EP1181391A2 - Method of detection of cytochrome b mutations in funghi leading to resistance against anti-fungal agents - Google Patents
Method of detection of cytochrome b mutations in funghi leading to resistance against anti-fungal agentsInfo
- Publication number
- EP1181391A2 EP1181391A2 EP00925493A EP00925493A EP1181391A2 EP 1181391 A2 EP1181391 A2 EP 1181391A2 EP 00925493 A EP00925493 A EP 00925493A EP 00925493 A EP00925493 A EP 00925493A EP 1181391 A2 EP1181391 A2 EP 1181391A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- mutation
- seq
- cytochrome
- fungal
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0055—Oxidoreductases (1.) acting on diphenols and related substances as donors (1.10)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/795—Porphyrin- or corrin-ring-containing peptides
- C07K14/80—Cytochromes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Definitions
- This invention relates to a diagnostic method for the detection of a cytochrome b mutation in fungi that leads to resistance to strobilurin analogues or compounds in the same cross resistance group using any (or a) single nucleotide polymorphism detection technique, preferably using the amplification refractory mutation system (ARMS).
- the invention also relates to mutation specific primers for use in the method and to diagnostic kits containing these primers.
- the invention further relates to the identification of a specific mutation in the fungal cytochrome b gene which results in the resistance of fungi containing the said mutation to strobilurin analogues or compounds in the same cross resistance group.
- the fungicidal activity of the strobilurin analogues is a result of their ability to inhibit mitochondrial respiration in fungi. More specifically, it has been established that these compounds have a novel single site mode of action, exerting their effect on fungi by blocking the ubiquinokcytochrome c oxidoreductase complex (cytochrome bcl) thus reducing the generation of energy rich ATP in the fungal cell (Becker et al FEBS Letts. 132 329-33). This family of inhibitors prevents electron transfer at the ubiquinone redox site Q 0 on the multimeric cytochrome b protein (Esposti et al 1993 Biochim. et Biophys Acta 243-271 ).
- the cytochrome b protein is mitochondrially encoded. Reports in the literature show that specific amino acid changes at the cytochrome b target site can affect the activity of strobilurin analogues.
- S. cerevisiae Saccharomyces cerevisiae
- mouse Howell et al 1988 J. Mol. Biol. 203, 607-618
- Chlamydomonas reinhardtii (Bennoun et al 1991 Genetics 127, 335-343) and Rhodobacter spp (Daldal et al 1989 EMBO J. 3951-3961 ) have been carried out. Relevant information was also gathered from studying the natural basis for resistance to strobilurin analogues in the sea urchin Paracentrotus lividus (Esposti et al 1990 FEBS 263, 245-247) and the Basidiomycete fungi Mycena galopoda and Strobilurus tenaceUus (Kraiczy et al 1996 Eur. J. Biochem.
- the present invention identifies for the first time the key importance of one of these mutations in cytochrome b gene of field isolates of important plant pathogenic fungi showing resistance to a strobilurin analogue or a compound in the same cross resistance group.
- Summary of the Invention According to a first aspect of the invention we provide a method foi detecting a mutation in fungal nucleic acid wheiein the screeningnce of said mutation gives rise to fungal lesistance to a stiobilu ⁇ n analogue 01 any othei compound in the same cross resistance group said method comprising identifying the gutternce or absence of said mutation in fungal nucleic acid using any (or a) single nucleotide polymo ⁇ hism detection technique
- single polymorphism detection techniques which may be used to detect mutations include, for example, lest ⁇ ction fragment length polymo ⁇ hism (RFLP), single strand conformation polymorphism, multiple clonal analysis, allele-specific oligonucleotide hybridisation, single nucleotide primer extension (Juvonen et al, (1994) Hum Genet 93 16- 20; Huoponen et al, (1994) Hum Mutat 3 29-36; Mashima et al (1995), Invest Opthelmol. Vision. Sci 36,1714-20; Howell et al (1994) Am J Hum Genet. 55 203-206; Koyabashi et al; (1994) Am. J. Hum. Genet.
- RFLP lest ⁇ ction fragment length polymo ⁇ hism
- PCR based detection systems are preferred.
- a method for detecting a mutation in fungal nucleic acid wherein the presence of said mutation gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group comprising detecting the presence of an amplicon generated during a PCR reaction wherein said PCR reaction comprises contacting a test sample comprising fungal nucleic acid with a primer in the presence of appropriate nucleotide triphosphates and an agent for polymerisation wherein the detection of said amplicon is directly related to presence or absence of said mutation in said nucleic acid.
- the detection of the amplicon generated during the PCR reaction may be directly dependent on the extension of a primer specific for the presence of the mutation i.e. where primer extension is dependent on the presence of the mutation and hence an amplicon is generated only when the primer binds and/or is extended when the mutation is present (as is the case with ARMS technology), similarly it may be directly dependent on the extension of a primer specific for the absence of the mutation e.g. wild type sequence or may be directly linked to the PCR extension product containing the mutant DNA sequence i.e. where the detection is of an amplicon comprising the mutant DNA sequence.
- the first alternative is particularly preferred.
- the amplicon can be from any PCR cycle and this includes a first allele specific primer extension product.
- the invention provides a method for detecting a mutation in fungal nucleic acid wherein the presence of said mutation gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group which method comprises contacting a test sample comprising fungal nucleic acid with an appropriate diagnostic primer in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended either when the said mutation is present in the sample or when wild type sequence is present; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product.
- the invention provides a method for detecting a mutation in fungal nucleic acid wherein the presence of said mutation gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group which method comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the specific mutation in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product.
- the first aspect of the invention we provide a method for detecting a mutation in fungal nucleic acid wherein the presence of said mutation gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group which method comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the specific mutation in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended only when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product.
- diagnostic primer is used to indicate the primer which is used specifically to identify the presence or absence of a mutation or wild type sequence and the term common primer is used to denote a primer binding to the opposite strand of DNA to the diagnostic primer and 3' to the region recognised by that diagnostic primer and which, by acting with said diagnostic primer allows amplification of the intervening tract of DNA during the PCR.
- diagnostic primer is an ARMS primer it can have a 3' mismatch when compared to the mutant or wild type sequence.
- the extension of the primer extension product is detected using a detection system which is an integral part of either the diagnostic primer or the common primer on the opposite strand. This is described more fully herein.
- the methods of the invention are particularly suitable for the detection of mutations in a mitochondrial gene which encodes a protein which is a target for a fungicide, more especially for the detection of mutations in a fungal cytochrome b gene where said mutations result in the inhibition of fungicide activity to the cytochrome b protein but still allow ATP generation to occur and most preferably wherein said mutation in the fungal cytochrome b gene results in one of the following amino acid substitutions: A ⁇ 26 T, F 129 L, Y ⁇ C, C i 33 Y, G n7 R/S/E/V, W, 42 T/K, G, 43 A, I 147 F, T, 48 M, N 2 , 6 Y/K/I, L 27 ,F/S/T or L 29 sF where the first amino acid is substituted by the second one at the position in the sequence denoted by the number, the presence of which give rise to fungal resistance 10 strobilurin analogues or any other compound in the same cross
- the strobilurin analogues and compounds in the same cross resistance group include for example, azoxystrobin, picoxystrobin, kresoxim-methyl, trifloxystrobin, famoxadone and fenamidone.
- cerevisiae sequence is a key determinant of fungal resistance to strobilurin analogues or any other compound in the same cross resistance group in field isolates of strobilurin analogue resistant plant pathogenic fungi.
- the methods of the invention described herein are particularly suitable for the detection of a mutation at the position corresponding to Saccharomyces cerevisiae cytochrome b residue 143 where the glycine residue is replaced by another amino acid which inhibits the activity of strobilurin analogues or any other compound in the same cross resistance group and results in a resistant phenotype in the fungi carrying the mutant cytochrome b gene thereby giving rise to fungal resistance to strobilurin analogues or any other compound in the same cross resistance group.
- the method is preferably used for the detection of a mutation resulting in the replacement of said glycine residue at the position corresponding to S. cerevisiae cytochrome b residue 143 with an amino acid selected from the group arginine, serine, cysteine, valine, aspartic acid, glutamic acid, tryptophan and most preferably alanine.
- an amino acid selected from the group arginine, serine, cysteine, valine, aspartic acid, glutamic acid, tryptophan and most preferably alanine.
- cerevisiae cytochrome b residue 143 in the encoded protein thereby giving rise to fungal resistance to strobilurin analogues or any other compound in the same cross resistance group said method comprising identifying the presence or absence of said mutation in fungal nucleic acid using any (or a) single nucleotide polymo ⁇ hism detection technique.
- 4 A replacement in the encoded protein is usually a guanine to cytosine base change at the second position (base) of the codon and the detection of this single nucleotide polymorphism is preferred for all aspects and embodiments of the invention described herein.
- a diagnostic method for the detection of a mutation in a fungal cytochrome b gene resulting in a G ⁇ A replacement in the encoded protein comprising detecting the presence of an amplicon generated during a PCR reaction wherein said PCR reaction comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer in the presence of appropriate nucleotide triphosphates and an agent for polymerisation wherein the detection of said amplicon is directly related to presence or absence of said mutation in said nucleic acid.
- a diagnostic method for the detection of a mutation in a fungal cytochrome b gene resulting in a G ⁇ A replacement in the encoded protein comprising contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the mutation resulting in a G ⁇ 4 A replacement in the encoded protein in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended when a mutation is present in the sample resulting in a G ] 3 A replacement in the encoded protein; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product.
- a diagnostic method for the detection of a mutation in a fungal cytochrome b gene resulting in a G) 3 A replacement in the encoded protein comprising contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the mutation resulting in a G
- 43 A is used to denote the substitution of a glycine lesidue by an alanine lesidue in a fungal cytochiome b sequence at the equiv alent of the position of the 143" codon/amino acid of the 5 ce ⁇ e ⁇ isiae cytochiome b sequence
- This nomenclature is used for all the other lesidue changes quoted heiein I e all positions aie quoted relative to the S c ei ex tsiae cytochrome b pi otein sequence
- the 5 ce ⁇ ⁇ s ⁇ ae cytochiome b gene and piotein sequences are available on the EMBL and SWISSPROT databases (See EMBL ACCESSION NO X84042 and SWISSPROT ACCESSION NO P00163) The skilled man will appieciate that the piecise length and register of equivalent pioteins fio different species may
- the positions in the cytochiome b sequence are prefeiably as defined relative to the S DCevtsiae cytochiome b consensus sequence as provided in SWISSPROT ACCESSION NO POO 163 Accoiding to one aspect of the invention theie is piovided a method foi the diagnosis of a single nucleotide polymorphism in a fungal cytochrome b gene which method comprises determining the sequence of fungal nucleic acid at a position corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S cet evisiae cytochiome b residue 143 in the cytochiome b piotein and determining the resistance status of the said fungi to a stiobilui in analogue oi a compound in the same cioss lesistance gioup by leference to a polymoiphism in the cytochiome b gene
- theie is piovided a method loi the diagnosis of a single nucleotide polymoiphism in a fungal cytochiome b gene which method compnses determining the sequence of fungal nucleic acid at a position conesponding to the second base in the tnplet coding foi the amino acid at the position conesponding to S cet evisiae cytochiome b tesidue 143 in the cytochrome b piotein and determining the lesistance status of the said fungi to a stiobilui in analogue or a compound in the same cioss lesistance gioup by reference to a polymoiphism in the cytochrome b gene
- the method foi diagnosis descnbed herein is one in which the single nucleotide polymoiphism at a position in the DNA conesponding to the second base in the tnplet coding foi the amino acid at the position conesponding to 5 cetevisiae cytochrome b lesidue 143 in the cytochiome b piotein is presence of G and/or C
- a glycine to alanine point mutation demands a G to a C change at the second base of the codon Othei mutations may also arise at the 3 rd position in the codon due to degeneracy in genetic code for alanine and glycine (see Table 1) but this is leadily taken into consideration when designing the diagnostic primer.
- the diagnostic primer is preferably an ARMS primer. (The concept of ARMS primers is described fully in Newton et al, Nucleic Acid Research 17 (7) 2503-2516 1989). As a result ARMS primers can be designed for the detection of the G
- the methods of the invention descnbed heiein aie paiticulaily useful in connection with plant pathogenic lungi and especially with the following fungal species Plasmopai a ⁇ iticola, Ei ysiphe giammis f sp ti itici/hoi dei Rhyntho ⁇ onum secalis, Py i enophoi a teies My cosphaerella gi aminicola Venlin ia inaequali s, My cosphaei ell a f ⁇ ien sts vai d ⁇ for us Sphaei otheca fuliginea, Unc inula netatoi , Colletoti ichum gi amimcola, Py thium aphaiudeimatum, Colletoti ichum ( ⁇ loeospoi loidc s Oidium ly opei siciim Ma ⁇ uipoi
- piovides a method foi detecting fungal lesistance to a stiobilurin analogue or any othei compound in the same cioss lesistance gioup said method comprising identifying thespectnce or absence of a mutation in fungal nucleic acid wherein thegronce of said mutation gives rise to lesistance to a stiobilurin analogue oi any othei compound in the same cioss lesistance group said method comprising identifying the presence oi absence of a single nucleotide polymo ⁇ hism occuriing at a position corresponding to the second base in the triplet coding for the amino acid at the position conesponding to S cerevisiae cytochiome b residue 143 in the cytochrome b pi otein
- the presence or absence of a single nucleotide polymo ⁇ hism at a position corresponding to the second base in the triplet coding for the amino acid at the position conesponding to S cet evisiae cytochiome b iesidue 143 in the cytochrome b gene in fungal nucleic acid is identified using any (oi a) single nucleotide polymo ⁇ hism detection techniques
- the invention furthei piovides a fungal DNA sequence encoding all oi part of a wild type cytochiome h piotein wheiein said DNA sequence encodes a glycine residue at the position conesponding to S DC ex isiae cytochrome b residue 143 in the wild type piotein wherein said sequence is obtainable oi obtained from a fungus selected fiom the group consisting of Plasmopaia viticola Ei y siphe grainims f sp tntic i/hoidei Rhynchospoi m secalis Py i enophoia lei es My c osphaerella gi amnnc ola My cosphaei ella j ⁇ iensis vai diffoi mis, Sphaei otheca fuliginea Uncinula necatoi Colletoti ichitin qi aminicola Py lhiuni ap
- the fungal DNA sequences according to the above aspects of the invention prefeiably comprises aiound 30 nucleotides on eithei or both sides of the position in the DNA conesponding to one oi more of the bases in the tnplet, prefeiably conesponding to the second base in the triplet coding for the amino acid at the position conesponding to 5 c ei ex isiae cytochrome b lesidue 143 in the protein since this extent of nucleic acid provides the skilled man with all infoi mation necerney to design species and mutation specific leagents and/oi methods for use in all single nucleotide polymorphism detection techniques
- the teim aiound 30 means that the sequence may compnse up to 30 nucleotides, foi example 5, up to 10, 15, 20, or 25 nucleotides or may comprise moie than 30 nucleotides
- DNA sequence oi protein sequence oi a fiagment thereof A fiagment of DNA or protein may foi example be 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% of the length of the whole sequence
- the invention also extends to a fungal DNA sequence showing homology or sequence identity to said DNA sequences in Table 3 and covers for example, variations in DNA sequences found in different samples or isolates of the same species. These variations may, for example, be due to the use of alternative codon usage, varying intron/exon mitochondrial organisation and amino acid replacement.
- the invention provides a fungal DNA sequence encoding all or part of a cytochrome b protein which, when said sequence is lined up against the corresponding wild type DNA sequence encoding a cytochrome b protein, is seen to contain a single nucleotide polymorphism mutation at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein which results in the replacement of the normal glycine residue with an alternative amino acid with the proviso that said DNA sequence is not the Mycena galopoda sequence encoding cytochrome b.
- the invention provides a fungal DNA sequence encoding all or part of a cytochrome b protein which, when said sequence is lined up against the corresponding wild type DNA sequence encoding a cytochrome b protein, is seen to contain a single nucleotide polymorphism mutation at a position in the DNA corresponding to the second base in the triplet coding for the amino acid at the position con-esponding to S. cerevisiae cytochrome b residue 143 in the protein which results in the replacement of the normal glycine residue with an alternative amino acid with the proviso that said DNA sequence is not the Mycena galopoda sequence encoding cytochrome b.
- the fungal DNA sequence according to the above aspect of the invention preferably comprises around 30 nucleotides on either or both sides of the position in the DNA corresponding to one or more of the bases in the triplet, preferably corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein since this extent of nucleic acid provides the skilled man with all information necessary to design species and mutation specific reagents and/or methods for use in all single nucleotide polymorphism techniques.
- the term around 30 means that the sequence may comprise up to 30 nucleotides, for example 5, up to 10, 15, 20, or 25 nucleotides or may comprise more than 30 nucleotides.
- the invention further provides a fungal DNA sequence encoding all or part of a mutant cytochrome b protein wherein the presence of a mutation in said DNA confers resistance to a strobilurin analogue or a compound within the same cross resistance group, said mutation occurring at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to 5. cerevisiae cytochrome b residue 143 in the protein with the proviso that said DNA sequence is not the Mycena galopoda sequence encoding cytochrome b.
- the invention further provides a fungal DNA sequence encoding all or part of a mutant cytochrome b protein wherein the presence of a mutation in said DNA confers resistance to a strobilurin analogue or a compound within the same cross resistance group, said mutation occurring at a position in the DNA corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein with the proviso that said DNA sequence is not the Mycena galopoda sequence encoding cytochrome b.
- the mutation occurring at a position in the DNA corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein is preferably a guanine to cytosine base change.
- the fungal DNA sequence encoding all or part of a mutant cytochrome b protein wherein the presence of a mutation in said DNA confers resistance to a strobilurin analogue or a compound within the same cross resistance group, according to the above aspects of the invention is preferably obtainable or obtained from a fungus selected from the group consisting of Plasmopara viticola, Eiysiphe graminis f.sp.
- the invention extends also to DNA sequences comprising all or part of the sequences provided in Table 3 wherein the residue at a position in the DNA corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein is a cytosine residue (SEQ ID NOS 176 to 196).
- SEQ ID NOS 176 to 196 cytosine residue
- GAGTGC 3'- (SEQ ID NO 179) 5"TTTTACCCTACGGGCAAATGAGCCTTTGAGCTGAAATATTTGCCTCAAATGTATA
- GAGCGC 3'- (SEQ ID NO 190) 5'TTTTACCATACGGACAAATGTCATTATGAGCTGCAACAGTTATTACTAACCTTAT
- TTCTGC 3'- (SEQ ID NO 195) 5'TTTTACCTTATGGTCAAATGTCTTTATGAGCAGCTACAGTTATAACTAATTTAATGAGTG
- the invention also extends to a fungal DNA sequence showing homology or sequence identity to said DNA sequence containing said polymorphism and covers for example, variations in DNA sequences found in different samples of the same species. These variations may, for example, be due to the use of alternative codon usage, varying intron/exon mitochondrial organisation and amino acid replacement.
- the DNA sequences encoding all or part of a wild type or mutant cytochrome b protein as described herein are preferably in isolated form. For example through being partially purified from any substance with which it occurs naturally.
- the DNA sequence is isolatable (obtainable) or isolated (obtained) from the fungi disclosed herein.
- the invention further provides a computer readable medium having stored thereon any of the sequences described and claimed herein and including all or part of a DNA sequence or protein sequence encoding a mutant cytochrome b protein as herein described wherein the presence of a mutation gives rise to fungal resistance to a strobilurin analogue or any compound in the same cross resistance group; all or part of a DNA or protein sequence encoding a mutant cytochrome b protein wherein said protein confers fungal resistance to a strobilurin analogue or a compound in the same cross resistance group from a fungus selected from the group Plasmopara viticola, Erysiphe graminis f.sp.
- the polynucleotide sequences of the invention represent a valuable information source.
- the use of this information source is most easily facilitated by storing the sequence information in a computer readable medium and then using the information in standard bioinformatics programs.
- the polynucleotide sequences of the invention are particularly useful as components in databases for sequence identity and other search analyses.
- sequence information in a computer readable medium and use in sequence databases in relation to polynucleotide or polynucleotide sequence of the invention covers any detectable chemical or physical chaiactenstic of a polynucleotide of the invention that may be leduced to.
- a computei based method is also piovided foi peifoiming sequence identification, said method compnsing the steps of pioviding a polynucleotide sequence compnsing a polymoiphism of the invention in a computei leadable medium and companng said pol> mo ⁇ h ⁇ sm containing polynucleotide sequence to at least one othei polynucleotide or pol) peptide sequence to identify identity (homology) 1 c screen lor themannnce of the polvmoiphism
- the invention further piovides a lungal cytochiome b piotein which confers iungal lesistance to a stiobiluiin analogue oi a compound within the same cioss lesistance gioup wheiein in said protein a noimal glycine lesidue is alteied due to thegronce of a mutation in the DNA coding foi said protein said mutation occuinng at a position in the DNA conesponding to one oi moie of the bases in the triplet coding foi the amino acid at the position conesponding to S DCex isiae cytochiome b lesidue 143 in the protein w ith the pioviso that said sequence is not the Mycena galopoda cytochiome h sequence
- the invention fuithei piovides a fungal cytochiome h piotein which confeis fungal lesistance to a stiobiluiin analogue oi a compound within the same cioss lesistance group wheiein in said piotein a normal glycine residue is alteied due to the presence of a mutation in the DNA coding for said piotein said mutation occurring at a position in the DNA conesponding to the second base in the tnplet coding foi the amino acid at the position conesponding to S cetevisiae cytochiome b lesidue 143 in the protein with the pioviso that said sequence is not the Mycena galopoda cytochiome b sequence
- the Mycena galopoda cytochiome b sequence is descnbed by Kiaiczy et al (Eur J Biochem 235, 54-63 (1996)) and the DNA sequence is in the EMBL data base EMBL Acession No X87997
- the glycine lesidue in the protein accoiding to the above aspect of the invention is pieferably replaced by an alternative amino acid and said replacement results in the said fungi showing resistance to a strobilurin analogue or any othei compound in the same cioss resistance gioup
- the mutation according to the above aspect of the invention preferably results in the replacement of said glycine residue with an amino acid selected from the group arginine, serine, cysteine, valine, aspartic acid, glutamic acid and most preferably alanine.
- the invention provides an antibody capable of recognising said mutant cytochrome b protein.
- the invention provides a method for the detection of a mutation in fungal cytochrome b gene resulting in replacement in the encoded protein of a glycine residue at the position corresponding to S. cerevisiae cytochrome b residue 143 said method comprising identifying the presence and absence of said mutation in a sample of fungal nucleic acid wherein any (or a) single nucleotide polymorphism detection method is based on the sequence information from around 30 to 90 nucleotides upstream and/or downstream of the position corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in either the wild type or mutant protein.
- the invention provides a method for the detection of a mutation in fungal cytochrome b gene resulting in a G] 4 A replacement in the encoded protein said method comprising identifying the presence and absence of said mutation in a sample of fungal nucleic acid wherein any (or a) single nucleotide polymo ⁇ hism detection method is based on the sequence information from around 30 to 90 nucleotides upstream and/or downstream of the position corresponding to the second base in the triplet coding for the amino acid at the position corresponding to 5. cerevisiae cytochrome b residue 143 in either the wild type or mutant protein.
- the invention provides a method for the detection of a guanine to cytosine mutation in a fungal cytochrome b gene resulting in a G
- sequence information according to the above aspect of the invention is preferably derived from a fungus selected from the group Plasmopara viticola, Eiysiphe graminis f.sp. tritici/lwrdei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var.
- the term around 30 means that the sequence may comprise up to 30 nucleotides, for example 5, up to 10, 15, 20, or 25 nucleotides or may comprise more than 30 nucleotides.
- the sequence information used is around 30, preferably 30 nucleotides upstream and/or downstream of the position corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in either the wild type or mutant protein.
- the nucleic acid according to the invention is preferably DNA
- the test sample of nucleic acid is conveniently a total DNA preparation from fungal material, a cDNA preparation from fungal material or the fungal material itself or plant or seed extracts containing fungal nucleic acid.
- the test sample may equally be a nucleic acid sequence corresponding to the sequence in the test sample. That is to say that all or a part of the region in the sample nucleic acid may firstly be isolated or amplified using any convenient technique such as PCR before use in the method of the invention.
- the present invention provides a means of analysing mutations in the DNA of agricultural field samples which by their very origin are considerably less well defined compared with an analogous situation involving human samples.
- Agricultural field samples aie considerably moie difficult to work with and it is moie technically demanding to detect a mutation event occuning at a low frequency in amongst a veiy laige amount of wild type DNA and/oi extianeous DNA from othei organisms piesent in a field isolate compaied with a human sample which geneially contains DNA fiom only one individual
- Any convenient enzyme foi polymensation may be used piovided that it has no lntnnsic ability to disci lminate between noi mal and mutant template sequences to any significant extent
- convenient enzymes include theimostable enzymes which have no significant 3'-5' exonuclease activ ity, foi example Taq DNA polymeiase, paiticulaily 'Amph Taq Gold ' TM DNA polymei ase (
- the invention piov ides an allele specific oligonucleotide capable of binding to all or part of a fungal nucleic acid sequence encoding a wild type cytochiome b piotein selected fiom the gioup consisting of Plasmopai a ⁇ mcola, Ei y siphe gi ammis f sp tntic i/lioidei, Rhync hospoi iuin secalis, Py ienophoi a tei es, My cosphaerella gi aminitola, Ventui ia inaequalis My cosphaei ella f ⁇ iensis vai diffoi mis, Sphaei otheca fulit ⁇ inea Uncinula necatoi, Colletoti ichum giaminitola Pythium aphamdei inatwn, Colletoti ichum
- the said fungal nucleic acid sequence is selected fiom the gioup consisting oi Plasmopai a viticola, Ery siphe giammis f sp tntici/lioidei, Rhynchospoi iuin secalis, Py ienophoia teres, My cosphaerella graminicola, My cosphaerella fi ⁇ ensis vai diffoimis, Sphaei otheca fuliginea, Uncinula necatoi, Colletoti ichum gi aminicola, Pythium aphamdei mat m, Colletoti ichum gloeospoi ioides, Oidium lycopei sicwn, Lex eillula taui ica, Pseudoperonospora cubensis, Altemai ia solani, Rhizo
- DNA in a further aspect of the invention we provide an allele specific oligonucleotide capable of binding to a fungal nucleic acid sequence encoding all or part of a mutant cytochrome b protein wherein said oligonucleotide comprises a sequence which recognises a nucelic acid sequence encoding an amino acid selected from the group arginine, serine, cysteine, valine, aspartic acid, glutamic acid , tryptophan, and most preferably alanine at the position corresponding to S. cerevisiae cytochrome b residue 143.
- an allele specific oligonucleotide capable of binding to a fungal nucleic acid sequence encoding all or part of a mutant cytochrome b protein selected from the group consisting oi Plasmopara viticola, Eiysiphe graminis f.sp. tritici/liordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var.
- oligonucleotide comprises a sequence which recognises a nucleic acid sequence encoding an amino acid selected from the group arginine, serine, cysteine, valine, aspartic acid, glutamic acid, tryptophan, and most preferably alanine at the position corresponding to S. cerevisiae cytochrome b residue 143.
- the invention provides an allele specific oligonucleotide probe capable of detecting a fungal cytochrome b gene polymorphism at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein.
- the invention provides an allele specific oligonucleotide probe capable of detecting a fungal cytochrome b gene polymo ⁇ hism at a position in the DNA corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein.
- said polymo ⁇ hism is a guanine to cytosine base change
- the mutation is in a fungus selected from the group consisting of Plasmopai a i iticola Ery siphe giammis f sp tntici/hoidei, Rhy nchospoi iuin secalis, Py i enophoi a tei es, Mycosphaei ella gi ainimcola Venturia inaequali s Mycosphaerella fi/iensis vai diffoimis Sphaerotheca fuliginea, Uncinula necatoi, Colletoti ii hum graminicola, Py thium aphamdei matum Colletoti ichum gloeospoi ioides, Oidium ly copei sicuiii Ma ⁇ iapoi the ⁇ sea
- the allele-specific oligonucleotide piobe is piefeiably 17 to 50 nucleotides long, moie piefei able about 17 35 nucleotides long and most pieierable about 17 30 nucleotides long
- Such piobes will be appended to the molcculai biologist of oidinaiy skill and may be based on DNA oi RNA sequence infoi mation
- Such piobes are of any convenient length such as up to 50 bases, up to 40 bases, moi e conveniently up to 30 bases in length, such as foi example 8-25 oi 8- 15 bases in length
- Such piobes will compnse base sequences entnely complementaiy to the conesponding wild type oi vanant locus in the gene Howev er, if lequned one oi moie mismatches may be introduced, piovided that the discriminatory powei of the oligonucleotide piobe is not unduly atlected
- the probes of the invention may cany one or moie labels to facilitate detection
- the invention alsthei piovides nucleotide p ⁇ meis which can detect the nucleotide polymoiphisms accoiding to the invention
- theie is piovided an allele specific primer capable of detecting a cytochiome b gene polymorphism at a position in the DNA conesponding to one or moie of the bases in the tnplet coding for the amino acid at the position coiresponding to S cerevisiae cytochrome b lesidue 143 in the piotein
- an allele specific primer capable of detecting a cytochrome b gene polymorphism at a position in the DNA corresponding to the second base in the tnplet coding foi the amino acid at the position conesponding to S cetevisiae cytochiome b lesidue 143 in the piotein
- the said mutation in the DNA sequence is preferably a guanine to cytosine base change
- piovides an allele specific pnmer capable of detecting a fungal DNA sequence encoding a wild type cytochiome b piotein selected from the group consisting oi Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var.
- the said fungal DNA sequence is selected from the group consisting oi Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Mycosphaerella fijiensis var. difformis Sphaerotheca fuliginea.
- an allele specific primer capable of detecting a fungal DNA sequence encoding all or part of a mutant cytochrome b protein wherein said allele specific primer is capable of detecting a DNA sequence encoding an amino acid selected from the group arginine, serine, cysteine, valine, aspartic acid, glutamic acid, tryptophan, and most preferably alanine at the position corresponding to 5. cerevisiae cytochrome b residue 143.
- an allele specific primer capable of detecting a fungal DNA sequence encoding all or part of a mutant cytochrome b protein selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici/liordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var.
- said primer is capable of detecting a DNA sequence encoding an amino acid selected from the group arginine, se ne, cysteine, valine, aspartic acid, glutamic acid, tryptophan, and most prefeiably alanine at the position corresponding to S cetevisiae cytochiome b lesidue 143
- An allele specific pnmei is used geneially with a common pnmei in an amplification ieaction such as a PCR reaction w hich piovides the discnmination between alleles thiough selective amplification of one allele at a paiticulai sequence position e g as used in the ARMS assay
- theieioie piovides a diagnostic pnmei capable of binding to a template compnsing a mutant type fungal cytochiome b nucleotide sequence wheiein the final 3' nucleotide ol the pnmer conesponds to a nucleotide piesent in said mutant foim of a fungal species
- the diagnostic pnmer of the invention is piefeiably at least 20 nucleotides in length, most piefeiably 26 nucleotides in length but this may be between 1 and 20 nucleotides in length
- the penultimate nucleotide (-2) of the pnmei is not the same as that piesent in the corresponding position in the wild type cytochiome b sequence
- destabilising components may be incoipoiated along with the -2 or -3 nucleotide
- a fuithei particularly pieferred embodiment of the above aspect of the invention we provide diagnostic primeis capable of binding to a template comprising a mutant type fungal cytochrome b nucleotide sequence wherein the final 3' nucleotide of the pnmei corresponds to a nucleotide piesent in said mutant form of a fungal cytochrome b gene and wherein up to 10, such as up to 8, 6, 4, 2, 1, of the remaining nucleotides may be varied with respect to the wild type sequence without significantly affecting the properties of the diagnostic primer.
- diagnostic primers comprising the sequences given below and derivatives thereof wherein the final nucleotide at the 3' end is identical to the sequences given below and wherein up to 10, such as up to 8, 6, 4, 2, 1, of the remaining nucleotides may be varied without significantly affecting the properties of the diagnostic primer.
- the sequence of the diagnostic primer is exactly as provided below. It is preferred that the ARMS primers in all aspects of the invention are 26 nucleotides in length. In the majority of the primers listed below the penultimate nucleotide has been altered from wild type cyt b sequence to destabilise the primer thereby making it more selective for the desired template and these primers are particularly preferred according to the invention. It will be apparent to the man skilled in the art of primer design that bases alternative to or in addition to those discussed above may also be varied without adversely affecting the ability of the primer to bind to the template.
- the primers included in Table 4 include:
- ARMS primers for P. teres, and V. ineaqualis which can be used effectively either on genomic DNA preparations or biological samples including fungal isolates, fungal cultures, fungal spores or infected plant material.
- cDNA material is recommended for the species where the intron/exon organisation is not currently characterised around the single nucleotide polymorphism (SNP) of interest.
- SNP single nucleotide polymorphism
- Such primers may be manufactured using any convenient method of synthesis. Examples of such methods may be found in standard textbooks, for example "Protocols For Oligonucleotides And Analogues: Synthesis And Properties;” Methods In Molecular Biology Series; Volume 20; Ed. Sudhir Agrawal, Humana ISBN: 0-89603-247-7; 1993; I s ' Edition.
- extension of a diagnostic primer can be designed to indicate the absence of the mutation resulting in a G
- ARMS primers for the detection of the absence of the mutation resulting in a G ⁇ 4 A replacement in the encoded protein is preferred. Primers designed for that pu ⁇ ose are described herein.
- the detection of the wild type sequence is useful as a control in relation to the detection of the mutation and also is necessary where quantitation of wild type and mutant alleles present in a sample is desired.
- the invention therefore provides a diagnostic primer capable of binding to a template comprising wild type fungal cytochrome b nucleotide sequence wherein the final 3' nucleotide of the primer corresponds to a nucleotide present in a wild type fungal cytochrome b gene said wild type fungus showing sensitivity to a strobilurin analogue or any other compound in the same cross resistance group.
- (-2) of the primer is not the same as that present in the corresponding position in the wild type cytochrome b sequence.
- the -3 nucleotide of the primer is not the same as that present in the corresponding position in the wild type cytochrome b sequence.
- Other destabilising components may be inco ⁇ orated along with the -2 or -3 nucleotide.
- the diagnostic primer of the invention is preferably at least 20 nucleotides in length, most piefeiably 26 nucleotides in length but this may be between 15 and 20 nucleotides in length
- diagnostic p mers capable of binding to a template compnsing wild type fungal cytochiome b nucleotide sequence wherein the final 3' nucleotide of the primer conesponds to a nucleotide present in a wild type fungal cytochrome b and wheiein up to 10, such as up to 8, 6, 4, 2, 1 , of the lemaining nucleotides may be vaned with respect to the wild type sequence without significantly affecting the pioperties of the diagnostic pnmer
- ARMS p meis may also be based on the reveise stiand of DNA if so desned
- Such reverse strand primers are designed following the same pimciples above foi foi ward strand p meis namely, that the primers may be at least 20 nucleotides in length most pieferably 26 nucleotides in length, but may be between 15 and 20 nucleotides in length and the final nucleotide at the 3' end of the pnmer matches the lelevant template l e mutant or wild type and piefeiably the penultimate lesidue is optimally changed such that it does not match the lelevant template Additionally up to 10, such as up to 8, 6, 4, 2, 1 , of the lemaining nucleotides in the primer may be vaned without significantly affecting the pioperties of the diagnostic primer
- a diagnostic primer of the invention with a further amplification pnmei lef erred to herein as the common primer, in one or more cycles of PCR amplification
- the further amplification pnmei is eithei a forward or a reveise common primer
- the pnmer used is as below
- the Primers shown below are reverse primers
- the common primer can be any convenient pathogen specific sequence which recognises the complementary strand of the cytochrome b gene (or other gene of interest) lying 3' of the mutation selective primer.
- the PCR amplicon size is preferentially 50 to 400bp long but can be from 30 to 2500bp long, or potentially from 30 to 10,000bp long.
- a convenient control primer may be used which is designed upstream from the G ⁇ 3 A position. It will be evident to the man skilled in the art that the control primer may be any primer which is not specific for the amplification of the mutation or wild type sequences. When using these primers along with the corresponding reverse ('common') primer described above, amplification will occur regardless whether the G) 43 A point mutation is present or not.
- a variety of methods may be used to detect the presence or absence of diagnostic primer extension products and/or amplification products. These will be apparent to the person skilled in the art of nucleic acid detection procedures. Preferred methods avoid the need for radiolabelled reagents. Particularly preferred detection methods are those based on fluorescence detection of the presence and/or absence of diagnostic primer extension products.
- Particular detection methods include gel electrophoresis analysis, "Sco ⁇ ions”TM product detection as described in PCT application number PCT /GB98/03521 filed in the name of Zeneca Limited on 25 November 1998 the teachings of which are incorporated herein by reference, “Taqman” TM product detection, for example as described in patent numbers US-A-5487972 & US-A-5210015; "Molecular Beacons” ® product detection, outlined in patent number WO-95/13399 and surface enhanced Raman resonance spectroscopy (SERRS), outlined in patent application WO 97/05280.
- Further preferred detection methods include ARMS linear extension (ALEX) and PCR with ALEX as described in published PCT application number WO 99/04037.
- ARMS primers based on the forward strand of DNA in combination with Scorpion detection based on the reverse strand of DNA as the detection method.
- the Sco ⁇ ion detection element prefeiably compnse the reverse primers shown in Table 6. It will be readily apparent to the man skilled in the art that alternative combinations of ARMS primers and Scorpion detection elements could also be used.
- the primer based on the forward strand of the DNA could be a combination of an ARMS primer with a Scorpion detection system and this could be used with a common primer based on the reverse strand of DNA or the pnmer based on the reverse strand of DNA could be a combination of an ARMS primer with a Sco ⁇ ion detection system and this could be used with a common primer based on the forward strand of DNA
- the Scorpion detection element is on the common primer.
- the ARMS primer specific to the mutation and the wild type sequence are used in combination with the common fluorescence labelled pnmei These two reactions are cairied out in diffeient PCR tubes and the fluorescence is emitted when the probe binds to the amplicon generated.
- the Sco ⁇ ion element may alternatively be incorpoiated on the ARMS primers.
- the two ARMS primers can be labelled with different fluorophores and used along with the common pnmer (this time unlabelled). These three primers may be included in the same reaction as the resulting mutant and wild type amplicons will lead to different fluorescence being emitted.
- the Sco ⁇ ions technology may be used in a number of different ways such as the intercalation embodiment where the tail of the Sco ⁇ ions primer carries an intercalating dye which is capable of being inco ⁇ orated between the bases of a double stranded nucleic acid molecule, upon which it becomes highly fluorescent; the FRET embodiment where the dyes involved in the primer form an energy transfer pair; the no-quencher embodiment where a fluorophore is attached to the tail of the Sco ⁇ ions primer; the Bimolecular embodiment where the fluorophore and quencher may be introduced on two separate but complementary molecules; the Capture Probe embodiment where amplicons may be specifically captured and probed using the same non-amplifiable tail and the Stem embodiment where the primer tail comprises self complementary stems.
- the intercalation embodiment where the tail of the Sco ⁇ ions primer carries an intercalating dye which is capable of being inco ⁇ orated between the bases of a double stranded nucleic acid molecule, upon which it becomes highly fluorescent
- the FRET embodiment where the dyes involved
- the methods of the invention described herein reliably detect a mutation in a fungal gene wherein the presence of said mutation gives rise to fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene at a detection level in the range of 1 mutated allele per 1 ,000,000 wild type alleles to 1 mutated allele per 10,000 wild type alleles, and preferably in the range of 1 mutated allele per 100,000 wild type alleles to 1 mutated allele per 10,000 wild type alleles.
- the method of the invention can also detect mutations occurring at higher frequency, for example, 1 mutated allele per 100 wild type alleles, 1 mutated allele per 10 wild type alleles or where only mutated alleles are present.
- the methods of the invention may be used to detect the frequency of the wild type allele in a background of mutated alleles.
- the high throughput nature of the method enables a wider area and more sites to be sampled and tested than might be possible using the bioassay Allele specific primer extension such as ARMS linked with leal time fluoiescent detection allows the detection of the presence of the resistance gene in a population befoie the effects of the gene can be viewed phenotypically by bioassay in heteroplasn ⁇ c and/or heterokaryotic cells, thus reducing the en or of classifying samples as sensitive when they carry a low fiequency of the resistance genotype Results aie obtained much fastei thiough simultaneous read-out (real time) compared to waiting for disease development in pi ant a, enabling fast responses to field situations and advice on resistance management to be given moie quickly
- kits will conveniently include one or moie of the following diagnostic, wild type, contiol and common oligonucleotide pnmers appiopnate nucleotide triphosphates, for example dATP, dCTP, dGTP, dTTP, a suitable polymerase as pieviously described, and a buffei solution
- piovides a method of detecting plant pathogenic fungal resistance to a fungicide said method compnsing detecting a mutation in a fungal gene wherein the presence of said mutation gives rise to fungal lesistance to a stiobilurin analogue or any othei compound in the same cioss lesistance gioup said method comprising identifying theillagence or absence of said mutation in fungal nucleic acid using any (or a)
- the invention provides a method of detecting plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene comprising contacting a test sample comprising fungal nucleic acid with a diagnostic pnmei for a specific mutation, the presence of which gives rise to resistance to said fungicide, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product.
- the invention provides a method of detecting plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene comprising contacting a test sample comprising fungal nucleic acid with a diagnostic primer for a specific mutation, the presence of which gives rise to resistance to said fungicide, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended only when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product.
- the methods of the invention described in the above aspect and embodiments are especially suitable for use with plant pathogenic fungal strains where the presence of a mutation in a cytochrome b gene gives rise to fungicide resistance and most especially to resistance to a strobilurin analogue or a compound in the same cross resistance group and most especially where the mutation in the fungal DNA gives rise to a replacement of a glycine residue at the position corresponding to S. cerevisiae cytochrome b residue 143, more especially to a G
- the invention provides a method of detecting and quantifying the frequency of a mutation giving rise to plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene said method comprising detecting the presence or absence of a mutation in a fungal gene wherein the presence of said mutation gives rise to fungal resistance to said fungicide said method comprising identifying and quantifying the presence or absence of said mutation in fungal nucleic acid using any (or a) single nucleotide polymorphism detection technique.
- the invention provides a method of detecting and quantifying the frequency of a mutation giving rise to plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene said method comprising detecting the presence or absence of a mutation in a fungal gene wherein the presence of said mutation gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising identifying and quantifying the presence or absence of said mutation in fungal nucleic acid using any (or a) single nucleotide polymorphism detection technique.
- the invention provides a method of detecting and quantifying the frequency of a mutation giving rise to plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene said method comprising detecting the presence of an amplicon generated during a PCR reaction wherein said PCR reaction comprises contacting a test sample comprising fungal nucleic acid with appropriate primers in the presence of appropriate nucleotide triphosphates and an agent for polymerisation wherein the detection of said amplicon is directly related to both the presence and absence of a mutation in said nucleic acid wherein the presence of said mutation gives rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene, and detecting and quantifying the relative presence and absence of the said mutation by reference to the presence or absence of an amplicon generated during the PCR reaction.
- the invention provides a method of detecting and quantifying the frequency of a mutation giving rise to plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene comprising contacting a test sample comprising fungal nucleic acid with diagnostic primers to detect both the presence and absence of a specific mutation in said nucleic acid, the presence of which gives rise to resistance to said fungicide, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primers relating to the absence and the presence of the specific mutation are extended when the appropriate fungal template is present in the sample; and detecting and quantifying the relative presence and absence of the said mutation by reference to the presence or absence of diagnostic primer extension products.
- the invention provides a method of detecting and quantifying the frequency of a mutation giving rise to plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene comprising contacting a test sample comprising fungal nucleic acid with diagnostic primers to detect both the presence and absence of a specific mutation in said nucleic acid, the presence of which gives rise to resistance to said fungicide, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primers relating to the absence and the presence of the specific mutation are extended only when the appropriate fungal template is present in the sample; and detecting and quantifying the relative presence and absence of the said mutation by reference to the presence or absence of diagnostic primer extension products.
- the methods of the invention described in the above aspect and embodiments are especially suitable for use with plant pathogenic fungal strains where the presence of a mutation in a cytochrome b gene gives rise to fungicide resistance and most especially to resistance to a strobilurin analogue or a compound in the same cross resistance group and most especially where the mutation in the fungal DNA gives rise to a replacement of a glycine residue at the position corresponding to 5.
- cerevisiae cytochrome b residue 143 more especially to a G
- the invention provides a method of selecting an active fungicide and optimal application levels thereof for application to a crop comprising analysing a sample of a fungus capable of infecting said crop and detecting and/or quantifying the presence and/or absence of a mutation in a gene from said fungus wherein the presence of said mutation may give rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene and then selecting an active fungicide and optimal application levels thereof.
- the detection method comprises any (or a) single nucleotide polymorphism detection technique and is more preferably comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the specific mutation in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product and the quantification is achieved by contacting a test sample comprising fungal nucleic acid with diagnostic primers to detect both the presence and absence of a specific mutation in said nucleic acid the presence of which gives rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primers relating to the absence and the presence of the specific mutation are extended when the appropriate fungal template is present in the sample; and detecting and
- the detection method comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the specific mutation in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended only when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product and the quantification is achieved by contacting a test sample comprising fungal nucleic acid with diagnostic primers to detect both the presence and absence of a specific mutation in said nucleic acid the presence of which gives rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primers relating to the absence and the presence of the specific mutation are extended only when the appropriate fungal template is present in the sample; and detecting and quantifying the relative presence and absence of the said mutation by reference to the presence or absence of diagnostic primer
- the methods of the invention described herein are especially suitable for use with plant pathogenic fungal strains where the presence of a mutation in a cytochrome b gene gives rise to fungicide resistance and most especially to resistance to a strobilurin analogue or a compound in the same cross resistance group and most especially where the mutation in the fungal DNA gives rise to a replacement of a glycine residue at the position corresponding to S. cerevisiae cytochrome b residue 143, more especially to a G
- the invention provides a method of controlling fungal infection of a crop comprising applying a fungicide to the crop wherein said fungicide is selected according to any of the selection methods of the invention described above.
- the method of the invention described above is especially suitable for use with plant pathogenic fungal strains where the presence of a mutation in a cytochrome b gene gives rise to fungicide resistance and most especially to resistance to a strobilurin analogue or a compound in the same cross resistance group.
- the invention provides an assay for the detection of fungicidally active compounds comprising screening the compounds against strains of fungi which have been tested for the presence or absence of a mutation giving rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene according to the methods of the invention described herein and then determining fungicidal activity against said strains of fungi.
- the methods of the invention described herein are especially suitable for use with plant pathogenic fungal strains where the presence of a mutation in a cytochrome b gene gives rise to fungicide resistance and most especially to resistance to a strobilurin analogue or a compound in the same cross resistance group and most especially where the mutation in the fungal DNA gives rise to a replacement of a glycine residue at the position corresponding to S. cerevisiae cytochrome b residue 143, more especially to a G
- the appropriate rate of application of fungicides and/or the appropriate combination of fungicides to be applied to the crop may be determined.
- the methods of the invention described herein are particularly suitable for monitoring fungal resistance to a strobilurin analogue or a compound in the same cross resistance group in crops such as cereals, fruit and vegetables such as canola, sunflower, tobacco, sugarbeet, cotton, soya, maize, wheat, barley, rice, sorghum, tomatoes, mangoes, peaches, apples, pears, strawberries, bananas, melons, potatoes, carrot, lettuce, cabbage, onion, vines and turf.
- crops such as cereals, fruit and vegetables such as canola, sunflower, tobacco, sugarbeet, cotton, soya, maize, wheat, barley, rice, sorghum, tomatoes, mangoes, peaches, apples, pears, strawberries, bananas, melons, potatoes, carrot, lettuce, cabbage, onion, vines and turf.
- the methods of the invention described herein are particularly sensitive for detecting low frequencies of mutations in mitochondrially encoded genes, such as the cytochrome b gene, making this an especially useful and commercially important way of screening plant pathogenic fungi for the onset of fungicidal resistance wherein the resistance is due to a mutation in a mitochondrially encoded gene.
- Figure 1 shows: a diagrammatic representation of the secondary structure of the Scorpion P. viticola primer using the MFold Zucker program
- Figure 2a shows: a graph illustrating the PCR amplification of a serial dilution oi P. viticola mutant DNA in a background of wild type DNA using the C specific primer and the Sco ⁇ ion primer (in duplicate).
- Figure 2b shows: a graph illustrating a multiplex experiment with P. viticola ARMS primers on two serial dilutions of mutant DNA in a background of wild type DNA (in duplicate).
- the line represented by the diamonds shows the results for 1 : 100 Gfam
- the line represented by the triangles shows the results for 1 :500 Gfam
- the line represented by the circles shows the results for 1 : 100 Ctet
- the line represented by the squares shows the results for 1 :500 Ctet.
- Figure 3a shows: a graph illustrating E. graminis total DNA amplified with the three primer pairs (specific G/C and control primers) (in duplicate). As shown in the figure the line represented by the diamonds shows the results for 1/100 standard, the line represented by the triangles shows the results for 1/100 Gmix and the line represented by the crosses shows the results for 1/100 Cmix.
- the line represented by the diamonds shows the results for Qmix
- 1/100 line 1
- the line represented by the squares shows the results for Qmix
- 1/1000 hne 2
- the line lepresented by the tnangles shows the results for Gmix
- 1/100 l ⁇ ne 3
- the line represented by the diamonds shows the lesults for Gmix
- 1/1000 l ⁇ ne 4
- the line lepiesented by the cross shows the lesults for Cmix
- 1/100 hne 5
- the line lepresented by the circles shows the results foi Cmix
- 1/1000 hne 6
- Figuie 5a shows a giaph illustiating the PCR amplification of a senal dilution of a wild type R secalis plasmid amplified with the wild type specific pnmer pair (in duplicate)
- the line represented by the diamonds shows the lesults for Gplasmid 10 ⁇ 8
- Figure 5b shows a giaph illustrating the PCR amplification of the highest concentiation of wild type and mutant R secalis plasmids amplified with the wild type specific pnmer pair (in duplicate)
- fiom the figuie the line lepiesented by the diamonds shows the results foi G-plasmid 10 ⁇ 8 and the line lepiesented by the triangles shows the results for c- plasmid 10 ⁇ 8
- Figure 6a shows a giaph illustrating the PCR amplification of a senal dilution of a mutant R secalis plasmid amplified with the mutant specific pnmei pan (in duplicate)
- the line repiesented by the diamonds shows the iesults foi c-plasmid 10 ⁇ 8
- the line lepresented by the tnangles shows the results for c-plasmid 10 ⁇ 6
- the line lepiesented by the squaies shows the results lor c-plasmid 10 ⁇ 4
- the line lepiesented by the cucles shows the iesults foi c-plasmid 10 ⁇ 2
- Figuie 6b shows a graph illustiating the PCR amplification of the highest concentration of wild type and mutant R secalis plasmids amplified with the mutant specific pnmei pair (in duplicate) As can be seen fiom the figure the line represented by the diamonds shows the lesults for G-plasmid 10 ⁇ 8 and the line repiesented by the triangles shows the iesults for c- plasmid 10 ⁇ 8
- Figuies 7a, b and c show graphs illustiating the PCR amplification of R secalis DNA and cDNA templates in three dilutions with the G primer pair (in duplicate) As can be see fiom the figures the line represented by the diamonds shows total DNA and the line represented by the triangles shows cDNA
- Figures 8 a, b and c show graphs illustrating the PCR amplification of /? secalis DNA and cDNA templates in thiee dilutions with the C primer pair (in duplicate) As can be see from the figures the line represented by the diamonds shows total DNA and the line represented by the triangles shows cDNA.
- Figure 9a and b show: graphs illustrating the amplification of P. teres P13 and P15 isolates in two dilutions with the three primer pairs (in duplicate).
- the diamonds representing S-mix line 1
- the triangles representing S-mix 1/10 line 2
- the squares representing G-mix line 3
- the circles representing G-mix 1/10 line 4
- the ScorpionTM system (AstraZeneca Diagnostics) was used as a product detection system.
- This detection system is described in full in PCT application number PCT/GB98/03521 filed in the name of Zeneca Limited on 25 November 1998 the teachings of which are inco ⁇ orated herein by reference.
- This novel detection system uses a tailed primer and an integrated signalling system.
- the primer has a template binding region and a tail comprising a linker and a target binding region.
- the target binding region in the tail hybridises to complementary sequence in an extension product of the primer.
- This target specific hybridisation event is coupled to a signalling system wherein hybridisation leads to a detectable change.
- the detection method of this system offers a number of significant advantages over other systems.
- a hexethylene glycol (HEG) monomer as a blocking moiety that is sited between the template binding region of the primer and the tail region, which moiety prevents polymerase mediated chain copying of the tail region of the primer template.
- FAM fluorescent molecule is added to the 5'end of the primer.
- FAM is one of the fluorescence molecules that can, for example, be readily detected by the 488nm laser of the ABI PRISM 7700 instrument (PE Biosystems)
- MR is a non-fluorogenic quencher attached to a uracil residue
- Other fluorescence molecules and quenching mechanisms can also be accommodated in Sco ⁇ ion primer design and would be suitable to use in this invention.
- Example 4 an intercalating dye was also used as a detection mechanism.
- the eighteen examples together describe the characterisation of partial cytochrome b gene sequences from a panel of important wild type fungal isolates, whilst Examples 1, 2 and 6 also describe the characterisation of partial cytochrome b gene sequences from fungal isolates which are resistant to strobilurin analogues and other compounds in the same cross resistance group. The methods are particularly suitable for use with the strobilurin analogues azoxystrobin and picoxystrobin.
- Example 1 we describe the characterisation of partial Plasmopara viticola cytochrome b gene sequence, the characterisation of a single nucleotide polymo ⁇ hism (SNP) that gives rise to strobilurin analogue resistance in P. viticola and the validation of a real time PCR Sco ⁇ ion assay for the monitoring of this SNP in P. viticola. A multiplexing approach to carrying out the real time PCR assay is also described.
- P. viticola is the causal agent of vine downy mildew.
- Freshly inoculated plants were incubated for 24 hours in a humidity chamber (temperature ambient, relative humidity 100%), then moved to a growth room (day 24°C/r.h. 60%; night 18°C/r.h. 95%; daylength 16 hours; 6,000 lux). Plants were returned to the humidity chamber after 6 days for a further 24 hour period, after which time successful infection showed as sporulating lesions on the abaxial leaf surfaces. Further subculturing was carried out as above, adjusting the sporangial suspension to 5,000- 10,000 sporangia per ml.
- a DNA fragment encoding a significant part of wild type P. viticola cytochrome b sequence was amplified using primers based on conserved regions of Phytophthora megasperma and Aspergillus nidulans cytochrome b genes (Cytbl2F (5' TGAACATATTATGAGAGATGT 3') (SEQ ID NO 106)and CytlOR (5' AATTGCATAAAAAGGTAAAAA 3') (SEQ ID NO 1 7) which delineate the sequence encoding amino acid region 66 and 281 of fungal cytochrome b based on the S. cerevisiae numbering system).
- DNA was extracted from the strobilurin analogue-sensitive isolate, using a phenol/chloroform extraction protocol. Sporangia were washed into 30ml of double distilled H O (ddH 2 O) from six leaves with 90-100% disease cover (originated from artificially inoculated six week old vine seedlings). The sporangial suspension was filtered through Miracloth (Calbiochem cat # 475855) and centrifuged at 3600 ⁇ m for 10 minutes at 4°C. The sporangia were then frozen in liquid nitrogen and ground to a fine powder using a pestle and mortar which had been previously cleaned and sterilised by acid washing and autoclaving.
- ddH 2 O double distilled H O
- the sporangial suspension was filtered through Miracloth (Calbiochem cat # 475855) and centrifuged at 3600 ⁇ m for 10 minutes at 4°C. The sporangia were then frozen in liquid nitrogen and ground to a fine powder using a pestle and mortar which had
- lysis buffer 200mM Tris-HCl (pH8.5), 250mM NaCl, 25mM EDTA and 0.5% SDS
- a phenol/chloroform/isoamyl alcohol 25:24: 1
- the tubes were centrifuged for 30 minutes at 14000 ⁇ m and the aqueous phase transfened to fresh Eppendorf tubes. The phenol/chloroform/isoamyl alcohol extraction was then repeated but this time the tubes were centrifuged at 14000rpm for only 15 minutes.
- PCRs were set up as recommended by the manufacturer of the Taq Polymerase enzyme (Gibco) in a final reaction volume of lOO ⁇ l. The primers were added to the reactions to a final concentration of lpmole/ ⁇ l.
- P. viticola specific primers based on the above analyses used in later amplifications of the cytochrome b region of interest were PL AS 17F (5 ' AAATAACGGTTGGTT A ATTCG 3') (SEQ ID NO 108) and PLAS15R (5' TCTTAAAATTGCATAAAAAGG (SEQ ID NO 109)3') delineating amino acid region 73-283 of fungal cytochrome b according to the S. cerevisiae numbering system.
- a strobilurin analogue-resistant isolate of P. viticola was identified at one trial site. Infected vine leaves were collected and processed essentially as above though samples were subcultured as mass populations and not isolated as single lesions prior to testing. The test method to verify strobilurin analogue resistance was a 24 hour preventative spray on 4-week old vine seedlings.
- a chemical dilution series was prepared by dissolving 5mg strobilurin analogue (strobilurin analogue as used in all examples herein denotes azoxystrobin) (technical material, 97% pure) in 1ml acetone and carrying out a further dilution in deionised water at room temperature to give a rate of lOppm (a dose known to give 100% control of strobilurin analogue sensitive baseline isolate).
- the abaxial surfaces of the target leaves were sprayed using a DeVilbiss spray gun, lOpsi, to maximum retention. Control plants were sprayed with deionised water only. The treated plants were left to dry in a growth room (conditions as above) overnight.
- Partial cytochrome b gene sequence was amplified with PLAS17F and PLAS15R primers from the resistant isolate (T5).
- Total genomic DNA (nuclear and mitochondrial) from this isolate was extracted using the phenol/chloroform extraction protocol described above. Again DNA presence and quality was checked by gel electrophoresis and suitable aliquots were diluted 1: 10 and 1 : 100 in ddH 2 O for PCR studies. lO ⁇ l of each DNA dilution was then added to Ready .To.GoTM Taq polymerase PCR beads (Amersham Pharmacia Biotech product number 27-9555-01) and made up to 25 ⁇ l with PLAS17F and PLAS15R primer solutions, each to a final primer concentration of lpmole/ ⁇ l.
- a l ⁇ l sample of the pooled PCR products was then cloned in the TA cloning pCR2.1 vector (Invitrogen) and transformed into E.coli cells (TOP 10 One ShotTM competent cells) as per the manufacturer's recommendations.
- TOP 10 One ShotTM competent cells E.coli cells
- a series of resulting clones were checked for the presence of inserts by performing Wizard minipreps (as per Promega instructions) and restriction digest analysis using EcoRI. 10 clones with the correct size inserts ( ⁇ 500bp) were then sequenced using Ml 3 forward and reverse primers (ABI377XL automated sequencer).
- G-sp-f- 1 CCTTGGTG ACAAATGAGTTTTTGTGG (SEQ ID NO 1 10)
- G-sp-f-2 CCTTGGTGACAAATGAGTTTTTGGAG (SEQ ID NO 1 1 1 )
- A mutation: C-sp-f- 1 : CCTTGGTG ACAAATGAGTTTTTGGCC (SEQ ID NO 1 12)
- C-sp-f-2 CCTTGGTGACAAATGAGTTTTTGGAC (SEQ ID NO 1 13) and a control primer designed upstream from the point mutation: STAND: GCCTTGGGGACAAATGAGTTTTTG (SEQ ID NO 1 14)
- the -1 base corresponds to the target point mutation site. Bases presented in bold differ from the wild type P. viticola cytochrome b sequence.
- the -20 base was changed from a G to a T base. This was done to disrupt the run of G bases.
- the G-sp-f-2 and C-sp-f-2 primers the -2 position was changed from a G to a A base.
- the G-sp-f- 1 the -3 position was changed from a G to a T base.
- the -2 primer was changed from a G to a C base. These alterations to the sequence were made to destabilise the primer and render any primer extension more specific to the corresponding template. Examples in the literature have shown that destabilising the ARMS primer decreases the risk of the primer mispriming on the wrong template (Newton et al, Nucleic Acid Research 17 (7) 2503-2516 1989).
- the Sco ⁇ ionTM product detection system was used in this case as a detection mechanism and the detection system was inco ⁇ orated on the reverse primer.
- the resulting amplicon was 234 bp long with the ARMS primers, and 235 bp long with the control primer.
- the Sco ⁇ ion primer was designed using Oligo 5 and MFold programs (MFold predicts optimal and suboptimal secondary structures for RNA or DNA molecules using the energy minimization method of Zucker (Zucker, M. (1989) Science 244, 48-52; SantaLucia, J.Jr. (1998). Proc. Natl. Acad. Sci. USA 95, 1460-1465).
- the sequence of the P. viticola Scorpion primer was:
- AmpliTaq Gold enzyme (Perkin-Elmer/ ABI) was included in the reaction mix at lunit/25 ⁇ l reaction.
- the reaction mix also contained lx buffer (lOmM Tris-HCl (pH8.3), 50mM KC1, 3.5 mM MgCl 2 , 0.01% gelatine) and lOO ⁇ M dNTPs.
- Amplifications were performed in an ABI Prism 7700 instrument for continuous fluorescence monitoring. A preliminary cycle of 95°C for 10 minutes was performed followed by 50 cycles of 95°C for 15 sec and 60°C for 45 sec. Fluorescence was monitored during the annealing/extension stage throughout all cycles.
- Primers were first validated for use in such analyses by using plasmid DNA as template at various concentrations. This was performed in order to check the specificity and sensitivity of the primer designs. Partial wild type cytochrome b gene sequence and the corresponding tract containing the G ⁇ A mutation were cloned into the TA pCR2.1 vector (Invitrogen) for use in this validation process. The C-sp-f-2 and G-sp-f-2 primers were preferred to the C-sp-f- 1 and the G-sp-1 primers as duplicate PCRs gave more consistent results and were slightly more specific. In all cases, plasmid DNA was diluted in lmg/ml bovine serum albumin (BSA).
- BSA bovine serum albumin
- the graph shown in Figure 2a illustrates PCRs where a dilution of mutant plasmid in a background of wild type template was amplified using the ARMS C-sp-f-2 primer.
- the C plasmid dilution reduces in the wild type plasmid background, the fluorescence detection is delayed. In all cases, the final plasmid concentration in the PCR was lxlO 7 molecules/ ⁇ l. With each 10 fold dilution of the C plasmid, there is a delay of 3-4 cycles in the detection of fluorescence.
- the C-sp-f-2 primer is totally specific to its corresponding template as no fluorescence can be detected in the 100% wild type plasmid sample in this experiment.
- the concentration of BSA added to the reactions was increased and the detergent Tween-20 was added to the PCR.
- an initial PCR was carried out and the PCR product from this reaction was used as a template in the real time PCR, the spore dilutions were boiled for 10 minutes before being added to the real time PCR to improve cell lysis and the DNA was extracted from the spores using 3 different protocols (DNA Isolator from Genosys Biotechnologies Inc., DNAzol from Helena Biosciences, and Qiagen DNeasy plant mini kit).
- the G ⁇ 4 and Aj 4 allele frequency was estimated in a P. viticola isolate collected from a field trial (denoted 17 A). Sporangia were collected in ddH 0 off 120 leaves and harvested by centrifugation. This sample contained approximately 2400 lesions and 6.4xl0 7 sporangia. 12xl0 6 sporangia were kept at -80°C to be used for DNA extraction.
- a genomic DNA extraction using the DNeasy Plant Minikit (Qiagen catalogue No. 69103) was carried out and the resulting DNA was diluted 1 : 10 and 1 : 100 in ddH 0 for use as template for real time PCR analysis. The PCR conditions were as described above.
- the resulting Cycle Threshold (Ct) values were 20 for the G specific primer and 34 with the C specific primer giving a Ct difference of 14 cycles and thus a frequency of resistant alleles of approximately 1 in 10,000.
- Sco ⁇ ion detection element was inco ⁇ orated on the ARMS primers to enable the G
- the Sco ⁇ ion/ARMS primer sequences were as follows: G ) 3 allele specific primer:
- Example 2 we report the characterisation of partial Erysiphe graminis f.sp tritici and hordei cytochrome b gene sequences, the characterisation of a SNP that gives rise to resistance to strobilurin analogues or compounds in the same cross resistance group and the description of a real time PCR Sco ⁇ ion assay for the monitoring of this SNP in E. graminis f.sp. tritici and hordei.
- Isolates of E. graminis f.sp. tritici and f.sp. hordei were collected from Northern France, Germany, Ireland and the United Kingdom. This was achieved by one of two methods: hand collection of field leaves or air spora sampling by car- mounted jet spore trap (Burkard Manufacturing Co. Ltd., Rickmansworth, UK).
- wheat leaves were cut from 9 day old plants (cv. Rapier) and placed on 1.8% water agar in plastic dishes, and maintained at 5°C until required.
- a jet spore trap was mounted on top of a car and the car was driven at speeds up to 90 km/hr along prearranged routes in each country.
- the plastic dishes containing the leaf pieces were placed in the base of the spore trap column to allow airborne spores entering the trap to settle onto the leaves. Dishes were changed approximately every 80 km. Once a batch of leaf pieces had been used in the spore trap, they were transferred to square petri dishes (lOc ⁇ r) containing 60ml 1.8% water agar and filter paper and stored at 5°C.
- graminis were incubated for 7 days after which time sporulation was sufficient to inoculate a phenotypic resistance assay. Single spore isolates were incubated for 7 days but subcultured one further time to provide enough material for testing. If sporulation was poor the above process was repeated until good (60-70%) sporulating disease coverage was obtained on all leaf pieces in order to generate sufficient conidia for assay. Testing and subsequent maintenance of resistant isolates was carried out on detached wheat seedling leaves treated 24 hours prior to inoculation with an aqueous solution of strobilurin analogue at 5ppm (a rate known to give 100% control of strobilurin sensitive baseline isolates) and Tween 20 wetting agent. Isolates were tested either as mass populations or single pustule isolates. Conidia were dry-inoculated onto treated leaf pieces. Infected material was incubated in a controlled environment (as described above) for 7 days prior to assessment.
- Partial E. graminis f.sp. tritici cytochrome b gene sequence was amplified using primers based on conserved regions of Aspergillus niger and Neurospora crassa cytochrome b genes (Cytb3F (5 ' C AGCTTC AGCTTTCTTCT 3 ' ) (S ⁇ Q ID NO 122) and Cytb9R (5 '
- ACTTAAAGGTCTAAATTG 3' (S ⁇ Q ID NO 122) which delineate the sequence encoding amino acid region 86 to 322 of fungal cytochrome b based on the S. cerevisiae numbering system).
- Approximately 500mg conidia from a strobilurin analogue-sensitive isolate that had had no exposure to strobilurin analogue selection were collected by tapping directly off leaves with sporulating disease into 1.5ml Eppendorf tubes. DNA was extracted from this conidial sample using a phenol/chloroform extraction protocol (see above).
- DNA presence and quality was analysed by gel electrophoresis and a serial dilution (1 : 10, 1 : 100 and 1 : 1000) was made in ddH O for use as template material in PCRs.
- PCRs were set up as recommended by the manufacturer of the Taq Polymerase enzyme (Gibco) in a final volume of lOO ⁇ l and primers were added to the reactions to a final concentration of lpmole/ ⁇ l.
- lO ⁇ l of each DNA dilution was added to the appropriate PCRs. Rigorous procedures were undertaken in order to limit the risk of PCR contamination. 30 cycles of 94°C for 45 sec, 42°C for 45 sec and 72°C for 1 min 30 sec were carried out in a Hybaid Omn-E instrument.
- graminis specific primers designed on the basis of the novel sequence were used in later amplifications of the cytochrome b region of interest. These were ⁇ RY1 IF (5' ATGAACAATTGGTACAGTAAT 3') (S ⁇ Q ID NO 124) and ⁇ RY12R (5' GTTAGGTATAGATCTTAATAT 3') (SEQ ID NO 125). Together they delineate the sequence encoding amino acids region 114-287 of fungal cytochrome b according to the S. cerevisiae coding system.
- Partial cytochrome b sequence was amplified with ERY1 IF and ERY12R primers from an E. graminis f.sp. tritici strobilurin analogue-resistant population.
- Conidia ⁇ 200mg
- Conidia ⁇ 200mg
- ddH 2 O diluted 1 : 10, 1 : 100 and 1 : 1000 in ddH 2 O.
- lO ⁇ l of each conidial dilution was added to a Ready.
- To.GoTM Taq polymerase PCR bead (Amersham Pharmacia Biotech product number 27-9555-01) and made up to 25 ⁇ l with ERY1 IF and ERY12R primer solutions so that the final primer concentration was lpmole/ ⁇ l.
- Partial cytochrome b gene sequence was also characterised from two E. graminis f.sp. hordei isolates. Small samples of conidia (-lOOmg) were tapped off infected barley leaves (which were prepared as previously described for the wheat) into sterile Eppendorf tubes. These conidial samples were kept at -80°C until needed. Each sample was then resuspended in 200 ⁇ l ddH 2 0, further diluted 1 : 10 and 1 :100, and lO ⁇ l of each dilution was used as templates for amplification. Partial cytochrome b gene sequences were amplified with ERY1 IF and ERY12R primers. The PCR conditions and components were as described previously.
- graminis primers were designed on the basis of the above information on the G ⁇ 4 A point mutation: a forward ARMS primer based on the wild type sequence: G-sp- 1 : CCATACGGGCAGATG AGCCACTGGAG (SEQ ID NO 126) a forward ARMS primer based on the G] 43 A mutation: C-sp- 1 : CCATACGGGCAG ATGAGCCACTGGAC (SEQ ID NO 127) and a control primer designed upstream from the point mutation: STAND2 : GCC ATACGGGCAG ATGAGCCACTG (SEQ ID NO 128) In both the G-sp-1 and the C-sp-1 primers, the -1 base (the 3'end base) corresponds to the second nucleotide of the G ⁇ 4 /A
- Bases in the primers that differ from the wild type cytochrome b E. graminis sequence are in bold.
- the -2 position was changed from a G to a A base. This was done to destabilise the primer, as is normal in ARMS reactions.
- the Sco ⁇ ionTM product detection system was used in this case as a detection mechanism. Again the Sco ⁇ ion primer was designed using Oligo 5 and the MFold (see details in Examplel) programs.
- the sequence of the E. graminis Scorpion primer was: 5' FAM-CCCGCCGTTTTAGCTGCTTTAGCTTTAATGCGGCGGG (SEQ ID NO 129) MR-REG-AACACCTAAAGGATTACCAGATCCTGCAC 3' (SEQ ID NO 130) Underlined regions are the hai ⁇ in forming parts, FAM is the fluorescein dye, MR is a non- fluorogenic quencher attached to a uracil residue and HEG is the replication blocking hexethylene glycol monomer. The sequence in italics is the reverse primer sequence and the sequence in bold is the Sco ⁇ ion sequence which anneals to the extension product of the reverse primer.
- primers were synthesised by Oswel DNA service. Before use, the primers were diluted to 5 ⁇ M in a total volume of 500 ⁇ l each. They were then further diluted to a final concentration of 500nM in the PCRs.
- Primers were first validated for use in ARMS/Sco ⁇ ion analyses by using plasmid DNA and total DNA as templates. This was performed in order to check the specificity and sensitivity of the primer designs. DNA fragments comprising partial wild type cytochrome b gene sequence and the corresponding sequence containing the G ⁇ 4 A mutation were cloned in the TA pCR2.1 vector to be used in this validation process. Plasmid DNA was always diluted in lmg/ml BSA prior to use as template in real time PCR assays. Fungal DNA for analysis was extracted from an E. graminis f.sp. tritici strobilurin analogue-sensitive control isolate using a phenol/chloroform extraction method (as described previously).
- a conidial E. graminis f.sp. tritici sample from a French strobilurin analogue-sensitive isolate (F12C) and a conidial E. graminis f.sp. tritici sample from a German strobilurin analogue-resistant isolate (11-8) were then tested using the validated primers at two conidial dilutions. All three fungal isolates originated from single pustules.
- AmpliTaq Gold enzyme (Perkin-Elmer/ABI) was included in the reaction mix at lunit/25 ⁇ l reaction.
- the reaction mix also contained lx buffer (lOmM Tris-HCl (pH8.3), 50mM KC1, 3.5 mM MgCl 2 , 0.01% gelatine), lOO ⁇ M dNTPs.
- Amplifications were performed in an ABI Prism 7700 instrument for continuous fluorescence monitoring. A preliminary incubation of 95°C for lOminutes was performed followed by 50 cycles of 95°C for 15sec and 60°C for 45sec. Fluorescence was monitored during the annealing/extension stage throughout all cycles.
- Control and G specific primer reactions emit a strong fluorescence signal whilst the C specific primer reaction does not show any increase in fluorescence.
- the control and G-specific ARMS primers have recognised and bound to the template whilst the C-specific primer did not bind to the template present in the reaction.
- the G ⁇ 43 :A )4 allele analysis is indicating only presence of the wild type allele.
- Figure 3b illustrates PCRs where the French sensitive isolate (F12C) was analysed with the three primer mixes (Stand 2 + E. graminis Scorpion, G-sp-1 + E. graminis Scorpion and C-sp-1 + E. graminis Sco ⁇ ion).
- F12C French sensitive isolate
- the three primer mixes Stand 2 + E. graminis Scorpion, G-sp-1 + E. graminis Scorpion and C-sp-1 + E. graminis Sco ⁇ ion.
- ⁇ 200mg conidia were suspended in 200 ⁇ l ddH 2 O and diluted 1 : 100 and 1 : 1000 in ddH 2 O. 5 ⁇ l of the dilutions was added to the appropriate PCRs.
- the control and G-specific primer reactions emitted a strong signal whilst the C-specific primer reaction did not show any increase in fluorescence. This indicates that only the wild type allele has been detected in this sample.
- Figure 4 illustrates PCRs where the German resistant isolate at two conidial dilutions was amplified using the three primer mixes (Stand 2 + E. graminis Sco ⁇ io, G-sp-1 + E. graminis Sco ⁇ io and C-sp-1 + E. graminis Sco ⁇ io).
- control and C-specific primer reactions emit strong signals whilst the G-specific primer reaction does not show any fluorescence. This indicates that only the mutant G
- EXAMPLE 3 In Example 3, we report the characterisation of partial cytochrome b Rhynchosporium secalis gene sequence and a real time PCR study where various R. secalis isolates were screened for the G
- Partial cytochrome b gene sequence was obtained from two R. secalis isolates (Kl 124 and K3327). These isolates were grown from a suspension of 100,000 spores per ml inoculated in a medium with a non-fermentable carbon source shaking at 85 ⁇ m for 21 days at 19°C (12hrs light/12hrs dark) and the mycelia were collected by filtering through Miracloth and frozen at -20°C until required. DNA was produced from the mycelia by using a phenol/chloroform extraction protocol (see Example 1).
- DNA yield and quality were checked by gel electrophoresis and then a serial stock dilution was made (1: 10, 1 :100 and 1: 1000 in ddH 2 O) for use as templates in PCR amplifications.
- PCRs were set up as described in earlier examples.
- the primers used were either degenerate primers (deg4F (5' AGGTYTRTA YTRYGGDTCWTA 3 ' ) (SEQ ID NO 131 ) and deg3R (5 '
- AGCDATAACWCCTAATAATTT 3' (SEQ ID NO 132) designed from homologous regions of cytochrome b fungal genes (delineating the sequence encoding amino acid region 100-294 according to S. cerevisiae coding system) or E. graminis specific primers ⁇ RY1 IF and ⁇ RY12R (details as in Example 2).
- a band of the expected size ( ⁇ 500bp) was amplified using both primer pairs from each isolate and each PCR product was cloned in the pCR2.1 TA vector (Invitrogen).
- G-sp-3 CCTTATGG ACAGATGTCTTTATGAAG (SEQ ID NO 1 4) two forward ARMS primer based on the predicted G) 4 A mutation: C-sp-2: CCTTATGG ACAG ATGTCTTTATG ATC (SEQ ID NO 135)
- C-sp-3 CCTTATGGACAGATGTCTTTATGAAC (SEQ ID NO 136) and a control primer designed upstream from the point mutation:
- the Sco ⁇ ionTM product detection system was used in this case as a detection mechanism and the Sco ⁇ ion reverse primer was again designed using the Oligo 5 and the MFold programs (details as in Example 1).
- the R. secalis Sco ⁇ ion primer sequence was: 5' FAM-CCCGCCATATTAGCTGCATTAGTATTAATGCGGCGGG (SEQ ID NO 138) - MR-B ⁇ G-TACACCTAAAGGATTACCTGACCCTGCAC 3'(SEQ ID NO 139) (See previous examples for details). All primers were synthesised by Oswel DNA Service. Before use, the primers were diluted to 5 ⁇ M in a total volume of 500 ⁇ l each. The primers were then further diluted to a final concentration of 500nM in the PCRs.
- primers were first validated for use in ARMS/Sco ⁇ ion analyses by using plasmid DNA as template at various concentrations. This was performed in order to check the specificity and sensitivity of the primer designs. Partial wild type cytochrome b gene sequence and a corresponding sequence containing the G ⁇ 43 A mutation were cloned in the TA pCR2.1 vector to be used in this validation process. As this mutation has not yet been found in R. secalis DNA, the A
- PCRs were set up using standard methods as previously described and 30 cycles of 94°C for 45 sec, 56°C for 45 sec and 72°C for 1 min 30 sec were performed on a Hybaid Omn-E instrument. An initial incubation of 3 minutes at 94°C and a final extension incubation of 10 minutes at 72°C were also included.
- the ⁇ 370bp PCR product was cloned into the TA pCR2.1 vector and resulting clones were sequenced to check for any PCR induced errors prior to use in this experiment.
- Figure 5b shows the highest concentration G (wild type (wt)) and C (mutant) cassette amplified with the G-sp-2 primer mix.
- the G primer does not misprime off the C template until very late in the PCR even though the DNA template concentration is high ( ⁇ 10 8 molecules of template in reaction). The significant delay before the G mispriming event therefore demonstrates that the primer has a good window of specificity.
- the C-sp-2 primer set also shows good specificity through the specific and non specific plasmid dilutions (figure 6a and 6b). G-sp-2 and C-sp-2 primer mixes were used in following experiments instead of G-sp-3 and C-sp-3 primer mixes.
- the second part of this study was to compare using total (genomic) DNA and cDNA as template for the PCR.
- Total DNA material was prepared from the R.secalis isolates using a phenol-chloroform extraction method (as described previously).
- Total RNA was extracted from lOOmg of ground mycelia using the RNeasy Plant minikit (Qiagen catalogue No. 74903) according to the manufacturer's recommendation.
- First strand cDNA synthesis was then undertaken with l ⁇ g of total RNA using RT PCR with the Advantage RT-PCR kit (Clontech catalogue No. K1402-1) according to the manufacturer's recommendation. Pools of total DNA and cDNA from three isolates (K3278, K3274 and K3276) were prepared.
- the total DNA pool was used as template diluted 1 : 100, 1 : 1000 and 1 : 10000 and the cDNA was used as template neat and diluted 1 :5 and 1 : 10. In each case, 5 ⁇ l of template was added to the PCRs. Real time PCR conditions described in Example 1 and 2 were also used except that in this case 40 cycles PCR were performed instead of 50.
- Figure 7a, b and c illustrate results obtained with total DNA and cDNA templates at three dilutions (dilution 1 : total DNA (1 :100) and cDNA (neat); dilution 2: total DNA (1 : 1000) and cDNA (1 :5); dilution 3: total DNA (1 : 10000) and cDNA (1: 10)) amplified using the G primer mix.
- Figures 8a, b and c illustrate the total DNA and cDNA templates amplified using the C primer mix. Using total DNA instead of cDNA as template gave more sensitive results with earlier Cycle threshold values. In order to give the best chance of detecting any C mutation, total DNA inputs at dilutions of 1 : 10 and 1: 1000 were chosen for future analyses. No fluorescence changes could be detected when the C specific primer mix was used in this 40 cycles PCR indicating that only the wild type Gj 4 allele was found in these isolates.
- Example 4 we report the characterisation of partial Pyrenophora teres cytochrome b gene sequence and a study where a G ⁇ 4 A resistance allele detection assay was carried out on a variety of P. teres isolates. This is a species where the G] 4 A mutation had not been identified previously.
- This example is divided into two sections; one describing a real time PCR study using an intercalating dye detection method using cDNA preparations of P. teres isolates and the other describing a real time PCR study using a Sco ⁇ ion detection assay on genomic DNA preparations of P. teres isolates.
- Real time PCR study using an intercalating dye one describing a real time PCR study using an intercalating dye detection method using cDNA preparations of P. teres isolates and the other describing a real time PCR study using a Sco ⁇ ion detection assay on genomic DNA preparations of P. teres isolates.
- Wild type isolates of P. teres were collected from the UK and France during 1994, 1996 and 1998 (see Table 10 for P. teres isolate details). 1994 and 1996 isolates could be considered "baseline" (collected prior to use of strobilurin analogues in the field) and 1998 isolates were obtained from trial sites which had been exposed to several sprays of strobilurin analogues over a number of seasons. Infected barley leaves were hand picked and sent to Jealott's Hill Research Station (Zeneca Agrochemicals). Upon arrival in the laboratory, the leaves were incubated in a humid environment at 21° for 24-48 hours.
- Partial cytochrome b sequence was identified from two isolates (K1056 and K1916).
- the initial wild type sequence was obtained from a biological sample prepared by inoculating potato dextrose broth (see Table 9) with a macerated mycelial suspension. The flask was incubated at 85 ⁇ m on an orbital shaker under a 12 hours white light/12 hours no light regime at a constant temperature of 19°C for 21 days until there was sufficient mycelial material for the DNA extraction protocol. The mycelium was then harvested by filtering through Miracloth and was frozen at -20°C until needed. Total DNA was produced using the phenol/chloroform extraction protocol (see Example 1).
- a specific P. teres primer (Pt2R: 5' CTT AC A TCT GTA ATA GGT AAT 3') (SEQ ID NO 140) was designed in the novel stretch of cytochrome b gene and was used with a forward primer that was designed on the basis of Venturia inaequalis cytochrome b gene sequence (Pt5F: 5' TGT TAC TTT AGC AAT GCA CTA 3') (SEQ ID NO 141) on P. teres cDNA template. cDNA was produced from mycelial samples of the two isolates.
- RNA was extracted from lOOmg of ground mycelium using the RNeasy kit (Qiagen) according to the manufacturer's recommendation.
- First strand cDNA synthesis was prepared from l ⁇ g of total RNA using RT PCR with the Advantage RT-PCR Clontech kit (according to the manufacturer's recommendation). 5 ⁇ l of the resulting cDNA was then used in PCRs. The PCR components and conditions were as described previously.
- a ⁇ 800bp PCR product was amplified for both isolates (delineating the sequence encoding amino acid region 48 to 310 of fungal cytochrome b according to the S. cerevisiae numbering system).
- teres primers were designed around the G i 3 A point mutation location: a forward ARMS primer based on the wild type sequence: G-sp-4: CCCTACGGGC AAATG AGCCTTTGAAG (SEQ ID NO 142) a forward ARMS primer based on the potential G ⁇ 4 A mutation: C-sp-5: CCCTACGGGCAAATGAGCCTTTGATC (SEQ ID NO 143) and a control primer designed upstream from the point mutation: STAND4: ACCCTACGGGC AAATG AGCCTTTG (SEQ ID NO 144) the reverse primer used was:
- the -1 base corresponds to the second nucleotide of the G ⁇ 3 /A l4 codon.
- Bases in the primers which differ from the wild type cytochrome b P. teres sequence are in bold.
- the -2 position was changed from a G to an A or T base. This was done to destabilise the primer.
- All primers were synthesised by Oswel DNA Service. Before use, the primers were diluted to 5 ⁇ M in a total volume of 500 ⁇ l ddH 2 O each. The primers were then further diluted to a final concentration of 500nM in the PCRs. In this case, an intercalating dye was used for detection of the PCR product.
- the dye used was YO-PRO-1 dye (Molecular Probes, Seattle Washington, USA) which binds to double stranded DNA and emits fluorescence which is detectable by the ABI Prism 7700 instrument.
- Primers were first validated by using plasmid DNA as template at various concentrations. This was done to check the specificity and sensitivity of the primer designs. Partial wild type P. teres cytochrome b gene sequence and a corresponding sequence containing the G
- the plasmid DNA stocks were calculated to be approx. 2xl ⁇ " molecules per ⁇ l.
- the two plasmids were diluted to 2xl0 7 , 10 s , 10 and 10 1 molecules/ ⁇ l and 5 ⁇ l were used of each dilution resulting in ⁇ lxlO 8 , 10 6 , 10 4 and 10 2 molecules of plasmid in the respective PCRs (see Example 1 for PCR conditions).
- the only difference was that YO- PRO-1 dye was added to the reaction mix.
- the generation of primer dimer product interfered with the signal past cycle 35. This method of detection is less sensitive than the Sco ⁇ ion detection system because it is more affected by background noise (e.g. fluorescence emission from primer dimer formation). Nevertheless, it was concluded that valuable information could be drawn from using this method but increased caution had to be taken in inte ⁇ reting results.
- a diagnostic GHSA Scorpion assay was also designed based on the genomic organisation that was determined for the P. teres cytochrome b gene encoding the amino acid region of interest.
- the intron/exon organisation around the base of interest was elucidated by carrying out PCR amplifications on genomic DNA preparations with a series of primers designed to the known coding sequence and to subsequently identified intron sequences.
- Taq ExtenderTM PCR Additive and Perfect Match® PCR Enhancer (both from Strategene catalogue No. 600148 and 600129 respectively) were used as per manufacturer's instructions in the amplification of large PCR fragments using a variety of different primer combinations. After an initial 94°C incubation for 3 minutes, 30 cycles of 94°C for 45 sec, 52°C for 45 sec and 72°C for 3 minutes were carried out on a Hybaid Omn-E PCR instrument. A final 72°C incubation for 10 minutes was also included.
- PT-G-1 and PT-C-5 provided the widest window of specificity. They were therefore chosen as the preferred primer pair for this assay.
- Primer PT-C-5 has a Ct value of 16 on the correct template
- PT-G-1 also has a Ct value of 16 on the correct template.
- the PT-C-5 primer misprimes on the wrong template at cycle 34 giving a window of specificity of 18 cycles and the PT-G-1 primer misprimes at cycle 32 giving a window of specificity of 16 cycles equating to approximately 10 fold difference in the sensitivity of the two primers.
- Table 12 ARMS primer validation The PT-G-1 and PT-C-5 ARMS primers were tested in a plasmid spiking experiment where the mutant plasmid was 'spiked' in a background of wild type plasmid at frequencies of 1:1, 1:10, 1:100, 1:1,000, 1:10,000 and 1:100,000, all in lmg/ml BSA. In all cases the total plasmid concentration of each frequency in the PCR assay was lxlO 7 molecules/reaction. Real time PCR conditions and components were as described previously. The resulting data is summarised in the table below:
- the fluorescence detection is delayed. With each 10 fold dilution of the C plasmid, there is a delay of 4 cycles in the detection of fluorescence.
- the PT-C-5 cycle threshold value on one mutant molecule in a background of 10,000 wild type molecules could be clearly seen but the 1 : 100,000 was not distinguishable as the PT-C-5 primer misprimes from the 100% wild type (G) cassette thus masking the lower C:G frequency. This indicates that the ARMS switch in this case will allow a frequency of ⁇ 1 : 10,000 to be detected with confidence.
- the mycelia were then pelleted by centrifugation at 13,000 ⁇ m for 5 minutes. The supernatant was removed using a pipette and one of the mycelial pellets was used in the DNA extraction, the other was kept at -80°C until needed.
- DNA extraction was carried out using the Qiagen DNeasy Plant Mini Kit protocol for isolation of DNA from plant tissue, as described in the manufacturer's protocol. The DNA was diluted 10-fold and 100- fold for use in the assay and 5 ⁇ l aliquots of DNA were used in each PCR assay. All isolates were tested with each primer pair (PT-C-5, PT-G-1 and the control primer; each with the common reverse primer containing the Sco ⁇ ion detection system) in triplicate and in two dilutions.
- Example 5 we report the characterisation of partial cytochrome b Uncinula necator gene sequence.
- U. necator is the causal agent of vine powdery mildew. Infected vine leaves and fruit were collected from trial sites and commercial vineyards in France and Italy during 1999 and sent to Jealott's Hill Research Station (Zeneca Agrochemicals). Following arrival in the laboratory, mycelium and spores were transferred using a small paintbrush to fresh surface-sterilised leaves detached from 6-7 leaf seedlings (var. Ohanez). U. necator from each collection site was treated as a separate population. On receipt in the laboratory the inoculated leaves were placed in a constant temperature room at 21°C and incubated for 2-3 weeks.
- First strand cDNA synthesis was from l ⁇ g of total RNA using RT PCR with the Advantage RT-PCR Clontech kit (according to the manufacturer's recommendation). 5 ⁇ l of cDNA was used as template for PCR amplification using ERY 1 IF (5'ATGAACAATTGGTACAGTAAT 3') (SEQ ID NO 163) and ERY 4R (5' AAATCTGTTAAAGGCATAGCC 3') (SEQ ID NO 164) which delineate amino acids 1 14 to 309 of fungal cytochrome b based on the S. cerevisiae numbering system.
- ERY 1 IF 5'ATGAACAATTGGTACAGTAAT 3'
- ERY 4R 5' AAATCTGTTAAAGGCATAGCC 3'
- a DNA fragment of the expected size ( ⁇ 500bp) was amplified and the PCR product was cloned in the pCR2.1 TA vector (Invitrogen) according to manufacturer's recommendations. Wizard minipreps were carried out to identify clones with suitable inserts and 5 clones were submitted for sequencing using the M13 forward and reverse primers.
- a novel cytochrome b gene sequence had been identified which was closely related to other ascomycete cytochrome b sequences.
- Primer combinations 2F (5' GTT TTA CCC TAC GGG CAG ATG3') (SEQ ID NO 165) -5R( 5' AAA GAA TCT GTT TAA GGT TGC 3') (SEQ ID NO 166), 2F6R (5' AAA CCA CCT CAA AGA AAC TCC 3') (SEQ ID NO 167) and 4F (5' CAT GAA TAG GAC AAG ATA TCG 3') (SEQ ID NO 168) -6R successfully amplified PCR products ranging from 1.6kb to 3kb in length. These PCR products were cloned in the TA pCR2.1 vector (Invitrogen) and subsequent clones were used for sequencing as described previously.
- a primer walking strategy was followed for one clone corresponding to each of the different PCR products and the sequence analysis of these three clones showed the presence of two introns (l. ⁇ kb and 1.1 kb in length) within the PCR fragments.
- the second base of the G) 4 codon is lObp upstream of an intron splicing site.
- a 41 nucleotide tract encoding 10 bases upstream and 30 bases downstream of the second base of the G ⁇ 43 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.
- EXAMPLE 6 In example 6 we report the characterisation of partial Sphaerotheca fuliginea cytochrome b gene sequence and a single nucleotide polymo ⁇ hism that gives rise to resistance to strobilurin analogues and compounds in the same cross resistance group. S. fuliginea is the causal agent for cucurbit powdery mildew.
- S. fuliginea infected cucumber and melon leaves were collected from the field and conidia were dry inoculated in the laboratory to fresh leaf material (cucumber and melon) using a small paintbrush.
- Monoconidial isolates were subcultured and tested in planta by 24 hour preventative discriminating dose assay (up to lOOppm doses, known to give a 100% control of wild type strains).
- Conidia from candidate resistant isolates were removed by aspiration by vacuum pump into a suitable container. Part of this sample was analysed using PCR analysis and the remainder was re-tested to confirm phenotypic resistance.
- RT-PCR strategy was followed (as described in Example 3) on a -lOOmg conidial strobilurin analogue sensitive sample.
- the resulting cDNA was used as template in a PCR amplification reaction using primers Ery2F (5' TCACCTAGAACATTAACATGA 169) 3'(SEQ ID NO) and 4R (5' AAATCTGTTAAAGGCATAGCC 3 '(SEQ ID NO 170)) which delineate amino acids 108 to 309 of fungal cytochrome b based on the S. cerevisiae numbering system.
- Other PCR components and conditions were as described previously.
- a PCR product of the expected size ( ⁇ 600bp) was found during gel electrophoresis analysis of the PCR products and this product was then cloned in the TA pCR2.1 vector (Invitrogen) and 5 clones with correct size inserts ( ⁇ 600bp) were sequenced using M13 forward and reverse primers as described previously.
- TA pCR2.1 vector Invitrogen
- 5 clones with correct size inserts ( ⁇ 600bp) were sequenced using M13 forward and reverse primers as described previously.
- Specific Sphaerotheca fuliginea PCR primers were then designed for the amplification of the G ⁇ 4 region from genomic DNA.
- Primer pairs SF1 (5' TTCCCTTCGGTCAAATGTCGC 3') (SEQ ID NO 171) - SF8 (5' AAACCCCCTCAGAGAAACTCC 3') (SEQ ID NO 172) and SF1 - SF10 (5' GACCCCGCGCTATCATGTAAG 3') (SEQ ID NO 173) were used in PCR amplifications using spore samples resuspended in ddH 0 as template.
- the PCR components and conditions were as described in previous examples.
- the PCR products were analysed by gel electrophoresis and a ⁇ 2kb product was found with the SF1/8 primer pair and a ⁇ 2.1kb band was found with the SF1/10 primer pair.
- Partial cytochrome b gene sequence was also amplified from conidial strobilurin analogue resistant samples. Conidial samples ( ⁇ 50mg) were resuspended in 200 ⁇ l ddH 0 and diluted 1 :10, 1: 100 in ddH 2 0. lO ⁇ l of each dilution was used as template for PCR amplification using the SF1/SF8 specific S. fuliginea primers. Taq ExtenderTM PCR Additive and Perfect Match® PCR Enhancer (both from Strategene) were used (as per manufacturer's instructions) in the amplification of this large PCR fragment.
- M. fijiensis is the causal agent of black sigatoka disease on banana.
- Infected banana leaves were collected from the field and ascospores inoculated from leaves directly onto artificial media in a petri dish. Monoascosporic isolates were maintained on artificial media and prepared for PCR analysis by shake flask culture in a broth medium. Mycelia were collected through Micracloth and ground to a fine powder using an acid washed and autoclaved sterile pestle and mortar. lOOmg of ground mycelia were used in a genomic DNA extraction and in a first strand cDNA synthesis (as described in previous examples). The genomic DNA was diluted 1 : 10, 1 : 100 and 1 : 1000 in ddH O prior to use as PCR template.
- M. graminicola is the causal agent of leaf blotch on wheat.
- Infected wheat leaves were collected from the field and incubated in a humid environment to promote spore production. Cirri were removed from leaves and spread onto Czapek Dox V8 agar plates (see Table 9) and incubated in a controlled environment at 19°C for 6 days. Single colony isolates were further subcultured and bulked up by shake flask culture in a suitable medium. Fungal material was removed and maintained at -80°C until needed.
- a genomic DNA preparation was carried out as described in Example 1 on 200mg of ground mycelia. The genomic DNA yield and quality was checked by gel electrophoresis and diluted 1: 10 and 1 : 100 in ddH 2 0.
- a 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the G) 43 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.
- EXAMPLE 10 In example 10 we report the characterisation of partial Colletotrichum graminicola cytochrome b gene sequence. C. graminicola is the causal agent of cereal and grass anthracnose.
- Infected leaf material (turf or moss) was collected from the field and the fungal material removed and subcultured on artificial media. Fungal material was bulked up by shake flask culture, harvested and kept at -80°C until needed.
- a genomic DNA preparation was carried out as described in Example 1 on 200mg of ground mycelia. The genomic DNA yield and quality was assessed by gel electrophoresis and dilutions of 1 : 10 and 1 : 100 in ddH 2 0 were prepared. lO ⁇ l of each dilution was used as template for PCR amplification using primers deg4F and deg3R (details in Example 3). PCR components and conditions were are described in Example 3.
- example 1 1 we report the characterisation of partial Colletotrichum gloeosporioides cytochrome b gene sequence.
- C. gloeosporioides is the causal agent of fruit anthracnose (e.g. pepper, avocado and mango).
- Infected plant material (mango or chilli) was collected from the field and fungal material was removed and subcultured on artificial media.
- the mycelia were ground using an acid washed sterile pestle and mortar and lOOmg was used in a genomic DNA preparation and a first strand cDNA synthesis (procedures as described in previous examples).
- lO ⁇ l of each genomic dilutions and 5 ⁇ l neat cDNA was used as template for PCR amplification using primers deg4F and deg3R (primer details in Example 3). PCR components and conditions were as described in previous Examples.
- the PCR products were analysed by gel electrophoresis and bands of the expected size were found ( ⁇ 500bp).
- the PCR product was the same size when using genomic DNA or cDNA as template which indicates the lack of introns in the DNA region amplified.
- the PCR products were cloned in TA pCR2.1 vector and 5 clones containing correct size inserts for each cloning event were sequenced as described in previous Examples.
- the sequencing data was analysed using the relevant bioinformatics software, the PCR products were found to be identical in all cases and to encode a novel cytochrome b gene sequence with close homology to other ascomycete sequences.
- a 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the G ⁇ 4 codon can be found in Table 3.
- EXAMPLE 12 A 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the G ⁇ 4 codon (according to the S. cere
- O. lycopersicwn is a causal agent for tomato powdery mildew.
- Diseased tomato leaves were collected from the field and conidia subcultured to fresh leaf material by dry inoculation in a settling tower. Conidia growing from the resulting infection were removed by aspiration by vacuum pump into a sterile Eppendorf tube and kept in at -80°C until needed.
- a first strand cDNA synthesis was carried out on RNA isolated from lOOmg of spores as described previously and 5 ⁇ l of this cDNA was used for PCR amplification using primers Ery2-4 (details in example 6).
- PCR components and conditions were as described previously.
- a PCR product was found at the expected size ( ⁇ 500bp).
- This PCR product was cloned and 5 clones containing the correct size insert ( ⁇ 500bp) were sequenced as described previously.
- the PCR fragment encodes a novel cytochrome b gene sequence which was closely related to other ascomycete cytochrome b sequences.
- a 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the G ⁇ 4 codon can be found in Table 3.
- EXAMPLE 13 In example 13 we report the characterisation of partial Leveillula taurica cytochrome b gene sequence. L. taurica is a causal agent for tomato powdery mildew.
- a first strand cDNA synthesis was carried out on RNA isolated from lOOmg of spores or diseased plant material as described previously. When diseased plant material was used as starting material, fungal lesions were enriched by removing non-diseased plant tissue from the preparation. 5 ⁇ l cDNA aliquots were used for PCR amplification using primers Eryl 1-12 (details in example 2). PCR components and conditions were as described previously. When the PCR products were analysed by gel electrophoresis, a PCR product was found at the expected size ( ⁇ 500bp). This PCR product was cloned and 5 clones containing the correct size insert ( ⁇ 500bp) were sequenced as described previously.
- A. solani is the causal agent for early blight in tomato and potato.
- Infected leaf material tomato or potato
- Fungal samples were bulked up in shake flask culture.
- Culture collection isolates had been stored in liquid nitrogen and periodically subcultured on artificial media or subcultured through live host material before re-storing at - 80°C.
- Mycelia grown in a shake flask were ground using an acid washed sterile pestle and mortar and lOOmg was used in a genomic DNA preparation and a first strand cDNA synthesis (procedures as described in previous examples).
- lO ⁇ l of each genomic dilutions and 5 ⁇ l neat cDNA was used as template for PCR amplification using primers deg4F and deg3R (details in Example 3).
- PCR components and conditions were as described in Example 3.
- the PCR products were analysed by gel electrophoresis and bands of the expected size were found ( ⁇ 500bp).
- the PCR product was the same size when using genomic DNA or cDNA as template which indicates the lack of introns in the DNA region amplified.
- the PCR products were cloned in TA pCR2.1 vector and 5 clones containing correct size inserts for each cloning event were sequenced as described before.
- Infected leaf material (peanut) was collected from the field and the fungal material removed and subcultured on artificial media. Cultures were stored in liquid nitrogen until required. Material was removed from storage onto agar and resulting colonies bulked up in shake flask culture and kept at -80°C until needed. Mycelia were ground using an acid washed sterile pestle and mortar and lOOmg was used in a genomic DNA preparation and a first strand cDNA synthesis (procedures as described in previous examples). lO ⁇ l of each genomic dilutions and 5 ⁇ l neat cDNA were used as template for PCR amplification using primers deg4F and deg3R (details in Example 3). PCR components and conditions were are described in Example 3.
- PCR products were analysed by gel electrophoresis and bands of the expected size were found ( ⁇ 500bp). Again the PCR product was the same size when using genomic DNA or cDNA as template which indicates the lack of introns in the DNA region amplified.
- the PCR products were cloned in TA pCR2.1 vector and 5 clones containing correct size inserts for each cloning event were sequenced as described before. When the sequencing data was analysed using the relevant bioinformatics software, the PCR products were was found to be identical in all cases and to encode a novel cytochrome b gene sequence which showed close homology to other cytochrome b gene sequences.
- a 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the G ⁇ 4 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.
- EXAMPLE 16 In example 16 we report the characterisation of partial Rhizoctonia solani cytochrome b gene sequence. R. solani is the causal agent of root stem rot or damping off.
- Infected leaf material (rice) was collected from the field and the fungal material removed and subcultured on artificial media. Cultures were stored in liquid nitrogen until required. Material was removed from storage onto agar and resulting colonies bulked up in shake flask culture and kept at -80°C until needed.
- a first strand cDNA synthesis was carried out on RNA isolated from lOOmg of ground mycelia as described previously and 5 ⁇ l was used for PCR amplification using basidiomycete degenerate primers IF (5' WYTRGTAYTAATGATGGCTATHGG 3') (SEQ ID NO 174) and IR (5' TCTTARWATWGCATAGAAWGG) 3' (SEQ ID NO 175) which delineate amino acids 121 to 283 of fungal cytochrome b according to the S. cerevisae numbering system.
- basidiomycete degenerate primers IF
- IR 5' TCTTARWATWGCATAGAAWGG
- PCR components and conditions were as described previously. When the PCR products were analysed by gel electrophoresis, a PCR product was found at the expected size ( ⁇ 500bp).
- This PCR product was cloned and 5 clones containing the correct size insert ( ⁇ 500bp) were sequenced as described previously.
- the sequencing data was analysed using the relevant bioinformatics software, the PCR product was found to encode a novel cytochrome b gene sequence which showed close homology to other basidiomycete sequences.
- a 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the G ⁇ 43 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.
- EXAMPLE 17 In example 17 we report the characterisation of partial Pythium aphanidermatum cytochrome b gene sequence. P. aphanidermatum is the causal agent of damping off.
- Infected leaf material (turf) was collected from the field and the fungal material removed and subcultured on artificial media. Cultures were stored in liquid nitrogen until required. Material was removed from storage onto agar and resulting colonies bulked up in shake flask culture and kept at -80°C until needed.
- a genomic DNA preparation was carried out as described in Example 1 on 200mg of ground mycelia. The genomic DNA yield was analysed by gel electrophoresis and stocks were diluted 1:10 and 1 : 100 in ddH 2 0. lO ⁇ l of each dilution was used as template for PCR amplification using primers PLAS17F and PLAS 15R (details in Example 1). PCR components and conditions were are described in
- Example 1 The PCR products were analysed by gel electrophoresis and a band of the correct size was found ( ⁇ 500bp). This PCR product was cloned in TA Invitrogen pCR2.1 vector and 5 clones containing correct size inserts were sequenced as described before. When the sequencing data was analysed using the relevant bioinformatics software, the PCR fragment was found to encode a novel cytochrome b gene sequence which showed close homology to other oomycete sequences. A 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the G
- Infected banana leaves were collected from the field and ascospores inoculated from leaves directly onto artificial media in a petri dish. Monoascosporic isolates were maintained on artificial media and prepared for PCR analysis by shake flask culture in a broth medium. Mycelia were collected through Miracloth and ground to a fine powder using an acid washed sterile pestle and mortar. lOOmg of ground mycelia were used in a genomic DNA extraction and in a first strand cDNA synthesis (as described in Example 7). The genomic DNA was diluted 1:10, 1:100 and 1:1000 in ddH 2 O prior to use as PCR template.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Biomedical Technology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
Claims
Applications Claiming Priority (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GBGB9910100.8A GB9910100D0 (en) | 1999-04-30 | 1999-04-30 | Assay |
| GB9910100 | 1999-04-30 | ||
| GB0006004A GB0006004D0 (en) | 2000-03-13 | 2000-03-13 | Assay |
| GB0006004 | 2000-03-13 | ||
| GB0007901 | 2000-03-31 | ||
| GB0007901A GB0007901D0 (en) | 2000-03-31 | 2000-03-31 | Methods |
| PCT/GB2000/001620 WO2000066773A2 (en) | 1999-04-30 | 2000-04-26 | Method of detection of cytochrome b mutations in funghi leading to resistance against anti-fungal agents |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP1181391A2 true EP1181391A2 (en) | 2002-02-27 |
Family
ID=27255594
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP00925493A Withdrawn EP1181391A2 (en) | 1999-04-30 | 2000-04-26 | Method of detection of cytochrome b mutations in funghi leading to resistance against anti-fungal agents |
Country Status (8)
| Country | Link |
|---|---|
| EP (1) | EP1181391A2 (en) |
| JP (1) | JP2002542803A (en) |
| KR (1) | KR20020008163A (en) |
| CN (1) | CN1359425A (en) |
| AU (1) | AU781410C (en) |
| BR (1) | BR0010163A (en) |
| CA (1) | CA2370117A1 (en) |
| WO (1) | WO2000066773A2 (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1118677A1 (en) * | 2000-01-17 | 2001-07-25 | Novartis AG | Oligonucleotides useful in identifying fungicide resistant plant pathogenic fungi |
| JP2002142774A (en) * | 2000-11-14 | 2002-05-21 | Ss Pharmaceut Co Ltd | Nucleic acid for detecting fungi and method for detecting fungi using the same |
| EP3429357B1 (en) * | 2016-03-16 | 2025-09-17 | Basf Se | Use of a specific tetrazolinone for combating resistant phytopathogenic fungi on cereals |
| CZ309242B6 (en) * | 2017-10-31 | 2022-06-15 | VÝZKUMNÝ A ŠLECHTITELSKÝ ÚSTAV OVOCNÁŘSKÝ HOLOVOUSY s.r.o | Kit for detecting G143A mutation causing resistance to QoI fungicides |
| CN112322709B (en) * | 2020-11-23 | 2022-07-05 | 河北省农林科学院植物保护研究所 | Method for rapidly identifying nucleotide point mutation of Cytb gene of potato late blight bacterium and resistance of Cytb gene to pyraclostrobin |
| CN118460782A (en) * | 2024-07-09 | 2024-08-09 | 中国农业科学院植物保护研究所 | RPA primers and probes, kits and methods for detecting wheat powdery mildew resistant to QoIs fungicides |
-
2000
- 2000-04-26 KR KR1020017013641A patent/KR20020008163A/en not_active Abandoned
- 2000-04-26 CA CA002370117A patent/CA2370117A1/en not_active Abandoned
- 2000-04-26 CN CN00809815A patent/CN1359425A/en active Pending
- 2000-04-26 EP EP00925493A patent/EP1181391A2/en not_active Withdrawn
- 2000-04-26 AU AU44214/00A patent/AU781410C/en not_active Ceased
- 2000-04-26 JP JP2000615395A patent/JP2002542803A/en active Pending
- 2000-04-26 BR BR0010163-0A patent/BR0010163A/en not_active IP Right Cessation
- 2000-04-26 WO PCT/GB2000/001620 patent/WO2000066773A2/en not_active Ceased
Non-Patent Citations (1)
| Title |
|---|
| See references of WO0066773A2 * |
Also Published As
| Publication number | Publication date |
|---|---|
| AU781410B2 (en) | 2005-05-19 |
| KR20020008163A (en) | 2002-01-29 |
| AU4421400A (en) | 2000-11-17 |
| BR0010163A (en) | 2002-01-15 |
| AU781410C (en) | 2007-01-25 |
| CN1359425A (en) | 2002-07-17 |
| JP2002542803A (en) | 2002-12-17 |
| WO2000066773A2 (en) | 2000-11-09 |
| CA2370117A1 (en) | 2000-11-09 |
| WO2000066773A3 (en) | 2001-10-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Simko et al. | Linkage disequilibrium mapping of a Verticillium dahliae resistance quantitative trait locus in tetraploid potato (Solanum tuberosum) through a candidate gene approach | |
| Avenot et al. | Molecular characterization of boscalid‐and penthiopyrad‐resistant isolates of Didymella bryoniae and assessment of their sensitivity to fluopyram | |
| Mercado-Blanco et al. | Detection of the defoliating pathotype of Verticillium dahliae in infected olive plants by nested PCR | |
| Albertini et al. | Eburicol 14α-demethylase gene (CYP51) polymorphism and speciation in Botrytis cinerea | |
| RU2296162C2 (en) | Method of determining stability of fungal phytopathogen, allele-specific primer, and collection | |
| US20030049612A1 (en) | Microsatelite dna markers and uses thereof | |
| Lesemann et al. | Mitochondrial heteroplasmy for the cytochrome b gene controls the level of strobilurin resistance in the apple powdery mildew fungus Podosphaera leucotricha (Ell. & Ev.) ES Salmon | |
| Malandrakis et al. | Biological and molecular characterization of laboratory mutants of Cercospora beticola resistant to Qo inhibitors | |
| Allioui et al. | Identification of Qol fungicide-resistant genotypes of the wheat pathogen Zymoseptoria tritici in Algeria | |
| Siah et al. | QoI resistance and mitochondrial genetic structure of Zymoseptoria tritici in Morocco | |
| Imam et al. | Molecular identification and virulence analysis of AVR genes in rice blast pathogen, Magnaporthe oryzae from Eastern India | |
| Forcelini et al. | Development of high-throughput SNP genotyping assays for rapid detection of strawberry Colletotrichum species and the G143A mutation | |
| Stack et al. | Genetic mapping, identification, and characterization of a candidate susceptibility gene for powdery mildew in Cannabis sativa | |
| Habib et al. | Resistance profiles of Botrytis cinerea populations to several fungicide classes on greenhouse tomato and strawberry in Lebanon | |
| GrÜNig et al. | Development of single-copy RFLP markers for population genetic studies of Phialocephala fortinii and closely related taxa | |
| Huang et al. | Detection and characterization of carboxylic acid amide-resistant Plasmopara viticola in China using a TaqMan-MGB real-time PCR | |
| AU781410C (en) | Methods | |
| Bowen et al. | Differentiation of a specific Trichoderma biological control agent by restriction fragment length polymorphism (RFLP) analysis | |
| Koopman et al. | Pathogenicity and virulence of south African isolates of Venturia inaequalis | |
| Wang | Genetic variability in the canker pathogen fungus, Gremmeniella abietina. Contribution of sexual compared with asexual reproduction | |
| Zhang et al. | PIRA-PCR for detection of Fusarium fujikuroi genotypes with carbendazim-resistance alleles | |
| RU2244750C2 (en) | Diagnostic basis for detection of mutation of fungal cytochrome b | |
| Martin et al. | Advances in understanding the epidemiology, molecular biology and control of net blotch and the net blotch barley interaction | |
| US20260043091A1 (en) | Methods and compositions for detecting the fungal pathogen ceratocystis fimbriata | |
| KR100973181B1 (en) | Genetically modified watermelon qualitative analysis method with DIP-1 as endogenous positive control gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE |
|
| AX | Request for extension of the european patent |
Free format text: AL;LT;LV;MK;RO;SI |
|
| 17P | Request for examination filed |
Effective date: 20020411 |
|
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: SYNGENTA LIMITED |
|
| 17Q | First examination report despatched |
Effective date: 20021119 |
|
| GRAP | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOSNIGR1 |
|
| GRAS | Grant fee paid |
Free format text: ORIGINAL CODE: EPIDOSNIGR3 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20070320 |