EP1185680A1 - Reverse transcription activity from bacillus stearothermophilus dna polymerase in the presence of magnesium - Google Patents

Abstract

The present invention is directed to a thermostable DNA polymerase from Bacillus stearothermophilus for use in reverse transcription and/or reverse transcriptase-polymerase chain reaction (RT-PCR), where said DNA polymerase shows magnesium ion dependent reverse transcriptase activity and in the substantial absence of manganese ions.

Description

Reverse Transcription Activity from Bacillus Stearothermophilus DNA Polymerase in the Presence of Magnesium

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims priority to US Serial No. 60/135,437 filed May 22, 1999.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR

DEVELOPMENT

Not applicable.

BACKGROUND OF THE INVENTION

The present invention is in the fields of molecular and cellular biology. The invention

is generally related to a thermostable reverse transcriptase derived from Bacillus

stearothermophilus and methods for the reverse transcription of nucleic acid molecules.

Specifically, the invention relates to methods for producing nucleic acid molecules (particularly

cDNA molecules) using a thermostable protein fragment having reverse transcriptase activity in

the presence of magnesium ions and in the substantial absence of manganese ions. The invention

also provides methods for the amplification of a DNA segment from an RNA template using

combinations of reverse transcriptase and thermostable DNA polymerase enzymes using a

thermostable reverse transcriptase derived from Bacillus stearothermophilus.

Reverse Transcription of RNA

The term "reverse transcriptase" describes a class of polymerases characterized as RNA-

dependent DNA polymerases. All known reverse transcriptases require a primer to synthesize a DNA transcript from an RNA template. Reverse transcriptase has been used primarily to

transcribe RNA into cDNA, which can then be cloned into a vector for further manipulation or

used in various amplification methods such as RT-PCR, NASBA, TMA, 3SR, or SPSR.

Reverse transcription is commonly performed with viral reverse transcriptases isolated

from Avian myeloblastosis virus (AMN-RT) or Moloney murine leukemia virus (MMLV-RT),

which are active in the presence of magnesium ions.

Reverse transcription at higher temperatures is advantageous to overcome secondary

structures of the RΝA template which could result in premature termination of products. For this

reason, a reverse transcription reaction may begin with an RΝA denaturation step which can be

carried out, for example, by heating to a temperature generally at least 60 ° C . Unfortunately, both

the AMV-RT and MMLV-RT (RΝase H⁺ or RΝase H^" forms) are inactivated at elevated

temperatures, each having a temperature optimum between 48-55°C or 37-42°C, respectively.

Alternative methods are described in U.S. Pat. Νos. 5,310,652 and 5,322,770 using the

reverse transcriptase activity of DΝA polymerases of thermophilic organisms which are active

at higher temperatures, both of which are incorporated herein by reference. Thermostable DΝA

polymerases with reverse transcriptase activities are commonly isolated from Thermus species.

These DΝA polymerases, however, possess significant reverse transcriptase activity only in the

presence of manganese ions. These reaction conditions are suboptimal because, in the presence

of manganese ions, the polymerase copies the template RΝA with low fidelity and the RΝA

template is prone to increased degradation (Beckman R. A., et al., Biochem 24:5810-5817 (1985);

Ricchetti M. and Buc H., EMBO J. 12:387-396 (1993)). PCR Amplification of RNA

Reverse transcriptases have been extensively used in reverse transcribing RNA prior to

PCR amplification. This method, often referred to as RT-PCR, is widely used for detection and

quantitation of RNA. In RT-PCR, an RNA template is first copied into cDNA using a reverse

transcriptase, a reaction termed "first-strand synthesis." PCR is then performed to exponentially

amplify the cDNA (see U.S. Pat Nos. 4,683,195 and 4,683,202).

In its least sophisticated implementation, the RT-PCR method entails three steps, namely:

(1) denaturation of the RNA by heating; (2) synthesis of the first cDNA strand ("first-strand

synthesis") in a buffer containing, apart from the nucleoside triphosphates, a first primer capable

of hybridizing with a sequence located in the vicinity of the 3' end of the RNA template, and a

reverse transcriptase; and (3) synthesis of the second cDNA strand ("second-strand synthesis")

by addition of a second primer capable of hybridizing with a sequence adjoining the 3' end of the

first cDNA strand (i.e., the primer must be identical or sufficiently homologous to a sequence

adjoining the 5' end of the RNA template) and a DNA polymerase, followed by the succession

of PCR amplifications (Schwartz, S. J. Virol., 24(6):2519-2529 (1990)).

To attempt to address the technical problems often associated with RT-PCR, a number

of protocols have been developed, where the above three step procedure has been reduced to a

"two-step" or a "one-step" protocol.

In the so-called "uncoupled" RT-PCR method ("two-step"), the first-strand synthesis

(cDNA) reaction is performed in one tube. Following cDNA synthesis, the reaction is diluted

into PCR reaction mixtures to decrease MgCl₂ and deoxyribonucleoside triphosphate (dNTP)

concentrations to conditions optimal for Tag DNA polymerase activity, and aliquots are then diluted in separate tubes. By contrast, "coupled" RT-PCR methods ("two-step") use a common

or compromised buffer for reverse transcriptase and Tag DNA polymerase activities. In one

version, after the first-strand synthesis reaction, the tubes are opened and the DNA polymerase(s)

and other PCR reagents are added (Goblet, C. et al., Nucl. Acids Res. 17(5):2144 (1989)). In

another version, the reverse transcriptase activity is a component of the thermostable Tth DNA

polymerase. Annealing and cDNA synthesis are performed in the presence of manganese ions,

then PCR is carried out in the presence of magnesium after the removal of manganese by a

chelating agent (Myers, T.W., et al, Biochem. 30:7661-7666 (1991)). Finally, the "continuous"

RT-PCR method ("one-step") integrates the three RT-PCR steps into a single continuous reaction

that avoids the opening of the reaction tube. Continuous RT-PCR has been described as a single

enzyme system using the reverse transcriptase activity of the thermostable DNA polymerase Tth

and as a two-enzyme system using AMN-RT and Tag DΝA polymerase wherein the initial 65 °C

RΝA denaturation step was omitted.

Each of the above protocols has significant disadvantages. Manganese-dependent reverse

transcription and subsequent amplification with a thermostable DΝA polymerase such as Tth

results in a significantly increased risk of degradation. Moreover, in the presence of manganese

ions, the polymerase copies the template RΝA with low fidelity. The use of viral reverse

transcriptases such as AMN-RT and MMLN-RT, which are not dependent upon manganese for

reverse transcriptase activity, are inactivated at the higher temperatures necessary to overcome

secondary structures of RΝA templates which could result in premature termination of products.

Transcription-based Amplification of RΝA Reverse transcriptases also have been used to reverse transcribe RNA during

transcription-based amplification techniques, where these techniques may be classified either as

temperature cycling reactions or as isothermal reactions. Isothermal amplifications are

conducted at essentially constant temperature, in contrast to the cycling between high and low

temperatures characteristic of amplification reactions such as the PCR.

An example of a transcription-based amplification technique using temperature cycling

is the transcription-based amplification system (TAS), which is described in U.S. Pat. No.

5,437,990 and incorporated herein by reference, and consists of the repetition of a cycle with

three stages. The first stage makes it possible to synthesize a cDNA from RNA in the presence

of reverse transcriptase and a hybrid deoxynucleotide primer containing a specific sequence of

phage RNA polymerase promoter. Following the thermal denaturation of the RNA/cDNA

heteroduplex, the single-stranded cDNA is replicated by reverse transcriptase in the presence of

an anti-sense oligonucleotide primer. The DNA homoduplex thus obtained during this second

stage contains a double-stranded promoter to which a phage DNA-dependent RNA polymerase

can bind. The third stage then consists of transcribing RNA molecules (from 30 to 1000 per

template) which will again be able to serve as template for the synthesis of cDNA and thereby

to continue the amplification cycle (Kwoh, O.Y., et al., Proc. Natl. Acad Sci. USA 86: 1173- 1177

(1989)).

In contrast, various methods have been derived from TAS that are isothermal

amplifications such as Nucleic Acid Sequence-Based Amplification (NASBA) which is

described in U.S. Pat. Nos. 5,130,238 and 5,409,818, both of which are incorporated herein by

reference, Transcription Mediated Amplification (TMA) which is described in U.S. Pat. No.

5,399,491 and incorporated herein by reference, Self-Sustained Sequence Replication (3SR) discussed by Guatelli, J.C., et al. in Proc. Natl. Acad. Sci USA 87, 1874-1878 (1990), with an

eπatum at Proc. Natl. Acad. Sci. USA, 87:7797 (1990), which is incorporated herein by

reference, and Single Primer Sequence Replication (SPSR) which is described in U.S. Pat. No.

5,194,370 and incorporated herein by reference.

These methods have in common the combination of three enzymatic activities: RNA- and

DNA-dependent DNA polymerase (a retrovirus reverse transcriptase such as AMV-RT or

MMLV-RT), ribonuclease H (RNase H) (E. coli enzyme and/or enzymatic activity associated

with reverse transcriptase), and DNA-dependent RNA polymerase (e.g., T7 bacteriophage RNA

polymerase). These methods are based on the same principle and are carried out at a fixed

temperature (from 37°Cto 45°C), according to a continuous process of reverse transcription and

transcription reactions in order to replicate an RNA target via cDNA. As in the case of TAS, an

RNA polymerase (e.g., T7 phage) binding site is introduced into the cDNA by the primer used

for the reverse transcription stage. However, the denaturation of the RNA/cDNA heteroduplex

is carried out isothermally by specific hydrolysis of the RNA of this heteroduplex by RNase H

activity. The free cDNA is then replicated from a second oligonucleotide primer by reverse

transcriptase. The DNA/DNA homoduplex is transcribed into RNA by T7 RNA polymerase and

this RNA can again serve as template for the next cycle.

While the NASBA, TMA, 3SR, and SPSR systems are all able to generate a large

quantity of product, one or more of the enzymes involved in each cannot be used at high

temperatures (i.e., > 45 °C). Therefore, the reaction temperatures cannot be raised to prevent, for

example, non-specific hybridization of the primers. If the primers are shortened in order to make

them melt more easily at low temperatures, the likelihood of having more than one perfect match

in a complex genome increases. Finally, reactions not carried out at high temperatures ineffectively denature, if at all, RNA secondary structure.

A thermostable reverse transcriptase that is active in the presence of magnesium ions and

in the substantial absence of manganese ions would overcome the disadvantages associated with

low temperature nucleic acid amplification reactions, and as such, would greatly enhance

amplification methods such as RT-PCR, NASBA, TMA, 3 SR, or SPSR. Among the advantages

of such a reverse transcriptase are: (1) improved ability to reverse transcribe RNA molecules

with greater secondary structure, especially due to the use of higher reaction temperatures; (2)

greater stability of the reverse transcriptase during performance of reactions at elevated

temperatures; (3) longer shelf-life of the reverse transcriptase due to greater thermostability; (4)

greater accuracy of the reverse transcription product (cDNA) due to the higher fidelity of the

reverse transcriptase; and/or (5) synthesis of larger amounts of cDNA due, in part, to lesser

amounts of RNA substrate degradation.

BRIEF SUMMARY OF THE INVENTION

The present invention is generally directed to thermostable DNA polymerases from

Bacillus stearothermophilus (Bst) which are mutated or truncated forms of the native enzyme

containing a deletion in the 5'-3' exonuclease domain of the enzyme and/or its corresponding

gene, and which exhibit reverse transcriptase activity, preferably in the presence of magnesium

ions and in the substantial absence of manganese ions. These enzymes may be used in first

strand cDNA synthesis and other biochemical protocols that require a reverse transcriptase

activity. Furthermore, because the enzymes provided herein are thermostable, they are suitable

for use in biochemical applications using higher temperatures than many other reverse transcriptases, such as AMV-RT and MMLV-RT.

In a preferred aspect of the invention, a mutated or truncated form of the native Bst DNA

polymerase has a molecular mass of about 55 to 65 kDA as determined by SDS gel

electrophoresis.

In another preferred aspect of the invention, the concentration of magnesium-containing

molecules is at least 1 mM, and more preferably about 1.0 mM to about 10.0 mM, about 1.0 mM

to about 5 mM, and most preferably about 1.0 mM to about 2.0 mM, or about 1.5 mM. The

invention also is directed to such concentrations wherein the source of the magnesium-containing

molecules is a buffer or a magnesium-containing salt which may be magnesium chloride,

magnesium sulfate, or magnesium acetate, as well as other magnesium-containing buffers and

salts that will be familiar to one of ordinary skill.

Additionally, the invention is directed to methods for amplifying a nucleic acid molecule

comprising (a) mixing an RNA template with a composition comprising a truncated form of Bst

DNA polymerase (sold as ISOTHERM™ DNA polymerase, Epicentre Technologies) having

reverse transcriptase activity in the presence of magnesium ions and in the substantial absence

of manganese ions in combination with one or more DNA polymerases to form a mixture; and

(b) incubating the mixture under conditions sufficient to amplify a DNA molecule

complementary to all or a portion of the RNA template. In preferred methods, the DNA

polymerases used are thermostable DNA polymerases, and most preferably Tne, Tma, Tag, Pfu,

Tth, Pwo, Tfl, or a mutant, variant or derivative thereof.

In other preferred aspects of the invention, the DNA polymerases may comprise a first

DNA polymerase having 3' exonuclease activity, most preferably a DNA polymerase selected

from the group consisting of Pfu, Pwo, Tne, Tma, and mutants variants and derivatives thereof, and a second DNA polymerase having substantially reduced 3' exonuclease activity, most

preferably a DNA polymerase selected from the group consisting of Tag, Tfl, Tth, and mutants,

variants and derivatives thereof. In additional preferred aspects of the invention, the unit ratio

of the reverse transcriptase to the DNA polymerases is from about 0.25:1 to about 16:1, and most

preferably a ratio of about 4:1.

The invention also is directed to such methods wherein the mixture further comprises one

or more nucleotides, preferably deoxyribonucleoside triphosphates (most preferably dATP,

dUTP, dTTP, dGTP or dCTP), dideoxyribonucleoside triphosphates (most preferably ddATP,

ddUTP, ddGTP, ddTTP, or ddCTP) or derivatives thereof. Such nucleotides may optionally be

detectably labeled (e.g., with a radioactive or non-radioactive detectable label).

The invention also is directed to such methods wherein such mixture further comprises

one or more oligonucleotide primers, which are preferably oligo(dT) primers, random primers,

arbitrary primers or target-specific primers, and which is more preferably a gene-specific primer.

The invention also is directed to such methods wherein the incubating step comprises (a)

incubating the mixture at a temperature of at least 40 ° C, most preferably with a range of at least

about 40°C to about 80°C, and for a time sufficient to make a DNA molecule complementary

to all or a portion of the RNA template; and (b) incubating the DNA molecule complementary

to the RNA template at a temperature and for a time sufficient to amplify the DNA molecule,

preferably via thermocyclmg, more preferably thermocyclmg comprising alternating heating and

cooling of the mixture sufficient to amplify said DNA molecule, and most preferably

thermocyclmg comprising alternating from a first temperature range of from about 90 ° C to about

100°C, to a second temperature range of from about 45 °C to about 75 °C, preferably from about

60 °C to about 75 °C. In particularly preferred aspects of the invention, the thermocyclmg is performed greater than 20 times, more preferably greater than 30 times.

In a further aspect, the present invention is directed to methods for amplifying a nucleic acid molecule using transcription-based amplification techniques that include, but are not limited

to, NASBA, TMA, 3SR, or SPSR.

A part of the invention includes test kits for carrying out the previously described methods.

Other preferred embodiments of the present invention will be apparent to one of ordinary

skill in light of the following drawings and description of the invention, and of the claims.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a photograph of an ethidium bromide stained gel demonstrating the ability

of both full-length Bst DNA polymerase and the Bst large fragment to produce a 1375 bp cDNA

copy of the 16S ribosomal RNA of E. coli. Lane M contains a DNA sizing ladder. Lanes 1 and

2 contain the cDNA produced by full-length Bst DNA polymerase. Lanes 3 and 4 contain the

cDNA produced by the Bst large fragment.

Figure 2 is a photograph of an ethidium bromide stained gel demonstrating the effect of

magnesium concentration on cDNA synthesis. Reverse transcription of the 16S ribosomal RNA

of E. coli with the large fragment of Bst DNA polymerase, in the presence of magnesium, results

in a 1375 b cDNA. Lane M contains a 100 bp DNA sizing ladder; Lanes 1-4 contain 0, 1.0, 2.0,

and 3.0 mM MgCl₂ respectively.

Figure 3 is a photograph of an ethidium bromide stained gel demonstrating coupled

reverse transcription, in the presence of magnesium or manganese, using the large fragment of

Bst DNA polymerase, and Tag DNA polymerase for the PCR amplification. The 463 bp amplification product of a region of the tobacco mosaic virus (TMV) RNA is indicated with an

arrow. Lane M contains 100 bp DNA sizing ladder; Lane 1 contains the reaction with no

magnesium or manganese present during reverse transcription; in Lane 2 the RT reaction

contained only 1.5 mM MgCl₂; in Lane 3 the RT reaction contained only 0.5 mM MnSO₄.

Figure 4 is a photograph of an ethidium bromide stained gel demonstrating a long RNA

amplification with the large fragment of Bst DNA polymerase in the presence of magnesium,

coupled with a mix of thermostable DNA polymerases. Continuous reverse transcription and

PCR amplification of a region of TMV RNA with the large fragment of Bst DNA polymerase,

Tag DNA polymerase and Pwo DNA polymerase, results in a 4650 bp product. Lane M contains

a DNA sizing ladder; Lanes 1 and 2 are the products from reactions containing OX and IX

MASTERAMP PCR Enhancer (Epicentre Technologies) respectively.

DETAILED DESCRIPTION OF THE INVENTION

The present invention is directed to a thermostable and enzymatically active truncated

fragment derived from native full-length Bacillus stearothermophilus DNA polymerase for use

in reverse transcription and/or reverse transcriptase-polymerase chain reaction (RT-PCR), where

it has been unexpectedly discovered that said fragment has significant reverse transcriptase

activity in the presence of magnesium ions and in the substantial absence of manganese ions.

The invention also provides compositions comprising Bst enzymes having reverse transcriptase

activity, one or more DNA polymerases, one or more primers, one or more nucleotides, and a

suitable buffer. These compositions may be used in the methods of the invention to produce, analyze, quantitate and otherwise manipulate nucleic acid molecules using a one- or two-step

RT-PCR procedure.

Reverse Transcriptase Enzymes

The present invention relates to a thermostable and enzymatically active truncated

fragment derived from native full-length Bacillus stearothermophilus DNA polymerase ( "Bst

large fragment") having reverse transcriptase activity in the presence of magnesium ions and in

the substantial absence of manganese ions. Bst DNA polymerase type strain 5, ATCC number

12980, was obtained from the American Type Culture Collection, Rockville, Md. Using

procedures well known in the art, a genomic library was prepared from said strain that led to the

identification of a clone that expressed the full-length Bst DNA polymerase. The full-length

protein may be purified according to any number of protocols known in the art (see e.g. , Ye, S. Y.

and Hong, G.F., Scientia Sinica, 30:503 (1987) andU.S. Pat. No. 5,874,282, col. 11, lines 3-51).

The purified full-length Bst DNA polymerase (167 μg/ml) (microgram/ml) in a standard

storage buffer (50% (v/v) glycerol solution; 0.05 M Tris-HCl pH 7.5; 0.1 mM EDTA; 1 mM

DTT; 0.1 M NaCl; and 0.1% Triton X-100) was treated with 0.01 volumes of 25 μg/ml

(microgram/milliliter) subtilisin for 16 hours at room temperature. The proteolysis reaction was

terminated by adding 0.01 volumes of 100 mM PMSF in absolute ethanol followed by mixing.

The solution was diluted with 1 volume of water and subjected to chromatography on a Bio-Rex

70 Ion Exchange Column (Bio-Rad Laboratories, Hercules, CA). The enzyme which bound to

the column under these conditions was subsequently eluted with a linear NaCl gradient for 0.05

to 0.5 M in a chromatography buffer (0.05 M Tris-HCl pH 7.5; 0.1 mM EDTA; 1% (v/v) β-

mercaptoethanol; and 5% (v/v) glycerol). The fractions were assayed for Bst polymerase activity and for purity by 10% SDS electrophoresis before pooling. The pool was dialyzed against the

above described standard storage buffer.

Subsequent analysis of the active, truncated large fragment revealed (1 ) that the fragment

has a molecular mass of about 55 to 65 kDA as determined by 10% SDS PAGE, (2) that the

fragment lacks 5 '-3' exonuclease activity, and (3) that the fragment has reverse transcriptase

activity in the presence of magnesium ions and in the substantial absence of manganese ions.

Particularly preferred enzymes for use in the invention include Bst reverse transcriptases,

but are not necessarily limited to, commercially available enzymes such as ISOTHERM™ DNA

polymerase, available from Epicentre Technologies Corp., Madison, WI.

Compositions

The buffer in the compositions of the invention provide appropriate pH and ionic

conditions for Bst enzymes having reverse transcriptase activity and DNA polymerase enzymes.

The nucleotides used in the compositions (e.g., deoxyribonucleoside triphosphates (dNTPs)), and

the primer nucleic acid molecules provide the substrates for synthesis or amplification of nucleic

acid molecules in accordance with the invention.

Buffer and Ionic Conditions

The buffer and ionic conditions of the present compositions have been optimized to yield

total and full-length cDNA product in reverse transcription and amplification reactions.

Preferred compositions of the invention provide a concentration of magnesium-containing

molecules of at least 1 mM, and more preferably about 1.0 mM to about 10.0 mM, about 1.0 mM

to about 5 mM, and most preferably about 1.0 mM to about 2.0 mM, or about 1.5 mM. The

invention also is directed to such concentrations wherein the source of the magnesium-containing molecules is a buffer or a magnesium-containing salt which may be magnesium chloride,

magnesium sulfate, or magnesium acetate, as well as other magnesium-containing buffers and

salts that will be familiar to one of ordinary skill.

DNA Polymerases

The compositions of the invention also comprise one or more DNA polymerases, which

are preferably thermostable DNA polymerases. These DNA polymerases may be isolated from

natural or recombinant sources, by techniques well-known in the art, from a variety of

thermophilic bacteria that are available commercially, or may be obtained by recombinant DNA

techniques. Suitable for use as sources of thermostable polymerases or the genes thereof for

expression in recombinant systems are the thermophilic bacteria Thermus aguaticus, Thermus

thermophilus, Thermococcus litoralis, Pyrococcusfuriosus, Pyrococcus wosei and other species

of the Pyrococcus genus, Bacillus stearothermophilus, Sulfolobus acidocaldarius,

Thermoplasma acidophilum, Thermus flavus, Thermus ruber, Thermus brockianus, Thermotoga

neapolitana, Thermotoga maritima and other species of the Thermotoga genus, and

Methanobacterium thermoautorophicum, and mutants variants or derivatives thereof. It is to be

understood, however, that thermostable DNA polymerases from other organisms may also be

used in the present invention without departing from the scope or preferred embodiments thereof.

Thermostable DNA polymerases such as Tag is preferably added to the present

compositions at a final concentration in solution of about 25-100 units per milliliter, most

preferably 100 units per milliliter, and Bst large fragment (sold as ISOTHERM DNA polymerase,

Epicentre Technologies) is preferably added to the present compositions at final concentration

in solution of about 25-400 units per milliliter, most preferably 400 units per milliliter.

In preferred compositions of the invention, the concentration of DNA polymerases is determined as a ratio of the concentration of the enzymes having reverse transcriptase activity.

Thus, in particularly prefeπed compositions the ratio units of the Bst large fragment having

reverse transcriptase activity to Tag DNA polymerase ranges from about 0.25:1 to about 16:1,

most preferably a ratio of about 4:1. Of course, other suitable ratios of unit activities of reverse

transcriptase enzymes to DNA polymerases suitable for use in the invention will be apparent to

one of ordinary skill in the art.

dNTPs

The compositions of the invention further comprise one or more nucleotides (e.g.,

deoxyribonucleoside triphosphates (dNTPs)). The nucleotide components of the present

compositions serve as the building blocks for newly synthesized nucleic acids, being

incorporated therein by the action of the reverse transcriptases or DNA polymerases. Examples

of nucleotides suitable for use in the present compositions include, but are not limited to, dUTP,

dATP, dTTP, dCTP, dGTP, dITP, 7-deaza-dGTP, α-thio-dATP, α-thio-dTTP, α-thio-dGTP, α-

thio-dCTP or derivatives thereof, all of which are available commercially from various suppliers.

The dNTPs may be unlabeled, or they may be detectably labeled by coupling them by methods

known in the art with radioisotopes, vitamins, fluorescent moieties, chemiluminescent labels,

dioxigenin and the like. Labeled dNTPs may also be obtained from commercial suppliers. In

the compositions, the dNTPs are added to give a working concentration of each dNTP of about

200 μM (micromolar). Other suitable working concentrations will be apparent to one of ordinary

skill in the art.

Primers

In addition to nucleotides, the present compositions comprise one or more primers which

facilitate the synthesis of a first strand DNA molecule complementary (single-stranded cDNA molecule) to all or a portion of an RNA template. Such primers may also be used to synthesize

a DNA molecule complementary to all or a portion of the first strand DNA molecule, thereby

forming a double-stranded cDNA molecule. Additionally, these primers may be used in

amplifying nucleic acid molecules in accordance with the invention. Such primers include, but

are not limited to, target-specific primers (which are preferably gene-specific primers), oligo(dT)

primers, random primers or arbitrary primers. Additional primers that may be used for

amplification of the DNA molecules according to the methods of the invention will be apparent

to one of ordinary skill in the art.

Methods of RT-PCR

In the RT-PCR reaction, the reaction mixtures are incubated at a temperature sufficient

to synthesize a DNA molecule complementary to all or a portion of the RNA template. Such

conditions typically occur at temperatures of at least 40 °C, and more preferably range from at

least about 40 °C to about 80 °C. After the reverse transcription reaction, the reaction is

incubated at a temperature sufficient to amplify the synthesized DNA molecule. Preferably the

amplification is accomplished via one or more polymerase chain reactions (PCRs). Preferred

conditions for amplification comprise thermocycling, which may comprise alternating heating

and cooling of the mixture sufficient to amplify the DNA molecule and which most preferably

comprises alternating from a first temperature range of from about 90°C to about 100°C, to a

second temperature range of from about 45 °C to about 75 °C, preferably from about 60 °C to

about 75 °C. According to the invention, the thermocycling may be performed any number of

times, preferably from about 5 to about 80 times, more preferably greater than about 20 times and

most preferably greater than about 30 times. The compositions and methods of the present invention may also be used for the

production, analysis and quantitation of large nucleic acid molecules (e.g., "long-PCR" or "long

RT-PCR"), preferably nucleic acid molecules that are larger than about 3-6 kilobases in size,

more preferably larger than about 4-5 kilobases in size, and most preferably nucleic acid

molecules that are larger than about 4 kilobases in size. In this aspect of the invention,

combinations of DNA polymerases, preferably mixtures of one or more DNA polymerases

lacking 3'-5' exonuclease activity ("3'-exc-") with one or more DNA polymerases having 3'-5'

activity ("3'-exo+") may be added to the compositions of the invention (Barnes, W.M., Proc.

Natl. Acad. Sci. 91 :2216-2220 ( 1994)). Preferred 3'-exo- and 3'-exo+ polymerases for use in this

aspect of the invention are thermostable polymerases. Particularly prefeπed 3 '-exo- polymerases

include, but are not limited to, Tag, Tne (3'-exo-), Tma (3'-exo-), Pfu (3'-exc-), andEwo (3'-exo-),

or mutants, variants or derivatives thereof. Particularly preferred 3'-exo+ polymerases include,

but are not limited to, Pfu, Pwo, Tne, and Tma.

Methods of NASBA, TMA, 3SR, or SPSR Amplification :

It will be apparent that, in addition to RT-PCR, the methods of the invention may be

easily adapted to other amplification techniques such as NASBA, TMA, 3SR, or SPSR. In a

reaction scheme similar to that previously described, the three enzymatic steps, which are carried

out at a fixed temperature (from about 37 °C to about 45 °C), can be modified to function at a

higher fixed temperature (from about 40 ° C to about 80 ° C). For example, replacing a retrovirus

reverse transcriptase (i.e., AMN-RT or MMLV-RT) with a thermostable reverse transcriptase

derived from Bacillus stearothermophilus also would amplify a DΝA molecule complementary

to all or a portion of the RΝA template. Additionally, a thermostable RΝase H as described in U.S. Pat. Nos. 5,268,289 and 5,459,055 and 5,500,370, all of which are incorporated herein by

reference (sold as HYBRIDASE Thermostable RNase H, Epicentre Technologies), can be

substituted for a non-thermostable RNase H enzyme derived from E. coli or associated with

retrovirus reverse transcriptases. Finally, a non-thermostable DNA-dependent RNA polymerase

(e.g., T7 bacteriophage RNA polymerase) may be replaced by either (1) a mutant phage RNA

polymerase (e.g., mutated forms from T3, T7, or SP6 RNA polymerases) that is active under

thermostable conditions (i.e., from about 40°C to about 80°C), wherein each mutant RNA

polymerase employs its own specific promoters; or (2) a thermophilic phage RNA polymerase,

from native or recombinant sources, that itself encodes for a thermostable RNA polymerase; or

(3) a bacterial RNA polymerase from any thermophilic organism (e.g., Tth or Bst) using

promoters from the respective thermophilic organism.

It will be readily apparent to one of ordinary skill in the relevant arts that other suitable

modifications and adaptions to the methods and applications described herein are obvious and

may be made without departing from the scope of the invention or any embodiment thereof.

Having now described the present invention in detail, the same will be more clearly understood

by reference to the following examples, which are included herewith for purposes of illustration

only and are not intended to be limiting the invention.

Example 1 : Detection of reverse transcriptase activity in presence of magnesium ions

To demonstrate that the large fragment of Bst DNA polymerase is capable of magnesium-

dependent reverse transcription, first strand synthesis reactions were set-up using 5 units of the

large fragment of Bst DNA polymerase or the full-length Bst protein. A DNA primer, designed

to transcribe a region of the 16S rRNA of E.coli, was used in a buffered reaction in the presence of 1.5 mM MgCl₂.

Initially, duplicate reactions were performed in RT-PCR buffer containing 50 mM Tris-

HCl, (pH 9.0), 20 mM (NH₄)₂SO₄, 12.5 mM NaCl. Reactions also contained 200 μM

(micromolar) each dNTP, 50 pmoles of 16S rRNA reverse primer (5'

AGGCCCGGGAACGTATTCAC 3') (SEQ ID NO: 1), 1 μg (microgram) total E.coli RNA, and

5 units of enzyme. The reagents were incubated for 30 minutes at 60 °C to allow reverse

transcription. Ten micro liters of each reaction were then separated by agarose gel electrophoresis

and visualized by ethidium bromide staining and UV transillumination. Both Bst DNA

polymerase and the Bst large fragment produced a cDNA transcript of the appropriate length

(1375 nucleotides) as shown in Figure 1, lanes 1-2, and lanes 3-4, respectively.

The optimal magnesium concentration for RT with the Bst large fragment was defined

with reactions containing varied amounts of MgCl₂. Reverse transcription was performed in

buffer containing 50 mM Tris-HCl (pH 8.3), and 50 mM KC1. Reactions also contained 200 μM

(micromolar) each dNTP, 50 pmoles of 16S rRNA reverse primer (as defined above), 1 μg

(microgram) of E. coli RNA, and 20 U of Bst large fragment. The concentration of MgCl₂ added

was 0, 1, 2, and 3 mM. Reactions were incubated for 30 minutes at 60 °C, and products were

separated and visualized by agarose gel electrophoresis. The results are depicted in Figure 2. The

optimum concentration of MgCl₂ for reverse transcription was 2 mM for reverse transcription

with this primer and template pair.

Example 2: RT-PCR using Bst reverse transcriptase in the presence of magnesium

Reverse transcription was also demonstrated with another primer and RNA template

combination. The reverse transcription and subsequent amplification of a 463 bp region of the tobacco mosaic virus (TMV) was performed using the magnesium-dependent RT activity of the

Bst large fragment. Reverse transcription was performed in reactions containing 50 mM Tris-HCl

(pH 8.3), 50 mM KC1, 200 μM (micromolar) each dNTP, 50 pmoles of TMV reverse primer (5'

CCCTTTGCGGACATCACTCTT 3 ') (SEQ ID NO: 2), 500 ng of TMV RNA, and 20 U of Bst

large fragment. One reaction contained no MgCl₂, one contained 1.5 mM MgCl₂, and one

contained no MgCl₂, but 0.5 mM MnSO₄ was added. RT was performed at 60 °C for 40 minutes.

Five microliters of each of the RT reactions was then amplified by PCR in reactions

containing 50 mM Tris-HCl (pH 8.3), 50 mM KC1, 200 μM (micromolar) each dNTP, 1.5 mM

MgCl₂, 1.5 Units of Tag DNA polymerase, and 12.5 pmoles of both forward and reverse TMV

primers having the following sequences: (forward) (5' GCCGGTTTGGTCGTCACGGGC 3')

(SEQ ID NO: 3); (reverse) (5' CCCTTTGCGGACATCACTCTT 3') (SEQ ID NO: 4). Thirty-

five cycles of amplification were performed with the following cycling profile: denaturation for

1 minute at 92°C, primer annealing for 1 minute at 64°C, and primer extension for 1 minute at

72 °C. Ten microliters of each reaction were separated by agarose gel electrophoresis and

visualized by ethidium bromide staining and UV transillumination. The 463 bp product was

clearly visible in both the reactions performed with MgCl₂ and MnSO₄ (Figure 3, lanes 2 and 3,

respectively). A small amount of product was also produced in the reaction where the reverse

transcription was performed without either MgCl₂ or MnSO₄.

Example 3: Comparison of Mg²⁺ and Mn²⁺ effects on fidelity

Comparisons were made of the rate of misincorporation of nucleotides during RT-PCR

amplification. Reactions were performed in the presence of 1.5 mM MgCl₂ with or without the

addition of 0.5 mM MnSO_4? which is required by most thermostable enzymes capable of reverse transcription. The sequences of resulting products were compared to generate relative mutation

rates.

A region of the rabbit tissue factor (RTF) mRNA transcript was used as a template for

the misincorporation studies. The RTF-RNA transcript was generated by subcloning an RT-PCR

amplified rabbit brain mRNA product into a transcription vector containing a T7 promoter. The

forward and reverse RTF primers used for the amplification had the following sequence:

(forward) 5' GGAACCGGTGCAGACACTACAGGTAGAGC 3' (SEQ ID NO: 5) and

(reverse) 5' CCCAAGCTTCAGGCGATGTTCAGG 3' (SEQ ID NO: 6).

Amplification conditions were as follows: reverse transcription was performed at 42°C for 30

minutes, followed by 30 amplification cycles of 95 °C for 30 seconds, 60 °C for 30 seconds, and

72 °C for 30 seconds.

The RT-PCR product was ligated into a plasmid by standard methods. The RTF

containing subclone was sequenced by standard methods and was verified. T7 RNA polymerase

was then used to transcribe from the subcloned RTF plasmid in a standard transcription reaction.

The RNA template was quantified by spectrophotometry. Two hundred and fifty picograms of

RNA transcript were used in the subsequent RT-PCR amplification reactions.

An 850 nucleotide long region of the rabbit tissue factor (RTF) message was amplified

from an RNA template by single step RT-PCR reactions using Bst DNA polymerase large

fragment for reverse transcription and Tag DNA polymerase for subsequent amplification.

Reactions contained 50 mM Tris-HCl, (pH 9.0), 20 mM (NH₄)₂SO₄, 12.5 mM NaCl, 200 μM

(micromolar) each dNTP, IX MASTERAMP PCR Enhancer (Epicentre Technologies), 12.5

pmoles of both forward and reverse RTF primer having the following sequence:

(forward) 5' CGGCGGCCGCAGACACTACAGGTAGA 3' (SEQ ID NO: 7); (reverse) 5' GCTCTAGATTCAGGCGATGTTCAGGGGGGA 3' (SEQ ID NO: 8), and 250 pg

RTF RNA transcript, and 20 U Bst DNA polymerase large fragment and 5 U Tag DNA

polymerase. One of the reactions also contained 0.5 mM MnSO₄. The reagents were incubated

for 30 minutes at 60°C to allow reverse transcription, and then PCR was performed using 30

cycles of: 95 °C for 30 seconds, 60 °C for 30 seconds and 72 °C for 30 seconds. Products were

quantified by fluorimetry and ligated into a pT7.1 plasmid vector. The ligations were transformed

into E.coli and DNA was purified from 3-5 colonies from each original amplification. The DNA

was sequence and compared to the published sequence of RTF.

The sequences were used to determine the relative misincorporation rates of reverse

transcription and amplification in the presence of 1.5 mM magnesium +/- 0.5 mM manganese.

The number of mutations per base sequenced was .0023 without manganese and was 0.0085 in

the presence of manganese. The misincorporation rate was therefore 3.7 fold better when reverse

transcription and the subsequent amplification were only dependent on the cation magnesium.

Therefore, the presence of manganese adversely affects the fidelity of RT-PCR amplifications.

Example 4: Long RT-PCR

Reverse transcription of a large RNA target was performed to demonstrate the ability of

the large fragment of Bst DNA polymerase to copy and amplify long regions of RNA when

combined with one or more thermostable DNA polymerases.

A 4650 nucleotide long region of tobacco mosaic virus (TMV) RNA was amplified in

reactions containing 50 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl₂, 200 μM

(micromolar) each dNTP, 50 pmoles of TMV2 reverse primer (5'

TCGCTTTATTACGTGCCTGC 3') (SEQ ID NO: 9), 200 ng of TMV RNA, 20 U Bst DNA polymerase large fragment, 5 U Tag DNA polymerase, and 0.25 U of Pwo DNA polymerase.

Two reactions were performed, one with and one without IX MASTERAMP PCR Enhancer

(Epicentre Technologies) included in the reaction. RT was performed at 60°C for 30 minutes,

followed by 20 cycles of PCR amplification at 92°C for 30 seconds, 62°C for 30 seconds, 72°C

for 3 minutes, and then 15 cycles of 92°C for 30 seconds, 62°C for 30 seconds, 72°C for 3.5

minutes plus 15 seconds added per cycle. Ten microliters of each reaction were separated by

agarose gel electrophoresis and visualized by transillumination. Some smaller non-specific

amplification products are detected, but the expected 4.6 Kb product was produced in the

presence of IX MASTERAMP PCR Enhancer (Epicentre Technologies) (Figure 4, lane 2).

The foregoing examples exemplify various embodiments of the present invention and are

not intended to limit the invention, the scope of the invention, and its equivalents being

determined solely by the claims.

REFERENCES

U.S. PATENT DOCUMENTS

U.S. patent 4,683,195 U.S. patent 5,437,990;

U.S. patent 4,683,202 U.S. patent 5,747,298;

U.S. patent 5,130,238 U.S. patent 5,817,465;

U.S. patent 5,194,370 U.S. patent 5,830,714;

U.S. patent 5, 310,652 U.S. patent 5,834,253;

U.S. patent 5,322,770 U.S. patent 5,874,282; and

U.S. patent 5,399,491 U.S. patent 6,013,451.

U.S. patent 5,409,818

INTERNATIONAL PATENT APPLICATIONS

WO 98/14589

OTHER PUBLICATIONS

Barnes W.M., Proc. Natl. Acad. Sri- USA 91:2216-2220 (1994);

Beckman R.A., et al.. Biochemistry 24:5810-5817 (1985);

Goblet C. et al., Nucleic Acids Research 17(5):2144 (1989);

GuateUi J.C. et al., Proc. Nati- Acad. Sri- USA 87:1874-1878 (1990);

Kwoh D.Y. et al., Proc. Natl. Acad. Sci. USA 86:1173-1177 (1989);

Myers T.W. et al.. Biochemistry 30:7661-7666 (1991);

Ricchetti M. and Buc H., EMBO J. 12:387-396 (1993);

Schwartz, S„ Journal of Virology 24(6 :2519-2529 (1990); and

Ye S.Y. and Hong G.F., Scientia Sinica 30:503 (1987);

Claims

WHAT IS CLAIMED IS:

1. A purified thermostable template-dependent DNA polymerase from the

species Bacillus stearothermophilus comprising reverse transcriptase activity in the presence

of magnesium ions at a concentration of at least 1 mM and in the substantial absence of

manganese ions.

2. The polymerase of claim 1, wherein said polymerase is type strain 5 ATCC

12980.

3. The polymerase of claim 1 or 2, further comprising 3'-5' exonuclease activity

and 5'-3' exonuclease activity.

4. The polymerase of claim 3, wherein said polymerase is modified or mutated to

reduce or eliminate 3'-5' exonuclease activity.

5. The polymerase of claim 3, wherein said polymerase is modified or mutated to

reduce or eliminate 5'-3' exonuclease activity.

6. The polymerase of claim 5 , wherein said polymerase has a molecular weight

between about 55 to about 65 kilodaltons as determined by SDS polyacrylamide

electrophoresis.

7. The polymerase of claim lor 2, wherein said magnesium ion concentration is

about 1 mM to about 10 mM.

8. The polymerase of claim 1 or 2, wherein the source of said magnesium ions is

a magnesium-containing buffer.

9. The polymerase of claim 1 or 2, wherein the source of said magnesium ions is

a magnesium-containing salt.

10. The polymerase of claim 9, wherein said magnesium-containing salt is

selected from the group consisting of magnesium chloride, magnesium sulfate and

magnesium acetate.

11. A method of preparing one or more cDNA molecules from one or more RNA

templates, comprising

(a) mixing one or more RNA templates with one or more of the

polymerases of claim 1 or claim 2 to form a mixture; and

(b) incubating said mixture under conditions sufficient to synthesize one

or more cDNA molecules complementary to all or a portion of said one or more templates.

12. The method of claim 11, wherein said incubating step (b) comprises

incubating said mixture at a temperature and for a time sufficient to make a DNA molecule

complementary to all or a portion of said RNA template.

13. The method of claim 12, wherein said incubating step (b) comprises

incubating said mixture at a temperature from about 40°C to about 80°C.

14. The method of claim 11, further comprising incubating said one or more

cDNA molecules under conditions sufficient to make one or more double stranded cDNA

molecules.

15. A method for amplifying a nucleic acid molecule, said method comprising

(a) mixing an RNA template with a composition comprising one or more

of the polymerases of claim 1 or claim 2 and one or more DNA polymerases to form a

mixture; and

(b) incubating said mixture under conditions sufficient to amplify a DNA

molecule complementary to all or a portion of said RNA template.

16. The method of claim 15, wherein said incubating step (b) comprises

(a) incubating said mixture at a temperature and for a time sufficient to

make a DNA molecule complementary to all or a portion of said RNA template; and

(b) incubating said DNA molecule complementary to said RNA template

at a temperature and for a time sufficient to amplify said DNA molecule.

17. The method of claim 16, wherein said incubating step (a) comprises

incubating said mixture at a temperature from about 40°C to about 80°C.

18. The method of claim 16, wherein said incubating step (b) comprises

thermocycling.

19. The method of claim 18, wherein said thermocycling comprises alternating

heating and cooling of the mixture to amplify said DNA molecule.

20. The method of claim 19, wherein said thermocycling comprises alternating

from a first temperature range of from about 90 °C to about 100°C, to a second temperature

range of from about 45 °C to about 75 °C.

21. The method of claim 20, wherein said second temperature range is from about

60°C to about 75°C.

22. The method of 18, wherein said thermocycling is performed greater than 5

times.

23. The method of claim 15, wherein said DNA polymerases are thermostable

DNA polymerases.

24. The method of claim 23, wherein said thermostable DNA polymerases are

selected from the group consisting of Tne, Tma, Tag, Pfu, Tth, Pwo, Tfl, and mutants, variants

and derivatives thereof.

25. The method of claim 15, wherein said DNA polymerases comprise a first

DNA polymerase having 3' exonuclease activity and a second DNA polymerase having

substantially reduced 3' exonuclease activity.

26. The method of claim 25, wherein said DNA polymerase having 3' exonuclease

activity is selected from the group consisting of Pfu, Pwo, Tne, Tma, and mutants, variants

and derivatives thereof.

27. The method of 25, wherein said DNA polymerase having substantially

reduced 3' exonuclease activity is selected from the group consisting of Tag, Tfl, Tth, and

mutants, variants and derivatives thereof.

28. The method of claim 15, wherein the unit ratio of said polymerases of claim 1

or claim 2 to said DNA polymerases is from about 0.25:1 to about 16:1.

29. The method of claim 15, wherein said mixture further comprises one or more

nucleotides.

30. The method of claim 29, wherein said nucleotides are deoxyribonucleoside

triphosphates or derivatives thereof, or dideoxyribonucleoside triphosphates or derivatives

thereof.

31. The method of claim 30, wherein said deoxyribonucleoside triphosphates are selected from the group consisting of dATP, dUTP, dTTP, dGTP, and dCTP.

32. The method of claim 15, wherein said mixture further comprises one or more

oligonucleotide primers.

33. The method of claim 32, wherein said primer is an oligo(dT) primer.

34. The method of claim 32, wherein said primer is a target-specific primer.

35. The method of claim 32, wherein said primer is a gene-specific primer.

36. The method of claim 15, wherein said nucleic acid molecule is amplified by

PCR, NASBA, TMA, 3SR, or SPSR.

37. A kit for synthesizing or amplifying a DNA molecule comprising one or more

of the polymerases of claim 1 or 2.

38. The kit of claim 37, further comprising one or more deoxyribonucleoside

triphosphates.