c G-proteins to various intracellular enzymes, ion channels and transporters (see. Johnson et al , Endoc Rev , 1989, 10 317-331)
  • Different G-protein a-subunits preferentially stimulate particular effectors to modulate various biological functions in a cell Phosphorylation of cytoplasmic residues of G-protein coupled l eceptors hav e been identified as an important mechanism for the regulation of G-protein coupling of some G-protein coupled receptors
  • G-protein coupled receptors are found in numerous sites within a mammalian host
  • the present invention relates to ⁇ XOR2 1 , in particular ⁇ XOR21 polypeptides and AXOR21 polynucleotides, recombinant mate ⁇ als and methods for their production
  • Such polypeptides and polynucleotides are of interest m relation to methods of treatment of certain diseases, including, but not limited to, obesity, diabetes, eating disorders, such as anorexia and bulimia
  • the invention relates to methods for identifying agonists and antagonists (e g , inhibitors) using the mate ⁇ als provided by the invention, and treating conditions associated with A ⁇ OR21 imbalance with the identified compounds
  • the invention relates to diagnostic assays for detecting diseases associated with inapprop ⁇ ate ⁇ O 21 activity or levels
  • the present invention relates to A ⁇ OR21 polypeptides
  • Such polypeptides include
  • Polypeptides of the present invention are believed to be members of the G protein-coupled receptor family of polypeptides
  • AXOR21 biological activity of AXOR21
  • AXOR21 activity biological activity of AXOR21
  • a polypeptide of the present invention exhibits at least one biological activity of AXOR21
  • Polypeptides of the present invention also includes va ⁇ ants of the aforementioned polypeptides, including all allelic forms and splice va ⁇ ants Such polypeptides vary from the reference polypeptide by insertions, deletions, and substitutions that may be conservative or non-conservative, or any combination thereof Particularly preferred va ⁇ ants are those in which several, for instance from 50 to 30, from 30 to 20, from 20 to 10, from 10 to 5, from 5 to 3, from 3 to 2, from 2 to 1 or I ammo acids are inserted, substituted, or deleted, m any combination
  • Preferred fragments of polypeptides of the present invention include an isolated polypeptide compnsmg an ammo acid sequence having at least 30, 50 or 100 contiguous ammo acids from the ammo acid sequence of SEQ ID NO 2, or an isolated polypeptide compnsmg an ammo acid sequence having at least 30, 50 or 100 contiguous ammo acids truncated or deleted from the ammo acid sequence of SEQ ID NO: 2.
  • Preferred fragments are biologically active fragments that mediate the biological activity of AXOR21 , including those with a similar activity or an improved activity, or with a decreased undesirable activity. Also preferred are those fragments that are antigenic or immunogenic in an animal, especially in a human.
  • polypeptides of the invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, these variants may be employed as intermediates for producing the full-length polypeptides of the invention.
  • the polypeptides of the present invention may be in the form of the "mature" protein or may be a part of a larger protein such as a precursor or a fusion protein. It is often advantageous to include an additional amino acid sequence that contains secretory or leader sequences, pro-sequences, sequences that aid in purification, for instance multiple histidine residues, or an additional sequence for stability during recombinant production.
  • Polypeptides of the present invention can be prepared in any suitable manner, for instance by isolation form naturally occuring sources, from genetically engineered host cells comprising expression systems (vide infra) or by chemical synthesis, using for instance automated peptide synthesisers, or a combination of such methods.
  • Means for preparing such polypeptides are well understood in the art.
  • the present invention relates to AXOR21 polynucleotides.
  • Such polynucleotides include:
  • Preferred fragments of polynucleotides of the present invention include an isolated polynucleotide comprising an nucleotide sequence having at least 15, 30, 50 or 100 contiguous nucleotides from the sequence of SEQ ID NO: 1, or an isolated polynucleotide comprising an sequence having at least 30, 50 or 100 contiguous nucleotides truncated or deleted from the sequence of SEQ ID NO: 1.
  • polynucleotides of the present invention include splice variants, allelic variants, and polymorphisms, including polynucleotides having one or more single nucleotide polymorphisms (SNPs).
  • Polynucleotides of the present invention also include polynucleotides encoding polypeptide variants that comprise the amino acid sequence of SEQ ID NO:2 and in which several, for instance from 50 to 30, from 30 to 20, from 20 to 10, from 10 to 5, from 5 to 3, from 3 to 2, from 2 to 1 or 1 amino acid residues are substituted, deleted or added, in any combination.
  • the present invention provides polynucleotides that are RNA transcripts of the DNA sequences of the present invention. Accordingly, there is provided an RNA polynucleotide that:
  • (a) comprises an RNA transcript of the DNA sequence encoding the polypeptide of SEQ ID NO:2;
  • (b) is the RNA transcript of the DNA sequence encoding the polypeptide of SEQ ID NO:2;
  • RNA transcript of the DNA sequence of SEQ ID NO: 1 comprises an RNA transcript of the DNA sequence of SEQ ID NO: 1; or (d) is the RNA transcript of the DNA sequence of SEQ ID NO: 1 ; and RNA polynucleotides that are complementary thereto.
  • the polynucleotide sequence of SEQ ID NO:l shows homology with rat somatostatin receptor-like (SLC1) (B Lakaye et al., Biochim. Biophys. Acta 1401:216-220, 1998).
  • SLC1 rat somatostatin receptor-like
  • the polynucleotide sequence of SEQ ID NO: 1 is a cDNA sequence that encodes the polypeptide of SEQ ID NO:2.
  • the polynucleotide sequence encoding the polypeptide of SEQ ID NO:2 may be identical to the polypeptide encoding sequence of SEQ ID NO: 1 or it may be a sequence other than SEQ ID NO: 1, which, as a result of the redundancy (degeneracy) of the genetic code, also encodes the polypeptide of SEQ ID NO:2.
  • the polypeptide of the SEQ ID NO:2 is related to other proteins of the G protein-coupled receptor family, having homology and/or structural similarity with rat somatostatin receptor-like (SLC 1 ) (B Lakaye et al., Biochim. Biophys. Acta 1401 :216-220, 1998).
  • Preferred polypeptides and polynucleotides of the present invention are expected to have, inter alia, similar biological functions/properties to their homologous polypeptides and polynucleotides. Furthermore, preferred polypeptides and polynucleotides of the present invention have at least one AXOR21 activity.
  • Polynucleotides of the present invention may be obtained using standard cloning and screening techniques from a cDNA library derived from mRNA in cells of human testes, small intestine, retina, (see for instance, Sambrook et al , Molecular Cloning A Laboratory Manual, 2nd Ed , Cold Sp ⁇ ng Harbor Laboratory Press, Cold Sp ⁇ ng Harbor, N Y (1989))
  • Polynucleotides of the invention can also be obtained from natural sources such as genomic DNA libraries or can be synthesized using well known and commercially available techniques
  • the polynucleotide may include the coding sequence for the mature polypeptide, by itself, or the coding sequence for the mature polypeptide in reading frame with other coding sequences, such as those encoding a leader or secretory sequence, a pre-, or pro- or prepro- protein sequence, or other fusion peptide portions
  • a leader or secretory sequence such as those encoding a leader or secretory sequence, a pre-, or pro
  • probes and p ⁇ mers may be used as hyb ⁇ dization probes for cDNA and genomic DNA or as p ⁇ mers for a nucleic acid amplification reaction (for instance, PCR) Such probes and p ⁇ mers may be used to isolate full-length cDNAs and genomic clones encoding polypeptides of the present invention and to isolate cDNA and genomic clones of other genes (including genes encoding paralogs from human sources and orthologs and paralogs from species other than human) that have a high sequence simila ⁇ ty to SEQ ID NO 1 , typically at least 95%> identity
  • Preferred probes and p ⁇ mers will generally comp ⁇ se at least 15 nucleotides, preferably, at least 30 nucleotides and may have at least 50, if not at least 100 nucleotides Particularly preferred probes will have between 30 and 50 nucleotides Particularly preferred p ⁇ mers will have between 20 and 25 nucleotides
  • cDNAs have been prepared from mRNA extracted from a chosen tissue and an 'adaptor' sequence hgated onto each end Nucleic acid amplification (PCR) is then carried out to amplify the "missing" 5' end of the cDNA using a combination of gene specific and adaptor specific ohgonucleotide p ⁇ mers
  • PCR Nucleic acid amplification
  • the PCR reaction is then repeated using 'nested' p ⁇ mers, that is, p ⁇ mers designed to anneal within the amplified product (typically an adaptor specific pnmer that anneals further 3' in the adaptor sequence and a gene specific pnmer that anneals further 5' in the known gene sequence)
  • the products of this reaction can then be analysed by DNA sequencing and a full-length cDNA constructed either by joining the product directly to the existing cDNA to give a complete sequence, or carrying out a separate full-length PCR using the new sequence information for the design of the 5' pnmer
  • Recombinant polypeptides of the present mvention may be prepared by processes well known in the art from genetically engmeered host cells compnsmg expression systems. Accordingly, in a further aspect, the present invention relates to expression systems compnsmg a polynucleotide or polynucleotides of the present invention, to host cells which are genetically engmeered with such expression sytems and to the production of polypeptides of the mvention by recombmant techniques. Cell-free translation systems can also be employed to produce such proteins using RNAs denved from the DNA constructs of the present invention
  • host cells can be genetically engineered to incorporate expression systems or portions thereof for polynucleotides of the present invention
  • Polynucleotides may be introduced into host cells by methods descnbed in many standard laboratory manuals, such as Davis et al., Basic Methods in Molecular Biology (1986) and Sambrook et al (ibid).
  • Preferred methods of introducing polynucleotides into host cells include, for instance, calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, catiomc hpid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction or infection
  • Representative examples of approp ⁇ ate hosts include bacte ⁇ al cells, such as Streptococci,
  • Staphylococci E coh, Streptomyces and Bacillus subtihs cells
  • fungal cells such as yeast cells and Asperg ⁇ lus cells
  • insect cells such as Drosophila S2 and Spodoptera Sf9 cells
  • animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, HEK 293 and Bowes melanoma cells, and plant cells
  • a great va ⁇ ety of expression systems can be used, for instance, chromosomal, episomal and virus- de ⁇ ved systems, e g , vectors de ⁇ ved from bactenal plasmids, from bacte ⁇ ophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors de ⁇ ved from combinations thereof, such as those de ⁇ ved from plasmid and bacte ⁇ ophage genetic elements, such as cosmids and phagemids
  • the expression systems may contain control regions that regulate as well as engender expression Generally, any system or vector that is able to maintain, propagate or express a polynucleotide to produce a polypeptide in a host may be used The approp
  • a polypeptide of the present invention is to be expressed for use in screenmg assays, it is generally preferred that the polypeptide be produced at the surface of the cell In this event, the cells may be harvested pnor to use in the screening assay If the polypeptide is secreted into the medium, the medium can be recovered m order to recover and purify the polypeptide If produced intracellularly, the cells must first be lysed before the polypeptide is recovered
  • Polypeptides of the present invention can be recovered and punfied from recombmant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectm chromatography Most preferably, high performance liquid chromatography is employed for pu ⁇ fication Well known techniques for refoldmg proteins may be employed to regenerate active conformation when the polypeptide is denatured during lntracellular synthesis, isolation and/or pu ⁇ fication
  • Polynucleotides of the present mvention may be used as diagnostic reagents, through detecting mutations in the associated gene Detection of a mutated form of the gene characte ⁇ sed by the polynucleotide of SEQ ID NO 1 m the cDNA or genomic sequence and which is associated with a dysfunction will provide a diagnostic tool that can add to, or define, a diagnosis of a disease, or susceptibility to a disease, which results from under-expression, over-expression or altered spatial or temporal expression of the gene
  • diseases include, but are not limited to obesity, diabetes, eating disorders such as anorexia and bulimia, pam cancels, asthma Paikinson's disease acute heart failure, hypotension, hypertension urinary retention, osteoporosis, angina pecto ⁇ s myocardial infarction stroke, ulcers, asthma, allergies benign prostatic hypertrophy, migraine, vomiting, psvchotic and neurological disoiders, including anxiety, schizophrenia, manic depression, depression, deli
  • the diseases Individuals carrying mutations in the gene may be detected at the DNA level by a variety of techniques well known in the art. Nucleic acids for diagnosis may be obtained from a subject's cells, such as from blood, urine, saliva, tissue biopsy or autopsy material. The genomic DNA may be used directly for detection or it may be amplified enzymatically by using PCR, preferably RT-PCR, or other amplification techniques prior to analysis. RNA or cDNA may also be used in similar fashion. Deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
  • Point mutations can be identified by hybridizing amplified DNA to labeled AXOR21 nucleotide sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase digestion or by differences in melting temperatures. DNA sequence difference may also be detected by alterations in the electrophoretic mobility of DNA fragments in gels, with or without denaturing agents, or by direct DNA sequencing (see, for instance, Myers et al, Science (1985) 230: 1242). Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (see Cotton et al, Proc Natl Acad Sci USA (1985) 85: 4397-4401).
  • SNPs Single Nucleotide Polymorphisms
  • ASA Allele Specific Amplification
  • a common primer is used in reverse complement to the polymorphism being assayed. This common primer can be between 50 and 1500 bps from the polymo ⁇ hic base.
  • the other two (or more) primers are identical to each other except that the final 3' base wobbles to match one of the two (or more) alleles that make up the polymo ⁇ hism.
  • Two (or more) PCR reactions are then conducted on sample DNA, each using the common primer and one of the Allele Specific Primers.
  • An array of oligonucleotides probes comprising AXOR21 polynucleotide sequence or fragments thereof can be constructed to conduct efficient screening of e.g., genetic mutations.
  • Such arrays are preferably high density arrays or grids.
  • Array technology methods are well known and have general applicability and can be used to address a variety of questions m molecular genetics including gene expression, genetic linkage, and genetic variability, see, for example, M.Che ⁇ et al., Science, 274, 610-613 (1996) and other references cited therein. Detection of abnormally decreased or increased levels of polypeptide or mRNA expression may also be used for diagnosing or determining susceptibility of a subject to a disease of the invention.
  • Decreased or increased expression can be measured at the RNA level using any of the methods well known in the art for the quantitation of polynucleotides, such as, for example, nucleic acid amplification, for instance PCR, RT-PCR, RNase protection, Northern blotting and other hybridization methods.
  • Assay techniques that can be used to determine levels of a protein, such as a polypeptide of the present invention, in a sample derived from a host are well-known to those of skill in the art. Such assay methods include radioimmunoassays, competitive-binding assays, Western Blot analysis and ELISA assays.
  • the present invention relates to a diagonostic kit comprising:
  • a polynucleotide of the present invention preferably the nucleotide sequence of SEQ ID NO: 1, or a fragment or an RNA transcript thereof;
  • polypeptide of the present invention preferably the polypeptide of SEQ ID NO:2 or a fragment thereof; or
  • kits an antibody to a polypeptide of the present invention, preferably to the polypeptide of SEQ ID NO:2.
  • a), (b), (c) or (d) may comprise a substantial component.
  • Such a kit will be of use in diagnosing a disease or susceptibility to a disease, particularly diseases of the invention, amongst others.
  • the polynucleotide sequences of the present invention are valuable for chromosome localisation studies.
  • the sequence is specifically targeted to, and can hybridize with, a particular location on an individual human chromosome.
  • the mapping of relevant sequences to chromosomes according to the present invention is an important first step in correlating those sequences with gene associated disease. Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found in, for example, V. McKusick, Mendelian Inheritance in Man (available on-line through Johns Hopkins University Welch Medical Library).
  • PCRs result in 93 scores indicating the presence or absence of the PCR product of the gene of interest. These scores are compared with scores created using PCR products from genomic sequences of known location. This comparison is conducted at http://www.genome.wi.mit.edu/
  • the polynucleotide sequences of the present invention are also valuable tools for tissue expression studies. Such studies allow the determination of expression patterns of polynucleotides of the present invention which may give an indication as to the expression patterns of the encoded polypeptides in tissues, by detecting the mRNAs that encode them.
  • the techniques used are well known in the art and include in situ hydridisation techniques to clones arrayed on a grid, such as cDNA microarray hybridisation (Schena et al, Science, 270, 467-470, 1995 and Shalon et al, Genome Res, 6, 639-645, 1996) and nucleotide amplification techniques such as PCR.
  • a preferred method uses the TAQMAN (Trade mark) technology available from Perkin Elmer. Results from these studies can provide an indication of the normal function of the polypeptide in the organism.
  • polypeptides of the present invention are expressed in, for example, brain, intestine, adipose, prostate and cartilage.
  • a further aspect of the present invention relates to antibodies.
  • the polypeptides of the invention or their fragments, or cells expressing them, can be used as immunogens to produce antibodies that are immunospecific for polypeptides of the present invention.
  • immunospecific means that the antibodies have substantially greater affinity for the polypeptides of the invention than their affinity for other related polypeptides in the prior art.
  • Antibodies generated against polypeptides of the present invention may be obtained by administering the polypeptides or epitope-bearing fragments, or cells to an animal, preferably a non-human animal, using routine protocols.
  • any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler, G. and Milstein, C, Nature (1975) 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al, Immunology Today (1983) 4:72) and the EBV-hybridoma technique (Cole et al, Monoclonal Antibodies and Cancer Therapy, 77-96, Alan R. Liss, Inc., 1985).
  • single chain antibodies such as those described in U.S. Patent No. 4,946,778, can also be adapted to produce single chain antibodies to polypeptides of this invention.
  • transgenic mice, or other organisms, including other mammals may be used to express humanized antibodies.
  • the above-described antibodies may be employed to isolate or to identify clones expressing the polypeptide or to purify the polypeptides by affinity chromatography.
  • Antibodies against polypeptides of the present invention may also be employed to treat diseases of the invention, amongst others.
  • polypeptides and polynucleotides of the present invention may also be used as vaccines. Accordingly, in a further aspect, the present invention relates to a method for inducing an immunological response in a mammal that comprises inoculating the mammal with a polypeptide of the present invention, adequate to produce antibody and/or T cell immune response, including, for example, cytokine-producing T cells or cytotoxic T cells, to protect said animal from disease, whether that disease is already established within the individual or not.
  • An immunological response in a mammal may also be induced by a method comprises delivering a polypeptide of the present invention via a vector directing expression of the polynucleotide and coding for the polypeptide in vivo in order to induce such an immunological response to produce antibody to protect said animal from diseases of the invention.
  • One way of administering the vector is by accelerating it into the desired cells as a coating on particles or otherwise.
  • Such nucleic acid vector may comprise DNA, RNA, a modified nucleic acid, or a DNA/RNA hybrid.
  • a polypeptide or a nucleic acid vector will be normally provided as a vaccine formulation (composition).
  • the formulation may further comprise a suitable carrier.
  • a polypeptide may be broken down in the stomach, it is preferably administered parenterally (for instance, subcutaneous, intramuscular, intravenous, or intradermal injection).
  • parenteral administration include aqueous and non-aqueous sterile injection solutions that may contain anti-oxidants, buffers, bacteriostats and solutes that render the formulation instonic with the blood of the recipient; and aqueous and non-aqueous sterile suspensions that may include suspending agents or thickening agents.
  • the formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampoules and vials and may be stored in a freeze-dried condition requiring only the addition of the sterile liquid carrier immediately prior to use.
  • the vaccine formulation may also include adjuvant systems for enhancing the immunogenicity of the formulation, such as oil-in water systems and other systems known in the art. The dosage will depend on the specific activity of the vaccine and can be readily determined by routine experimentation.
  • a further aspect of the present invention concerns the identification of melanin concentrating hormone (MCH) as a ligand for the AXOR21 receptor polypeptide and the use of MCH and AXOR21 polypeptides in the development of screens for identifying agonist or antagonist compounds.
  • MCH melanin concentrating hormone
  • SEQ ID NO: 1 SEQ ID NO: 1
  • MCH is over expressed in ob/ob homozygous mice and fasting further increased expression of MCH mRNA in both normal and obese mice. Injection of MCH into lateral ventricles of rats results in increased food consumption. In other studies, intracerebroventricular injection of MCH has been shown to inhibit feeding (Presse, F et al Neuroscience 1996 71 :735-45).
  • Mammalian MCH is initially generated as a precursor polypeptide having 165 amino acids, from which the 19 amino acid MCH peptide is subsequently cleaved.
  • a receptor for which MCH acts as a ligand has been identified as SLC-1 (Chambers J et al., Nature 1999, 400:261-265; Saito Y et al., Nature 1999, 400:265-269).
  • the identification of mMCH as a ligand for AXOR21 therefore facilitates the development of screening methods for identifying agonists and antagonists of the receptor. Accordingly, the present invention further provides a method of identifying compounds which bind to and activate (agonist) or inhibit activation (antagonist) of the receptor AXOR21 which method comprises using AXOR21, in combination with mMCH or a derivative thereof.
  • mMCH refers to mammalian melanin-concentrating hormone, having the amino acid sequence given in SEQ ID NO:3.
  • Derivatives of mMCH which are useful in the present invention include mMCH peptides which have limited modifications to the sequence, for example addition of an amino acid residue at either the N or C terminus, or both, of the peptide, or the substitution of one amino acid residue within the peptide sequence with another. Such additions and substitutions may, for example, facilitate the radioactive or chemical labelling of the peptide thereby enabling detection of the peptide when carrying out the methods of the invention. Such additions or substitutions have little or no effect on the binding properties of the mMCH peptide to the AXOR21 receptor.
  • a suitable amino acid for adding to the N or C terminus of the peptide is lysine.
  • lysine is an example of an amino acid that can be used to substitute for an amino acid residue in the mMCH peptide. Lysine is a preferred residue for these pu ⁇ oses because of it's flexibility with regard the range of chemical labels which can be attached to it.
  • Further derivatives include truncated forms of mMCH wherein the mMCH peptide has one or more amino acid residues at the N-terminus, C-terminus or internal amino acid residues removed, or the mMCH peptide derivatives are synthesised to lack said residues.
  • mMCH peptides wherein one or more amino acid residues are substituted with other amino acid residues. Such substituted derivatives may or may not be truncated. Derivatives such as those described will include other naturally ocurring MCH peptides, for example salmon MCH (H.Kawauchi et al (1993), Ann. N.Y Acad. Sci., 680, 64). mMCH derivatives may include naturally occuring amino acid residues, naturally occuring amino acid residues that have been chemically modified and non-naturally occuring amino acid residues.
  • modified amino acid residues include radiolabeled residues (for example tyrosine labeled with ⁇ "Iodine) anc j chemically labeled residues with, for example, biotin or a fluorescent label.
  • mMCH is commercially available (Bachem).
  • mMCH and mMCH derivatives may be prepared by peptide synthesis methods well known in the art.
  • mMCH and mMCH derivatives may be made by recombinant DNA means whereby the polypeptide is expressed from an appropriate polynucleotide encoding said polypeptide either directly (the expressed mMCH or mMCH derivative peptide does not require any further processing) or as part of a polypeptide precursor from which the mMCH or mMCH derivative peptide is subsequently cleaved.
  • Such precursors may include signal sequences to direct the expressed peptide to an extracytoplasmic location, or may include peptide "tags" that can be used to facilitate subsequent purification (for example a hexa-histidine peptide, as provided in the pQE vector (Qiagen, Inc.) and described in Gentz et al, Proc Natl Acad Sci USA (1989) 86:821-824, or is an HA tag.
  • the mMCH or mMCH derivative can be engineered to be expressed as part of a natural mMCH precursor, for example that of the human or rat, the peptide being subsequently cleaved from the precursor.
  • the mMCH peptide may be isolated directly from a natural source such as mammalian brain using standard isolation and purification methods (Saito et al, 1999, Nature, 400, 265- 269).
  • an agonist or antagonist of AXOR21 may be identified by contacting a cell expressing on the surface thereof the receptor AXOR21 , said receptor being associated with a second component capable of providing a detectable signal in response to the binding of a compound to said receptor, with a compound to be screened under conditions to permit binding to the receptor; and determining whether the compound binds to, and activates, or inhibits, the receptor, by detecting the presence or absence of a signal generated from the interaction of the compound with the receptor, in the presence of labeled or unlabeled ligand, for example mMCH.
  • an agonist or antagonist of AXOR21 may be identified by determining the inhibition of binding of a ligand to cells which have the receptor (AXOR21) on the surface thereof, or to cell membranes containing the receptor, in the presence of a candidate compound, under conditions to permit binding to the receptor, and determining the amount of ligand bound to the receptor, such that a compound capable of causing reduction of binding of a ligand is an agonist or antagonist, in which method the ligand is mMCH, preferably labelled MCH.
  • such screening methods involve providing appropriate cells which express AXOR21 on the surface thereof.
  • Such cells include cells from mammals, yeast, Drosophila or E. coli.
  • a polynucleotide encoding AXOR21 is employed to transfect cells to thereby express said receptor.
  • Construction of expression vectors comprising an AXOR21 encoding polynucleotide and transfection of cells with said AXOR21 expression vectors can be achieved using standard methods, as described in, for example, Sambrook et al, (supra).
  • Receptor expression may be transient or stable.
  • the expression is stable.
  • a mammalian cell line is transfected with an expression vector comprising a nucleic acid sequence encoding the AXOR21 receptor, for example the polynucleotide of SEQ ID NO: 1, or the coding region thereof, and the cell line then cultured in a culture medium, such that the receptor is stably expressed on the surface of the cell.
  • the expressed receptor is then contacted with a test compound to observe binding, stimulation or inhibition of a functional response, in the presence or absence of a ligand, such as mMCH
  • a ligand such as mMCH
  • a soluble portion of the AX0R21 receptor (le not membrane-bound) comprising the ligand binding domain, may be expressed m the soluble fraction, either in the intracellular compartment, or secreted out of the cell into the medium
  • Techniques for the isolation and purification of expressed soluble receptors are well known in the art
  • One such screening method involves the use of melanophores which are transfected to express the AXOR21 receptor Such a screening technique is descnbed in WO 92/01810, published February 6, 1992
  • Such an assay may be employed to screen for a compound which inhibits activation of the receptor polypeptide of the present invention by contacting the melanophore cells which encode the receptor with both the receptor ligand, such as mMCH, and a compound to be
  • Another method involves screening for compounds which are antagonists, and thus inhibit activation of AXOR21 , by determining inhibition of binding of labeled ligand, such as mMCH, to cells which have the receptor on the surface thereof, or cell membranes containing the receptor
  • a method involves transfecting a eukaryotic cell with DNA encoding AXOR21 such that the cell expresses the receptor on its surface
  • the cell is then contacted with a potential antagonist in the presence of a labeled form of a ligand, such as mMCH
  • the ligand can be labeled, e g , by radioactivity, for instance with 12 3 j 0 ⁇ j me
  • the amount of labeled ligand bound to the receptors is measured, e g , by measunng radioactivity associated with transfected cells or membrane from these cells If the compound binds to the receptor, the binding of labeled ligand to the receptor is inhibited as determined by a reduction of labeled lig
  • a further screening method involves the use of mammalian cells which are transfected to express the receptor of interest
  • the cells are loaded with an indicator dye that produces a fluorescent signal when bound to calcium, and the cells are contacted with a test substance and a receptor agonist, such as mMCH
  • a receptor agonist such as mMCH
  • Any change in fluorescent signal is measured over a defined pe ⁇ od of time using, for example, a fluorescence spectrophotometer or a fluorescence imaging plate reader
  • a change in the fluorescence signal pattern generated by the ligand indicates that a compound is a potential antagonist (or agonist) for the receptor
  • Another such screening method involves use of mammalian cells which are transfected to express the receptor of interest, and which are also transfected with a reporter gene construct that is coupled to activation of the receptor (for example, luciferase or beta-galactosidase behind an approp ⁇ ate promoter)
  • the cells are contacted with a test substance and a receptor hgand, such as mMCH, and the signal produced by the reporter gene is measured after a defined penod of time
  • the signal can be measured usmg a luminometer, spectrophotometer, fluo ⁇ meter, or other such instrument approp ⁇ ate for the specific reporter construct used
  • Inhibition of the signal generated by the ligand indicates that a compound is a potential antagonist for the receptor
  • Another such screening method for antagonists or agomts involves introducing RNA encoding AXOR21 into Xenopus oocytes to transiently or stably express the receptor The receptor oocytes are then contacted with the receptor ligand, such as mMCH, and a compound to be screened Inhibition or activation of the receptor is then determined by detection of a signal, such as, cAMP, calcium, proton, or other ions
  • Another method involves screening for AXOR21 inhibitors by determining inhibition or stimulation of AXOR21 -mediated cAMP and/or adenylate cyclase accumulation or dimunition
  • Such a method involves transiently or stably transfecting a eukaryotic cell with AXOR21 to express the receptor on the cell surface
  • the cell is then exposed to potential antagonists in the presence of an AXOR21 ligand, such as mMCH
  • the changes in levels of cAMP is then measured over a defined pe ⁇ od of time, for example, by radio-immuno or protein binding assays (for example using Flashplates or a scintillation proximity assay) Changes in cAMP levels can also be determined by directly measunng the activity of the enzyme, adenylyl cyclase, in broken cell preparations If the potential antagonist binds the receptor, and thus inhibits AXOR21 binding, the levels of AXOR21 -mediated cAMP, or adenylate
  • yeast Saccharomyces cerevisiae
  • Heterothallic strains of yeast can exist in two mitotically stable haploid mating types, MAT and MAT&. Each cell type secretes a small peptide hormone that binds to a G-protein coupled receptor on opposite mating-type cells which triggers a MAP kinase cascade leading to Gl arrest as a prelude to cell fusion.
  • Genetic alteration of certain genes in the pheromone response pathway can alter the normal response to pheromone, and heterologous expression and coupling of human G-protein coupled receptors and humanized G-protein subunits in yeast cells devoid of endogenous pheromone receptors can be linked to downstream signaling pathways and reporter genes (e.g., U.S. Patents 5,063,154; 5,482,835; 5,691,188).
  • Such genetic alterations include, but are not limited to, (i) deletion of the STE2 or STE3 gene encoding the endogenous G-protein coupled pheromone receptors; (ii) deletion of the FAR1 gene encoding a protein that normally associates with cyclin- dependent kinases leading to cell cycle arrest; and (iii) construction of reporter genes fused to the FUS1 gene promoter (where FUS1 encodes a membrane-anchored glycoprotein required for cell fusion).
  • Downstream reporter genes can permit either a positive growth selection (e.g., histidine prototrophy using the FUS1-HIS3 reporter), or a colorimetric, fluorimetric or spectrophotometric readout, depending on the specific reporter construct used (e.g., ⁇ -galactosidase induction using a FUSl-LacZ reporter).
  • the yeast cells can be further engineered to express and secrete small peptides from random peptide libraries, some of which can permit autocrine activation of heterologously expressed human (or mammalian) G-protein coupled receptors (Broach, J.R. and Thorner, J. Nature 384: 14-16, 1996; Manfredi et al., Mol. Cell. Biol.
  • yeast cells that functionally express human (or mammalian) G-protein coupled receptors linked to a reporter gene readout (e.g., FUSl-LacZ) can be used as a platform for high-throughput screening of known ligands, fractions of biological extracts and libraries of chemical compounds for either natural or surrogate ligands.
  • Functional agonists of sufficient potency can be used as screening tools in yeast cell-based assays for identifying G-protein coupled receptor antagonists.
  • the yeast system offers advantages over mammalian expression systems due to its ease of utility and null receptor background (lack of endogenous G-protein coupled receptors) which often interferes with the ability to identify agonists or antagonists.
  • This invention also provides a method for identifying other ligands for AXOR21, by using, for example, a standard radio-ligand competition assay whereby either mMCH or the test ligand is labelled.
  • a resulting competition assay with non-radiolabelled mMCH or test ligand would provide a receptor affinity constant.
  • further receptors for which mMCH acts as a ligand may be identified by screening potential candidates against mMCH in a suitable assay, for instance determining potential inhibition of forskolin-elevated cAMP levels.
  • Kits may be provided for identifying agonists and antagonists for AXOR21.
  • Such kits comprise: (a) an AXOR21 polypeptide and labeled or unlabeled mMCH;
  • kits may comprise a substantial component.
  • Agonists and/or antagonists may be identified from a variety of sources, for instance, from cells, cell-free preparations, chemical libraries and natural product mixtures. Such agonists and/or antagonists may be natural or modified substrates, ligands, receptors, enzymes, etc., as the case may be, of mMCH; or may be structural or functional mimetics of the polypeptide of the present invention (see Coligan et al, Current Protocols in Immunology l(2):Chapter 5 (1991)).
  • Examples of potential antagonists include: (a) antibodies or, in some cases, oligonucleotides, which bind to the receptor but do not elicit a second messenger response such that the activity of the receptor is prevented;
  • the invention further provides a method of rational drug design comprising the steps: a) probing the structure of the mMCH binding site on the AXOR21 receptor with mMCH or derivatives; b) identifying contacting atoms in the binding site of the AXOR21 receptor that interact with the mMCH ligand during binding; and c) designing agonist or antagonist compounds that interact with the atoms in the binding site identified in (b) to activate (agonist) or inhibit activation of (antagonist) the receptor. Truncated forms of the mMCH ligand are particularly useful in such methods. Conversely, the structure of the mMCH when bound to the ligand binding site on the AXOR21 receptor can also be determined, enabling the design of further antagonist compounds.
  • Such antagonists bind to the mMCH ligand, thereby preventing the binding of the mMCH to the receptor.
  • Methods of using ligands or their derivatives to probe the structure of the ligand binding sites in receptors, and rational drug design based on this structural information are well known in the art (see for example Boyle, S et al Bioorganic & Medicinal Chemistry 1994, 2, 101-113; Beck-Sickinger, A.G et al, European Journal Of Biochemistry 1994, 225, 947-958; McWherter, C.A et al. J.Biol.Chem. 1997, 272, 1 1874-1 1880; Horwell, D.C et al. International Journal of Peptide & Protein Research 1996, 48, 522-531; Bednarek, M.A. et al. Peptides 1999, 20, 401-409).
  • the present invention provides a compound identified as an agonist or an antagonist of AXOR21 for use in therapy, in particular for treating infections such as obesity, diabetes, eating disorders such as anorexia and bulimia, pain; cancers; asthma: Parkinson's disease, acute heart failure: hypotension: hypertension: urinary retention: osteoporosis; angina pecto ⁇ s; myocardial infarction; stroke, ulcers; asthma: allergies benign prostatic hypertrophy: migraine vomiting; psychotic and neurological disorders, including anxiety, schizophrenia, manic depression, depression, delirium, dementia, and severe mental retardation, and dyskmesias. such as Huntington's disease or Gillcs dela Tourctt's syndrome, among others.
  • this invention provides a method of treating an abnormal condition related to an excess of AXOR21 activity and/or a ligand thereof, for example mMCH , which comprises administering to a patient in need thereof an antagonist as hereinbefore described in an amount effective to block binding of ligands to the receptor, or by inhibiting a second signal, and thereby alleviating the abnormal conditions.
  • This invention also provides a method of treating an abnormal condition related to an under- expression of AXOR21 activity and/or a ligand thereof which comprises administering to a patient in need thereof a therapeutically effective amount of an agonist compound, including mMCH, which activates the receptor as hereinbefore described and thereby alleviate the abnormal conditions.
  • an agonist compound including mMCH
  • Identification of a ligand for AXOR21 allows for the effective identification of polyclonal or monoclonal antibodies raised against the AXOR21 which are neutralising antibodies.
  • Such neutralising antibodies are of use in therapy, in comparison to non-neutralising antibodies which are ineffective.
  • the present invention provides for the use of neutralising antibodies raised against AXOR21 in therapy.
  • Such antibodies may be, for example, polyclonal or monoclonal antibodies.
  • the present invention also includes chimeric, single chain or humanised antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures well known in the art may be used for the production of such antibodies.
  • Antibodies generated against AXOR21 may be obtained by direct injection of the isolated receptor into an animal or by administering the receptor to an animal, preferably a non-human. The antibody so obtained willl then bind the receptor.
  • any technique which provides antibodies produced by continuous cell line cultures may be used, for instance the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the humanB-cell hybridoma technique (Kozbor et al, 1985, Immunology Today, 4:72) and the EBV- hybridoma technique to produce human monoclonal antibodies (Cole et al, in Monoclonal Antibodies and Cancer Therapy, Alan R Liss Inc, 1975: 77-96). Techniques described for the production of single chain antibodies in US 4,946,778 can be adapted to produce single chain antibodies to immunogenic polypeptides. In addition, transgenic mice may be used to express humanised antibodies to immunogenic polypeptides.
  • the present invention provides for a pharmaceutical composition
  • a pharmaceutical composition comprising a compound identified as an inhibitor (antagonist) or an activator (agonist) of the AXOR21 and a pharmaceutically acceptable excipient or carrier.
  • the AXOR21 agonists or antagonists may be administered in combination with a suitable pharmaceutical carrier e.g. saline, buffered saline, dextrose, water, glycerol, ethanol, or combinations of these agents.
  • the formulation consists of a therapeutically effective amount of the agonist or antagonist, and the pharmaceutically acceptable carrier.
  • the formulations may be administered by topical, intravenous, intraperitoneal, intramuscular, intranasal or intradermal routes, in amounts which are effective for treating and / or prophylaxis of the specific indication.
  • the formulations will be administered in an amount of at least lOug/kg body weight, and not in excess of about 8mg/kg body weight. In most cases, the dosage is from about lO ⁇ g/kg to about lmg/kg body weight daily, depending on the route of administration, symptoms etc.
  • a liquid formulation will generally consist of a suspension or solution of the compound or pharmaceutically acceptable salt in a suitable liquid carrier(s) for example, ethanol, glycerine, non-aqueous solvent, for example polyethylene glycol, oils, or water with a suspending agent, preservative, flavouring or colouring agent.
  • a suitable liquid carrier(s) for example, ethanol, glycerine, non-aqueous solvent, for example polyethylene glycol, oils, or water with a suspending agent, preservative, flavouring or colouring agent.
  • a composition in the form of a tablet can be prepared using any suitable pharmaceutical carrier(s) routinely used for preparing solid formulations. Examples of such carriers include magnesium stearate, starch, lactose, sucrose and cellulose.
  • a composition in the form of a capsule can be prepared using routine encapsulation procedures.
  • pellets containing the active ingredient can be prepared using standard carriers and then filled into a hard gelatin capsule; alternatively, a dispersion or suspension can be prepared using any suitable pharmaceutical carrier(s), for example aqueous gums, celluloses, silicates or oils and the dispersion or suspension then filled into a soft gelatin capsule.
  • suitable pharmaceutical carrier(s) for example aqueous gums, celluloses, silicates or oils and the dispersion or suspension then filled into a soft gelatin capsule.
  • Typical parenteral compositions consist of a solution or suspension of the compound or pharmaceutically acceptable salt in a sterile aqueous carrier or parenterally acceptable oil, for example polyethylene glycol, polyvinyl pyrrolidone, lecithin, arachis oil or sesame oil.
  • the solution can be lyophilised and then reconstituted with a suitable solvent just prior to administration.
  • a typical suppository formulation comprises an active compound or a pharmaceutically acceptable salt thereof which is active when administered in this way, with a binding and/or lubricating agent such as polymeric glycols, gelatins or cocoa butter or other low melting vegetable or synthetic waxes or fats.
  • the composition is in unit dose form such as a tablet or capsule.
  • Each dosage unit for oral administration contains preferably from 1 to 250 mg (and for parenteral administration contains preferably from 0.1 to 25 mg) of an inhibitor of the invention.
  • the daily dosage regimen for an adult patient may be, for example, an oral dose of between 1 mg and 500 mg, preferably between 1 mg and 250 mg, or an intravenous, subcutaneous, or intramuscular dose of between 0.1 mg and 100 mg, preferably between 0.1 mg and 25 mg, of the active compound, or a pharmaceutically acceptable salt thereof, calculated as the free base, the compound being administered 1 to 4 times per day.
  • the compounds will be administered for a period of continuous therapy.
  • Antibodies as used herein includes polyclonal and monoclonal antibodies, chimeric, single chain, and humanized antibodies, as well as Fab fragments, including the products of an Fab or other immunoglobulin expression library.
  • Isolated means altered “by the hand of man” from its natural state, i.e., if it occurs in nature, it has been changed or removed from its original environment, or both.
  • a polynucleotide or a polypeptide naturally present in a living organism is not “isolated,” but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is “isolated”, as the term is employed herein.
  • a polynucleotide or polypeptide that is introduced into an organism by transformation, genetic manipulation or by any other recombinant method is “isolated” even if it is still present in said organism, which organism may be living or non-living.
  • Polynucleotide generally refers to any polyribonucleotide (RNA) or polydeoxribonucleotide
  • Polynucleotides include, without limitation, single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.
  • polynucleotide refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA.
  • polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons.
  • Modified bases include, for example, tritylated bases and unusual bases such as inosine.
  • a variety of modifications may be made to DNA and RNA; thus, “polynucleotide” embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells.
  • Polynucleotide also embraces relatively short polynucleotides, often referred to as oligonucleotides.
  • Polypeptide refers to any polypeptide comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres.
  • Polypeptide refers to both short chains, commonly referred to as peptides, oligopeptides or oligomers, and to longer chains, generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene-encoded amino acids.
  • Polypeptides include amino acid sequences modified either by natural processes, such as post- translational processing, or by chemical modification techniques that are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature.
  • Modifications may occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present to the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications. Polypeptides may be branched as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched and branched cyclic polypeptides may result from post-translation natural processes or may be made by synthetic methods.
  • Modifications include acetylation, acylation, ADP-ribosylation, amidation, biotinylation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystine, formation of pyroglutamate, formylation, gamma- carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination (see, for instance, Proteins
  • Variant refers to a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide, but retains the essential properties thereof.
  • a typical variant of a polynucleotide differs in nucleotide sequence from the reference polynucleotide.
  • Changes in the nucleotide sequence of the variant may or may not alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide Nucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below
  • a typical variant of a polypeptide differs in amino acid sequence from the reference polypeptide Generally, alterations are limited so that the sequences of the reference polypeptide and the va ⁇ ant are closely similar overall and, in many regions, identical
  • a vanant and reference polypeptide may differ in amino acid sequence by one or more substitutions, insertions, deletions in any combination
  • a substituted or inserted amino acid residue may or may not be one encoded by the genetic code Typical conservative substitutions include Gly, Ala, Val, He, Leu, Asp, Glu, Asn, Gin, Ser, Thr, Lys, Arg, and Phe and Tyr
  • Allele refers to one of two or more alternative forms of a gene occunng at a given locus in the genome
  • Polymo ⁇ hism refers to a vanation in nucleotide sequence (and encoded polypeptide sequence, if relevant) at a given position in the genome withm a population
  • Single Nucleotide Polymo ⁇ hism refers to the occurence of nucleotide va ⁇ abihty at a single nucleotide position in the genome, within a population An SNP may occur within a gene or within lnterge c regions of the genome
  • RNA molecules produced from RNA molecules initially transcnbed from the same genomic DNA sequence but which have undergone alternative RNA splicing
  • Alternative RNA splicing occurs when a pnmary RNA transcnpt undergoes splicing, generally for the removal of mtrons, which results in the production of more than one mRNA molecule each of that may encode different amino acid sequences
  • the term splice va ⁇ ant also refers to the proteins encoded by the above cDNA molecules
  • Identity reflects a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, determined by comparing the sequences In general, identity refers to an exact nucleotide to nucleotide or amino acid to ammo acid correspondence of the two polynucleotide or two polypeptide sequences, respectively, over the length of the sequences being compared
  • % Identity For sequences where there is not an exact correspondence, a “% identity” may be determined
  • the two sequences to be compared are aligned to give a maximum correlation between the sequences This may include inserting "gaps" in either one or both sequences, to enhance the degree of alignment
  • a % identity may be determined over the whole length of each of the sequences being compared (so-called global alignment), that is particularly suitable for sequences of the same or very similar length, or over shorter, defined lengths (so-called local alignment), that is more suitable for sequences of unequal length.
  • Similarity is a further, more sophisticated measure of the relationship between two polypeptide sequences.
  • similarity means a comparison between the amino acids of two polypeptide chains, on a residue by residue basis, taking into account not only exact correspondences between a between pairs of residues, one from each of the sequences being compared (as for identity) but also, where there is not an exact conespondence, whether, on an evolutionary basis, one residue is a likely substitute for the other. This likelihood has an associated "score” from which the "% similarity" of the two sequences can then be determined.
  • BESTFIT is more suited to comparing two polynucleotide or two polypeptide sequences that are dissimilar in length, the program assuming that the shorter sequence represents a portion of the longer.
  • GAP aligns two sequences, finding a "maximum similarity", according to the algorithm of Neddleman and Wunsch (J Mol Biol, 48, 443-453, 1970).
  • GAP is more suited to comparing sequences that are approximately the same length and an alignment is expected over the entire length.
  • the parameters "Gap Weight” and "Length Weight” used in each program are 50 and 3, for polynucleotide sequences and 12 and 4 for polypeptide sequences, respectively.
  • % identities and similarities are determined when the two sequences being compared are optimally aligned.
  • the BLOSUM62 amino acid substitution matrix (Henikoff S and Henikoff J G, Proc. Nat. Acad Sci. USA, 89, 10915-10919, 1992) is used in polypeptide sequence comparisons including where nucleotide sequences are first translated into amino acid sequences before comparison.
  • the program BESTFIT is used to determine the % identity of a query polynucleotide or a polypeptide sequence with respect to a reference polynucleotide or a polypeptide sequence, the query and the reference sequence being optimally aligned and the parameters of the program set at the default value, as hereinbefore described.
  • Identity Index is a measure of sequence relatedness which may be used to compare a candidate sequence (polynucleotide or polypeptide) and a reference sequence.
  • a candidate polynucleotide sequence having, for example, an Identity Index of 0.95 compared to a reference polynucleotide sequence is identical to the reference sequence except that the candidate polynucleotide sequence may include on average up to five differences per each 100 nucleotides of the reference sequence. Such differences are selected from the group consisting of at least one nucleotide deletion, substitution, including transition and transversion, or insertion.
  • a candidate polypeptide sequence having, for example, an Identity Index of 0.95 compared to a reference polypeptide sequence is identical to the reference sequence except that the polypeptide sequence may include an average of up to five differences per each 100 amino acids of the reference sequence. Such differences are selected from the group consisting of at least one amino acid deletion, substitution, including conservative and non-conservative substitution, or insertion. These differences may occur at the amino- or carboxy-terminal positions of the reference polypeptide sequence or anywhere between these terminal positions, interspersed either individually among the amino acids in the reference sequence or in one or more contiguous groups within the reference sequence.
  • n a is the number of nucleotide or amino acid differences
  • x a is the total number of nucleotides or amino acids in SEQ ID NO: l or SEQ ID NO:2, respectively
  • I is the Identity Index
  • Homolog is a generic term used in the art to indicate a polynucleotide or polypeptide sequence possessing a high degree of sequence relatedness to a reference sequence Such relatedness may be quantified by determining the degree of identity and/or similarity between the two sequences as hereinbefore defined Falling within this generic term are the terms "ortholog”, and “paralog” "Ortholog” refers to a polynucleotide or polypeptide that is the functional equivalent of the polynucleotide or polypeptide m another species "Paralog” refers to a polynucleotideor polypeptide that within the same species which is functionally similar
  • Fusion protein refers to a protein encoded by two, often unrelated, fused genes or fragments thereof
  • EP-A-0 464 *** discloses fusion proteins compnsmg various portions of constant region of immunoglobulin molecules together with another human protein or part thereof
  • employing an immunoglobulin Fc region as a part of a fusion protein is advantageous for use in therapy and diagnosis resulting m, for example, improved pharmacokinetic properties [see, e g , EP-A 0232 262]
  • 5' and 3' untranslated sequences refer to those sequences in mRNA flanking the protein coding region and which themselves do not code for protein In eukaryotic mRNA the 5' and 3' untranslated region are of va ⁇ able length, the 3' untranslated sequences frequently reaching several kilobases in length It is usual to refer to these terms in the context of the corresponding DNA sequences for convenience
  • Example 1 Stable expression of AXOR21 receptor in mammalian cell lines - HEK 293
  • the receptor of the present invention was expressed in human embryonic kidney 293 (HEK293) cells To maximize receptor expression 5' and 3' untranslated regions (UTRs) were removed from the AXOR21 cDNA p ⁇ or to insertion into a pCDN (Aiyar, N et al, (1994) Mol Cell Biochem 131 p75-86) or pCDNA3 expression vector (Invitrogen) The cells were transfected with individual receptor cDNAs by hpofection and selected in the presence of 400 mg/ml G418 After 3 weeks of selection, individual clones were picked and expanded for further analysis HEK293 cells transfected with the vector alone serve as negative controls To isolate cell lmes stably expressmg the mdividual receptor, clones were selected and analyzed by functional activity testing on FLIPR (Fluorescent Imaging Plate Reader, Molecular Devices, Sunnyvale, CA)
  • Example 2 Identification of Ligands or Antagonists a) Identification of MCH as a ligand for AXOR21
  • a microtitre plate based Ca2 ⁇ -mob ⁇ hzat ⁇ on FLIPR assay (Fluorescent Imaging Plate Reader, Molecular Devices, Sunnyvale, CA) was used for the functional identification of the ligand activatmg HEK 293 cells stably expressmg AXOR 21 Cells were plated in a poly-D-lystne coated 96 well black/clear plates (Becton Dickinson, Bedford, MA).
  • the expressed receptor is utilized to screen compound banks, complex biological fluids, combmato ⁇ al organic and peptide libranes, etc. to identify antagonists Similarly, the receptor is screened against tissue extracts of human, and other mammalian, species, such as porcine tissue Specifically such tissue extracts include lung, liver, gut, heart, kidney, adrenals, lschemic brain, plasma, unne and placenta Extraction techniques employed in the formation of these tissue banks are known in the art
  • RNA transc ⁇ pts 10 ng/oocyte are injected in a 50 nl bolus using a Drummond microinjection apparatus
  • Two electrode voltage clamp (Warner Instruments) are used to measure the currents from individual Xenopus oocytes Recordings are made in Ca2+ free
  • Microphysiometer assay Screening of these banks is accomplished using a microphysiometer (commercially available from, e g Molecular Devices, Ltd )
  • a microphysiometer commercially available from, e g Molecular Devices, Ltd
  • activation of secondary messenger systems results in the extrusion of small amounts of acid from a cell, formed largely as a result of increased metabolic activity required to fuel the mtracellular signaling process
  • the pH changes in the media surrounding the cell are small and detectable by the microphysiometer
  • any receptor which is coupled to an energy utilizing mtracellular signaling pathway e g , any G-protein coupled receptor
  • Receptors stably expressed in HEK 293 cells can demonstrate a robust calcium response to agonists with the approp ⁇ ate rank order and potency Basal calcium levels in the HEK 293 cells in receptor-transfected or vector control cells is m the normal 100 nM to 200 nM range HEK 293 cells expressing recombinant receptors were loaded with FLUO-4 and in a single day > 150 selected ligands were evaluated for agomst-mduced calcium mobilization Agonists presenting a transient calcium mobilization, for example MCH, were tested in vector control cells to determine if the calcium response was unique to the transfected receptor cells When a unique agonist-induced response is identified, the response is reproduced in a separate group of cells and then pharmacologically charactenzed with concentration response curves for the effective and related ligands
  • HEK 293 cells stably transfected with AXOR21 responded with a robust dose-dependent calcium mobilisation response to mMCH
  • a mMCHbinding competition assay is most useful
  • source of the AXOR21 receptor CHO or HEK 293 cells, stably transfected with the AXOR21 receptor, could be used although other cells transfected with the AXOR21 receptor or cells that naturally show a high level expression of the AXOR21 receptor could also be employed
  • the culture of cells expressing the AXOR21 receptor (see example 1) is scaled up to 30L and cells are recovered by cent ⁇ fugation at 600 x g for 10 mm The cell pellet is then frozen in liquid nitrogen Pellets usually contain around 10 ⁇ cells For membrane isolation, pellets are freeze/ thawed 3 times They are then resuspended in ice cold lOmM T ⁇ s (pH 7 5), 1 mM EDTA (sodium salt) (40 mls/le8 cells) and homogenized using a Dounce (glass/glass) homogemzer (20-25 strokes), followed
  • Membranes obtained this way are suitable for the set-up of a high throughput mMCH binding competition assay to search for compounds that interfere in the hgand-receptor interaction
  • the total binding of mMCHto these membranes is first tested to be linear with the amount of membranes used
  • the time pe ⁇ od to reach equihb ⁇ um binding at a suitable temperature is also established and is in our expe ⁇ ence about 1 h at a temperature of 20 °C
  • For the screening assay typically 25 ⁇ g of membrane protein per well is used in a total volume of 100 ⁇ l buffer containing 50 mM HEPES, 1 mM CaCl2, 5 mM MgCl2 and 0 5 % Bovine serum albumin (western blot quality), pH 7 4
  • the concentration of *25 ⁇ _ mMCH is typically 1-2 nM and 75,000 cpm /well Specific binding of labeled mMCH should be displaced completely by unlabeled mMCH at concentrations
  • mMCH could be tagged with either a fluorescent label (page 415-421, Handbook of Fluorescent Probes and Research Chemicals 6th Edition, RP Haugland editor, Molecular Probes), a biotin label or a enzyme tag like the alkaline phosphatase SEAP-tag (H ⁇ sh ⁇ ema,K et al, J Biol Chem 1997, 272, 5846-53)
  • a fluorescent label page 415-421, Handbook of Fluorescent Probes and Research Chemicals 6th Edition, RP Haugland editor, Molecular Probes
  • biotin label or a enzyme tag like the alkaline phosphatase SEAP-tag (H ⁇ sh ⁇ ema,K et al, J Biol Chem 1997, 272, 5846-53)
  • the binding assay itself would typically be very similar to that descnbed for radiolabeled mMCH Detection of bound mMCH would be by measunng fluorescence, binding of streptavadin or
  • AXOR 21 Expression pattern of AXOR 21 was investigated using Taqman fluorescent PCR (Perkin Elmer) and human cDNAs prepared from vanous brain areas and peripheral tissues All Taqman analysis was carried out according to the manufacturers instructions using the following oligonucleotides AXOR 21 labelled probe 5' AATGAGTGTGGACAGGTACTTTGCCCTCGT 3'
  • Fig 1 shows that AXOR21 mRNA was detected at appreciable levels in brain and at lower levels in intestine, adipose, prostate and cartilage
  • Figure 1 shows the results of the Taqman expe ⁇ ments. Key to tissues- (1) Brain*, (2) pituitary, (3) heart, (4) lung, (5) liver, (6) foetal liver, (7) kidney, (8) skeletal muscle, (9) stomach, (10) small/large intestine, (1 1) spleen, (12) lymphocytes (PBMC), (13) macrophages, (14) adipose, (15) pancreas, (16) prostate (4 males), (17) placenta, (18) cartilage, (19) bone (1 male, 3 females), (20) bone marrow.
  • PBMC lymphocytes
  • pancreas (16) prostate (4 males), (17) placenta
  • cartilage (19) bone (1 male, 3 females), (20) bone marrow.
  • Brain an equal-part mix of the 18 most distinct brain regions representing 75% of sample and 25% of sample is spinal cord. This approach was designed to maximise the chance of detecting genes expressed spefically in small brain sub-regions.
  • Figure 2 shows response (change in fluorescence as measured by FLIPR) in cells transiently expressing either the AXOR 21 receptor or the SLC-1 receptor (Chambers J et al , Nature 1999, 400:261-265, Saito Y et al, Nature 1999, 400:265-269), following challenge with human MCH.
  • the SLC-1 receptor is labelled "11CBY"

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Endocrinology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

AXOR21 polypeptides and polynucleotides and methods for producing such polypeptides by recombinant techniques are disclosed. Also disclosed is the use of AXOR21 polypeptides and an AXOR21 ligand, melanin concentrating hormone (MCH), in identifying compounds that may be agonists or antagonists that are potentially useful in therapy.

Description

Field of the Invention AXOR 21' A G ™>TEIN COUPLED RECEPTOR
This invention relates to newly identified polypeptides and polynucleotides encoding such polypeptides, to their use in diagnosis and in identifying compounds that may be agonists, antagonists that are potentially useful in therapy, and to production of such polypeptides and polynucleotides.
Background of the Invention
The drug discovery process is currently undergoing a fundamental revolution as it embraces "functional genomics", that is, high throughput genome- or gene-based biology. This approach as a means to identify genes and gene products as therapeutic targets is rapidly superceding earlier approaches based on "positional cloning". A phenotype, that is a biological function or genetic disease, would be identified and this would then be tracked back to the responsible gene, based on its genetic map position.
Functional genomics relies heavily on high-throughput DNA sequencing technologies and the various tools of bioinformatics to identify gene sequences of potential interest from the many molecular biology databases now available. There is a continuing need to identify and characterise further genes and their related polypeptides/proteins, as targets for drug discovery.
It is well established that many medically significant biological processes are mediated by proteins participating in signal transduction pathways that involve G-proteins and/or second messengers, e.g., cAMP (Lefkowitz, Nature, 1991 , 351 :353-354). Herein these proteins are referred to as proteins participating in pathways with G-proteins or PPG proteins. Some examples of these proteins include the GPC receptors, such as those for adrenergic agents and dopamine (Kobilka, B. ., et al., Proc. Natl Acad. Sci., USA, 1987, 84:46-50; Kobilka, B.K., et al., Science, 1987, 238:650-656: Bunzow, J.R., et al., Nature, 1988, 336:783- 787). G-proteins themselves, effector proteins, e.g., phospholipase C, adenyl cyclase, and phosphodiesterase. and actuator proteins, e.g., protein kinase A and protein kinase C (Simon, M.I., et al., Science, 1991, 252:802- 8).
For example, in one form of signal transduction, the effect of hormone binding is activation of the enzyme, adenylate cyclase, inside the cell. Enzyme activation by hormones is dependent on the presence of the nucleotide GTP. GTP also influences hormone binding. A G-protein connects the hormone receptor to adenylate cyclase. G-protein was shown to exchange GTP for bound GDP when activated by a hormone receptor. The GTP-carrying form then binds to activated adenylate cyclase. Hydrolysis of GTP to GDP, catalyzed by the G-protein itself, returns the G-protein to its basal, inactive form. Thus, the G-protein serves a dual role, as an intermediate that relays the signal from receptor to effector, and as a clock that controls the duration of the signal. The membrane protein gene superfamily of G-protein coupled receptors has been characterized as having seven putative transmembrane domains. The domains are believed to represent transmembrane a- helices connected by extracellular or cytoplasmic loops G-protein coupled l eceptoi s include a w ide range of biologically active receptors, such as hormone, \ iral. growth factor and neui oreceptoi
G-piotein coupled leceptors (otheiΛvise known as 7TM l eceptoi s) hav e been characterized as including these seven conserved hydi ophobic stretches of about 20 to 30 amino acids connecting at least eight divergent hvdrophilic loops The G-piotein family of coupled l eceptors includes dopamine receptors which bind to neuroleptic daigs used toi ti eating psychotic and neurological disordei s Other examples of members of this fami lv include, but ai e not limited to. calcitonm. adrenei gic. endothe n. c ΛMP adenosme muscai inic. acetylcholme serotonin, histamine, thi ombin. kinin. follicle stimulating hoi mone, ODsins. endothelial differentiation gene- 1. rhodopsins, odoiant and cytomegalov iαia receptors Most G-pi otein coupled l eceptoi s hav e single conserved cysteme residues in each ot the tli st two extracellular loops w hich form disulfide bonds that are believ ed to stabilize functional protein sti ucture The 7 transmembrane legions are designated as TM 1. TM2. TM3, TM4, TM5. TM6. and TM" TM3 has been implicated in signal transduction
Phosphorylation and pidation (palmitylation or famesylation) of cysteme residues can influence signal transduction of some G-protein coupled receptois Most G-piotein coupled receptois contain potential phosphorylation sites within the third cytoplasmic loop and/or the carboxy terminus For seveial G-protein coupled receptors, such as the b-adrenoreceptor, phosphorylation by protein kinase A and or specific receptor kinases mediates receptor desensitization
For some receptors, the ligand binding sites of G-protein coupled receptors are believed to comprise hydrophilic sockets formed by several G-protein coupled receptor transmembrane domains, said socket being surrounded by hydrophobic residues of the G-protein coupled receptors. The hydiophiltc side of each G- protein coupled receptoi transmembrane helix is postulated to face inward and form polar ligand binding site TM3 has been implicated in several G-protein coupled receptors as having a ligand binding site, such as the TM3 aspartate residue TM5 seπnes. a TM6 asparagine and TM6 or TM7 phenylalanines or tyrosines are also implicated in ligand binding
G-protein coupled receptors can be lntracellularly coupled by heterotnmeπc G-proteins to various intracellular enzymes, ion channels and transporters (see. Johnson et al , Endoc Rev , 1989, 10 317-331) Different G-protein a-subunits preferentially stimulate particular effectors to modulate various biological functions in a cell Phosphorylation of cytoplasmic residues of G-protein coupled l eceptors hav e been identified as an important mechanism for the regulation of G-protein coupling of some G-protein coupled receptors G-protein coupled receptors are found in numerous sites within a mammalian host
Over the past 1 yeai s, nearly 350 therapeutic agents targeting 7 ti ansmembiane ("* TM) leceptoi s have been successfully introduced onto the market
Summary of the Invention The present invention relates to ΛXOR2 1 , in particular ΛXOR21 polypeptides and AXOR21 polynucleotides, recombinant mateπals and methods for their production Such polypeptides and polynucleotides are of interest m relation to methods of treatment of certain diseases, including, but not limited to, obesity, diabetes, eating disorders, such as anorexia and bulimia In a further aspect, the invention relates to methods for identifying agonists and antagonists (e g , inhibitors) using the mateπals provided by the invention, and treating conditions associated with A\OR21 imbalance with the identified compounds In a still further aspect, the invention relates to diagnostic assays for detecting diseases associated with inappropπate Λ\O 21 activity or levels
Description of the InvenUon
In a first aspect, the present invention relates to A\OR21 polypeptides Such polypeptides include
(a) an isolated polypeptide encoded by a polynucleotide comprising the sequence of SEQ ID NO 1,
(b) an isolated polypeptide comprising a polypeptide sequence having at least 95%, 96%, 97%, 98%, or 99% identity to the polypeptide sequence of SEQ ID NO 2, (c) an isolated polypeptide compnsmg the polypeptide sequence of SEQ ID NO 2,
(d) an isolated polypeptide having at least 95%, 96%, 97%, 98%, or 99% identity to the polypeptide sequence of SEQ ID NO 2,
(e) the polypeptide sequence of SEQ ID NO 2, and
(f) an isolated polypeptide having or comprising a polypeptide sequence that has an Identity Index of 0 95, 0 96, 0 97, 0 98, or 0 99 compared to the polypeptide sequence of SEQ ID NO 2,
(g) fragments and vaπants of such polypeptides in (a) to (f)
Polypeptides of the present invention are believed to be members of the G protein-coupled receptor family of polypeptides
The biological properties of the AXOR21 are hereinafter referred to as "biological activity of AXOR21 " or "AXOR21 activity" Preferably, a polypeptide of the present invention exhibits at least one biological activity of AXOR21
Polypeptides of the present invention also includes vaπants of the aforementioned polypeptides, including all allelic forms and splice vaπants Such polypeptides vary from the reference polypeptide by insertions, deletions, and substitutions that may be conservative or non-conservative, or any combination thereof Particularly preferred vaπants are those in which several, for instance from 50 to 30, from 30 to 20, from 20 to 10, from 10 to 5, from 5 to 3, from 3 to 2, from 2 to 1 or I ammo acids are inserted, substituted, or deleted, m any combination
Preferred fragments of polypeptides of the present invention include an isolated polypeptide compnsmg an ammo acid sequence having at least 30, 50 or 100 contiguous ammo acids from the ammo acid sequence of SEQ ID NO 2, or an isolated polypeptide compnsmg an ammo acid sequence having at least 30, 50 or 100 contiguous ammo acids truncated or deleted from the ammo acid sequence of SEQ ID NO: 2. Preferred fragments are biologically active fragments that mediate the biological activity of AXOR21 , including those with a similar activity or an improved activity, or with a decreased undesirable activity. Also preferred are those fragments that are antigenic or immunogenic in an animal, especially in a human. Fragments of the polypeptides of the invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, these variants may be employed as intermediates for producing the full-length polypeptides of the invention.The polypeptides of the present invention may be in the form of the "mature" protein or may be a part of a larger protein such as a precursor or a fusion protein. It is often advantageous to include an additional amino acid sequence that contains secretory or leader sequences, pro-sequences, sequences that aid in purification, for instance multiple histidine residues, or an additional sequence for stability during recombinant production.
Polypeptides of the present invention can be prepared in any suitable manner, for instance by isolation form naturally occuring sources, from genetically engineered host cells comprising expression systems (vide infra) or by chemical synthesis, using for instance automated peptide synthesisers, or a combination of such methods.. Means for preparing such polypeptides are well understood in the art.
In a further aspect, the present invention relates to AXOR21 polynucleotides. Such polynucleotides include:
(a) an isolated polynucleotide comprising a polynucleotide sequence having at least 95%, 96%, 97%, 98%, or 99% identity to the polynucleotide squence of SEQ ID NO: 1 ;
(b) an isolated polynucleotide comprising the polynucleotide of SEQ ID NO: 1 ;
(c) an isolated polynucleotide having at least 95%, 96%, 97%, 98%, or 99% identity to the polynucleotide of SEQ ID NO: l;
(d) the isolated polynucleotide of SEQ ID NO: 1 ; (e) an isolated polynucleotide comprising a polynucleotide sequence encoding a polypeptide sequence having at least 95%, 96%, 97%, 98%, or 99% identity to the polypeptide sequence of SEQ ID NO:2;
(f an isolated polynucleotide comprising a polynucleotide sequence encoding the polypeptide of SEQ ID NO:2;
(g) an isolated polynucleotide having a polynucleotide sequence encoding a polypeptide sequence having at least 95%, 96%, 97%, 98%, or 99% identity to the polypeptide sequence of SEQ ID NO:2;
(h) an isolated polynucleotide encoding the polypeptide of SEQ ID NO:2;
(i) an isolated polynucleotide having or comprising a polynucleotide sequence that has an Identity Index of 0.95, 0.96, 0.97, 0.98, or 0.99 compared to the polynucleotide sequence of SEQ ID NO: l; (j) an isolated polynucleotide having or comprising a polynucleotide sequence encoding a polypeptide sequence that has an Identity Index of 0.95, 0.96, 0.97, 0.98, or 0.99 compared to the polypeptide sequence of SEQ ID NO:2; and polynucleotides that are fragments and variants of the above mentioned polynucleotides or that are complementary to above mentioned polynucleotides, over the entire length thereof.
Preferred fragments of polynucleotides of the present invention include an isolated polynucleotide comprising an nucleotide sequence having at least 15, 30, 50 or 100 contiguous nucleotides from the sequence of SEQ ID NO: 1, or an isolated polynucleotide comprising an sequence having at least 30, 50 or 100 contiguous nucleotides truncated or deleted from the sequence of SEQ ID NO: 1.
Preferred variants of polynucleotides of the present invention include splice variants, allelic variants, and polymorphisms, including polynucleotides having one or more single nucleotide polymorphisms (SNPs). Polynucleotides of the present invention also include polynucleotides encoding polypeptide variants that comprise the amino acid sequence of SEQ ID NO:2 and in which several, for instance from 50 to 30, from 30 to 20, from 20 to 10, from 10 to 5, from 5 to 3, from 3 to 2, from 2 to 1 or 1 amino acid residues are substituted, deleted or added, in any combination.
In a further aspect, the present invention provides polynucleotides that are RNA transcripts of the DNA sequences of the present invention. Accordingly, there is provided an RNA polynucleotide that:
(a) comprises an RNA transcript of the DNA sequence encoding the polypeptide of SEQ ID NO:2;
(b) is the RNA transcript of the DNA sequence encoding the polypeptide of SEQ ID NO:2;
(c) comprises an RNA transcript of the DNA sequence of SEQ ID NO: 1; or (d) is the RNA transcript of the DNA sequence of SEQ ID NO: 1 ; and RNA polynucleotides that are complementary thereto.
The polynucleotide sequence of SEQ ID NO:l shows homology with rat somatostatin receptor-like (SLC1) (B Lakaye et al., Biochim. Biophys. Acta 1401:216-220, 1998). The polynucleotide sequence of SEQ ID NO: 1 is a cDNA sequence that encodes the polypeptide of SEQ ID NO:2. The polynucleotide sequence encoding the polypeptide of SEQ ID NO:2 may be identical to the polypeptide encoding sequence of SEQ ID NO: 1 or it may be a sequence other than SEQ ID NO: 1, which, as a result of the redundancy (degeneracy) of the genetic code, also encodes the polypeptide of SEQ ID NO:2. The polypeptide of the SEQ ID NO:2 is related to other proteins of the G protein-coupled receptor family, having homology and/or structural similarity with rat somatostatin receptor-like (SLC 1 ) (B Lakaye et al., Biochim. Biophys. Acta 1401 :216-220, 1998).
Preferred polypeptides and polynucleotides of the present invention are expected to have, inter alia, similar biological functions/properties to their homologous polypeptides and polynucleotides. Furthermore, preferred polypeptides and polynucleotides of the present invention have at least one AXOR21 activity. Polynucleotides of the present invention may be obtained using standard cloning and screening techniques from a cDNA library derived from mRNA in cells of human testes, small intestine, retina, (see for instance, Sambrook et al , Molecular Cloning A Laboratory Manual, 2nd Ed , Cold Spπng Harbor Laboratory Press, Cold Spπng Harbor, N Y (1989)) Polynucleotides of the invention can also be obtained from natural sources such as genomic DNA libraries or can be synthesized using well known and commercially available techniques When polynucleotides of the present invention are used for the recombinant production of polypeptides of the present invention, the polynucleotide may include the coding sequence for the mature polypeptide, by itself, or the coding sequence for the mature polypeptide in reading frame with other coding sequences, such as those encoding a leader or secretory sequence, a pre-, or pro- or prepro- protein sequence, or other fusion peptide portions For example, a marker sequence that facilitates puπfication of the fused polypeptide can be encoded In certain preferred embodiments of this aspect of the invention, the marker sequence is a hexa-histidine peptide, as provided in the pQE vector (Qtagen, Inc ) and descπbed in Gentz et al , Proc Natl Acad Sci USA (1989) 86 821-824, or is an HA tag The polynucleotide may also contain non- coding 5' and 3' sequences, such as transcnbed, non-translated sequences, splicing and polyadenylation signals, nbosome binding sites and sequences that stabilize mRNA Polynucleotides that are identical, or have sufficient identity to a polynucleotide sequence of SEQ ID
NO 1, may be used as hybπdization probes for cDNA and genomic DNA or as pπmers for a nucleic acid amplification reaction (for instance, PCR) Such probes and pπmers may be used to isolate full-length cDNAs and genomic clones encoding polypeptides of the present invention and to isolate cDNA and genomic clones of other genes (including genes encoding paralogs from human sources and orthologs and paralogs from species other than human) that have a high sequence similaπty to SEQ ID NO 1 , typically at least 95%> identity Preferred probes and pπmers will generally compπse at least 15 nucleotides, preferably, at least 30 nucleotides and may have at least 50, if not at least 100 nucleotides Particularly preferred probes will have between 30 and 50 nucleotides Particularly preferred pπmers will have between 20 and 25 nucleotides A polynucleotide encoding a polypeptide of the present invention, including homologs from species other than human, may be obtained by a process compnsmg the steps of screening a library under stringent hybndization conditions with a labeled probe having the sequence of SEQ ID NO 1 or a fragment thereof, preferably of at least 15 nucleotides, and isolating full-length cDNA and genomic clones containing said polynucleotide sequence Such hybπdization techniques are well known to the skilled artisan Preferred stringent hybπdization conditions include overnight incubation at 42°C in a solution compnsmg 50% formamide, 5xSSC (150mM NaCl, 15mM tnsodium citrate), 50 mM sodium phosphate (pH7 6), 5x Denhardt's solution, 10 % dextran sulfate, and 20 microgram/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0 lx SSC at about 65°C Thus the present invention also includes isolated polynucleotides, preferably with a nucleotide sequence of at least 100, obtained by screening a library under stringent hybπdization conditions with a labeled probe having the sequence of SEQ ID NO 1 or a fragment thereof, preferably of at least 15 nucleotides The skilled artisan will appreciate that, in many cases, an isolated cDNA sequence will be incomplete, in that the region coding for the polypeptide does not extend all the way through to the 5' terminus This is a consequence of reverse transcπptase, an enzyme with inherently low "processivity" (a measure of the ability of the enzyme to remain attached to the template dunng the polymeπsation reaction), failing to complete a DNA copy of the mRNA template during first strand cDNA synthesis There are several methods available and well known to those skilled in the art to obtain full- length cDNAs, or extend short cDNAs, for example those based on the method of Rapid Amplification of cDNA ends (RACE) (see, for example, Frohman et al , Proc Nat Acad Sci USA 85, 8998-9002, 1988) Recent modifications of the technique, exemplified by the Marathon (trade mark) technology (Clontech Laboratoπes Inc ) for example, have significantly simplified the search for longer cDNAs. In the
Marathon (trade mark) technology, cDNAs have been prepared from mRNA extracted from a chosen tissue and an 'adaptor' sequence hgated onto each end Nucleic acid amplification (PCR) is then carried out to amplify the "missing" 5' end of the cDNA using a combination of gene specific and adaptor specific ohgonucleotide pπmers The PCR reaction is then repeated using 'nested' pπmers, that is, pπmers designed to anneal within the amplified product (typically an adaptor specific pnmer that anneals further 3' in the adaptor sequence and a gene specific pnmer that anneals further 5' in the known gene sequence) The products of this reaction can then be analysed by DNA sequencing and a full-length cDNA constructed either by joining the product directly to the existing cDNA to give a complete sequence, or carrying out a separate full-length PCR using the new sequence information for the design of the 5' pnmer
Recombinant polypeptides of the present mvention may be prepared by processes well known in the art from genetically engmeered host cells compnsmg expression systems. Accordingly, in a further aspect, the present invention relates to expression systems compnsmg a polynucleotide or polynucleotides of the present invention, to host cells which are genetically engmeered with such expression sytems and to the production of polypeptides of the mvention by recombmant techniques. Cell-free translation systems can also be employed to produce such proteins using RNAs denved from the DNA constructs of the present invention
For recombinant production, host cells can be genetically engineered to incorporate expression systems or portions thereof for polynucleotides of the present invention Polynucleotides may be introduced into host cells by methods descnbed in many standard laboratory manuals, such as Davis et al., Basic Methods in Molecular Biology (1986) and Sambrook et al (ibid). Preferred methods of introducing polynucleotides into host cells include, for instance, calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, catiomc hpid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction or infection Representative examples of appropπate hosts include bacteπal cells, such as Streptococci,
Staphylococci, E coh, Streptomyces and Bacillus subtihs cells; fungal cells, such as yeast cells and Aspergύlus cells, insect cells such as Drosophila S2 and Spodoptera Sf9 cells, animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, HEK 293 and Bowes melanoma cells, and plant cells
A great vaπety of expression systems can be used, for instance, chromosomal, episomal and virus- deπved systems, e g , vectors deπved from bactenal plasmids, from bacteπophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors deπved from combinations thereof, such as those deπved from plasmid and bacteπophage genetic elements, such as cosmids and phagemids The expression systems may contain control regions that regulate as well as engender expression Generally, any system or vector that is able to maintain, propagate or express a polynucleotide to produce a polypeptide in a host may be used The appropπate polynucleotide sequence may be inserted into an expression system by any of a vaπety of well- known and routine techniques, such as, for example, those set forth m Sambrook et al , (ibid) Appropnate secretion signals may be incorporated mto the desired polypeptide to allow secretion of the translated protein into the lumen of the endoplasmic reticulum, the penplasmic space or the extracellular environment These signals may be endogenous to the polypeptide or they may be heterologous signals
If a polypeptide of the present invention is to be expressed for use in screenmg assays, it is generally preferred that the polypeptide be produced at the surface of the cell In this event, the cells may be harvested pnor to use in the screening assay If the polypeptide is secreted into the medium, the medium can be recovered m order to recover and purify the polypeptide If produced intracellularly, the cells must first be lysed before the polypeptide is recovered
Polypeptides of the present invention can be recovered and punfied from recombmant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectm chromatography Most preferably, high performance liquid chromatography is employed for puπfication Well known techniques for refoldmg proteins may be employed to regenerate active conformation when the polypeptide is denatured during lntracellular synthesis, isolation and/or puπfication
Polynucleotides of the present mvention may be used as diagnostic reagents, through detecting mutations in the associated gene Detection of a mutated form of the gene characteπsed by the polynucleotide of SEQ ID NO 1 m the cDNA or genomic sequence and which is associated with a dysfunction will provide a diagnostic tool that can add to, or define, a diagnosis of a disease, or susceptibility to a disease, which results from under-expression, over-expression or altered spatial or temporal expression of the gene Such diseases include, but are not limited to obesity, diabetes, eating disorders such as anorexia and bulimia, pam cancels, asthma Paikinson's disease acute heart failure, hypotension, hypertension urinary retention, osteoporosis, angina pectoπs myocardial infarction stroke, ulcers, asthma, allergies benign prostatic hypertrophy, migraine, vomiting, psvchotic and neurological disoiders, including anxiety, schizophrenia, manic depression, depression, delirium, dementia, and severe mental retardation; and dyskmesias. such as Huntmgton's disease or Gilles deia Tourett's syndrome, hereinafter referred to as "the diseases". Individuals carrying mutations in the gene may be detected at the DNA level by a variety of techniques well known in the art. Nucleic acids for diagnosis may be obtained from a subject's cells, such as from blood, urine, saliva, tissue biopsy or autopsy material. The genomic DNA may be used directly for detection or it may be amplified enzymatically by using PCR, preferably RT-PCR, or other amplification techniques prior to analysis. RNA or cDNA may also be used in similar fashion. Deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to labeled AXOR21 nucleotide sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase digestion or by differences in melting temperatures. DNA sequence difference may also be detected by alterations in the electrophoretic mobility of DNA fragments in gels, with or without denaturing agents, or by direct DNA sequencing (see, for instance, Myers et al, Science (1985) 230: 1242). Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (see Cotton et al, Proc Natl Acad Sci USA (1985) 85: 4397-4401). Single Nucleotide Polymorphisms (SNPs) can be assayed using Allele Specific Amplification (ASA). For the process at least 3 primers are required. A common primer is used in reverse complement to the polymorphism being assayed. This common primer can be between 50 and 1500 bps from the polymoφhic base. The other two (or more) primers are identical to each other except that the final 3' base wobbles to match one of the two (or more) alleles that make up the polymoφhism. Two (or more) PCR reactions are then conducted on sample DNA, each using the common primer and one of the Allele Specific Primers.
An array of oligonucleotides probes comprising AXOR21 polynucleotide sequence or fragments thereof can be constructed to conduct efficient screening of e.g., genetic mutations. Such arrays are preferably high density arrays or grids. Array technology methods are well known and have general applicability and can be used to address a variety of questions m molecular genetics including gene expression, genetic linkage, and genetic variability, see, for example, M.Cheε et al., Science, 274, 610-613 (1996) and other references cited therein. Detection of abnormally decreased or increased levels of polypeptide or mRNA expression may also be used for diagnosing or determining susceptibility of a subject to a disease of the invention. Decreased or increased expression can be measured at the RNA level using any of the methods well known in the art for the quantitation of polynucleotides, such as, for example, nucleic acid amplification, for instance PCR, RT-PCR, RNase protection, Northern blotting and other hybridization methods. Assay techniques that can be used to determine levels of a protein, such as a polypeptide of the present invention, in a sample derived from a host are well-known to those of skill in the art. Such assay methods include radioimmunoassays, competitive-binding assays, Western Blot analysis and ELISA assays.
Thus in another aspect, the present invention relates to a diagonostic kit comprising:
(a) a polynucleotide of the present invention, preferably the nucleotide sequence of SEQ ID NO: 1, or a fragment or an RNA transcript thereof;
(b) a nucleotide sequence complementary to that of (a);
(c) a polypeptide of the present invention, preferably the polypeptide of SEQ ID NO:2 or a fragment thereof; or
(d) an antibody to a polypeptide of the present invention, preferably to the polypeptide of SEQ ID NO:2. It will be appreciated that in any such kit, (a), (b), (c) or (d) may comprise a substantial component. Such a kit will be of use in diagnosing a disease or susceptibility to a disease, particularly diseases of the invention, amongst others.
The polynucleotide sequences of the present invention are valuable for chromosome localisation studies. The sequence is specifically targeted to, and can hybridize with, a particular location on an individual human chromosome. The mapping of relevant sequences to chromosomes according to the present invention is an important first step in correlating those sequences with gene associated disease. Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found in, for example, V. McKusick, Mendelian Inheritance in Man (available on-line through Johns Hopkins University Welch Medical Library). The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (co-inheritance of physically adjacent genes). Precise human chromosomal localisations for a genomic sequence (gene fragment etc.) can be determined using Radiation Hybrid (RH) Mapping (Walter, M. Spillett, D., Thomas, P., Weissenbach, J., and Goodfellow, P., (1994) A method for constructing radiation hybrid maps of whole genomes, Nature Genetics 7, 22-28). A number of RH panels are available from Research Genetics (Huntsville, AL, USA) e.g. the GeneBridge4 RH panel (Hum Mol Genet 1996 Mar;5(3):339-46 A radiation hybrid map of the human genome. Gyapay G, Schmitt K, Fizames C, Jones H, Vega-Czamy N, Spillett D, Muselet D, Prud'Homme JF, Dib C, Auffray C, Morissette J, Weissenbach J, Goodfellow PN). To determine the chromosomal location of a gene using this panel, 93 PCRs are performed using primers designed from the gene of interest on RH DNAs. Each of these DNAs contains random human genomic fragments maintained in a hamster background (human / hamster hybrid cell lines). These PCRs result in 93 scores indicating the presence or absence of the PCR product of the gene of interest. These scores are compared with scores created using PCR products from genomic sequences of known location. This comparison is conducted at http://www.genome.wi.mit.edu/ The polynucleotide sequences of the present invention are also valuable tools for tissue expression studies. Such studies allow the determination of expression patterns of polynucleotides of the present invention which may give an indication as to the expression patterns of the encoded polypeptides in tissues, by detecting the mRNAs that encode them. The techniques used are well known in the art and include in situ hydridisation techniques to clones arrayed on a grid, such as cDNA microarray hybridisation (Schena et al, Science, 270, 467-470, 1995 and Shalon et al, Genome Res, 6, 639-645, 1996) and nucleotide amplification techniques such as PCR. A preferred method uses the TAQMAN (Trade mark) technology available from Perkin Elmer. Results from these studies can provide an indication of the normal function of the polypeptide in the organism. In addition, comparative studies of the normal expression pattern of mRNAs with that of mRNAs encoded by an alternative form of the same gene (for example, one having an alteration in polypeptide coding potential or a regulatory mutation) can provide valuable insights into the role of the polypeptides of the present invention, or that of inappropriate expression thereof in disease. Such inappropriate expression may be of a temporal, spatial or simply quantitative nature.
The polypeptides of the present invention are expressed in, for example, brain, intestine, adipose, prostate and cartilage.
A further aspect of the present invention relates to antibodies. The polypeptides of the invention or their fragments, or cells expressing them, can be used as immunogens to produce antibodies that are immunospecific for polypeptides of the present invention. The term "immunospecific" means that the antibodies have substantially greater affinity for the polypeptides of the invention than their affinity for other related polypeptides in the prior art.
Antibodies generated against polypeptides of the present invention may be obtained by administering the polypeptides or epitope-bearing fragments, or cells to an animal, preferably a non-human animal, using routine protocols. For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler, G. and Milstein, C, Nature (1975) 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al, Immunology Today (1983) 4:72) and the EBV-hybridoma technique (Cole et al, Monoclonal Antibodies and Cancer Therapy, 77-96, Alan R. Liss, Inc., 1985).
Techniques for the production of single chain antibodies, such as those described in U.S. Patent No. 4,946,778, can also be adapted to produce single chain antibodies to polypeptides of this invention. Also, transgenic mice, or other organisms, including other mammals, may be used to express humanized antibodies. The above-described antibodies may be employed to isolate or to identify clones expressing the polypeptide or to purify the polypeptides by affinity chromatography. Antibodies against polypeptides of the present invention may also be employed to treat diseases of the invention, amongst others.
Polypeptides and polynucleotides of the present invention may also be used as vaccines. Accordingly, in a further aspect, the present invention relates to a method for inducing an immunological response in a mammal that comprises inoculating the mammal with a polypeptide of the present invention, adequate to produce antibody and/or T cell immune response, including, for example, cytokine-producing T cells or cytotoxic T cells, to protect said animal from disease, whether that disease is already established within the individual or not. An immunological response in a mammal may also be induced by a method comprises delivering a polypeptide of the present invention via a vector directing expression of the polynucleotide and coding for the polypeptide in vivo in order to induce such an immunological response to produce antibody to protect said animal from diseases of the invention. One way of administering the vector is by accelerating it into the desired cells as a coating on particles or otherwise. Such nucleic acid vector may comprise DNA, RNA, a modified nucleic acid, or a DNA/RNA hybrid. For use a vaccine, a polypeptide or a nucleic acid vector will be normally provided as a vaccine formulation (composition). The formulation may further comprise a suitable carrier. Since a polypeptide may be broken down in the stomach, it is preferably administered parenterally (for instance, subcutaneous, intramuscular, intravenous, or intradermal injection). Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions that may contain anti-oxidants, buffers, bacteriostats and solutes that render the formulation instonic with the blood of the recipient; and aqueous and non-aqueous sterile suspensions that may include suspending agents or thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampoules and vials and may be stored in a freeze-dried condition requiring only the addition of the sterile liquid carrier immediately prior to use. The vaccine formulation may also include adjuvant systems for enhancing the immunogenicity of the formulation, such as oil-in water systems and other systems known in the art. The dosage will depend on the specific activity of the vaccine and can be readily determined by routine experimentation.
A further aspect of the present invention concerns the identification of melanin concentrating hormone (MCH) as a ligand for the AXOR21 receptor polypeptide and the use of MCH and AXOR21 polypeptides in the development of screens for identifying agonist or antagonist compounds. Mammalian MCH (hereinafter "mMCH") is a polypeptide of 19 amino acids and is cyclic (SEQ
ID NO:3, WO 90/11295, The Salk Institute for Biological Research). The human and rat sequences are identical (Vaughan J M et al, Endocrinology, 125(3), 1660, 1989). There is also an earlier identified salmon MCH which is a cyclic heptadecapeptide (Kawauchi H et al, Nature, 305, 321). The peptide is present in the brain of veterbrates and functions as a pigment cell agonist in fish, regulating melanocyte proliferation and melanin synthesis. In mammals it is thought to be involved in hypothalmic regulation of feeding/drinking behavior. (Qu, D et al. Nature 1996, 380:243-7). MCH is over expressed in ob/ob homozygous mice and fasting further increased expression of MCH mRNA in both normal and obese mice. Injection of MCH into lateral ventricles of rats results in increased food consumption. In other studies, intracerebroventricular injection of MCH has been shown to inhibit feeding (Presse, F et al Neuroscience 1996 71 :735-45). Mammalian MCH is initially generated as a precursor polypeptide having 165 amino acids, from which the 19 amino acid MCH peptide is subsequently cleaved. A receptor for which MCH acts as a ligand has been identified as SLC-1 (Chambers J et al., Nature 1999, 400:261-265; Saito Y et al., Nature 1999, 400:265-269).
The identification of mMCH as a ligand for AXOR21 therefore facilitates the development of screening methods for identifying agonists and antagonists of the receptor. Accordingly, the present invention further provides a method of identifying compounds which bind to and activate (agonist) or inhibit activation (antagonist) of the receptor AXOR21 which method comprises using AXOR21, in combination with mMCH or a derivative thereof.
As used herein, "mMCH" refers to mammalian melanin-concentrating hormone, having the amino acid sequence given in SEQ ID NO:3. Derivatives of mMCH which are useful in the present invention include mMCH peptides which have limited modifications to the sequence, for example addition of an amino acid residue at either the N or C terminus, or both, of the peptide, or the substitution of one amino acid residue within the peptide sequence with another. Such additions and substitutions may, for example, facilitate the radioactive or chemical labelling of the peptide thereby enabling detection of the peptide when carrying out the methods of the invention. Such additions or substitutions have little or no effect on the binding properties of the mMCH peptide to the AXOR21 receptor. An example of a suitable amino acid for adding to the N or C terminus of the peptide is lysine. Similarly lysine is an example of an amino acid that can be used to substitute for an amino acid residue in the mMCH peptide. Lysine is a preferred residue for these puφoses because of it's flexibility with regard the range of chemical labels which can be attached to it. Further derivatives include truncated forms of mMCH wherein the mMCH peptide has one or more amino acid residues at the N-terminus, C-terminus or internal amino acid residues removed, or the mMCH peptide derivatives are synthesised to lack said residues. Other derivatives include mMCH peptides wherein one or more amino acid residues are substituted with other amino acid residues. Such substituted derivatives may or may not be truncated. Derivatives such as those described will include other naturally ocurring MCH peptides, for example salmon MCH (H.Kawauchi et al (1993), Ann. N.Y Acad. Sci., 680, 64). mMCH derivatives may include naturally occuring amino acid residues, naturally occuring amino acid residues that have been chemically modified and non-naturally occuring amino acid residues. Examples of modified amino acid residues include radiolabeled residues (for example tyrosine labeled with ^"Iodine) ancj chemically labeled residues with, for example, biotin or a fluorescent label. mMCH is commercially available (Bachem). Alternatively mMCH and mMCH derivatives may be prepared by peptide synthesis methods well known in the art. Alternatively mMCH and mMCH derivatives may be made by recombinant DNA means whereby the polypeptide is expressed from an appropriate polynucleotide encoding said polypeptide either directly (the expressed mMCH or mMCH derivative peptide does not require any further processing) or as part of a polypeptide precursor from which the mMCH or mMCH derivative peptide is subsequently cleaved. Such precursors may include signal sequences to direct the expressed peptide to an extracytoplasmic location, or may include peptide "tags" that can be used to facilitate subsequent purification (for example a hexa-histidine peptide, as provided in the pQE vector (Qiagen, Inc.) and described in Gentz et al, Proc Natl Acad Sci USA (1989) 86:821-824, or is an HA tag. Alternatively the mMCH or mMCH derivative can be engineered to be expressed as part of a natural mMCH precursor, for example that of the human or rat, the peptide being subsequently cleaved from the precursor. For natural mMCH this would involve expression of the natural precursor cDNA sequence whereas for the mMCH derivatives it would be necessary to substitute the desired mMCH derivative natural encoding DNA for the natural mMCH encoding DNA. Such techniques are well known in the art (see for example Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)).
Alternatively the mMCH peptide may be isolated directly from a natural source such as mammalian brain using standard isolation and purification methods (Saito et al, 1999, Nature, 400, 265- 269).
In a one embodiment, an agonist or antagonist of AXOR21 may be identified by contacting a cell expressing on the surface thereof the receptor AXOR21 , said receptor being associated with a second component capable of providing a detectable signal in response to the binding of a compound to said receptor, with a compound to be screened under conditions to permit binding to the receptor; and determining whether the compound binds to, and activates, or inhibits, the receptor, by detecting the presence or absence of a signal generated from the interaction of the compound with the receptor, in the presence of labeled or unlabeled ligand, for example mMCH.
In a further embodiment, an agonist or antagonist of AXOR21 may be identified by determining the inhibition of binding of a ligand to cells which have the receptor (AXOR21) on the surface thereof, or to cell membranes containing the receptor, in the presence of a candidate compound, under conditions to permit binding to the receptor, and determining the amount of ligand bound to the receptor, such that a compound capable of causing reduction of binding of a ligand is an agonist or antagonist, in which method the ligand is mMCH, preferably labelled MCH.
In general, such screening methods involve providing appropriate cells which express AXOR21 on the surface thereof. Such cells include cells from mammals, yeast, Drosophila or E. coli. In particular, a polynucleotide encoding AXOR21 is employed to transfect cells to thereby express said receptor. Construction of expression vectors comprising an AXOR21 encoding polynucleotide and transfection of cells with said AXOR21 expression vectors can be achieved using standard methods, as described in, for example, Sambrook et al, (supra). Receptor expression may be transient or stable. Preferably, the expression is stable. More preferably a mammalian cell line is transfected with an expression vector comprising a nucleic acid sequence encoding the AXOR21 receptor, for example the polynucleotide of SEQ ID NO: 1, or the coding region thereof, and the cell line then cultured in a culture medium, such that the receptor is stably expressed on the surface of the cell. The expressed receptor is then contacted with a test compound to observe binding, stimulation or inhibition of a functional response, in the presence or absence of a ligand, such as mMCH Alternatively a soluble portion of the AX0R21 receptor (le not membrane-bound) comprising the ligand binding domain, may be expressed m the soluble fraction, either in the intracellular compartment, or secreted out of the cell into the medium Techniques for the isolation and purification of expressed soluble receptors are well known in the art One such screening method involves the use of melanophores which are transfected to express the AXOR21 receptor Such a screening technique is descnbed in WO 92/01810, published February 6, 1992 Such an assay may be employed to screen for a compound which inhibits activation of the receptor polypeptide of the present invention by contacting the melanophore cells which encode the receptor with both the receptor ligand, such as mMCH, and a compound to be screened Inhibition of the signal generated by the ligand indicates that a compound is a potential antagonist for the receptor, i e inhibits activation of the receptor The technique may also be employed for screening of compounds which activate the receptor by contacting such cells with compounds to be screened and determining whether such compound generates a signal, i e , activates the receptor Other screening methods include the use of cells which express AXOR21 (for example, transfected CHO cells) in a system which measures extracellular pH changes caused by receptor activation In this technique, compounds may be contacted with cells expressing the receptor polypeptide of the present invention A second messenger response, e g , signal transduction or pH changes, is then measured to determine whether the potential compound activates or inhibits the receptor Another screening method involves expressing AXOR21 in which the receptor is linked to phosphohpase C or D Representative examples of such cells include, but are not limited to, endothehal cells, smooth muscle cells, and embryonic kidney cells The screening may be accomplished as hereinabove descnbed by detecting activation of the receptor or inhibition of activation of the receptor from the phosphohpase second signal Another screening method involves the incubation of the compound with cells expressing the
AXOR21 followed by subsequent detection of an induced calcium signal or the detection of an inhibition of an mMCH-stimulated calcium signal This method provides a means for determining the compound's potential agonist or antagonist effect
Another method involves screening for compounds which are antagonists, and thus inhibit activation of AXOR21 , by determining inhibition of binding of labeled ligand, such as mMCH, to cells which have the receptor on the surface thereof, or cell membranes containing the receptor Such a method involves transfecting a eukaryotic cell with DNA encoding AXOR21 such that the cell expresses the receptor on its surface The cell is then contacted with a potential antagonist in the presence of a labeled form of a ligand, such as mMCH The ligand can be labeled, e g , by radioactivity, for instance with 123j0<jme The amount of labeled ligand bound to the receptors is measured, e g , by measunng radioactivity associated with transfected cells or membrane from these cells If the compound binds to the receptor, the binding of labeled ligand to the receptor is inhibited as determined by a reduction of labeled ligand which binds to the receptors This method is generally referred to as a binding assay In another method, an immunoassay may be used to detect mMCHbinding to its receptor by detecting the immunological reactivity of mMCH with anti-mMCHantibodies in the presence or absence of the test compound The immunoassay may for example involve an antibody sandwich or an enzyme linked immunoassay (ELISA) Such methods are well known in the art and described in, for instance, Methods in Enzymology (1987, vol 154 and 155, Wu and Grossman, and Wu) and Methods in Cell and Molecular Biology (Academic Press, London)
A further screening method involves the use of mammalian cells which are transfected to express the receptor of interest The cells are loaded with an indicator dye that produces a fluorescent signal when bound to calcium, and the cells are contacted with a test substance and a receptor agonist, such as mMCH Any change in fluorescent signal is measured over a defined peπod of time using, for example, a fluorescence spectrophotometer or a fluorescence imaging plate reader A change in the fluorescence signal pattern generated by the ligand indicates that a compound is a potential antagonist (or agonist) for the receptor
Another such screening method involves use of mammalian cells which are transfected to express the receptor of interest, and which are also transfected with a reporter gene construct that is coupled to activation of the receptor (for example, luciferase or beta-galactosidase behind an appropπate promoter) The cells are contacted with a test substance and a receptor hgand, such as mMCH, and the signal produced by the reporter gene is measured after a defined penod of time The signal can be measured usmg a luminometer, spectrophotometer, fluoπmeter, or other such instrument appropπate for the specific reporter construct used Inhibition of the signal generated by the ligand indicates that a compound is a potential antagonist for the receptor
Another such screening method for antagonists or agomts involves introducing RNA encoding AXOR21 into Xenopus oocytes to transiently or stably express the receptor The receptor oocytes are then contacted with the receptor ligand, such as mMCH, and a compound to be screened Inhibition or activation of the receptor is then determined by detection of a signal, such as, cAMP, calcium, proton, or other ions
Another method involves screening for AXOR21 inhibitors by determining inhibition or stimulation of AXOR21 -mediated cAMP and/or adenylate cyclase accumulation or dimunition Such a method involves transiently or stably transfecting a eukaryotic cell with AXOR21 to express the receptor on the cell surface The cell is then exposed to potential antagonists in the presence of an AXOR21 ligand, such as mMCH The changes in levels of cAMP is then measured over a defined peπod of time, for example, by radio-immuno or protein binding assays (for example using Flashplates or a scintillation proximity assay) Changes in cAMP levels can also be determined by directly measunng the activity of the enzyme, adenylyl cyclase, in broken cell preparations If the potential antagonist binds the receptor, and thus inhibits AXOR21 binding, the levels of AXOR21 -mediated cAMP, or adenylate cyclase activity, will be reduced or increased.
Another screening method for agonists and antagonists relies on the endogenous pheromone response pathway in the yeast, Saccharomyces cerevisiae. Heterothallic strains of yeast can exist in two mitotically stable haploid mating types, MAT and MAT&. Each cell type secretes a small peptide hormone that binds to a G-protein coupled receptor on opposite mating-type cells which triggers a MAP kinase cascade leading to Gl arrest as a prelude to cell fusion. Genetic alteration of certain genes in the pheromone response pathway can alter the normal response to pheromone, and heterologous expression and coupling of human G-protein coupled receptors and humanized G-protein subunits in yeast cells devoid of endogenous pheromone receptors can be linked to downstream signaling pathways and reporter genes (e.g., U.S. Patents 5,063,154; 5,482,835; 5,691,188). Such genetic alterations include, but are not limited to, (i) deletion of the STE2 or STE3 gene encoding the endogenous G-protein coupled pheromone receptors; (ii) deletion of the FAR1 gene encoding a protein that normally associates with cyclin- dependent kinases leading to cell cycle arrest; and (iii) construction of reporter genes fused to the FUS1 gene promoter (where FUS1 encodes a membrane-anchored glycoprotein required for cell fusion).
Downstream reporter genes can permit either a positive growth selection (e.g., histidine prototrophy using the FUS1-HIS3 reporter), or a colorimetric, fluorimetric or spectrophotometric readout, depending on the specific reporter construct used (e.g., β-galactosidase induction using a FUSl-LacZ reporter). The yeast cells can be further engineered to express and secrete small peptides from random peptide libraries, some of which can permit autocrine activation of heterologously expressed human (or mammalian) G-protein coupled receptors (Broach, J.R. and Thorner, J. Nature 384: 14-16, 1996; Manfredi et al., Mol. Cell. Biol. 16: 4700-4709, 1996). This provides a rapid direct growth selection (e.g, using the FUS1-HIS3 reporter) for surrogate peptide agonists that activate characterized or oφhan receptors. Alternatively, yeast cells that functionally express human (or mammalian) G-protein coupled receptors linked to a reporter gene readout (e.g., FUSl-LacZ) can be used as a platform for high-throughput screening of known ligands, fractions of biological extracts and libraries of chemical compounds for either natural or surrogate ligands. Functional agonists of sufficient potency (whether natural or surrogate) can be used as screening tools in yeast cell-based assays for identifying G-protein coupled receptor antagonists. For this puφose, the yeast system offers advantages over mammalian expression systems due to its ease of utility and null receptor background (lack of endogenous G-protein coupled receptors) which often interferes with the ability to identify agonists or antagonists.
This invention also provides a method for identifying other ligands for AXOR21, by using, for example, a standard radio-ligand competition assay whereby either mMCH or the test ligand is labelled. A resulting competition assay with non-radiolabelled mMCH or test ligand would provide a receptor affinity constant. Conversely, further receptors for which mMCH acts as a ligand may be identified by screening potential candidates against mMCH in a suitable assay, for instance determining potential inhibition of forskolin-elevated cAMP levels.
Kits may be provided for identifying agonists and antagonists for AXOR21. Such kits comprise: (a) an AXOR21 polypeptide and labeled or unlabeled mMCH;
(b) a recombinant cell expressing an AXOR21 polypeptide and labeled or unlabeled mMCH; or
(c) a cell membrane expressing an AXOR21 polypeptide and labeled or unlabled mMCH.
It will be appreciated that in any such kit, (a), (b), or (c) may comprise a substantial component.
Agonists and/or antagonists may be identified from a variety of sources, for instance, from cells, cell- free preparations, chemical libraries and natural product mixtures. Such agonists and/or antagonists may be natural or modified substrates, ligands, receptors, enzymes, etc., as the case may be, of mMCH; or may be structural or functional mimetics of the polypeptide of the present invention (see Coligan et al, Current Protocols in Immunology l(2):Chapter 5 (1991)).
Examples of potential antagonists include: (a) antibodies or, in some cases, oligonucleotides, which bind to the receptor but do not elicit a second messenger response such that the activity of the receptor is prevented;
(b) proteins which are closely related to the ligand of AXOR21 , i.e. a fragment of mMCH, which have lost biological function and when binding to the AXOR21 receptor, elicit no response;
(c) small molecule which binds to AXOR21, making it inaccessible to ligands such that normal biological activity is prevented, for example, small peptides or peptide-like molecules;
(d) soluble forms of AXOR21, e.g., fragments of the receptor, which bind to the ligand and prevent the ligand from interacting with membrane bound AXOR21.
The invention further provides a method of rational drug design comprising the steps: a) probing the structure of the mMCH binding site on the AXOR21 receptor with mMCH or derivatives; b) identifying contacting atoms in the binding site of the AXOR21 receptor that interact with the mMCH ligand during binding; and c) designing agonist or antagonist compounds that interact with the atoms in the binding site identified in (b) to activate (agonist) or inhibit activation of (antagonist) the receptor. Truncated forms of the mMCH ligand are particularly useful in such methods. Conversely, the structure of the mMCH when bound to the ligand binding site on the AXOR21 receptor can also be determined, enabling the design of further antagonist compounds. Such antagonists bind to the mMCH ligand, thereby preventing the binding of the mMCH to the receptor. Methods of using ligands or their derivatives to probe the structure of the ligand binding sites in receptors, and rational drug design based on this structural information are well known in the art (see for example Boyle, S et al Bioorganic & Medicinal Chemistry 1994, 2, 101-113; Beck-Sickinger, A.G et al, European Journal Of Biochemistry 1994, 225, 947-958; McWherter, C.A et al. J.Biol.Chem. 1997, 272, 1 1874-1 1880; Horwell, D.C et al. International Journal of Peptide & Protein Research 1996, 48, 522-531; Bednarek, M.A. et al. Peptides 1999, 20, 401-409).
Compounds identified using the above screening or rational design methods will be of use in therapy. Accordingly, in a further aspect, the present invention provides a compound identified as an agonist or an antagonist of AXOR21 for use in therapy, in particular for treating infections such as obesity, diabetes, eating disorders such as anorexia and bulimia, pain; cancers; asthma: Parkinson's disease, acute heart failure: hypotension: hypertension: urinary retention: osteoporosis; angina pectoπs; myocardial infarction; stroke, ulcers; asthma: allergies benign prostatic hypertrophy: migraine vomiting; psychotic and neurological disorders, including anxiety, schizophrenia, manic depression, depression, delirium, dementia, and severe mental retardation, and dyskmesias. such as Huntington's disease or Gillcs dela Tourctt's syndrome, among others.
Accordingly, in a further aspect, this invention provides a method of treating an abnormal condition related to an excess of AXOR21 activity and/or a ligand thereof, for example mMCH , which comprises administering to a patient in need thereof an antagonist as hereinbefore described in an amount effective to block binding of ligands to the receptor, or by inhibiting a second signal, and thereby alleviating the abnormal conditions.
This invention also provides a method of treating an abnormal condition related to an under- expression of AXOR21 activity and/or a ligand thereof which comprises administering to a patient in need thereof a therapeutically effective amount of an agonist compound, including mMCH, which activates the receptor as hereinbefore described and thereby alleviate the abnormal conditions.
Identification of a ligand for AXOR21, such as mMCH, allows for the effective identification of polyclonal or monoclonal antibodies raised against the AXOR21 which are neutralising antibodies. Such neutralising antibodies are of use in therapy, in comparison to non-neutralising antibodies which are ineffective. Accordingly, in a further aspect, the present invention provides for the use of neutralising antibodies raised against AXOR21 in therapy.
Such antibodies may be, for example, polyclonal or monoclonal antibodies. The present invention also includes chimeric, single chain or humanised antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures well known in the art may be used for the production of such antibodies.
Antibodies generated against AXOR21 may be obtained by direct injection of the isolated receptor into an animal or by administering the receptor to an animal, preferably a non-human. The antibody so obtained willl then bind the receptor. For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures may be used, for instance the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the humanB-cell hybridoma technique (Kozbor et al, 1985, Immunology Today, 4:72) and the EBV- hybridoma technique to produce human monoclonal antibodies (Cole et al, in Monoclonal Antibodies and Cancer Therapy, Alan R Liss Inc, 1975: 77-96). Techniques described for the production of single chain antibodies in US 4,946,778 can be adapted to produce single chain antibodies to immunogenic polypeptides. In addition, transgenic mice may be used to express humanised antibodies to immunogenic polypeptides.
Compounds, including antibodies, for use in such methods of treatment will normally be provided in pharmaceutical compositions. Accordingly, in a further aspect, the present invention provides for a pharmaceutical composition comprising a compound identified as an inhibitor (antagonist) or an activator (agonist) of the AXOR21 and a pharmaceutically acceptable excipient or carrier. The AXOR21 agonists or antagonists may be administered in combination with a suitable pharmaceutical carrier e.g. saline, buffered saline, dextrose, water, glycerol, ethanol, or combinations of these agents. The formulation consists of a therapeutically effective amount of the agonist or antagonist, and the pharmaceutically acceptable carrier.
The formulations may be administered by topical, intravenous, intraperitoneal, intramuscular, intranasal or intradermal routes, in amounts which are effective for treating and / or prophylaxis of the specific indication. In general, the formulations will be administered in an amount of at least lOug/kg body weight, and not in excess of about 8mg/kg body weight. In most cases, the dosage is from about lOμg/kg to about lmg/kg body weight daily, depending on the route of administration, symptoms etc.
Compounds which are active when given orally can be formulated as liquids, for example syrups, suspensions or emulsions, tablets, capsules and, lozenges. A liquid formulation will generally consist of a suspension or solution of the compound or pharmaceutically acceptable salt in a suitable liquid carrier(s) for example, ethanol, glycerine, non-aqueous solvent, for example polyethylene glycol, oils, or water with a suspending agent, preservative, flavouring or colouring agent. A composition in the form of a tablet can be prepared using any suitable pharmaceutical carrier(s) routinely used for preparing solid formulations. Examples of such carriers include magnesium stearate, starch, lactose, sucrose and cellulose. A composition in the form of a capsule can be prepared using routine encapsulation procedures. For example, pellets containing the active ingredient can be prepared using standard carriers and then filled into a hard gelatin capsule; alternatively, a dispersion or suspension can be prepared using any suitable pharmaceutical carrier(s), for example aqueous gums, celluloses, silicates or oils and the dispersion or suspension then filled into a soft gelatin capsule. Typical parenteral compositions consist of a solution or suspension of the compound or pharmaceutically acceptable salt in a sterile aqueous carrier or parenterally acceptable oil, for example polyethylene glycol, polyvinyl pyrrolidone, lecithin, arachis oil or sesame oil. Alternatively, the solution can be lyophilised and then reconstituted with a suitable solvent just prior to administration. A typical suppository formulation comprises an active compound or a pharmaceutically acceptable salt thereof which is active when administered in this way, with a binding and/or lubricating agent such as polymeric glycols, gelatins or cocoa butter or other low melting vegetable or synthetic waxes or fats.
Preferably the composition is in unit dose form such as a tablet or capsule. Each dosage unit for oral administration contains preferably from 1 to 250 mg (and for parenteral administration contains preferably from 0.1 to 25 mg) of an inhibitor of the invention. The daily dosage regimen for an adult patient may be, for example, an oral dose of between 1 mg and 500 mg, preferably between 1 mg and 250 mg, or an intravenous, subcutaneous, or intramuscular dose of between 0.1 mg and 100 mg, preferably between 0.1 mg and 25 mg, of the active compound, or a pharmaceutically acceptable salt thereof, calculated as the free base, the compound being administered 1 to 4 times per day. Suitably the compounds will be administered for a period of continuous therapy.
Glossary
The following definitions are provided to facilitate understanding of certain terms used frequently hereinbefore. "Antibodies" as used herein includes polyclonal and monoclonal antibodies, chimeric, single chain, and humanized antibodies, as well as Fab fragments, including the products of an Fab or other immunoglobulin expression library.
"Isolated" means altered "by the hand of man" from its natural state, i.e., if it occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or a polypeptide naturally present in a living organism is not "isolated," but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated", as the term is employed herein. Moreover, a polynucleotide or polypeptide that is introduced into an organism by transformation, genetic manipulation or by any other recombinant method is "isolated" even if it is still present in said organism, which organism may be living or non-living. "Polynucleotide" generally refers to any polyribonucleotide (RNA) or polydeoxribonucleotide
(DNA), which may be unmodified or modified RNA or DNA. "Polynucleotides" include, without limitation, single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, "polynucleotide" refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term "polynucleotide" also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications may be made to DNA and RNA; thus, "polynucleotide" embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. "Polynucleotide" also embraces relatively short polynucleotides, often referred to as oligonucleotides.
"Polypeptide" refers to any polypeptide comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres. "Polypeptide" refers to both short chains, commonly referred to as peptides, oligopeptides or oligomers, and to longer chains, generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene-encoded amino acids. "Polypeptides" include amino acid sequences modified either by natural processes, such as post- translational processing, or by chemical modification techniques that are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature. Modifications may occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present to the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications. Polypeptides may be branched as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched and branched cyclic polypeptides may result from post-translation natural processes or may be made by synthetic methods. Modifications include acetylation, acylation, ADP-ribosylation, amidation, biotinylation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystine, formation of pyroglutamate, formylation, gamma- carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination (see, for instance, Proteins - Structure and Molecular Properties, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York, 1993; Wold, F., Post-translational Protein
Modifications: Perspectives and Prospects, 1-12, in Post-translational Covalent Modification of Proteins, B. C. Johnson, Ed., Academic Press, New York, 1983; Seifter et al, "Analysis for protein modifications and nonprotein cofactors", Meth Enzymol, 182, 626-646, 1990, and Rattan et al, "Protein Synthesis: Post-translational Modifications and Aging", Ann NY Acad Sci, 663, 48-62, 1992). "Fragment" of a polypeptide sequence refers to a polypeptide sequence that is shorter than the reference sequence but that retains essentially the same biological function or activity as the reference polypeptide. "Fragment" of a polynucleotide sequence refers to a polynucloetide sequence that is shorter than the reference sequence of SEQ ID NO: l..
"Variant" refers to a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide, but retains the essential properties thereof. A typical variant of a polynucleotide differs in nucleotide sequence from the reference polynucleotide. Changes in the nucleotide sequence of the variant may or may not alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide Nucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below A typical variant of a polypeptide differs in amino acid sequence from the reference polypeptide Generally, alterations are limited so that the sequences of the reference polypeptide and the vaπant are closely similar overall and, in many regions, identical A vanant and reference polypeptide may differ in amino acid sequence by one or more substitutions, insertions, deletions in any combination A substituted or inserted amino acid residue may or may not be one encoded by the genetic code Typical conservative substitutions include Gly, Ala, Val, He, Leu, Asp, Glu, Asn, Gin, Ser, Thr, Lys, Arg, and Phe and Tyr A vanant of a polynucleotide or polypeptide may be naturally occurring such as an allele, or it may be a vaπant that is not known to occur naturally Non-naturally occurring vaπants of polynucleotides and polypeptides may be made by mutagenesis techniques or by direct synthesis Also included as variants are polypeptides having one or more post-translational modifications, for instance glycosylation, phosphorylation, methylation, ADP nbosylation and the like Embodiments include methylation of the N-terminal ammo acid, phosphorylations of seπnes and threomnes and modification of C-terminal glycines
"Allele" refers to one of two or more alternative forms of a gene occunng at a given locus in the genome
"Polymoφhism" refers to a vanation in nucleotide sequence (and encoded polypeptide sequence, if relevant) at a given position in the genome withm a population "Single Nucleotide Polymoφhism" (SNP) refers to the occurence of nucleotide vaπabihty at a single nucleotide position in the genome, within a population An SNP may occur within a gene or within lnterge c regions of the genome
"Splice Vaπant" as used herein refers to cDNA molecules produced from RNA molecules initially transcnbed from the same genomic DNA sequence but which have undergone alternative RNA splicing Alternative RNA splicing occurs when a pnmary RNA transcnpt undergoes splicing, generally for the removal of mtrons, which results in the production of more than one mRNA molecule each of that may encode different amino acid sequences The term splice vaπant also refers to the proteins encoded by the above cDNA molecules
"Identity" reflects a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, determined by comparing the sequences In general, identity refers to an exact nucleotide to nucleotide or amino acid to ammo acid correspondence of the two polynucleotide or two polypeptide sequences, respectively, over the length of the sequences being compared
"% Identity" - For sequences where there is not an exact correspondence, a "% identity" may be determined In general, the two sequences to be compared are aligned to give a maximum correlation between the sequences This may include inserting "gaps" in either one or both sequences, to enhance the degree of alignment A % identity may be determined over the whole length of each of the sequences being compared (so-called global alignment), that is particularly suitable for sequences of the same or very similar length, or over shorter, defined lengths (so-called local alignment), that is more suitable for sequences of unequal length.
"Similarity" is a further, more sophisticated measure of the relationship between two polypeptide sequences. In general, "similarity" means a comparison between the amino acids of two polypeptide chains, on a residue by residue basis, taking into account not only exact correspondences between a between pairs of residues, one from each of the sequences being compared (as for identity) but also, where there is not an exact conespondence, whether, on an evolutionary basis, one residue is a likely substitute for the other. This likelihood has an associated "score" from which the "% similarity" of the two sequences can then be determined.
Methods for comparing the identity and similarity of two or more sequences are well known in the art. Thus for instance, programs available in the Wisconsin Sequence Analysis Package, version 9.1 (Devereux J et al, Nucleic Acids Res, 12, 387-395, 1984, available from Genetics Computer Group, Madison, Wisconsin, USA), for example the programs BESTFIT and GAP, may be used to determine the % identity between two polynucleotides and the % identity and the % similarity between two polypeptide sequences. BESTFIT uses the "local homology" algorithm of Smith and Waterman (J Mol Biol, 147,195- 197, 1981, Advances in Applied Mathematics, 2, 482-489, 1981) and finds the best single region of similarity between two sequences. BESTFIT is more suited to comparing two polynucleotide or two polypeptide sequences that are dissimilar in length, the program assuming that the shorter sequence represents a portion of the longer. In comparison, GAP aligns two sequences, finding a "maximum similarity", according to the algorithm of Neddleman and Wunsch (J Mol Biol, 48, 443-453, 1970). GAP is more suited to comparing sequences that are approximately the same length and an alignment is expected over the entire length. Preferably, the parameters "Gap Weight" and "Length Weight" used in each program are 50 and 3, for polynucleotide sequences and 12 and 4 for polypeptide sequences, respectively. Preferably, % identities and similarities are determined when the two sequences being compared are optimally aligned.
Other programs for determining identity and/or similarity between sequences are also known in the art, for instance the BLAST family of programs (Altschul S F et al, J Mol Biol, 215, 403-410, 1990, Altschul S F et al, Nucleic Acids Res., 25:389-3402, 1997, available from the National Center for Biotechnology Information (NCBI), Bethesda, Maryland, USA and accessible through the home page of the NCBI at www.ncbi.nlm.nih.gov) and FASTA (Pearson W R, Methods in Enzymology, 183, 63-99, 1990; Pearson W R and Lipman D J, Proc Nat Acad Sci USA, 85, 2444-2448, 1988, available as part of the Wisconsin Sequence Analysis Package).
Preferably, the BLOSUM62 amino acid substitution matrix (Henikoff S and Henikoff J G, Proc. Nat. Acad Sci. USA, 89, 10915-10919, 1992) is used in polypeptide sequence comparisons including where nucleotide sequences are first translated into amino acid sequences before comparison. Preferably, the program BESTFIT is used to determine the % identity of a query polynucleotide or a polypeptide sequence with respect to a reference polynucleotide or a polypeptide sequence, the query and the reference sequence being optimally aligned and the parameters of the program set at the default value, as hereinbefore described. "Identity Index" is a measure of sequence relatedness which may be used to compare a candidate sequence (polynucleotide or polypeptide) and a reference sequence. Thus, for instance, a candidate polynucleotide sequence having, for example, an Identity Index of 0.95 compared to a reference polynucleotide sequence is identical to the reference sequence except that the candidate polynucleotide sequence may include on average up to five differences per each 100 nucleotides of the reference sequence. Such differences are selected from the group consisting of at least one nucleotide deletion, substitution, including transition and transversion, or insertion. These differences may occur at the 5' or 3' terminal positions of the reference polynucleotide sequence or anywhere between these terminal positions, interspersed either individually among the nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence. In other words, to obtain a polynucleotide sequence having an Identity Index of 0.95 compared to a reference polynucleotide sequence, an average of up to 5 in every 100 of the nucleotides of the in the reference sequence may be deleted, substituted or inserted, or any combination thereof, as hereinbefore described. The same applies mutatis mutandis for other values of the Identity Index, for instance 0.96, 0.97, 0.98 and 0.99.
Similarly, for a polypeptide, a candidate polypeptide sequence having, for example, an Identity Index of 0.95 compared to a reference polypeptide sequence is identical to the reference sequence except that the polypeptide sequence may include an average of up to five differences per each 100 amino acids of the reference sequence. Such differences are selected from the group consisting of at least one amino acid deletion, substitution, including conservative and non-conservative substitution, or insertion. These differences may occur at the amino- or carboxy-terminal positions of the reference polypeptide sequence or anywhere between these terminal positions, interspersed either individually among the amino acids in the reference sequence or in one or more contiguous groups within the reference sequence. In other words, to obtain a polypeptide sequence having an Identity Index of 0.95 compared to a reference polypeptide sequence, an average of up to 5 in every 100 of the amino acids in the reference sequence may be deleted, substituted or inserted, or any combination thereof, as hereinbefore described. The same applies mutatis mutandis for other values of the Identity Index, for instance 0.96, 0.97, 0.98 and 0.99. The relationship between the number of nucleotide or amino acid differences and the Identity Index may be expressed in the following equation: na ≤ xa " (xa * I). in which: na is the number of nucleotide or amino acid differences, xa is the total number of nucleotides or amino acids in SEQ ID NO: l or SEQ ID NO:2, respectively, I is the Identity Index ,
• is the symbol for the multiplication operator, and in which any non-integer product of xa and I is rounded down to the nearest integer prior to subtracting it from xa "Homolog" is a generic term used in the art to indicate a polynucleotide or polypeptide sequence possessing a high degree of sequence relatedness to a reference sequence Such relatedness may be quantified by determining the degree of identity and/or similarity between the two sequences as hereinbefore defined Falling within this generic term are the terms "ortholog", and "paralog" "Ortholog" refers to a polynucleotide or polypeptide that is the functional equivalent of the polynucleotide or polypeptide m another species "Paralog" refers to a polynucleotideor polypeptide that within the same species which is functionally similar
"Fusion protein" refers to a protein encoded by two, often unrelated, fused genes or fragments thereof In one example, EP-A-0 464 *** discloses fusion proteins compnsmg various portions of constant region of immunoglobulin molecules together with another human protein or part thereof In many cases, employing an immunoglobulin Fc region as a part of a fusion protein is advantageous for use in therapy and diagnosis resulting m, for example, improved pharmacokinetic properties [see, e g , EP-A 0232 262] On the other hand, for some uses it would be desirable to be able to delete the Fc part after the fusion protein has been expressed, detected and punfied
"5' and 3' untranslated sequences" refer to those sequences in mRNA flanking the protein coding region and which themselves do not code for protein In eukaryotic mRNA the 5' and 3' untranslated region are of vaπable length, the 3' untranslated sequences frequently reaching several kilobases in length It is usual to refer to these terms in the context of the corresponding DNA sequences for convenience
The invention is further descnbed m the following examples which are intended to illustrate the invention without limiting its scope
Examples
Example 1 - Stable expression of AXOR21 receptor in mammalian cell lines - HEK 293
The receptor of the present invention was expressed in human embryonic kidney 293 (HEK293) cells To maximize receptor expression 5' and 3' untranslated regions (UTRs) were removed from the AXOR21 cDNA pπor to insertion into a pCDN (Aiyar, N et al, (1994) Mol Cell Biochem 131 p75-86) or pCDNA3 expression vector (Invitrogen) The cells were transfected with individual receptor cDNAs by hpofection and selected in the presence of 400 mg/ml G418 After 3 weeks of selection, individual clones were picked and expanded for further analysis HEK293 cells transfected with the vector alone serve as negative controls To isolate cell lmes stably expressmg the mdividual receptor, clones were selected and analyzed by functional activity testing on FLIPR (Fluorescent Imaging Plate Reader, Molecular Devices, Sunnyvale, CA)
Example 2 - Identification of Ligands or Antagonists a) Identification of MCH as a ligand for AXOR21 A microtitre plate based Ca2 ~-mobιhzatιon FLIPR assay (Fluorescent Imaging Plate Reader, Molecular Devices, Sunnyvale, CA) was used for the functional identification of the ligand activatmg HEK 293 cells stably expressmg AXOR 21 Cells were plated in a poly-D-lystne coated 96 well black/clear plates (Becton Dickinson, Bedford, MA). After 18-24 h the media was aspirated and Fluo 4/AM-loaded cells (Molecular Probes, Eugene, OR) were exposed to mMCH (salmon MCH and synthetic MCH),. After initiation of the assay, fluorescence was read every Is for 1mm and then every 3s for the following lmin. HEK 293 cells transiently expressing AXOR 21 exhibited a dose dependent calcium mobilization response to MCH
b) Identification of other ligands or antagonists
The expressed receptor is utilized to screen compound banks, complex biological fluids, combmatoπal organic and peptide libranes, etc. to identify antagonists Similarly, the receptor is screened against tissue extracts of human, and other mammalian, species, such as porcine tissue Specifically such tissue extracts include lung, liver, gut, heart, kidney, adrenals, lschemic brain, plasma, unne and placenta Extraction techniques employed in the formation of these tissue banks are known in the art
Example 3 - Functional Assays (a) Xenopus oocyte assay
A Xenopus oocyte system is used in the characterization of cell surface receptors because these cells accurately translate mRNA and are capable of carrying out a large number of post-translational modifications, including signal peptide cleavage, glycosylation, phosphorylation and subunit assembly A functional assay is performed as follows In vitro capped RNA transcripts are prepared from hneanzed plasmid templates encoding the AXOR21 receptor cDNA with RNA polymerases using standard protocols In vitro transcπpts are suspended in water at a final concentration of 0 2 mg/ml Ovarian lobes are removed from adult female toad, stage V defol culated oocytes are obtained and RNA transcπpts (10 ng/oocyte) are injected in a 50 nl bolus using a Drummond microinjection apparatus Two electrode voltage clamp (Warner Instruments) are used to measure the currents from individual Xenopus oocytes Recordings are made in Ca2+ free Barth's medium at room temperature
(b) Microphysiometer assay Screening of these banks is accomplished using a microphysiometer (commercially available from, e g Molecular Devices, Ltd ) For example activation of secondary messenger systems results in the extrusion of small amounts of acid from a cell, formed largely as a result of increased metabolic activity required to fuel the mtracellular signaling process The pH changes in the media surrounding the cell are small and detectable by the microphysiometer Thus activation of any receptor which is coupled to an energy utilizing mtracellular signaling pathway (e g , any G-protein coupled receptor) may be detectable
(c) Calcium Assay
Receptors stably expressed in HEK 293 cells can demonstrate a robust calcium response to agonists with the appropπate rank order and potency Basal calcium levels in the HEK 293 cells in receptor-transfected or vector control cells is m the normal 100 nM to 200 nM range HEK 293 cells expressing recombinant receptors were loaded with FLUO-4 and in a single day > 150 selected ligands were evaluated for agomst-mduced calcium mobilization Agonists presenting a transient calcium mobilization, for example MCH, were tested in vector control cells to determine if the calcium response was unique to the transfected receptor cells When a unique agonist-induced response is identified, the response is reproduced in a separate group of cells and then pharmacologically charactenzed with concentration response curves for the effective and related ligands
HEK 293 cells stably transfected with AXOR21 responded with a robust dose-dependent calcium mobilisation response to mMCH
Example 4 - Membrane Preparation and High Throughput Screen for AXOR21
For the discovery of antagonists and agonists of the AXOR21 receptor, a mMCHbinding competition assay is most useful As source of the AXOR21 receptor, CHO or HEK 293 cells, stably transfected with the AXOR21 receptor, could be used although other cells transfected with the AXOR21 receptor or cells that naturally show a high level expression of the AXOR21 receptor could also be employed Typically the culture of cells expressing the AXOR21 receptor (see example 1) is scaled up to 30L and cells are recovered by centπfugation at 600 x g for 10 mm The cell pellet is then frozen in liquid nitrogen Pellets usually contain around 10^ cells For membrane isolation, pellets are freeze/ thawed 3 times They are then resuspended in ice cold lOmM Tπs (pH 7 5), 1 mM EDTA (sodium salt) (40 mls/le8 cells) and homogenized using a Dounce (glass/glass) homogemzer (20-25 strokes), followed by a Polytron suspension with 3-10 sec pulses on a 3/4 setting (Bπnkman tissue homogemzer) This suspension is centnftiged at 300 x g for 10 mm Pellet is discarded and the supematent fraction is centnftiged at 40,000 x g (Sorvall SS-34 18,000 φra) for 30 mm at 4 °C Pellet is resuspended in homogenizing buffer using the polytron and washed one time The pellet is resuspended m assay buffer (50 mM Tπs pH 7 5) at a concentration of 1 - 4 mg protein/ml
Membranes obtained this way are suitable for the set-up of a high throughput mMCH binding competition assay to search for compounds that interfere in the hgand-receptor interaction The total binding of mMCHto these membranes is first tested to be linear with the amount of membranes used The time peπod to reach equihbπum binding at a suitable temperature is also established and is in our expeπence about 1 h at a temperature of 20 °C For the screening assay typically 25 μg of membrane protein per well is used in a total volume of 100 μl buffer containing 50 mM HEPES, 1 mM CaCl2, 5 mM MgCl2 and 0 5 % Bovine serum albumin (western blot quality), pH 7 4 The concentration of *25τ_ mMCH is typically 1-2 nM and 75,000 cpm /well Specific binding of labeled mMCH should be displaced completely by unlabeled mMCH at concentrations of 100 nM or more The compounds to be tested are typically disolved and added m DMSO and final concentrations of DMSO in the assay are 1 % or less After incubation the contents of the wells are harvested on a polyethyleneimine-treated GF/C filter using a 96 well plate cell harvester and the filters is washed four times with typically 1 ml icecold wash buffer containing 20 mM HEPES 0 5M NaCl pH 7 4 To determine any antagonists of labelled mMCH binding, the filters are counted
Alternatively, mMCH could be tagged with either a fluorescent label (page 415-421, Handbook of Fluorescent Probes and Research Chemicals 6th Edition, RP Haugland editor, Molecular Probes), a biotin label or a enzyme tag like the alkaline phosphatase SEAP-tag (Hιshιema,K et al, J Biol Chem 1997, 272, 5846-53) The binding assay itself would typically be very similar to that descnbed for radiolabeled mMCH Detection of bound mMCH would be by measunng fluorescence, binding of streptavadin or by measunng enzyme activity As an alternative for detection of ^^1-mM.CE. by filter binding, a SPA assay (Amersham) might be used
Example 5: Taqman analysis of mRNA tissue distribution
Expression pattern of AXOR 21 was investigated using Taqman fluorescent PCR (Perkin Elmer) and human cDNAs prepared from vanous brain areas and peripheral tissues All Taqman analysis was carried out according to the manufacturers instructions using the following oligonucleotides AXOR 21 labelled probe 5' AATGAGTGTGGACAGGTACTTTGCCCTCGT 3'
AXOR 21 forward pnmer . 5' TTGCCTGTAGTGCCATCATGA 3'
AXOR 21 reverse primer 5' AACGTGTCAGTCGAAATGGTTG 3'
Abundance is presented as the gene's mRNA copies detected per ng mRNA pool isolated from the tissues of 4 non-diseased individuals (2 males - left two bars, 2 females - right two bars) Expression in all 4 individuals is required for confident inteφretation of tissue-dependent trends, while positive expression in single samples may reflect person-dependent expression.
Fig 1 shows that AXOR21 mRNA was detected at appreciable levels in brain and at lower levels in intestine, adipose, prostate and cartilage
Brief description of the figures.
Figure 1. shows the results of the Taqman expeπments. Key to tissues- (1) Brain*, (2) pituitary, (3) heart, (4) lung, (5) liver, (6) foetal liver, (7) kidney, (8) skeletal muscle, (9) stomach, (10) small/large intestine, (1 1) spleen, (12) lymphocytes (PBMC), (13) macrophages, (14) adipose, (15) pancreas, (16) prostate (4 males), (17) placenta, (18) cartilage, (19) bone (1 male, 3 females), (20) bone marrow.
* Brain = an equal-part mix of the 18 most distinct brain regions representing 75% of sample and 25% of sample is spinal cord. This approach was designed to maximise the chance of detecting genes expressed spefically in small brain sub-regions.
Figure 2. shows response (change in fluorescence as measured by FLIPR) in cells transiently expressing either the AXOR 21 receptor or the SLC-1 receptor (Chambers J et al , Nature 1999, 400:261-265, Saito Y et al, Nature 1999, 400:265-269), following challenge with human MCH. In the figure, the SLC-1 receptor is labelled "11CBY"
SEQUENCE INFORMATION
SEQ ID NO: 1
>
ATGAATCCATTTCATGCATCTTGTTGGAACACCTCTGCCGAACTTTTAAACAAATCCTGG AATAAAGAGTTTGCTTATCAAACTGCCAGTGTGGTGGATACAGTCATCCTCCCTTCCATG ATTGGGATTATCTGTTCAACAGGGCTGGTTGGCAACATCCTCATTGTATTCACTATAATA AGATCCAGGAAAAAAACAGTCCCTGACATCTATATCTGCAACCTGGCTGTGGCTGATTTG GTCCACATAGTTGGAATGCCTTTTCTTATTCACCAATGGGCCCGAGGGGGAGAGTGGGTG TTTGGGGGGCCTCTCTGCACCATCATCACATCCCTGGATACTTGTAACCAATTTGCCTGT AGTGCCATCATGACTGTAATGAGTGTGGACAGGTACTTTGCCCTCGTCCAACCATTTCGA CTGACACGTTGGAGAACAAGGTACAAGACCATCCGGATCAATTTGGGCCTTTGGGCAGCT TCCTTTATCCTGGCATTGCCTGTCTGGGTCTACTCGAAGGTCATCAAATTTAAAGACGGT GTTGAGAGTTGTGCTTTTGATTTGACATCCCCTGACGATGTACTCTGGTATACACTTTAT TTGACGATAACAACTTTTTTTTTCCCTCTACCCTTGATTTTGGTGTGCTATATTTTAATT TTATGCTATACTTGGGAGATGTATCAACAGAATAAGGATGCCAGATGCTGCAATCCCAGT GTACCAAAACAGAGAGTGATGAAGTTGACAAAGATGGTGCTGGTGCTGGTGGTAGTCTTT ATCCTGAGTGCTGCCCCTTATCATGTGATACAACTGGTGAACTTACAGATGGAACAGCCC ACACTGGCCTTCTATGTGGGTTATTACCTCTCCATCTGTCTCAGCTATGCCAGCAGCAGC ATTAACCCTTTTCTCTACATCCTGCTGAGTGGAAATTTCCAGAAACGTCTGCCTCAAATC CAAAGAAGAGCGACTGAGAAGGAAATCAACAATATGGGAAACACTCTGAAATCACACTTT TAG
SEQ ID NO:2 > MNPFHASC TSAE NKS KEFAYQTASWDTVILPSMIGI ICSTGLVGNILIVFTI I RSRK TVPDIYICN AVAD VHIVGMPFLIHQ ARGGEWVFGGP CTIITSLDTCNQFAC SAIMTVMSVDRYFA VQPFR TR RTRYKTIRIN GLWAASFILALPV VYSKVIKFKDG VESCAFDLTSPDDλT YTLYLTITTFFFPLPLI VCYILILCYTWEMYQQNKDARCCNPS VPKQRVMKLTKMVLV VWFILSAAPYHVIQLVNLQMEQPTliAFYVGYY SICLSYASSS INPF YILLSGNFQKRLPQIQRRATEKEINNMGNT KSHF
SEQ ID NO:3 >
DFDMLRCM GRVYRPC QV

Claims

Claims
1. An isolated polypeptide selected from the group consisting of:
(a) an isolated polypeptide encoded by a polynucleotide comprising the sequence of SEQ ID NO: 1; (b) an isolated polypeptide comprising a polypeptide sequence having at least 95% identity to the polypeptide sequence of SEQ ID NO:2;
(c) an isolated polypeptide having at least 95% identity to the polypeptide sequence of SEQ ID NO:2; and
(d) fragments and variants of such polypeptides in (a) to (e).
2. The isolated polypeptide as claimed in claim 1 comprising the polypeptide sequence of SEQ ID
NO:2.
3. The isolated polypeptide as claimed in claim 1 which is the polypeptide sequence of SEQ ID NO:2.
4. An isolated polynucleotide selected from the group consisting of:
(a) an isolated polynucleotide comprising a polynucleotide sequence having at least 95% identity to the polynucleotide sequence of SEQ ID NO: l;
(b) an isolated polynucleotide having at least 95% identity to the polynucleotide of SEQ ID NO:l; (c) an isolated polynucleotide comprising a polynucleotide sequence encoding a polypeptide sequence having at least 95% identity to the polypeptide sequence of SEQ ID NO:2;
(d) an isolated polynucleotide having a polynucleotide sequence encoding a polypeptide sequence having at least 95% identity to the polypeptide sequence of SEQ ID NO:2;
(e) an isolated polynucleotide with a nucleotide sequence of at least 100 nucleotides obtained by screening a library under stringent hybridization conditions with a labeled probe having the sequence of SEQ ID NO: 1 or a fragment thereof having at least 15 nucleotides;
(f) a polynucleotide which is the RNA equivalent of a polynucleotide of (a) to (e); or a polynucleotide sequence complementary to said isolated polynucleotide and polynucleotides that are variants and fragments of the above mentioned polynucleotides or that are complementary to above mentioned polynucleotides, over the entire length thereof.
5. An isolated polynucleotide as claimed in claim 4 selected from the group consisting of:
(a) an isolated polynucleotide comprising the polynucleotide of SEQ ID NO: 1 ;
(b) the isolated polynucleotide of SEQ ID NO: 1; (c) an isolated polynucleotide comprising a polynucleotide sequence encoding the polypeptide of SEQ ID NO:2; and (d) an isolated polynucleotide encoding the polypeptide of SEQ ID NO 2
6 An expression vector compnsmg a polynucleotide capable of producing a polypeptide of claim 1 when said expression vector is present in a compatible host cell
7 A recombinant host cell comprising the expression vector of claim 6 or a membrane thereof expressing the polypeptide of claim 1
8 An antibody immunospecific for the polypeptide of any one of claims 1 to 3
9 A method to identify compounds which bind to and activate (agonist) or inhibit activation (antagonist) of the receptor AXOR21 which method compπses using AXOR21, in combination with the ligand mMCH or mMCH deπvative
10 A method according to claim 9 wherein the method is of rational drug design compnsmg the steps a) probing the structure of the mMCH binding site on the AXOR21 receptor with mMCH or derivatives, b) identifying contacting atoms m the binding site of the AXOR21 receptor that interact with the mMCH ligand duπng binding; and c) designing agonist or antagonist compounds that interact with the atoms in the binding site identified in (b) to activate (agonist) or inhibit activation of (antagonist) the receptor
11 A method according to claim 9 in which an agonist or antagonist of AXOR21 may be identified by contacting a cell expressing on the surface thereof the receptor AXOR21 , said receptor being associated with a second component capable of providing a detectable signal in response to the binding of a compound to said receptor, with a compound to be screened under conditions to permit binding to the receptor; and determining whether the compound bmds to, and activates, or inhibits, the receptor, by detecting the presence or absence of a signal generated from the interaction of the compound with the receptor, m the presence of labeled or unlabeled mMCH or mMCH deπvative
12 A method as claimed in claim 9 in which an agonist or antagonist is identified by determining the inhibition of binding of a ligand to cells which have the receptor (AXOR21) on the surface thereof, or to cell membranes containing the receptor, in the presence of a candidate compound, under conditions to permit binding to the receptor, and determining the amount of ligand bound to the receptor, such that a compound capable of causing reduction of binding of a ligand is an agonist or antagonist, in which method the ligand is mMCH or mMCH derivative
13 A method according to claim 12 wherein the mMCH or mMCH deπvative is labelled
14 A method of treating an abnormal condition related to an excess of AXOR21 activity and/or an excess of a ligand thereof which compπses admmisteπng to a patient in need thereof a therapeutically effective amount of an antagonist of the receptor identified using any one of the methods defined in any one of the claims 9 to 13
15 A method of treating an abnormal condition related to an under-expression of AXOR21 activity which comprises administenng to a patient in need thereof a therapeutically effective amount of an agonist of the receptor identified using any one of the methods defined in any one of the claims 9 to 13
16 A method according to claim 15 wherein the agonist is mMCH or an mMCH deπvative
17 A pharmaceutical composition compnsmg a compound identified by any one of the screeninε methods defined in any one of claims 9 to 13 and a pharmaceutically acceptable excipient or earner
18 The use of mMCH or an mMCH deπvative and AXOR21 to identify further ligands for the receptor, using a competitive bindmg assay and labelled mMCH or mMCH deπvative
EP00948173A 1999-07-27 2000-07-27 Axor21, a g-protein coupled receptor Withdrawn EP1196572A1 (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
GBGB9917627.3A GB9917627D0 (en) 1999-07-27 1999-07-27 Novel compounds
GB9917627 1999-07-27
GB9920046 1999-08-24
GBGB9920046.1A GB9920046D0 (en) 1999-08-24 1999-08-24 Novel receptor/ligand
PCT/GB2000/002899 WO2001007606A1 (en) 1999-07-27 2000-07-27 Axor21, a g-protein coupled receptor

Publications (1)

Publication Number Publication Date
EP1196572A1 true EP1196572A1 (en) 2002-04-17

Family

ID=26315801

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00948173A Withdrawn EP1196572A1 (en) 1999-07-27 2000-07-27 Axor21, a g-protein coupled receptor

Country Status (2)

Country Link
EP (1) EP1196572A1 (en)
WO (1) WO2001007606A1 (en)

Families Citing this family (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6555339B1 (en) 1997-04-14 2003-04-29 Arena Pharmaceuticals, Inc. Non-endogenous, constitutively activated human protein-coupled receptors
US7119190B2 (en) 1997-04-14 2006-10-10 Arena Pharmaceuticals, Inc. Endogenous and non-endogenous versions of human G protein-coupled receptors
WO2001036479A1 (en) * 1999-11-16 2001-05-25 Merck & Co., Inc. G-protein coupled receptor
CA2390547A1 (en) * 1999-11-17 2001-05-25 Arena Pharmaceuticals, Inc. Endogenous and non-endogenous versions of human g protein-coupled receptors
EP1686135A1 (en) * 2000-02-23 2006-08-02 Pharmacia & Upjohn Company LLC G protein-coupled receptors
JP4780365B2 (en) * 2000-07-05 2011-09-28 武田薬品工業株式会社 MCH receptor antagonist / agonist screening method
DE60143525D1 (en) 2000-07-05 2011-01-05 Takeda Pharmaceutical PROCESS FOR SCREENING MHC RECEPTOR ANTAGONISTS OR AGONISTS
US7078484B2 (en) 2001-04-19 2006-07-18 Neurogen Corporation Melanin concentrating hormone receptors
US7078187B2 (en) 2001-04-19 2006-07-18 Neurogen Corporation Melanin concentrating hormone receptors
US6858619B2 (en) 2001-05-04 2005-02-22 Amgen Inc. Fused heterocyclic compounds
US6809104B2 (en) 2001-05-04 2004-10-26 Tularik Inc. Fused heterocyclic compounds
WO2002097394A2 (en) 2001-05-31 2002-12-05 Merck & Co., Inc. Rhesus monkey, dog and ferret melanin-concentrating hormone type 2 receptor
US7141391B2 (en) 2001-11-13 2006-11-28 Neurogen Corporation Monkey and canine melanin concentrating hormone receptors
US6902902B2 (en) 2001-11-27 2005-06-07 Arena Pharmaceuticals, Inc. Human G protein-coupled receptors and modulators thereof for the treatment of metabolic-related disorders
DE10225651A1 (en) * 2002-06-08 2003-12-24 Aventis Pharma Gmbh Method of identifying agonists or antagonists for the GPR45like / GPR63 receptor
US7300764B2 (en) 2002-06-08 2007-11-27 Sanofi-Aventis Deutschland Gmbh Method for identifying agonists and antagonists of the GPR45-like/GPR63 receptor
US7045527B2 (en) 2002-09-24 2006-05-16 Amgen Inc. Piperidine derivatives
CN101134757A (en) 2002-11-06 2008-03-05 安姆根有限公司 Fused heterocyclic compounds

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1033401A2 (en) * 1999-02-26 2000-09-06 Genset Expressed sequence tags and encoded human proteins

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1033401A2 (en) * 1999-02-26 2000-09-06 Genset Expressed sequence tags and encoded human proteins

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
See also references of WO0107606A1 *
WILSON ET AL: "ORPHAN G-PROTEIN-COUPLED RECEPTORS: THE NEXT GENERATION OF DRUG TARGETS", BRITISH JOURNAL OF PHARMACOLOGY, vol. 125, December 1998 (1998-12-01), pages 1387 - 1392, XP001010584 *

Also Published As

Publication number Publication date
WO2001007606A1 (en) 2001-02-01

Similar Documents

Publication Publication Date Title
EP1196572A1 (en) Axor21, a g-protein coupled receptor
EP0897980A2 (en) CXCR4B: A human splice variant of CXCR4 chemokine receptor
US6344342B1 (en) Human G protein coupled lysophosphatidic acid receptor
WO2001016159A1 (en) Gpcr, theant
WO2001004139A2 (en) Human axor29 receptor
EP1054903A1 (en) Fishboy, a g-protein coupled receptor
US6881827B2 (en) Molecular cloning of a 7TM receptor (AXOR34) and screening methods thereof
US20010034331A1 (en) EDG family gene, human H218
US6428982B1 (en) Polynucleotides encoding mouse urotensin-II Receptor (UTB-R)
EP1194551A1 (en) G-protein coupled receptor and dna sequences thereof
WO2000064942A1 (en) Axor-27, a g-protein coupled receptor
US20020052330A1 (en) Molecular cloning of a chemokine receptor (SBELEVTM)
WO2001027153A1 (en) A murine seven-transmembrane receptor, mus musculus mhneaa81
WO2001053308A1 (en) Cloning of a monkey 7tm receptor (axor8)
WO2001042486A1 (en) Axor12
GB2364057A (en) G protein coupled receptor
US20020098538A1 (en) 7TM receptor (AXOR23)
US20050054034A1 (en) Thyrotropin-releasing hormone receptor-like gpcr(gprfwki)
GB2371301A (en) G protein coupled receptors
GB2365012A (en) G protein coupled receptor AXOR89
WO2001064836A2 (en) Cloning of a gpr38 variant
US20060154244A1 (en) Novel g-protein coupled receptor
GB2371546A (en) G protein coupled receptor AXOR 109
GB2364058A (en) AXOR79, a G-protein coupled receptor
GB2365009A (en) AXOR polypeptides and polynucleotides

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20011221

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: SMITHKLINE BEECHAM PLC

RBV Designated contracting states (corrected)

Designated state(s): GB

REG Reference to a national code

Ref country code: DE

Ref legal event code: 8566

17Q First examination report despatched

Effective date: 20040930

17Q First examination report despatched

Effective date: 20040930

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20070623