EP1181391A2 - Method of detection of cytochrome b mutations in funghi leading to resistance against anti-fungal agents - Google Patents

Method of detection of cytochrome b mutations in funghi leading to resistance against anti-fungal agents

Info

Publication number
EP1181391A2
EP1181391A2 EP00925493A EP00925493A EP1181391A2 EP 1181391 A2 EP1181391 A2 EP 1181391A2 EP 00925493 A EP00925493 A EP 00925493A EP 00925493 A EP00925493 A EP 00925493A EP 1181391 A2 EP1181391 A2 EP 1181391A2
Authority
EP
European Patent Office
Prior art keywords
mutation
seq
cytochrome
fungal
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00925493A
Other languages
German (de)
French (fr)
Inventor
John David Windass
Stephen Paul Heaney
Annabel Renwick
David Mark Whitcombe
Stephen Little
Neil James Gibson
Jane Theaker
Carole Patricia Stanger
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Syngenta Ltd
Original Assignee
Syngenta Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB9910100.8A external-priority patent/GB9910100D0/en
Priority claimed from GB0006004A external-priority patent/GB0006004D0/en
Priority claimed from GB0007901A external-priority patent/GB0007901D0/en
Application filed by Syngenta Ltd filed Critical Syngenta Ltd
Publication of EP1181391A2 publication Critical patent/EP1181391A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0055Oxidoreductases (1.) acting on diphenols and related substances as donors (1.10)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/795Porphyrin- or corrin-ring-containing peptides
    • C07K14/80Cytochromes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays

Definitions

  • This invention relates to a diagnostic method for the detection of a cytochrome b mutation in fungi that leads to resistance to strobilurin analogues or compounds in the same cross resistance group using any (or a) single nucleotide polymorphism detection technique, preferably using the amplification refractory mutation system (ARMS).
  • the invention also relates to mutation specific primers for use in the method and to diagnostic kits containing these primers.
  • the invention further relates to the identification of a specific mutation in the fungal cytochrome b gene which results in the resistance of fungi containing the said mutation to strobilurin analogues or compounds in the same cross resistance group.
  • the fungicidal activity of the strobilurin analogues is a result of their ability to inhibit mitochondrial respiration in fungi. More specifically, it has been established that these compounds have a novel single site mode of action, exerting their effect on fungi by blocking the ubiquinokcytochrome c oxidoreductase complex (cytochrome bcl) thus reducing the generation of energy rich ATP in the fungal cell (Becker et al FEBS Letts. 132 329-33). This family of inhibitors prevents electron transfer at the ubiquinone redox site Q 0 on the multimeric cytochrome b protein (Esposti et al 1993 Biochim. et Biophys Acta 243-271 ).
  • the cytochrome b protein is mitochondrially encoded. Reports in the literature show that specific amino acid changes at the cytochrome b target site can affect the activity of strobilurin analogues.
  • S. cerevisiae Saccharomyces cerevisiae
  • mouse Howell et al 1988 J. Mol. Biol. 203, 607-618
  • Chlamydomonas reinhardtii (Bennoun et al 1991 Genetics 127, 335-343) and Rhodobacter spp (Daldal et al 1989 EMBO J. 3951-3961 ) have been carried out. Relevant information was also gathered from studying the natural basis for resistance to strobilurin analogues in the sea urchin Paracentrotus lividus (Esposti et al 1990 FEBS 263, 245-247) and the Basidiomycete fungi Mycena galopoda and Strobilurus tenaceUus (Kraiczy et al 1996 Eur. J. Biochem.
  • the present invention identifies for the first time the key importance of one of these mutations in cytochrome b gene of field isolates of important plant pathogenic fungi showing resistance to a strobilurin analogue or a compound in the same cross resistance group.
  • Summary of the Invention According to a first aspect of the invention we provide a method foi detecting a mutation in fungal nucleic acid wheiein the screeningnce of said mutation gives rise to fungal lesistance to a stiobilu ⁇ n analogue 01 any othei compound in the same cross resistance group said method comprising identifying the gutternce or absence of said mutation in fungal nucleic acid using any (or a) single nucleotide polymo ⁇ hism detection technique
  • single polymorphism detection techniques which may be used to detect mutations include, for example, lest ⁇ ction fragment length polymo ⁇ hism (RFLP), single strand conformation polymorphism, multiple clonal analysis, allele-specific oligonucleotide hybridisation, single nucleotide primer extension (Juvonen et al, (1994) Hum Genet 93 16- 20; Huoponen et al, (1994) Hum Mutat 3 29-36; Mashima et al (1995), Invest Opthelmol. Vision. Sci 36,1714-20; Howell et al (1994) Am J Hum Genet. 55 203-206; Koyabashi et al; (1994) Am. J. Hum. Genet.
  • RFLP lest ⁇ ction fragment length polymo ⁇ hism
  • PCR based detection systems are preferred.
  • a method for detecting a mutation in fungal nucleic acid wherein the presence of said mutation gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group comprising detecting the presence of an amplicon generated during a PCR reaction wherein said PCR reaction comprises contacting a test sample comprising fungal nucleic acid with a primer in the presence of appropriate nucleotide triphosphates and an agent for polymerisation wherein the detection of said amplicon is directly related to presence or absence of said mutation in said nucleic acid.
  • the detection of the amplicon generated during the PCR reaction may be directly dependent on the extension of a primer specific for the presence of the mutation i.e. where primer extension is dependent on the presence of the mutation and hence an amplicon is generated only when the primer binds and/or is extended when the mutation is present (as is the case with ARMS technology), similarly it may be directly dependent on the extension of a primer specific for the absence of the mutation e.g. wild type sequence or may be directly linked to the PCR extension product containing the mutant DNA sequence i.e. where the detection is of an amplicon comprising the mutant DNA sequence.
  • the first alternative is particularly preferred.
  • the amplicon can be from any PCR cycle and this includes a first allele specific primer extension product.
  • the invention provides a method for detecting a mutation in fungal nucleic acid wherein the presence of said mutation gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group which method comprises contacting a test sample comprising fungal nucleic acid with an appropriate diagnostic primer in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended either when the said mutation is present in the sample or when wild type sequence is present; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product.
  • the invention provides a method for detecting a mutation in fungal nucleic acid wherein the presence of said mutation gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group which method comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the specific mutation in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product.
  • the first aspect of the invention we provide a method for detecting a mutation in fungal nucleic acid wherein the presence of said mutation gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group which method comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the specific mutation in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended only when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product.
  • diagnostic primer is used to indicate the primer which is used specifically to identify the presence or absence of a mutation or wild type sequence and the term common primer is used to denote a primer binding to the opposite strand of DNA to the diagnostic primer and 3' to the region recognised by that diagnostic primer and which, by acting with said diagnostic primer allows amplification of the intervening tract of DNA during the PCR.
  • diagnostic primer is an ARMS primer it can have a 3' mismatch when compared to the mutant or wild type sequence.
  • the extension of the primer extension product is detected using a detection system which is an integral part of either the diagnostic primer or the common primer on the opposite strand. This is described more fully herein.
  • the methods of the invention are particularly suitable for the detection of mutations in a mitochondrial gene which encodes a protein which is a target for a fungicide, more especially for the detection of mutations in a fungal cytochrome b gene where said mutations result in the inhibition of fungicide activity to the cytochrome b protein but still allow ATP generation to occur and most preferably wherein said mutation in the fungal cytochrome b gene results in one of the following amino acid substitutions: A ⁇ 26 T, F 129 L, Y ⁇ C, C i 33 Y, G n7 R/S/E/V, W, 42 T/K, G, 43 A, I 147 F, T, 48 M, N 2 , 6 Y/K/I, L 27 ,F/S/T or L 29 sF where the first amino acid is substituted by the second one at the position in the sequence denoted by the number, the presence of which give rise to fungal resistance 10 strobilurin analogues or any other compound in the same cross
  • the strobilurin analogues and compounds in the same cross resistance group include for example, azoxystrobin, picoxystrobin, kresoxim-methyl, trifloxystrobin, famoxadone and fenamidone.
  • cerevisiae sequence is a key determinant of fungal resistance to strobilurin analogues or any other compound in the same cross resistance group in field isolates of strobilurin analogue resistant plant pathogenic fungi.
  • the methods of the invention described herein are particularly suitable for the detection of a mutation at the position corresponding to Saccharomyces cerevisiae cytochrome b residue 143 where the glycine residue is replaced by another amino acid which inhibits the activity of strobilurin analogues or any other compound in the same cross resistance group and results in a resistant phenotype in the fungi carrying the mutant cytochrome b gene thereby giving rise to fungal resistance to strobilurin analogues or any other compound in the same cross resistance group.
  • the method is preferably used for the detection of a mutation resulting in the replacement of said glycine residue at the position corresponding to S. cerevisiae cytochrome b residue 143 with an amino acid selected from the group arginine, serine, cysteine, valine, aspartic acid, glutamic acid, tryptophan and most preferably alanine.
  • an amino acid selected from the group arginine, serine, cysteine, valine, aspartic acid, glutamic acid, tryptophan and most preferably alanine.
  • cerevisiae cytochrome b residue 143 in the encoded protein thereby giving rise to fungal resistance to strobilurin analogues or any other compound in the same cross resistance group said method comprising identifying the presence or absence of said mutation in fungal nucleic acid using any (or a) single nucleotide polymo ⁇ hism detection technique.
  • 4 A replacement in the encoded protein is usually a guanine to cytosine base change at the second position (base) of the codon and the detection of this single nucleotide polymorphism is preferred for all aspects and embodiments of the invention described herein.
  • a diagnostic method for the detection of a mutation in a fungal cytochrome b gene resulting in a G ⁇ A replacement in the encoded protein comprising detecting the presence of an amplicon generated during a PCR reaction wherein said PCR reaction comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer in the presence of appropriate nucleotide triphosphates and an agent for polymerisation wherein the detection of said amplicon is directly related to presence or absence of said mutation in said nucleic acid.
  • a diagnostic method for the detection of a mutation in a fungal cytochrome b gene resulting in a G ⁇ A replacement in the encoded protein comprising contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the mutation resulting in a G ⁇ 4 A replacement in the encoded protein in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended when a mutation is present in the sample resulting in a G ] 3 A replacement in the encoded protein; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product.
  • a diagnostic method for the detection of a mutation in a fungal cytochrome b gene resulting in a G) 3 A replacement in the encoded protein comprising contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the mutation resulting in a G
  • 43 A is used to denote the substitution of a glycine lesidue by an alanine lesidue in a fungal cytochiome b sequence at the equiv alent of the position of the 143" codon/amino acid of the 5 ce ⁇ e ⁇ isiae cytochiome b sequence
  • This nomenclature is used for all the other lesidue changes quoted heiein I e all positions aie quoted relative to the S c ei ex tsiae cytochrome b pi otein sequence
  • the 5 ce ⁇ ⁇ s ⁇ ae cytochiome b gene and piotein sequences are available on the EMBL and SWISSPROT databases (See EMBL ACCESSION NO X84042 and SWISSPROT ACCESSION NO P00163) The skilled man will appieciate that the piecise length and register of equivalent pioteins fio different species may
  • the positions in the cytochiome b sequence are prefeiably as defined relative to the S DCevtsiae cytochiome b consensus sequence as provided in SWISSPROT ACCESSION NO POO 163 Accoiding to one aspect of the invention theie is piovided a method foi the diagnosis of a single nucleotide polymorphism in a fungal cytochrome b gene which method comprises determining the sequence of fungal nucleic acid at a position corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S cet evisiae cytochiome b residue 143 in the cytochiome b piotein and determining the resistance status of the said fungi to a stiobilui in analogue oi a compound in the same cioss lesistance gioup by leference to a polymoiphism in the cytochiome b gene
  • theie is piovided a method loi the diagnosis of a single nucleotide polymoiphism in a fungal cytochiome b gene which method compnses determining the sequence of fungal nucleic acid at a position conesponding to the second base in the tnplet coding foi the amino acid at the position conesponding to S cet evisiae cytochiome b tesidue 143 in the cytochrome b piotein and determining the lesistance status of the said fungi to a stiobilui in analogue or a compound in the same cioss lesistance gioup by reference to a polymoiphism in the cytochrome b gene
  • the method foi diagnosis descnbed herein is one in which the single nucleotide polymoiphism at a position in the DNA conesponding to the second base in the tnplet coding foi the amino acid at the position conesponding to 5 cetevisiae cytochrome b lesidue 143 in the cytochiome b piotein is presence of G and/or C
  • a glycine to alanine point mutation demands a G to a C change at the second base of the codon Othei mutations may also arise at the 3 rd position in the codon due to degeneracy in genetic code for alanine and glycine (see Table 1) but this is leadily taken into consideration when designing the diagnostic primer.
  • the diagnostic primer is preferably an ARMS primer. (The concept of ARMS primers is described fully in Newton et al, Nucleic Acid Research 17 (7) 2503-2516 1989). As a result ARMS primers can be designed for the detection of the G
  • the methods of the invention descnbed heiein aie paiticulaily useful in connection with plant pathogenic lungi and especially with the following fungal species Plasmopai a ⁇ iticola, Ei ysiphe giammis f sp ti itici/hoi dei Rhyntho ⁇ onum secalis, Py i enophoi a teies My cosphaerella gi aminicola Venlin ia inaequali s, My cosphaei ell a f ⁇ ien sts vai d ⁇ for us Sphaei otheca fuliginea, Unc inula netatoi , Colletoti ichum gi amimcola, Py thium aphaiudeimatum, Colletoti ichum ( ⁇ loeospoi loidc s Oidium ly opei siciim Ma ⁇ uipoi
  • piovides a method foi detecting fungal lesistance to a stiobilurin analogue or any othei compound in the same cioss lesistance gioup said method comprising identifying thespectnce or absence of a mutation in fungal nucleic acid wherein thegronce of said mutation gives rise to lesistance to a stiobilurin analogue oi any othei compound in the same cioss lesistance group said method comprising identifying the presence oi absence of a single nucleotide polymo ⁇ hism occuriing at a position corresponding to the second base in the triplet coding for the amino acid at the position conesponding to S cerevisiae cytochiome b residue 143 in the cytochrome b pi otein
  • the presence or absence of a single nucleotide polymo ⁇ hism at a position corresponding to the second base in the triplet coding for the amino acid at the position conesponding to S cet evisiae cytochiome b iesidue 143 in the cytochrome b gene in fungal nucleic acid is identified using any (oi a) single nucleotide polymo ⁇ hism detection techniques
  • the invention furthei piovides a fungal DNA sequence encoding all oi part of a wild type cytochiome h piotein wheiein said DNA sequence encodes a glycine residue at the position conesponding to S DC ex isiae cytochrome b residue 143 in the wild type piotein wherein said sequence is obtainable oi obtained from a fungus selected fiom the group consisting of Plasmopaia viticola Ei y siphe grainims f sp tntic i/hoidei Rhynchospoi m secalis Py i enophoia lei es My c osphaerella gi amnnc ola My cosphaei ella j ⁇ iensis vai diffoi mis, Sphaei otheca fuliginea Uncinula necatoi Colletoti ichitin qi aminicola Py lhiuni ap
  • the fungal DNA sequences according to the above aspects of the invention prefeiably comprises aiound 30 nucleotides on eithei or both sides of the position in the DNA conesponding to one oi more of the bases in the tnplet, prefeiably conesponding to the second base in the triplet coding for the amino acid at the position conesponding to 5 c ei ex isiae cytochrome b lesidue 143 in the protein since this extent of nucleic acid provides the skilled man with all infoi mation necerney to design species and mutation specific leagents and/oi methods for use in all single nucleotide polymorphism detection techniques
  • the teim aiound 30 means that the sequence may compnse up to 30 nucleotides, foi example 5, up to 10, 15, 20, or 25 nucleotides or may comprise moie than 30 nucleotides
  • DNA sequence oi protein sequence oi a fiagment thereof A fiagment of DNA or protein may foi example be 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% of the length of the whole sequence
  • the invention also extends to a fungal DNA sequence showing homology or sequence identity to said DNA sequences in Table 3 and covers for example, variations in DNA sequences found in different samples or isolates of the same species. These variations may, for example, be due to the use of alternative codon usage, varying intron/exon mitochondrial organisation and amino acid replacement.
  • the invention provides a fungal DNA sequence encoding all or part of a cytochrome b protein which, when said sequence is lined up against the corresponding wild type DNA sequence encoding a cytochrome b protein, is seen to contain a single nucleotide polymorphism mutation at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein which results in the replacement of the normal glycine residue with an alternative amino acid with the proviso that said DNA sequence is not the Mycena galopoda sequence encoding cytochrome b.
  • the invention provides a fungal DNA sequence encoding all or part of a cytochrome b protein which, when said sequence is lined up against the corresponding wild type DNA sequence encoding a cytochrome b protein, is seen to contain a single nucleotide polymorphism mutation at a position in the DNA corresponding to the second base in the triplet coding for the amino acid at the position con-esponding to S. cerevisiae cytochrome b residue 143 in the protein which results in the replacement of the normal glycine residue with an alternative amino acid with the proviso that said DNA sequence is not the Mycena galopoda sequence encoding cytochrome b.
  • the fungal DNA sequence according to the above aspect of the invention preferably comprises around 30 nucleotides on either or both sides of the position in the DNA corresponding to one or more of the bases in the triplet, preferably corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein since this extent of nucleic acid provides the skilled man with all information necessary to design species and mutation specific reagents and/or methods for use in all single nucleotide polymorphism techniques.
  • the term around 30 means that the sequence may comprise up to 30 nucleotides, for example 5, up to 10, 15, 20, or 25 nucleotides or may comprise more than 30 nucleotides.
  • the invention further provides a fungal DNA sequence encoding all or part of a mutant cytochrome b protein wherein the presence of a mutation in said DNA confers resistance to a strobilurin analogue or a compound within the same cross resistance group, said mutation occurring at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to 5. cerevisiae cytochrome b residue 143 in the protein with the proviso that said DNA sequence is not the Mycena galopoda sequence encoding cytochrome b.
  • the invention further provides a fungal DNA sequence encoding all or part of a mutant cytochrome b protein wherein the presence of a mutation in said DNA confers resistance to a strobilurin analogue or a compound within the same cross resistance group, said mutation occurring at a position in the DNA corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein with the proviso that said DNA sequence is not the Mycena galopoda sequence encoding cytochrome b.
  • the mutation occurring at a position in the DNA corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein is preferably a guanine to cytosine base change.
  • the fungal DNA sequence encoding all or part of a mutant cytochrome b protein wherein the presence of a mutation in said DNA confers resistance to a strobilurin analogue or a compound within the same cross resistance group, according to the above aspects of the invention is preferably obtainable or obtained from a fungus selected from the group consisting of Plasmopara viticola, Eiysiphe graminis f.sp.
  • the invention extends also to DNA sequences comprising all or part of the sequences provided in Table 3 wherein the residue at a position in the DNA corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein is a cytosine residue (SEQ ID NOS 176 to 196).
  • SEQ ID NOS 176 to 196 cytosine residue
  • GAGTGC 3'- (SEQ ID NO 179) 5"TTTTACCCTACGGGCAAATGAGCCTTTGAGCTGAAATATTTGCCTCAAATGTATA
  • GAGCGC 3'- (SEQ ID NO 190) 5'TTTTACCATACGGACAAATGTCATTATGAGCTGCAACAGTTATTACTAACCTTAT
  • TTCTGC 3'- (SEQ ID NO 195) 5'TTTTACCTTATGGTCAAATGTCTTTATGAGCAGCTACAGTTATAACTAATTTAATGAGTG
  • the invention also extends to a fungal DNA sequence showing homology or sequence identity to said DNA sequence containing said polymorphism and covers for example, variations in DNA sequences found in different samples of the same species. These variations may, for example, be due to the use of alternative codon usage, varying intron/exon mitochondrial organisation and amino acid replacement.
  • the DNA sequences encoding all or part of a wild type or mutant cytochrome b protein as described herein are preferably in isolated form. For example through being partially purified from any substance with which it occurs naturally.
  • the DNA sequence is isolatable (obtainable) or isolated (obtained) from the fungi disclosed herein.
  • the invention further provides a computer readable medium having stored thereon any of the sequences described and claimed herein and including all or part of a DNA sequence or protein sequence encoding a mutant cytochrome b protein as herein described wherein the presence of a mutation gives rise to fungal resistance to a strobilurin analogue or any compound in the same cross resistance group; all or part of a DNA or protein sequence encoding a mutant cytochrome b protein wherein said protein confers fungal resistance to a strobilurin analogue or a compound in the same cross resistance group from a fungus selected from the group Plasmopara viticola, Erysiphe graminis f.sp.
  • the polynucleotide sequences of the invention represent a valuable information source.
  • the use of this information source is most easily facilitated by storing the sequence information in a computer readable medium and then using the information in standard bioinformatics programs.
  • the polynucleotide sequences of the invention are particularly useful as components in databases for sequence identity and other search analyses.
  • sequence information in a computer readable medium and use in sequence databases in relation to polynucleotide or polynucleotide sequence of the invention covers any detectable chemical or physical chaiactenstic of a polynucleotide of the invention that may be leduced to.
  • a computei based method is also piovided foi peifoiming sequence identification, said method compnsing the steps of pioviding a polynucleotide sequence compnsing a polymoiphism of the invention in a computei leadable medium and companng said pol> mo ⁇ h ⁇ sm containing polynucleotide sequence to at least one othei polynucleotide or pol) peptide sequence to identify identity (homology) 1 c screen lor themannnce of the polvmoiphism
  • the invention further piovides a lungal cytochiome b piotein which confers iungal lesistance to a stiobiluiin analogue oi a compound within the same cioss lesistance gioup wheiein in said protein a noimal glycine lesidue is alteied due to thegronce of a mutation in the DNA coding foi said protein said mutation occuinng at a position in the DNA conesponding to one oi moie of the bases in the triplet coding foi the amino acid at the position conesponding to S DCex isiae cytochiome b lesidue 143 in the protein w ith the pioviso that said sequence is not the Mycena galopoda cytochiome h sequence
  • the invention fuithei piovides a fungal cytochiome h piotein which confeis fungal lesistance to a stiobiluiin analogue oi a compound within the same cioss lesistance group wheiein in said piotein a normal glycine residue is alteied due to the presence of a mutation in the DNA coding for said piotein said mutation occurring at a position in the DNA conesponding to the second base in the tnplet coding foi the amino acid at the position conesponding to S cetevisiae cytochiome b lesidue 143 in the protein with the pioviso that said sequence is not the Mycena galopoda cytochiome b sequence
  • the Mycena galopoda cytochiome b sequence is descnbed by Kiaiczy et al (Eur J Biochem 235, 54-63 (1996)) and the DNA sequence is in the EMBL data base EMBL Acession No X87997
  • the glycine lesidue in the protein accoiding to the above aspect of the invention is pieferably replaced by an alternative amino acid and said replacement results in the said fungi showing resistance to a strobilurin analogue or any othei compound in the same cioss resistance gioup
  • the mutation according to the above aspect of the invention preferably results in the replacement of said glycine residue with an amino acid selected from the group arginine, serine, cysteine, valine, aspartic acid, glutamic acid and most preferably alanine.
  • the invention provides an antibody capable of recognising said mutant cytochrome b protein.
  • the invention provides a method for the detection of a mutation in fungal cytochrome b gene resulting in replacement in the encoded protein of a glycine residue at the position corresponding to S. cerevisiae cytochrome b residue 143 said method comprising identifying the presence and absence of said mutation in a sample of fungal nucleic acid wherein any (or a) single nucleotide polymorphism detection method is based on the sequence information from around 30 to 90 nucleotides upstream and/or downstream of the position corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in either the wild type or mutant protein.
  • the invention provides a method for the detection of a mutation in fungal cytochrome b gene resulting in a G] 4 A replacement in the encoded protein said method comprising identifying the presence and absence of said mutation in a sample of fungal nucleic acid wherein any (or a) single nucleotide polymo ⁇ hism detection method is based on the sequence information from around 30 to 90 nucleotides upstream and/or downstream of the position corresponding to the second base in the triplet coding for the amino acid at the position corresponding to 5. cerevisiae cytochrome b residue 143 in either the wild type or mutant protein.
  • the invention provides a method for the detection of a guanine to cytosine mutation in a fungal cytochrome b gene resulting in a G
  • sequence information according to the above aspect of the invention is preferably derived from a fungus selected from the group Plasmopara viticola, Eiysiphe graminis f.sp. tritici/lwrdei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var.
  • the term around 30 means that the sequence may comprise up to 30 nucleotides, for example 5, up to 10, 15, 20, or 25 nucleotides or may comprise more than 30 nucleotides.
  • the sequence information used is around 30, preferably 30 nucleotides upstream and/or downstream of the position corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in either the wild type or mutant protein.
  • the nucleic acid according to the invention is preferably DNA
  • the test sample of nucleic acid is conveniently a total DNA preparation from fungal material, a cDNA preparation from fungal material or the fungal material itself or plant or seed extracts containing fungal nucleic acid.
  • the test sample may equally be a nucleic acid sequence corresponding to the sequence in the test sample. That is to say that all or a part of the region in the sample nucleic acid may firstly be isolated or amplified using any convenient technique such as PCR before use in the method of the invention.
  • the present invention provides a means of analysing mutations in the DNA of agricultural field samples which by their very origin are considerably less well defined compared with an analogous situation involving human samples.
  • Agricultural field samples aie considerably moie difficult to work with and it is moie technically demanding to detect a mutation event occuning at a low frequency in amongst a veiy laige amount of wild type DNA and/oi extianeous DNA from othei organisms piesent in a field isolate compaied with a human sample which geneially contains DNA fiom only one individual
  • Any convenient enzyme foi polymensation may be used piovided that it has no lntnnsic ability to disci lminate between noi mal and mutant template sequences to any significant extent
  • convenient enzymes include theimostable enzymes which have no significant 3'-5' exonuclease activ ity, foi example Taq DNA polymeiase, paiticulaily 'Amph Taq Gold ' TM DNA polymei ase (
  • the invention piov ides an allele specific oligonucleotide capable of binding to all or part of a fungal nucleic acid sequence encoding a wild type cytochiome b piotein selected fiom the gioup consisting of Plasmopai a ⁇ mcola, Ei y siphe gi ammis f sp tntic i/lioidei, Rhync hospoi iuin secalis, Py ienophoi a tei es, My cosphaerella gi aminitola, Ventui ia inaequalis My cosphaei ella f ⁇ iensis vai diffoi mis, Sphaei otheca fulit ⁇ inea Uncinula necatoi, Colletoti ichum giaminitola Pythium aphamdei inatwn, Colletoti ichum
  • the said fungal nucleic acid sequence is selected fiom the gioup consisting oi Plasmopai a viticola, Ery siphe giammis f sp tntici/lioidei, Rhynchospoi iuin secalis, Py ienophoia teres, My cosphaerella graminicola, My cosphaerella fi ⁇ ensis vai diffoimis, Sphaei otheca fuliginea, Uncinula necatoi, Colletoti ichum gi aminicola, Pythium aphamdei mat m, Colletoti ichum gloeospoi ioides, Oidium lycopei sicwn, Lex eillula taui ica, Pseudoperonospora cubensis, Altemai ia solani, Rhizo
  • DNA in a further aspect of the invention we provide an allele specific oligonucleotide capable of binding to a fungal nucleic acid sequence encoding all or part of a mutant cytochrome b protein wherein said oligonucleotide comprises a sequence which recognises a nucelic acid sequence encoding an amino acid selected from the group arginine, serine, cysteine, valine, aspartic acid, glutamic acid , tryptophan, and most preferably alanine at the position corresponding to S. cerevisiae cytochrome b residue 143.
  • an allele specific oligonucleotide capable of binding to a fungal nucleic acid sequence encoding all or part of a mutant cytochrome b protein selected from the group consisting oi Plasmopara viticola, Eiysiphe graminis f.sp. tritici/liordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var.
  • oligonucleotide comprises a sequence which recognises a nucleic acid sequence encoding an amino acid selected from the group arginine, serine, cysteine, valine, aspartic acid, glutamic acid, tryptophan, and most preferably alanine at the position corresponding to S. cerevisiae cytochrome b residue 143.
  • the invention provides an allele specific oligonucleotide probe capable of detecting a fungal cytochrome b gene polymorphism at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein.
  • the invention provides an allele specific oligonucleotide probe capable of detecting a fungal cytochrome b gene polymo ⁇ hism at a position in the DNA corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein.
  • said polymo ⁇ hism is a guanine to cytosine base change
  • the mutation is in a fungus selected from the group consisting of Plasmopai a i iticola Ery siphe giammis f sp tntici/hoidei, Rhy nchospoi iuin secalis, Py i enophoi a tei es, Mycosphaei ella gi ainimcola Venturia inaequali s Mycosphaerella fi/iensis vai diffoimis Sphaerotheca fuliginea, Uncinula necatoi, Colletoti ii hum graminicola, Py thium aphamdei matum Colletoti ichum gloeospoi ioides, Oidium ly copei sicuiii Ma ⁇ iapoi the ⁇ sea
  • the allele-specific oligonucleotide piobe is piefeiably 17 to 50 nucleotides long, moie piefei able about 17 35 nucleotides long and most pieierable about 17 30 nucleotides long
  • Such piobes will be appended to the molcculai biologist of oidinaiy skill and may be based on DNA oi RNA sequence infoi mation
  • Such piobes are of any convenient length such as up to 50 bases, up to 40 bases, moi e conveniently up to 30 bases in length, such as foi example 8-25 oi 8- 15 bases in length
  • Such piobes will compnse base sequences entnely complementaiy to the conesponding wild type oi vanant locus in the gene Howev er, if lequned one oi moie mismatches may be introduced, piovided that the discriminatory powei of the oligonucleotide piobe is not unduly atlected
  • the probes of the invention may cany one or moie labels to facilitate detection
  • the invention alsthei piovides nucleotide p ⁇ meis which can detect the nucleotide polymoiphisms accoiding to the invention
  • theie is piovided an allele specific primer capable of detecting a cytochiome b gene polymorphism at a position in the DNA conesponding to one or moie of the bases in the tnplet coding for the amino acid at the position coiresponding to S cerevisiae cytochrome b lesidue 143 in the piotein
  • an allele specific primer capable of detecting a cytochrome b gene polymorphism at a position in the DNA corresponding to the second base in the tnplet coding foi the amino acid at the position conesponding to S cetevisiae cytochiome b lesidue 143 in the piotein
  • the said mutation in the DNA sequence is preferably a guanine to cytosine base change
  • piovides an allele specific pnmer capable of detecting a fungal DNA sequence encoding a wild type cytochiome b piotein selected from the group consisting oi Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var.
  • the said fungal DNA sequence is selected from the group consisting oi Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Mycosphaerella fijiensis var. difformis Sphaerotheca fuliginea.
  • an allele specific primer capable of detecting a fungal DNA sequence encoding all or part of a mutant cytochrome b protein wherein said allele specific primer is capable of detecting a DNA sequence encoding an amino acid selected from the group arginine, serine, cysteine, valine, aspartic acid, glutamic acid, tryptophan, and most preferably alanine at the position corresponding to 5. cerevisiae cytochrome b residue 143.
  • an allele specific primer capable of detecting a fungal DNA sequence encoding all or part of a mutant cytochrome b protein selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici/liordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var.
  • said primer is capable of detecting a DNA sequence encoding an amino acid selected from the group arginine, se ne, cysteine, valine, aspartic acid, glutamic acid, tryptophan, and most prefeiably alanine at the position corresponding to S cetevisiae cytochiome b lesidue 143
  • An allele specific pnmei is used geneially with a common pnmei in an amplification ieaction such as a PCR reaction w hich piovides the discnmination between alleles thiough selective amplification of one allele at a paiticulai sequence position e g as used in the ARMS assay
  • theieioie piovides a diagnostic pnmei capable of binding to a template compnsing a mutant type fungal cytochiome b nucleotide sequence wheiein the final 3' nucleotide ol the pnmer conesponds to a nucleotide piesent in said mutant foim of a fungal species
  • the diagnostic pnmer of the invention is piefeiably at least 20 nucleotides in length, most piefeiably 26 nucleotides in length but this may be between 1 and 20 nucleotides in length
  • the penultimate nucleotide (-2) of the pnmei is not the same as that piesent in the corresponding position in the wild type cytochiome b sequence
  • destabilising components may be incoipoiated along with the -2 or -3 nucleotide
  • a fuithei particularly pieferred embodiment of the above aspect of the invention we provide diagnostic primeis capable of binding to a template comprising a mutant type fungal cytochrome b nucleotide sequence wherein the final 3' nucleotide of the pnmei corresponds to a nucleotide piesent in said mutant form of a fungal cytochrome b gene and wherein up to 10, such as up to 8, 6, 4, 2, 1, of the remaining nucleotides may be varied with respect to the wild type sequence without significantly affecting the properties of the diagnostic primer.
  • diagnostic primers comprising the sequences given below and derivatives thereof wherein the final nucleotide at the 3' end is identical to the sequences given below and wherein up to 10, such as up to 8, 6, 4, 2, 1, of the remaining nucleotides may be varied without significantly affecting the properties of the diagnostic primer.
  • the sequence of the diagnostic primer is exactly as provided below. It is preferred that the ARMS primers in all aspects of the invention are 26 nucleotides in length. In the majority of the primers listed below the penultimate nucleotide has been altered from wild type cyt b sequence to destabilise the primer thereby making it more selective for the desired template and these primers are particularly preferred according to the invention. It will be apparent to the man skilled in the art of primer design that bases alternative to or in addition to those discussed above may also be varied without adversely affecting the ability of the primer to bind to the template.
  • the primers included in Table 4 include:
  • ARMS primers for P. teres, and V. ineaqualis which can be used effectively either on genomic DNA preparations or biological samples including fungal isolates, fungal cultures, fungal spores or infected plant material.
  • cDNA material is recommended for the species where the intron/exon organisation is not currently characterised around the single nucleotide polymorphism (SNP) of interest.
  • SNP single nucleotide polymorphism
  • Such primers may be manufactured using any convenient method of synthesis. Examples of such methods may be found in standard textbooks, for example "Protocols For Oligonucleotides And Analogues: Synthesis And Properties;” Methods In Molecular Biology Series; Volume 20; Ed. Sudhir Agrawal, Humana ISBN: 0-89603-247-7; 1993; I s ' Edition.
  • extension of a diagnostic primer can be designed to indicate the absence of the mutation resulting in a G
  • ARMS primers for the detection of the absence of the mutation resulting in a G ⁇ 4 A replacement in the encoded protein is preferred. Primers designed for that pu ⁇ ose are described herein.
  • the detection of the wild type sequence is useful as a control in relation to the detection of the mutation and also is necessary where quantitation of wild type and mutant alleles present in a sample is desired.
  • the invention therefore provides a diagnostic primer capable of binding to a template comprising wild type fungal cytochrome b nucleotide sequence wherein the final 3' nucleotide of the primer corresponds to a nucleotide present in a wild type fungal cytochrome b gene said wild type fungus showing sensitivity to a strobilurin analogue or any other compound in the same cross resistance group.
  • (-2) of the primer is not the same as that present in the corresponding position in the wild type cytochrome b sequence.
  • the -3 nucleotide of the primer is not the same as that present in the corresponding position in the wild type cytochrome b sequence.
  • Other destabilising components may be inco ⁇ orated along with the -2 or -3 nucleotide.
  • the diagnostic primer of the invention is preferably at least 20 nucleotides in length, most piefeiably 26 nucleotides in length but this may be between 15 and 20 nucleotides in length
  • diagnostic p mers capable of binding to a template compnsing wild type fungal cytochiome b nucleotide sequence wherein the final 3' nucleotide of the primer conesponds to a nucleotide present in a wild type fungal cytochrome b and wheiein up to 10, such as up to 8, 6, 4, 2, 1 , of the lemaining nucleotides may be vaned with respect to the wild type sequence without significantly affecting the pioperties of the diagnostic pnmer
  • ARMS p meis may also be based on the reveise stiand of DNA if so desned
  • Such reverse strand primers are designed following the same pimciples above foi foi ward strand p meis namely, that the primers may be at least 20 nucleotides in length most pieferably 26 nucleotides in length, but may be between 15 and 20 nucleotides in length and the final nucleotide at the 3' end of the pnmer matches the lelevant template l e mutant or wild type and piefeiably the penultimate lesidue is optimally changed such that it does not match the lelevant template Additionally up to 10, such as up to 8, 6, 4, 2, 1 , of the lemaining nucleotides in the primer may be vaned without significantly affecting the pioperties of the diagnostic primer
  • a diagnostic primer of the invention with a further amplification pnmei lef erred to herein as the common primer, in one or more cycles of PCR amplification
  • the further amplification pnmei is eithei a forward or a reveise common primer
  • the pnmer used is as below
  • the Primers shown below are reverse primers
  • the common primer can be any convenient pathogen specific sequence which recognises the complementary strand of the cytochrome b gene (or other gene of interest) lying 3' of the mutation selective primer.
  • the PCR amplicon size is preferentially 50 to 400bp long but can be from 30 to 2500bp long, or potentially from 30 to 10,000bp long.
  • a convenient control primer may be used which is designed upstream from the G ⁇ 3 A position. It will be evident to the man skilled in the art that the control primer may be any primer which is not specific for the amplification of the mutation or wild type sequences. When using these primers along with the corresponding reverse ('common') primer described above, amplification will occur regardless whether the G) 43 A point mutation is present or not.
  • a variety of methods may be used to detect the presence or absence of diagnostic primer extension products and/or amplification products. These will be apparent to the person skilled in the art of nucleic acid detection procedures. Preferred methods avoid the need for radiolabelled reagents. Particularly preferred detection methods are those based on fluorescence detection of the presence and/or absence of diagnostic primer extension products.
  • Particular detection methods include gel electrophoresis analysis, "Sco ⁇ ions”TM product detection as described in PCT application number PCT /GB98/03521 filed in the name of Zeneca Limited on 25 November 1998 the teachings of which are incorporated herein by reference, “Taqman” TM product detection, for example as described in patent numbers US-A-5487972 & US-A-5210015; "Molecular Beacons” ® product detection, outlined in patent number WO-95/13399 and surface enhanced Raman resonance spectroscopy (SERRS), outlined in patent application WO 97/05280.
  • Further preferred detection methods include ARMS linear extension (ALEX) and PCR with ALEX as described in published PCT application number WO 99/04037.
  • ARMS primers based on the forward strand of DNA in combination with Scorpion detection based on the reverse strand of DNA as the detection method.
  • the Sco ⁇ ion detection element prefeiably compnse the reverse primers shown in Table 6. It will be readily apparent to the man skilled in the art that alternative combinations of ARMS primers and Scorpion detection elements could also be used.
  • the primer based on the forward strand of the DNA could be a combination of an ARMS primer with a Scorpion detection system and this could be used with a common primer based on the reverse strand of DNA or the pnmer based on the reverse strand of DNA could be a combination of an ARMS primer with a Sco ⁇ ion detection system and this could be used with a common primer based on the forward strand of DNA
  • the Scorpion detection element is on the common primer.
  • the ARMS primer specific to the mutation and the wild type sequence are used in combination with the common fluorescence labelled pnmei These two reactions are cairied out in diffeient PCR tubes and the fluorescence is emitted when the probe binds to the amplicon generated.
  • the Sco ⁇ ion element may alternatively be incorpoiated on the ARMS primers.
  • the two ARMS primers can be labelled with different fluorophores and used along with the common pnmer (this time unlabelled). These three primers may be included in the same reaction as the resulting mutant and wild type amplicons will lead to different fluorescence being emitted.
  • the Sco ⁇ ions technology may be used in a number of different ways such as the intercalation embodiment where the tail of the Sco ⁇ ions primer carries an intercalating dye which is capable of being inco ⁇ orated between the bases of a double stranded nucleic acid molecule, upon which it becomes highly fluorescent; the FRET embodiment where the dyes involved in the primer form an energy transfer pair; the no-quencher embodiment where a fluorophore is attached to the tail of the Sco ⁇ ions primer; the Bimolecular embodiment where the fluorophore and quencher may be introduced on two separate but complementary molecules; the Capture Probe embodiment where amplicons may be specifically captured and probed using the same non-amplifiable tail and the Stem embodiment where the primer tail comprises self complementary stems.
  • the intercalation embodiment where the tail of the Sco ⁇ ions primer carries an intercalating dye which is capable of being inco ⁇ orated between the bases of a double stranded nucleic acid molecule, upon which it becomes highly fluorescent
  • the FRET embodiment where the dyes involved
  • the methods of the invention described herein reliably detect a mutation in a fungal gene wherein the presence of said mutation gives rise to fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene at a detection level in the range of 1 mutated allele per 1 ,000,000 wild type alleles to 1 mutated allele per 10,000 wild type alleles, and preferably in the range of 1 mutated allele per 100,000 wild type alleles to 1 mutated allele per 10,000 wild type alleles.
  • the method of the invention can also detect mutations occurring at higher frequency, for example, 1 mutated allele per 100 wild type alleles, 1 mutated allele per 10 wild type alleles or where only mutated alleles are present.
  • the methods of the invention may be used to detect the frequency of the wild type allele in a background of mutated alleles.
  • the high throughput nature of the method enables a wider area and more sites to be sampled and tested than might be possible using the bioassay Allele specific primer extension such as ARMS linked with leal time fluoiescent detection allows the detection of the presence of the resistance gene in a population befoie the effects of the gene can be viewed phenotypically by bioassay in heteroplasn ⁇ c and/or heterokaryotic cells, thus reducing the en or of classifying samples as sensitive when they carry a low fiequency of the resistance genotype Results aie obtained much fastei thiough simultaneous read-out (real time) compared to waiting for disease development in pi ant a, enabling fast responses to field situations and advice on resistance management to be given moie quickly
  • kits will conveniently include one or moie of the following diagnostic, wild type, contiol and common oligonucleotide pnmers appiopnate nucleotide triphosphates, for example dATP, dCTP, dGTP, dTTP, a suitable polymerase as pieviously described, and a buffei solution
  • piovides a method of detecting plant pathogenic fungal resistance to a fungicide said method compnsing detecting a mutation in a fungal gene wherein the presence of said mutation gives rise to fungal lesistance to a stiobilurin analogue or any othei compound in the same cioss lesistance gioup said method comprising identifying theillagence or absence of said mutation in fungal nucleic acid using any (or a)
  • the invention provides a method of detecting plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene comprising contacting a test sample comprising fungal nucleic acid with a diagnostic pnmei for a specific mutation, the presence of which gives rise to resistance to said fungicide, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product.
  • the invention provides a method of detecting plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene comprising contacting a test sample comprising fungal nucleic acid with a diagnostic primer for a specific mutation, the presence of which gives rise to resistance to said fungicide, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended only when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product.
  • the methods of the invention described in the above aspect and embodiments are especially suitable for use with plant pathogenic fungal strains where the presence of a mutation in a cytochrome b gene gives rise to fungicide resistance and most especially to resistance to a strobilurin analogue or a compound in the same cross resistance group and most especially where the mutation in the fungal DNA gives rise to a replacement of a glycine residue at the position corresponding to S. cerevisiae cytochrome b residue 143, more especially to a G
  • the invention provides a method of detecting and quantifying the frequency of a mutation giving rise to plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene said method comprising detecting the presence or absence of a mutation in a fungal gene wherein the presence of said mutation gives rise to fungal resistance to said fungicide said method comprising identifying and quantifying the presence or absence of said mutation in fungal nucleic acid using any (or a) single nucleotide polymorphism detection technique.
  • the invention provides a method of detecting and quantifying the frequency of a mutation giving rise to plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene said method comprising detecting the presence or absence of a mutation in a fungal gene wherein the presence of said mutation gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising identifying and quantifying the presence or absence of said mutation in fungal nucleic acid using any (or a) single nucleotide polymorphism detection technique.
  • the invention provides a method of detecting and quantifying the frequency of a mutation giving rise to plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene said method comprising detecting the presence of an amplicon generated during a PCR reaction wherein said PCR reaction comprises contacting a test sample comprising fungal nucleic acid with appropriate primers in the presence of appropriate nucleotide triphosphates and an agent for polymerisation wherein the detection of said amplicon is directly related to both the presence and absence of a mutation in said nucleic acid wherein the presence of said mutation gives rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene, and detecting and quantifying the relative presence and absence of the said mutation by reference to the presence or absence of an amplicon generated during the PCR reaction.
  • the invention provides a method of detecting and quantifying the frequency of a mutation giving rise to plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene comprising contacting a test sample comprising fungal nucleic acid with diagnostic primers to detect both the presence and absence of a specific mutation in said nucleic acid, the presence of which gives rise to resistance to said fungicide, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primers relating to the absence and the presence of the specific mutation are extended when the appropriate fungal template is present in the sample; and detecting and quantifying the relative presence and absence of the said mutation by reference to the presence or absence of diagnostic primer extension products.
  • the invention provides a method of detecting and quantifying the frequency of a mutation giving rise to plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene comprising contacting a test sample comprising fungal nucleic acid with diagnostic primers to detect both the presence and absence of a specific mutation in said nucleic acid, the presence of which gives rise to resistance to said fungicide, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primers relating to the absence and the presence of the specific mutation are extended only when the appropriate fungal template is present in the sample; and detecting and quantifying the relative presence and absence of the said mutation by reference to the presence or absence of diagnostic primer extension products.
  • the methods of the invention described in the above aspect and embodiments are especially suitable for use with plant pathogenic fungal strains where the presence of a mutation in a cytochrome b gene gives rise to fungicide resistance and most especially to resistance to a strobilurin analogue or a compound in the same cross resistance group and most especially where the mutation in the fungal DNA gives rise to a replacement of a glycine residue at the position corresponding to 5.
  • cerevisiae cytochrome b residue 143 more especially to a G
  • the invention provides a method of selecting an active fungicide and optimal application levels thereof for application to a crop comprising analysing a sample of a fungus capable of infecting said crop and detecting and/or quantifying the presence and/or absence of a mutation in a gene from said fungus wherein the presence of said mutation may give rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene and then selecting an active fungicide and optimal application levels thereof.
  • the detection method comprises any (or a) single nucleotide polymorphism detection technique and is more preferably comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the specific mutation in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product and the quantification is achieved by contacting a test sample comprising fungal nucleic acid with diagnostic primers to detect both the presence and absence of a specific mutation in said nucleic acid the presence of which gives rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primers relating to the absence and the presence of the specific mutation are extended when the appropriate fungal template is present in the sample; and detecting and
  • the detection method comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the specific mutation in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended only when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product and the quantification is achieved by contacting a test sample comprising fungal nucleic acid with diagnostic primers to detect both the presence and absence of a specific mutation in said nucleic acid the presence of which gives rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primers relating to the absence and the presence of the specific mutation are extended only when the appropriate fungal template is present in the sample; and detecting and quantifying the relative presence and absence of the said mutation by reference to the presence or absence of diagnostic primer
  • the methods of the invention described herein are especially suitable for use with plant pathogenic fungal strains where the presence of a mutation in a cytochrome b gene gives rise to fungicide resistance and most especially to resistance to a strobilurin analogue or a compound in the same cross resistance group and most especially where the mutation in the fungal DNA gives rise to a replacement of a glycine residue at the position corresponding to S. cerevisiae cytochrome b residue 143, more especially to a G
  • the invention provides a method of controlling fungal infection of a crop comprising applying a fungicide to the crop wherein said fungicide is selected according to any of the selection methods of the invention described above.
  • the method of the invention described above is especially suitable for use with plant pathogenic fungal strains where the presence of a mutation in a cytochrome b gene gives rise to fungicide resistance and most especially to resistance to a strobilurin analogue or a compound in the same cross resistance group.
  • the invention provides an assay for the detection of fungicidally active compounds comprising screening the compounds against strains of fungi which have been tested for the presence or absence of a mutation giving rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene according to the methods of the invention described herein and then determining fungicidal activity against said strains of fungi.
  • the methods of the invention described herein are especially suitable for use with plant pathogenic fungal strains where the presence of a mutation in a cytochrome b gene gives rise to fungicide resistance and most especially to resistance to a strobilurin analogue or a compound in the same cross resistance group and most especially where the mutation in the fungal DNA gives rise to a replacement of a glycine residue at the position corresponding to S. cerevisiae cytochrome b residue 143, more especially to a G
  • the appropriate rate of application of fungicides and/or the appropriate combination of fungicides to be applied to the crop may be determined.
  • the methods of the invention described herein are particularly suitable for monitoring fungal resistance to a strobilurin analogue or a compound in the same cross resistance group in crops such as cereals, fruit and vegetables such as canola, sunflower, tobacco, sugarbeet, cotton, soya, maize, wheat, barley, rice, sorghum, tomatoes, mangoes, peaches, apples, pears, strawberries, bananas, melons, potatoes, carrot, lettuce, cabbage, onion, vines and turf.
  • crops such as cereals, fruit and vegetables such as canola, sunflower, tobacco, sugarbeet, cotton, soya, maize, wheat, barley, rice, sorghum, tomatoes, mangoes, peaches, apples, pears, strawberries, bananas, melons, potatoes, carrot, lettuce, cabbage, onion, vines and turf.
  • the methods of the invention described herein are particularly sensitive for detecting low frequencies of mutations in mitochondrially encoded genes, such as the cytochrome b gene, making this an especially useful and commercially important way of screening plant pathogenic fungi for the onset of fungicidal resistance wherein the resistance is due to a mutation in a mitochondrially encoded gene.
  • Figure 1 shows: a diagrammatic representation of the secondary structure of the Scorpion P. viticola primer using the MFold Zucker program
  • Figure 2a shows: a graph illustrating the PCR amplification of a serial dilution oi P. viticola mutant DNA in a background of wild type DNA using the C specific primer and the Sco ⁇ ion primer (in duplicate).
  • Figure 2b shows: a graph illustrating a multiplex experiment with P. viticola ARMS primers on two serial dilutions of mutant DNA in a background of wild type DNA (in duplicate).
  • the line represented by the diamonds shows the results for 1 : 100 Gfam
  • the line represented by the triangles shows the results for 1 :500 Gfam
  • the line represented by the circles shows the results for 1 : 100 Ctet
  • the line represented by the squares shows the results for 1 :500 Ctet.
  • Figure 3a shows: a graph illustrating E. graminis total DNA amplified with the three primer pairs (specific G/C and control primers) (in duplicate). As shown in the figure the line represented by the diamonds shows the results for 1/100 standard, the line represented by the triangles shows the results for 1/100 Gmix and the line represented by the crosses shows the results for 1/100 Cmix.
  • the line represented by the diamonds shows the results for Qmix
  • 1/100 line 1
  • the line represented by the squares shows the results for Qmix
  • 1/1000 hne 2
  • the line lepresented by the tnangles shows the results for Gmix
  • 1/100 l ⁇ ne 3
  • the line represented by the diamonds shows the lesults for Gmix
  • 1/1000 l ⁇ ne 4
  • the line lepiesented by the cross shows the lesults for Cmix
  • 1/100 hne 5
  • the line lepresented by the circles shows the results foi Cmix
  • 1/1000 hne 6
  • Figuie 5a shows a giaph illustiating the PCR amplification of a senal dilution of a wild type R secalis plasmid amplified with the wild type specific pnmer pair (in duplicate)
  • the line represented by the diamonds shows the lesults for Gplasmid 10 ⁇ 8
  • Figure 5b shows a giaph illustrating the PCR amplification of the highest concentiation of wild type and mutant R secalis plasmids amplified with the wild type specific pnmer pair (in duplicate)
  • fiom the figuie the line lepiesented by the diamonds shows the results foi G-plasmid 10 ⁇ 8 and the line lepiesented by the triangles shows the results for c- plasmid 10 ⁇ 8
  • Figure 6a shows a giaph illustrating the PCR amplification of a senal dilution of a mutant R secalis plasmid amplified with the mutant specific pnmei pan (in duplicate)
  • the line repiesented by the diamonds shows the iesults foi c-plasmid 10 ⁇ 8
  • the line lepresented by the tnangles shows the results for c-plasmid 10 ⁇ 6
  • the line lepiesented by the squaies shows the results lor c-plasmid 10 ⁇ 4
  • the line lepiesented by the cucles shows the iesults foi c-plasmid 10 ⁇ 2
  • Figuie 6b shows a graph illustiating the PCR amplification of the highest concentration of wild type and mutant R secalis plasmids amplified with the mutant specific pnmei pair (in duplicate) As can be seen fiom the figure the line represented by the diamonds shows the lesults for G-plasmid 10 ⁇ 8 and the line repiesented by the triangles shows the iesults for c- plasmid 10 ⁇ 8
  • Figuies 7a, b and c show graphs illustiating the PCR amplification of R secalis DNA and cDNA templates in three dilutions with the G primer pair (in duplicate) As can be see fiom the figures the line represented by the diamonds shows total DNA and the line represented by the triangles shows cDNA
  • Figures 8 a, b and c show graphs illustrating the PCR amplification of /? secalis DNA and cDNA templates in thiee dilutions with the C primer pair (in duplicate) As can be see from the figures the line represented by the diamonds shows total DNA and the line represented by the triangles shows cDNA.
  • Figure 9a and b show: graphs illustrating the amplification of P. teres P13 and P15 isolates in two dilutions with the three primer pairs (in duplicate).
  • the diamonds representing S-mix line 1
  • the triangles representing S-mix 1/10 line 2
  • the squares representing G-mix line 3
  • the circles representing G-mix 1/10 line 4
  • the ScorpionTM system (AstraZeneca Diagnostics) was used as a product detection system.
  • This detection system is described in full in PCT application number PCT/GB98/03521 filed in the name of Zeneca Limited on 25 November 1998 the teachings of which are inco ⁇ orated herein by reference.
  • This novel detection system uses a tailed primer and an integrated signalling system.
  • the primer has a template binding region and a tail comprising a linker and a target binding region.
  • the target binding region in the tail hybridises to complementary sequence in an extension product of the primer.
  • This target specific hybridisation event is coupled to a signalling system wherein hybridisation leads to a detectable change.
  • the detection method of this system offers a number of significant advantages over other systems.
  • a hexethylene glycol (HEG) monomer as a blocking moiety that is sited between the template binding region of the primer and the tail region, which moiety prevents polymerase mediated chain copying of the tail region of the primer template.
  • FAM fluorescent molecule is added to the 5'end of the primer.
  • FAM is one of the fluorescence molecules that can, for example, be readily detected by the 488nm laser of the ABI PRISM 7700 instrument (PE Biosystems)
  • MR is a non-fluorogenic quencher attached to a uracil residue
  • Other fluorescence molecules and quenching mechanisms can also be accommodated in Sco ⁇ ion primer design and would be suitable to use in this invention.
  • Example 4 an intercalating dye was also used as a detection mechanism.
  • the eighteen examples together describe the characterisation of partial cytochrome b gene sequences from a panel of important wild type fungal isolates, whilst Examples 1, 2 and 6 also describe the characterisation of partial cytochrome b gene sequences from fungal isolates which are resistant to strobilurin analogues and other compounds in the same cross resistance group. The methods are particularly suitable for use with the strobilurin analogues azoxystrobin and picoxystrobin.
  • Example 1 we describe the characterisation of partial Plasmopara viticola cytochrome b gene sequence, the characterisation of a single nucleotide polymo ⁇ hism (SNP) that gives rise to strobilurin analogue resistance in P. viticola and the validation of a real time PCR Sco ⁇ ion assay for the monitoring of this SNP in P. viticola. A multiplexing approach to carrying out the real time PCR assay is also described.
  • P. viticola is the causal agent of vine downy mildew.
  • Freshly inoculated plants were incubated for 24 hours in a humidity chamber (temperature ambient, relative humidity 100%), then moved to a growth room (day 24°C/r.h. 60%; night 18°C/r.h. 95%; daylength 16 hours; 6,000 lux). Plants were returned to the humidity chamber after 6 days for a further 24 hour period, after which time successful infection showed as sporulating lesions on the abaxial leaf surfaces. Further subculturing was carried out as above, adjusting the sporangial suspension to 5,000- 10,000 sporangia per ml.
  • a DNA fragment encoding a significant part of wild type P. viticola cytochrome b sequence was amplified using primers based on conserved regions of Phytophthora megasperma and Aspergillus nidulans cytochrome b genes (Cytbl2F (5' TGAACATATTATGAGAGATGT 3') (SEQ ID NO 106)and CytlOR (5' AATTGCATAAAAAGGTAAAAA 3') (SEQ ID NO 1 7) which delineate the sequence encoding amino acid region 66 and 281 of fungal cytochrome b based on the S. cerevisiae numbering system).
  • DNA was extracted from the strobilurin analogue-sensitive isolate, using a phenol/chloroform extraction protocol. Sporangia were washed into 30ml of double distilled H O (ddH 2 O) from six leaves with 90-100% disease cover (originated from artificially inoculated six week old vine seedlings). The sporangial suspension was filtered through Miracloth (Calbiochem cat # 475855) and centrifuged at 3600 ⁇ m for 10 minutes at 4°C. The sporangia were then frozen in liquid nitrogen and ground to a fine powder using a pestle and mortar which had been previously cleaned and sterilised by acid washing and autoclaving.
  • ddH 2 O double distilled H O
  • the sporangial suspension was filtered through Miracloth (Calbiochem cat # 475855) and centrifuged at 3600 ⁇ m for 10 minutes at 4°C. The sporangia were then frozen in liquid nitrogen and ground to a fine powder using a pestle and mortar which had
  • lysis buffer 200mM Tris-HCl (pH8.5), 250mM NaCl, 25mM EDTA and 0.5% SDS
  • a phenol/chloroform/isoamyl alcohol 25:24: 1
  • the tubes were centrifuged for 30 minutes at 14000 ⁇ m and the aqueous phase transfened to fresh Eppendorf tubes. The phenol/chloroform/isoamyl alcohol extraction was then repeated but this time the tubes were centrifuged at 14000rpm for only 15 minutes.
  • PCRs were set up as recommended by the manufacturer of the Taq Polymerase enzyme (Gibco) in a final reaction volume of lOO ⁇ l. The primers were added to the reactions to a final concentration of lpmole/ ⁇ l.
  • P. viticola specific primers based on the above analyses used in later amplifications of the cytochrome b region of interest were PL AS 17F (5 ' AAATAACGGTTGGTT A ATTCG 3') (SEQ ID NO 108) and PLAS15R (5' TCTTAAAATTGCATAAAAAGG (SEQ ID NO 109)3') delineating amino acid region 73-283 of fungal cytochrome b according to the S. cerevisiae numbering system.
  • a strobilurin analogue-resistant isolate of P. viticola was identified at one trial site. Infected vine leaves were collected and processed essentially as above though samples were subcultured as mass populations and not isolated as single lesions prior to testing. The test method to verify strobilurin analogue resistance was a 24 hour preventative spray on 4-week old vine seedlings.
  • a chemical dilution series was prepared by dissolving 5mg strobilurin analogue (strobilurin analogue as used in all examples herein denotes azoxystrobin) (technical material, 97% pure) in 1ml acetone and carrying out a further dilution in deionised water at room temperature to give a rate of lOppm (a dose known to give 100% control of strobilurin analogue sensitive baseline isolate).
  • the abaxial surfaces of the target leaves were sprayed using a DeVilbiss spray gun, lOpsi, to maximum retention. Control plants were sprayed with deionised water only. The treated plants were left to dry in a growth room (conditions as above) overnight.
  • Partial cytochrome b gene sequence was amplified with PLAS17F and PLAS15R primers from the resistant isolate (T5).
  • Total genomic DNA (nuclear and mitochondrial) from this isolate was extracted using the phenol/chloroform extraction protocol described above. Again DNA presence and quality was checked by gel electrophoresis and suitable aliquots were diluted 1: 10 and 1 : 100 in ddH 2 O for PCR studies. lO ⁇ l of each DNA dilution was then added to Ready .To.GoTM Taq polymerase PCR beads (Amersham Pharmacia Biotech product number 27-9555-01) and made up to 25 ⁇ l with PLAS17F and PLAS15R primer solutions, each to a final primer concentration of lpmole/ ⁇ l.
  • a l ⁇ l sample of the pooled PCR products was then cloned in the TA cloning pCR2.1 vector (Invitrogen) and transformed into E.coli cells (TOP 10 One ShotTM competent cells) as per the manufacturer's recommendations.
  • TOP 10 One ShotTM competent cells E.coli cells
  • a series of resulting clones were checked for the presence of inserts by performing Wizard minipreps (as per Promega instructions) and restriction digest analysis using EcoRI. 10 clones with the correct size inserts ( ⁇ 500bp) were then sequenced using Ml 3 forward and reverse primers (ABI377XL automated sequencer).
  • G-sp-f- 1 CCTTGGTG ACAAATGAGTTTTTGTGG (SEQ ID NO 1 10)
  • G-sp-f-2 CCTTGGTGACAAATGAGTTTTTGGAG (SEQ ID NO 1 1 1 )
  • A mutation: C-sp-f- 1 : CCTTGGTG ACAAATGAGTTTTTGGCC (SEQ ID NO 1 12)
  • C-sp-f-2 CCTTGGTGACAAATGAGTTTTTGGAC (SEQ ID NO 1 13) and a control primer designed upstream from the point mutation: STAND: GCCTTGGGGACAAATGAGTTTTTG (SEQ ID NO 1 14)
  • the -1 base corresponds to the target point mutation site. Bases presented in bold differ from the wild type P. viticola cytochrome b sequence.
  • the -20 base was changed from a G to a T base. This was done to disrupt the run of G bases.
  • the G-sp-f-2 and C-sp-f-2 primers the -2 position was changed from a G to a A base.
  • the G-sp-f- 1 the -3 position was changed from a G to a T base.
  • the -2 primer was changed from a G to a C base. These alterations to the sequence were made to destabilise the primer and render any primer extension more specific to the corresponding template. Examples in the literature have shown that destabilising the ARMS primer decreases the risk of the primer mispriming on the wrong template (Newton et al, Nucleic Acid Research 17 (7) 2503-2516 1989).
  • the Sco ⁇ ionTM product detection system was used in this case as a detection mechanism and the detection system was inco ⁇ orated on the reverse primer.
  • the resulting amplicon was 234 bp long with the ARMS primers, and 235 bp long with the control primer.
  • the Sco ⁇ ion primer was designed using Oligo 5 and MFold programs (MFold predicts optimal and suboptimal secondary structures for RNA or DNA molecules using the energy minimization method of Zucker (Zucker, M. (1989) Science 244, 48-52; SantaLucia, J.Jr. (1998). Proc. Natl. Acad. Sci. USA 95, 1460-1465).
  • the sequence of the P. viticola Scorpion primer was:
  • AmpliTaq Gold enzyme (Perkin-Elmer/ ABI) was included in the reaction mix at lunit/25 ⁇ l reaction.
  • the reaction mix also contained lx buffer (lOmM Tris-HCl (pH8.3), 50mM KC1, 3.5 mM MgCl 2 , 0.01% gelatine) and lOO ⁇ M dNTPs.
  • Amplifications were performed in an ABI Prism 7700 instrument for continuous fluorescence monitoring. A preliminary cycle of 95°C for 10 minutes was performed followed by 50 cycles of 95°C for 15 sec and 60°C for 45 sec. Fluorescence was monitored during the annealing/extension stage throughout all cycles.
  • Primers were first validated for use in such analyses by using plasmid DNA as template at various concentrations. This was performed in order to check the specificity and sensitivity of the primer designs. Partial wild type cytochrome b gene sequence and the corresponding tract containing the G ⁇ A mutation were cloned into the TA pCR2.1 vector (Invitrogen) for use in this validation process. The C-sp-f-2 and G-sp-f-2 primers were preferred to the C-sp-f- 1 and the G-sp-1 primers as duplicate PCRs gave more consistent results and were slightly more specific. In all cases, plasmid DNA was diluted in lmg/ml bovine serum albumin (BSA).
  • BSA bovine serum albumin
  • the graph shown in Figure 2a illustrates PCRs where a dilution of mutant plasmid in a background of wild type template was amplified using the ARMS C-sp-f-2 primer.
  • the C plasmid dilution reduces in the wild type plasmid background, the fluorescence detection is delayed. In all cases, the final plasmid concentration in the PCR was lxlO 7 molecules/ ⁇ l. With each 10 fold dilution of the C plasmid, there is a delay of 3-4 cycles in the detection of fluorescence.
  • the C-sp-f-2 primer is totally specific to its corresponding template as no fluorescence can be detected in the 100% wild type plasmid sample in this experiment.
  • the concentration of BSA added to the reactions was increased and the detergent Tween-20 was added to the PCR.
  • an initial PCR was carried out and the PCR product from this reaction was used as a template in the real time PCR, the spore dilutions were boiled for 10 minutes before being added to the real time PCR to improve cell lysis and the DNA was extracted from the spores using 3 different protocols (DNA Isolator from Genosys Biotechnologies Inc., DNAzol from Helena Biosciences, and Qiagen DNeasy plant mini kit).
  • the G ⁇ 4 and Aj 4 allele frequency was estimated in a P. viticola isolate collected from a field trial (denoted 17 A). Sporangia were collected in ddH 0 off 120 leaves and harvested by centrifugation. This sample contained approximately 2400 lesions and 6.4xl0 7 sporangia. 12xl0 6 sporangia were kept at -80°C to be used for DNA extraction.
  • a genomic DNA extraction using the DNeasy Plant Minikit (Qiagen catalogue No. 69103) was carried out and the resulting DNA was diluted 1 : 10 and 1 : 100 in ddH 0 for use as template for real time PCR analysis. The PCR conditions were as described above.
  • the resulting Cycle Threshold (Ct) values were 20 for the G specific primer and 34 with the C specific primer giving a Ct difference of 14 cycles and thus a frequency of resistant alleles of approximately 1 in 10,000.
  • Sco ⁇ ion detection element was inco ⁇ orated on the ARMS primers to enable the G
  • the Sco ⁇ ion/ARMS primer sequences were as follows: G ) 3 allele specific primer:
  • Example 2 we report the characterisation of partial Erysiphe graminis f.sp tritici and hordei cytochrome b gene sequences, the characterisation of a SNP that gives rise to resistance to strobilurin analogues or compounds in the same cross resistance group and the description of a real time PCR Sco ⁇ ion assay for the monitoring of this SNP in E. graminis f.sp. tritici and hordei.
  • Isolates of E. graminis f.sp. tritici and f.sp. hordei were collected from Northern France, Germany, Ireland and the United Kingdom. This was achieved by one of two methods: hand collection of field leaves or air spora sampling by car- mounted jet spore trap (Burkard Manufacturing Co. Ltd., Rickmansworth, UK).
  • wheat leaves were cut from 9 day old plants (cv. Rapier) and placed on 1.8% water agar in plastic dishes, and maintained at 5°C until required.
  • a jet spore trap was mounted on top of a car and the car was driven at speeds up to 90 km/hr along prearranged routes in each country.
  • the plastic dishes containing the leaf pieces were placed in the base of the spore trap column to allow airborne spores entering the trap to settle onto the leaves. Dishes were changed approximately every 80 km. Once a batch of leaf pieces had been used in the spore trap, they were transferred to square petri dishes (lOc ⁇ r) containing 60ml 1.8% water agar and filter paper and stored at 5°C.
  • graminis were incubated for 7 days after which time sporulation was sufficient to inoculate a phenotypic resistance assay. Single spore isolates were incubated for 7 days but subcultured one further time to provide enough material for testing. If sporulation was poor the above process was repeated until good (60-70%) sporulating disease coverage was obtained on all leaf pieces in order to generate sufficient conidia for assay. Testing and subsequent maintenance of resistant isolates was carried out on detached wheat seedling leaves treated 24 hours prior to inoculation with an aqueous solution of strobilurin analogue at 5ppm (a rate known to give 100% control of strobilurin sensitive baseline isolates) and Tween 20 wetting agent. Isolates were tested either as mass populations or single pustule isolates. Conidia were dry-inoculated onto treated leaf pieces. Infected material was incubated in a controlled environment (as described above) for 7 days prior to assessment.
  • Partial E. graminis f.sp. tritici cytochrome b gene sequence was amplified using primers based on conserved regions of Aspergillus niger and Neurospora crassa cytochrome b genes (Cytb3F (5 ' C AGCTTC AGCTTTCTTCT 3 ' ) (S ⁇ Q ID NO 122) and Cytb9R (5 '
  • ACTTAAAGGTCTAAATTG 3' (S ⁇ Q ID NO 122) which delineate the sequence encoding amino acid region 86 to 322 of fungal cytochrome b based on the S. cerevisiae numbering system).
  • Approximately 500mg conidia from a strobilurin analogue-sensitive isolate that had had no exposure to strobilurin analogue selection were collected by tapping directly off leaves with sporulating disease into 1.5ml Eppendorf tubes. DNA was extracted from this conidial sample using a phenol/chloroform extraction protocol (see above).
  • DNA presence and quality was analysed by gel electrophoresis and a serial dilution (1 : 10, 1 : 100 and 1 : 1000) was made in ddH O for use as template material in PCRs.
  • PCRs were set up as recommended by the manufacturer of the Taq Polymerase enzyme (Gibco) in a final volume of lOO ⁇ l and primers were added to the reactions to a final concentration of lpmole/ ⁇ l.
  • lO ⁇ l of each DNA dilution was added to the appropriate PCRs. Rigorous procedures were undertaken in order to limit the risk of PCR contamination. 30 cycles of 94°C for 45 sec, 42°C for 45 sec and 72°C for 1 min 30 sec were carried out in a Hybaid Omn-E instrument.
  • graminis specific primers designed on the basis of the novel sequence were used in later amplifications of the cytochrome b region of interest. These were ⁇ RY1 IF (5' ATGAACAATTGGTACAGTAAT 3') (S ⁇ Q ID NO 124) and ⁇ RY12R (5' GTTAGGTATAGATCTTAATAT 3') (SEQ ID NO 125). Together they delineate the sequence encoding amino acids region 114-287 of fungal cytochrome b according to the S. cerevisiae coding system.
  • Partial cytochrome b sequence was amplified with ERY1 IF and ERY12R primers from an E. graminis f.sp. tritici strobilurin analogue-resistant population.
  • Conidia ⁇ 200mg
  • Conidia ⁇ 200mg
  • ddH 2 O diluted 1 : 10, 1 : 100 and 1 : 1000 in ddH 2 O.
  • lO ⁇ l of each conidial dilution was added to a Ready.
  • To.GoTM Taq polymerase PCR bead (Amersham Pharmacia Biotech product number 27-9555-01) and made up to 25 ⁇ l with ERY1 IF and ERY12R primer solutions so that the final primer concentration was lpmole/ ⁇ l.
  • Partial cytochrome b gene sequence was also characterised from two E. graminis f.sp. hordei isolates. Small samples of conidia (-lOOmg) were tapped off infected barley leaves (which were prepared as previously described for the wheat) into sterile Eppendorf tubes. These conidial samples were kept at -80°C until needed. Each sample was then resuspended in 200 ⁇ l ddH 2 0, further diluted 1 : 10 and 1 :100, and lO ⁇ l of each dilution was used as templates for amplification. Partial cytochrome b gene sequences were amplified with ERY1 IF and ERY12R primers. The PCR conditions and components were as described previously.
  • graminis primers were designed on the basis of the above information on the G ⁇ 4 A point mutation: a forward ARMS primer based on the wild type sequence: G-sp- 1 : CCATACGGGCAGATG AGCCACTGGAG (SEQ ID NO 126) a forward ARMS primer based on the G] 43 A mutation: C-sp- 1 : CCATACGGGCAG ATGAGCCACTGGAC (SEQ ID NO 127) and a control primer designed upstream from the point mutation: STAND2 : GCC ATACGGGCAG ATGAGCCACTG (SEQ ID NO 128) In both the G-sp-1 and the C-sp-1 primers, the -1 base (the 3'end base) corresponds to the second nucleotide of the G ⁇ 4 /A
  • Bases in the primers that differ from the wild type cytochrome b E. graminis sequence are in bold.
  • the -2 position was changed from a G to a A base. This was done to destabilise the primer, as is normal in ARMS reactions.
  • the Sco ⁇ ionTM product detection system was used in this case as a detection mechanism. Again the Sco ⁇ ion primer was designed using Oligo 5 and the MFold (see details in Examplel) programs.
  • the sequence of the E. graminis Scorpion primer was: 5' FAM-CCCGCCGTTTTAGCTGCTTTAGCTTTAATGCGGCGGG (SEQ ID NO 129) MR-REG-AACACCTAAAGGATTACCAGATCCTGCAC 3' (SEQ ID NO 130) Underlined regions are the hai ⁇ in forming parts, FAM is the fluorescein dye, MR is a non- fluorogenic quencher attached to a uracil residue and HEG is the replication blocking hexethylene glycol monomer. The sequence in italics is the reverse primer sequence and the sequence in bold is the Sco ⁇ ion sequence which anneals to the extension product of the reverse primer.
  • primers were synthesised by Oswel DNA service. Before use, the primers were diluted to 5 ⁇ M in a total volume of 500 ⁇ l each. They were then further diluted to a final concentration of 500nM in the PCRs.
  • Primers were first validated for use in ARMS/Sco ⁇ ion analyses by using plasmid DNA and total DNA as templates. This was performed in order to check the specificity and sensitivity of the primer designs. DNA fragments comprising partial wild type cytochrome b gene sequence and the corresponding sequence containing the G ⁇ 4 A mutation were cloned in the TA pCR2.1 vector to be used in this validation process. Plasmid DNA was always diluted in lmg/ml BSA prior to use as template in real time PCR assays. Fungal DNA for analysis was extracted from an E. graminis f.sp. tritici strobilurin analogue-sensitive control isolate using a phenol/chloroform extraction method (as described previously).
  • a conidial E. graminis f.sp. tritici sample from a French strobilurin analogue-sensitive isolate (F12C) and a conidial E. graminis f.sp. tritici sample from a German strobilurin analogue-resistant isolate (11-8) were then tested using the validated primers at two conidial dilutions. All three fungal isolates originated from single pustules.
  • AmpliTaq Gold enzyme (Perkin-Elmer/ABI) was included in the reaction mix at lunit/25 ⁇ l reaction.
  • the reaction mix also contained lx buffer (lOmM Tris-HCl (pH8.3), 50mM KC1, 3.5 mM MgCl 2 , 0.01% gelatine), lOO ⁇ M dNTPs.
  • Amplifications were performed in an ABI Prism 7700 instrument for continuous fluorescence monitoring. A preliminary incubation of 95°C for lOminutes was performed followed by 50 cycles of 95°C for 15sec and 60°C for 45sec. Fluorescence was monitored during the annealing/extension stage throughout all cycles.
  • Control and G specific primer reactions emit a strong fluorescence signal whilst the C specific primer reaction does not show any increase in fluorescence.
  • the control and G-specific ARMS primers have recognised and bound to the template whilst the C-specific primer did not bind to the template present in the reaction.
  • the G ⁇ 43 :A )4 allele analysis is indicating only presence of the wild type allele.
  • Figure 3b illustrates PCRs where the French sensitive isolate (F12C) was analysed with the three primer mixes (Stand 2 + E. graminis Scorpion, G-sp-1 + E. graminis Scorpion and C-sp-1 + E. graminis Sco ⁇ ion).
  • F12C French sensitive isolate
  • the three primer mixes Stand 2 + E. graminis Scorpion, G-sp-1 + E. graminis Scorpion and C-sp-1 + E. graminis Sco ⁇ ion.
  • ⁇ 200mg conidia were suspended in 200 ⁇ l ddH 2 O and diluted 1 : 100 and 1 : 1000 in ddH 2 O. 5 ⁇ l of the dilutions was added to the appropriate PCRs.
  • the control and G-specific primer reactions emitted a strong signal whilst the C-specific primer reaction did not show any increase in fluorescence. This indicates that only the wild type allele has been detected in this sample.
  • Figure 4 illustrates PCRs where the German resistant isolate at two conidial dilutions was amplified using the three primer mixes (Stand 2 + E. graminis Sco ⁇ io, G-sp-1 + E. graminis Sco ⁇ io and C-sp-1 + E. graminis Sco ⁇ io).
  • control and C-specific primer reactions emit strong signals whilst the G-specific primer reaction does not show any fluorescence. This indicates that only the mutant G
  • EXAMPLE 3 In Example 3, we report the characterisation of partial cytochrome b Rhynchosporium secalis gene sequence and a real time PCR study where various R. secalis isolates were screened for the G
  • Partial cytochrome b gene sequence was obtained from two R. secalis isolates (Kl 124 and K3327). These isolates were grown from a suspension of 100,000 spores per ml inoculated in a medium with a non-fermentable carbon source shaking at 85 ⁇ m for 21 days at 19°C (12hrs light/12hrs dark) and the mycelia were collected by filtering through Miracloth and frozen at -20°C until required. DNA was produced from the mycelia by using a phenol/chloroform extraction protocol (see Example 1).
  • DNA yield and quality were checked by gel electrophoresis and then a serial stock dilution was made (1: 10, 1 :100 and 1: 1000 in ddH 2 O) for use as templates in PCR amplifications.
  • PCRs were set up as described in earlier examples.
  • the primers used were either degenerate primers (deg4F (5' AGGTYTRTA YTRYGGDTCWTA 3 ' ) (SEQ ID NO 131 ) and deg3R (5 '
  • AGCDATAACWCCTAATAATTT 3' (SEQ ID NO 132) designed from homologous regions of cytochrome b fungal genes (delineating the sequence encoding amino acid region 100-294 according to S. cerevisiae coding system) or E. graminis specific primers ⁇ RY1 IF and ⁇ RY12R (details as in Example 2).
  • a band of the expected size ( ⁇ 500bp) was amplified using both primer pairs from each isolate and each PCR product was cloned in the pCR2.1 TA vector (Invitrogen).
  • G-sp-3 CCTTATGG ACAGATGTCTTTATGAAG (SEQ ID NO 1 4) two forward ARMS primer based on the predicted G) 4 A mutation: C-sp-2: CCTTATGG ACAG ATGTCTTTATG ATC (SEQ ID NO 135)
  • C-sp-3 CCTTATGGACAGATGTCTTTATGAAC (SEQ ID NO 136) and a control primer designed upstream from the point mutation:
  • the Sco ⁇ ionTM product detection system was used in this case as a detection mechanism and the Sco ⁇ ion reverse primer was again designed using the Oligo 5 and the MFold programs (details as in Example 1).
  • the R. secalis Sco ⁇ ion primer sequence was: 5' FAM-CCCGCCATATTAGCTGCATTAGTATTAATGCGGCGGG (SEQ ID NO 138) - MR-B ⁇ G-TACACCTAAAGGATTACCTGACCCTGCAC 3'(SEQ ID NO 139) (See previous examples for details). All primers were synthesised by Oswel DNA Service. Before use, the primers were diluted to 5 ⁇ M in a total volume of 500 ⁇ l each. The primers were then further diluted to a final concentration of 500nM in the PCRs.
  • primers were first validated for use in ARMS/Sco ⁇ ion analyses by using plasmid DNA as template at various concentrations. This was performed in order to check the specificity and sensitivity of the primer designs. Partial wild type cytochrome b gene sequence and a corresponding sequence containing the G ⁇ 43 A mutation were cloned in the TA pCR2.1 vector to be used in this validation process. As this mutation has not yet been found in R. secalis DNA, the A
  • PCRs were set up using standard methods as previously described and 30 cycles of 94°C for 45 sec, 56°C for 45 sec and 72°C for 1 min 30 sec were performed on a Hybaid Omn-E instrument. An initial incubation of 3 minutes at 94°C and a final extension incubation of 10 minutes at 72°C were also included.
  • the ⁇ 370bp PCR product was cloned into the TA pCR2.1 vector and resulting clones were sequenced to check for any PCR induced errors prior to use in this experiment.
  • Figure 5b shows the highest concentration G (wild type (wt)) and C (mutant) cassette amplified with the G-sp-2 primer mix.
  • the G primer does not misprime off the C template until very late in the PCR even though the DNA template concentration is high ( ⁇ 10 8 molecules of template in reaction). The significant delay before the G mispriming event therefore demonstrates that the primer has a good window of specificity.
  • the C-sp-2 primer set also shows good specificity through the specific and non specific plasmid dilutions (figure 6a and 6b). G-sp-2 and C-sp-2 primer mixes were used in following experiments instead of G-sp-3 and C-sp-3 primer mixes.
  • the second part of this study was to compare using total (genomic) DNA and cDNA as template for the PCR.
  • Total DNA material was prepared from the R.secalis isolates using a phenol-chloroform extraction method (as described previously).
  • Total RNA was extracted from lOOmg of ground mycelia using the RNeasy Plant minikit (Qiagen catalogue No. 74903) according to the manufacturer's recommendation.
  • First strand cDNA synthesis was then undertaken with l ⁇ g of total RNA using RT PCR with the Advantage RT-PCR kit (Clontech catalogue No. K1402-1) according to the manufacturer's recommendation. Pools of total DNA and cDNA from three isolates (K3278, K3274 and K3276) were prepared.
  • the total DNA pool was used as template diluted 1 : 100, 1 : 1000 and 1 : 10000 and the cDNA was used as template neat and diluted 1 :5 and 1 : 10. In each case, 5 ⁇ l of template was added to the PCRs. Real time PCR conditions described in Example 1 and 2 were also used except that in this case 40 cycles PCR were performed instead of 50.
  • Figure 7a, b and c illustrate results obtained with total DNA and cDNA templates at three dilutions (dilution 1 : total DNA (1 :100) and cDNA (neat); dilution 2: total DNA (1 : 1000) and cDNA (1 :5); dilution 3: total DNA (1 : 10000) and cDNA (1: 10)) amplified using the G primer mix.
  • Figures 8a, b and c illustrate the total DNA and cDNA templates amplified using the C primer mix. Using total DNA instead of cDNA as template gave more sensitive results with earlier Cycle threshold values. In order to give the best chance of detecting any C mutation, total DNA inputs at dilutions of 1 : 10 and 1: 1000 were chosen for future analyses. No fluorescence changes could be detected when the C specific primer mix was used in this 40 cycles PCR indicating that only the wild type Gj 4 allele was found in these isolates.
  • Example 4 we report the characterisation of partial Pyrenophora teres cytochrome b gene sequence and a study where a G ⁇ 4 A resistance allele detection assay was carried out on a variety of P. teres isolates. This is a species where the G] 4 A mutation had not been identified previously.
  • This example is divided into two sections; one describing a real time PCR study using an intercalating dye detection method using cDNA preparations of P. teres isolates and the other describing a real time PCR study using a Sco ⁇ ion detection assay on genomic DNA preparations of P. teres isolates.
  • Real time PCR study using an intercalating dye one describing a real time PCR study using an intercalating dye detection method using cDNA preparations of P. teres isolates and the other describing a real time PCR study using a Sco ⁇ ion detection assay on genomic DNA preparations of P. teres isolates.
  • Wild type isolates of P. teres were collected from the UK and France during 1994, 1996 and 1998 (see Table 10 for P. teres isolate details). 1994 and 1996 isolates could be considered "baseline" (collected prior to use of strobilurin analogues in the field) and 1998 isolates were obtained from trial sites which had been exposed to several sprays of strobilurin analogues over a number of seasons. Infected barley leaves were hand picked and sent to Jealott's Hill Research Station (Zeneca Agrochemicals). Upon arrival in the laboratory, the leaves were incubated in a humid environment at 21° for 24-48 hours.
  • Partial cytochrome b sequence was identified from two isolates (K1056 and K1916).
  • the initial wild type sequence was obtained from a biological sample prepared by inoculating potato dextrose broth (see Table 9) with a macerated mycelial suspension. The flask was incubated at 85 ⁇ m on an orbital shaker under a 12 hours white light/12 hours no light regime at a constant temperature of 19°C for 21 days until there was sufficient mycelial material for the DNA extraction protocol. The mycelium was then harvested by filtering through Miracloth and was frozen at -20°C until needed. Total DNA was produced using the phenol/chloroform extraction protocol (see Example 1).
  • a specific P. teres primer (Pt2R: 5' CTT AC A TCT GTA ATA GGT AAT 3') (SEQ ID NO 140) was designed in the novel stretch of cytochrome b gene and was used with a forward primer that was designed on the basis of Venturia inaequalis cytochrome b gene sequence (Pt5F: 5' TGT TAC TTT AGC AAT GCA CTA 3') (SEQ ID NO 141) on P. teres cDNA template. cDNA was produced from mycelial samples of the two isolates.
  • RNA was extracted from lOOmg of ground mycelium using the RNeasy kit (Qiagen) according to the manufacturer's recommendation.
  • First strand cDNA synthesis was prepared from l ⁇ g of total RNA using RT PCR with the Advantage RT-PCR Clontech kit (according to the manufacturer's recommendation). 5 ⁇ l of the resulting cDNA was then used in PCRs. The PCR components and conditions were as described previously.
  • a ⁇ 800bp PCR product was amplified for both isolates (delineating the sequence encoding amino acid region 48 to 310 of fungal cytochrome b according to the S. cerevisiae numbering system).
  • teres primers were designed around the G i 3 A point mutation location: a forward ARMS primer based on the wild type sequence: G-sp-4: CCCTACGGGC AAATG AGCCTTTGAAG (SEQ ID NO 142) a forward ARMS primer based on the potential G ⁇ 4 A mutation: C-sp-5: CCCTACGGGCAAATGAGCCTTTGATC (SEQ ID NO 143) and a control primer designed upstream from the point mutation: STAND4: ACCCTACGGGC AAATG AGCCTTTG (SEQ ID NO 144) the reverse primer used was:
  • the -1 base corresponds to the second nucleotide of the G ⁇ 3 /A l4 codon.
  • Bases in the primers which differ from the wild type cytochrome b P. teres sequence are in bold.
  • the -2 position was changed from a G to an A or T base. This was done to destabilise the primer.
  • All primers were synthesised by Oswel DNA Service. Before use, the primers were diluted to 5 ⁇ M in a total volume of 500 ⁇ l ddH 2 O each. The primers were then further diluted to a final concentration of 500nM in the PCRs. In this case, an intercalating dye was used for detection of the PCR product.
  • the dye used was YO-PRO-1 dye (Molecular Probes, Seattle Washington, USA) which binds to double stranded DNA and emits fluorescence which is detectable by the ABI Prism 7700 instrument.
  • Primers were first validated by using plasmid DNA as template at various concentrations. This was done to check the specificity and sensitivity of the primer designs. Partial wild type P. teres cytochrome b gene sequence and a corresponding sequence containing the G
  • the plasmid DNA stocks were calculated to be approx. 2xl ⁇ " molecules per ⁇ l.
  • the two plasmids were diluted to 2xl0 7 , 10 s , 10 and 10 1 molecules/ ⁇ l and 5 ⁇ l were used of each dilution resulting in ⁇ lxlO 8 , 10 6 , 10 4 and 10 2 molecules of plasmid in the respective PCRs (see Example 1 for PCR conditions).
  • the only difference was that YO- PRO-1 dye was added to the reaction mix.
  • the generation of primer dimer product interfered with the signal past cycle 35. This method of detection is less sensitive than the Sco ⁇ ion detection system because it is more affected by background noise (e.g. fluorescence emission from primer dimer formation). Nevertheless, it was concluded that valuable information could be drawn from using this method but increased caution had to be taken in inte ⁇ reting results.
  • a diagnostic GHSA Scorpion assay was also designed based on the genomic organisation that was determined for the P. teres cytochrome b gene encoding the amino acid region of interest.
  • the intron/exon organisation around the base of interest was elucidated by carrying out PCR amplifications on genomic DNA preparations with a series of primers designed to the known coding sequence and to subsequently identified intron sequences.
  • Taq ExtenderTM PCR Additive and Perfect Match® PCR Enhancer (both from Strategene catalogue No. 600148 and 600129 respectively) were used as per manufacturer's instructions in the amplification of large PCR fragments using a variety of different primer combinations. After an initial 94°C incubation for 3 minutes, 30 cycles of 94°C for 45 sec, 52°C for 45 sec and 72°C for 3 minutes were carried out on a Hybaid Omn-E PCR instrument. A final 72°C incubation for 10 minutes was also included.
  • PT-G-1 and PT-C-5 provided the widest window of specificity. They were therefore chosen as the preferred primer pair for this assay.
  • Primer PT-C-5 has a Ct value of 16 on the correct template
  • PT-G-1 also has a Ct value of 16 on the correct template.
  • the PT-C-5 primer misprimes on the wrong template at cycle 34 giving a window of specificity of 18 cycles and the PT-G-1 primer misprimes at cycle 32 giving a window of specificity of 16 cycles equating to approximately 10 fold difference in the sensitivity of the two primers.
  • Table 12 ARMS primer validation The PT-G-1 and PT-C-5 ARMS primers were tested in a plasmid spiking experiment where the mutant plasmid was 'spiked' in a background of wild type plasmid at frequencies of 1:1, 1:10, 1:100, 1:1,000, 1:10,000 and 1:100,000, all in lmg/ml BSA. In all cases the total plasmid concentration of each frequency in the PCR assay was lxlO 7 molecules/reaction. Real time PCR conditions and components were as described previously. The resulting data is summarised in the table below:
  • the fluorescence detection is delayed. With each 10 fold dilution of the C plasmid, there is a delay of 4 cycles in the detection of fluorescence.
  • the PT-C-5 cycle threshold value on one mutant molecule in a background of 10,000 wild type molecules could be clearly seen but the 1 : 100,000 was not distinguishable as the PT-C-5 primer misprimes from the 100% wild type (G) cassette thus masking the lower C:G frequency. This indicates that the ARMS switch in this case will allow a frequency of ⁇ 1 : 10,000 to be detected with confidence.
  • the mycelia were then pelleted by centrifugation at 13,000 ⁇ m for 5 minutes. The supernatant was removed using a pipette and one of the mycelial pellets was used in the DNA extraction, the other was kept at -80°C until needed.
  • DNA extraction was carried out using the Qiagen DNeasy Plant Mini Kit protocol for isolation of DNA from plant tissue, as described in the manufacturer's protocol. The DNA was diluted 10-fold and 100- fold for use in the assay and 5 ⁇ l aliquots of DNA were used in each PCR assay. All isolates were tested with each primer pair (PT-C-5, PT-G-1 and the control primer; each with the common reverse primer containing the Sco ⁇ ion detection system) in triplicate and in two dilutions.
  • Example 5 we report the characterisation of partial cytochrome b Uncinula necator gene sequence.
  • U. necator is the causal agent of vine powdery mildew. Infected vine leaves and fruit were collected from trial sites and commercial vineyards in France and Italy during 1999 and sent to Jealott's Hill Research Station (Zeneca Agrochemicals). Following arrival in the laboratory, mycelium and spores were transferred using a small paintbrush to fresh surface-sterilised leaves detached from 6-7 leaf seedlings (var. Ohanez). U. necator from each collection site was treated as a separate population. On receipt in the laboratory the inoculated leaves were placed in a constant temperature room at 21°C and incubated for 2-3 weeks.
  • First strand cDNA synthesis was from l ⁇ g of total RNA using RT PCR with the Advantage RT-PCR Clontech kit (according to the manufacturer's recommendation). 5 ⁇ l of cDNA was used as template for PCR amplification using ERY 1 IF (5'ATGAACAATTGGTACAGTAAT 3') (SEQ ID NO 163) and ERY 4R (5' AAATCTGTTAAAGGCATAGCC 3') (SEQ ID NO 164) which delineate amino acids 1 14 to 309 of fungal cytochrome b based on the S. cerevisiae numbering system.
  • ERY 1 IF 5'ATGAACAATTGGTACAGTAAT 3'
  • ERY 4R 5' AAATCTGTTAAAGGCATAGCC 3'
  • a DNA fragment of the expected size ( ⁇ 500bp) was amplified and the PCR product was cloned in the pCR2.1 TA vector (Invitrogen) according to manufacturer's recommendations. Wizard minipreps were carried out to identify clones with suitable inserts and 5 clones were submitted for sequencing using the M13 forward and reverse primers.
  • a novel cytochrome b gene sequence had been identified which was closely related to other ascomycete cytochrome b sequences.
  • Primer combinations 2F (5' GTT TTA CCC TAC GGG CAG ATG3') (SEQ ID NO 165) -5R( 5' AAA GAA TCT GTT TAA GGT TGC 3') (SEQ ID NO 166), 2F6R (5' AAA CCA CCT CAA AGA AAC TCC 3') (SEQ ID NO 167) and 4F (5' CAT GAA TAG GAC AAG ATA TCG 3') (SEQ ID NO 168) -6R successfully amplified PCR products ranging from 1.6kb to 3kb in length. These PCR products were cloned in the TA pCR2.1 vector (Invitrogen) and subsequent clones were used for sequencing as described previously.
  • a primer walking strategy was followed for one clone corresponding to each of the different PCR products and the sequence analysis of these three clones showed the presence of two introns (l. ⁇ kb and 1.1 kb in length) within the PCR fragments.
  • the second base of the G) 4 codon is lObp upstream of an intron splicing site.
  • a 41 nucleotide tract encoding 10 bases upstream and 30 bases downstream of the second base of the G ⁇ 43 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.
  • EXAMPLE 6 In example 6 we report the characterisation of partial Sphaerotheca fuliginea cytochrome b gene sequence and a single nucleotide polymo ⁇ hism that gives rise to resistance to strobilurin analogues and compounds in the same cross resistance group. S. fuliginea is the causal agent for cucurbit powdery mildew.
  • S. fuliginea infected cucumber and melon leaves were collected from the field and conidia were dry inoculated in the laboratory to fresh leaf material (cucumber and melon) using a small paintbrush.
  • Monoconidial isolates were subcultured and tested in planta by 24 hour preventative discriminating dose assay (up to lOOppm doses, known to give a 100% control of wild type strains).
  • Conidia from candidate resistant isolates were removed by aspiration by vacuum pump into a suitable container. Part of this sample was analysed using PCR analysis and the remainder was re-tested to confirm phenotypic resistance.
  • RT-PCR strategy was followed (as described in Example 3) on a -lOOmg conidial strobilurin analogue sensitive sample.
  • the resulting cDNA was used as template in a PCR amplification reaction using primers Ery2F (5' TCACCTAGAACATTAACATGA 169) 3'(SEQ ID NO) and 4R (5' AAATCTGTTAAAGGCATAGCC 3 '(SEQ ID NO 170)) which delineate amino acids 108 to 309 of fungal cytochrome b based on the S. cerevisiae numbering system.
  • Other PCR components and conditions were as described previously.
  • a PCR product of the expected size ( ⁇ 600bp) was found during gel electrophoresis analysis of the PCR products and this product was then cloned in the TA pCR2.1 vector (Invitrogen) and 5 clones with correct size inserts ( ⁇ 600bp) were sequenced using M13 forward and reverse primers as described previously.
  • TA pCR2.1 vector Invitrogen
  • 5 clones with correct size inserts ( ⁇ 600bp) were sequenced using M13 forward and reverse primers as described previously.
  • Specific Sphaerotheca fuliginea PCR primers were then designed for the amplification of the G ⁇ 4 region from genomic DNA.
  • Primer pairs SF1 (5' TTCCCTTCGGTCAAATGTCGC 3') (SEQ ID NO 171) - SF8 (5' AAACCCCCTCAGAGAAACTCC 3') (SEQ ID NO 172) and SF1 - SF10 (5' GACCCCGCGCTATCATGTAAG 3') (SEQ ID NO 173) were used in PCR amplifications using spore samples resuspended in ddH 0 as template.
  • the PCR components and conditions were as described in previous examples.
  • the PCR products were analysed by gel electrophoresis and a ⁇ 2kb product was found with the SF1/8 primer pair and a ⁇ 2.1kb band was found with the SF1/10 primer pair.
  • Partial cytochrome b gene sequence was also amplified from conidial strobilurin analogue resistant samples. Conidial samples ( ⁇ 50mg) were resuspended in 200 ⁇ l ddH 0 and diluted 1 :10, 1: 100 in ddH 2 0. lO ⁇ l of each dilution was used as template for PCR amplification using the SF1/SF8 specific S. fuliginea primers. Taq ExtenderTM PCR Additive and Perfect Match® PCR Enhancer (both from Strategene) were used (as per manufacturer's instructions) in the amplification of this large PCR fragment.
  • M. fijiensis is the causal agent of black sigatoka disease on banana.
  • Infected banana leaves were collected from the field and ascospores inoculated from leaves directly onto artificial media in a petri dish. Monoascosporic isolates were maintained on artificial media and prepared for PCR analysis by shake flask culture in a broth medium. Mycelia were collected through Micracloth and ground to a fine powder using an acid washed and autoclaved sterile pestle and mortar. lOOmg of ground mycelia were used in a genomic DNA extraction and in a first strand cDNA synthesis (as described in previous examples). The genomic DNA was diluted 1 : 10, 1 : 100 and 1 : 1000 in ddH O prior to use as PCR template.
  • M. graminicola is the causal agent of leaf blotch on wheat.
  • Infected wheat leaves were collected from the field and incubated in a humid environment to promote spore production. Cirri were removed from leaves and spread onto Czapek Dox V8 agar plates (see Table 9) and incubated in a controlled environment at 19°C for 6 days. Single colony isolates were further subcultured and bulked up by shake flask culture in a suitable medium. Fungal material was removed and maintained at -80°C until needed.
  • a genomic DNA preparation was carried out as described in Example 1 on 200mg of ground mycelia. The genomic DNA yield and quality was checked by gel electrophoresis and diluted 1: 10 and 1 : 100 in ddH 2 0.
  • a 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the G) 43 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.
  • EXAMPLE 10 In example 10 we report the characterisation of partial Colletotrichum graminicola cytochrome b gene sequence. C. graminicola is the causal agent of cereal and grass anthracnose.
  • Infected leaf material (turf or moss) was collected from the field and the fungal material removed and subcultured on artificial media. Fungal material was bulked up by shake flask culture, harvested and kept at -80°C until needed.
  • a genomic DNA preparation was carried out as described in Example 1 on 200mg of ground mycelia. The genomic DNA yield and quality was assessed by gel electrophoresis and dilutions of 1 : 10 and 1 : 100 in ddH 2 0 were prepared. lO ⁇ l of each dilution was used as template for PCR amplification using primers deg4F and deg3R (details in Example 3). PCR components and conditions were are described in Example 3.
  • example 1 1 we report the characterisation of partial Colletotrichum gloeosporioides cytochrome b gene sequence.
  • C. gloeosporioides is the causal agent of fruit anthracnose (e.g. pepper, avocado and mango).
  • Infected plant material (mango or chilli) was collected from the field and fungal material was removed and subcultured on artificial media.
  • the mycelia were ground using an acid washed sterile pestle and mortar and lOOmg was used in a genomic DNA preparation and a first strand cDNA synthesis (procedures as described in previous examples).
  • lO ⁇ l of each genomic dilutions and 5 ⁇ l neat cDNA was used as template for PCR amplification using primers deg4F and deg3R (primer details in Example 3). PCR components and conditions were as described in previous Examples.
  • the PCR products were analysed by gel electrophoresis and bands of the expected size were found ( ⁇ 500bp).
  • the PCR product was the same size when using genomic DNA or cDNA as template which indicates the lack of introns in the DNA region amplified.
  • the PCR products were cloned in TA pCR2.1 vector and 5 clones containing correct size inserts for each cloning event were sequenced as described in previous Examples.
  • the sequencing data was analysed using the relevant bioinformatics software, the PCR products were found to be identical in all cases and to encode a novel cytochrome b gene sequence with close homology to other ascomycete sequences.
  • a 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the G ⁇ 4 codon can be found in Table 3.
  • EXAMPLE 12 A 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the G ⁇ 4 codon (according to the S. cere
  • O. lycopersicwn is a causal agent for tomato powdery mildew.
  • Diseased tomato leaves were collected from the field and conidia subcultured to fresh leaf material by dry inoculation in a settling tower. Conidia growing from the resulting infection were removed by aspiration by vacuum pump into a sterile Eppendorf tube and kept in at -80°C until needed.
  • a first strand cDNA synthesis was carried out on RNA isolated from lOOmg of spores as described previously and 5 ⁇ l of this cDNA was used for PCR amplification using primers Ery2-4 (details in example 6).
  • PCR components and conditions were as described previously.
  • a PCR product was found at the expected size ( ⁇ 500bp).
  • This PCR product was cloned and 5 clones containing the correct size insert ( ⁇ 500bp) were sequenced as described previously.
  • the PCR fragment encodes a novel cytochrome b gene sequence which was closely related to other ascomycete cytochrome b sequences.
  • a 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the G ⁇ 4 codon can be found in Table 3.
  • EXAMPLE 13 In example 13 we report the characterisation of partial Leveillula taurica cytochrome b gene sequence. L. taurica is a causal agent for tomato powdery mildew.
  • a first strand cDNA synthesis was carried out on RNA isolated from lOOmg of spores or diseased plant material as described previously. When diseased plant material was used as starting material, fungal lesions were enriched by removing non-diseased plant tissue from the preparation. 5 ⁇ l cDNA aliquots were used for PCR amplification using primers Eryl 1-12 (details in example 2). PCR components and conditions were as described previously. When the PCR products were analysed by gel electrophoresis, a PCR product was found at the expected size ( ⁇ 500bp). This PCR product was cloned and 5 clones containing the correct size insert ( ⁇ 500bp) were sequenced as described previously.
  • A. solani is the causal agent for early blight in tomato and potato.
  • Infected leaf material tomato or potato
  • Fungal samples were bulked up in shake flask culture.
  • Culture collection isolates had been stored in liquid nitrogen and periodically subcultured on artificial media or subcultured through live host material before re-storing at - 80°C.
  • Mycelia grown in a shake flask were ground using an acid washed sterile pestle and mortar and lOOmg was used in a genomic DNA preparation and a first strand cDNA synthesis (procedures as described in previous examples).
  • lO ⁇ l of each genomic dilutions and 5 ⁇ l neat cDNA was used as template for PCR amplification using primers deg4F and deg3R (details in Example 3).
  • PCR components and conditions were as described in Example 3.
  • the PCR products were analysed by gel electrophoresis and bands of the expected size were found ( ⁇ 500bp).
  • the PCR product was the same size when using genomic DNA or cDNA as template which indicates the lack of introns in the DNA region amplified.
  • the PCR products were cloned in TA pCR2.1 vector and 5 clones containing correct size inserts for each cloning event were sequenced as described before.
  • Infected leaf material (peanut) was collected from the field and the fungal material removed and subcultured on artificial media. Cultures were stored in liquid nitrogen until required. Material was removed from storage onto agar and resulting colonies bulked up in shake flask culture and kept at -80°C until needed. Mycelia were ground using an acid washed sterile pestle and mortar and lOOmg was used in a genomic DNA preparation and a first strand cDNA synthesis (procedures as described in previous examples). lO ⁇ l of each genomic dilutions and 5 ⁇ l neat cDNA were used as template for PCR amplification using primers deg4F and deg3R (details in Example 3). PCR components and conditions were are described in Example 3.
  • PCR products were analysed by gel electrophoresis and bands of the expected size were found ( ⁇ 500bp). Again the PCR product was the same size when using genomic DNA or cDNA as template which indicates the lack of introns in the DNA region amplified.
  • the PCR products were cloned in TA pCR2.1 vector and 5 clones containing correct size inserts for each cloning event were sequenced as described before. When the sequencing data was analysed using the relevant bioinformatics software, the PCR products were was found to be identical in all cases and to encode a novel cytochrome b gene sequence which showed close homology to other cytochrome b gene sequences.
  • a 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the G ⁇ 4 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.
  • EXAMPLE 16 In example 16 we report the characterisation of partial Rhizoctonia solani cytochrome b gene sequence. R. solani is the causal agent of root stem rot or damping off.
  • Infected leaf material (rice) was collected from the field and the fungal material removed and subcultured on artificial media. Cultures were stored in liquid nitrogen until required. Material was removed from storage onto agar and resulting colonies bulked up in shake flask culture and kept at -80°C until needed.
  • a first strand cDNA synthesis was carried out on RNA isolated from lOOmg of ground mycelia as described previously and 5 ⁇ l was used for PCR amplification using basidiomycete degenerate primers IF (5' WYTRGTAYTAATGATGGCTATHGG 3') (SEQ ID NO 174) and IR (5' TCTTARWATWGCATAGAAWGG) 3' (SEQ ID NO 175) which delineate amino acids 121 to 283 of fungal cytochrome b according to the S. cerevisae numbering system.
  • basidiomycete degenerate primers IF
  • IR 5' TCTTARWATWGCATAGAAWGG
  • PCR components and conditions were as described previously. When the PCR products were analysed by gel electrophoresis, a PCR product was found at the expected size ( ⁇ 500bp).
  • This PCR product was cloned and 5 clones containing the correct size insert ( ⁇ 500bp) were sequenced as described previously.
  • the sequencing data was analysed using the relevant bioinformatics software, the PCR product was found to encode a novel cytochrome b gene sequence which showed close homology to other basidiomycete sequences.
  • a 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the G ⁇ 43 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.
  • EXAMPLE 17 In example 17 we report the characterisation of partial Pythium aphanidermatum cytochrome b gene sequence. P. aphanidermatum is the causal agent of damping off.
  • Infected leaf material (turf) was collected from the field and the fungal material removed and subcultured on artificial media. Cultures were stored in liquid nitrogen until required. Material was removed from storage onto agar and resulting colonies bulked up in shake flask culture and kept at -80°C until needed.
  • a genomic DNA preparation was carried out as described in Example 1 on 200mg of ground mycelia. The genomic DNA yield was analysed by gel electrophoresis and stocks were diluted 1:10 and 1 : 100 in ddH 2 0. lO ⁇ l of each dilution was used as template for PCR amplification using primers PLAS17F and PLAS 15R (details in Example 1). PCR components and conditions were are described in
  • Example 1 The PCR products were analysed by gel electrophoresis and a band of the correct size was found ( ⁇ 500bp). This PCR product was cloned in TA Invitrogen pCR2.1 vector and 5 clones containing correct size inserts were sequenced as described before. When the sequencing data was analysed using the relevant bioinformatics software, the PCR fragment was found to encode a novel cytochrome b gene sequence which showed close homology to other oomycete sequences. A 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the G
  • Infected banana leaves were collected from the field and ascospores inoculated from leaves directly onto artificial media in a petri dish. Monoascosporic isolates were maintained on artificial media and prepared for PCR analysis by shake flask culture in a broth medium. Mycelia were collected through Miracloth and ground to a fine powder using an acid washed sterile pestle and mortar. lOOmg of ground mycelia were used in a genomic DNA extraction and in a first strand cDNA synthesis (as described in Example 7). The genomic DNA was diluted 1:10, 1:100 and 1:1000 in ddH 2 O prior to use as PCR template.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biomedical Technology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses methods which are particularly sensitive for detecting low frequencies of mutations in mitochondrially encoded genes, such as the cytochrome b gene, making these an especially useful and commercially important way of screening plant pathogenic fungi for the onset of fungicidal resistance wherein the resistance is due to a mutation in a mitochondrially encoded gene. The methods disclosed include single nucleotide polymorphism detection techniques especially PCR detection methods. Also disclosed are DNA sequences encoding part of the wild type and mutant cytochrome b sequences of a range of plant pathogenic fungi and the use of the sequence information to detect mutations giving rise to fungicidal resistance. Allele specific oligonucleotides and oligonucleotide probes, diagnostic primers and diagnostic kits are also disclosed.

Description

METHODS
Field of the Invention
This invention relates to a diagnostic method for the detection of a cytochrome b mutation in fungi that leads to resistance to strobilurin analogues or compounds in the same cross resistance group using any (or a) single nucleotide polymorphism detection technique, preferably using the amplification refractory mutation system (ARMS). The invention also relates to mutation specific primers for use in the method and to diagnostic kits containing these primers. The invention further relates to the identification of a specific mutation in the fungal cytochrome b gene which results in the resistance of fungi containing the said mutation to strobilurin analogues or compounds in the same cross resistance group. Background of the Invention
The widespread use of fungicides in agriculture is a relatively recent phenomenon, and most of the major developments have taken place during the last 40 years. Previously, farmers often ignored or did not recognise the effect that fungal pathogens had on the yield and quality of their crops. Nowadays, however, these losses are unacceptable, and farmers rely on the use of fungicidal chemicals to control fungal diseases. As a consequence, commercial fungicides have become an important component of the total agrochemical business, with world-wide sales in 1996 of about $5.9 billion, equivalent to 18.9% of the total agrochemical market (Wood Mackenzie, 1997a 'Agchem products- The key agrochemical product groups', in Agrochemical Service, Update of the Products Section, May 1997, 1-74). A large number of fungicides are already available to the farmer; a recent edition of The Pesticide Manual (Tomlin, 1994 10lh Edition, British Crop Protection Council, Farnham, UK, and the Royal Society of Chemistry, Cambridge, UK) contains 158 different fungicidal active ingredients in current use. Nevertheless, further industrial research aimed at the discovery and development of new compounds is extremely intensive and product management procedures are extremely important in securing the best and longest lasting performance from fungicides with a particular mode of action and/or belonging to a particular compound series. In particular it is vital to develop effective resistance management strategies when fungicides with new modes of action are introduced (Fungicide Resistance Management : Into The Next Millenium (Russell) 1999, in Pesticide Outlook, October 1999 (213-215). The strobilurin analogues constitute a major new series of agricultural fungicides which are considered the most exciting development on the agricultural fungicide scene since the discovery of the 1 ,2,4-triazoles in the 1970s.
The fungicidal activity of the strobilurin analogues is a result of their ability to inhibit mitochondrial respiration in fungi. More specifically, it has been established that these compounds have a novel single site mode of action, exerting their effect on fungi by blocking the ubiquinokcytochrome c oxidoreductase complex (cytochrome bcl) thus reducing the generation of energy rich ATP in the fungal cell (Becker et al FEBS Letts. 132 329-33). This family of inhibitors prevents electron transfer at the ubiquinone redox site Q0 on the multimeric cytochrome b protein (Esposti et al 1993 Biochim. et Biophys Acta 243-271 ). Unlike many mitochondrial proteins, the cytochrome b protein is mitochondrially encoded. Reports in the literature show that specific amino acid changes at the cytochrome b target site can affect the activity of strobilurin analogues. In depth mutagenesis studies in Saccharomyces cerevisiae (hereinafter referred to as S. cerevisiae) (JP Rago et al 1989 J. Biol. Chem. 264, 14543-14548), mouse (Howell et al 1988 J. Mol. Biol. 203, 607-618),
Chlamydomonas reinhardtii (Bennoun et al 1991 Genetics 127, 335-343) and Rhodobacter spp (Daldal et al 1989 EMBO J. 3951-3961 ) have been carried out. Relevant information was also gathered from studying the natural basis for resistance to strobilurin analogues in the sea urchin Paracentrotus lividus (Esposti et al 1990 FEBS 263, 245-247) and the Basidiomycete fungi Mycena galopoda and Strobilurus tenaceUus (Kraiczy et al 1996 Eur. J. Biochem. 235, 54-63), both of which produce natural variants of the strobilurin analogues. There are two distinct regions of the cytochrome b gene where amino acid changes have a dramatic effect on strobilurin analogue activity. These areas cover amino acid residues 125-148 and 250-295 (based on S. cerevisiae residue numbering system). More precisely amino acid changes at residues 126, 129, 132, 133, 137, 142, 143, 147, 148, 256, 275 and 295 have been shown to give rise to resistance to strobilurin analogues (Brasseur et al 1996 Biochim. Biophys. Acta 1275, 61-69 and Esposti et al (1993) Biochimica et Biophysica Acta, 1 143, 243-271).
The present invention identifies for the first time the key importance of one of these mutations in cytochrome b gene of field isolates of important plant pathogenic fungi showing resistance to a strobilurin analogue or a compound in the same cross resistance group. Summary of the Invention According to a first aspect of the invention we provide a method foi detecting a mutation in fungal nucleic acid wheiein the piesence of said mutation gives rise to fungal lesistance to a stiobiluπn analogue 01 any othei compound in the same cross resistance group said method comprising identifying the piesence or absence of said mutation in fungal nucleic acid using any (or a) single nucleotide polymoφhism detection technique
In the present invention we have now devised novel diagnostic methods foi the detection of a poim mutation in a fungal cytochrome b gene based on single nucleotide polymoiphism detection methods including allele speciiic amplification It will be apparent to the person skilled in the art that theie aie a laige numbei of analytical proceduies which may be used to detect the piesence oi absence of variant nucleotides at one oi moie polymoiphic positions accoiding to the invention In genei al, the detection ol allelic variation requnes a mutation discrimination technique, optionally an amplification reaction and optionally a signal geneiation system Many current methods foi the detection of allelic variation aie reviewed by Nollau et al, Chn Chem 43, 1 1 14-1 120, 1997 and in standard textbooks, for example 'Laboiatoiy Protocols for Mutation Detection', Ed, bu U Landegren, Oxford University Press, 1996 and 'PCR' 2nd Edition by Mewton and Graham, BIOS Scientific Publishers limited, 1997 Allele specific amplification leactions include primer based methods including PCR based methods and moie specifically, allele specific polymerase chain reaction (PCR) extension (ASPCR) and specifically ARMS (Amplification Refractoiy Mutagenesis System) wheiein the mutation gives use to lesistance to a stiobiluπn analogue and these are particulaily pielerred foi use in the methods of the present invention The methods of the invention also include indiscriminate PCRs followed by specific probing of the amplicon generated These methods are suitable foi the detection of the specific alleles which can confer resistance to any of the stiobiluπn analogues or any other compound in the same cioss lesistance group Robust tests have been developed for the detection of this point mutation in a range of fungal plant pathogens Compounds may be considered to be in the same cross lesistance group when the resistance mechanism to one compound also confers resistance to anothei, even when the modes of action are not the same The technique of ASPCR is described in US Patent No 563961 1 and the ARMS technique is described fully in European Patent No EP 332435
Other single polymorphism detection techniques which may be used to detect mutations include, for example, lestπction fragment length polymoφhism (RFLP), single strand conformation polymorphism, multiple clonal analysis, allele-specific oligonucleotide hybridisation, single nucleotide primer extension (Juvonen et al, (1994) Hum Genet 93 16- 20; Huoponen et al, (1994) Hum Mutat 3 29-36; Mashima et al (1995), Invest Opthelmol. Vision. Sci 36,1714-20; Howell et al (1994) Am J Hum Genet. 55 203-206; Koyabashi et al; (1994) Am. J. Hum. Genet. 55 206-209; Johns and Neufeld (1993) Am J Hum Genet 53 916- 920; Chomyn et al, (1992) Proc. Natl. Acad. Sci USA 89 4221 -4225) and Invader ™ technology ( available from Third Wave Technologies Inc. 502 South Rosa Road, Madison, WI 53719 USA).
The use of PCR based detection systems is preferred. According to a preferred embodiment of the first aspect of the invention we provide a method for detecting a mutation in fungal nucleic acid wherein the presence of said mutation gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising detecting the presence of an amplicon generated during a PCR reaction wherein said PCR reaction comprises contacting a test sample comprising fungal nucleic acid with a primer in the presence of appropriate nucleotide triphosphates and an agent for polymerisation wherein the detection of said amplicon is directly related to presence or absence of said mutation in said nucleic acid. The detection of the amplicon generated during the PCR reaction may be directly dependent on the extension of a primer specific for the presence of the mutation i.e. where primer extension is dependent on the presence of the mutation and hence an amplicon is generated only when the primer binds and/or is extended when the mutation is present (as is the case with ARMS technology), similarly it may be directly dependent on the extension of a primer specific for the absence of the mutation e.g. wild type sequence or may be directly linked to the PCR extension product containing the mutant DNA sequence i.e. where the detection is of an amplicon comprising the mutant DNA sequence. The first alternative is particularly preferred.
The amplicon can be from any PCR cycle and this includes a first allele specific primer extension product.
In a further preferred embodiment the invention provides a method for detecting a mutation in fungal nucleic acid wherein the presence of said mutation gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group which method comprises contacting a test sample comprising fungal nucleic acid with an appropriate diagnostic primer in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended either when the said mutation is present in the sample or when wild type sequence is present; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product.
In a further preferred embodiment the invention provides a method for detecting a mutation in fungal nucleic acid wherein the presence of said mutation gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group which method comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the specific mutation in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product. According to a particularly preferred embodiment of the first aspect of the invention we provide a method for detecting a mutation in fungal nucleic acid wherein the presence of said mutation gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group which method comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the specific mutation in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended only when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product.
As used herein the term diagnostic primer is used to indicate the primer which is used specifically to identify the presence or absence of a mutation or wild type sequence and the term common primer is used to denote a primer binding to the opposite strand of DNA to the diagnostic primer and 3' to the region recognised by that diagnostic primer and which, by acting with said diagnostic primer allows amplification of the intervening tract of DNA during the PCR. Where the diagnostic primer is an ARMS primer it can have a 3' mismatch when compared to the mutant or wild type sequence.
In this and all further aspects and embodiments of the invention it is preferred that the extension of the primer extension product is detected using a detection system which is an integral part of either the diagnostic primer or the common primer on the opposite strand. This is described more fully herein.
The methods of the invention are particularly suitable for the detection of mutations in a mitochondrial gene which encodes a protein which is a target for a fungicide, more especially for the detection of mutations in a fungal cytochrome b gene where said mutations result in the inhibition of fungicide activity to the cytochrome b protein but still allow ATP generation to occur and most preferably wherein said mutation in the fungal cytochrome b gene results in one of the following amino acid substitutions: Aι26T, F129L, Yπ C, Ci 33Y, Gn7R/S/E/V, W,42T/K, G,43A, I147F, T,48M, N2,6Y/K/I, L27,F/S/T or L29sF where the first amino acid is substituted by the second one at the position in the sequence denoted by the number, the presence of which give rise to fungal resistance 10 strobilurin analogues or any other compound in the same cross resistance group wherein the residue identification is based on the S. cerevisiae residue numbering system for cytochrome b.
The strobilurin analogues and compounds in the same cross resistance group include for example, azoxystrobin, picoxystrobin, kresoxim-methyl, trifloxystrobin, famoxadone and fenamidone.
We have found that the position in the fungal cytochrome b nucleic acid corresponding to the 143rc codon/amino acid in the cytochrome b of 5. cerevisiae sequence is a key determinant of fungal resistance to strobilurin analogues or any other compound in the same cross resistance group in field isolates of strobilurin analogue resistant plant pathogenic fungi. The methods of the invention described herein are particularly suitable for the detection of a mutation at the position corresponding to Saccharomyces cerevisiae cytochrome b residue 143 where the glycine residue is replaced by another amino acid which inhibits the activity of strobilurin analogues or any other compound in the same cross resistance group and results in a resistant phenotype in the fungi carrying the mutant cytochrome b gene thereby giving rise to fungal resistance to strobilurin analogues or any other compound in the same cross resistance group.
The method is preferably used for the detection of a mutation resulting in the replacement of said glycine residue at the position corresponding to S. cerevisiae cytochrome b residue 143 with an amino acid selected from the group arginine, serine, cysteine, valine, aspartic acid, glutamic acid, tryptophan and most preferably alanine. In a yet further preferred embodiment of the first aspect of the invention we now provide a method for the detection of a mutation in a fungal cytochrome b gene resulting in a glycine to alanine replacement at the position corresponding to S. cerevisiae cytochrome b residue 143 (Gι A) in the encoded protein thereby giving rise to fungal resistance to strobilurin analogues or any other compound in the same cross resistance group said method comprising identifying the presence or absence of said mutation in fungal nucleic acid using any (or a) single nucleotide polymoφhism detection technique.
The mutation in the fungal cytochrome b gene resulting in a G|4 A replacement in the encoded protein is usually a guanine to cytosine base change at the second position (base) of the codon and the detection of this single nucleotide polymorphism is preferred for all aspects and embodiments of the invention described herein.
In a still further preferred embodiment of the first aspect of the invention we now provide a diagnostic method for the detection of a mutation in a fungal cytochrome b gene resulting in a Gι A replacement in the encoded protein said method comprising detecting the presence of an amplicon generated during a PCR reaction wherein said PCR reaction comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer in the presence of appropriate nucleotide triphosphates and an agent for polymerisation wherein the detection of said amplicon is directly related to presence or absence of said mutation in said nucleic acid. In a particularly preferred embodiment of the first aspect of the invention we now provide a diagnostic method for the detection of a mutation in a fungal cytochrome b gene resulting in a Gι A replacement in the encoded protein said method comprising contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the mutation resulting in a Gι4 A replacement in the encoded protein in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended when a mutation is present in the sample resulting in a G] 3A replacement in the encoded protein; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product.
In a further particularly preferred embodiment of the first aspect of the invention we now provide a diagnostic method for the detection of a mutation in a fungal cytochrome b gene resulting in a G) 3A replacement in the encoded protein said method comprising contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the mutation resulting in a G|4^A leplacement in the encoded protein in the piesence of appiopnate nucleotide tπphosphates and an agent for polymerisation, such that the diagnostic pπmei is extended only when a mutation lesulting in a G,43A leplacement in the encoded piotein is piesent in the sample, and detecting the piesence 01 absence of the said mutation by leference to the presence 01 absence of a diagnostic pπmei extension product
As used heiem the tei m G|43A is used to denote the substitution of a glycine lesidue by an alanine lesidue in a fungal cytochiome b sequence at the equiv alent of the position of the 143" codon/amino acid of the 5 ceι e\ isiae cytochiome b sequence This nomenclature is used for all the other lesidue changes quoted heiein I e all positions aie quoted relative to the S c ei ex tsiae cytochrome b pi otein sequence The 5 ceι ιsιae cytochiome b gene and piotein sequences are available on the EMBL and SWISSPROT databases (See EMBL ACCESSION NO X84042 and SWISSPROT ACCESSION NO P00163) The skilled man will appieciate that the piecise length and register of equivalent pioteins fio different species may vaiy as a lesult of amino oi caiboxy terminal and/oi one oi moie internal deletions oi insertions Since the amino acid tract containing the residue conesponding to G| ^ in S ceievtsiae is well conserved (Widger et al Pioc Nat Acad Sci , U S A 81 (1984) 674 678) it is straightforward to identify the piecisely conesponding residue in a newly obtained fungal cytochrome b sequence either by visual inspection or use of one of sex eial sequence alignment piogiammes including Megahgn oi Macaw Though designated G ui in this application, because oi positional and functional equivalence, the piecise position of this glycine in the new cytochiome b may not be the 143'd residue fiom its amino tei minal end The S ceievisiae cytochrome b consensus sequence is provided in SWISSPROT ACCESSION NO POO 163 In all aspects and embodiments of the invention described herein the positions in the cytochiome b sequence are piefeiably as defined relative to the S cei e\ isiae cytochrome b sequence piovided in EMBL ACCESSION NO X84042
Alternatively, in all aspects and embodiments of the invention described herein the positions in the cytochiome b sequence are prefeiably as defined relative to the S ceievtsiae cytochiome b consensus sequence as provided in SWISSPROT ACCESSION NO POO 163 Accoiding to one aspect of the invention theie is piovided a method foi the diagnosis of a single nucleotide polymorphism in a fungal cytochrome b gene which method comprises determining the sequence of fungal nucleic acid at a position corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S cet evisiae cytochiome b residue 143 in the cytochiome b piotein and determining the resistance status of the said fungi to a stiobilui in analogue oi a compound in the same cioss lesistance gioup by leference to a polymoiphism in the cytochiome b gene
In all aspects and embodiments of the invention descnbed herein it is piefened that only one base in the triplet coding foi the amino acid at the position conesponding to 5 cei ex i siae cytochiome b lesidue 143 in the cytochiome h pi otein shows a mutation 1 e there is a single nucleotide polymoiphism occuning at one position only and it is further prefened that it is at the fu st oi second base of the triplet and most especially is at the second base in the tnplet
Accoiding to a piefened embodiment of this aspect of the invention theie is piovided a method loi the diagnosis of a single nucleotide polymoiphism in a fungal cytochiome b gene which method compnses determining the sequence of fungal nucleic acid at a position conesponding to the second base in the tnplet coding foi the amino acid at the position conesponding to S cet evisiae cytochiome b tesidue 143 in the cytochrome b piotein and determining the lesistance status of the said fungi to a stiobilui in analogue or a compound in the same cioss lesistance gioup by reference to a polymoiphism in the cytochrome b gene
In an embodiment ol the above aspect of the invention the method foi diagnosis descnbed herein is one in which the single nucleotide polymoiphism at a position in the DNA conesponding to the second base in the tnplet coding foi the amino acid at the position conesponding to 5 cetevisiae cytochrome b lesidue 143 in the cytochiome b piotein is presence of G and/or C
Table 1 codon usage
A glycine to alanine point mutation demands a G to a C change at the second base of the codon Othei mutations may also arise at the 3rd position in the codon due to degeneracy in genetic code for alanine and glycine (see Table 1) but this is leadily taken into consideration when designing the diagnostic primer. The diagnostic primer is preferably an ARMS primer. (The concept of ARMS primers is described fully in Newton et al, Nucleic Acid Research 17 (7) 2503-2516 1989). As a result ARMS primers can be designed for the detection of the G|43A point mutation given only sequence information on the wild type, strobilurin analogue sensitive, cytochrome b gene. There is no need to have access to a resistant isolate in new fungi of interest resulting from a G| 3A mutation. Some examples of relevant plant pathogenic fungi are listed in Table 2. This list is not meant to be in any way to be exclusive. The skilled plant pathologist will be able to readily identify those fungi to which the methods of this invention are relevant.
21 My cosphaerella musicola
Table 2 Example of species w here Gi ,A can be assayed
The methods of the invention descnbed heiein aie paiticulaily useful in connection with plant pathogenic lungi and especially with the following fungal species Plasmopai a \ iticola, Ei ysiphe giammis f sp ti itici/hoi dei Rhynthoψonum secalis, Py i enophoi a teies My cosphaerella gi aminicola Venlin ia inaequali s, My cosphaei ell a fηien sts vai dήfor us Sphaei otheca fuliginea, Unc inula netatoi , Colletoti ichum gi amimcola, Py thium aphaiudeimatum, Colletoti ichum (ξloeospoi loidc s Oidium ly opei siciim Maψuipoi the iζi isea Phy tophthora infestans Le\ eιllula taui ua Pseudopeionospoi a cubensis Alteinana solani Rhizoctonia solani, My c osphaei ell a music ola and Cei c ospoi a at ac hidola In a fui thei aspect the inv ention piov ides a method loi detecting fungal lesistance to a stiobilui in analogue or any othei compound in the same cioss lesistance gioup said method compnsing identifying the piesence oi absence of a mutation in fungal nucleic acid wheiein the piesence of said mutation gives use to lesistance to a stiobilui in analogue oi any other compound in the same cioss lesistance gioup said method comprising identifying the piesence or absence of a single nucleotide polymorphism occurring at a position conesponding to one oi more of the bases in the tnplet coding foi the amino acid at the position conesponding to 5 cei ex isiae cytochiome b lesidue 143 in the cytochiome b protein
In a fuithei piefeired embodiment of this aspect the invention piovides a method foi detecting fungal lesistance to a stiobilurin analogue or any othei compound in the same cioss lesistance gioup said method comprising identifying the piesence or absence of a mutation in fungal nucleic acid wherein the piesence of said mutation gives rise to lesistance to a stiobilurin analogue oi any othei compound in the same cioss lesistance group said method comprising identifying the presence oi absence of a single nucleotide polymoφhism occuriing at a position corresponding to the second base in the triplet coding for the amino acid at the position conesponding to S cerevisiae cytochiome b residue 143 in the cytochrome b pi otein
In a preferred embodiment of this aspect of the invention the presence or absence of a single nucleotide polymoφhism at a position corresponding to the second base in the triplet coding for the amino acid at the position conesponding to S cet evisiae cytochiome b iesidue 143 in the cytochrome b gene in fungal nucleic acid is identified using any (oi a) single nucleotide polymoφhism detection techniques
The invention furthei piovides a fungal DNA sequence encoding all oi part of a wild type cytochiome h piotein wheiein said DNA sequence encodes a glycine residue at the position conesponding to S cei ex isiae cytochrome b residue 143 in the wild type piotein wherein said sequence is obtainable oi obtained from a fungus selected fiom the group consisting of Plasmopaia viticola Ei y siphe grainims f sp tntic i/hoidei Rhynchospoi m secalis Py i enophoia lei es My c osphaerella gi amnnc ola My cosphaei ella jηiensis vai diffoi mis, Sphaei otheca fuliginea Uncinula necatoi Colletoti ichitin qi aminicola Py lhiuni aphamdei matum, Colletoti ichitin gloeospoi ioides, Oidium lyc opei SIC UIII Lex eilluki taui ica Pseudopei onospoi a c uben sis Altei nai ia solani, Rhi octania solani My c osphaei ella musu ola and Ceicospoi a ai achidola
The fungal DNA sequences according to the above aspects of the invention prefeiably comprises aiound 30 nucleotides on eithei or both sides of the position in the DNA conesponding to one oi more of the bases in the tnplet, prefeiably conesponding to the second base in the triplet coding for the amino acid at the position conesponding to 5 c ei ex isiae cytochrome b lesidue 143 in the protein since this extent of nucleic acid provides the skilled man with all infoi mation necessaiy to design species and mutation specific leagents and/oi methods for use in all single nucleotide polymorphism detection techniques As used heiein the teim aiound 30 means that the sequence may compnse up to 30 nucleotides, foi example 5, up to 10, 15, 20, or 25 nucleotides or may comprise moie than 30 nucleotides
As used herein in connection with all DNA and protein sequences the teim 'all or part of is used to denote a DNA sequence oi protein sequence oi a fiagment thereof A fiagment of DNA or protein may foi example be 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% of the length of the whole sequence
It will be evident to the man skilled in the ait that both samples containing genomic (mitochondnal) and cDNA may be analysed according to the invention Where the sample contains genomic DNA intion oiga sation needs to be taken into account when using the sequence information Examples of wild type fungal DNA sequences comprising part of the wild type cytochrome b gene sequence according to the above aspect of the invention aie piovided in the table below and said sequences form a furthei aspect of the invention
Table 3
In the above table the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 which results in the replacement of the normal glycine residue with an alternative amino acid wherein said replacement confers resistance to strobilurin analogues or a compound within the same cross resistance group is in bold and underlined.
The invention also extends to a fungal DNA sequence showing homology or sequence identity to said DNA sequences in Table 3 and covers for example, variations in DNA sequences found in different samples or isolates of the same species. These variations may, for example, be due to the use of alternative codon usage, varying intron/exon mitochondrial organisation and amino acid replacement.
In a further aspect the invention provides a fungal DNA sequence encoding all or part of a cytochrome b protein which, when said sequence is lined up against the corresponding wild type DNA sequence encoding a cytochrome b protein, is seen to contain a single nucleotide polymorphism mutation at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein which results in the replacement of the normal glycine residue with an alternative amino acid with the proviso that said DNA sequence is not the Mycena galopoda sequence encoding cytochrome b. In a further preferred embodiment of this aspect the invention provides a fungal DNA sequence encoding all or part of a cytochrome b protein which, when said sequence is lined up against the corresponding wild type DNA sequence encoding a cytochrome b protein, is seen to contain a single nucleotide polymorphism mutation at a position in the DNA corresponding to the second base in the triplet coding for the amino acid at the position con-esponding to S. cerevisiae cytochrome b residue 143 in the protein which results in the replacement of the normal glycine residue with an alternative amino acid with the proviso that said DNA sequence is not the Mycena galopoda sequence encoding cytochrome b. The fungal DNA sequence according to the above aspect of the invention preferably comprises around 30 nucleotides on either or both sides of the position in the DNA corresponding to one or more of the bases in the triplet, preferably corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein since this extent of nucleic acid provides the skilled man with all information necessary to design species and mutation specific reagents and/or methods for use in all single nucleotide polymorphism techniques. As used herein the term around 30 means that the sequence may comprise up to 30 nucleotides, for example 5, up to 10, 15, 20, or 25 nucleotides or may comprise more than 30 nucleotides. The invention further provides a fungal DNA sequence encoding all or part of a mutant cytochrome b protein wherein the presence of a mutation in said DNA confers resistance to a strobilurin analogue or a compound within the same cross resistance group, said mutation occurring at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to 5. cerevisiae cytochrome b residue 143 in the protein with the proviso that said DNA sequence is not the Mycena galopoda sequence encoding cytochrome b.
In a preferred embodiment of this aspect the invention further provides a fungal DNA sequence encoding all or part of a mutant cytochrome b protein wherein the presence of a mutation in said DNA confers resistance to a strobilurin analogue or a compound within the same cross resistance group, said mutation occurring at a position in the DNA corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein with the proviso that said DNA sequence is not the Mycena galopoda sequence encoding cytochrome b.
In the above aspects of the invention the mutation occurring at a position in the DNA corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein is preferably a guanine to cytosine base change. The fungal DNA sequence encoding all or part of a mutant cytochrome b protein wherein the presence of a mutation in said DNA confers resistance to a strobilurin analogue or a compound within the same cross resistance group, according to the above aspects of the invention is preferably obtainable or obtained from a fungus selected from the group consisting of Plasmopara viticola, Eiysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella βjiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeospoiioides, Oidium lycopersicum, Magnaporlhe grisea, Phytophthora infest an s, Leveillula tauiica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola and Cercospora arachidola.
The invention extends also to DNA sequences comprising all or part of the sequences provided in Table 3 wherein the residue at a position in the DNA corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein is a cytosine residue (SEQ ID NOS 176 to 196). These sequences are shown below and form a further aspect of the invention: 5'TTTTGCCTTGGGGACAAATGAGTTTTTGGCιCTGCAACAGTTATTACAAATTTATTCTCGGC 3' (SEQ ID NO 176).
5 ATTGCCATACGGGCAGATGAGCCACTGGGCTGCAACCGTTATCACTAACCTAA TGAGCGC 3'- (SEQ ID NO 177)
5 GCTTCCTTATGGACAGATGTCTTTATGAGCTGCCACAGTTATAACTAATCTTAT
GAGTGC 3'- (SEQ ID NO 178)
5'TTTTACCCTACGGGCAAATGAGCCTITGAGCTGCTACAGTTATTACTAACCTTAT
GAGTGC 3'- (SEQ ID NO 179) 5"TTTTACCCTACGGGCAAATGAGCCTTTGAGCTGAAATATTTGCCTCAAATGTATA
ACTAAT 3'- (SEQ ID NO 180)
5'TATTACCTTATGGTCAAATGTCTTTATGAGCAGCAACAGTTATAACTAACTTATTGAGTG
C3" (SEQ ID NO 181)
5 TTTACCTTATGGTCAAATGTCTTTATGAGCAGCTACAGTTATAACTAATTTAAT GAGCGC 3'- (SEQ ID NO 182)
5 ACTTCCCTTCGGTCAAATGTCGCTCTGGGCTGCAACCGTTATTACTAACCTTAT
GAGCGC 3'- (SEQ ID NO 183)
5' *TCTGGGCTGCAACCGTTAAGTAATAGCGGTTGTAAAA- (SEQ ID NO 184)
5TTTTACCCTACGGGCAGATGAGCCTATGGGCTGCAACCGTTATTACTAACCTTAT GAGCGC 3'- (SEQ ID NO 185) 5'*AGCCTATGGGCTGCAACCGTTAAGTAGGTAATAGCGGTTGA 3'- (SEQ ID NO 186)
5'TTTTACCTTACGGACAAATGTCATTATGAGCTGCTACAGTTATTACTAACCTTAT
AAGTGC 3'- (SEQ ID NO 187)
5"TATTACCTTGGGGTCAAATGAGTTTTTGGGCTGCTACTGTTATTACTAATTTATT TTCAGC 3"- (SEQ ID NO 188)
5-TTTTACCTTATGGACAAATGTCATTATGAGCTGCAACAGTTATTACTAACCTTAT
AAGTGC 3'- (SEQ ID NO 189)
5 TTTACCCTACGGGCAGATGAGCCTGTGGGCTGCAACCGTTATTACTAACCTTAT
GAGCGC 3'- (SEQ ID NO 190) 5'TTTTACCATACGGACAAATGTCATTATGAGCTGCAACAGTTATTACTAACCTTAT
GAGTGC 3'- (SEQ ID NO 191)
5"TTTTACCTTGGGGACAAATGAGTTTTTGGGCTGCAACTGTTATTACTAATTTATT
TTCTGC 3'- (SEQ ID NO 192)
5'TTCTTCCTTATGGGCAAATGTCTTTATGAGCTGCTACAGTTATTACTAACCTTAT GAGTGC 3"- (SEQ ID NO 193)
5'TATTACCTTATGGACAAATGTCATTATGAGCAGCTACAGTTATTACTAATTTATT
ATCTGC 3'- (SEQ ID NO 194)
5 GCTTCCATACGGGCAAATGTCTCTGTGGGCTGCTACAGTAATTACTAATTTACT
TTCTGC 3'- (SEQ ID NO 195) 5'TTTTACCTTATGGTCAAATGTCTTTATGAGCAGCTACAGTTATAACTAATTTAATGAGTG
C.T (SEQ ID NO 196)
The invention also extends to a fungal DNA sequence showing homology or sequence identity to said DNA sequence containing said polymorphism and covers for example, variations in DNA sequences found in different samples of the same species. These variations may, for example, be due to the use of alternative codon usage, varying intron/exon mitochondrial organisation and amino acid replacement.
The DNA sequences encoding all or part of a wild type or mutant cytochrome b protein as described herein are preferably in isolated form. For example through being partially purified from any substance with which it occurs naturally. The DNA sequence is isolatable (obtainable) or isolated (obtained) from the fungi disclosed herein.
The invention further provides a computer readable medium having stored thereon any of the sequences described and claimed herein and including all or part of a DNA sequence or protein sequence encoding a mutant cytochrome b protein as herein described wherein the presence of a mutation gives rise to fungal resistance to a strobilurin analogue or any compound in the same cross resistance group; all or part of a DNA or protein sequence encoding a mutant cytochrome b protein wherein said protein confers fungal resistance to a strobilurin analogue or a compound in the same cross resistance group from a fungus selected from the group Plasmopara viticola, Erysiphe graminis f.sp. tiitici/lwrdei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola. Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necatoi; Colletotrichum graminicola, Pythium aplianiderinatum, Colletotrichum gloeospoiioides, Oidium lycopersicwn, Magnaporthe grisea, Phytophthora infestans, Leveillula tauiica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola and Cercospora arachidola, with the proviso that said DNA or protein sequence is not the Mycena galopoda cytochiome b sequence; all or part of a DNA or protein sequence encoding a wild type cytochrome b sequence from a fungus selected from the group Plasmopara viticola, Eiysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necatoi; Colletotiichum graminicola, Pythium aplianiderinatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Leveillula tauiica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola and Cercospora arachidola: or any allele specific oligonucleotide; allele specific oligonucleotide probe, allele specific primer, common or diagnostic primer disclosed herein. The computer readable medium may be used, for example, in homology searching, mapping, haplotyping, genotyping or any other bioinformatic analysis. Any computer readable medium may be used, for example, compact disk, tape, floppy disk, hard drive or computer chips.
The polynucleotide sequences of the invention, or parts thereof, particularly those relating to and identifying the single nucleotide polymorphisms identified herein, especially the G to C change in fungal cytochrome b causing the G|43A change in the encoded protein, represent a valuable information source. The use of this information source is most easily facilitated by storing the sequence information in a computer readable medium and then using the information in standard bioinformatics programs. The polynucleotide sequences of the invention are particularly useful as components in databases for sequence identity and other search analyses. As used herein, storage of the sequence information in a computer readable medium and use in sequence databases in relation to polynucleotide or polynucleotide sequence of the invention covers any detectable chemical or physical chaiactenstic of a polynucleotide of the invention that may be leduced to. converted into oi stoied in a tangible medium, such as a computer disk, piefeiably in a computei leadable foim Foi example, chromatogiaphic scan data 01 peak data, photogiaphic scan oi peak data, mass spectiographic data, sequence gel (01 othei ) data A computei based method is also piovided foi peifoiming sequence identification, said method compnsing the steps of pioviding a polynucleotide sequence compnsing a polymoiphism of the invention in a computei leadable medium and companng said pol> moφhιsm containing polynucleotide sequence to at least one othei polynucleotide or pol) peptide sequence to identify identity (homology) 1 c screen lor the piesence of the polvmoiphism
The invention further piovides a lungal cytochiome b piotein which confers iungal lesistance to a stiobiluiin analogue oi a compound within the same cioss lesistance gioup wheiein in said protein a noimal glycine lesidue is alteied due to the piesence of a mutation in the DNA coding foi said protein said mutation occuinng at a position in the DNA conesponding to one oi moie of the bases in the triplet coding foi the amino acid at the position conesponding to S ceiex isiae cytochiome b lesidue 143 in the protein w ith the pioviso that said sequence is not the Mycena galopoda cytochiome h sequence
In a piefened embodiment of this aspect the invention fuithei piovides a fungal cytochiome h piotein which confeis fungal lesistance to a stiobiluiin analogue oi a compound within the same cioss lesistance group wheiein in said piotein a normal glycine residue is alteied due to the presence of a mutation in the DNA coding for said piotein said mutation occurring at a position in the DNA conesponding to the second base in the tnplet coding foi the amino acid at the position conesponding to S cetevisiae cytochiome b lesidue 143 in the protein with the pioviso that said sequence is not the Mycena galopoda cytochiome b sequence
The Mycena galopoda cytochiome b sequence is descnbed by Kiaiczy et al (Eur J Biochem 235, 54-63 (1996)) and the DNA sequence is in the EMBL data base EMBL Acession No X87997
The glycine lesidue in the protein accoiding to the above aspect of the invention is pieferably replaced by an alternative amino acid and said replacement results in the said fungi showing resistance to a strobilurin analogue or any othei compound in the same cioss resistance gioup The mutation according to the above aspect of the invention preferably results in the replacement of said glycine residue with an amino acid selected from the group arginine, serine, cysteine, valine, aspartic acid, glutamic acid and most preferably alanine.
In a further aspect the invention provides an antibody capable of recognising said mutant cytochrome b protein.
In a further aspect the invention provides a method for the detection of a mutation in fungal cytochrome b gene resulting in replacement in the encoded protein of a glycine residue at the position corresponding to S. cerevisiae cytochrome b residue 143 said method comprising identifying the presence and absence of said mutation in a sample of fungal nucleic acid wherein any (or a) single nucleotide polymorphism detection method is based on the sequence information from around 30 to 90 nucleotides upstream and/or downstream of the position corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in either the wild type or mutant protein. In a further preferred embodiment of this aspect the invention provides a method for the detection of a mutation in fungal cytochrome b gene resulting in a G]4 A replacement in the encoded protein said method comprising identifying the presence and absence of said mutation in a sample of fungal nucleic acid wherein any (or a) single nucleotide polymoφhism detection method is based on the sequence information from around 30 to 90 nucleotides upstream and/or downstream of the position corresponding to the second base in the triplet coding for the amino acid at the position corresponding to 5. cerevisiae cytochrome b residue 143 in either the wild type or mutant protein.
In a further preferred embodiment of this aspect the invention provides a method for the detection of a guanine to cytosine mutation in a fungal cytochrome b gene resulting in a G| 3A replacement in the encoded protein said method comprising identifying the presence and absence of said mutation in a sample of fungal nucleic acid wherein any (or a) single nucleotide polymoiphism detection method is based on the sequence information from around 30 to 90 nucleotides upstream and/or downstream of the position corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in either the wild type or mutant protein.
The sequence information according to the above aspect of the invention is preferably derived from a fungus selected from the group Plasmopara viticola, Eiysiphe graminis f.sp. tritici/lwrdei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necatoi; Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicwn, Magnaporthe grisea, Phytophthora infestans, Leveillula tauiica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola and Cercospora arachidola and more preferably from the group Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necatoi; Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicwn, Leveillula tauiica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctania solani, Mycosphaerella musicola and Cercospora arachidola.
As used herein the term around 30 means that the sequence may comprise up to 30 nucleotides, for example 5, up to 10, 15, 20, or 25 nucleotides or may comprise more than 30 nucleotides. In the above aspects of the invention it is preferred that the sequence information used is around 30, preferably 30 nucleotides upstream and/or downstream of the position corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in either the wild type or mutant protein. The nucleic acid according to the invention is preferably DNA, the test sample of nucleic acid is conveniently a total DNA preparation from fungal material, a cDNA preparation from fungal material or the fungal material itself or plant or seed extracts containing fungal nucleic acid. In this invention, we describe the detection of the Gι 3A mutation by using total DNA preparation, cDNA preparation and by directly using fungal spore material as template in the PCRs. It will be appreciated that the test sample may equally be a nucleic acid sequence corresponding to the sequence in the test sample. That is to say that all or a part of the region in the sample nucleic acid may firstly be isolated or amplified using any convenient technique such as PCR before use in the method of the invention. The present invention provides a means of analysing mutations in the DNA of agricultural field samples which by their very origin are considerably less well defined compared with an analogous situation involving human samples. Agricultural field samples aie considerably moie difficult to work with and it is moie technically demanding to detect a mutation event occuning at a low frequency in amongst a veiy laige amount of wild type DNA and/oi extianeous DNA from othei organisms piesent in a field isolate compaied with a human sample which geneially contains DNA fiom only one individual Any convenient enzyme foi polymensation may be used piovided that it has no lntnnsic ability to disci lminate between noi mal and mutant template sequences to any significant extent Examples of convenient enzymes include theimostable enzymes which have no significant 3'-5' exonuclease activ ity, foi example Taq DNA polymeiase, paiticulaily 'Amph Taq Gold' ™ DNA polymei ase (PE Applied Biosystems), Stoffel f iagment, oi othei appiopnately N-tei minal deleted modilications of Taq (Theimus aquatic us ) oi Tth (Thei mus theimophilus) DNA polymciases
In a fuithei aspect the invention piov ides an allele specific oligonucleotide capable of binding to all or part of a fungal nucleic acid sequence encoding a wild type cytochiome b piotein selected fiom the gioup consisting of Plasmopai a \ mcola, Ei y siphe gi ammis f sp tntic i/lioidei, Rhync hospoi iuin secalis, Py ienophoi a tei es, My cosphaerella gi aminitola, Ventui ia inaequalis My cosphaei ella fηiensis vai diffoi mis, Sphaei otheca fulitξinea Uncinula necatoi, Colletoti ichum giaminitola Pythium aphamdei inatwn, Colletoti ichum gloeospoiioides Oidium ly c opei sic wn Magnapot the nse, Pln tophthoi a infestan s, Lex eillula taui ica Pseudopei onospoi a cubensis, Altemai ia solani, Rhizoctonia solani My cosphaei ella music ola and Cei cospoi a aiac liidola wheiein said oligonucleotide comprises a sequence which recognises a nucleic acid sequence encoding a glycine residue at the position conesponding to 5 cetevisiae cytochrome b residue 143
In a piefened embodiment of this aspect of the invention the said fungal nucleic acid sequence is selected fiom the gioup consisting oi Plasmopai a viticola, Ery siphe giammis f sp tntici/lioidei, Rhynchospoi iuin secalis, Py ienophoia teres, My cosphaerella graminicola, My cosphaerella fiμensis vai diffoimis, Sphaei otheca fuliginea, Uncinula necatoi, Colletoti ichum gi aminicola, Pythium aphamdei mat m, Colletoti ichum gloeospoi ioides, Oidium lycopei sicwn, Lex eillula taui ica, Pseudoperonospora cubensis, Altemai ia solani, Rhizoctonia solani, My cosphaerella musicola and Cercospoia aiacliidola The fungal nucleic acid accoiding to the above aspects of the invention is preferably
DNA In a further aspect of the invention we provide an allele specific oligonucleotide capable of binding to a fungal nucleic acid sequence encoding all or part of a mutant cytochrome b protein wherein said oligonucleotide comprises a sequence which recognises a nucelic acid sequence encoding an amino acid selected from the group arginine, serine, cysteine, valine, aspartic acid, glutamic acid , tryptophan, and most preferably alanine at the position corresponding to S. cerevisiae cytochrome b residue 143.
In a preferred embodiment of this aspect of the invention we provide an allele specific oligonucleotide capable of binding to a fungal nucleic acid sequence encoding all or part of a mutant cytochrome b protein selected from the group consisting oi Plasmopara viticola, Eiysiphe graminis f.sp. tritici/liordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necatoi; Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicwn, Magnaporthe grisea, Phytophthora infestans, Leveillula laurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola and Cercospora arachidola wherein said oligonucleotide comprises a sequence which recognises a nucleic acid sequence encoding an amino acid selected from the group arginine, serine, cysteine, valine, aspartic acid, glutamic acid, tryptophan, and most preferably alanine at the position corresponding to S. cerevisiae cytochrome b residue 143. The fungal nucleic acid according to the above aspects of the invention is preferably
DNA.
In a further aspect the invention provides an allele specific oligonucleotide probe capable of detecting a fungal cytochrome b gene polymorphism at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein.
In a further preferred embodiment of this aspect the invention provides an allele specific oligonucleotide probe capable of detecting a fungal cytochrome b gene polymoφhism at a position in the DNA corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein.
In further preferred embodiments of the above aspect of the invention said polymoφhism is a guanine to cytosine base change, the mutation is in a fungus selected from the group consisting of Plasmopai a i iticola Ery siphe giammis f sp tntici/hoidei, Rhy nchospoi iuin secalis, Py i enophoi a tei es, Mycosphaei ella gi ainimcola Venturia inaequali s Mycosphaerella fi/iensis vai diffoimis Sphaerotheca fuliginea, Uncinula necatoi, Colletoti ii hum graminicola, Py thium aphamdei matum Colletoti ichum gloeospoi ioides, Oidium ly copei sicuiii Maφiapoi the ςπsea Phy tophthoi a infestans Le eillula taui ica, Pseudopei onospoi a cuben sis Altemai ia solani Rhizoctonia solani, Mycosphaei ella musicola and Ceicospoia aiac liidola
The allele-specific oligonucleotide piobe is piefeiably 17 to 50 nucleotides long, moie piefei able about 17 35 nucleotides long and most pieierable about 17 30 nucleotides long
The design of such piobes will be appaient to the molcculai biologist of oidinaiy skill and may be based on DNA oi RNA sequence infoi mation Such piobes are of any convenient length such as up to 50 bases, up to 40 bases, moi e conveniently up to 30 bases in length, such as foi example 8-25 oi 8- 15 bases in length In genei al such piobes will compnse base sequences entnely complementaiy to the conesponding wild type oi vanant locus in the gene Howev er, if lequned one oi moie mismatches may be introduced, piovided that the discriminatory powei of the oligonucleotide piobe is not unduly atlected The probes of the invention may cany one or moie labels to facilitate detection
The invention luithei piovides nucleotide pπmeis which can detect the nucleotide polymoiphisms accoiding to the invention
Accoiding to another aspect of the invention theie is piovided an allele specific primer capable of detecting a cytochiome b gene polymorphism at a position in the DNA conesponding to one or moie of the bases in the tnplet coding for the amino acid at the position coiresponding to S cerevisiae cytochrome b lesidue 143 in the piotein Accoiding to a pieferred embodiment of this aspect of the invention there is provided an allele specific primer capable of detecting a cytochrome b gene polymorphism at a position in the DNA corresponding to the second base in the tnplet coding foi the amino acid at the position conesponding to S cetevisiae cytochiome b lesidue 143 in the piotein
In the above aspects the said mutation in the DNA sequence is preferably a guanine to cytosine base change
In a further aspect the invention piovides an allele specific pnmer capable of detecting a fungal DNA sequence encoding a wild type cytochiome b piotein selected from the group consisting oi Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necatoi; Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicwn, Magnaporthe grisea, Phytophthora infestans, Leveillula tauiica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola and Cercospora arachidola wherein said primer is capable of detecting a DNA sequence encoding a glycine residue at the position corresponding to S. cerevisiae cytochrome b residue 143. In a preferred embodiment of this aspect of the invention the said fungal DNA sequence is selected from the group consisting oi Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Mycosphaerella fijiensis var. difformis Sphaerotheca fuliginea. Uncinula necatoi; Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicwn, Leveillula tauiica, Pseudoperonospora cubensis,
Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola and Cercospora arachidola.
In a further aspect of the invention we provide an allele specific primer capable of detecting a fungal DNA sequence encoding all or part of a mutant cytochrome b protein wherein said allele specific primer is capable of detecting a DNA sequence encoding an amino acid selected from the group arginine, serine, cysteine, valine, aspartic acid, glutamic acid, tryptophan, and most preferably alanine at the position corresponding to 5. cerevisiae cytochrome b residue 143.
In a preferred embodiment of this aspect of the invention we provide an allele specific primer capable of detecting a fungal DNA sequence encoding all or part of a mutant cytochrome b protein selected from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici/liordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicwn, Magnaporthe grisea, Phytophthora infestans, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola and Cercospora arachidola wherein said primer is capable of detecting a DNA sequence encoding an amino acid selected from the group arginine, se ne, cysteine, valine, aspartic acid, glutamic acid, tryptophan, and most prefeiably alanine at the position corresponding to S cetevisiae cytochiome b lesidue 143
An allele specific pnmei is used geneially with a common pnmei in an amplification ieaction such as a PCR reaction w hich piovides the discnmination between alleles thiough selective amplification of one allele at a paiticulai sequence position e g as used in the ARMS assay
We have now devised primeis foi the G|4ιA mutation in the above-listed fungal species which have been show n to detect the specific mutations ieliabl and lobustly The pi imeis detect the guanine to c> tosιne base change at a position in the DNA conesponding to the second base in the tnplet coding loi the amino acid at the position conesponding to S cei ex isiae cytochiome b lesidue 143 in the piotein The allele specific pi l eis are herein lelened to as diagnostic pnmeis In a furthei aspect the invention theieioie piovides a diagnostic pnmei capable of binding to a template compnsing a mutant type fungal cytochiome b nucleotide sequence wheiein the final 3' nucleotide ol the pnmer conesponds to a nucleotide piesent in said mutant foim of a fungal cytochiome b gene and the piesence of said nucleotide gives rise to fungal lesistance to a stiobilurin analogue or any other compound in the same cioss lesistance group
The diagnostic pnmer of the invention is piefeiably at least 20 nucleotides in length, most piefeiably 26 nucleotides in length but this may be between 1 and 20 nucleotides in length
In a piefeired embodiment of the above aspect of the invention the penultimate nucleotide (-2) of the pnmei is not the same as that piesent in the corresponding position in the wild type cytochiome b sequence
In a further piefeired embodiment it is the -3 nucleotide of the primer which is not the same as that present in the conesponding position in the wild type cytochiome b sequence
Other destabilising components may be incoipoiated along with the -2 or -3 nucleotide
In a fuithei particularly pieferred embodiment of the above aspect of the invention we provide diagnostic primeis capable of binding to a template comprising a mutant type fungal cytochrome b nucleotide sequence wherein the final 3' nucleotide of the pnmei corresponds to a nucleotide piesent in said mutant form of a fungal cytochrome b gene and wherein up to 10, such as up to 8, 6, 4, 2, 1, of the remaining nucleotides may be varied with respect to the wild type sequence without significantly affecting the properties of the diagnostic primer.
In a further particularly preferred embodiment of the above aspect of the invention we provide diagnostic primers comprising the sequences given below and derivatives thereof wherein the final nucleotide at the 3' end is identical to the sequences given below and wherein up to 10, such as up to 8, 6, 4, 2, 1, of the remaining nucleotides may be varied without significantly affecting the properties of the diagnostic primer.
Conveniently, the sequence of the diagnostic primer is exactly as provided below. It is preferred that the ARMS primers in all aspects of the invention are 26 nucleotides in length. In the majority of the primers listed below the penultimate nucleotide has been altered from wild type cyt b sequence to destabilise the primer thereby making it more selective for the desired template and these primers are particularly preferred according to the invention. It will be apparent to the man skilled in the art of primer design that bases alternative to or in addition to those discussed above may also be varied without adversely affecting the ability of the primer to bind to the template.
Table 4: ARMS primer design for the detection of the G| 3A mutation
For the puφoses of exemplification the primers included in Table 4 include:
• ARMS primers for P. teres, and V. ineaqualis which can be used effectively either on genomic DNA preparations or biological samples including fungal isolates, fungal cultures, fungal spores or infected plant material.
• ARMS primers for S. fulginea, O. lycopersicon, L. taurica, U. necatoi; Phytopthora infestans, Magnoporthe grisea, R. solani which may only be effective on cDNA
• ARMS primers for P. viticola, E. graminis f.sp ttitici or liordei, R. secalis, M. graminicola, M. fijiensis var. difformis, C. graminicola, P. aphanidermatum, C. gloesporoides, P. cubensis, C, arachidola, Mycosphaerella musicola and A. solani which may be used effectively with either genomic DNA preparations, cDNA preparations, cDNA preparations or biological samples incuding fungal isolates, fungal cultures, fungal spores or infected plant material. cDNA material is recommended for the species where the intron/exon organisation is not currently characterised around the single nucleotide polymorphism (SNP) of interest. To adapt the primers shown in the above Table for use in a standard ASPCR reaction the last base at the 3' end should correspond to the point mutation without a destabilising base introduced.
Such primers may be manufactured using any convenient method of synthesis. Examples of such methods may be found in standard textbooks, for example "Protocols For Oligonucleotides And Analogues: Synthesis And Properties;" Methods In Molecular Biology Series; Volume 20; Ed. Sudhir Agrawal, Humana ISBN: 0-89603-247-7; 1993; Is' Edition.
It will be appreciated that extension of a diagnostic primer can be designed to indicate the absence of the mutation resulting in a G|43A replacement in the encoded protein. The use of ARMS primers for the detection of the absence of the mutation resulting in a Gι4 A replacement in the encoded protein is preferred. Primers designed for that puφose are described herein.
The detection of the wild type sequence is useful as a control in relation to the detection of the mutation and also is necessary where quantitation of wild type and mutant alleles present in a sample is desired. In a further aspect the invention therefore provides a diagnostic primer capable of binding to a template comprising wild type fungal cytochrome b nucleotide sequence wherein the final 3' nucleotide of the primer corresponds to a nucleotide present in a wild type fungal cytochrome b gene said wild type fungus showing sensitivity to a strobilurin analogue or any other compound in the same cross resistance group. In a preferred embodiment of this aspect of the invention the penultimate nucleotide
(-2) of the primer is not the same as that present in the corresponding position in the wild type cytochrome b sequence.
In a further preferred embodiment the -3 nucleotide of the primer is not the same as that present in the corresponding position in the wild type cytochrome b sequence. Other destabilising components may be incoφorated along with the -2 or -3 nucleotide. The diagnostic primer of the invention is preferably at least 20 nucleotides in length, most piefeiably 26 nucleotides in length but this may be between 15 and 20 nucleotides in length In a further particulaily pieferred embodiment of the above aspect of the invention we provide diagnostic p mers capable of binding to a template compnsing wild type fungal cytochiome b nucleotide sequence wherein the final 3' nucleotide of the primer conesponds to a nucleotide present in a wild type fungal cytochrome b and wheiein up to 10, such as up to 8, 6, 4, 2, 1 , of the lemaining nucleotides may be vaned with respect to the wild type sequence without significantly affecting the pioperties of the diagnostic pnmer
In a furthei particulaily piefened embodiment of this aspect of the invention we provide diagnostic primers compnsing the sequences given below and derivatives theieof wheiein the final nucleotide at the 3' end is identical to the sequences given below and wherein up to 10, such as up to 8, 6, 4, 2, 1, of the lemaining nucleotides may be vaned without significantly affecting the properties of the diagnostic primer Conveniently, the sequence of the diagnostic pnmei is exactly as piovided below In the majoiity of the primers listed below the penultimate nucleotide has been alteied fiom wild type cytochiome b sequence to destabilise the pnmei theieby making it moie selective for the desired template It will be apparent to the man skilled in the art of primer design that bases alternative to or in addition to those discussed above may also be varied without adversely affecting the ability of the pnmei to bind to the template
Table 5: ARMS primer design for the detection of the wild type sequence
To adapt the primers shown in the above Table for use in a standard ASPCR reaction the last base at the 3' end should correspond to the wild type sequence without a destabilising base introduced. The examples descnbed above relate to ARMS primeis based on the foi ward strand of DNA The use of ARMS primeis based on the foi ward stiand of DNA is particularly preferred
ARMS p meis may also be based on the reveise stiand of DNA if so desned Such reverse strand primers are designed following the same pimciples above foi foi ward strand p meis namely, that the primers may be at least 20 nucleotides in length most pieferably 26 nucleotides in length, but may be between 15 and 20 nucleotides in length and the final nucleotide at the 3' end of the pnmer matches the lelevant template l e mutant or wild type and piefeiably the penultimate lesidue is optimally changed such that it does not match the lelevant template Additionally up to 10, such as up to 8, 6, 4, 2, 1 , of the lemaining nucleotides in the primer may be vaned without significantly affecting the pioperties of the diagnostic primer
In many situations, it will be convenient to use a diagnostic primer of the invention with a further amplification pnmei lef erred to herein as the common primer, in one or more cycles of PCR amplification A convenient example of this aspect is set out in European patent numbei EP-B 1-0332435 The further amplification pnmei is eithei a forward or a reveise common primer For each species, the pnmer used is as below The Primers shown below are reverse primers
Table 6: Examples of common primers to use with ARMS primers
In the case of the longer sequences provided in Table 6 the skilled man will be able to use this information to design appropriate primers.
It will be evident to the man skilled in the art that the common primer can be any convenient pathogen specific sequence which recognises the complementary strand of the cytochrome b gene (or other gene of interest) lying 3' of the mutation selective primer.
The PCR amplicon size is preferentially 50 to 400bp long but can be from 30 to 2500bp long, or potentially from 30 to 10,000bp long. A convenient control primer may be used which is designed upstream from the Gι 3A position. It will be evident to the man skilled in the art that the control primer may be any primer which is not specific for the amplification of the mutation or wild type sequences. When using these primers along with the corresponding reverse ('common') primer described above, amplification will occur regardless whether the G)43A point mutation is present or not.
Table 7: Examples of possible control primer design
A variety of methods may be used to detect the presence or absence of diagnostic primer extension products and/or amplification products. These will be apparent to the person skilled in the art of nucleic acid detection procedures. Preferred methods avoid the need for radiolabelled reagents. Particularly preferred detection methods are those based on fluorescence detection of the presence and/or absence of diagnostic primer extension products. Particular detection methods include gel electrophoresis analysis, "Scoφions"™ product detection as described in PCT application number PCT /GB98/03521 filed in the name of Zeneca Limited on 25 November 1998 the teachings of which are incorporated herein by reference, "Taqman" ™ product detection, for example as described in patent numbers US-A-5487972 & US-A-5210015; "Molecular Beacons" ® product detection, outlined in patent number WO-95/13399 and surface enhanced Raman resonance spectroscopy (SERRS), outlined in patent application WO 97/05280. Further preferred detection methods include ARMS linear extension (ALEX) and PCR with ALEX as described in published PCT application number WO 99/04037. Conveniently, real-time detection is employed. The use of "Scoφions"™ product detection as described in PCT application number PCT /GB98/03521 and published UK patent application No. GB2338301 is particularly preferred for use in all aspects of the invention described herein. The combination of the ARMS and the Scoφion technology as described herein is particularly preferred foi use in all aspects of the invention descnbed herein and the preferred detection method is a fluoiescence based detection method Many of these detection methods are appropriate for quantitative work using all of the above primers. These different PCRs can be carried out in different tubes or multiplexed in one tube. Using such methods, estimates can be made on the frequency of point mutation molecules present in a background of wild type molecules.
As exemplified herein we have used ARMS primers based on the forward strand of DNA in combination with Scorpion detection based on the reverse strand of DNA as the detection method. The Scoφion detection element prefeiably compnse the reverse primers shown in Table 6. It will be readily apparent to the man skilled in the art that alternative combinations of ARMS primers and Scorpion detection elements could also be used. For example the primer based on the forward strand of the DNA could be a combination of an ARMS primer with a Scorpion detection system and this could be used with a common primer based on the reverse strand of DNA or the pnmer based on the reverse strand of DNA could be a combination of an ARMS primer with a Scoφion detection system and this could be used with a common primer based on the forward strand of DNA
In most of the examples described herein, the Scorpion detection element is on the common primer. The ARMS primer specific to the mutation and the wild type sequence are used in combination with the common fluorescence labelled pnmei These two reactions are cairied out in diffeient PCR tubes and the fluorescence is emitted when the probe binds to the amplicon generated. The Scoφion element may alternatively be incorpoiated on the ARMS primers. In this case, the two ARMS primers can be labelled with different fluorophores and used along with the common pnmer (this time unlabelled). These three primers may be included in the same reaction as the resulting mutant and wild type amplicons will lead to different fluorescence being emitted.
As described in published UK patent application No. GB2338301 the Scoφions technology may be used in a number of different ways such as the intercalation embodiment where the tail of the Scoφions primer carries an intercalating dye which is capable of being incoφorated between the bases of a double stranded nucleic acid molecule, upon which it becomes highly fluorescent; the FRET embodiment where the dyes involved in the primer form an energy transfer pair; the no-quencher embodiment where a fluorophore is attached to the tail of the Scoφions primer; the Bimolecular embodiment where the fluorophore and quencher may be introduced on two separate but complementary molecules; the Capture Probe embodiment where amplicons may be specifically captured and probed using the same non-amplifiable tail and the Stem embodiment where the primer tail comprises self complementary stems. These embodiments are described fully in published UK patent application No. GB2338301 , the teaching of which is incoiporated herein by reference.
The methods of the invention described herein reliably detect a mutation in a fungal gene wherein the presence of said mutation gives rise to fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene at a detection level in the range of 1 mutated allele per 1 ,000,000 wild type alleles to 1 mutated allele per 10,000 wild type alleles, and preferably in the range of 1 mutated allele per 100,000 wild type alleles to 1 mutated allele per 10,000 wild type alleles. The method of the invention can also detect mutations occurring at higher frequency, for example, 1 mutated allele per 100 wild type alleles, 1 mutated allele per 10 wild type alleles or where only mutated alleles are present. Similarly the methods of the invention may be used to detect the frequency of the wild type allele in a background of mutated alleles.
The combination of allele specific primer extension made more sensitive with use of the ARMS technology and quantitative detection methods which are used in the present invention make this an extremely valuable technique for the detection of fungal mutations occurring at low frequency. The detection of alleles present in given isolates enables the results of phenotypic bioassays to be related to the DNA profile of the target gene. The discovery of a single point mutation as the resistance mechanism explains the qualitative nature of the resistance, and the confirmation of single spore isolate sequences validates the accuracy of the screens in determining frequencies of resistant and sensitive isolates in the samples tested. The development of the method combining allele specific primer extension, the specificity of ARMS and real time fluorescent detection as exemplified herein with the Scorpion system enables a greater number of samples to be analysed for the presence of the resistance mutation than would be feasible in a bioassay programme. Larger sample numbers enable the identification of the resistance mutation at frequencies of a lower percentage than might be easily detected through bioassay. This enables resistance to be identified in the population before it might be apparent from field data. The high throughput nature of the method enables a wider area and more sites to be sampled and tested than might be possible using the bioassay Allele specific primer extension such as ARMS linked with leal time fluoiescent detection allows the detection of the presence of the resistance gene in a population befoie the effects of the gene can be viewed phenotypically by bioassay in heteroplasnπc and/or heterokaryotic cells, thus reducing the en or of classifying samples as sensitive when they carry a low fiequency of the resistance genotype Results aie obtained much fastei thiough simultaneous read-out (real time) compared to waiting for disease development in pi ant a, enabling fast responses to field situations and advice on resistance management to be given moie quickly
One oi moie of the diagnostic primeis of the invention may be conveniently packaged with instiuctions foi use in the methods of the invention and appiopriate packaging and sold as a kit The kits will conveniently include one or moie of the following diagnostic, wild type, contiol and common oligonucleotide pnmers appiopnate nucleotide triphosphates, for example dATP, dCTP, dGTP, dTTP, a suitable polymerase as pieviously described, and a buffei solution In a further aspect the invention piovides a method of detecting plant pathogenic fungal resistance to a fungicide said method compnsing detecting a mutation in a fungal gene wherein the presence of said mutation gives rise to fungal lesistance to a stiobilurin analogue or any othei compound in the same cioss lesistance gioup said method comprising identifying the piesence or absence of said mutation in fungal nucleic acid using any (or a) single nucleotide polymorphism detection technique
In a further embodiment of this aspect the invention provides a method of detecting plant pathogenic fungal resistance to a fungicide said method comprising detecting the piesence of an amplicon generated during a PCR reaction wheiein said PCR reaction compnses contacting a test sample comprising fungal nucleic acid with a diagnostic primer in the piesence of appropriate nucleotide triphosphates and an agent for polymerisation wherein the detection of said amplicon is directly related to presence or absence of a mutation in said nucleic acid wheiein the presence of said mutation gives rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene
In a piefened embodiment of this aspect the invention provides a method of detecting plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene comprising contacting a test sample comprising fungal nucleic acid with a diagnostic pnmei for a specific mutation, the presence of which gives rise to resistance to said fungicide, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product. In a further preferred embodiment of this aspect the invention provides a method of detecting plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene comprising contacting a test sample comprising fungal nucleic acid with a diagnostic primer for a specific mutation, the presence of which gives rise to resistance to said fungicide, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended only when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product.
The methods of the invention described in the above aspect and embodiments are especially suitable for use with plant pathogenic fungal strains where the presence of a mutation in a cytochrome b gene gives rise to fungicide resistance and most especially to resistance to a strobilurin analogue or a compound in the same cross resistance group and most especially where the mutation in the fungal DNA gives rise to a replacement of a glycine residue at the position corresponding to S. cerevisiae cytochrome b residue 143, more especially to a G|43A replacement in the encoded protein, and especially where the mutation is a G to C base change at the second position in the codon at the position corresponding to S. cerevisiae cytochrome b residue 143.
In a further aspect the invention provides a method of detecting and quantifying the frequency of a mutation giving rise to plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene said method comprising detecting the presence or absence of a mutation in a fungal gene wherein the presence of said mutation gives rise to fungal resistance to said fungicide said method comprising identifying and quantifying the presence or absence of said mutation in fungal nucleic acid using any (or a) single nucleotide polymorphism detection technique.
In a further preferred embodiment of this aspect the invention provides a method of detecting and quantifying the frequency of a mutation giving rise to plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene said method comprising detecting the presence or absence of a mutation in a fungal gene wherein the presence of said mutation gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising identifying and quantifying the presence or absence of said mutation in fungal nucleic acid using any (or a) single nucleotide polymorphism detection technique. In a further embodiment of this aspect the invention provides a method of detecting and quantifying the frequency of a mutation giving rise to plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene said method comprising detecting the presence of an amplicon generated during a PCR reaction wherein said PCR reaction comprises contacting a test sample comprising fungal nucleic acid with appropriate primers in the presence of appropriate nucleotide triphosphates and an agent for polymerisation wherein the detection of said amplicon is directly related to both the presence and absence of a mutation in said nucleic acid wherein the presence of said mutation gives rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene, and detecting and quantifying the relative presence and absence of the said mutation by reference to the presence or absence of an amplicon generated during the PCR reaction.
In a preferred embodiment of this aspect the invention provides a method of detecting and quantifying the frequency of a mutation giving rise to plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene comprising contacting a test sample comprising fungal nucleic acid with diagnostic primers to detect both the presence and absence of a specific mutation in said nucleic acid, the presence of which gives rise to resistance to said fungicide, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primers relating to the absence and the presence of the specific mutation are extended when the appropriate fungal template is present in the sample; and detecting and quantifying the relative presence and absence of the said mutation by reference to the presence or absence of diagnostic primer extension products.
In a further preferred embodiment of this aspect the invention provides a method of detecting and quantifying the frequency of a mutation giving rise to plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene comprising contacting a test sample comprising fungal nucleic acid with diagnostic primers to detect both the presence and absence of a specific mutation in said nucleic acid, the presence of which gives rise to resistance to said fungicide, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primers relating to the absence and the presence of the specific mutation are extended only when the appropriate fungal template is present in the sample; and detecting and quantifying the relative presence and absence of the said mutation by reference to the presence or absence of diagnostic primer extension products.
The methods of the invention described in the above aspect and embodiments are especially suitable for use with plant pathogenic fungal strains where the presence of a mutation in a cytochrome b gene gives rise to fungicide resistance and most especially to resistance to a strobilurin analogue or a compound in the same cross resistance group and most especially where the mutation in the fungal DNA gives rise to a replacement of a glycine residue at the position corresponding to 5. cerevisiae cytochrome b residue 143, more especially to a G| 3A replacement in the encoded protein, and especially where the mutation is a G to C base change at the second position in the codon at the position corresponding to S. cerevisiae cytochrome b residue 143. In a yet further aspect the invention provides a method of selecting an active fungicide and optimal application levels thereof for application to a crop comprising analysing a sample of a fungus capable of infecting said crop and detecting and/or quantifying the presence and/or absence of a mutation in a gene from said fungus wherein the presence of said mutation may give rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene and then selecting an active fungicide and optimal application levels thereof.
In a particularly preferred embodiment of this aspect of the invention the detection method comprises any (or a) single nucleotide polymorphism detection technique and is more preferably comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the specific mutation in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product and the quantification is achieved by contacting a test sample comprising fungal nucleic acid with diagnostic primers to detect both the presence and absence of a specific mutation in said nucleic acid the presence of which gives rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primers relating to the absence and the presence of the specific mutation are extended when the appropriate fungal template is present in the sample; and detecting and quantifying the relative presence and absence of the said mutation by reference to the presence or absence of diagnostic primer extension products.
In a further particularly preferred embodiment of this aspect of the invention the detection method comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the specific mutation in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended only when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product and the quantification is achieved by contacting a test sample comprising fungal nucleic acid with diagnostic primers to detect both the presence and absence of a specific mutation in said nucleic acid the presence of which gives rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primers relating to the absence and the presence of the specific mutation are extended only when the appropriate fungal template is present in the sample; and detecting and quantifying the relative presence and absence of the said mutation by reference to the presence or absence of diagnostic primer extension products.
The methods of the invention described herein are especially suitable for use with plant pathogenic fungal strains where the presence of a mutation in a cytochrome b gene gives rise to fungicide resistance and most especially to resistance to a strobilurin analogue or a compound in the same cross resistance group and most especially where the mutation in the fungal DNA gives rise to a replacement of a glycine residue at the position corresponding to S. cerevisiae cytochrome b residue 143, more especially to a G|43A replacement in the encoded protein, and especially where the mutation is a G to C base change at the second position in the codon at the position corresponding to S. cerevisiae cytochrome b residue 143. In a still further aspect the invention provides a method of controlling fungal infection of a crop comprising applying a fungicide to the crop wherein said fungicide is selected according to any of the selection methods of the invention described above. The method of the invention described above is especially suitable for use with plant pathogenic fungal strains where the presence of a mutation in a cytochrome b gene gives rise to fungicide resistance and most especially to resistance to a strobilurin analogue or a compound in the same cross resistance group. In a yet further aspect the invention provides an assay for the detection of fungicidally active compounds comprising screening the compounds against strains of fungi which have been tested for the presence or absence of a mutation giving rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene according to the methods of the invention described herein and then determining fungicidal activity against said strains of fungi.
The methods of the invention described herein are especially suitable for use with plant pathogenic fungal strains where the presence of a mutation in a cytochrome b gene gives rise to fungicide resistance and most especially to resistance to a strobilurin analogue or a compound in the same cross resistance group and most especially where the mutation in the fungal DNA gives rise to a replacement of a glycine residue at the position corresponding to S. cerevisiae cytochrome b residue 143, more especially to a G|4 A replacement in the encoded protein, and especially where the mutation is a G to C base change at the second position in the codon at the position corresponding to S. cerevisiae cytochrome b residue 143. By applying the methods of the invention described herein the appropriate rate of application of fungicides and/or the appropriate combination of fungicides to be applied to the crop may be determined.
The methods of the invention described herein are particularly suitable for monitoring fungal resistance to a strobilurin analogue or a compound in the same cross resistance group in crops such as cereals, fruit and vegetables such as canola, sunflower, tobacco, sugarbeet, cotton, soya, maize, wheat, barley, rice, sorghum, tomatoes, mangoes, peaches, apples, pears, strawberries, bananas, melons, potatoes, carrot, lettuce, cabbage, onion, vines and turf.
The methods of the invention described herein are particularly sensitive for detecting low frequencies of mutations in mitochondrially encoded genes, such as the cytochrome b gene, making this an especially useful and commercially important way of screening plant pathogenic fungi for the onset of fungicidal resistance wherein the resistance is due to a mutation in a mitochondrially encoded gene. Brief Description of the Drawings The invention will now be illustrated with reference to the following non-limiting Examples and Figures in which :
Figure 1 shows: a diagrammatic representation of the secondary structure of the Scorpion P. viticola primer using the MFold Zucker program
Figure 2a shows: a graph illustrating the PCR amplification of a serial dilution oi P. viticola mutant DNA in a background of wild type DNA using the C specific primer and the Scoφion primer (in duplicate). As indicated on the figure the diamonds representing 50% C/G = line 1 , the diamonds representing 100% G=line 7, the circles representing 10%C =line 2, the circles representing 1 %C =line 3, the circles representing 0.1 %C =line 4, the circles representing 0.01 %C =line 5 and the circles representing NTC=line 6. Figure 2b shows: a graph illustrating a multiplex experiment with P. viticola ARMS primers on two serial dilutions of mutant DNA in a background of wild type DNA (in duplicate). As indicated in the figure the line represented by the diamonds shows the results for 1 : 100 Gfam, the line represented by the triangles shows the results for 1 :500 Gfam, the line represented by the circles shows the results for 1 : 100 Ctet, and the line represented by the squares shows the results for 1 :500 Ctet.
Figure 3a shows: a graph illustrating E. graminis total DNA amplified with the three primer pairs (specific G/C and control primers) (in duplicate). As shown in the figure the line represented by the diamonds shows the results for 1/100 standard, the line represented by the triangles shows the results for 1/100 Gmix and the line represented by the crosses shows the results for 1/100 Cmix.
Figure 3b shows: a graph illustrating the amplification of a sensitive E. graminis isolate with the three primer pairs. As shown in the figure the line represented by the diamonds shows the results for Qmix, 1/100 =line 1 , the line represented by the squares shows the results for
Qmix, 1/1000 =line 2, the line represented by the triangles shows the results for Gmix, 1/100 =line 3, the line represented by the circles shows the results for Gmix, 1/1000 =line 4, the line represented by the cross shows the results for Cmix, 1/100 =line 5, the line represented by the diamonds shows the results for Cmix,l/1000 =line 6. Figure 4 shows: a graph illustrating the amplification of a resistant E. graminis isolate with the three primer pairs. As shown in the figure the line represented by the diamonds shows the results for Qmix, 1/100 =line 1, the line represented by the squares shows the results for Qmix, 1/1000 =hne 2, the line lepresented by the tnangles shows the results for Gmix, 1/100 =lιne 3, the line represented by the diamonds shows the lesults for Gmix, 1/1000 =lιne 4, the line lepiesented by the cross shows the lesults for Cmix, 1/100 =hne 5, the line lepresented by the circles shows the results foi Cmix, 1/1000 =hne 6 Figuie 5a shows a giaph illustiating the PCR amplification of a senal dilution of a wild type R secalis plasmid amplified with the wild type specific pnmer pair (in duplicate) As shown in the figure the line represented by the diamonds shows the lesults for Gplasmid 10Λ8, the line lepresented by the tnangles shows the results foi G-plasmid 10Λ6, the line lepiesented by the squaies shows the results foi G-plasmid 10Λ4 and the line lepiesented by the cucles shows the lesults foi G-plasmid 10Λ2
Figure 5b shows a giaph illustrating the PCR amplification of the highest concentiation of wild type and mutant R secalis plasmids amplified with the wild type specific pnmer pair (in duplicate) As can be seen fiom the figuie the line lepiesented by the diamonds shows the results foi G-plasmid 10Λ8 and the line lepiesented by the triangles shows the results for c- plasmid 10Λ8
Figure 6a shows a giaph illustrating the PCR amplification of a senal dilution of a mutant R secalis plasmid amplified with the mutant specific pnmei pan (in duplicate) As shown in the figure the line repiesented by the diamonds shows the iesults foi c-plasmid 10Λ8, the line lepresented by the tnangles shows the results for c-plasmid 10Λ6, the line lepiesented by the squaies shows the results lor c-plasmid 10Λ4 and the line lepiesented by the cucles shows the iesults foi c-plasmid 10Λ2
Figuie 6b shows a graph illustiating the PCR amplification of the highest concentration of wild type and mutant R secalis plasmids amplified with the mutant specific pnmei pair (in duplicate) As can be seen fiom the figure the line represented by the diamonds shows the lesults for G-plasmid 10Λ8 and the line repiesented by the triangles shows the iesults for c- plasmid 10Λ8
Figuies 7a, b and c show graphs illustiating the PCR amplification of R secalis DNA and cDNA templates in three dilutions with the G primer pair (in duplicate) As can be see fiom the figures the line represented by the diamonds shows total DNA and the line represented by the triangles shows cDNA
Figures 8 a, b and c show graphs illustrating the PCR amplification of /? secalis DNA and cDNA templates in thiee dilutions with the C primer pair (in duplicate) As can be see from the figures the line represented by the diamonds shows total DNA and the line represented by the triangles shows cDNA.
Figure 9a and b show: graphs illustrating the amplification of P. teres P13 and P15 isolates in two dilutions with the three primer pairs (in duplicate). As indicated on the figure in Figure 9a the diamonds representing S-mix = line 1, the triangles representing S-mix 1/10 =line 2, the squares representing G-mix =line 3, the circles representing G-mix 1/10 =line 4, the circles representing C-mix =line 5 and the squares representing C-mix 1/10 =line 6. In figure 9b the diamonds representing s-mix = line 1, the triangles representing s-mix, l/10=line 2, the squares representing g-mix =line 3, the circles representing g-mix, 1/10 =line 4, the circles representing c-mix =line 5 and the squares representing c-mix, 1/10 =line 6.
Detailed Description of the Invention EXAMPLES:
In the first four Examples below the Scorpion™ system (AstraZeneca Diagnostics) was used as a product detection system. This detection system is described in full in PCT application number PCT/GB98/03521 filed in the name of Zeneca Limited on 25 November 1998 the teachings of which are incoφorated herein by reference. This novel detection system uses a tailed primer and an integrated signalling system. The primer has a template binding region and a tail comprising a linker and a target binding region. In use the target binding region in the tail hybridises to complementary sequence in an extension product of the primer. This target specific hybridisation event is coupled to a signalling system wherein hybridisation leads to a detectable change. The detection method of this system offers a number of significant advantages over other systems. Only a single primer/detector species is required. This provides both increased simplicity and enhanced specificity based on the ready availability of the target binding region for hybridisation with the primer extension product. The newly synthesised primer extension product is the target species so the output signal obtainable is directly related to amount of extended primer. It is not dependent on additional hybridisation events or enzymatic steps. Intra and inter-strand competition for the probe site is limited so probe design becomes simplified. As the interaction is unimolecular, the signalling reaction is very rapid, permitting increased cycling rates which is "a significant feature for experimental efficiency. The Scorpion primers designed in the examples described below have the following modifications in common:
• A hexethylene glycol (HEG) monomer as a blocking moiety that is sited between the template binding region of the primer and the tail region, which moiety prevents polymerase mediated chain copying of the tail region of the primer template.
• A FAM fluorescent molecule is added to the 5'end of the primer. FAM is one of the fluorescence molecules that can, for example, be readily detected by the 488nm laser of the ABI PRISM 7700 instrument (PE Biosystems)
• MR is a non-fluorogenic quencher attached to a uracil residue Other fluorescence molecules and quenching mechanisms can also be accommodated in Scoφion primer design and would be suitable to use in this invention.
In Example 4, an intercalating dye was also used as a detection mechanism. The eighteen examples together describe the characterisation of partial cytochrome b gene sequences from a panel of important wild type fungal isolates, whilst Examples 1, 2 and 6 also describe the characterisation of partial cytochrome b gene sequences from fungal isolates which are resistant to strobilurin analogues and other compounds in the same cross resistance group. The methods are particularly suitable for use with the strobilurin analogues azoxystrobin and picoxystrobin.
EXAMPLE 1
In Example 1 , we describe the characterisation of partial Plasmopara viticola cytochrome b gene sequence, the characterisation of a single nucleotide polymoφhism (SNP) that gives rise to strobilurin analogue resistance in P. viticola and the validation of a real time PCR Scoφion assay for the monitoring of this SNP in P. viticola. A multiplexing approach to carrying out the real time PCR assay is also described. P. viticola is the causal agent of vine downy mildew.
The wild type ES2B strobilurin analogue sensitive isolate of P. viticola was collected in 1996 from Spain. This isolate had never been exposed to strobilurin analogue selection. Infected vine leaves were hand picked and stored in a polythene bag and sent to Jealott's Hill Research Station (Zeneca Agrochemicals). Upon arrival the leaves were placed in pairs, with abaxial sporulating surfaces together, over moist absorbent paper in plastic boxes, and incubated for 24-48 hours at 21-24°C. Single lesions were excised from the leaves and the sporangia suspended in 5ml deionised water, then sprayed onto the abaxial surfaces of 5-6 week old vine seedlings (var. Ohanez). Freshly inoculated plants were incubated for 24 hours in a humidity chamber (temperature ambient, relative humidity 100%), then moved to a growth room (day 24°C/r.h. 60%; night 18°C/r.h. 95%; daylength 16 hours; 6,000 lux). Plants were returned to the humidity chamber after 6 days for a further 24 hour period, after which time successful infection showed as sporulating lesions on the abaxial leaf surfaces. Further subculturing was carried out as above, adjusting the sporangial suspension to 5,000- 10,000 sporangia per ml.
A DNA fragment encoding a significant part of wild type P. viticola cytochrome b sequence was amplified using primers based on conserved regions of Phytophthora megasperma and Aspergillus nidulans cytochrome b genes (Cytbl2F (5' TGAACATATTATGAGAGATGT 3') (SEQ ID NO 106)and CytlOR (5' AATTGCATAAAAAGGTAAAAA 3') (SEQ ID NO 1 7) which delineate the sequence encoding amino acid region 66 and 281 of fungal cytochrome b based on the S. cerevisiae numbering system). DNA was extracted from the strobilurin analogue-sensitive isolate, using a phenol/chloroform extraction protocol. Sporangia were washed into 30ml of double distilled H O (ddH2O) from six leaves with 90-100% disease cover (originated from artificially inoculated six week old vine seedlings). The sporangial suspension was filtered through Miracloth (Calbiochem cat # 475855) and centrifuged at 3600φm for 10 minutes at 4°C. The sporangia were then frozen in liquid nitrogen and ground to a fine powder using a pestle and mortar which had been previously cleaned and sterilised by acid washing and autoclaving. 0.5ml of lysis buffer (200mM Tris-HCl (pH8.5), 250mM NaCl, 25mM EDTA and 0.5% SDS) was added and the suspension was transferred to a sterile screw cap 1.5ml Eppendorf tube. 0.5ml of a phenol/chloroform/isoamyl alcohol (25:24: 1) mixture was immediately added and mixed by inverting several times. The tubes were centrifuged for 30 minutes at 14000φm and the aqueous phase transfened to fresh Eppendorf tubes. The phenol/chloroform/isoamyl alcohol extraction was then repeated but this time the tubes were centrifuged at 14000rpm for only 15 minutes. After transferring the aqueous phase to a new Eppendorf tube, a final chloroform extraction was performed. Fungal DNA was then precipitated by adding 0.1 vol of 3M sodium acetate (pH5.5) and 0.6 vol of isopropanol.
After inverting several times, the tubes were centrifuged at 14000φm for 20 minutes at 4°C. The DNA pellet was then washed twice with 70% ethanol, vacuum dried and resuspended in 50μl of ddH O. DNA yield and quality was checked by gel electrophoresis and a serial dilution (1: 10, 1:100 and 1 : 1000) was made in ddH2O for use as template material in subsequent PCRs. PCRs were set up as recommended by the manufacturer of the Taq Polymerase enzyme (Gibco) in a final reaction volume of lOOμl. The primers were added to the reactions to a final concentration of lpmole/μl. lOμl of each DNA dilution was added to the appropriate PCRs. Standard procedures were carried out in order to limit the risk of PCR contamination. 30 cycles of 94°C for 45 sec, 42°C for 45 sec and 72°C for 1 min 30 sec were carried out on a Hybaid Omn-E PCR instrument. An initial step at 94°C for 3 minutes and a final extension at 72°C for 10 minutes were also performed. The efficiency of the PCRs was then assessed by analysing 18μl of the reaction mixtures by gel electrophoresis. A 2μl sample of the ~500bp PCR products was then cloned in the TA PCR cloning pCR2.1 vector (Invitrogen Catalogue No. K4500-01) and transformed into Escherichia coli cells (TOP 10 One Shot™ competent cells) as per the manufacturer's recommendations. A series of resulting clones were checked for the presence of inserts by performing Wizard minipreps (Promega catalogue No. A7100) as per manufacturer's instructions and restriction digest analysis using EcoRI. 6 clones with suitable inserts (~500bp) were then sequenced using Ml 3 forward and reverse primers (ABI377XL automated sequencer). When the nucleotide sequence data from these studies was analysed using the relevant bioinformatics software (Seqman, Editseq and Macaw), the resulting novel sequence was found to encode a new cytochrome b gene with close homology to other known oomycete cytochrome b sequences such as P. megasperma. The sequence of a 61 nucleotide tract of the resultant P. viticola encoding 30bp upstream and downstream of the second base of the Gι4 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.
P. viticola specific primers based on the above analyses used in later amplifications of the cytochrome b region of interest were PL AS 17F (5 ' AAATAACGGTTGGTT A ATTCG 3') (SEQ ID NO 108) and PLAS15R (5' TCTTAAAATTGCATAAAAAGG (SEQ ID NO 109)3') delineating amino acid region 73-283 of fungal cytochrome b according to the S. cerevisiae numbering system.
A strobilurin analogue-resistant isolate of P. viticola was identified at one trial site. Infected vine leaves were collected and processed essentially as above though samples were subcultured as mass populations and not isolated as single lesions prior to testing. The test method to verify strobilurin analogue resistance was a 24 hour preventative spray on 4-week old vine seedlings. A chemical dilution series was prepared by dissolving 5mg strobilurin analogue (strobilurin analogue as used in all examples herein denotes azoxystrobin) (technical material, 97% pure) in 1ml acetone and carrying out a further dilution in deionised water at room temperature to give a rate of lOppm (a dose known to give 100% control of strobilurin analogue sensitive baseline isolate). The abaxial surfaces of the target leaves were sprayed using a DeVilbiss spray gun, lOpsi, to maximum retention. Control plants were sprayed with deionised water only. The treated plants were left to dry in a growth room (conditions as above) overnight. Inoculation of the test P. viticola sample was carried out at 5,000 sporangia per ml and freshly inoculated plants were incubated as described previously. 7 days following inoculation any potentially resistant growth on the treated leaves was isolated and subcultured to provide sufficient material for PCR analysis. This isolate was designated T5.
Partial cytochrome b gene sequence was amplified with PLAS17F and PLAS15R primers from the resistant isolate (T5). Total genomic DNA (nuclear and mitochondrial) from this isolate was extracted using the phenol/chloroform extraction protocol described above. Again DNA presence and quality was checked by gel electrophoresis and suitable aliquots were diluted 1: 10 and 1 : 100 in ddH2O for PCR studies. lOμl of each DNA dilution was then added to Ready .To.Go™ Taq polymerase PCR beads (Amersham Pharmacia Biotech product number 27-9555-01) and made up to 25μl with PLAS17F and PLAS15R primer solutions, each to a final primer concentration of lpmole/μl. Standard procedures were carried out to limit the risk of PCR contamination. 30 cycles PCR was then carried out at 94°C for 45sec, 52°C for 45 sec and 72°C for 1 min 30 sec on a Hybaid Omn-E PCR instrument. An initial step at 94°C for 3 minutes and a final extension step at 72°C for 10 minutes were also included. These PCRs were performed in duplicate. After the analysis of lOμl of the PCRs by gel electrophoresis on an 0.8% TBE agarose gel, the resulting ~500bp PCR products were pooled prior to cloning. A lμl sample of the pooled PCR products was then cloned in the TA cloning pCR2.1 vector (Invitrogen) and transformed into E.coli cells (TOP 10 One Shot™ competent cells) as per the manufacturer's recommendations. A series of resulting clones were checked for the presence of inserts by performing Wizard minipreps (as per Promega instructions) and restriction digest analysis using EcoRI. 10 clones with the correct size inserts (~500bp) were then sequenced using Ml 3 forward and reverse primers (ABI377XL automated sequencer). Analysis of the sequence data using suitable bioinformatics software (Seqman, Editseq and Macaw software) in all 10 cases revealed a G— >C point mutation in the cytochrome b sequence when compared to wild type sequence. This DNA point mutation leads to a single glycine to alanine change at position 143 (according to the S. cerevisiae amino acid coding system).
Different specific ARMS P. viticola primers were designed to detect the presence or absence of this G]43A point mutation: two forward ARMS primers based on the wild type sequence: G-sp-f- 1 : CCTTGGTG ACAAATGAGTTTTTGTGG (SEQ ID NO 1 10) G-sp-f-2: CCTTGGTGACAAATGAGTTTTTGGAG (SEQ ID NO 1 1 1 ) two forward ARMS primers based on the G| A mutation: C-sp-f- 1 : CCTTGGTG ACAAATGAGTTTTTGGCC (SEQ ID NO 1 12)
C-sp-f-2: CCTTGGTGACAAATGAGTTTTTGGAC (SEQ ID NO 1 13) and a control primer designed upstream from the point mutation: STAND: GCCTTGGGGACAAATGAGTTTTTG (SEQ ID NO 1 14)
In all of the above ARMS primers, the -1 base (the 3'end base of the primer sequence) corresponds to the target point mutation site. Bases presented in bold differ from the wild type P. viticola cytochrome b sequence. In all of the ARMS primers (not the control primer), the -20 base was changed from a G to a T base. This was done to disrupt the run of G bases. In the G-sp-f-2 and C-sp-f-2 primers, the -2 position was changed from a G to a A base. In the G-sp-f- 1 , the -3 position was changed from a G to a T base. In the C-sp-f- 1 primer, the -2 primer was changed from a G to a C base. These alterations to the sequence were made to destabilise the primer and render any primer extension more specific to the corresponding template. Examples in the literature have shown that destabilising the ARMS primer decreases the risk of the primer mispriming on the wrong template (Newton et al, Nucleic Acid Research 17 (7) 2503-2516 1989).
The Scoφion™ product detection system was used in this case as a detection mechanism and the detection system was incoφorated on the reverse primer. The resulting amplicon was 234 bp long with the ARMS primers, and 235 bp long with the control primer. The Scoφion primer was designed using Oligo 5 and MFold programs (MFold predicts optimal and suboptimal secondary structures for RNA or DNA molecules using the energy minimization method of Zucker (Zucker, M. (1989) Science 244, 48-52; SantaLucia, J.Jr. (1998). Proc. Natl. Acad. Sci. USA 95, 1460-1465). The sequence of the P. viticola Scorpion primer was:
5' FAM-CCCGCCGTAATTGTAGGGGCTGTACTAATACGGCGGG (SEQ ID NO 115) MR-HEG-GATACCTAATGGATTATTTGAACCTACCT 3'(SEQ ID NO 1 16) Underlined regions are the haiφin forming parts, FAM is the fluorescein dye, MR is a non- fluorogenic quencher attached to a uracil residue and HEG is the replication blocking hexethylene glycol monomer. The sequence in italics is the reverse primer sequence and the sequence in bold is the Scoφion sequence that binds to the extension product of the reverse primer. The stem loop secondary structure of this Scorpion primer can be visualised using the
MFold program (see figure 1). It is predicted to have an energy of -2.2 kcal/mol in its inert form. However in the presence of the extension product the haiφin structure is separated, as the probe sequence of the Scoφion primer binds to the extension product with a predicted energy of -6.1 kcal/mol. This separates the FAM dye from its quencher, causing emission of fluorescence detectable, for example, by an ABI Prism 7700 instrument. The annealing of the Scoφion element onto the newly synthesised strand is therefore energetically favourable compared to the Scoφion stem loop configuration in its inert state.
All primers were synthesised by Oswel DNA Service (Lab 5005, Medical and Biological Sciences Building, Southampton). Before use, the primers were diluted to 5μM in a total volume of 500μl ddH2O each. The primers were then further diluted to a final concentration of 500nM in the PCRs.
In all cases AmpliTaq Gold enzyme (Perkin-Elmer/ ABI) was included in the reaction mix at lunit/25μl reaction. The reaction mix also contained lx buffer (lOmM Tris-HCl (pH8.3), 50mM KC1, 3.5 mM MgCl2, 0.01% gelatine) and lOOμM dNTPs. Amplifications were performed in an ABI Prism 7700 instrument for continuous fluorescence monitoring. A preliminary cycle of 95°C for 10 minutes was performed followed by 50 cycles of 95°C for 15 sec and 60°C for 45 sec. Fluorescence was monitored during the annealing/extension stage throughout all cycles.
Primers were first validated for use in such analyses by using plasmid DNA as template at various concentrations. This was performed in order to check the specificity and sensitivity of the primer designs. Partial wild type cytochrome b gene sequence and the corresponding tract containing the Gι A mutation were cloned into the TA pCR2.1 vector (Invitrogen) for use in this validation process. The C-sp-f-2 and G-sp-f-2 primers were preferred to the C-sp-f- 1 and the G-sp-1 primers as duplicate PCRs gave more consistent results and were slightly more specific. In all cases, plasmid DNA was diluted in lmg/ml bovine serum albumin (BSA). The graph shown in Figure 2a illustrates PCRs where a dilution of mutant plasmid in a background of wild type template was amplified using the ARMS C-sp-f-2 primer. As the C plasmid dilution reduces in the wild type plasmid background, the fluorescence detection is delayed. In all cases, the final plasmid concentration in the PCR was lxlO7 molecules/μl. With each 10 fold dilution of the C plasmid, there is a delay of 3-4 cycles in the detection of fluorescence. When the C plasmid is present at only 1 in 10000 copies in wild type plasmid background, it is still detected by the specific ARMS primer. The C-sp-f-2 primer is totally specific to its corresponding template as no fluorescence can be detected in the 100% wild type plasmid sample in this experiment.
The different possible materials that could be used as starting material for resistance monitoring assays using such Scoφion technology were investigated. Three different isolates were used in this study. For each of these isolates, sporangia were collected both directly from diseased field vine leaves and from artificially innoculated glasshouse-grown leaves (as described previously). In both cases the sporangia were washed off the leaves using ddH 0. The sporangia were then collected by centrifugation and maintained at -80°C until needed. The sporangial samples were then resuspended in 1ml of ddH O and diluted 1 : 10 and 1: 100 again in ddH20. Real time PCR assays were carried out as described above except that bovine serum albumin (0.25μg/μl) was also added to each PCR, using 5μl of each dilution as template. Each dilution was carried out in duplicate, with C-sp-f-2, G-sp-f-2 and the control forward primer each added together with the common Scorpion reverse primer. The use of sporangia collected from glasshouse-grown vine leaves as starting material gave good results with consistent cycle threshold values (Ct). Using sporangia collected directly from field vine leaves gave poor results so the following two approaches were followed in order to improve the quality of the data: to reduce the inhibition in the PCR (field material will contain many more possible contaminants compared to glasshouse-grown leaves) and to make the DNA more available for amplification.
To reduce the effect of inhibitory components on the PCR, the concentration of BSA added to the reactions was increased and the detergent Tween-20 was added to the PCR. To make the DNA more available for amplification, an initial PCR was carried out and the PCR product from this reaction was used as a template in the real time PCR, the spore dilutions were boiled for 10 minutes before being added to the real time PCR to improve cell lysis and the DNA was extracted from the spores using 3 different protocols (DNA Isolator from Genosys Biotechnologies Inc., DNAzol from Helena Biosciences, and Qiagen DNeasy plant mini kit). Each method was tried in turn with sporangia or DNA diluted 1 : 10, 1 : 100 and 1 : 1000 in ddH2O as template. Each dilution was tested in triplicate with the C-sp-f-2 and G- sp-f-2 ARMS primers and the control primer; all with the reverse Scoφion common primer. 5μl of each template was added to the PCR assays and the conditions were essentially as described previously but with addition of 0.25μg/μl BSA (when the BSA concentration was not a variable). DNA extracted using either DNAzol or Qiagen DNA preps gave good and consistent results.
The Gι4 and Aj4 allele frequency was estimated in a P. viticola isolate collected from a field trial (denoted 17 A). Sporangia were collected in ddH 0 off 120 leaves and harvested by centrifugation. This sample contained approximately 2400 lesions and 6.4xl07 sporangia. 12xl06 sporangia were kept at -80°C to be used for DNA extraction. A genomic DNA extraction using the DNeasy Plant Minikit (Qiagen catalogue No. 69103) was carried out and the resulting DNA was diluted 1 : 10 and 1 : 100 in ddH 0 for use as template for real time PCR analysis. The PCR conditions were as described above. The resulting Cycle Threshold (Ct) values were 20 for the G specific primer and 34 with the C specific primer giving a Ct difference of 14 cycles and thus a frequency of resistant alleles of approximately 1 in 10,000.
A multiplex approach has also been evaluated. In this instance, the Scoφion detection element was incoφorated on the ARMS primers to enable the G|43 and Ai43 allele PCR amplifications to be multiplexed in the same PCR. The Scoφion/ARMS primer sequences were as follows: G) 3 allele specific primer:
5'FAM CCCGCCC TGGGATAGCCGAGAATAAAT GGGCGGG (SEQ ID NO 1) MR- HEG CCTTGGTGACAAATGAGTTTTTGGAG (3' SEQ ID NO 118) A|43 allele specific primer:
5'TET CCCGCCC TGGGATAGCCGAGAATAAAT GGGCGGG (SEQ ID NO 1 19) MR- HEG CCTTGGTGACAAATGAGTTTTTGAGC 3 '(SEQ ID NO 120) The Scoφion detection element details are as described above. The At43 allele specific primer was labelled with TET to allow the distinction to be made between the two amplicons. A common reverse (unlabelled) primer was used: Reverse 5' CATAACCAGTCAACAACTTCTTTTCC 3 '(SEQ ID NO 121) The amplicon generated in both cases was 95bp long. Again Scoφion primers were designed using the Oligo5 and MFold programs (as described above). The other real time PCR components were as described above with only the primer concentrations being varied during the validation of this multiplexing approach. By decreasing the final concentration of the G FAM Scoφion to lOOnM and maintaining the final concentration of the C TET Scoφion and the reverse primer at 500nM, it was possible to reliably detect ratios of at least 1 :500 C:G using plasmid DNA as template (see figure 2b). EXAMPLE 2
In Example 2, we report the characterisation of partial Erysiphe graminis f.sp tritici and hordei cytochrome b gene sequences, the characterisation of a SNP that gives rise to resistance to strobilurin analogues or compounds in the same cross resistance group and the description of a real time PCR Scoφion assay for the monitoring of this SNP in E. graminis f.sp. tritici and hordei.
Isolates of E. graminis f.sp. tritici and f.sp. hordei (causal agents of wheat and barley powdery mildew) were collected from Northern France, Germany, Ireland and the United Kingdom. This was achieved by one of two methods: hand collection of field leaves or air spora sampling by car- mounted jet spore trap (Burkard Manufacturing Co. Ltd., Rickmansworth, UK).
Wheat leaves infected with sporulating powdery mildew were collected from sites where the populations had been exposed to strobilurin analogues in multiple trials. Upon return to the laboratory, the leaves were placed in polythene bags and incubated at 21°C overnight. The following day pustules were resporulating. All pustules were subcultured by tapping infected leaves above fresh leaf pieces (wheat cv Rapier, 9 days old) placed over filter paper (Whatman No. 1) in 9cm petri dishes containing 1.2% water agar. The freshly inoculated plates were incubated for 7 days and the resulting colonies were then tested for sensitivity to strobilurin analogues.
For spore trapping, wheat leaves were cut from 9 day old plants (cv. Rapier) and placed on 1.8% water agar in plastic dishes, and maintained at 5°C until required. A jet spore trap was mounted on top of a car and the car was driven at speeds up to 90 km/hr along prearranged routes in each country. The plastic dishes containing the leaf pieces were placed in the base of the spore trap column to allow airborne spores entering the trap to settle onto the leaves. Dishes were changed approximately every 80 km. Once a batch of leaf pieces had been used in the spore trap, they were transferred to square petri dishes (lOcπr) containing 60ml 1.8% water agar and filter paper and stored at 5°C.
On return to Jealott's Hill, the leaves exposed in the spore trap were incubated in a constant temperature room (day length 16hrs, light 4-5,000 lux, temperature 21°C, relative humidity ambient). 5-6 days after exposure in the spore trap, E. graminis pustules could be seen forming (small areas of yellowing of the leaf material followed by appearance of powdery sporulating lesions). These were either subcultured onto leaf pieces in 9cm Petri dishes as "populations" (one population per sampling stage) or excised as single pustule isolates and incubated separately on leaf pieces in 5cm petri dishes on 15ml 1.2% water agar covered with filter paper. Leaf pieces inoculated with populations of E. graminis were incubated for 7 days after which time sporulation was sufficient to inoculate a phenotypic resistance assay. Single spore isolates were incubated for 7 days but subcultured one further time to provide enough material for testing. If sporulation was poor the above process was repeated until good (60-70%) sporulating disease coverage was obtained on all leaf pieces in order to generate sufficient conidia for assay. Testing and subsequent maintenance of resistant isolates was carried out on detached wheat seedling leaves treated 24 hours prior to inoculation with an aqueous solution of strobilurin analogue at 5ppm (a rate known to give 100% control of strobilurin sensitive baseline isolates) and Tween 20 wetting agent. Isolates were tested either as mass populations or single pustule isolates. Conidia were dry-inoculated onto treated leaf pieces. Infected material was incubated in a controlled environment (as described above) for 7 days prior to assessment.
Any growth on leaf pieces treated with 5ppm strobilurin analogue was considered potentially resistant. Material from these lesions was further subcultured onto strobilurin analogue-treated leaves to confirm resistance in planta, and analysed using the molecular assay described in this application. Phenotypic resistance frequencies of approximately 1 in 100 and higher could be detected by the mass population screen, and more precise frequencies were estimated by comparing single spore isolates where growth on treated leaves was comparable to controls (resistant), with plates where the treated leaves gave 100% control of disease (sensitive).
Partial E. graminis f.sp. tritici cytochrome b gene sequence was amplified using primers based on conserved regions of Aspergillus niger and Neurospora crassa cytochrome b genes (Cytb3F (5 ' C AGCTTC AGCTTTCTTCT 3 ' ) (SΕQ ID NO 122) and Cytb9R (5 '
ACTTAAAGGTCTAAATTG 3') (SΕQ ID NO 122) which delineate the sequence encoding amino acid region 86 to 322 of fungal cytochrome b based on the S. cerevisiae numbering system). Approximately 500mg conidia from a strobilurin analogue-sensitive isolate that had had no exposure to strobilurin analogue selection were collected by tapping directly off leaves with sporulating disease into 1.5ml Eppendorf tubes. DNA was extracted from this conidial sample using a phenol/chloroform extraction protocol (see above). DNA presence and quality was analysed by gel electrophoresis and a serial dilution (1 : 10, 1 : 100 and 1 : 1000) was made in ddH O for use as template material in PCRs. PCRs were set up as recommended by the manufacturer of the Taq Polymerase enzyme (Gibco) in a final volume of lOOμl and primers were added to the reactions to a final concentration of lpmole/μl. lOμl of each DNA dilution was added to the appropriate PCRs. Rigorous procedures were undertaken in order to limit the risk of PCR contamination. 30 cycles of 94°C for 45 sec, 42°C for 45 sec and 72°C for 1 min 30 sec were carried out in a Hybaid Omn-E instrument. An initial incubation at 94°C for 3 minutes and a final extension at 72°C for 10 minutes were also performed. The efficiency of the PCRs was then assessed by analysing 18μl of the reaction mixtures by gel electrophoresis. A 2μl sample of the ~500bp PCR products was cloned in the TA PCR cloning pCR2.1 vector (Invitrogen) and transformed into E.coli cells (TOP 10 One Shot™ competent cells) as per the manufacturer's recommendations. A series of resulting clones was checked for the presence of inserts by performing Wizard minipreps (as per Promega instructions) and restriction digest analysis using EcoRI. 6 clones with expected inserts size (~500bp) were then sequenced using M13 forward and reverse primers (ABI377XL automated sequencer). When the nucleotide sequence data from these studies was analysed using the relevant bioinformatics software, the resulting novel sequence was found to encode a new cytochrome b gene with close homology to other known ascomycete cytochrome b sequences. A 61 nucleotide tract, encoding 30 bases upstream and 30 bases downstream of the second base of the Gι4 codon (according to the S.cerevisiae amino acid numbering system), can be found in Table 3. E. graminis specific primers designed on the basis of the novel sequence were used in later amplifications of the cytochrome b region of interest. These were ΕRY1 IF (5' ATGAACAATTGGTACAGTAAT 3') (SΕQ ID NO 124) and ΕRY12R (5' GTTAGGTATAGATCTTAATAT 3') (SEQ ID NO 125). Together they delineate the sequence encoding amino acids region 114-287 of fungal cytochrome b according to the S. cerevisiae coding system.
Partial cytochrome b sequence was amplified with ERY1 IF and ERY12R primers from an E. graminis f.sp. tritici strobilurin analogue-resistant population. Conidia (~200mg) were suspended in 200μl of ddH2O and diluted 1 : 10, 1 : 100 and 1 : 1000 in ddH2O. lOμl of each conidial dilution was added to a Ready. To.Go™ Taq polymerase PCR bead (Amersham Pharmacia Biotech product number 27-9555-01) and made up to 25μl with ERY1 IF and ERY12R primer solutions so that the final primer concentration was lpmole/μl. Standard procedures were carried out to limit the risk of PCR contamination. 30 cycles of 94°C for 45 sec, 52°C for 45 sec and 72°C for 1 min 30 sec were carried out on a Hybaid Omn-E instrument. An initial step at 94°C for 3 minutes and a final extension at 72°C for 10 minutes were also included. All PCRs in this case were performed in triplicate. After the analysis of lOμl of the PCRs by gel electrophoresis on an 0.8% TBE agarose gel, the resulting ~500bp PCR products were pooled prior to cloning. A 2μl sample of the pooled PCR products was cloned in the TA Invitrogen PCR cloning pCR2.1 vector and transformed into E.coli (TOP10 One Shot™ competent cells) as per the manufacturer's recommendations. A series of clones was checked for inserts by performing Wizard minipreps (as per Promega instructions) and restriction digest analysis using EcoRI. 10 clones with inserts of the expected size (~500bp) were then sequenced using Ml 3 forward and reverse primers (ABI377XL automated sequencer). Analysis of the sequence data generated using suitable bioinformatics software revealed a G— >C point mutation in the cytochrome b gene sequence in all 10 isolates when compared with the previously obtained wild type E. graminis f.sp. tritici cytochrome b gene sequence. This DNA point mutation leads to a glycine to alanine change at position 143 (according to the S. cerevisiae coding system).
Partial cytochrome b gene sequence was also characterised from two E. graminis f.sp. hordei isolates. Small samples of conidia (-lOOmg) were tapped off infected barley leaves (which were prepared as previously described for the wheat) into sterile Eppendorf tubes. These conidial samples were kept at -80°C until needed. Each sample was then resuspended in 200μl ddH20, further diluted 1 : 10 and 1 :100, and lOμl of each dilution was used as templates for amplification. Partial cytochrome b gene sequences were amplified with ERY1 IF and ERY12R primers. The PCR conditions and components were as described previously. Upon gel electrophoresis analysis, a PCR product of the expected size (~500bp) was found. This product was cloned in the TA pCR2.1 vector and sequenced as described previously. Upon sequence analysis, it was found that the cytochrome b sequence amplified from E. graminis f.sp. hordei was identical to that from E. graminis f.sp. tritici apart from lbp (T to A change) 379bp downstream of the second base of the Gι4 codon. This base change would not lead to an amino acid change in the final protein (i.e. a silent mutation). 31 different E. graminis isolates were studied using the above protocol and in all cases the sequence found was consistent with the G|4 A mutation being the cause for resistance to strobilurin analogues in E. graminis f.sp. tritici. The Aι4 resistance allele was not detected in the E. graminis f.sp. hordei samples. Specific ARMS E. graminis primers were designed on the basis of the above information on the Gι4 A point mutation: a forward ARMS primer based on the wild type sequence: G-sp- 1 : CCATACGGGCAGATG AGCCACTGGAG (SEQ ID NO 126) a forward ARMS primer based on the G]43A mutation: C-sp- 1 : CCATACGGGCAG ATGAGCCACTGGAC (SEQ ID NO 127) and a control primer designed upstream from the point mutation: STAND2 : GCC ATACGGGCAG ATGAGCCACTG (SEQ ID NO 128) In both the G-sp-1 and the C-sp-1 primers, the -1 base (the 3'end base) corresponds to the second nucleotide of the Gι4 /A|43 codon. Bases in the primers that differ from the wild type cytochrome b E. graminis sequence are in bold. The -2 position was changed from a G to a A base. This was done to destabilise the primer, as is normal in ARMS reactions.
The Scoφion™ product detection system was used in this case as a detection mechanism. Again the Scoφion primer was designed using Oligo 5 and the MFold (see details in Examplel) programs. The sequence of the E. graminis Scorpion primer was: 5' FAM-CCCGCCGTTTTAGCTGCTTTAGCTTTAATGCGGCGGG (SEQ ID NO 129) MR-REG-AACACCTAAAGGATTACCAGATCCTGCAC 3' (SEQ ID NO 130) Underlined regions are the haiφin forming parts, FAM is the fluorescein dye, MR is a non- fluorogenic quencher attached to a uracil residue and HEG is the replication blocking hexethylene glycol monomer. The sequence in italics is the reverse primer sequence and the sequence in bold is the Scoφion sequence which anneals to the extension product of the reverse primer.
All primers were synthesised by Oswel DNA service. Before use, the primers were diluted to 5μM in a total volume of 500μl each. They were then further diluted to a final concentration of 500nM in the PCRs.
Primers were first validated for use in ARMS/Scoφion analyses by using plasmid DNA and total DNA as templates. This was performed in order to check the specificity and sensitivity of the primer designs. DNA fragments comprising partial wild type cytochrome b gene sequence and the corresponding sequence containing the Gι4 A mutation were cloned in the TA pCR2.1 vector to be used in this validation process. Plasmid DNA was always diluted in lmg/ml BSA prior to use as template in real time PCR assays. Fungal DNA for analysis was extracted from an E. graminis f.sp. tritici strobilurin analogue-sensitive control isolate using a phenol/chloroform extraction method (as described previously). A conidial E. graminis f.sp. tritici sample from a French strobilurin analogue-sensitive isolate (F12C) and a conidial E. graminis f.sp. tritici sample from a German strobilurin analogue-resistant isolate (11-8) were then tested using the validated primers at two conidial dilutions. All three fungal isolates originated from single pustules.
In all cases AmpliTaq Gold enzyme (Perkin-Elmer/ABI) was included in the reaction mix at lunit/25μl reaction. The reaction mix also contained lx buffer (lOmM Tris-HCl (pH8.3), 50mM KC1, 3.5 mM MgCl2, 0.01% gelatine), lOOμM dNTPs. Amplifications were performed in an ABI Prism 7700 instrument for continuous fluorescence monitoring. A preliminary incubation of 95°C for lOminutes was performed followed by 50 cycles of 95°C for 15sec and 60°C for 45sec. Fluorescence was monitored during the annealing/extension stage throughout all cycles.
When tested against the control templates (plasmids and DNA from the strobilurin analogue-sensitive control isolate), the E. graminis ARMS/Scoφion primers showed good specificity with no evidence of mispriming occurring from the wrong template. In Figure 3a, amplification of the strobilurin analogue-sensitive control E. graminis DNA at a 1:100 dilution with the three primer mixes (Stand 2 + E. graminis Scoφio , G-sp-1 + E. graminis Scoφio and C-sp-1 + E. graminis Scoφio) are shown. Each reaction was carried out in duplicate. Control and G specific primer reactions emit a strong fluorescence signal whilst the C specific primer reaction does not show any increase in fluorescence. The control and G-specific ARMS primers have recognised and bound to the template whilst the C-specific primer did not bind to the template present in the reaction. In this case, the Gι43:A)4 allele analysis is indicating only presence of the wild type allele.
Figure 3b illustrates PCRs where the French sensitive isolate (F12C) was analysed with the three primer mixes (Stand 2 + E. graminis Scorpion, G-sp-1 + E. graminis Scorpion and C-sp-1 + E. graminis Scoφion). In each case ~200mg conidia were suspended in 200μl ddH2O and diluted 1 : 100 and 1 : 1000 in ddH2O. 5μl of the dilutions was added to the appropriate PCRs. On analysis again, the control and G-specific primer reactions emitted a strong signal whilst the C-specific primer reaction did not show any increase in fluorescence. This indicates that only the wild type allele has been detected in this sample. There is a definite delay in fluorescence being produced when using conidia as template for the reaction compared with using plasmid DNA as template. This is either due to the reduced copies of molecules that can be used as template being present in the reaction or due to inhibitory components being present in the conidial sample.
Figure 4 illustrates PCRs where the German resistant isolate at two conidial dilutions was amplified using the three primer mixes (Stand 2 + E. graminis Scoφio, G-sp-1 + E. graminis Scoφio and C-sp-1 + E. graminis Scoφio). In this case control and C-specific primer reactions emit strong signals whilst the G-specific primer reaction does not show any fluorescence. This indicates that only the mutant G|4 A allele has been detected in this sample. EXAMPLE 3 In Example 3, we report the characterisation of partial cytochrome b Rhynchosporium secalis gene sequence and a real time PCR study where various R. secalis isolates were screened for the G|4 A resistance allele. This is an example where the Gι43A assay was carried out on a species where the point mutation had not previously been identified.
Wild type isolates of R. secalis were collected from the UK and France (see Table 8: R. secalis isolate details). The Kl 124 and K3327 isolates could be considered "baseline" (collected prior to use of strobilurin analogues in the field) and the other isolates were obtained from trial sites which had been exposed to several sprays of strobilurin analogues over a number of seasons. Infected barley leaves were hand picked and stored in a polythene bag and sent to Jealott's Hill Research Station (Zeneca Agrochemicals). Upon arrival in the laboratory single lesions were excised from the leaves, surface sterilised in ethanol (30 seconds) followed by a 0.1 % sodium hypochlorite solution wash (2 minutes) then placed onto Lima Bean agar (see Table 9) and incubated under alternating 12 hour black light
(365nm Philips TLD 18W/08 - Philips Lighting Ltd, Croydon, UK )/12 hour no light cycle at a constant temperature of 19°C for 4-5 days. Colonies growing out of the lesions were subcultured as an uncounted spore suspension on Lima Bean agar and incubated as above for approximately 7 days until sporulation was obtained. Resulting spores were removed and stored in liquid nitrogen until isolates were required. Retrieval of isolates was achieved by plating out the spore suspension onto Lima Bean agar and incubating as above for approximately 7 days until sporulation was obtained.
Table 8: R. secalis isolate details
Partial cytochrome b gene sequence was obtained from two R. secalis isolates (Kl 124 and K3327). These isolates were grown from a suspension of 100,000 spores per ml inoculated in a medium with a non-fermentable carbon source shaking at 85φm for 21 days at 19°C (12hrs light/12hrs dark) and the mycelia were collected by filtering through Miracloth and frozen at -20°C until required. DNA was produced from the mycelia by using a phenol/chloroform extraction protocol (see Example 1). DNA yield and quality were checked by gel electrophoresis and then a serial stock dilution was made (1: 10, 1 :100 and 1: 1000 in ddH2O) for use as templates in PCR amplifications. PCRs were set up as described in earlier examples. The primers used were either degenerate primers (deg4F (5' AGGTYTRTA YTRYGGDTCWTA 3 ' ) (SEQ ID NO 131 ) and deg3R (5 '
AGCDATAACWCCTAATAATTT 3') (SEQ ID NO 132) designed from homologous regions of cytochrome b fungal genes (delineating the sequence encoding amino acid region 100-294 according to S. cerevisiae coding system) or E. graminis specific primers ΕRY1 IF and ΕRY12R (details as in Example 2). A band of the expected size (~500bp) was amplified using both primer pairs from each isolate and each PCR product was cloned in the pCR2.1 TA vector (Invitrogen). Wizard minipreps were carried out to identify clones with inserts of the expected size (~500bp) and 5 clones were submitted for sequencing from each cloning event using the Ml 3 forward and reverse primers. Upon analysis with the relevant bioinformatics software, it was found that a novel cytochrome b gene sequence had been identified which was closely related to other ascomycete cytochrome b gene sequences. A 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the Gι 3 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.
Different specific ARMS R. secalis primers were designed around the Gι4 A point mutation location: two forward ARMS primer based on the wild type sequence: G-sp-2: CCTTATGG ACAGATGTCTTTATGATG (SEQ ID NO 133)
G-sp-3: CCTTATGG ACAGATGTCTTTATGAAG (SEQ ID NO 1 4) two forward ARMS primer based on the predicted G)4 A mutation: C-sp-2: CCTTATGG ACAG ATGTCTTTATG ATC (SEQ ID NO 135)
C-sp-3: CCTTATGGACAGATGTCTTTATGAAC (SEQ ID NO 136) and a control primer designed upstream from the point mutation:
STAND3 : TCCTTATGGACAG ATGTCTTTATG (SEQ ID NO 137) In the ARMS primers, the -1 base (the 3'end base) corresponds to the second nucleotide of the G|43 A] 3 codon. Bases in the primers which differ from the wild type cytochrome b R. secalis sequence are in bold. The -2 position was changed from a G to an A or T base. This was done to destabilise the primer, as is normal for ARMS primers.
The Scoφion™ product detection system was used in this case as a detection mechanism and the Scoφion reverse primer was again designed using the Oligo 5 and the MFold programs (details as in Example 1). The R. secalis Scoφion primer sequence was: 5' FAM-CCCGCCATATTAGCTGCATTAGTATTAATGCGGCGGG (SEQ ID NO 138) - MR-BΈG-TACACCTAAAGGATTACCTGACCCTGCAC 3'(SEQ ID NO 139) (See previous examples for details). All primers were synthesised by Oswel DNA Service. Before use, the primers were diluted to 5μM in a total volume of 500μl each. The primers were then further diluted to a final concentration of 500nM in the PCRs.
Again primers were first validated for use in ARMS/Scoφion analyses by using plasmid DNA as template at various concentrations. This was performed in order to check the specificity and sensitivity of the primer designs. Partial wild type cytochrome b gene sequence and a corresponding sequence containing the Gι43A mutation were cloned in the TA pCR2.1 vector to be used in this validation process. As this mutation has not yet been found in R. secalis DNA, the A|43 point mutation was incoφorated into the sequence using a site directed mutagenesis strategy: the point mutation was incoφorated into a primer design and this primer was used to amplify the region of interest using the wild type clone as template. PCRs were set up using standard methods as previously described and 30 cycles of 94°C for 45 sec, 56°C for 45 sec and 72°C for 1 min 30 sec were performed on a Hybaid Omn-E instrument. An initial incubation of 3 minutes at 94°C and a final extension incubation of 10 minutes at 72°C were also included. The ~370bp PCR product was cloned into the TA pCR2.1 vector and resulting clones were sequenced to check for any PCR induced errors prior to use in this experiment.
Undiluted, the plasmid DNA preparations were calculated to be at concentrations
1 1 7 approx. 2x10 molecules per μl. The two plasmids stocks were therefore diluted to 2x10 , 10 , 10 and 101 molecules/μl in lmg/ml BSA and 5μl aliquots were used of each dilution resulting in - lxlO8, 106, 104 and 102 molecules of plasmid in the respective PCRs. The PCR conditions and components were as described previously. In figure 5a, which shows a serial dilution of the G plasmid detected with the G primer mix, the detection of fluorescence is delayed by ~ 4 cycles with each 10 fold plasmid dilution. Figure 5b shows the highest concentration G (wild type (wt)) and C (mutant) cassette amplified with the G-sp-2 primer mix. The G primer does not misprime off the C template until very late in the PCR even though the DNA template concentration is high (~108 molecules of template in reaction). The significant delay before the G mispriming event therefore demonstrates that the primer has a good window of specificity. The C-sp-2 primer set also shows good specificity through the specific and non specific plasmid dilutions (figure 6a and 6b). G-sp-2 and C-sp-2 primer mixes were used in following experiments instead of G-sp-3 and C-sp-3 primer mixes. The second part of this study was to compare using total (genomic) DNA and cDNA as template for the PCR. Total DNA material was prepared from the R.secalis isolates using a phenol-chloroform extraction method (as described previously). Total RNA was extracted from lOOmg of ground mycelia using the RNeasy Plant minikit (Qiagen catalogue No. 74903) according to the manufacturer's recommendation. First strand cDNA synthesis was then undertaken with lμg of total RNA using RT PCR with the Advantage RT-PCR kit (Clontech catalogue No. K1402-1) according to the manufacturer's recommendation. Pools of total DNA and cDNA from three isolates (K3278, K3274 and K3276) were prepared. The total DNA pool was used as template diluted 1 : 100, 1 : 1000 and 1 : 10000 and the cDNA was used as template neat and diluted 1 :5 and 1 : 10. In each case, 5μl of template was added to the PCRs. Real time PCR conditions described in Example 1 and 2 were also used except that in this case 40 cycles PCR were performed instead of 50. Figure 7a, b and c illustrate results obtained with total DNA and cDNA templates at three dilutions (dilution 1 : total DNA (1 :100) and cDNA (neat); dilution 2: total DNA (1 : 1000) and cDNA (1 :5); dilution 3: total DNA (1 : 10000) and cDNA (1: 10)) amplified using the G primer mix. Figures 8a, b and c illustrate the total DNA and cDNA templates amplified using the C primer mix. Using total DNA instead of cDNA as template gave more sensitive results with earlier Cycle threshold values. In order to give the best chance of detecting any C mutation, total DNA inputs at dilutions of 1 : 10 and 1: 1000 were chosen for future analyses. No fluorescence changes could be detected when the C specific primer mix was used in this 40 cycles PCR indicating that only the wild type Gj4 allele was found in these isolates. EXAMPLE 4
In Example 4, we report the characterisation of partial Pyrenophora teres cytochrome b gene sequence and a study where a Gι4 A resistance allele detection assay was carried out on a variety of P. teres isolates. This is a species where the G]4 A mutation had not been identified previously. This example is divided into two sections; one describing a real time PCR study using an intercalating dye detection method using cDNA preparations of P. teres isolates and the other describing a real time PCR study using a Scoφion detection assay on genomic DNA preparations of P. teres isolates. Real time PCR study using an intercalating dye:
Wild type isolates of P. teres (causal agent of barley net blotch) were collected from the UK and France during 1994, 1996 and 1998 (see Table 10 for P. teres isolate details). 1994 and 1996 isolates could be considered "baseline" (collected prior to use of strobilurin analogues in the field) and 1998 isolates were obtained from trial sites which had been exposed to several sprays of strobilurin analogues over a number of seasons. Infected barley leaves were hand picked and sent to Jealott's Hill Research Station (Zeneca Agrochemicals). Upon arrival in the laboratory, the leaves were incubated in a humid environment at 21° for 24-48 hours. Single lesions were excised from the leaves, surface sterilised in ethanol (30 seconds) followed by a 0.1% sodium hypochlorite solution wash (2 minutes) then placed onto Rose Bengal agar (see Table 9) and incubated under an alternating 12 hour black light/ 12 hour no light regime at a constant temperature of 22°C for 4-5 days. All media described in Table 9 were sterilised by autoclaving at 121 degrees C for 15 mins at 15psi. Colonies growing out of the lesions were subcultured by mycelial plug onto V8+streptomycin agar (see Table 9) and incubated as above for 14 days.
Table 9 Media recipes
Resulting mycelial and spore material was removed and stored in liquid nitrogen until isolates were required. Retrieval of isolates was achieved by plating out stored fungal samples onto V8 agar and incubating as above for 14 days until sporulation was obtained.
Table 10: P. teres isolate details
Partial cytochrome b sequence was identified from two isolates (K1056 and K1916). The initial wild type sequence was obtained from a biological sample prepared by inoculating potato dextrose broth (see Table 9) with a macerated mycelial suspension. The flask was incubated at 85φm on an orbital shaker under a 12 hours white light/12 hours no light regime at a constant temperature of 19°C for 21 days until there was sufficient mycelial material for the DNA extraction protocol. The mycelium was then harvested by filtering through Miracloth and was frozen at -20°C until needed. Total DNA was produced using the phenol/chloroform extraction protocol (see Example 1). After the DNA yield and quality were checked by gel electrophoresis, a serial dilution was made (1: 10, 1 :100 and 1:1000 in ddH2O) for use as PCR templates. Many different primer combinations were tried (specific and degenerates) and in most cases no amplification product was obtained. However, a primer pair that was designed to conserved Aspergillus niger and Neurospora crassa cytochrome b sequences (Cytb3F and Cyt9R, see Example 2 for details) did give a ~500bp PCR product. This product was cloned in the TA pCR2.1 vector (Invitrogen) and 6 clones were sequenced using M13 forward and reverse primers. Upon analysis of the results, it was discovered that the reverse primer had correctly bound to cytochrome b sequence whilst the forward primer had misprimed in DNA sequence with intron-like features. A specific P. teres primer (Pt2R: 5' CTT AC A TCT GTA ATA GGT AAT 3') (SEQ ID NO 140) was designed in the novel stretch of cytochrome b gene and was used with a forward primer that was designed on the basis of Venturia inaequalis cytochrome b gene sequence (Pt5F: 5' TGT TAC TTT AGC AAT GCA CTA 3') (SEQ ID NO 141) on P. teres cDNA template. cDNA was produced from mycelial samples of the two isolates. Total RNA was extracted from lOOmg of ground mycelium using the RNeasy kit (Qiagen) according to the manufacturer's recommendation. First strand cDNA synthesis was prepared from lμg of total RNA using RT PCR with the Advantage RT-PCR Clontech kit (according to the manufacturer's recommendation). 5μl of the resulting cDNA was then used in PCRs. The PCR components and conditions were as described previously. A ~800bp PCR product was amplified for both isolates (delineating the sequence encoding amino acid region 48 to 310 of fungal cytochrome b according to the S. cerevisiae numbering system). In both cases, the PCR product was cloned in the TA pCR2.1 vector (Invitrogen) and 4 clones which contained an expected size insert (~800bp) were sequenced using M13 forward and reverse primers for each isolate. Sequence data analysis revealed that a novel cytochrome b gene sequence had been isolated that was closely related to other known ascomycete cytochrome b sequences. A 61 nucleotide tract of cDNA sequence encoding 30 bases upstream and 30 bases downstream of the second base of the G) 3 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3. Specific ARMS P. teres primers were designed around the Gi 3A point mutation location: a forward ARMS primer based on the wild type sequence: G-sp-4: CCCTACGGGC AAATG AGCCTTTGAAG (SEQ ID NO 142) a forward ARMS primer based on the potential Gι4 A mutation: C-sp-5: CCCTACGGGCAAATGAGCCTTTGATC (SEQ ID NO 143) and a control primer designed upstream from the point mutation: STAND4: ACCCTACGGGC AAATG AGCCTTTG (SEQ ID NO 144) the reverse primer used was:
UNLS4: TACACCTAA AGG ATTTCCTGACCCTGC AA (SEQ ID NO 145)
Again in the ARMS primers, the -1 base (the 3 'end base) corresponds to the second nucleotide of the Gι 3/Al4 codon. Bases in the primers which differ from the wild type cytochrome b P. teres sequence are in bold. The -2 position was changed from a G to an A or T base. This was done to destabilise the primer.
All primers were synthesised by Oswel DNA Service. Before use, the primers were diluted to 5μM in a total volume of 500μl ddH2O each. The primers were then further diluted to a final concentration of 500nM in the PCRs. In this case, an intercalating dye was used for detection of the PCR product. The dye used was YO-PRO-1 dye (Molecular Probes, Seattle Washington, USA) which binds to double stranded DNA and emits fluorescence which is detectable by the ABI Prism 7700 instrument.
Primers were first validated by using plasmid DNA as template at various concentrations. This was done to check the specificity and sensitivity of the primer designs. Partial wild type P. teres cytochrome b gene sequence and a corresponding sequence containing the G| 3A mutation introduced by site directed mutagenesis were cloned in the TA pCR2.1 vector to be used in this validation process (as described in Example 3).
Undiluted, the plasmid DNA stocks were calculated to be approx. 2xlθ" molecules per μl. The two plasmids were diluted to 2xl07, 10s, 10 and 101 molecules/μl and 5μl were used of each dilution resulting in ~ lxlO8, 106, 104 and 102 molecules of plasmid in the respective PCRs (see Example 1 for PCR conditions). The only difference was that YO- PRO-1 dye was added to the reaction mix. The generation of primer dimer product interfered with the signal past cycle 35. This method of detection is less sensitive than the Scoφion detection system because it is more affected by background noise (e.g. fluorescence emission from primer dimer formation). Nevertheless, it was concluded that valuable information could be drawn from using this method but increased caution had to be taken in inteφreting results.
In the following experiment, the isolates described above were checked for the presence of the Gi43A allele. Isolates were grown in a medium with a non-fermentable carbon source to obtain material for ARMS/Scoφion assays. An initial spore suspension was inoculated (1ml at 100,000 spores/ml) into conical flasks containing broth. The cultures were incubated on an orbital shaker as previously described and the resulting mycelia were then harvested for use in cDNA preparations. cDNA material was prepared (as described previously) from each of the isolates. This was done to avoid designing primers within the complex intron/exon organisation of the P. teres cytochrome b sequence. All PCRs were set up as previously described and 50 cycles were carried out. The only difference was that YO-PRO-1 dye was added to the reaction mix. cDNA neat and diluted 1 : 10 were used as template, in all cases 5μl of template were added to the PCR assays. Figures 9 a and b illustrate the PCR amplification results of two of the eleven isolates tested in two dilutions, in duplicate with the three primer pairs. In no case were detectable levels of the G)4 A allele present in the samples tested. Real time PCR study using a Scoφion detection system:
A diagnostic GHSA Scorpion assay was also designed based on the genomic organisation that was determined for the P. teres cytochrome b gene encoding the amino acid region of interest.
The intron/exon organisation around the base of interest was elucidated by carrying out PCR amplifications on genomic DNA preparations with a series of primers designed to the known coding sequence and to subsequently identified intron sequences. Taq Extender™ PCR Additive and Perfect Match® PCR Enhancer (both from Strategene catalogue No. 600148 and 600129 respectively) were used as per manufacturer's instructions in the amplification of large PCR fragments using a variety of different primer combinations. After an initial 94°C incubation for 3 minutes, 30 cycles of 94°C for 45 sec, 52°C for 45 sec and 72°C for 3 minutes were carried out on a Hybaid Omn-E PCR instrument. A final 72°C incubation for 10 minutes was also included. When the PCR products were analysed using gel electrophoresis, a 2.7kb PCR product was found with the primer pair pter23F (coding region 5' ACA TAG TAA TAC TGC TTC AGC 3') (SEQ ID NO 146) - ρter25R (intron region 5' TAC ATT TGA GGC AAA TAT TTC (SEQ ID NO 147) 3') and a 7.5kb PCR product was found with primer pair pter7F (coding region 5' CTA CGG GCA AAT GAG CCT TTG 3') (SEQ ID NO 148) - pter6R (coding region 5' CTC TGG AAC TAT CGC TGC AGG 3') (SEQ ID NO 149). These PCR products were cloned in the pCR-XL-TOPO vector (Invitrogen
Catalogue No. K4700-10) according to the manufacturer's instructions and 2 clones for each cloning event were sequenced as described previously. The second base of the G]4 codon was found to be located at the 3' end of a 36bp exon. A 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the G|4 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.
A series of 31bp ARMS primers and a control primer (for the amplification of both mutant and wild type alleles) were designed on the forward strand whilst the common Scorpion primer was designed on the reverse strand in intron sequence. The resulting amplicon was 121 bp long (with the ARMS primers) and 123bp long (with the control primer). In this case, the second base of the Gι4 codon is on a 36bp exon, only lbp away from the 3' splicing site. Again the Scorpion primer was designed using the Oligo 5 and MFold programs (see details in Example 1). The P. teres Scorpion primer sequence was:
5 'FAM CCC GCC GCA AGC TGA TTT CAT AGG CGG G. (SEQ ID NO 150) MR-HEG TT CAA GTA CAT CCA ATT TCA ATA TAC ACT ' (SEQ ID NO 151)
The Scorpion primer description, the primer synthesis and real time PCR conditions were as described in previous examples.
In the optimisation of this Scoφion assay, a wider variety of primers than in previous Examples were tested for specificity, each with different mismatched bases at their 3' end to cause destabilisation (highlighted in bold), as shown below.
Table 11 : P. teres ARMS primers
Initial validation of the primers was carried out on the wild type and mutant plasmid template at lxlO7 molecules per reaction. Real time PCR on the ABI Prism 7700 instrument was carried out in duplicate for each of the plasmid templates, using both the G and C- specific ARMS primers and the control primer (which amplifies both mutant and wild type alleles) with the common reverse Scoφion primer.
As seen in the Table 12, the different ARMS primer designs gave different windows of specificity when tested against mutant and wild type plasmid templates. When compared to the other primers tested, PT-G-1 and PT-C-5 provided the widest window of specificity. They were therefore chosen as the preferred primer pair for this assay. Primer PT-C-5 has a Ct value of 16 on the correct template, and PT-G-1 also has a Ct value of 16 on the correct template. The PT-C-5 primer misprimes on the wrong template at cycle 34 giving a window of specificity of 18 cycles and the PT-G-1 primer misprimes at cycle 32 giving a window of specificity of 16 cycles equating to approximately 10 fold difference in the sensitivity of the two primers.
Table 12: ARMS primer validation The PT-G-1 and PT-C-5 ARMS primers were tested in a plasmid spiking experiment where the mutant plasmid was 'spiked' in a background of wild type plasmid at frequencies of 1:1, 1:10, 1:100, 1:1,000, 1:10,000 and 1:100,000, all in lmg/ml BSA. In all cases the total plasmid concentration of each frequency in the PCR assay was lxlO7 molecules/reaction. Real time PCR conditions and components were as described previously. The resulting data is summarised in the table below:
Table 13: Spiking experiment results
As the C plasmid reduces in the wild type plasmid background, the fluorescence detection is delayed. With each 10 fold dilution of the C plasmid, there is a delay of 4 cycles in the detection of fluorescence. The PT-C-5 cycle threshold value on one mutant molecule in a background of 10,000 wild type molecules could be clearly seen but the 1 : 100,000 was not distinguishable as the PT-C-5 primer misprimes from the 100% wild type (G) cassette thus masking the lower C:G frequency. This indicates that the ARMS switch in this case will allow a frequency of ≤ 1 : 10,000 to be detected with confidence.
A series of P. teres samples gathered from Cork in Ireland (Ir 5-8, Ir 9-13, Ir 14-17, Ir 18-21 , Ir 30-34 ) were tested using the newly optimised real time Scoφion PCR assay. These groups of 4 or 5 isolates were inoculated onto V8 agar plates and incubated until sporulation of the resulting colony was achieved. Mycelia were harvested from the agar plates in 10ml sterile ddH2O. The mycelial suspension was transferred to a 15ml Falcon tube and centrifuged at 3200φm for 10 minutes. The water was removed and the mycelial mass was divided between two sterile Eppendorf tubes. The mycelia were then pelleted by centrifugation at 13,000φm for 5 minutes. The supernatant was removed using a pipette and one of the mycelial pellets was used in the DNA extraction, the other was kept at -80°C until needed. DNA extraction was carried out using the Qiagen DNeasy Plant Mini Kit protocol for isolation of DNA from plant tissue, as described in the manufacturer's protocol. The DNA was diluted 10-fold and 100- fold for use in the assay and 5μl aliquots of DNA were used in each PCR assay. All isolates were tested with each primer pair (PT-C-5, PT-G-1 and the control primer; each with the common reverse primer containing the Scoφion detection system) in triplicate and in two dilutions.
The results of the isolate screening using the 1 : 10 dilution of genomic DNA as template are shown below:
Table 14 : P. teres real time PCR results
In most cases the PT-C-5 primer only shows a cycle threshold value (Ct) at or later than cycle 34 at which mispriming is shown to occur on plasmid template. In some cases the PT-C-5 primer does not misprime at all. These results demonstrate that there was no evidence of the G143A mutation being present in the samples studied. EXAMPLE 5
In Example 5, we report the characterisation of partial cytochrome b Uncinula necator gene sequence. U. necator is the causal agent of vine powdery mildew. Infected vine leaves and fruit were collected from trial sites and commercial vineyards in France and Italy during 1999 and sent to Jealott's Hill Research Station (Zeneca Agrochemicals). Following arrival in the laboratory, mycelium and spores were transferred using a small paintbrush to fresh surface-sterilised leaves detached from 6-7 leaf seedlings (var. Ohanez). U. necator from each collection site was treated as a separate population. On receipt in the laboratory the inoculated leaves were placed in a constant temperature room at 21°C and incubated for 2-3 weeks. Once sporulating disease was detected, the infected leaves were used to inoculate 3-4 leaf vine seedlings sown directly into a plastic plant propagator. A compressed airline was used to blow conidia off source leaves onto appropriate target leaves of up to 40 vine seedlings per isolate. The lid was replaced on the propagator, which was then incubated in a controlled environment growth room for 2 weeks. Conidia produced on these plants were collected and frozen at -80°C until needed. Total RNA was extracted from 1 OOmg of ground U. necator spores originating from one isolate using the RNeasy kit from Qiagen (according to the manufacturer's recommendation). First strand cDNA synthesis was from lμg of total RNA using RT PCR with the Advantage RT-PCR Clontech kit (according to the manufacturer's recommendation). 5μl of cDNA was used as template for PCR amplification using ERY 1 IF (5'ATGAACAATTGGTACAGTAAT 3') (SEQ ID NO 163) and ERY 4R (5' AAATCTGTTAAAGGCATAGCC 3') (SEQ ID NO 164) which delineate amino acids 1 14 to 309 of fungal cytochrome b based on the S. cerevisiae numbering system. A DNA fragment of the expected size (~500bp) was amplified and the PCR product was cloned in the pCR2.1 TA vector (Invitrogen) according to manufacturer's recommendations. Wizard minipreps were carried out to identify clones with suitable inserts and 5 clones were submitted for sequencing using the M13 forward and reverse primers. Upon analysis with the relevant bioinformatics software (Seqman and Macaw), it was found that a novel cytochrome b gene sequence had been identified which was closely related to other ascomycete cytochrome b sequences. A 61 nucleotide tract of cDNA sequence encoding 30 bases upstream and 30 bases downstream of the second base of the Gι4 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3. Specific U. necator primers were designed based on the novel sequence for use directly on spore material. The presence of intron sequences within the region of interest (500bp around the Gι SNP) was suspected as no previous PCR amplification on biological material had been successful. Taq Extender™ PCR Additive and Perfect Match® PCR Enhancer (both from Strategene) were used (as per manufacturer's instructions) in the amplification of large PCR fragments using a variety of different primer combinations. After an initial 94°C incubation for 3 minutes, 30 cycles of 94°C for 45 sec, 52°C for 45 sec and 72°C for 3 minutes were carried out on a Hybaid Omn- E PCR instrument. A final 72°C incubation for 10 minutes was also included. Primer combinations 2F (5' GTT TTA CCC TAC GGG CAG ATG3') (SEQ ID NO 165) -5R( 5' AAA GAA TCT GTT TAA GGT TGC 3') (SEQ ID NO 166), 2F6R (5' AAA CCA CCT CAA AGA AAC TCC 3') (SEQ ID NO 167) and 4F (5' CAT GAA TAG GAC AAG ATA TCG 3') (SEQ ID NO 168) -6R successfully amplified PCR products ranging from 1.6kb to 3kb in length. These PCR products were cloned in the TA pCR2.1 vector (Invitrogen) and subsequent clones were used for sequencing as described previously. A primer walking strategy was followed for one clone corresponding to each of the different PCR products and the sequence analysis of these three clones showed the presence of two introns (l.όkb and 1.1 kb in length) within the PCR fragments. The second base of the G)4 codon is lObp upstream of an intron splicing site. A 41 nucleotide tract encoding 10 bases upstream and 30 bases downstream of the second base of the Gι43 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3. EXAMPLE 6: In example 6 we report the characterisation of partial Sphaerotheca fuliginea cytochrome b gene sequence and a single nucleotide polymoφhism that gives rise to resistance to strobilurin analogues and compounds in the same cross resistance group. S. fuliginea is the causal agent for cucurbit powdery mildew.
S. fuliginea infected cucumber and melon leaves were collected from the field and conidia were dry inoculated in the laboratory to fresh leaf material (cucumber and melon) using a small paintbrush. Monoconidial isolates were subcultured and tested in planta by 24 hour preventative discriminating dose assay (up to lOOppm doses, known to give a 100% control of wild type strains). Conidia from candidate resistant isolates were removed by aspiration by vacuum pump into a suitable container. Part of this sample was analysed using PCR analysis and the remainder was re-tested to confirm phenotypic resistance.
An RT-PCR strategy was followed (as described in Example 3) on a -lOOmg conidial strobilurin analogue sensitive sample. The resulting cDNA was used as template in a PCR amplification reaction using primers Ery2F (5' TCACCTAGAACATTAACATGA 169) 3'(SEQ ID NO) and 4R (5' AAATCTGTTAAAGGCATAGCC 3 '(SEQ ID NO 170)) which delineate amino acids 108 to 309 of fungal cytochrome b based on the S. cerevisiae numbering system. Other PCR components and conditions were as described previously. A PCR product of the expected size (~600bp) was found during gel electrophoresis analysis of the PCR products and this product was then cloned in the TA pCR2.1 vector (Invitrogen) and 5 clones with correct size inserts (~600bp) were sequenced using M13 forward and reverse primers as described previously. Upon analysis with the relevant bioinformatics software (Seqman and Macaw), it was found that a novel cytochrome b gene sequence had been identified which was closely related to other ascomycete cytochrome b sequences. Specific Sphaerotheca fuliginea PCR primers were then designed for the amplification of the Gι4 region from genomic DNA. Primer pairs SF1 (5' TTCCCTTCGGTCAAATGTCGC 3') (SEQ ID NO 171) - SF8 (5' AAACCCCCTCAGAGAAACTCC 3') (SEQ ID NO 172) and SF1 - SF10 (5' GACCCCGCGCTATCATGTAAG 3') (SEQ ID NO 173) were used in PCR amplifications using spore samples resuspended in ddH 0 as template. The PCR components and conditions were as described in previous examples. The PCR products were analysed by gel electrophoresis and a ~2kb product was found with the SF1/8 primer pair and a ~2.1kb band was found with the SF1/10 primer pair. Both PCR products were cloned in the TA pCR2.1 cloning vector (Invitrogen) and 5 clones were sequenced as described previously. Two clones from both cloning events were fully sequenced using a primer walking strategy. When the sequence data was analysed using the relevant bioinformatics software, it was found that a 1917bp intron was present 9bp downstream from the second base of the Gι43 codon. The cDNA and the genomic (taking in account the intron/exon organisation) sequences of a 37 nucleotide tract encoding 6 bases upstream and 30 bases downstream of the second base of the G!4 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.
Partial cytochrome b gene sequence was also amplified from conidial strobilurin analogue resistant samples. Conidial samples (<50mg) were resuspended in 200μl ddH 0 and diluted 1 :10, 1: 100 in ddH20. lOμl of each dilution was used as template for PCR amplification using the SF1/SF8 specific S. fuliginea primers. Taq Extender™ PCR Additive and Perfect Match® PCR Enhancer (both from Strategene) were used (as per manufacturer's instructions) in the amplification of this large PCR fragment. After an initial 94°C incubation for 3 minutes, 30 cycles of 94°C for 45 sec, 50°C for 45 sec and 72°C for 5 minutes were carried out on a Hybaid Omn-E PCR instrument. A final 72°C incubation for 10 minutes was also included. The PCR products were analysed using gel electrophoresis analysis and an expected size band (~2kb) was found. This was cloned in the TA pCR2.1 vector (Invitrogen) and 10 clones which had the expected size insert were sequenced as described in previous examples. Analysis of the sequence data using suitable bioinformatics software (Seqman, Editseq and Macaw software) revealed a G— >C point mutation in the cytochrome b sequence when compared to wild type sequence in all 10 cases. This DNA point mutation leads to a single glycine to alanine change at position 143 (according to the S. cerevisiae amino acid coding system). EX AMPLE 7:
In example 7 we report the characterisation of partial Mycosphaerella fijiensis var. difformis cytochrome b gene sequence. M. fijiensis is the causal agent of black sigatoka disease on banana.
Infected banana leaves were collected from the field and ascospores inoculated from leaves directly onto artificial media in a petri dish. Monoascosporic isolates were maintained on artificial media and prepared for PCR analysis by shake flask culture in a broth medium. Mycelia were collected through Micracloth and ground to a fine powder using an acid washed and autoclaved sterile pestle and mortar. lOOmg of ground mycelia were used in a genomic DNA extraction and in a first strand cDNA synthesis (as described in previous examples). The genomic DNA was diluted 1 : 10, 1 : 100 and 1 : 1000 in ddH O prior to use as PCR template. 5μl of cDNA and lOμl of each genomic DNA dilution were used as template for PCR amplification using the degenerate primer pair as described in Example 3. The PCR conditions and components were as described in previous Examples. Upon gel electrophoresis analysis of the PCR products, an expected size band (~500bp) was found when cDNA was used as template and a larger band (~1.6kb) was found when genomic DNA was used as template. The two PCR products were cloned in the pCR2.1 TA vector (Invitrogen) and five resulting clones with the correct size inserts (~500bp and 1.6kb) were sequenced using the M13 forward and reverse primers. Upon analysis of the sequence data using the relevant bioinformatics software, it was found that the larger PCR product contained a 1064bp intron, 78bp downstream from the second base of the G]43 codon. Apart from the presence of the intron in the larger PCR product, the DNA sequences were identical. This cytochrome b gene sequence was identified as novel and was closely related to other ascomycete cytochrome b sequences. A 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the Gι4 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3. EXAMPLE 8:
In example 8 we report the characterisation of partial Pseudoperonospora cubensis cytochrome b gene sequence. P. cubensis is the causal agent of cucurbit downy mildew.
Sporangia were washed off infected leaf material into deionised water. The resulting sporangial suspension was inoculated by spray gun onto fresh leaf material at a concentration of 10,000 spores per ml. After disease had developed, a sample of spore suspension, collected in ddH20, was spun in a centrifuge to produce a pellet and kept at -80°C until needed. The P. cubensis sporangia were then resuspended in 200μl of ddH20 and diluted 1:10 and 1: 100 in ddH 0. lOμl of each sporangia dilution was used as template for PCR amplification using primers PLAS17F and PLAS15R (see details in Example 1). The PCR conditions and components were as described in previous Examples. Upon gel electrophoresis analysis of the PCR products, an expected size band (~500bp) was found. This PCR product was then cloned in the pCR2.1 TA vector and five resulting clones with the correct size inserts (~500bp) were sequenced using the M13 forward and reverse primers. Upon analysis with the relevant bioinformatics software, it was found that a novel cytochrome b gene sequence had been identified which was closely related to other oomycete cytochrome b sequences. A 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the Gι4 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3. EXAMPLE 9:
In example 9 we report the characterisation of partial Mycosphaerella graminicola cytochrome b gene sequence. M. graminicola is the causal agent of leaf blotch on wheat.
Infected wheat leaves were collected from the field and incubated in a humid environment to promote spore production. Cirri were removed from leaves and spread onto Czapek Dox V8 agar plates (see Table 9) and incubated in a controlled environment at 19°C for 6 days. Single colony isolates were further subcultured and bulked up by shake flask culture in a suitable medium. Fungal material was removed and maintained at -80°C until needed. A genomic DNA preparation was carried out as described in Example 1 on 200mg of ground mycelia. The genomic DNA yield and quality was checked by gel electrophoresis and diluted 1: 10 and 1 : 100 in ddH20. lOμl of each dilution was used as template for PCR amplification using primers Cyt3F and Cyt9R (details in Example 2). PCR components and conditions were as described in Example 2. The PCR products were analysed by gel electrophoresis and a band of the expected size was found (~500bp). This PCR product was cloned in the TA pCR2.1 vector and 5 clones containing correct size inserts were sequenced as described before. When the sequencing data was analysed using the relevant bioinformatics software, the PCR fragment was found to encode part of a novel cytochrome b gene sequence which showed close homology to those of other ascomycete' s. A 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the G)43 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3. EXAMPLE 10: In example 10 we report the characterisation of partial Colletotrichum graminicola cytochrome b gene sequence. C. graminicola is the causal agent of cereal and grass anthracnose.
Infected leaf material (turf or moss) was collected from the field and the fungal material removed and subcultured on artificial media. Fungal material was bulked up by shake flask culture, harvested and kept at -80°C until needed. A genomic DNA preparation was carried out as described in Example 1 on 200mg of ground mycelia. The genomic DNA yield and quality was assessed by gel electrophoresis and dilutions of 1 : 10 and 1 : 100 in ddH20 were prepared. lOμl of each dilution was used as template for PCR amplification using primers deg4F and deg3R (details in Example 3). PCR components and conditions were are described in Example 3. The PCR products were analysed by gel electrophoresis and a band of the expected size was found (~500bp). This PCR product was cloned in TA pCR2.1 vector and 5 clones containing correct size inserts were sequenced as described before. Upon analysis with the relevant bioinformatics software, it was found that a novel cytochrome b gene sequence had been identified and that this was closely related to other ascomycete cytochrome b sequences. A 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the Gj43 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3. EXAMPLE 11:
In example 1 1 we report the characterisation of partial Colletotrichum gloeosporioides cytochrome b gene sequence. C. gloeosporioides is the causal agent of fruit anthracnose (e.g. pepper, avocado and mango).
Infected plant material (mango or chilli) was collected from the field and fungal material was removed and subcultured on artificial media. Mycelia was bulked up in shake flask culture and harvested by filtration through Miracloth. The mycelia were stored at -80°C until needed. The mycelia were ground using an acid washed sterile pestle and mortar and lOOmg was used in a genomic DNA preparation and a first strand cDNA synthesis (procedures as described in previous examples). lOμl of each genomic dilutions and 5μl neat cDNA was used as template for PCR amplification using primers deg4F and deg3R (primer details in Example 3). PCR components and conditions were as described in previous Examples. The PCR products were analysed by gel electrophoresis and bands of the expected size were found (~500bp). The PCR product was the same size when using genomic DNA or cDNA as template which indicates the lack of introns in the DNA region amplified. The PCR products were cloned in TA pCR2.1 vector and 5 clones containing correct size inserts for each cloning event were sequenced as described in previous Examples. When the sequencing data was analysed using the relevant bioinformatics software, the PCR products were found to be identical in all cases and to encode a novel cytochrome b gene sequence with close homology to other ascomycete sequences. A 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the Gι4 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3. EXAMPLE 12:
In example 12 we report the characterisation of partial Oidium lycopersicwn cytochrome b gene sequence. O. lycopersicwn is a causal agent for tomato powdery mildew. Diseased tomato leaves were collected from the field and conidia subcultured to fresh leaf material by dry inoculation in a settling tower. Conidia growing from the resulting infection were removed by aspiration by vacuum pump into a sterile Eppendorf tube and kept in at -80°C until needed. A first strand cDNA synthesis was carried out on RNA isolated from lOOmg of spores as described previously and 5μl of this cDNA was used for PCR amplification using primers Ery2-4 (details in example 6). The PCR components and conditions were as described previously. When the PCR products were analysed by gel electrophoresis, a PCR product was found at the expected size (~500bp). This PCR product was cloned and 5 clones containing the correct size insert (~500bp) were sequenced as described previously. Upon analysis with the relevant bioinformatics software, it was found that the PCR fragment encodes a novel cytochrome b gene sequence which was closely related to other ascomycete cytochrome b sequences. A 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the Gι4 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.
EXAMPLE 13: In example 13 we report the characterisation of partial Leveillula taurica cytochrome b gene sequence. L. taurica is a causal agent for tomato powdery mildew.
Diseased pepper leaves were collected from the field and conidia dry inoculated to fresh leaf material on whole plants. Conidia from resulting infections were removed by aspiration by vacuum pump into a suitable container and analysed using PCR. Diseased pepper and tomato leaves were collected from the field and glasshouse at Jealott's Hill and infected leaf material was used directly in PCR analysis.
A first strand cDNA synthesis was carried out on RNA isolated from lOOmg of spores or diseased plant material as described previously. When diseased plant material was used as starting material, fungal lesions were enriched by removing non-diseased plant tissue from the preparation. 5μl cDNA aliquots were used for PCR amplification using primers Eryl 1-12 (details in example 2). PCR components and conditions were as described previously. When the PCR products were analysed by gel electrophoresis, a PCR product was found at the expected size (~500bp). This PCR product was cloned and 5 clones containing the correct size insert (~500bp) were sequenced as described previously. Upon analysis with the relevant bioinformatics software, it was found that the PCR product encodes a novel cytochrome b sequence which was closely related to other ascomycete cytochrome b sequences. A 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the Gi codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3. EXAMPLE 14:
In example 14 we report the characterisation of partial Alternaria solani cytochrome b gene sequence. A. solani is the causal agent for early blight in tomato and potato. Infected leaf material (tomato or potato) was collected from the field and the fungal material removed and subcultured on artificial media. Fungal samples were bulked up in shake flask culture. Culture collection isolates had been stored in liquid nitrogen and periodically subcultured on artificial media or subcultured through live host material before re-storing at - 80°C. Mycelia grown in a shake flask were ground using an acid washed sterile pestle and mortar and lOOmg was used in a genomic DNA preparation and a first strand cDNA synthesis (procedures as described in previous examples). lOμl of each genomic dilutions and 5μl neat cDNA was used as template for PCR amplification using primers deg4F and deg3R (details in Example 3). PCR components and conditions were as described in Example 3. The PCR products were analysed by gel electrophoresis and bands of the expected size were found (~500bp). The PCR product was the same size when using genomic DNA or cDNA as template which indicates the lack of introns in the DNA region amplified. The PCR products were cloned in TA pCR2.1 vector and 5 clones containing correct size inserts for each cloning event were sequenced as described before. When the sequencing data was analysed using the relevant bioinformatics software, the PCR products were found to be identical in all cases and to encode a novel cytochrome b gene sequence which shows close homology to other ascomycete sequences. A 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the Gι4 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.
A sequence only 12bp different from the previously isolated A. solani sequence was also amplified when using genomic DNA extracted directly from field infected tomato leaves as template for PCR amplification using primers Eryl 1-12 (see above for details). Although this DNA sequence contained 12 nucleotide differences, it did not result in any difference at the amino acid level when the two sequences were translated. The significant difference between these two sequences was the presence of an ~1.2kb intron, 62bp downstream of the second base in the G]4 codon. These differences in intron/exon organisation and codon usage are evidence that such variations are possible within one species. EXAMPLE 15: In example 15 we report the characterisation of partial Cercospora arachidola cytochrome b gene sequence. C. arachidola is the causal agent of peanut leaf blotch.
Infected leaf material (peanut) was collected from the field and the fungal material removed and subcultured on artificial media. Cultures were stored in liquid nitrogen until required. Material was removed from storage onto agar and resulting colonies bulked up in shake flask culture and kept at -80°C until needed. Mycelia were ground using an acid washed sterile pestle and mortar and lOOmg was used in a genomic DNA preparation and a first strand cDNA synthesis (procedures as described in previous examples). lOμl of each genomic dilutions and 5μl neat cDNA were used as template for PCR amplification using primers deg4F and deg3R (details in Example 3). PCR components and conditions were are described in Example 3. The PCR products were analysed by gel electrophoresis and bands of the expected size were found (~500bp). Again the PCR product was the same size when using genomic DNA or cDNA as template which indicates the lack of introns in the DNA region amplified. The PCR products were cloned in TA pCR2.1 vector and 5 clones containing correct size inserts for each cloning event were sequenced as described before. When the sequencing data was analysed using the relevant bioinformatics software, the PCR products were was found to be identical in all cases and to encode a novel cytochrome b gene sequence which showed close homology to other cytochrome b gene sequences. A 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the Gι4 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3. EXAMPLE 16: In example 16 we report the characterisation of partial Rhizoctonia solani cytochrome b gene sequence. R. solani is the causal agent of root stem rot or damping off.
Infected leaf material (rice) was collected from the field and the fungal material removed and subcultured on artificial media. Cultures were stored in liquid nitrogen until required. Material was removed from storage onto agar and resulting colonies bulked up in shake flask culture and kept at -80°C until needed. A first strand cDNA synthesis was carried out on RNA isolated from lOOmg of ground mycelia as described previously and 5μl was used for PCR amplification using basidiomycete degenerate primers IF (5' WYTRGTAYTAATGATGGCTATHGG 3') (SEQ ID NO 174) and IR (5' TCTTARWATWGCATAGAAWGG) 3' (SEQ ID NO 175) which delineate amino acids 121 to 283 of fungal cytochrome b according to the S. cerevisae numbering system. PCR components and conditions were as described previously. When the PCR products were analysed by gel electrophoresis, a PCR product was found at the expected size (~500bp). This PCR product was cloned and 5 clones containing the correct size insert (~500bp) were sequenced as described previously. When the sequencing data was analysed using the relevant bioinformatics software, the PCR product was found to encode a novel cytochrome b gene sequence which showed close homology to other basidiomycete sequences. A 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the Gι43 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3.
EXAMPLE 17: In example 17 we report the characterisation of partial Pythium aphanidermatum cytochrome b gene sequence. P. aphanidermatum is the causal agent of damping off.
Infected leaf material (turf) was collected from the field and the fungal material removed and subcultured on artificial media. Cultures were stored in liquid nitrogen until required. Material was removed from storage onto agar and resulting colonies bulked up in shake flask culture and kept at -80°C until needed. A genomic DNA preparation was carried out as described in Example 1 on 200mg of ground mycelia. The genomic DNA yield was analysed by gel electrophoresis and stocks were diluted 1:10 and 1 : 100 in ddH20. lOμl of each dilution was used as template for PCR amplification using primers PLAS17F and PLAS 15R (details in Example 1). PCR components and conditions were are described in
Example 1. The PCR products were analysed by gel electrophoresis and a band of the correct size was found (~500bp). This PCR product was cloned in TA Invitrogen pCR2.1 vector and 5 clones containing correct size inserts were sequenced as described before. When the sequencing data was analysed using the relevant bioinformatics software, the PCR fragment was found to encode a novel cytochrome b gene sequence which showed close homology to other oomycete sequences. A 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the G|43 codon (according to the S. cerevisiae amino acid numbering system) can be found in Table 3. EXAMPLE 18 In example 18 we report the characterisation of partial Mycosphaerella musicola cytochrome b gene sequence. M. musicola is the causal agent of yellow sigatoka disease on banana.
Infected banana leaves were collected from the field and ascospores inoculated from leaves directly onto artificial media in a petri dish. Monoascosporic isolates were maintained on artificial media and prepared for PCR analysis by shake flask culture in a broth medium. Mycelia were collected through Miracloth and ground to a fine powder using an acid washed sterile pestle and mortar. lOOmg of ground mycelia were used in a genomic DNA extraction and in a first strand cDNA synthesis (as described in Example 7). The genomic DNA was diluted 1:10, 1:100 and 1:1000 in ddH2O prior to use as PCR template. 5μl of cDNA and lOμl of each genomic dilution were used as template for PCR amplification using the degenerate primer pair F4 R3 (as described in Example 3). The PCR conditions and components were as described in previous Examples. Upon gel electrophoresis analysis of the PCR products, an expected size band (~500bp) was found when both the genomic DNA and cDNA was used as template. The two PCR products were cloned in the pCR2.1 TA vector and 5 resulting clones with the correct size inserts (~500bp) were sequenced using the
M13 forward and reverse primers. Upon analysis of the sequence data using the relevant bioinformatics software, it was found that the PCR fragments encoded a novel cytochrome b gene sequence with close homology to other ascomycete cytochrome b gene sequences. A 61 nucleotide tract encoding 30 bases upstream and 30 bases downstream of the second base of the G] codon (according to the amino acid numbering system) can be found in Table 3.

Claims

1. A method for detecting a mutation in fungal nucleic acid wherein the presence of said mutation gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising identifying the presence or absence of said mutation in fungal nucleic acid using any (or a) single nucleotide polymoφhism detection technique.
2. A method for detecting a mutation in fungal nucleic acid wherein the presence of said mutation gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising detecting the presence of an amplicon generated during a PCR reaction wherein said PCR reaction comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer in the presence of appropriate nucleotide triphosphates and an agent for polymerisation wherein the detection of said amplicon is directly related to the presence or absence of said mutation in said nucleic acid.
3. A method for detecting a mutation in fungal nucleic acid wherein the presence of said mutation gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group which method comprises contacting a test sample comprising fungal nucleic acid with an appropriate diagnostic primer in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended either when the said mutation is present in the sample or when wild type sequence is present; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product.
4. A method for detecting a mutation in fungal nucleic acid according to claim 2 wherein said method comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the specific mutation in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product.
5. A method according to any of the preceding claims wherein the mutation is present in a fungal cytochrome b gene where said mutation results in the inhibition of a strobilurin analogue or any other compound in the same cross resistance group to the active site of the cytochrome b protein but still allows the respiration process to occur.
6. A method according to the previous claim wherein the mutation in the fungal nucleic acid results in the replacement of a glycine residue at the position corresponding to S. cerevisiae cytochrome b residue 143 in the encoded protein with an amino acid selected from the group arginine, serine, cysteine, valine, aspartic acid and alanine.
7. A method according to any of the preceding claims wherein the mutation in the fungal nucleic acid results in the replacement of a glycine residue at the position corresponding to S. cerevisiae cytochrome b residue 143 in the encoded protein with an alanine.
8. A method according to claim 2 for the detection of a mutation in a fungal cytochrome b gene resulting in a G|4 A replacement in the encoded protein wherein said mutation gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising detecting the presence of an amplicon generated during a PCR reaction wherein said PCR reaction comprises contacting a test sample comprising fungal nucleic acid with a primer in the presence of appropriate nucleotide triphosphates and an agent for polymerisation wherein the detection of said amplicon is directly related to presence or absence of said mutation in said nucleic acid.
9. A method according to claim 3 for the detection of a mutation in a fungal cytochrome b gene resulting in a Gj43A replacement in the encoded protein said method comprising contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the mutation resulting in a Gι43A replacement in the encoded protein in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended when a mutation is present in the sample resulting in a Gι4 A replacement in the encoded protein; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product.
10. A method according to any of the preceding claims wherein the fungal gene is present in a plant pathogenic fungus selected from the group consisting oi Plasmopara viticola, Erysiphe graminis f.sp. tritici/liordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporiodes, Oidium lycopersicwn, Magnaporthe grisea, Phytophthora infestans, Leveillula taurica, Psuedoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola and Cercospora arachidola.
1 1. A method for detecting fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising identifying the presence or absence of a mutation in fungal nucleic acid wherein the presence of said mutation gives rise to resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising identifying the presence or absence of a single nucleotide polymoφhism occurring at a position corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the cytochrome b protein.
12. A method according to claim 11 wherein the said single nucleotide polymorphism occurs at a position corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143.
13. A method according to any of the preceding claims wherein the single nucleotide polymoφhism which is detected is a G to C base change occurring at a position corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the cytochrome b protein.
14. A fungal DNA sequence encoding all or part of a cytochrome b protein wherein said DNA sequence encodes a glycine residue at the position corresponding to S. cerevisiae cytochrome b residue 143 and is obtainable from a fungus sleeted from the group consisting oi Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, , Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator,
Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicwn, Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola and Cercospora arachidola.
15. A fungal DNA sequence according to claim 14 comprising all or part of a DNA sequence selected from the group SEQ ID NO 1; SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 1 1, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 18, SEQ ID NO 19,
SEQ ID NO 20 and SEQ ID NO 21
16. A fungal DNA sequence encoding all or part of a cytochrome b protein which, when said sequence is lined up against the corresponding wild type DNA sequence encoding a cytochrome b protein, is seen to contain a single nucleotide polymoφhism mutation at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein which results in the replacement of the normal glycine residue with an alternative amino acid with the proviso that said DNA sequence is not the Mycena galopoda sequence encoding cytochrome b.
7. A fungal DNA sequence according to claim 16 wherein said single nucleotide polymorphism mutation occurs at a position corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein which results in the replacement of the normal glycine residue with an alternative amino acid with the proviso that said DNA sequence is not the Mycena galopoda sequence encoding cytochrome b.
18. A fungal DNA sequence encoding all or part of a cytochrome b protein wherein said DNA sequence encodes an alanine residue at the position corresponding to 5. cerevisiae cytochrome b residue 143 and is obtainable from a fungus sleeted from the group consisting of Plasmopara viticola, Erysiphe graminis f.sp. tritici/hordei, Rhynchosporium secalis, Pyrenophora teres; Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides; Oidium lycopersicwn, Magnaporthe grisea, Phytophthora infestans,
Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola and Cercospora arachidola.
19 A fungal DNA sequence encoding all or part of a cytochrome b protein according to claim 18 wherein said DNA sequence contains a single nucleotide polymorphism which results in the replacement of the normal guanine reside with a cytosine residue at a position corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein with the proviso that said DNA sequence is not the Mycena galopoda sequence encoding cytochrome b.
20. A fungal DNA sequence according to any of claims 16 to 19 comprising all or part of a sequence selected from the group SEQ ID NO 176; SEQ ID NO 177, SEQ ID NO 178, SEQ ID NO 179, SEQ ID NO 180, SEQ ID NO 181, SEQ ID NO 182, SEQ ID NO 183, SEQ ID NO 184, SEQ ID NO 185, SEQ ID NO 186, SEQ ID NO 187, SEQ
ID NO 188, SEQ ID NO 189, SEQ ID NO 190, SEQ ID NO 191 , SEQ ID NO 192, SEQ ID NO 193, SEQ ID NO 194, SEQ ID NO 195 and SEQ ID NO 196.
21. A fungal cytochrome b protein which confers fungal resistance to a strobilurin analogue or a compound within the same cross resistance group wherein in said protein a normal glycine residue is altered due to the presence of a mutation in the DNA coding for said protein said mutation occurring at a position corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein with the proviso that protein is not the Mycena galopoda cytochrome b protein.
22. A fungal cytochrome b protein according to claim 21 wherein in said protein a normal glycine residue is altered due to the presence of a mutation in the DNA coding for said protein said mutation occurring at a position corresponding to the second base in the triplet coding for the amino acid at the position corresponding to 5. cerevisiae cytochrome b residue 143 in the protein with the proviso that protein is not the Mycena galopoda cytochrome b protein.
23. A method for the detection of a mutation in fungal cytochrome b gene resulting in the replacement of a glycine residue in the encoded protein at the position conesponding to S. cerevisiae cytochrome b residue 143 said method comprising identifying the presence and absence of said mutation in a sample of fungal nucleic acid wherein any
(or a) single nucleotide polymoφhism detection method is based on the sequence information from around 30 to 90 nucleotides upstream and/or downstream of the position corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in either the wild type or mutant protein.
24. A method according to claim 23 wherein any (or a) single nucleotide polymoφhism detection method is based on the sequence information from around 30 to 90 nucleotides upstream and/or downstream of the position corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in either the wild type or mutant protein.
25. An allele specific oligonucleotide capable of binding to a fungal nucleic acid sequence encoding a wild type cytochrome b protein selected from the group consisting oi Plasmopara viticola, Erysiphe graminis f.sp. tritici/liordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola,
Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicwn, Leveillula tauiica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola and Cercospora arachidola wherein said oligonucleotide comprises a sequence which recognises a nucelic acid sequence encoding a glycine residue at the position corresponding to S. cerevisiae cytochrome b residue 143 .
26. An allele specific oligonucleotide capable of binding to a fungal nucleic acid sequence encoding a mutant cytochrome b protein wherein said oligonucleotide comprises a sequence which recognises a nucleic acid sequence encoding an amino acid selected from the group arginine, serine, cysteine, valine, aspartic acid, glutamic acid, tryptophan, or alanine. at the position conesponding to S. cerevisiae cytochrome b residue 143 .
27. A diagnostic primer or a diagnostic oligonucleotide capable of binding to a template comprising a mutant type fungal cytochrome b nucleotide sequence wherein the final 3' nucleotide of the primer or oligonucleotide corresponds to a nucleotide present in said mutant form of a fungal cytochrome b gene and the presence of said nucleotide gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group.
28. A diagnostic primer according to claim 27 wherein either the penultimate nucleotides (-2) or (-3) of the primer is not the same as that present in the corresponding position in the wild type cytochrome b sequence.
29. One or more diagnostic primers for detecting a Gι43A mutation in a fungal cytochrome b gene selected from the group consisting of SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 25, SEQ ID NO 26, SEQ ID NO 27, SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 33, SEQ ID NO 34, SEQ ID NO 35, SEQ ID NO 36, SEQ ID NO 37, SEQ ID NO 38,
SEQ ID NO39, SEQ ID NO 40, SEQ ID NO41 and SEQ ID NO 42 and derivatives thereof wherein the final nucleotide at the 3' end is identical to the sequences given above and wherein up to 10, such as up to 8, 6, 4, 2, 1, of the remaining nucleotides may be varied without significantly affecting the properties of the diagnostic primer.
30. An allele specific oligonucleotide probe capable of detecting a fungal cytochrome b gene polymoφhism at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein.
31. An allele specific oligonucleotide probe according to claim 30 wherein said polymorphism is at a position in the DNA corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the protein.
32. An allele specific oligonucleotide probe according to claim 31 wherein the polymoφhism is a guanine to cytosine base change.
33. A diagnostic kit comprising one or more of the diagnostic primers as claimed in claims 27 to 29, or an allele specific oligonucleotide as claimed in claims 25 or 26 or an allele specific oligonucleotide probe as claimed in claim 30 to 32, nucleotide triphosphates, polymerase, and buffer solution.
34. A method of detecting plant pathogenic fungal resistance to a fungicide said method comprising detecting a mutation in a fungal gene wherein the presence of said mutation gives rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene using any (or a ) single nucleotide polymoφhism technique.
35. A method of detecting plant pathogenic fungal resistance to a fungicide said method comprising detecting the presence of an amplicon generated during a PCR reaction wherein said PCR reaction comprises contacting a test sample comprising fungal nucleic acid with a primer in the presence of appropriate nucleotide triphosphates and an agent for polymerisation wherein the detection of said amplicon is directly related to presence or absence of a mutation in said nucleic acid wherein the presence of said mutation gives rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene.
36. A method of detecting plant pathogenic fungal resistance to a fungicide according to claim 34 or claim 35 said method comprising contacting a test sample comprising fungal nucleic acid with a diagnostic primer for a specific mutation the presence of which gives rise to fungicide resistance in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product.
37. A method of detecting and quantifying the frequency of a mutation giving rise to plant pathogenic fungal resistance to a fungicide whose target protein is encoded by a mitochondrial gene said method comprising detecting the presence or absence of a mutation in a fungal gene wherein the presence of said mutation gives rise to fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising identifying and quantifying the presence or absence of said mutation in fungal nucleic acid using any (or a) single nucleotide polymoφhism detection technique.
38. A method according to claim 37 said method comprising detecting the presence of an amplicon generated during a PCR reaction wherein said PCR reaction comprises contacting a test sample comprising fungal nucleic acid with appropriate primers in the presence of appropriate nucleotide triphosphates and an agent for polymerisation wherein the detection of said amplicon is directly related to both the presence and absence of a mutation in said nucleic acid wherein the presence of said mutation gives rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene, and detecting and quantifying the relative presence and absence of the said mutation by reference to the presence or absence of an amplicon generated during the PCR reaction.
39. A method according to claim 37 or claim 38 comprising contacting a test sample comprising fungal nucleic acid with diagnostic primers to detect both the presence and absence of a specific mutation in said nucleic acid the presence of which gives rise to fungicide resistance to a fungicide whose target protein is encoded by a mitochondrial gene, in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primers relating to the absence and the presence of the specific mutation are extended when the appropriate fungal template is present in the sample; and detecting and quantifying the relative presence and absence of the said mutation by reference to the presence or absence of diagnostic primer extension products.
40. A method of selecting an active fungicide and optimal application levels thereof for application to a crop comprising analysing a sample of a fungus capable of infecting said crop and detecting and/or quantifying the presence and/or absence of a mutation in a gene from said fungus wherein the presence of said mutation may give rise to resistance to a fungicide whose target protein is encoded by a mitochondrial gene and then selecting an active fungicide and optimal application levels thereof.
41. A method according to claim 40 wherein the detection method uses any (or a) single nucleotide polymoφhism detection technique.
42. A method according to claim 40 or claim 41 wherein the detection method comprises contacting a test sample comprising fungal nucleic acid with a diagnostic primer for the specific mutation in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is extended when the said mutation is present in the sample; and detecting the presence or absence of the said mutation by reference to the presence or absence of a diagnostic primer extension product.
43. A method of controlling fungal infection of a crop comprising applying a fungicide to the crop wherein said fungicide is selected according to any of claims 40 to 42.
44. A method according to any of claims 34 to 43 wherein the fungicide is a strobilurin analogue or any other compound in the same cross resistance group.
45. A method for detecting fungal resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising identifying the presence or absence of a mutation in fungal nucleic acid wherein the presence of said mutation gives rise to resistance to a strobilurin analogue or any other compound in the same cross resistance group said method comprising identifying the presence or absence of a single nucleotide polymoφhism occurring at a position in the DNA corresponding to one or more of the bases in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the cytochrome b protein.
46. A method for detecting fungal resistance to a strobilurin analogue according to claim 45 said method comprising identifying the presence or absence of a single nucleotide polymorphism occurring at a position in the DNA corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the cytochrome b protein.
47. A method according to any of the preceding claims wherein the method of detection and/or quantifying is based on fluorescence detection of diagnostic primer extension products.
48. A method according to any of the preceding claims wherein the method of detection involves the use of the Scoφion™ detection system.
49. A method according to any of claims 34 to 48 wherein said mutation occurs at a position in the DNA corresponding to the second base in the triplet coding for the amino acid at the position corresponding to S. cerevisiae cytochrome b residue 143 in the cytochrome b protein.
50. A method according to any of claims 34 to 49 wherein the said mutation is a guanine to cytosine change resulting in a G143A replacement in the encoded protein where a wild type glycine residue is substituted with an alanine residue at the position corresponding to S. cerevisiae cytochrome b residue 143.
51. A computer readable medium having stored thereon any of the sequences in any of the previous claims including all or part of a DNA sequence or protein sequence encoding a mutant cytochrome b protein as herein described wherein the presence of a mutation gives rise to fungal resistance to a strobilurin analogue or any compound in the same cross resistance group; all or part of a DNA or protein sequence encoding a wild type cytochrome b sequence from a fungus selected from the group
Plasmopara viticola, Erysiphe graminis f.sp. tritici/liordei, Rhynchosporium secalis, Pyrenophora teres, Mycosphaerella graminicola, Venturia inaequalis, Mycosphaerella fijiensis var. difformis, Sphaerotheca fuliginea, Uncinula necator, Colletotrichum graminicola, Pythium aphanidermatum, Colletotrichum gloeosporioides, Oidium lycopersicum, Magnaporthe grisea .Phytophthora infestans,
Leveillula taurica, Pseudoperonospora cubensis, Alternaria solani, Rhizoctonia solani, Mycosphaerella musicola and Cercospora arachidola; or any allele specific oligonucleotide; allele specific primer, allele specific oligonucleotide probe, common or diagnostic primer according to any of the preceding claims..
52. A diagnostic kit for use in a method according to any of claims 1 to 13, 21 or 34 to 50.
3. A diagnostic kit according to claim 52 comprising one or more of the following: diagnostic, wild type, control and/or common oligonucleotide primers, allele specific oligonucleotide probes, appropriate nucleotide triphosphates, for example dATP, dCTP, dGTP, dTTP, a suitable polymerase, and a buffer solution.
EP00925493A 1999-04-30 2000-04-26 Method of detection of cytochrome b mutations in funghi leading to resistance against anti-fungal agents Withdrawn EP1181391A2 (en)

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
GBGB9910100.8A GB9910100D0 (en) 1999-04-30 1999-04-30 Assay
GB9910100 1999-04-30
GB0006004A GB0006004D0 (en) 2000-03-13 2000-03-13 Assay
GB0006004 2000-03-13
GB0007901 2000-03-31
GB0007901A GB0007901D0 (en) 2000-03-31 2000-03-31 Methods
PCT/GB2000/001620 WO2000066773A2 (en) 1999-04-30 2000-04-26 Method of detection of cytochrome b mutations in funghi leading to resistance against anti-fungal agents

Publications (1)

Publication Number Publication Date
EP1181391A2 true EP1181391A2 (en) 2002-02-27

Family

ID=27255594

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00925493A Withdrawn EP1181391A2 (en) 1999-04-30 2000-04-26 Method of detection of cytochrome b mutations in funghi leading to resistance against anti-fungal agents

Country Status (8)

Country Link
EP (1) EP1181391A2 (en)
JP (1) JP2002542803A (en)
KR (1) KR20020008163A (en)
CN (1) CN1359425A (en)
AU (1) AU781410C (en)
BR (1) BR0010163A (en)
CA (1) CA2370117A1 (en)
WO (1) WO2000066773A2 (en)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1118677A1 (en) * 2000-01-17 2001-07-25 Novartis AG Oligonucleotides useful in identifying fungicide resistant plant pathogenic fungi
JP2002142774A (en) * 2000-11-14 2002-05-21 Ss Pharmaceut Co Ltd Nucleic acid for detecting fungi and method for detecting fungi using the same
EP3429357B1 (en) * 2016-03-16 2025-09-17 Basf Se Use of a specific tetrazolinone for combating resistant phytopathogenic fungi on cereals
CZ309242B6 (en) * 2017-10-31 2022-06-15 VÝZKUMNÝ A ŠLECHTITELSKÝ ÚSTAV OVOCNÁŘSKÝ HOLOVOUSY s.r.o Kit for detecting G143A mutation causing resistance to QoI fungicides
CN112322709B (en) * 2020-11-23 2022-07-05 河北省农林科学院植物保护研究所 Method for rapidly identifying nucleotide point mutation of Cytb gene of potato late blight bacterium and resistance of Cytb gene to pyraclostrobin
CN118460782A (en) * 2024-07-09 2024-08-09 中国农业科学院植物保护研究所 RPA primers and probes, kits and methods for detecting wheat powdery mildew resistant to QoIs fungicides

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0066773A2 *

Also Published As

Publication number Publication date
AU781410B2 (en) 2005-05-19
KR20020008163A (en) 2002-01-29
AU4421400A (en) 2000-11-17
BR0010163A (en) 2002-01-15
AU781410C (en) 2007-01-25
CN1359425A (en) 2002-07-17
JP2002542803A (en) 2002-12-17
WO2000066773A2 (en) 2000-11-09
CA2370117A1 (en) 2000-11-09
WO2000066773A3 (en) 2001-10-11

Similar Documents

Publication Publication Date Title
Simko et al. Linkage disequilibrium mapping of a Verticillium dahliae resistance quantitative trait locus in tetraploid potato (Solanum tuberosum) through a candidate gene approach
Avenot et al. Molecular characterization of boscalid‐and penthiopyrad‐resistant isolates of Didymella bryoniae and assessment of their sensitivity to fluopyram
Mercado-Blanco et al. Detection of the defoliating pathotype of Verticillium dahliae in infected olive plants by nested PCR
Albertini et al. Eburicol 14α-demethylase gene (CYP51) polymorphism and speciation in Botrytis cinerea
RU2296162C2 (en) Method of determining stability of fungal phytopathogen, allele-specific primer, and collection
US20030049612A1 (en) Microsatelite dna markers and uses thereof
Lesemann et al. Mitochondrial heteroplasmy for the cytochrome b gene controls the level of strobilurin resistance in the apple powdery mildew fungus Podosphaera leucotricha (Ell. & Ev.) ES Salmon
Malandrakis et al. Biological and molecular characterization of laboratory mutants of Cercospora beticola resistant to Qo inhibitors
Allioui et al. Identification of Qol fungicide-resistant genotypes of the wheat pathogen Zymoseptoria tritici in Algeria
Siah et al. QoI resistance and mitochondrial genetic structure of Zymoseptoria tritici in Morocco
Imam et al. Molecular identification and virulence analysis of AVR genes in rice blast pathogen, Magnaporthe oryzae from Eastern India
Forcelini et al. Development of high-throughput SNP genotyping assays for rapid detection of strawberry Colletotrichum species and the G143A mutation
Stack et al. Genetic mapping, identification, and characterization of a candidate susceptibility gene for powdery mildew in Cannabis sativa
Habib et al. Resistance profiles of Botrytis cinerea populations to several fungicide classes on greenhouse tomato and strawberry in Lebanon
GrÜNig et al. Development of single-copy RFLP markers for population genetic studies of Phialocephala fortinii and closely related taxa
Huang et al. Detection and characterization of carboxylic acid amide-resistant Plasmopara viticola in China using a TaqMan-MGB real-time PCR
AU781410C (en) Methods
Bowen et al. Differentiation of a specific Trichoderma biological control agent by restriction fragment length polymorphism (RFLP) analysis
Koopman et al. Pathogenicity and virulence of south African isolates of Venturia inaequalis
Wang Genetic variability in the canker pathogen fungus, Gremmeniella abietina. Contribution of sexual compared with asexual reproduction
Zhang et al. PIRA-PCR for detection of Fusarium fujikuroi genotypes with carbendazim-resistance alleles
RU2244750C2 (en) Diagnostic basis for detection of mutation of fungal cytochrome b
Martin et al. Advances in understanding the epidemiology, molecular biology and control of net blotch and the net blotch barley interaction
US20260043091A1 (en) Methods and compositions for detecting the fungal pathogen ceratocystis fimbriata
KR100973181B1 (en) Genetically modified watermelon qualitative analysis method with DIP-1 as endogenous positive control gene

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

17P Request for examination filed

Effective date: 20020411

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: SYNGENTA LIMITED

17Q First examination report despatched

Effective date: 20021119

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20070320