EP1181315A1 - LAWSONIA DERIVED GENE AND RELATED FlgE POLYPEPTIDES, PEPTIDES AND PROTEINS AND THEIR USES - Google Patents

LAWSONIA DERIVED GENE AND RELATED FlgE POLYPEPTIDES, PEPTIDES AND PROTEINS AND THEIR USES

Info

Publication number
EP1181315A1
EP1181315A1 EP00924976A EP00924976A EP1181315A1 EP 1181315 A1 EP1181315 A1 EP 1181315A1 EP 00924976 A EP00924976 A EP 00924976A EP 00924976 A EP00924976 A EP 00924976A EP 1181315 A1 EP1181315 A1 EP 1181315A1
Authority
EP
European Patent Office
Prior art keywords
polypeptide
isolated
seq
intracellulans
lawsonia
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00924976A
Other languages
German (de)
French (fr)
Other versions
EP1181315A4 (en
Inventor
Michael Panaccio
Everett Lee Rosey
Meri Sinistaj
Detlef Hasse
Jim Parsons
Robert Gerard Ankenbauer
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Agriculture Victoria Services Pty Ltd
Australian Pork Ltd
Pfizer Products Inc
Original Assignee
Daratech Pty Ltd
Agriculture Victoria Services Pty Ltd
Australian Pork Ltd
Pfizer Products Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Daratech Pty Ltd, Agriculture Victoria Services Pty Ltd, Australian Pork Ltd, Pfizer Products Inc filed Critical Daratech Pty Ltd
Publication of EP1181315A1 publication Critical patent/EP1181315A1/en
Publication of EP1181315A4 publication Critical patent/EP1181315A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/205Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Campylobacter (G)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies

Definitions

  • the present invention relates generally to therapeutic compositions for the treatment and/or prophylaxis of intestinal disease conditions in animals and birds caused or exacerbated by Lawsonia intracellularls or similar or otherwise related microorganism
  • the present invention provides a novel gene derived from Lawsonia intracellularls which encodes an immunogenic peptide, polypeptide or protein
  • polypeptide described herein designated as FlgE, or a peptide homologue, analogue or derivative thereof is particularly useful as an antigen in vaccine preparation for conferring humoral immunity against Lawsonia intracellularls and related pathogens in animal hosts
  • the present invention is also directed to methods for the treatment and/or prophylaxis of such intestinal disease conditions and to diagnostic agents and
  • L intracellularls includes all microorganisms similar to or otherwise related to this microorganism, as 25 described by Stills (1991 ) or Jones et al (1997) or Lawson et al (1993) or McO ⁇ st et al (1995)
  • the word "flgE', or the term “flgE gene” shall be taken to refer to the gene encoding the flagellar hook protein of the present invention It shall also be 30 understood that the term “FlgE polypeptide” refers to the flagellar hook protein of the invention
  • the term “derived from” shall be taken to indicate that a specified product in particular a macromolecule such as a peptide polypeptide, protein gene or nucleic acid molecule, antibody molecule Ig fraction or other macromolecule or a biological sample comprising said macromolecule may be obtained from a particular source, organism, tissue, organ or cell albeit not necessarily directly from that source organism, tissue, organ or cell
  • the meat-producing sector of the agricultural industry is dependant upon the health of its livestock and there is a need to maintain disease-free livestock for human consumption
  • the industry is subject to rapid economic downturn in response to disease conditions adversely affecting livestock and the quality of meat products derived therefrom, including those diseases which may potentially be transmitted to humans It is important therefore to have well defined treatments and prophylactic and diagnostic procedures available to deal with infections or potential infections in livestock animals and humans
  • porcine proliferative enteropathy PPE
  • porcine intestinal adenomatosis PPA
  • necrotic enteritis Rost and Lawson, 1976
  • proliferative haemorrhagic enteropathy Love and Love 1977
  • regional ileitis Jonsson and Martinsson, 1976
  • haemorrhagic bowel syndrome O'Neil, 1970
  • porcine proliferative enteritis and Campylobacter spp - induced enteritis (Straw, 1990)
  • PPE proliferative haemorrhagic enteropathy
  • the causative organism of PPE is a Campy/o-bacter-like organism referred to herein as "Lawsonia intracellulans" (McO ⁇ st et al 1995)
  • the organism has also been previously referred to as Heal symbiont intracellulans (Stills, 1991)
  • PPE-like diseases in pigs may also be caused by other pathogens such as various species of Campylobacter (Gebhart et al, 1983)
  • Lawsonia intracellulans is an intracellular, possibly obligate intracellular, bacterium It can only be cultured in vitro with tissue culture cells (Jones et al , 1997, Lawson et al , 1993, McO ⁇ st et al, 1995, International Patent Application No PCT/US96/09576)
  • L intracellulans is located in the cytoplasm of the villus cells and intestinal crypt cells of infected animals
  • Pigs suffering from PPE are characterised by irregularities in the villus cells and intestinal crypt structure with epithelial cell dysplasia wherein crypt abscesses form as the vil and intestinal crypts become branched and fill with inflammatory cells
  • PPE is a significant cost component associated with the pig industry, especially in terms of stock losses, medication costs, reduced growth rates of pigs and increased feed costs PPE also contributes to downstream indirect costs in, for example additional labour costs and environmental costs in dealing with antibiotic residue contamination, and in control measures to prevent the organism from being passed on or carried to other animals or humans
  • the most effective vaccine preparations are generally comprised of a highly antigenic component, such as a peptide, polypeptide, protein or other macromolecule which is derived from the pathogenic organ' r , against which the vaccine is directed, wherein said antigenic component produces little or no contraindications when administered to a susceptible host animal, and produces little or no antigenic cross-reactivity with desirable organisms, such as non-pathogenic organisms that are a part of the normal flora of the intestinal tract or other tissues of said host animal
  • a highly antigenic component such as a peptide, polypeptide, protein or other macromolecule which is derived from the pathogenic organ' r , against which the vaccine is directed
  • said antigenic component produces little or no contraindications when administered to a susceptible host animal, and produces little or no antigenic cross-reactivity with desirable organisms, such as non-pathogenic organisms that are a part of the normal flora of the intestinal tract or other tissues of said host animal
  • an effective vaccine preparation must be immunogenic, specific and
  • One aspect of the present invention is directed to an isolated or recombinant immunogenic polypeptide which comprises mimics or cross-reacts with a B-cell or T- cell epitope of the FlgE polypeptide derived from Lawsonia spp
  • the isolated or recombinant immunogenic polypeptide is selected from the group consisting of the following
  • a peptide, o gopeptide or polypeptide which comprises an ammo acid sequence which has at least about 60% sequence identity overall to the ammo acid sequence set forth in SEQ ID NO-1 ,
  • a peptide, ohgopeptide or polypeptide which comprises at least about 5 contiguous ammo acids of the am o acid sequence defined by SEQ ID NO 1 , or (in) a homologue analogue or derivative of (i) or (n) which mimics a B-cell or
  • the polypeptide comprises or consists essentially of the ammo acid sequence of SEQ ID NO 1
  • a further aspect of the present invention provides a vaccine composition for the prophylaxis or treatment of infection in an animal, such as a pig or bird, by L intracellulans or a similar or otherwise related microorganism, said vaccine composition comprising an immunologically effective amount of an immunogenic component which comprises an isolated or recombinant polypeptide having at least about 60% overall sequence identity to the ammo acid sequence set forth in SEQ ID NO 1 , or comprising at least 5 contiguous ammo acids derived from SEQ ID NO 1 or an immunogenic homologue, analogue or derivative thereof which is immunologically cross-reactive with Lawsonia intracellulans and one or more carriers, diluents and/or adjuvants suitable for veterinary or pharmaceutical use
  • the polypeptide of the vaccine composition comprises or consists essentially of the ammo acid sequence of SEQ ID NO' 1
  • a further aspect of the invention extends to an immunologically interactive molecule, such as an antibody or antibody fragment, which is capable of binding to the immunogenic polypeptide of the invention
  • a further aspect of the invention provides a method of diagnosing infection of an animal by Lawsonia intracellulans or a related microorganism, said method comprising the steps of contacting a biological sample derived from said animal with an immunologically interactive molecule of the present invention for a time and under conditions sufficient for a complex, such as an antigen.antibody complex, to form, and then detecting said complex formation.
  • a further aspect of the present invention contemplates a method of determining whether or not an animal has suffered from a past infection, or is currently infected, by Lawsonia intracellulans or a related microorganism, said method comprising contacting a tissue or fluid sample, such as blood or serum derived from said animal, with the immunogenic polypeptide of the invention for a time and under conditions sufficient for a complex, such as an antigen.antibody complex, to form, and then detecting said complex formation.
  • a tissue or fluid sample such as blood or serum derived from said animal
  • a further aspect of the present invention provides an isolated nucleic acid molecule which comprises a sequence of nucleotides that encodes, or is complementary to a nucleic acid molecule that encodes, a peptide, ohgopeptide or polypeptide selected from the following:
  • the isolated nucleic acid molecule comprises the nucleotide sequence set forth in SEQ ID NO 2, or a degenerate variant thereof, has at least about 60% sequence identity to all or a part thereof
  • a still further aspect of the invention provides a diagnostic method of detecting Lawsonia intracellulans or related microorganism in a biological sample derived from an animal subject, said method comprising the steps of hybridising one or more polynucleotide or ohgonucleotide probes or primers derived from the nucleotide sequence set forth in SEQ ID NO 2 or a complementary nucleotide sequence thereof or a homologue, analogue or derivative thereof, to said sample, and then detecting said hybridisation using a detection means
  • the detection means according to this aspect of the invention is any nucleic acid-based hybridisation or amplification reaction
  • a further aspect of the invention provides an isolated probe or primer derived from SEQ ID NO 2 or a complementary nucleotide sequence thereto
  • Figure 1 is a schematic representation comparing the ammo acid secjence of Lawsonia intracellulans (L int) flagellar hook protein FlgE to the ammo acid sequences of flagellar hook proteins derived from Treponema phagedenis (T phage), Treponema pallidum (T palli), Salmonella typhimunum (S typhi), Esche ⁇ chia coll (E co ), Aquifex aeolicus (A aeo), Vibrio parahaemolyticus (V parah) and Borrelia burgdorfen (B burgd) Gaps have been introduced to optimise the alignment Positions containing identical ammo acid residues with respect to the FlgE polypeptide of Lawsonia intracellulans (SEQ ID NO 1) are shaded Residues that are identical in all eight sequences appear in boldface DETAILED DESCRIPTION OF THE INVENTION
  • one aspect of the present invention is directed to an isolated or recombinant immunogenic polypeptide which comprises mimics or cross-reacts with a B-cell or T-cell epitope of the FlgE polypeptide derived from Lawsonia spp
  • Epitopes of Lawsonia spp may be B cell epitopes or T-cell epitopes It is well-known that antibody-binding sites (B-cell epitopes) involve linear as well as conformational epitopes (van Regenmortel, 1992) B-cell epitopes are predominantly conformational In contrast, T-cells recognize predominantly linear epitope sequences in combination with MHC class II molecules
  • a precise identification and careful selection of epitopes of Lawsonia spp facilitates the development of diagnostic reagents and vaccine compositions for the effective treatment or prophylaxis of Lawsonia infections
  • Epitope identification and characterization i e , determination of the molecular weight, ammo acid sequence, and structure of epitopes of Lawsonia spp
  • Degrading and denaturing of the epitope molecule must be avoided in order to conserve the three-dimensional structure, because the antigen-antibody reaction will be diminished i.
  • the secondary structure of the epitope is altered significantly In practice, the characterisation and isolation of linear non-conformational epitopes is easier, because any immunoreactive regions are contained within a single peptide fragment or single ammo acid sequence which is capable of being purified under a range of conditions
  • Both non-conformational and conformational epitopes may be identified by virtue of their ability to bind detectable amounts of antibodies (such as IgM or IgG) from sera of animals immunised against or infected with Lawsonia spp and, in particular L intracellula ⁇ s or an isolated polypeptide derived therefrom or alternatively, by virtue of their ability to bind detectable amounts of antibodies in a purified Ig fraction derived from such sera
  • the antibodies may be derived from or contained within pools of polyclonal sera, or may be monoclonal antibodies
  • Antibody fragments or recombinant antibodies, such as those expressed on the surface of a bacte ⁇ ophage or virus particle, such as in a phage display library may also be employed
  • T-cell epitopes are determined by analysing the ability of the epitope peptides to induce the proliferation of peripheral blood lymphocytes or T-cell clones
  • the identification of T-cell epitopes is accomplished using a variety of methods as known in the art, including the use of whole and fragmented native or recombinant antigenic protein, as well as the more commonly employed "overlapping peptide" method In the latter method, overlapping peptides which span the entire sequence of a polypeptide derived from Lawsonia spp are synthesized and tested for their capacity to stimulate T-cell cytotoxic or proliferative responses in vitro
  • Structure determination of both conformational non-linear and non-conformational linear epitopes may be performed by nuclear magnetic resonance spectroscopy (NMR) and X-ray crystallographic analysis
  • NMR nuclear magnetic resonance spectroscopy
  • X-ray crystallographic analysis requires the protein-antibody complex to be crystallized, whereas NMR allows analysis of the complex in a liquid state NMR measures the amount of ammo acids as well as the neighbourhood of protons of different ammo acid residues, wherein the alternating effect of two protons along the carbon backbone is characteristic of a particular epitope
  • the Western blot Peptides may be generated from a complete Lawsonia spp polypeptide by digestion with site-specific proteases, such as trypsm or chymotrypsin, and the peptides generated thereby can be separated using standard electrophoretic or chromatographic procedures
  • site-specific proteases such as trypsm or chymotrypsin
  • the peptides generated thereby can be separated using standard electrophoretic or chromatographic procedures
  • the peptides can be transferred to immobilizing nylon or nitrocellulose membranes and incubated with sera raised against the intact polypeptides Peptides that comprise immunogenic regions
  • B-cell or T-cell epitopes are bound by the antibodies in the sera and the bound antibodies may be detected using secondary antibodies, such as anti-lgG antibodies, that have been labelled radioactively or enzymatically
  • the epitopes may then be characterised by purification based upon their size, charge or ability to bind specifically to antibodies against the intact polypeptide, using one or more techniques, such as size-exclusion chromatography, ion-exchange chromatography, affinity chromatography or ELISA among others After purification of the epitope, only one band or spot should be detectable with gel electrophoresis
  • the N-termmal or total sequencing of the peptide offers the possibility to compare the peptide with known proteins in databases
  • AMPHI The AMPHI algorithm (Margaht et al ,1987), which is based on the periodicity of T cell epitopes, has been widely used for the prediction of T-cell antigenic sites from sequence information alone Essentially, AMPHI describes a common structural pattern of MHC binding motifs, since MHC binding motifs (i e , patterns of ammo acids that appear to be common to most of the peptides that bind to a specific MHC molecule) appear to exhibit the same periodicity as an alpha helix Identification of T- cell epitopes by locating MHC binding motifs in an ammo acid sequence provides an effective means of identifying immunogenic epitopes in diagnostic assays
  • the EpiMer algorithm locates clustered MHC binding motifs in ammo acid sequences of proteins, based upon the correlation between MHC binding motif-dense regions and peptides that may have the capacity to bind to a variety of MHC molecules (promiscuous or multi-determinant binders) and to stimulate an immune response in these various MHC contexts as well (promiscuous or multi-determinant epitopes)
  • the EpiMer algorithm uses a library of MHC binding motifs for multiple class I and class II HLA alleles to predict antigenic sites within a protein that have the potential to induce an immune response in subjects with a variety of genetic backgrounds
  • EpiMer locates matches to each MHC-binding motif within the primary sequence of a given protein antigen The relative density of these motif matches is determined along the length of the antigen, resulting in the generation of a motif-density histogram
  • the algorithm identifies protein regions in this
  • Recombinant methods offer the opportunity to obtain well characterized epitopes of high purity for the production of diagnostic reagents and epitope-specific vaccine formulations (Mohapatra etal , 1995) Based upon the ammo acid sequence of a linear epitope and identification of the corresponding nucleotide sequence encoding same polymerase chain reaction (PCR) may be performed to amplify the epitope-encodmg region from cDNA After cloning and expression in a suitable vector/host system a large amount of epitopes of high purity can be extracted Accordingly the present invention clearly extends to both isolated non-recombmant polypeptides and recombinant polypeptides in an impure or isolated form
  • polypeptide as used herein shall be taken to refer to any polymer consisting of am o acids linked by covalent bonds and includes within its scope full-length proteins and parts or fragments thereof such as for example ohgopeptides and short peptide sequences consisting of at least about 5 ammo acid residues preferably at least about 10 ammo acid residues, more preferably at least about 12 ammo acid residues, and even more preferably at least about 15 ammo acid residues Also included within the scope of the definition of a "polypeptide” are ammo acid sequence variants, containing one or more preferably conservative ammo acid substitutions, deletions, or insertions, which do not alter at least one essential property of said polypeptide such as, for example, its imnnunogenicity, use as a diagnostic reagent, or effectiveness as a peptide vaccine against Lawsonia spp, amongst others Accordingly, a polypeptide may be isolated from a source in nature, or chemically synthesized Furthermore,
  • the present invention is not limited by the source of the subject immunogen and clearly extends to isolated and recombinant polypeptides which are derived from a natural or a non-natural occurring source
  • recombinant polypeptide as used herein shall be taken to refer to a polypeptide which is produced in vitro or in a host cell by the expression of a genetic sequence encoding said polypeptide, which genetic sequence is under the control of a suitable promoter, wherein a genetic manipulation has been performed in order to achieve said expression
  • the term “recombinant polypeptide” clearly encompasses polypeptides produced by the expression of genetic sequences contained in viral vectors, cosmids or plasmids that have been introduced into prokaryotic or eukaryotic cells, tissues or organs Genetic manipulations which may be used in this context will be known to those skilled in the art and include, but are not limited to, nucleic acid isolation, restriction endonuclease digestion, exonuclease digestion, end-filling using the Klenow fragment of E coli DNA polymerase I or T4 DNA polymerase enzymes, blunt-ending of DNA molecules using T4 DNA polymerase or Exolll enzymes, site-directed
  • the present invention extends to a recombinant polypeptide or a derivative, homologue or analogue thereof as present in a virus particle, or as produced in prokaryotic or eukaryotic host cell, or in a virus or cell culture thereof
  • the present invention also extends to a recombinant polypeptide according to any of the foregoing embodiments which is produced in a bacterial cell belonging to the genus Lawsonia, in particular a cell of L intracellulans, or a culture thereof
  • isolated polypeptide refers to a polypeptide of the present invention which has been purified to some extent, preferably to at least about 20% by weight of protein, preferably to at least about 50% by weight of protein, more preferably to at least about 60% by weight of protein, still more preferably to at least about 70% by weight of protein and even more preferably to at least about 80% by weight of protein or greater, from its natural source or, in the case of non-naturally-occur ⁇ ng polypeptides, from the culture medium or cellular environment in which it was produced Such isolation may be performed to improve the immunogenicity of the polypeptide of the present invention, or to improve the specificity of the immune response against that polypeptide, or to remove toxic or undesirable contaminants therefrom
  • the necessary or required degree of purity of an isolated polypeptide will vary depending upon the purpose for which the polypeptide is intended, and for many applications it will be sufficient for the polypeptide preparation to contain no contaminants which would reduce the immunogenicity of the polypeptide when administered to a host animal, in particular a porcine or
  • the purity of an isolated polypeptide of the present invention may be determined by any means known to those skilled in the art, including the degree of homogeneity of a protein preparation as assessed by SDS/polyacrylamide gel electrophoresis, 2- dimensional electrophoresis or ammo acid composition analysis or sequence analysis
  • polypeptide of the present invention will be substantially homogeneous or substantially free of nonspecific proteins, as assessed by SDS/polyacrylamide gel electrophoresis, 2-d ⁇ mens ⁇ onal electrophoresis, or am o acid composition analysis or sequence analysis
  • polypeptide of the present invention can be purified for use as a component of a vaccine composition by any one or a combination of methods known to those of ordinary skill in the art, including, for example, reverse phase chromatography, HPLC, ion-exchange chromatography, and affinity chromatography, among others
  • the isolated or recombinant polypeptide of the invention functions as a flagellar hook protein in a bacterium such as, for example, L intracellulans, or is derived from a flagellar hook protein or, alternatively, is immunologically cross-reactive with the L intracellulans flagellar hook protein, FlgE, of the present invention
  • the isolated or recombinant polypeptide of the invention is derived from Lawsonia spp or other pathogenic agent associated with the onset and/or development of PPE and more preferably, the subject polypeptide is derived from Lawsonia intracellulans
  • a B-cell or T-cell epitope of a FlgE polypeptide or a derivative homologue or analogue thereof may comprise any combination of the following
  • immunogenic polypeptides or derivatives, homologues or analogues thereof comprising the same, or substantially the same primary ammo acid sequence are hereinafter defined as "immunogens which comprise a B-cell or T-cell epitope" or similar term
  • Immunogenic polypeptides or derivatives, homologues, or analogues thereof comprising different primary ammo acid sequences may comprise immunologically identical immunogens, because they possess conformational B-cell or T-cell epitopes ihat are recognised by the immune system of a host species to be dentical
  • immunogenic polypeptides or derivatives, homologues or analogues thereof are hereinafter defined as "immunogens which mimic or cross-react with a B-cell or T-cell epitope", or similar term
  • the present invention extends to an immunogen which comprises, mimics, or cross-reacts with a B-cell or T-cell epitope of an isolated or recombinant polypeptide according to any one of the foregoing embodiments or a derivative, homologue or analogue thereof
  • the present invention provides an immunogen which comprises, mimics or cross-reacts with a B-cell or T- cell epitope of an isolated or recombinant polypeptide which in its native form is obtainable from a species of Lawsonia such as, but not limited to L intracellulans and which polypeptide preferably functions as a flagellar hook protein
  • such immunogenic polypeptides will not comprise a primary ammo acid sequence which is highly-conserved between L intracellulans and another non- pathogenic microorganism which is normally resident in the gut or other organ of an animal in particular a porcine or avian animal
  • a primary ammo acid sequence which is highly-conserved between L intracellulans and another non- pathogenic microorganism which is normally resident in the gut or other organ of an animal in particular a porcine or avian animal
  • the present inventors have shown that the N-termmal ammo acid sequence of the FlgE polypeptide derived from L intracellulans and the 5'-reg ⁇ on of the corresponding flgE gene are less highly conserved among homologous genes and polypeptides derived from other species, compared to the C-termmal region of the L intracellulans FlgE polypeptide and the 3'-reg ⁇ on of the flgE gene Accordingly, the N- termmal region of the FlgE polypeptide is a particularly preferred immunogen for use in vaccination protocols and as diagnostic reagents in respect of L intracellulans Similarly the 5 -end of the flgE gene is particularly preferred for use as a diagnostic reagent for L intracellulans
  • ammo acids not corresponding to the original protein sequence can be added to the ammo or carboxyl terminus of the polypeptide.
  • extra amino acids are useful for coupling the polypeptide to another peptide or polypeptide, to a large carrier protein or to a solid support
  • Ammo acids that are useful for these purposes include but are not limited to tyrosine, lysine, glutamic acid, aspartic acid, cysteine and derivatives thereof
  • Additional protein modification techniques can be used such as, e g , NH 2 -acetylat ⁇ on or COOH-termmal amidation, to provide additional means for coupling the polypeptide to another polypeptide, protein, or peptide molecule, or to a solid support Procedures for coupling polypeptides to each other, or to carrier X -
  • protems or solid supports are well known in the art Polypeptides containing the above-mentioned extra ammo acid residues at either the carboxyl- or ammo-termini and either uncoupled or coupled to a carrier or solid support are consequently within the scope of the present invention
  • polypeptide can be immobilised to a polymeric carrier or support material
  • the immunogenicity of a polypeptide of the present invention may be improved using molecular biology techniques to produce a fusion protein containing one or more polypeptides of the present invention fused to a carrier molecules such as a highly immunogenic protein
  • a fusion protein containing a polypeptide of the present invention fused to the highly immunogenic B subunit of cholera toxin can be used to increase the immune response to the polypeptide
  • the present invention also contemplates fusion proteins comprising a cytokine, such as an interleukin, fused to the subject polypeptide of the present invention, and genes encoding same
  • the polypeptide of the present invention when administered to a mammal, induces an immune response in said mammal.
  • the polypeptide of the present invention when administered to a mammal, in particular a porcine animal (e g , a pig) induces a protective immune response against Lawsonia spp , and preferably against L intracellulans, therein
  • the phrase "induct' ⁇ n of a protecti a immune response" refers to the ability of the administered polypeptide of the present invention to prevent or detectably slow the onset, development, or progression of symptoms associated with Lawsonia infection, and preferably, to prevent or detectably slow the onset, development, or progression of symptoms associated with
  • the immunogenic polypeptide of the invention comprises an am o acid sequence which is substantially the same as the ammo acid sequence set forth in SEQ ID NO 1 or is at least about 60% identical overall to SEQ ID NO 1 or is at least about 75% identical to at least 8 contiguous am o acids of SEQ ID NO 1
  • the immunogenic polypeptide of the present invention consists essentially of the ammo acid sequence of SEQ ID NO 1 or the ammo acid sequence 5 encoded by the FlgE-encodmg nucleotide sequence present in pALK11 (ATCC 207156)
  • ammo acid sequence set forth in SEQ ID NO 1 represents the ammo acid sequence of the FlgE polypeptide encoded by the Lawsonia 10 intracellulans flgE gene
  • the nucleotide sequence of the L intracellulans flgE gene is set forth in SEQ ID NO 2
  • the percentage am o acid sequence identity to SEQ ID NO 1 is at least about 70%, more preferably at least about 80%, even more preferably at least about 15 90%, and still even more preferably at least about 95%
  • the isolated or recombinant immunogenic polypeptide of the invention comprises at least about 10 contiguous ammo acids derived from SEQ ID NO 1 , more preferably at least about 20 contiguous ammo acid residues derived from SEQ ID NO 1 , even more preferably at least about 30 contiguous am o acid residues derived from SEQ ID NO 1 and still even more preferably at least about 40 contiguous ammo acid residues derived from SEQ ID NO 1
  • the present invention further encompasses homologues, analogues and derivatives of a polypeptide comprising the ammo acid sequence set forth in SEQ ID NO.1
  • “Homologues” of a polypeptide are those polypeptides which contain ammo acid substitutions, deletions and/or additions relative to the polypeptide without altering one or more of its properties, such as its immunogenicity, biological activity or catalytic activity
  • am o acids can be replaced by other ammo acids having similar properties such as, for example, hydrophobicity, hydrophihcity, hydrophobic moment, antigenicity, propensity to form or break ⁇ -hehcal structures of ⁇ -sheet structures, and so on
  • Substitutional variants are those in which at least one residue in the sequence has been removed and a different residue inserted in its place.
  • Ammo acid substitutions are typically of single residues, but may be clustered depending upon functional constraints placed upon the polypeptide, insertions will usually be of the order of about 1-10 ammo acid residues and deletions will range from about 1-20 residues
  • ammo acid substitutions will comprise conservative ammo acid substitutions, such as those described supra
  • Insertional ammo acid sequence variants are those in which one or more ammo acid residues are introduced into a predetermined site in the protein Insertions can comprise ammo-terminal and/or carboxyl terminal fusions as well as mtra-sequence insertions of single or multiple ammo acids.
  • Insertions within the amino acid sequence will be smaller than ammo or carboxyl terminal fusions, of the order of about 1 to 4 residues.
  • Deletional variants are characterised by the removal of one or more amino acids from the sequence.
  • Ammo acid variants of the polypeptide of the present invention may readily be made using peptide synthetic techniques well known in the art, such as solid phase peptide synthesis and the like, or by recombinant DNA manipulations.
  • the manipulation of DNA sequences to produce variant proteins which manifest as substitutional, insertional or deletional variants are well known in the art.
  • techniques for making substitution mutations at predetermined sites in DNA having known sequence are well known to those skilled in the art, such as by M13 mutagenesis or other site- directed mutagenesis protocol.
  • Analogues are defined as peptides, ohgopeptides and polypeptides which are functionally equivalent to the peptides of the present invention but which contain certain non-naturally occurring or modified ammo acid residues as will be known to those skilled in the art.
  • an "analogue” as defined herein need not comprise an amino acid sequence which is similar to the amino aci sequence set forth herein such as, for example, peptides, ohgopeptides and polypeptides which are derived from computational predictions or empirical data revealing the secondary, tertiary or quaternary structure of the polypeptide of the present invention, and which therefore do not comprise the same primary amino acid sequence of said polypeptide, yet nevertheless mimic or cross-react with B-cell or T-cell epitope of Lawsonia spp. and preferably, mimic or cross-react with B-cell or T-cell epitope of Lawsonia intracellulans.
  • mimotopes polypeptide analogues that cross-react with a B-cell or T-cell epitope of the Lawsonia polypeptide of the invention but however comprise a different am o acid sequence to said epitope
  • the antibodies used to identify such mimotopes may be polyclonal or monoclonal or recombinant antibodies, in crude or purified form
  • Mimotopes of a T-cell epitope may then be assayed further for their ability to stimulate T-cell cytotoxic or proliferative responses in vitro
  • Mimotopes are particularly useful as analogues of non- linear (i e conformational) epitopes of the polypeptide of the present invention because conformational epitopes are generally formed from non-contiguous regions in a polypeptide
  • polypeptide analogues can result in polypeptides with increased immunogenic and/or antigenic activity, that are less sensitive to enzymatic degradation, and which are more selective
  • a suitable prohne analogue is 2- aminocyclopentane carboxylic acid ( ⁇ AC 5 c) which has been shown to increase the immunogenic activity of a native polypeptide more than 20 times (Mierke et al, 1990, Portoghese et al, 1990, Goodman et al, 1987)
  • “Derivatives” of a polypeptide described herein are those peptides, ohgopeptides and polypeptides which comprise at least about five contiguous ammo acid residues of the ammo acid sequence set forth in SEQ ID NO 1
  • a “derivative” may further comprise additional naturally-occurring, altered glycosylated, acylated or non-naturally occurring ammo acid residues compared to the ammo acid sequence set forth in SEQ ID NO 1
  • a derivative may comprise one or more non-ammo acid substituents such as, for example, a reporter molecule or other ligand, covalently or non-covalently bound to the ammo acid sequence such as, for example, a reporter molecule which is bound thereto to facilitate its detection
  • recombinant or synthetic mutants and derivatives of the peptide immunogens of the present invention include those incorporating single or multiple substitutions, deletions and/or additions therein such as carbohydrates hpids and/or proteins or polypeptides Naturally occurring or altered glycosylated or acylated forms of the subject peptides are particularly contemplated by the present invention Additionally, homopolymers or heteropolymers comprising one or more copies of the subject peptide listed in SEQ ID NO 1 , or one or more derivatives, homologues or analogues thereof, are within the scope of the invention
  • homologues, analogues and derivatives of the polypeptide of the invention are "immunogenic", defined hereinafter as the ability of said polypeptide, or a derivative, homologue or analogue thereof, to elicit B cell and/or T cell responses in the host, in response to immunization
  • Preferred homologues, analogues and derivatives of the ammo acid sequence set forth in SEQ ID NO 1 include those ammo acid variants that function as B cell or T cell epitopes of said ammo acid sequence which are capable of mediating an immune response such as, for example, mimotopes of the immunogenic polypeptide described herein which have been produced by synthetic means, such as by Fmoc chemistry
  • the only requirement of such molecules is that they cross-react immunologically with a polypeptide which comprises the ammo acid sequence set forth in SEQ ID NO:1 or a derivative thereof which comprises at least 5 contiguous ammo acids in length of SEQ ID NO 1
  • such homologues, analogues and derivatives of the polypeptide of the invention molecules will be useful to prepare antibodies that cross-react with antibodies against said polypeptide and/or to elicit a protective immune response of similar specificity to that elicited by said polypeptide.
  • Such molecules will also be useful in diagnostic and other applications that are immunological in nature such as, for example, diagnostics which utilise one or more immunoassay formats (eg ELISA, RIA and the like)
  • the immunogen of the present invention or a derivative, homologue or analogue thereof is useful in vaccine compositions that protect an individual against infection by L intracellulans and/or as an antigen to elicit polyclonal or monoclonal antibody production and/or in the detection of antibodies against L intracellulans in infected animals particularly in porcine and avian animals
  • ammo acid sequence set forth in SEQ ID NO 1 is particularly unique as compared to other immunogenic ammo acid sequences, including those of the flagellar hook proteins derived from other bacteria Accordingly, peptides ohgopeptides and polypeptides which comprise unique epitope regions of SEQ ID NO 1 as described in Figure 1 will have improved specificity compared to other regions of the Lawsonia spp FlgE molecule The particular advantages of such peptides will be immediately apparent to those skilled in the production of vaccine compositions, where specificity against a pathogen of interest is an important consideration
  • the unique regions of the L intracellulans FlgE polypeptide are promising antigenic peptides for the formulation of Lawso ⁇ /a-specific vaccines and diagnostics for the specific detection of Lawsonia spp in biological samples
  • a second aspect of the present invention provides a vaccine composition for the prophylaxis or treatment of infection in a mammal or bird by L intracellulans or similar or otherwise related microorganism, said vaccine composition comprising
  • an immunogenic component which comprises an isolated or recombinant polypeptide having at least about 60% overall amino acid sequ°nce identity to the ammo acid sequence set forth in SEQ ID NO 1 and/or comprising at least
  • immunogenic component refers to a peptide, polypeptide 2 -
  • the vaccine ⁇ composition clearly encompasses those vaccine compositions which comprise attenuated, killed or non-pathogenic isolates or forms of L intracellulans or related microorganisms thereto which comprise or express said peptide, polypeptide or protein
  • ' protective immune response is meant that the immunogenic component elicits an immune response in the animal to which the vaccine composition is administered at the humoral and/or cellular level which is sufficient to prevent infection by Lawsonia intracellulans or a related microorganism thereto and/or which is sufficient to detectably reduce one or more symptoms or conditions, or to detectably slow the onset of one or more symptoms or conditions, associated with infection by Lawsonia intracellulans or a related microorganism thereto in an animal host, as compared to a control infected animal
  • effective amount of an immunogenic component present in the vaccine composition refers to that amount of said immunogenic component that is capable of inducing a protective immune response after a single complete dose has been administered, or after several divided doses have been administered
  • the polypeptide component of the subject vaccine composition comprises an ammo acid sequence which is both immunogenic and specific, by virtue of its immunologica- cross-reactivity with the causative agent of PP' 7 , Lawsonia intracellulans
  • polypeptide components may comprise an ammo acid sequence derived from SEQ ID NO 1 or a homologue, analogue or derivative of the ammo acid sequence set forth in SEQ ID NO 1 such as, for example, a mimotope of said sequence
  • immunogenic polypeptide or immunogenic homologue, analogue or derivative may be a naturally-occurring peptide, ohgopeptide or polypeptide in isolated or recombinant form according to any of the embodiments described supra or exemplified herein 2b
  • the immunogenic polypeptide or immunogenic homologue, analogue or derivative is derived from Lawsonia spp in particular L intracellulans or a microorganism that is related thereto
  • the immunogenic component has undergone at least one purification step or at least partial concentration from a cell culture comprising L intracellulans or a related microorganism thereto, or from a lysed preparation of L intracellulans cells or related microorganism, or from another culture in which the immunogenic component is recombinantly expressed
  • the purity of such a component which has the requisite immunogenic properties is preferably at least about 20% by weight of protein in a particular preparation, more preferably at least about 50%, even more preferably at least about 60%, still more preferably at least about 70% and even more preferably at least about 80% or greater
  • the immunogenic component of the vaccine of the present invention can comprise a single peptide, polypeptide or protein, or a range or combination of different peptides, polypeptides or proteins covering different or similar epitopes
  • a single polypeptide can be provided with multiple epitopes
  • the latter type of vaccine is referred to as a polyvalent vaccine
  • a multiple epitope includes two or more epitopes located within a peptide or polypeptide molecule
  • a particularly useful form of the vaccine is a recombinant vaccine produced, for example, in a vaccine vector, such as but not limited to a cell transfected with a vaccinia virus vector or a bacterial cell capable of expressing the immunogenic component
  • the present invention clearly extends to recombinant vaccine compositions in which the immunogenic component at least is contained within killed vaccine vectors 1 1
  • the immunogenic component of the vaccine is generally synthesized in a live vaccine vector which is killed prior to administration to an animal
  • the vaccine vector expressing the immunogenic component may be non- pathogenic or attenuated
  • Attenuated or non-pathogenic host cells include those cells which are not harmful to an animal to which the subject vaccine is administered
  • live vaccines can comprise an attenuated virus vector encoding the immunogenic component or a host cell comprising same, which is capable of replicating in an animal to which it is administered, and using host cell machinery to express the immunogenic componant albeit producing no adverse side-effects therein
  • Such vaccine vectors may colonise the gut or other organ of the vaccinated animal
  • live vaccine vectors are efficacious by virtue of their ability to continually express the immunogenic component in the host animal for a time and at a level sufficient to confer protective immunity against a pathogen which expresses an immunogenic equivalent of said immunogenic component
  • the present invention clearly encompasses the use of such attenuated or non-pathogenic vectors and live vaccine preparations
  • the vaccine vector may be a virus, bacterial cell or a eukaryotic cell such as an avian porcine or other mammalian cell or a yeast cell or a cell line such as COS, VERO, HeLa, mouse C127, Chinese hamster ovary (CHO), WI-38, baby hamster kidney (BHK) or MDCK cell lines
  • Suitable prokaryotic cells include Mycobactenum spp , Corynebactenum spp , Salmonella spp , Escherichia coli, Bacillus spp and Pseudomonas spp, amongst others Bacterial strains which are suitable for the present purpose are well-known in the relevant art (Ausubel et al, 1987, Sambrook et -8 -
  • Such cells and cell lines are capable of expression of a genetic sequence encoding a FlgE peptide, polypeptide or protein of the present invention from L intracellulans in a manner effective to induce a protective immune response in the animal
  • a non-pathogenic bacterium could be prepared containing a recombinant sequence capable of encoding a peptide, polypeptide or protein from L intracellulans
  • the recombinant sequence would be in the form of an expression vector under the control of a constitutive or mducible promoter
  • the bacterium would then be permitted to colonise suitable locations in a pig's gut and would be permitted to grow and produce the recombinant peptide, polypeptide or protein in amount sufficient to induce a protective immune response against L intracellulans
  • the vaccine can be a DNA or RNA vaccine comprising a DNA or RNA molecule encoding a peptide, polypeptide or protein of the present invention which is injected into muscular tissue or other suitable tissue in a pig under conditions sufficient to permit transient expression of said DNA or RNA to produce an amount of peptide, polypeptide or protein effective to induce a protective immune response
  • the DNA vaccine is in the form of a plasmid, in which the DNA is operably connected with a promoter region capable of expressing the nucleotide sequence encoding the immunogen in cells of the immunized animal
  • the immunogenic component in a suitable vector system
  • the immunogenic component can be expressed by
  • nucleic acid molecule comprising the coding region of the nucleotide sequence set forth in SEQ ID NO 2 or a protein-encoding homologue, analogue or derivative of SEQ ID NO 2 selected from the group consisting of
  • nucleotide sequences that hybridise under at least low stringency hybridisation, preferably under at least moderate stringency conditions, and even more preferably under at least high level stringency conditions to the complement of SEQ ID NO 2, and
  • nucleotide sequences that encode the ammo acid sequence set forth in SEQ ID NO 1 or a homologue, analogue or derivative thereof, including for example, a mimotope of the am o acid set forth in SEQ ID NO 1
  • a low stringency is defined herein as being a hybridisation and/or a wash carried out in 6xSSC buffer, 0 1 % (w/v) SDS at 28°C
  • a moderate stringency is defined herein as being a hybridisation and/or washing carried out in 2xSSC buffer, 0 1 % (w/v) SDS at a temperature in the range 20 45°C to 65°C
  • a high stringency is defined herein as being a hybridisation and/or wash carried out in 0 1xSSC buffer, 0 1% (w/v) SDS at a temperature of at least 65°C
  • the stringency is increased by reducing the concentration of SSC buffer, and/or increasing the concentration of SDS and/or increasing the tem p erature of the
  • hybridisation and/or wash may vary depending upon the nature of the hybridisation membrane or the type of hybridisation probe used Conditions for hybridisations and washes are well understood by one normally skilled in the art For the purposes of clarification of the parameters affecting hybridisation between nucleic acid molecules,
  • nucleic acid molecule in an expressible format ' is a protein- encoding region of a nucleic acid molecule placed in operable connection with a promoter or other regulatory sequence capable of regulating expression in the vaccine vector system
  • promoter includes the transc ⁇ ptional regulatory sequences of a classical genomic gene, including the TATA box which is required for accurate transcription initiation, with or without a CCAAT box sequence and additional regulatory elements (i e upstream activating sequences enhancers and silencers) which alter gene expression in response to developmental and/or external stimuli, or in a tissue-specific manner
  • promoter is also used to describe a recombinant, synthetic or fusion molecule, or derivative which confers, activates or enhances the expression of a nucleic acid molecule to which it is operably connected, and which encodes the immunogenic polypeptide Preferred promoters can contain additional copies of one or more specific regulatory elements to further enhance expression and/or to alter the spatial expression and/or temporal expression of the said nucleic acid molecule
  • a nucleic acid molecule under the regulatory control of i e "in operable connection with” a promoter sequence means positioning the said molecule such that expression is controlled by the promoter sequence Promoters are generally, but not necessarily, positioned 5 (upstream) to the genes that they control In the construction of heterologous promoter/structural gene combinations it is generally preferred to position the p omoter at a distance from the gene transcription start site that is approximately the same as the distance between that promoter and the gene it controls in its natural setting, i e , the gene from which the promoter is derived
  • the regulatory elements comprising a promoter are usually positioned within 2 kb of the start site of transcription of the gene As is known in the art, some variation in this distance can be accommodated without loss of promoter function Similarly, the preferred positioning of a regulatory sequence element with respect to a heterologous gene to be placed under its control is defined by the positioning of the element in its natural setting, i e , the genes from which it is derived Again, as is - J
  • Typical promoters suitable for expression in bacterial cells such as E coli include, but are not limited to, the lacz promoter, temperature-sensitive ⁇ L or ⁇ R promoters, T7 promoter or the IPTG- mducible tac promoter
  • Typical promoters suitable for expression in bacterial cells such as E coli include, but are not limited to, the lacz promoter, temperature-sensitive ⁇ L or ⁇ R promoters, T7 promoter or the IPTG- mducible tac promoter
  • a number of other vector systems for expressing the nucleic acid molecule of the invention in E coli are well-known in the art and are described, for example, in Ausubel et al (1987) or Sambrook et al (1989) Numerous plasmids with suitable promoter sequences for expression in bacteria and efficient ⁇ bosome binding sites have been described, such as for example, pKC30 ( ⁇ L Shimatake and Rosenberg, 1981), pKK173-3 (tac Amann and Brosius 1985
  • Means for introducing the isolated nucleic acid molecule or a genetic construct comprising same into a cell for expression of the immunogenic component of the vaccine composition are well-known to those skilled in the art
  • the technique used for a given organism depends on the known successful techniques
  • Means for introducing recombinant DNA into animal cells include microinjection, transfection mediated by DEAE-dextran, t r ansfect ⁇ on mediated by posomes such as by using hpofectamine (Gibco, MD, USA) and/or cellfectm (Gibco, MD, USA), PEG-mediated DNA uptake, electroporation and microparticle bombardment such as by using DNA-coated tungsten or gold particles (Agracetus Ine , Wl, USA) amongst others
  • the immunogenic component of a vaccine composition as contemplated herein exhibits excellent therapeutic activity, for example, in the treatment and/or prophylaxis of PPE when administered in an amount which depends on the particular case
  • from about 0 5 ⁇ g to about 20 mg may be administered, preferably from about 1 ug to about 10 mg more preferably from about 10 ug to about 5 mg and most preferably from about 50 ⁇ g to about 1 mg equivalent of the immunogenic component in a volume of about 1 ml to about 5ml
  • recombinant peptide molecules from about 0 5 ⁇ g to about 20 mg may be administered, preferably from about 1 ug to about 10 mg more preferably from about 10 ug to about 5 mg and most preferably from about 50 ⁇ g to about 1 mg equivalent of the immunogenic component in a volume of about 1 ml to about 5ml
  • DNA vaccines a preferred amount is from about 0 1 ⁇ g/ml to about 5 mg/ml in a volume of about 1 to about 5 ml
  • the DNA can be present in "naked” form or it can be administered together with an agent facilitating cellular uptake (e g , in posomes or cationic hpids)
  • agent facilitating cellular uptake e g , in posomes or cationic hpids
  • the important feature is to administer sufficient immunogen to induce a protective immune response
  • the above amounts can be administered as stated or calculated per kilogram of body weight Dosage regime can be adjusted to provide the optimum therapeutic response For example, several divided doses can be administered or the dose can be proportionally reduced as indicated by the exigencies of the therapeutic situation Booster administration may also be required
  • the vaccine of the present invention can further comprise one or more additional immunomodulatory components such as, for example, an adjuvant or cytokine molecule, amongst others, that is capable of increasing the immune response against the immunogenic component
  • additional immunomodulatory components such as, for example, an adjuvant or cytokine molecule, amongst others, that is capable of increasing the immune response against the immunogenic component
  • adjuvants include the RIBI adjuvant system (Ribi Ine , Hamilton, MT, USA), alum, mineral gels such as aluminium hydroxide gel, oil-m-water emulsions, water-m-oil emulsions such as, for example, Block co-polymer (CytRx, Atlanta GA, USA),QS-21 (Cambridge Biotech Ine , Cambridge MA, USA), SAF-M (Chiron, Emeryville CA, USA), AMPHIGEN ® adjuvant, Freund's complete adjuvant, Freund's incomplete adjuvant, and Saponm, QuilA
  • the vaccine composition can be administered in a convenient manner such as by oral, intravenous (where water soluble), intramuscular, subcutaneous, mtranasal, mtradermal or suppository routes or by implantation (eg , using slow release 1 -3
  • the immunogenic component may be required to be coated in a material to protect it from the action of enzymes, acids and other natural conditions which may inactivate it such as those in the digestive tract
  • the vaccine composition may also be administered parenterally or intrape ⁇ toneally Dispersions can also be prepared in glycerol, liquid polyethylene glycois, and mixtures thereof or in oils Under ordinary conditions of storage and use, these preparations can contain a preservative to prevent the growth of microorganisms Alternatively, the vaccine composition can be stored in lyophilised form to be rehydrated with ar appropriate vehicle or carrier prior to use
  • compositions suitable for mjectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile mjectable solutions or dispersion
  • sterile aqueous solutions where water soluble
  • dispersions sterile powders for the extemporaneous preparation of sterile mjectable solutions or dispersion
  • the form must be fluid to the extent that easy sy ⁇ ngabihty exists, unless the pharmaceutical form is a solid or semi-solid such as when slow release technology is employed In any event, it must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms
  • the carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), suitable mixtures thereof and vegetable oils
  • the proper fluidity can be maintained, fo r example, by the use of a coating such as lecithin, by the mai'.tenance of the required particle size in the case of dispersion and by the use of surfactants
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents such as, for example,, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like
  • it will be preferable to include isotonic agents such as, for example,, sugars or sodium chloride
  • Prolonged absorption of the mjectable compositions can be brought about by the use in the compositions of agents delaying absorption such as, for example, aluminum monostearate and gelatin Sterile mjectable
  • the present invention extends to vaccine compositions which confer protection against infection by one or more isolates or sub-types of L intracellulans including those that belong to the same serovar or serogroup as Lawsonia intracellulans
  • the vaccine composition preferably also confers protection against infection by other species of the genus Lawsonia or other microorganisms related thereto, as determined at the nucleotide, biochemical, structural, physiological and/or immunointeractive level, the only requirement being that said other species or other microorganism expresses a polypeptide which is immunologically cross-reactive to the polypeptide of the invention described herein
  • such related microorganisms may comprise genomic DNA which is at least about 70% identical overall to the genomic DNA of Lawsonia intracellulans as determined using standard genomic DNA hybridisation and analysis techniques
  • serovar refers to a classification of microorganirms which is based upon serological typing data, in particular data obtained using agglutination assays such as the microscopic agglutination test (MAT)
  • agglutination assay such as the microscopic agglutination test (MAT)
  • MAT microscopic agglutination test
  • serovar and serogroup antigens are a mosaic on the cell surface and, as a consequence there will be no strict delineation between bacteria belonging to a serovar and/or serogroup
  • organisms which belong to different species may be classified into the same serovar or serogroup because they are indistinguishable by antigenic determination
  • the term “serovar” means one or more Lawsonia strains which are antigenically-identical with respect to antigenic determinants produced by one or more loci Quantitatively serovars may be differentiated from one another by cross-agglutination absorption techniques
  • serogroup refers
  • the present invention thus clearly extends to vaccine compositions for the treatment and/or prophylaxis of animals in particular vaccine compositions for the treatment and/or prophylaxis of porcine and/or avian species against any bacterium belonging to the same serovar or serogroup as Lawsonia intracellulans
  • vaccine compositions for the treatment and/or prophylaxis of porcine and/or avian species against any bacterium belonging to the same serovar or serogroup as Lawsonia intracellulans Preferably, such organisms will express a polypeptide having an ammo acid sequence identity of at least about 60% overall with respect to SEQ ID NO 1
  • the present invention extends further to vaccine compositions capable of conferring protection against a "genetic variant" of Lawsonia intracellulans, the only requirement being that said variant expresses a polypeptide having an overall ammo acid sequence identity of at least about 60% with respect to SEQ ID NO 1 and/or comprises at least about 5 contiguous ammo acid residues derived from SEQ ID NO 1 or a homologue, analogue or derivative thereof which is immunologically cross-reactive thereto
  • Genetic variants of L intracellulans can be developed by mutation, recombination, conjugation or transformation of L intracellulans or may occur naturally It will be known to a person skilled in the art how to produce such derivatives
  • the vaccine composition of the invention is intended for or suitable for the prophylaxis and/or treatment of infection in a porcine or avian animal and more preferably, for prophylaxis and/or treatment of a porcine animal for infection by L intracellulans
  • the vaccine composition of the invention is intended for or suitable for the prophylaxis and/or treatment of infection in a porcine or avian animal and more preferably for prophylaxis and/or treatment of a porcine animal for infection by L intracellulans
  • the present invention clearly extends to the use of the immunogenic polypeptide of the invention according to any one of the preceding embodiments or as exemplified herein in the preparation of a medicament for the treatment and/or prophylaxis of PPE in animals particularly porcine or avian animals
  • the invention further extends to a method of treatment and/or prophylaxis of PPE in an animal such as an avian or porcine animal said method comprising administering the vaccine composition or the immunogenic polypeptide of the invention as described or exemplified herein to said animal for a time and under conditions sufficient for an immune response to occur thereto
  • the immune response to the immunogen is a protective immune response
  • the present invention further extends to combination vaccines comprising an effective 1 /
  • the second immunogenic component is selected from the group consisting of the L intracellulans autolysm, hemolysin, OmpH, and SodC polypeptides and homologues, analogues or derivatives thereof, in particular immunogenic variants or derivatives thereof, and nucleic acid molecules encoding same
  • the isolated or recombinant FlgE polypeptide of the invention or an immunologically- equivalent homologue, analogue or derivative thereof is also useful for the preparation of immunologically interactive molecules which are useful in the diagnosis of infection of an animal by Lawsonia spp , in particular by L intracellulans or a related organism thereto
  • immunologically interactive molecule includes antibodies and antibody derivatives and functional equivalents, such as a Fab, or a SCAB (single- chain antibody), any of which optionally can be conjugated to an enzyme, radioactive or fluorescent tag, amongst others
  • Fab single-chain antibody
  • SCAB single- chain antibody
  • a further aspect of the mveruon extends to an immunologically interactive molecule which is capable of binding ⁇ o any one or more of the following
  • a peptide, ohgopeptide or polypeptide which comprises an ammo acid sequence which has at least about 60% overall sequence identity to the ammo acid sequence set forth in SEQ ID NO 1 ,
  • the immunologically interactive molecule is an antibody that binds specifically to a polypeptide consisting of the amino acid of SEQ ID NO 1
  • polyclonal antisera or monoclonal antibodies can be made using standard methods
  • a mammal e g , a mouse, hamster, or rabbit
  • an immunogenic form of the polypeptide of the present invention which elicits an antibody response in the mammal
  • Techniques for conferring immunogenicity on a polypeptide include conjugation to carriers, or other techniques well known in the art
  • the polypeptide can be administered in the presence of adjuvant or can be coupled to a carrier molecule, as known in the art, that enhances the immunogenicity of the polypeptide
  • the progress of immunization can be monitored by detection of antibody titres in plasma or serum Standard ELISA or other immunoassay can be used with the immunogen as antigen to assess the levels of antibodies Following immunization, antisera can be obtained and, for example, IgG molecules corresponding to the polyclon
  • antibody producing cells can be harvested from an animal immunised with a peptide of the present invention and fused with myeloma cells by standard somatic cell fusion procedures, thus immortalizing these cells and yielding hyb ⁇ doma cells
  • somatic cell fusion procedures thus immortalizing these cells and yielding hyb ⁇ doma cells
  • Hyb ⁇ doma cells can be isolated and screened immunochemically for production of antibodies that are specifically reactive with the polypeptide and monoclonal antibodies isolated therefrom
  • the immunogenically effective amounts of the peptides of the invention must be determined empirically Factors to be considered include the immunogenicity of the native peptide, whether or not the peptide will be complexed with or covalently attached to an adjuvant or carrier protein or other carrier, the route of administration for the composition, i e , intravenous intramuscular, subcutaneous, etc , and the number of immunizing doses to be administered Such factors are known in the vaccine art and it is well within the skill of immunoiogists to make such determinations without undue experimentation
  • antibody as used herein, is intended to include fragments thereof which are also specifically reactive with a peptide that mimics or cross-reacts with a B-cell or T- cell epitope of the Lawsonia intracellulans FlgE polypeptide set forth in SEQ ID NO 1
  • Antibodies can be fragmented using conventional techniques and the fragments screened for utility in the same manner as described above for whole antibodies For example, F(ab')2 fragments can be generated by treating antibody with pepsin The resulting F(ab')2 fragment can be treated to reduce disulfide bridges to produce Fab' fragments
  • any secondary antibodies (monoclonal, polyclonal or fragments of antibodies), including anti-idiotypic antibodies, directed to the first mentioned antibodies discussed above
  • Both the first and second antibodies can be used in detection assays or a first antibody can be used with a commercially available anti-immunoglobuhn antibody
  • An antibody as contemplated herein includes any antibody specific to any region of a peptide which mimics, or cross-reacts with a B-cell or T-cell epitope of the Lawsonia intracellulans FlgE polypeptide set forth in SEQ ID NO 1 as here before described
  • the antibodies described herein are useful for determining B-cell or T-cell epitopes of the ammo acid sequence set forth in SEQ ID NO 1 such as, for example, by testing the ability of synthetic peptides to cross-react immunologically with said am o acid sequence or to elicit the production of antibodies which cross-react with said ammo acid sequence Using methods described herein, polyclonal antibodies, monoclonal antibodies or chime ⁇ c monoclonal antibodies can also be raised to peptides which mimic or cross-react with a B-cell or T-cell epitope of the Lawsonia intracellulans FlgE - 40 -
  • polyclonal monoclonal or chime ⁇ c monoclonal antibodies can be used to detect the peptides of the invention and/or any homologues, analogues or derivatives thereof, in various biological materials
  • they can be used in an ELISA, radioimmunoassay or histochemical test
  • the antibodies can be used to test for binding to a polypeptide of the invention or to a homologue, analogue or derivative thereof in a biological sample to diagnose the presence of Lawsonia intracellulans therein
  • a further aspect of the invention provides a method of diagnosing infection of an animal by Lawsonia intracellulans or a related microorganism thereto, said method comprising the steps of contacting a biological sample derived from said animal with an immunologically interactive molecule which is capable of binding to a peptide, ohgopeptide or polypeptide comprising the ammo acid sequence set forth in SEQ ID NO 1 or a homologue, analogue or derivative thereof, for a time and under conditions sufficient for an antigen antibody complex to form, and detecting said complex formation
  • the immunologically interactive molecule is preferably an antibody molecule prepared against the Lawsonia intracellulans FlgE polypeptide set forth in SEQ ID NO 1 or an analogue or derivative thereof
  • the biological sample is one which might contain a polypeptide having an ammo acid sequence set forth in SEQ ID NO 1 or a homologue, analogue or thereof, in particular a biological sample derived from a porcine or avian host of the pathogen Lawsonia intracellulans or a related microorganism thereto, and can include any appropriate tissue or fluid sample from the animal
  • Preferred biological samp'es are derived from the ileum, caecum, small intestine, large intestine, whole serum or lymph nodes of the porcine or avian host animal being tested
  • the biological test sample may comprise faeces or a rectal swab derived from the animal
  • the antibodies should not be prepared against highly-conserved epitopes of FlgE such as those regions of at least 5 am o acids in length which are conserved between L intracellulans and a microorganism which is present in the gut or other organ of an animal in respect of which diagnosis is sought such as, for ⁇ example, E coli
  • the present invention contemplates a method of identifying whether or not an animal has suffered from a past infection, or is currently infected with Lawsonia intracellulans or a related microorganism thereto, said method comprising contacting blood or serum derived from said animal with the immunogenic polypeptide of the invention for a time and under conditions sufficient for an antigen antibody complex to form, and detecting said complex formation
  • This embodiment differs from the embodiment described supra in that it relies upon the detection of emulating antibodies against Lawsonia intracellulans or related organism in the animals blood or serum which are present as a consequence of a past or present infection by this pathogen
  • the principle of the assay format is the same As with other embodiments of the invention referred to supra, conventional immunoassays can be used Persons skilled in the art will readily be capable of varying known immunoassay formats to perform the present embodiment
  • This embodiment of the invention can also utilise derivatives of blood and serum which comprise immunologically interactive molecules such as, for
  • a further aspect of the present invention provides an isolated nucleic acid molecule which comprises a sequence of nucleotides which encodes, or is complementary to a nucleic acid molecule which encodes, a peptide, ohgopeptide or polypeptide selected from the following
  • a peptide, ohgopeptide or polypeptide which comprises an ammo acid sequence having at least about 60% identical overall to the amino acid sequence set forth in SEQ ID NO:1 , (II) a peptide comprising at least 5 contiguous ammo acids derived from
  • the present invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides which encodes, or is complementary to a nucleic acid molecule which encodes, a polypeptide immunogen which comprises, mimics or cross-reacts with a B-cell or T-cell epitope of the Lawsonia intracellulans FlgE polypeptide set forth in SEQ ID NO'1
  • the present invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides encoding the L. intracellulans FlgE polypeptide having an ammo acid sequence set forth in SEQ ID NO: 1.
  • polymeric forms of the immunogenic polypeptide described herein such as aggregates of the amino acid sequence set forth in SEQ ID NO:1 or a homologue, analogue or derivative thereof or, alternatively, as polypeptides comprising repeats of the amino acid sequence set forth in SEQ ID NO:1 or a homologue, analogue or derivative thereof.
  • the present invention extends further to nucleic acid molecules encoding such polymeric forms. thereof.
  • the isolated nucleic acid molecule of the invention further comprises a sequence of nucleotides which has at least about 60% overall sequence identity to the nucleotide sequence set forth in SEQ ID NO:2 or to a complementary nucleotide sequence thereof. More preferably, the percentage sequence identity to SEQ ID NO:2 or to a complementary nucleotide sequence thereto is at least about 80%. Still more preferably, the percentage sequence identity is at least about 90%. Yet still more preferably, the percentage sequence identity is at least about 95%.
  • the nucleic acid molecule comprises the nucleotide sequence set forth in SEQ ID NO:2, or the FlgE-encoding nucleotide sequence present in pALK11 (ATCC 207156), or a degenerate variant thereof, and complements thereof.
  • nucleotide sequences In determining whether or not two nucleotide sequences fall within these percentage limits, those skilled in the art will be aware that it is necessary to conduct a side-by-side comparison or multiple alignment of sequences. In such comparisons or alignments, differences may arise in the positioning of non-identical residues, depending upon the algorithm used to perform the alignment.
  • reference to a percentage identity between two or more nucleotide sequences shall be taken to refer to the number of identical residues between said sequences as determined using any standard algorithm known to those skilled in the art. For example, nucleotide sequences may be aligned and their identity calculated using the BESTFIT programme or other appropriate programme of the Computer Genetics Group, Inc., University Research Park, Madison, Wisconsin, United States of America (Devereaux et al, 1984).
  • the isolated nucleic acid molecule of the invention is capable of hybridising under at least low stringency conditions and to the nucleotide sequence set forth in SEQ ID NO:2 or to a complementary nucleotide sequence thereto or to a nucleic acid fragment comprising at least about 20 contiguous nucleotides in length derived from the sequence set forth in SEQ ID NO:2 or to a complementary nucleotide sequence thereto
  • nucleic acid molecule is capable of hybridising under at least moderate stringency conditions even more preferably under high stringency conditions • s
  • a low stringency is defined herein as being a hybridisation and/or a wash carried out in 6xSSC buffer 0 1 % (w/v) SDS at 28 C C
  • a moderate stringency is defined herein as being a hybridisation and/or wash carried out in 2xSSC buffer, 0 1 % (w/v) SDS at a temperature in the range 45 n C to 10 65°C
  • a high stringency is defined herein as being a hybridisation and/or wash carried out in 0 1xSSC buffer, 0 1% (w/v) SDS at a temperature of at least 65 °C
  • the stringency is increased by reducing the concentration of SSC buffer, and/or increasing the concentration of SDS and/or increasing the temperature of the 5 hybridisation and/or wash
  • the conditions for hybridisation and/or washing may vary depending upon the nature of the hybridisation membrane or the type of hybridisation probe used
  • Conditions for hybridisations and washes are well understood by one normally skilled in the art
  • 0 reference is found in pages 2 10 8 to 2 10 16 of Ausubel ef a/ (1987), which is herein incorporated by reference
  • the present invention clearly encompasses genetic constructs comprising the subject nucleic acid molecule in an expressible format s- -table for the preparation of a 5 recombinant immunogenic polypeptide of the present invention, such as for use in recombinant univalent or polyvalent recombinant vaccines
  • nucleic acid molecule will be operably connected to a promoter sequence which can thereby regulate expression of said nucleic acid molecule in a 0 prokaryotic or eukaryotic cell as described supra
  • the genetic construct optionally further comprises a terminator sequence
  • terminator refers to a DNA sequence at the end of a transc ⁇ ptional unit which signals termination of transcription
  • a ' terminator is a nucleotide sequence, generally located within the 3 -non-translated region of a gene or mRNA comprising a polyadenylation signal to facilitate the post-transc ⁇ ptional addition of a polyadenylate sequence to the 3'-end of a primary mRNA transcript
  • Terminator sequences may be isolated from the genetic sequences of bacteria, fungi, viruses, animals and/or plants Terminators active in animal cells are known and described in the literature
  • the genetic construct can be a cloning or expression vector, as known in the art, such as a plasmid, cosmid, or phage, comprising a nucleic acid molecule of the present invention, and host cells transformed or transfected therewith
  • the vector is plasmid pALK11 (ATCC Accession No. 207156)
  • the genetic constructs of the present invention are particularly useful for producing the immunogenic component of the vaccine composition described herein or for use in a DNA vaccine.
  • a range of genetic diagnostic assays to detect infection of an animal by Lawsonia intracellulans or a related microorganism can be employed using the nucleic acid molecule described herein such as, for example, assays based upon the polymerase chain reaction (PCR) and nucleic acid hybridisation All such assays are contemplated in the present invention
  • a still further aspect of the invention provides a diagnostic method of detecting Lawsonia intracellulans or related microorganism in a biological sample derived from an animal subject, said method comprising the steps of hyb ⁇ dismg one or more probes or primers derived from the nucleotide sequence set forth in SEQ ID NO 2 or a complementary nucleotide sequence thereto or a homologue, analogue or derivative thereof, to a DNA or RNA molecule present in said sample and then detecting said hybridisation using a detection means
  • the term ' probe refers to a nucleic acid molecule which is derived from the nucleotide sequence set forth in SEQ ID NO 2 and which is capable of being used in the detection thereof Probes may comprise DNA (single-stranded or double- stranded) or RNA (i e , ⁇ boprobes) or analogues thereof
  • primer refers to a probe as hereinbefore defined which is further capable of being used to amplify a nucleotide sequence from Lawsonia intracellulans or a related microorganism thereto in a PCR
  • Preferred probes and primers include fragments of the nucleotide sequence set forth in SEQ ID NO 2 and synthetic single-stranded DNA or RNA molecules of at least about 15 nucleotides in length derived from the sequence set forth in SEQ ID NO 2 or a complementary nucleotide sequence thereto
  • probes and primers according to this embodiment will comprise at least about 20 contiguous nucleotides derived from SEQ ID NO 2 or a complementary sequence thereto, even more preferably at least about 25 contiguous nucleotides, still even more preferably at least about 50 contiguous nucleotides and even more preferably at least about 100 nucleotides to about 500 nucleotides derived from the sequence set forth in SEQ ID NO 2 or a complement thereof Probes and primers comprising the full-length of SEQ ID NO 2 or a complementary nucleotide sequence thereto are also encompassed by the present invention
  • homologues of a nucleotide sequence shall be taken to refer to an isolated nucleic acid molecule which encodes a polypeptide that is functionally equivalent to the polypeptide encoded by the nucleic acid molecule of the present invention or to a polypeptide which is a homologue, analogue or derivative of SEQ ID NO 1 , notwithstanding the occurrence within said sequence, of one or more nucleotide substitutions, insertions, deletions, or rearrangements
  • nucleotide sequence set forth herein shall be taken to refer to an isolated nucleic acid molecule which encodes a functionally-equivalent polypeptide to the polypeptide encoded by the nucleic acid molecule of the present invention or a homologue, analogue or derivative of a polypeptide having the amino acid sequence of SEQ ID NON notwithstanding the occurrence of any non-nucleotide constituents not normally present in said isolated nucleic acid molecule such as, for example, carbohydrates, radiochemicals including radio nucleotides, reporter molecules such as, but not limited to biotin, DIG, alkaline phosphatase or horseradish peroxidase, amongst others.
  • Derivatives of a nucleotide sequence set forth herein shall be taken to refer to any isolated nucleic acid molecule which contains at least about 50% nucleotide sequence identity to 15 or more contiguous nucleotides present in the nucleotide sequence set forth in SEQ ID ⁇ O:2 or a complementary nucleotide sequence thereto.
  • the nucleotide sequence of the present invention may be subjected to mutagenesis to produce single or multiple nucleotide substitutions, deletions and/or insertions.
  • Nucleotide insertional derivatives of the nucleotide sequence of the present invention include 5 ' and 3 ' terminal fusions as well as intra-sequence insertions of single or multiple nucleotides or nucleotide analogues.
  • Insertional nucleotide sequence variants are those in which one or more nucleotides or nucleotide analogues are introduced into a predetermined site in the nucleotide sequence of said sequence, although random insertion is also possible with suitable screening of the resulting product being performed.
  • Deletional nucleotide sequence variants are characterised by the removal of one or more nucleotides from the nucleotide sequence.
  • Substitutional nucleotide sequence variants are those in which at least one nucleotide in the sequence has been removed and a different nucleotide or nucleotide analogue inserted in its place. In a preferred embodiment, such substitutions are selected based on the degeneracy of the genetic code, as known in the art, with the resulting substitutional variant encoding the amino acid sequence of SEQ ID NO:1.
  • Probes or primers can comprise inosine, adenine, guanine, thymidine, cytidine or uracil residues or functional analogues or derivatives thereof that are capable of being incorporated into a polynucleotide molecule, provided that the resulting probe or primer is capable of hybridising under at least low stringency conditions to SEQ ID NO:2 or to a complementary nucleotide sequence thereof, or is at least about 60% identical to SEQ ID NO 2 or to a complementary nucleotide sequence thereof
  • the biological sample according to this aspect of the invention includes any organ, tissue, cell or exudate which contains or is likely to contain Lawsonia intracellulans or a nucleic acid derived therefrom
  • a biological sample can be prepared in a suitable solution such as, for example, an extraction buffer or suspension buffer
  • suitable solution such as, for example, an extraction buffer or suspension buffer
  • the present invention extends to the testing of biological solutions thus prepared, the only requirement being that said solution at least comprises a biological sample as described herein
  • the diagnostic assay of the present invention is useful for the detection of Lawsonia intracellulans or a microorganism which is related thereto which expresses the flagellar hook protein of the present invention or a flagellar hook protein-like polypeptide
  • the probe or primer, or a homologue, analogue or derivative thereof comprises DNA capable of being used to detect multiple Lawsonia spp
  • the probe or primer or a homologue, analogue or derivative thereof comprises DNA capable of being used to distinguish Lawsonia intracellulans from related microorganisms
  • SEQ ID NO 2 Less-highly consen/ed regions within SEQ ID NO 2 are particularly us ⁇ ful as species-specific probes and/or primers for the detection of L intracellulans and very closely related species
  • the diagnostic assays described herein can be adapted to a genus- specific or species-specific assay by varying the stringency of the hybridisation step Accordingly, a low stringency hybridisation can be used to detect several different species of Lawsonia in one or more biological samples being assayed, while a high stringency hybridisation can be used to distinguish Lawsonia intracellulans from such other species
  • the detection means may be any nucleic acid- based detection means such as for example, nucleic acid hybridisation techniques or paper chromatography hybridisation assay (PACHA), or an amplification reaction such as PCR, or nucleic acid sequence-based amplification (NASBA) system
  • the invention further encompasses the use of different assay formats of said nucleic acid-based detection means, including restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), single-strand chain polymorphism (SSCP), amplification and mismatch detection (AMD) interspersed repetitive sequence polymerase chain reaction (IRS-PCR), inverse polymerase chain reaction (iPCR), in situ polymerase chain reaction and reverse transcription polymerase chain reaction (RT-PCR), amongst others
  • the probe can be labelled with a reporter molecule capable of producing an identifiable signal (e g , a radioisotope such as 32 P or 35 S, or a biot ylated molecule)
  • a reporter molecule capable of producing an identifiable signal
  • the detection of said reporter molecule provides for identification of the probe and that, following the hybridisation reaction, the detection of the corresponding nucleotide sequences in the biological sample is facilitated Additional probes can be used to confirm the assay results obtained using a single probe
  • a variation of '.he nucleic acid hybridisation technique contemplated by the present invention is the paper chromatography hybridisation assay (PACHA) described by Reinhartz ef al (1993) and equivalents thereof, wherein a target nucleic acid molecule is labelled with a reporter molecule such as biotm, applied to one end of a nitrocellulose or nylon membrane filter strip and subjected to chromatography under the action of capillary or other forces (e g , an electric field) for a time and under conditions sufficient to promote migration of said target nucleic acid along the length of said membrane to a zone at which a DNA probe is immobilised thereto such as, for example, in the middle region
  • labelled target nucleic acid comprising the Lawsonia spp nucleotide sequences complementary to the probe will hybridise thereto and become immobilised in that region of the membrane to which the probe is bound
  • Non-complementary sequences to the probe will diffuse past the site at which the probe is bound
  • the target nucleic acid
  • the detection means is a RFLP
  • nucleic acid derived from the biological sample, in particular DNA is digested with one or more restriction endonuclease enzymes and the digested DNA is subjected to electrophoresis, transferred to a solid support such as, for example, a nylon or nitrocellulose membrane, and hybridised to a probe optionally labelled with a reporter molecule as hereinbefore defined
  • a specific pattern of DNA fragments is displayed on the support, wherein said pattern is preferably specific for a particular Lawsonia spp., to enable the user to distinguish between different species of the bacterium.
  • the detection means is an amplification reaction such as, for example, a polymerase chain reaction or a nucleic acid sequence-based amplification (NASBA) system or a variant thereof, one or more nucleic acid primer molecules of at least 15 contiguous nucleotides in length derivable from SEQ ID NO.2 or its complementary nucleotide sequence, or a homologue, analogue or derivative thereof, is hybridised to nucleic acid der /ed from a biological sample, and nucleic acid copies of the FlgE- encoding genetic sequences in said sample, or a part or fragment thereof, are enzymically-amplified
  • NASBA nucleic acid sequence-based amplification
  • the stringency conditions can be selected to promote hybridisation - 3 ;
  • each primer is at least about 95% identical to a region of SEQ ID NO 2 or its complementary nucleotide sequence in the template molecule to which it hybridises
  • PCR provides for the hybridisation of non-complementary primers to different strands of the template molecule such that the hybridised primers are positioned to facilitate the 5 ⁇ 3 synthesis of nucleic acid in the intervening region, under the control of a thermostable DNA polymerase enzyme
  • PCR provides an advantage over other detection means in so far as the nucleotide sequence in the region between the hybridised primers may be unknown and unrelated to any known nucleotide sequence
  • the primers are selected such that, when nucleic acid derived from the biological sample, in particular DNA, is amplified, different length amplification products are produced from different Lawsonia spp
  • the amplification products can be subjected to electrophoresis, transferred to a solid support such as, for example, a nylon or nitrocellulose membrane, and hybridised to a probe optionally labelled with a reporter molecule as hereinbefore described
  • a specific pattern of amplified DNA fragments is displayed on the support, said pattern optionally specific for a particular Lawsonia ssp , to enable the user to distinguish between different species of the bacterium in much the same way as for RFLP analysis
  • the technique of AMD facilitates, not only the detection of Lawsonia spp DNA in a biological sample, out also the determination of nucleotide seque ce variants which differ from the primers and probes used in the assay format
  • the probe is end-labelled with a suitable reporter molecule and mixed with an excess of the amplified template molecule
  • the mixtures are subsequently denatured and allowed to renature to form nucleic acid "probe template hybrid molecules" or "hybrids”, such that any nucleotide sequence variation between the probe and the temple molecule to which it is hybridised will disrupt base-pairing in the hybrids
  • probe template hybrid molecules or "hybrids”
  • the use of a single end-labelled probe allows unequivocal localisation of the sequence variation
  • the distance between the po ⁇ nt(s) of sequence variation and the end-label is represented by the size of the cleavage product
  • the probe is labelled at both ends with a reporter molecule, to facilitate the simultaneous analysis of both DNA strands
  • the nucleic acid sample comprises an RNA molecule which is a transcription product of Lawson/a-de ⁇ ved DNA or a homologue, analogue or derivative thereof
  • this assay format is particularly useful when it is desirable to determine expression of one or more Lawsonia genes
  • the RNA sample is reverse-transcribed to produce the complementary single-stranded DNA which is subsequently amplified using standard procedures
  • the present invention clearly extends to the use of any and all detection means referred to supra for the purposes of diagnosing Lawsonia spp and in particular Lawsonia intracellulans infection in animal
  • the amplification reaction detection means described supra can be further coupled to a classical hybridisation reaction detection means to further enhance sensitivity and -> .
  • hybridisation reaction detection means described supra can be further coupled to a second hybridisation step employing a probe which is different from the probe used in the first hybridisation reaction
  • a further aspect of the invention provides an isolated probe or primer derived from SEQ ID NO 2 or a complementary nucleotide sequence thereto
  • the present invention does not extend to immunogenic polypeptides which comprises exclusively the C-termmal region of the FlgE polypeptide as described in International Patent Application No PCT/AU96/00767 or nucleotide sequences encoding same or vaccine compositions therefor
  • Sections of grossly thickened ilea were taken from pigs naturally or experimentally affected by PPE The presence of L. intracellulans bacteria in the ilea vas confirmed using immunofluorescent staining with specific monoclonal antibodies (McO ⁇ st ef a/., 1987)
  • An example of a suitable antibody is monoclonal antibody IG4 available from the University of Edinburgh, UK.
  • Lawsonia intracellulans bacteria were extracted directly from lesions of PPE in pigs by filtration and further purified over a Percoll (Pharmacia Uppsala Sweden) gradient as follows Infected ilea were collected from pigs and the presence of L intracellulans was confirmed histologically before storage at -80 °C Sections of ileum were thawed and approximately 8g of infected mucosa were scraped from the intestinal wall The mucosa was homogenised with 40 ml sterile phosphate buffered saline (PBS) on half speed for 10 seconds using a Sorvall omnimixer This suspension was centrifuged at 2000 xg for 4 minutes The supernatant was discarded and the ceil pellet was resuspended in 40 ml PBS and re-cent ⁇ fuged This washing step was repeated twice The cell pellet was then resuspended in 20 ml PBS and homogenised at full speed for one minute to release L intra
  • the L intracellulans cells were pelleted by cent ⁇ fugation at 14,000 x g at 4°C for 15 mm
  • the cells were resuspended in 10 ml of TE buffer (1 mM Tris-HCI, 0 1 mM EDTA, pH 8.0) and centrifuged as before The pellet was then resuspended in 4 ml of TE buffer containing 4 mg/ml lysozyme (Sigma Chemical Co.) and incubated at 37 " C for 20 m SDS and protemase K (Promega, Wl, USA) were added to final concentrations of 1 % (w/v) and 200 ⁇ g/ml, respectively, and incubation was continued at 45°C for 4 hours.
  • the lysate was then extracted with an equal volume of phenol, phenol chloroform (1 :1 ) and chloroform, respectively, and the nucleic acids were recovered from the supernatant by ethanol precipitation.
  • the pellet was gently dissolved in TE, treated with RnaseA (Promega, Wl, USA) at 37°C for 30 min and then digested with proteinase K in the presence of 0.5% (w/v) SDS for 1 h at 50°C. After another round of phenokchloroform (1 :1) and ethanol precipitation, the purified DNA was dissolved in TE The DNA was then stored at 4°C
  • Example 3 The genomic DNA from Example 3 was partially digested with the restriction endonuclease SauZA (Promega) and hgated into Lambda ZAP Express (Stratagene, CA, USA). The lambda library was plated on a lawn of E. coli XLI-Blue cells at a density of 1 ,000 phage forming units (pfu) per 150 mm L-broth agar plate.
  • the library was screened using the method described in the Protoblot Technical Manual (Promega, Wl, USA) The filters were blocked in blocking buffer (10 mM Tris-HCI, pH 8.0, 150 mM NaCl, 0.05% Tween 20, 5% Blotto), prior to screening with sera from the pigs Y12 and/or 395.
  • the pigs Y12 and 395 had been immunised with formalin-killed L intracellulans and heat-killed L intracellulans, respectively as described in International Patent Application No PCT/AU96/00767 Positive plaques which were identified in the primary screen were picked re-plated at a lower density and re- screened with either or both sera until an individual plaque was isolated Plasmid DNA from the positive lambda phage clone was isolated by in vivo excision, as recommended by the manufacturer (Stratagene CA USA) A clone containing the partial flgE gene of L intracellulans was identified in this way
  • Phagemid DNA from positive ⁇ ZAP II Express phage clones was isolated by in vivo excision, by the conditions recommended by the manufacturer (Stratagene)
  • Plasmid DNA for restriction analysis was extracted by alkaline-lysis, as described by Sambrook et al (1989), and for automated sequencing, using the High Pure Plasmid Kit, as recommended by the manufacturer (Boeh ⁇ nger Mannheim, Mannheim, Germany)
  • the nucleotide sequence (1005 bp) of the 5' region of the flgE gene of Lawsonia intracellulans was obtained from the clone isolated as described in Example 4 The remaining portion of the flgE gene was amplified using the Vectorette System as described by the manufacturer (Genosys Biotechnologies Ine , TX, USA)
  • the Vectored System enables the amplification of specific DNA fragments where the sequence of only one primer is known There are three basic steps as follows
  • the nucleotide sequence of the amplified product containing the flgE gene was then obtained DNA sequencing of amplified DNA and isolated clone inserts was performed by the Dye-terminator method of automated sequencing (ABI Biosystems CA USA)
  • the nucleotide sequence of the complete coding region of the flgE gene is set out in SEQ ID NO 2
  • the FlgE gene was amplified from L intracellulans chromosomal DNA using the following primers
  • the resulting 1 5 kb PCR fragment was cloned into the pGEMT-TA vector (Promega)
  • the FlgE- containing DNA fragment was isolated from this construct following complete digestion with Xbal and partial digestion with A/del
  • the resulting band was gel-purified and directionally- cloned, as an A/del -Xbal fragment, into a heat-inducible lambda-PL expression vector
  • the recombinant vector was introduced into E. coli cells which were maintained at 30"C. Heat induction of FlgE expression occurred upon shifting the incubation temperature to 42 °C.
  • the solubilized protein was applied to a Q-sepharose FF column using 4 M Urea, 50 mM Tris, pH 7.0 as buffer, and eluted using a salt gradient.
  • the desired protein eluted from this column at 10-15% NaCl concentration.
  • the pooled eluant fractions were step-dialyzed using 10kDa molecular weight cut-off membrane against 2 M Urea, 50 mM Tris (pH 7.2), and then step-dialyzed to 50 mM Tris, pH 7.0.
  • the final product was filtered through a 0.22 ⁇ M membrane.
  • the protein concentration of the filtrered solution was 0.85 mg/ml, with an estimated purity of greater than about 80% as determined using SDS/PAGE.
  • Template DNA was purified from DNA isolated from infected pig intestinal mucosa isolated from the ileum of pigs infected with L. intracellulans. DNA purification from intestinal mucosa was performed according to the method of Nollau ef al. (1996). Due to the presence of contaminating polysaccharides and other material, the DNA content of the samples was not quantitated and samples were used empirically in PCR amplifications
  • the PCR amplifications consisted of 1 u ⁇ pig intestinal mucosa, 1 uM each of the forward (RA170 5' CTATTTTTAGGAGATGTTATC 3 , SEQ ID NO 3) and reverse primers (RA171 5' TACAAAATTAACAATAAAATAC 3', SEQ ID NO 4), 7 5 units KlenTaql polymerase (Ab Peptides, Ine , St Louis Missouri), 0 075 units Pfu polymerase (Stratagene Cloning Systems, La Jolla, California), 1 x PC2 (KlenTaql) buffer and 0 2 mM dNTPs in a 50 u ⁇ volume PCR was carried out in 4 stages (i) 94°C for 5 mm, (n) 94°C for 1 mm, 58°C for 30 seconds, 72X for 2 mm, x 33 cycles, (in) 72°C for 10 m ⁇ n, (iv) hold at 4°C
  • pCR2 1-TOPO Invitrogen Corp , Carlsbad, CA
  • pALK11 ATCC Accession No. 207156
  • the plasmid pALK11 was deposited with the American Type Culture Collection (ATCC) at 10801 University Boulevard, Manassas, VA 20110, USA on 11th March, 1999 and was assigned ATCC Accession No 207156

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Analytical Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates generally to therapeutic compositions for the treatment and/or prophylaxis of intestinal disease conditions in animals and birds caused or exacerbated by Lawsonia intracellularis or similar or otherwise related microorganism. In particular, the present invention provides a novel gene derived from Lawsonia intracellularis which encodes an immunogenic FlgE peptide, polypeptide or protein that is particularly useful as an antigen in vaccine preparation for conferring humoral immunity against Lawsonia intracellularis and related pathogens in animal hosts. The present invention is also directed to methods for the treatment and/or prophylaxis of such intestinal disease conditions and to diagnostic agents and procedures for detecting Lawsonia intracellularis or similar or otherwise related microorganisms.

Description

LAWSONIA DERIVED GENE AND RELATED FlgE POLYPEPTIDES, PEPTIDES AND PROTEINS AND THEIR USES
FIELD OF THE INVENTION
5 The present invention relates generally to therapeutic compositions for the treatment and/or prophylaxis of intestinal disease conditions in animals and birds caused or exacerbated by Lawsonia intracellularls or similar or otherwise related microorganism In particular, the present invention provides a novel gene derived from Lawsonia intracellularls which encodes an immunogenic peptide, polypeptide or protein The
10 polypeptide described herein, designated as FlgE, or a peptide homologue, analogue or derivative thereof is particularly useful as an antigen in vaccine preparation for conferring humoral immunity against Lawsonia intracellularls and related pathogens in animal hosts The present invention is also directed to methods for the treatment and/or prophylaxis of such intestinal disease conditions and to diagnostic agents and
15 procedures for detecting Lawsonia intracellularls or similar or otherwise related microorganisms
GENERAL
Bibliographic details of the publications numerically referred to in this specification are 20 collected at the end of the description All patents, patent applications, and publications cited herein are incorporated by reference in their entirety
Reference hereinafter to "Lawsonia intracellularls" or its abbreviation "L intracellularls" includes all microorganisms similar to or otherwise related to this microorganism, as 25 described by Stills (1991 ) or Jones et al (1997) or Lawson et al (1993) or McOπst et al (1995)
As used herein, the word "flgE', or the term "flgE gene", shall be taken to refer to the gene encoding the flagellar hook protein of the present invention It shall also be 30 understood that the term "FlgE polypeptide" refers to the flagellar hook protein of the invention As used herein the term "derived from" shall be taken to indicate that a specified product in particular a macromolecule such as a peptide polypeptide, protein gene or nucleic acid molecule, antibody molecule Ig fraction or other macromolecule or a biological sample comprising said macromolecule may be obtained from a particular source, organism, tissue, organ or cell albeit not necessarily directly from that source organism, tissue, organ or cell
Throughout this specification unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated step or element or integer or group of steps or elements or integers but not the exclusion of any other step or element or integer or group of elements or integers
Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described It is to be understood that the invention includes all such variations and modifications The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps features, compositions and compounds
The present invention is not to be limited in scope by the specific embodiments described herein, which are intended for the purposes of exemplification only Functionally equivalent products, compositions and methods are clearly within the scope of the invention, as described herein
BACKGROUND OF THE INVENTION
The meat-producing sector of the agricultural industry is dependant upon the health of its livestock and there is a need to maintain disease-free livestock for human consumption The industry is subject to rapid economic downturn in response to disease conditions adversely affecting livestock and the quality of meat products derived therefrom, including those diseases which may potentially be transmitted to humans It is important therefore to have well defined treatments and prophylactic and diagnostic procedures available to deal with infections or potential infections in livestock animals and humans
Meat products derived from porcine and avian species are significant commercial products in the agriculture industry In particular, pigs form a major component of the meat industry However, pigs are sensitive to a wide spectrum of intestinal diseases collectively referred to as porcine proliferative enteropathy (PPE) These diseases have previously been known as intestinal adenomatosis complex (Barker and van Drumel 1985) porcine intestinal adenomatosis (PIA) necrotic enteritis (Rowland and Lawson, 1976), proliferative haemorrhagic enteropathy (Love and Love 1977), regional ileitis (Jonsson and Martinsson, 1976), haemorrhagic bowel syndrome (O'Neil, 1970), porcine proliferative enteritis and Campylobacter spp - induced enteritis (Straw, 1990)
There are two main forms of PPE a non-haemorrhagic form represented by intestinal adenomatosis which frequently causes growth retardation and mild diarrhoea, and a haemorrhagic form, which is often fatal, represented by proliferative haemorrhagic enteropathy (PHE), where the distal small intestine lumen becomes engorged with blood PPE has been reported in a number of animal species including pigs (McOπst er a/ 1993), hamsters (Stills, 1991) ferrets (Fox et al, 1989) guinea pigs (Elwell et al, 1981), rabbits (Schodeb and Fox, 1990) as well as avian species (Mason et al, 1998)
The causative organism of PPE is a Campy/o-bacter-like organism referred to herein as "Lawsonia intracellulans" (McOπst et al 1995) The organism has also been previously referred to as Heal symbiont intracellulans (Stills, 1991) PPE-like diseases in pigs may also be caused by other pathogens such as various species of Campylobacter (Gebhart et al, 1983)
Lawsonia intracellulans is an intracellular, possibly obligate intracellular, bacterium It can only be cultured in vitro with tissue culture cells (Jones et al , 1997, Lawson et al , 1993, McOπst et al, 1995, International Patent Application No PCT/US96/09576) L intracellulans is located in the cytoplasm of the villus cells and intestinal crypt cells of infected animals Pigs suffering from PPE are characterised by irregularities in the villus cells and intestinal crypt structure with epithelial cell dysplasia wherein crypt abscesses form as the vil and intestinal crypts become branched and fill with inflammatory cells
PPE is a significant cost component associated with the pig industry, especially in terms of stock losses, medication costs, reduced growth rates of pigs and increased feed costs PPE also contributes to downstream indirect costs in, for example additional labour costs and environmental costs in dealing with antibiotic residue contamination, and in control measures to prevent the organism from being passed on or carried to other animals or humans
Current control strategies for PPE rely on the use of antibacteπals However, such a strategy is considered to only be short to medium term, especially since governmental regulatory pressures tend to discourage animal husbandry practices which involve the use of prophylactic antibiotics There is a need, therefore, to develop effective, safe and low cost alternatives to the use of antibiotics and, in particular, to develop vaccine preparations capable of conferring protective immunity against Lawsonia intracellulans infection in livestock animals
The most effective vaccine preparations are generally comprised of a highly antigenic component, such as a peptide, polypeptide, protein or other macromolecule which is derived from the pathogenic organ'r, against which the vaccine is directed, wherein said antigenic component produces little or no contraindications when administered to a susceptible host animal, and produces little or no antigenic cross-reactivity with desirable organisms, such as non-pathogenic organisms that are a part of the normal flora of the intestinal tract or other tissues of said host animal In summary, an effective vaccine preparation must be immunogenic, specific and safe
Accordingly, there is a need to identify highly immunogenic antigens produced by the bacterium Lawsonia intracellulans International Patent Application No PCT/AU96/00767 describes several L intracellulans partial genetic sequences and partial polypeptides encoded thereby However there is a need to further identify polypeptide immunogens produced by the bacterium L intracellulans and immunogenic peptides derived therefrom including those immunogens which are genus- or species-specific for use in improved vaccine compositions The presently-described invention provides such immunogens
SUMMARY OF THE INVENTION
One aspect of the present invention is directed to an isolated or recombinant immunogenic polypeptide which comprises mimics or cross-reacts with a B-cell or T- cell epitope of the FlgE polypeptide derived from Lawsonia spp Preferably, the isolated or recombinant immunogenic polypeptide is selected from the group consisting of the following
(i) a peptide, o gopeptide or polypeptide which comprises an ammo acid sequence which has at least about 60% sequence identity overall to the ammo acid sequence set forth in SEQ ID NO-1 ,
(n) a peptide, ohgopeptide or polypeptide which comprises at least about 5 contiguous ammo acids of the am o acid sequence defined by SEQ ID NO 1 , or (in) a homologue analogue or derivative of (i) or (n) which mimics a B-cell or
T-cell epitope of Lawsonia spp
In a preferred embodiment, the polypeptide comprises or consists essentially of the ammo acid sequence of SEQ ID NO 1
A further aspect of the present invention provides a vaccine composition for the prophylaxis or treatment of infection in an animal, such as a pig or bird, by L intracellulans or a similar or otherwise related microorganism, said vaccine composition comprising an immunologically effective amount of an immunogenic component which comprises an isolated or recombinant polypeptide having at least about 60% overall sequence identity to the ammo acid sequence set forth in SEQ ID NO 1 , or comprising at least 5 contiguous ammo acids derived from SEQ ID NO 1 or an immunogenic homologue, analogue or derivative thereof which is immunologically cross-reactive with Lawsonia intracellulans and one or more carriers, diluents and/or adjuvants suitable for veterinary or pharmaceutical use
In a preferred embodiment, the polypeptide of the vaccine composition comprises or consists essentially of the ammo acid sequence of SEQ ID NO' 1
A further aspect of the invention extends to an immunologically interactive molecule, such as an antibody or antibody fragment, which is capable of binding to the immunogenic polypeptide of the invention
A further aspect of the invention provides a method of diagnosing infection of an animal by Lawsonia intracellulans or a related microorganism, said method comprising the steps of contacting a biological sample derived from said animal with an immunologically interactive molecule of the present invention for a time and under conditions sufficient for a complex, such as an antigen.antibody complex, to form, and then detecting said complex formation.
A further aspect of the present invention contemplates a method of determining whether or not an animal has suffered from a past infection, or is currently infected, by Lawsonia intracellulans or a related microorganism, said method comprising contacting a tissue or fluid sample, such as blood or serum derived from said animal, with the immunogenic polypeptide of the invention for a time and under conditions sufficient for a complex, such as an antigen.antibody complex, to form, and then detecting said complex formation.
A further aspect of the present invention provides an isolated nucleic acid molecule which comprises a sequence of nucleotides that encodes, or is complementary to a nucleic acid molecule that encodes, a peptide, ohgopeptide or polypeptide selected from the following:
(i) a peptide, ohgopeptide or polypeptide which comprises an amino acid sequence which has at least about 60% overall sequence identity to the amino acid sequence set forth in SEQ ID NO 1
(II) a peptide ohgopeptide or polypeptide which comprises at least about 5 contiguous ammo acids derived from SEQ ID NO 1 or (in) a homologue analogue or derivative of (i) or (n) which mimics a B-cell or T-cell epitope of Lawsonia spp
In a preferred embodiment the isolated nucleic acid molecule comprises the nucleotide sequence set forth in SEQ ID NO 2, or a degenerate variant thereof, has at least about 60% sequence identity to all or a part thereof
A still further aspect of the invention provides a diagnostic method of detecting Lawsonia intracellulans or related microorganism in a biological sample derived from an animal subject, said method comprising the steps of hybridising one or more polynucleotide or ohgonucleotide probes or primers derived from the nucleotide sequence set forth in SEQ ID NO 2 or a complementary nucleotide sequence thereof or a homologue, analogue or derivative thereof, to said sample, and then detecting said hybridisation using a detection means The detection means according to this aspect of the invention is any nucleic acid-based hybridisation or amplification reaction
A further aspect of the invention provides an isolated probe or primer derived from SEQ ID NO 2 or a complementary nucleotide sequence thereto
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a schematic representation comparing the ammo acid secjence of Lawsonia intracellulans (L int) flagellar hook protein FlgE to the ammo acid sequences of flagellar hook proteins derived from Treponema phagedenis (T phage), Treponema pallidum (T palli), Salmonella typhimunum (S typhi), Escheπchia coll (E co ), Aquifex aeolicus (A aeo), Vibrio parahaemolyticus (V parah) and Borrelia burgdorfen (B burgd) Gaps have been introduced to optimise the alignment Positions containing identical ammo acid residues with respect to the FlgE polypeptide of Lawsonia intracellulans (SEQ ID NO 1) are shaded Residues that are identical in all eight sequences appear in boldface DETAILED DESCRIPTION OF THE INVENTION
In work leading up to the present invention the inventors sought to identify immunogenic proteins of Lawsonia intracellulans for use in vaccines for the prophylaxis and treatment of PPE in animals including pigs and birds
Accordingly one aspect of the present invention is directed to an isolated or recombinant immunogenic polypeptide which comprises mimics or cross-reacts with a B-cell or T-cell epitope of the FlgE polypeptide derived from Lawsonia spp
Epitopes of Lawsonia spp may be B cell epitopes or T-cell epitopes It is well-known that antibody-binding sites (B-cell epitopes) involve linear as well as conformational epitopes (van Regenmortel, 1992) B-cell epitopes are predominantly conformational In contrast, T-cells recognize predominantly linear epitope sequences in combination with MHC class II molecules
A precise identification and careful selection of epitopes of Lawsonia spp facilitates the development of diagnostic reagents and vaccine compositions for the effective treatment or prophylaxis of Lawsonia infections Epitope identification and characterization (i e , determination of the molecular weight, ammo acid sequence, and structure of epitopes of Lawsonia spp ) may be performed using art-recognised techniques For the detection of conformational epitopes, degrading and denaturing of the epitope molecule must be avoided in order to conserve the three-dimensional structure, because the antigen-antibody reaction will be diminished i. the secondary structure of the epitope is altered significantly In practice, the characterisation and isolation of linear non-conformational epitopes is easier, because any immunoreactive regions are contained within a single peptide fragment or single ammo acid sequence which is capable of being purified under a range of conditions
Both non-conformational and conformational epitopes may be identified by virtue of their ability to bind detectable amounts of antibodies (such as IgM or IgG) from sera of animals immunised against or infected with Lawsonia spp and, in particular L intracellulaπs or an isolated polypeptide derived therefrom or alternatively, by virtue of their ability to bind detectable amounts of antibodies in a purified Ig fraction derived from such sera The antibodies may be derived from or contained within pools of polyclonal sera, or may be monoclonal antibodies Antibody fragments or recombinant antibodies, such as those expressed on the surface of a bacteπophage or virus particle, such as in a phage display library, may also be employed
The determination of T-cell epitopes is performed by analysing the ability of the epitope peptides to induce the proliferation of peripheral blood lymphocytes or T-cell clones The identification of T-cell epitopes is accomplished using a variety of methods as known in the art, including the use of whole and fragmented native or recombinant antigenic protein, as well as the more commonly employed "overlapping peptide" method In the latter method, overlapping peptides which span the entire sequence of a polypeptide derived from Lawsonia spp are synthesized and tested for their capacity to stimulate T-cell cytotoxic or proliferative responses in vitro
Structure determination of both conformational non-linear and non-conformational linear epitopes may be performed by nuclear magnetic resonance spectroscopy (NMR) and X-ray crystallographic analysis The determination of epitopes using X-ray techniques requires the protein-antibody complex to be crystallized, whereas NMR allows analysis of the complex in a liquid state NMR measures the amount of ammo acids as well as the neighbourhood of protons of different ammo acid residues, wherein the alternating effect of two protons along the carbon backbone is characteristic of a particular epitope
A successful method to recognize non-conformational linear epitopes is the immunoblot and in particular, the Western blot Peptides may be generated from a complete Lawsonia spp polypeptide by digestion with site-specific proteases, such as trypsm or chymotrypsin, and the peptides generated thereby can be separated using standard electrophoretic or chromatographic procedures For example, after electrophoresis according to molecular weight using SDS/PAGE (SDS/polyacrylamide gel electrophoresis) and/or according to isoelectπc point using IEF (isoelectπc focussing) or alternatively, by two-dimensional electrophoresis, the peptides can be transferred to immobilizing nylon or nitrocellulose membranes and incubated with sera raised against the intact polypeptides Peptides that comprise immunogenic regions
(i e , B-cell or T-cell epitopes) are bound by the antibodies in the sera and the bound antibodies may be detected using secondary antibodies, such as anti-lgG antibodies, that have been labelled radioactively or enzymatically The epitopes may then be characterised by purification based upon their size, charge or ability to bind specifically to antibodies against the intact polypeptide, using one or more techniques, such as size-exclusion chromatography, ion-exchange chromatography, affinity chromatography or ELISA among others After purification of the epitope, only one band or spot should be detectable with gel electrophoresis The N-termmal or total sequencing of the peptide offers the possibility to compare the peptide with known proteins in databases
Several computer-driven algorithms have now been devised to search for T-cell epitopes in proteins (Margaht et al, 1987, Vajda and C Deϋsi, 1990, Altuvia et al., 1994, Parker et al 994, DeGroot et al , 1995, Gabriel et al, 1995, Meister et al , 1995) These algorithms search the ammo acid sequence of a given protein for characteristics believed to be common to immunogenic peptides, locating regions that are likely to induce a cellular immune response in vitro Computer-driven algorithms can identify regions of a Lawsonia spp polypeptide that contain epitopes and are less variable among different isolates Alternatively, computer-driven algorithms can rapidly identify regions of each isolate's more variable proteins that should be included in a multivalent vaccine
The AMPHI algorithm (Margaht et al ,1987), which is based on the periodicity of T cell epitopes, has been widely used for the prediction of T-cell antigenic sites from sequence information alone Essentially, AMPHI describes a common structural pattern of MHC binding motifs, since MHC binding motifs (i e , patterns of ammo acids that appear to be common to most of the peptides that bind to a specific MHC molecule) appear to exhibit the same periodicity as an alpha helix Identification of T- cell epitopes by locating MHC binding motifs in an ammo acid sequence provides an effective means of identifying immunogenic epitopes in diagnostic assays
The EpiMer algorithm (Meister e al 1995, Gabriel et al 1995 DeGroot et al , 1995) locates clustered MHC binding motifs in ammo acid sequences of proteins, based upon the correlation between MHC binding motif-dense regions and peptides that may have the capacity to bind to a variety of MHC molecules (promiscuous or multi-determinant binders) and to stimulate an immune response in these various MHC contexts as well (promiscuous or multi-determinant epitopes) The EpiMer algorithm uses a library of MHC binding motifs for multiple class I and class II HLA alleles to predict antigenic sites within a protein that have the potential to induce an immune response in subjects with a variety of genetic backgrounds EpiMer locates matches to each MHC-binding motif within the primary sequence of a given protein antigen The relative density of these motif matches is determined along the length of the antigen, resulting in the generation of a motif-density histogram Finally, the algorithm identifies protein regions in this histogram with a motif match density above an algorithm-defined cutoff density value, and produces a list of subsequences representing these clustered, or motif-πch regions The regions selected by EpiMer may be more likely to act as multi-determinant binding peptides than randomly chosen peptides from the same antigen, due to their concentration of MHC-binding motif matches The selection of regions that are MHC binding motif-dense increases the likelihood that the predicted peptide contains a "valid" motif, and furthermore, that the reiteration of identical motifs may contribute to peptide binding
Additional MHC binding motif-based algoπt ns have been described by Pirker et al (1994) and Altuvia ef al (1994) In these algorithms, binding to a given MHC molecule is predicted by a linear function of the residues at each position, based on empirically defined parameters, and in the case of the Altuvia et al (1994) algorithm, known crystallographic structures may also be taken into consideration
Recombinant methods offer the opportunity to obtain well characterized epitopes of high purity for the production of diagnostic reagents and epitope-specific vaccine formulations (Mohapatra etal , 1995) Based upon the ammo acid sequence of a linear epitope and identification of the corresponding nucleotide sequence encoding same polymerase chain reaction (PCR) may be performed to amplify the epitope-encodmg region from cDNA After cloning and expression in a suitable vector/host system a large amount of epitopes of high purity can be extracted Accordingly the present invention clearly extends to both isolated non-recombmant polypeptides and recombinant polypeptides in an impure or isolated form
The term "polypeptide" as used herein shall be taken to refer to any polymer consisting of am o acids linked by covalent bonds and includes within its scope full-length proteins and parts or fragments thereof such as for example ohgopeptides and short peptide sequences consisting of at least about 5 ammo acid residues preferably at least about 10 ammo acid residues, more preferably at least about 12 ammo acid residues, and even more preferably at least about 15 ammo acid residues Also included within the scope of the definition of a "polypeptide" are ammo acid sequence variants, containing one or more preferably conservative ammo acid substitutions, deletions, or insertions, which do not alter at least one essential property of said polypeptide such as, for example, its imnnunogenicity, use as a diagnostic reagent, or effectiveness as a peptide vaccine against Lawsonia spp, amongst others Accordingly, a polypeptide may be isolated from a source in nature, or chemically synthesized Furthermore, a polypeptide may be derived from a full-length protein by chemical or enzymatic cleavage, using reagents such as CNBr, trypsin, or chymotrypsin, amongst others
Conservative ammo acid si-ostitutions are well-known in the art For example, one or more ammo acid residues of a native flagellar hook protein of the present invention can be substituted conservatively with an ammo acid residue of similar charge, size or polarity, with the resulting polypeptide retaining an ability to function in a vaccine or as a diagnostic reagent as described herein Rules for making such substitutions include those described by Dayhof (1978) More specifically, conservative ammo acid substitutions are those that generally take place within a family of ammo acids that are related in their side chains Genetically-encoded ammo acids are generally divided into four groups (1) acιdιc=aspartate, glutamate, (2) basιc=lysιne, arginme, and histidme, (3) non-polar=alanιne valine leucine isoleucine prohne, phenylalanine, methionine, and tryptophan and (4) uncharged polar= glycine asparagine glutamme, cysteine, serine threonine and tyrosine Phenylalanine, tyrosine and tryptophan are also jointly classified as aromatic ammo acids One or more replacements within any particular group such as for example, the substitution of leucine for isoleucine or valine or alternatively, the substitution of aspartate for glutamate or threonine for serine, or of any other ammo acid residue with a structurally-related ammo acid residue, will generally have an insignificant effect on the function of the resulting polypeptide
The present invention is not limited by the source of the subject immunogen and clearly extends to isolated and recombinant polypeptides which are derived from a natural or a non-natural occurring source
The term "recombinant polypeptide" as used herein shall be taken to refer to a polypeptide which is produced in vitro or in a host cell by the expression of a genetic sequence encoding said polypeptide, which genetic sequence is under the control of a suitable promoter, wherein a genetic manipulation has been performed in order to achieve said expression Accordingly, the term "recombinant polypeptide" clearly encompasses polypeptides produced by the expression of genetic sequences contained in viral vectors, cosmids or plasmids that have been introduced into prokaryotic or eukaryotic cells, tissues or organs Genetic manipulations which may be used in this context will be known to those skilled in the art and include, but are not limited to, nucleic acid isolation, restriction endonuclease digestion, exonuclease digestion, end-filling using the Klenow fragment of E coli DNA polymerase I or T4 DNA polymerase enzymes, blunt-ending of DNA molecules using T4 DNA polymerase or Exolll enzymes, site-directed mutagenesis, gation, and amplification reactions As will be known to those skilled in the art, additional techniques such as nucle'c acid hybridisations and nucleotide sequence analysis may also be utilised in the preparation of recombinant polypeptides, in confirming the identity of a nucleic acid molecule encoding a desired recombinant polypeptide and a genetic construct comprising the nucleic acid molecule Wherein the polypeptide of the present invention is a recombinant polypeptide, it may be produced in and if desirable isolated from a recombinant viral vector expression system or host cell As will be known to those skilled in the relevant art, a cell for production of a recombinant polypeptide is selected on the basis of several parameters including the genetic constructs used to express the polypeptide under consideration as well as the stability and activity of said polypeptide It will also be known to those skilled in the art that the stability or activity of a recombinant polypeptide may be determined, at least in part by post-translational modifications to the polypeptide such as, for example, glycosylation, acylation or alkylation reactions, amongst others, which may vary between cell lines used to produce the recombinant polypeptide
Accordingly, in a more particularly preferred embodiment, the present invention extends to a recombinant polypeptide or a derivative, homologue or analogue thereof as present in a virus particle, or as produced in prokaryotic or eukaryotic host cell, or in a virus or cell culture thereof
The present invention also extends to a recombinant polypeptide according to any of the foregoing embodiments which is produced in a bacterial cell belonging to the genus Lawsonia, in particular a cell of L intracellulans, or a culture thereof
The term "isolated polypeptide" refers to a polypeptide of the present invention which has been purified to some extent, preferably to at least about 20% by weight of protein, preferably to at least about 50% by weight of protein, more preferably to at least about 60% by weight of protein, still more preferably to at least about 70% by weight of protein and even more preferably to at least about 80% by weight of protein or greater, from its natural source or, in the case of non-naturally-occurπng polypeptides, from the culture medium or cellular environment in which it was produced Such isolation may be performed to improve the immunogenicity of the polypeptide of the present invention, or to improve the specificity of the immune response against that polypeptide, or to remove toxic or undesirable contaminants therefrom The necessary or required degree of purity of an isolated polypeptide will vary depending upon the purpose for which the polypeptide is intended, and for many applications it will be sufficient for the polypeptide preparation to contain no contaminants which would reduce the immunogenicity of the polypeptide when administered to a host animal, in particular a porcine or avian animal being immunized against PPE or alternatively which would inhibit immuno-specific binding in an immunoassay for the diagnosis of PPE or a causative agent thereof
The purity of an isolated polypeptide of the present invention may be determined by any means known to those skilled in the art, including the degree of homogeneity of a protein preparation as assessed by SDS/polyacrylamide gel electrophoresis, 2- dimensional electrophoresis or ammo acid composition analysis or sequence analysis
Preferably, the polypeptide of the present invention will be substantially homogeneous or substantially free of nonspecific proteins, as assessed by SDS/polyacrylamide gel electrophoresis, 2-dιmensιonal electrophoresis, or am o acid composition analysis or sequence analysis
The polypeptide of the present invention can be purified for use as a component of a vaccine composition by any one or a combination of methods known to those of ordinary skill in the art, including, for example, reverse phase chromatography, HPLC, ion-exchange chromatography, and affinity chromatography, among others
In a preferred embodiment, the isolated or recombinant polypeptide of the invention functions as a flagellar hook protein in a bacterium such as, for example, L intracellulans, or is derived from a flagellar hook protein or, alternatively, is immunologically cross-reactive with the L intracellulans flagellar hook protein, FlgE, of the present invention
In a particularly preferred embodiment, the isolated or recombinant polypeptide of the invention is derived from Lawsonia spp or other pathogenic agent associated with the onset and/or development of PPE and more preferably, the subject polypeptide is derived from Lawsonia intracellulans A B-cell or T-cell epitope of a FlgE polypeptide or a derivative homologue or analogue thereof may comprise any combination of the following
(i) the primary ammo acid sequence of a FlgE polypeptide, known in the art as a continuous non-conformational epitope, (n) the secondary structure which a FlgE polypeptide adopts, known in the art as a continuous conformational epitope (in) the tertiary structure which a FlgE polypeptide adopts in contact with another region of the same polypeptide molecule, known in the art as a discontinuous conformational epitope, or (iv) the quaternary structure which a FlgE polypeptide adopts in contact with a region of another polypeptide molecule, known in the art as a discontinuous conformational epitope
Accordingly, immunogenic polypeptides or derivatives, homologues or analogues thereof comprising the same, or substantially the same primary ammo acid sequence are hereinafter defined as "immunogens which comprise a B-cell or T-cell epitope" or similar term
Immunogenic polypeptides or derivatives, homologues, or analogues thereof comprising different primary ammo acid sequences may comprise immunologically identical immunogens, because they possess conformational B-cell or T-cell epitopes ihat are recognised by the immune system of a host species to be dentical Such immunogenic polypeptides or derivatives, homologues or analogues thereof are hereinafter defined as "immunogens which mimic or cross-react with a B-cell or T-cell epitope", or similar term
Accordingly, the present invention extends to an immunogen which comprises, mimics, or cross-reacts with a B-cell or T-cell epitope of an isolated or recombinant polypeptide according to any one of the foregoing embodiments or a derivative, homologue or analogue thereof In a particularly preferred embodiment, the present invention provides an immunogen which comprises, mimics or cross-reacts with a B-cell or T- cell epitope of an isolated or recombinant polypeptide which in its native form is obtainable from a species of Lawsonia such as, but not limited to L intracellulans and which polypeptide preferably functions as a flagellar hook protein
Preferably, such immunogenic polypeptides will not comprise a primary ammo acid sequence which is highly-conserved between L intracellulans and another non- pathogenic microorganism which is normally resident in the gut or other organ of an animal in particular a porcine or avian animal The significance of this exclusion to those embodiments of the invention wherein specificity is essential to performance (eg vaccine and diagnostic applications) will be apparent to those skilled in the art
In this regard, the present inventors have shown that the N-termmal ammo acid sequence of the FlgE polypeptide derived from L intracellulans and the 5'-regιon of the corresponding flgE gene are less highly conserved among homologous genes and polypeptides derived from other species, compared to the C-termmal region of the L intracellulans FlgE polypeptide and the 3'-regιon of the flgE gene Accordingly, the N- termmal region of the FlgE polypeptide is a particularly preferred immunogen for use in vaccination protocols and as diagnostic reagents in respect of L intracellulans Similarly the 5 -end of the flgE gene is particularly preferred for use as a diagnostic reagent for L intracellulans
To improve the immunogenicity of a subject polypeptide of the present invention one or more ammo acids not corresponding to the original protein sequence can be added to the ammo or carboxyl terminus of the polypeptide Such extra amino acids are useful for coupling the polypeptide to another peptide or polypeptide, to a large carrier protein or to a solid support Ammo acids that are useful for these purposes include but are not limited to tyrosine, lysine, glutamic acid, aspartic acid, cysteine and derivatives thereof Additional protein modification techniques can be used such as, e g , NH2-acetylatιon or COOH-termmal amidation, to provide additional means for coupling the polypeptide to another polypeptide, protein, or peptide molecule, or to a solid support Procedures for coupling polypeptides to each other, or to carrier X -
protems or solid supports are well known in the art Polypeptides containing the above-mentioned extra ammo acid residues at either the carboxyl- or ammo-termini and either uncoupled or coupled to a carrier or solid support are consequently within the scope of the present invention
Furthermore, the polypeptide can be immobilised to a polymeric carrier or support material
In an alternative embodiment the immunogenicity of a polypeptide of the present invention may be improved using molecular biology techniques to produce a fusion protein containing one or more polypeptides of the present invention fused to a carrier molecules such as a highly immunogenic protein For example, a fusion protein containing a polypeptide of the present invention fused to the highly immunogenic B subunit of cholera toxin can be used to increase the immune response to the polypeptide The present invention also contemplates fusion proteins comprising a cytokine, such as an interleukin, fused to the subject polypeptide of the present invention, and genes encoding same
Preferably, the polypeptide of the present invention, or a derivative, homologue or analogue thereof, when administered to a mammal, induces an immune response in said mammal More preferably, the polypeptide of the present invention, when administered to a mammal, in particular a porcine animal (e g , a pig) induces a protective immune response against Lawsonia spp , and preferably against L intracellulans, therein As used herein, the phrase "induct' ^n of a protecti a immune response", and the like, refers to the ability of the administered polypeptide of the present invention to prevent or detectably slow the onset, development, or progression of symptoms associated with Lawsonia infection, and preferably, to prevent or detectably slow the onset, development, or progression of symptoms associated with
Preferably, the immunogenic polypeptide of the invention comprises an am o acid sequence which is substantially the same as the ammo acid sequence set forth in SEQ ID NO 1 or is at least about 60% identical overall to SEQ ID NO 1 or is at least about 75% identical to at least 8 contiguous am o acids of SEQ ID NO 1 In a preferred embodiment the immunogenic polypeptide of the present invention consists essentially of the ammo acid sequence of SEQ ID NO 1 or the ammo acid sequence 5 encoded by the FlgE-encodmg nucleotide sequence present in pALK11 (ATCC 207156)
For the purposes of nomenclature the ammo acid sequence set forth in SEQ ID NO 1 represents the ammo acid sequence of the FlgE polypeptide encoded by the Lawsonia 10 intracellulans flgE gene The nucleotide sequence of the L intracellulans flgE gene is set forth in SEQ ID NO 2
Preferably, the percentage am o acid sequence identity to SEQ ID NO 1 is at least about 70%, more preferably at least about 80%, even more preferably at least about 15 90%, and still even more preferably at least about 95%
In determining whether or not two ammo acid sequences fall within these percentage limits, those skilled in the art will be aware that it is necessary to conduct a side-by-side comparison or multiple alignment of sequences In such comparisons or alignments, 0 differences will arise in the positioning of non-identical residues, depending upon the algorithm used to perform the alignment In the present context, reference to a percentage sequence identity or similarity between two or more ammo acid sequences shall be taken to refer to the number of identical and similar residues respectively, between said sequences as determined usmσ any standard algorithm known to those 5 skilled in the art For example, am o acid sequence identities or similarities may be calculated using the GAP programme of the Computer Genetics Group, Ine , University Research Park, Madison, Wisconsin, United States of America (Devereaux et al, 1984) The GAP programme utilizes the algorithm of Needleman and Wunsch (1970) to maximise the number of identical/similar residues and to minimise the number 0 and/or length of sequence gaps in the alignment Alternatively or in addition, where more than two ammo acid sequences are being compared, the ClustalW programme of Thompson et al (1994) can be used In an alternative embodiment the present invention provides an isolated or recombinant immunogenic polypeptide which comprises mimics or cross-reacts with a B-cell or T-cell epitope of the FlgE polypeptide derived from Lawsonia spp wherein said isolated or recombinant immunogenic polypeptide comprises an ammo acid sequence which comprises at least 5 contiguous am o acid residues of SEQ ID NO 1 or a homologue, analogue or derivative thereof
Preferably, the isolated or recombinant immunogenic polypeptide of the invention comprises at least about 10 contiguous ammo acids derived from SEQ ID NO 1 , more preferably at least about 20 contiguous ammo acid residues derived from SEQ ID NO 1 , even more preferably at least about 30 contiguous am o acid residues derived from SEQ ID NO 1 and still even more preferably at least about 40 contiguous ammo acid residues derived from SEQ ID NO 1
The present invention further encompasses homologues, analogues and derivatives of a polypeptide comprising the ammo acid sequence set forth in SEQ ID NO.1
"Homologues" of a polypeptide are those polypeptides which contain ammo acid substitutions, deletions and/or additions relative to the polypeptide without altering one or more of its properties, such as its immunogenicity, biological activity or catalytic activity In such molecules, am o acids can be replaced by other ammo acids having similar properties such as, for example, hydrophobicity, hydrophihcity, hydrophobic moment, antigenicity, propensity to form or break α-hehcal structures of β-sheet structures, and so on
Substitutional variants are those in which at least one residue in the sequence has been removed and a different residue inserted in its place. Ammo acid substitutions are typically of single residues, but may be clustered depending upon functional constraints placed upon the polypeptide, insertions will usually be of the order of about 1-10 ammo acid residues and deletions will range from about 1-20 residues Preferably, ammo acid substitutions will comprise conservative ammo acid substitutions, such as those described supra Insertional ammo acid sequence variants are those in which one or more ammo acid residues are introduced into a predetermined site in the protein Insertions can comprise ammo-terminal and/or carboxyl terminal fusions as well as mtra-sequence insertions of single or multiple ammo acids. Generally, insertions within the amino acid sequence will be smaller than ammo or carboxyl terminal fusions, of the order of about 1 to 4 residues.
Deletional variants are characterised by the removal of one or more amino acids from the sequence.
Ammo acid variants of the polypeptide of the present invention may readily be made using peptide synthetic techniques well known in the art, such as solid phase peptide synthesis and the like, or by recombinant DNA manipulations. The manipulation of DNA sequences to produce variant proteins which manifest as substitutional, insertional or deletional variants are well known in the art. For example, techniques for making substitution mutations at predetermined sites in DNA having known sequence are well known to those skilled in the art, such as by M13 mutagenesis or other site- directed mutagenesis protocol.
"Analogues" are defined as peptides, ohgopeptides and polypeptides which are functionally equivalent to the peptides of the present invention but which contain certain non-naturally occurring or modified ammo acid residues as will be known to those skilled in the art. Accordingly, an "analogue" as defined herein need not comprise an amino acid sequence which is similar to the amino aci sequence set forth herein such as, for example, peptides, ohgopeptides and polypeptides which are derived from computational predictions or empirical data revealing the secondary, tertiary or quaternary structure of the polypeptide of the present invention, and which therefore do not comprise the same primary amino acid sequence of said polypeptide, yet nevertheless mimic or cross-react with B-cell or T-cell epitope of Lawsonia spp. and preferably, mimic or cross-react with B-cell or T-cell epitope of Lawsonia intracellulans. For example mimotopes (polypeptide analogues that cross-react with a B-cell or T-cell epitope of the Lawsonia polypeptide of the invention but however comprise a different am o acid sequence to said epitope) may be identified by screening random am o acid sequences in peptide libraries with antibodies that bind to a desired T-cell or B-cell epitope As with techniques for the identification of B-cell or T-cell epitopes as described supra, the antibodies used to identify such mimotopes may be polyclonal or monoclonal or recombinant antibodies, in crude or purified form Mimotopes of a T-cell epitope may then be assayed further for their ability to stimulate T-cell cytotoxic or proliferative responses in vitro Mimotopes are particularly useful as analogues of non- linear (i e conformational) epitopes of the polypeptide of the present invention because conformational epitopes are generally formed from non-contiguous regions in a polypeptide, and the mimotopes provide immunogenic equivalents thereof in the form of a single peptide molecule
Additionally, the use of polypeptide analogues can result in polypeptides with increased immunogenic and/or antigenic activity, that are less sensitive to enzymatic degradation, and which are more selective A suitable prohne analogue is 2- aminocyclopentane carboxylic acid (βAC5c) which has been shown to increase the immunogenic activity of a native polypeptide more than 20 times (Mierke et al, 1990, Portoghese et al, 1990, Goodman et al, 1987)
"Derivatives" of a polypeptide described herein are those peptides, ohgopeptides and polypeptides which comprise at least about five contiguous ammo acid residues of the ammo acid sequence set forth in SEQ ID NO 1 A "derivative" may further comprise additional naturally-occurring, altered glycosylated, acylated or non-naturally occurring ammo acid residues compared to the ammo acid sequence set forth in SEQ ID NO 1 Alternatively or in addition, a derivative may comprise one or more non-ammo acid substituents such as, for example, a reporter molecule or other ligand, covalently or non-covalently bound to the ammo acid sequence such as, for example, a reporter molecule which is bound thereto to facilitate its detection
Other examples of recombinant or synthetic mutants and derivatives of the peptide immunogens of the present invention include those incorporating single or multiple substitutions, deletions and/or additions therein such as carbohydrates hpids and/or proteins or polypeptides Naturally occurring or altered glycosylated or acylated forms of the subject peptides are particularly contemplated by the present invention Additionally, homopolymers or heteropolymers comprising one or more copies of the subject peptide listed in SEQ ID NO 1 , or one or more derivatives, homologues or analogues thereof, are within the scope of the invention
Preferably, homologues, analogues and derivatives of the polypeptide of the invention are "immunogenic", defined hereinafter as the ability of said polypeptide, or a derivative, homologue or analogue thereof, to elicit B cell and/or T cell responses in the host, in response to immunization
Preferred homologues, analogues and derivatives of the ammo acid sequence set forth in SEQ ID NO 1 include those ammo acid variants that function as B cell or T cell epitopes of said ammo acid sequence which are capable of mediating an immune response such as, for example, mimotopes of the immunogenic polypeptide described herein which have been produced by synthetic means, such as by Fmoc chemistry The only requirement of such molecules is that they cross-react immunologically with a polypeptide which comprises the ammo acid sequence set forth in SEQ ID NO:1 or a derivative thereof which comprises at least 5 contiguous ammo acids in length of SEQ ID NO 1
As will be -,.pparent to those skilled in the art, such homologues, analogues and derivatives of the polypeptide of the invention molecules will be useful to prepare antibodies that cross-react with antibodies against said polypeptide and/or to elicit a protective immune response of similar specificity to that elicited by said polypeptide. Such molecules will also be useful in diagnostic and other applications that are immunological in nature such as, for example, diagnostics which utilise one or more immunoassay formats (eg ELISA, RIA and the like)
Accordingly, the immunogen of the present invention or a derivative, homologue or analogue thereof is useful in vaccine compositions that protect an individual against infection by L intracellulans and/or as an antigen to elicit polyclonal or monoclonal antibody production and/or in the detection of antibodies against L intracellulans in infected animals particularly in porcine and avian animals
The present inventors have also shown that the ammo acid sequence set forth in SEQ ID NO 1 is particularly unique as compared to other immunogenic ammo acid sequences, including those of the flagellar hook proteins derived from other bacteria Accordingly, peptides ohgopeptides and polypeptides which comprise unique epitope regions of SEQ ID NO 1 as described in Figure 1 will have improved specificity compared to other regions of the Lawsonia spp FlgE molecule The particular advantages of such peptides will be immediately apparent to those skilled in the production of vaccine compositions, where specificity against a pathogen of interest is an important consideration
The unique regions of the L intracellulans FlgE polypeptide are promising antigenic peptides for the formulation of Lawsoπ/a-specific vaccines and diagnostics for the specific detection of Lawsonia spp in biological samples
A second aspect of the present invention provides a vaccine composition for the prophylaxis or treatment of infection in a mammal or bird by L intracellulans or similar or otherwise related microorganism, said vaccine composition comprising
(i) an immunogenic component which comprises an isolated or recombinant polypeptide having at least about 60% overall amino acid sequ°nce identity to the ammo acid sequence set forth in SEQ ID NO 1 and/or comprising at least
5 contiguous ammo acids derived from SEQ ID NO 1 or an immunogenic homologue, analogue or derivative thereof which is immunologically cross- reactive with Lawsonia intracellulans, and (n) one or more carriers, diluents and/or adjuvants suitable for veterinary or pharmaceutical use
As used herein, the term "immunogenic component" refers to a peptide, polypeptide 2 -
or a protein encoded by DNA from or derived from L intracellulans or a related microorganism thereto which is capable of inducing a protective immune response in an animal in particular a porcine or avian animal whether or not said peptide, polypeptide or protein is in an isolated or recombinant form Accordingly the vaccine ^ composition clearly encompasses those vaccine compositions which comprise attenuated, killed or non-pathogenic isolates or forms of L intracellulans or related microorganisms thereto which comprise or express said peptide, polypeptide or protein
By ' protective immune response' is meant that the immunogenic component elicits an immune response in the animal to which the vaccine composition is administered at the humoral and/or cellular level which is sufficient to prevent infection by Lawsonia intracellulans or a related microorganism thereto and/or which is sufficient to detectably reduce one or more symptoms or conditions, or to detectably slow the onset of one or more symptoms or conditions, associated with infection by Lawsonia intracellulans or a related microorganism thereto in an animal host, as compared to a control infected animal The term "effective amount" of an immunogenic component present in the vaccine composition refers to that amount of said immunogenic component that is capable of inducing a protective immune response after a single complete dose has been administered, or after several divided doses have been administered
Preferably, the polypeptide component of the subject vaccine composition comprises an ammo acid sequence which is both immunogenic and specific, by virtue of its immunologica- cross-reactivity with the causative agent of PP'7, Lawsonia intracellulans In this regard, it will be apparent from the preceding description that such polypeptide components may comprise an ammo acid sequence derived from SEQ ID NO 1 or a homologue, analogue or derivative of the ammo acid sequence set forth in SEQ ID NO 1 such as, for example, a mimotope of said sequence
The immunogenic polypeptide or immunogenic homologue, analogue or derivative may be a naturally-occurring peptide, ohgopeptide or polypeptide in isolated or recombinant form according to any of the embodiments described supra or exemplified herein 2b
Preferably the immunogenic polypeptide or immunogenic homologue, analogue or derivative is derived from Lawsonia spp in particular L intracellulans or a microorganism that is related thereto
Preferably, the immunogenic component has undergone at least one purification step or at least partial concentration from a cell culture comprising L intracellulans or a related microorganism thereto, or from a lysed preparation of L intracellulans cells or related microorganism, or from another culture in which the immunogenic component is recombinantly expressed The purity of such a component which has the requisite immunogenic properties is preferably at least about 20% by weight of protein in a particular preparation, more preferably at least about 50%, even more preferably at least about 60%, still more preferably at least about 70% and even more preferably at least about 80% or greater
The immunogenic component of the vaccine of the present invention can comprise a single peptide, polypeptide or protein, or a range or combination of different peptides, polypeptides or proteins covering different or similar epitopes In addition or, alternatively, a single polypeptide can be provided with multiple epitopes The latter type of vaccine is referred to as a polyvalent vaccine A multiple epitope includes two or more epitopes located within a peptide or polypeptide molecule
The formulation of vaccines is generally known in the art and reference can conveniently be made to Remington's Pharmaceutical Sciences, 17th ed , Mack Publishing Co , Easton, Pennsylvania, USA
A particularly useful form of the vaccine is a recombinant vaccine produced, for example, in a vaccine vector, such as but not limited to a cell transfected with a vaccinia virus vector or a bacterial cell capable of expressing the immunogenic component
The present invention clearly extends to recombinant vaccine compositions in which the immunogenic component at least is contained within killed vaccine vectors 1 1
prepared for example, by heat, formalin or other chemical treatment electric shock or high or low pressure forces According to this embodiment, the immunogenic component of the vaccine is generally synthesized in a live vaccine vector which is killed prior to administration to an animal
Furthermore, the vaccine vector expressing the immunogenic component may be non- pathogenic or attenuated Within the scope of this embodiment are cells that have been transfected with non-pathogenic or attenuated viruses encoding the immunogenic component of the vaccine and non-pathogenic or attenuated cells that directly express the immunogenic component
Attenuated or non-pathogenic host cells include those cells which are not harmful to an animal to which the subject vaccine is administered As will be known to those skilled in the art, "live vaccines" can comprise an attenuated virus vector encoding the immunogenic component or a host cell comprising same, which is capable of replicating in an animal to which it is administered, and using host cell machinery to express the immunogenic componant albeit producing no adverse side-effects therein Such vaccine vectors may colonise the gut or other organ of the vaccinated animal Such live vaccine vectors are efficacious by virtue of their ability to continually express the immunogenic component in the host animal for a time and at a level sufficient to confer protective immunity against a pathogen which expresses an immunogenic equivalent of said immunogenic component The present invention clearly encompasses the use of such attenuated or non-pathogenic vectors and live vaccine preparations
The vaccine vector may be a virus, bacterial cell or a eukaryotic cell such as an avian porcine or other mammalian cell or a yeast cell or a cell line such as COS, VERO, HeLa, mouse C127, Chinese hamster ovary (CHO), WI-38, baby hamster kidney (BHK) or MDCK cell lines Suitable prokaryotic cells include Mycobactenum spp , Corynebactenum spp , Salmonella spp , Escherichia coli, Bacillus spp and Pseudomonas spp, amongst others Bacterial strains which are suitable for the present purpose are well-known in the relevant art (Ausubel et al, 1987, Sambrook et -8 -
al 1989)
Such cells and cell lines are capable of expression of a genetic sequence encoding a FlgE peptide, polypeptide or protein of the present invention from L intracellulans in a manner effective to induce a protective immune response in the animal For example, a non-pathogenic bacterium could be prepared containing a recombinant sequence capable of encoding a peptide, polypeptide or protein from L intracellulans The recombinant sequence would be in the form of an expression vector under the control of a constitutive or mducible promoter The bacterium would then be permitted to colonise suitable locations in a pig's gut and would be permitted to grow and produce the recombinant peptide, polypeptide or protein in amount sufficient to induce a protective immune response against L intracellulans
In a further alternative embodiment, the vaccine can be a DNA or RNA vaccine comprising a DNA or RNA molecule encoding a peptide, polypeptide or protein of the present invention which is injected into muscular tissue or other suitable tissue in a pig under conditions sufficient to permit transient expression of said DNA or RNA to produce an amount of peptide, polypeptide or protein effective to induce a protective immune response In a preferred embodiment, the DNA vaccine is in the form of a plasmid, in which the DNA is operably connected with a promoter region capable of expressing the nucleotide sequence encoding the immunogen in cells of the immunized animal
In the production of a recombinant vaccine, except for a DNA vaccine described herein, it is therefore necessary to express the immunogenic component in a suitable vector system For the present purpose, the immunogenic component can be expressed by
(i) placing an isolated nucleic acid molecule in an expressible format, said nucleic acid molecule comprising the coding region of the nucleotide sequence set forth in SEQ ID NO 2 or a protein-encoding homologue, analogue or derivative of SEQ ID NO 2 selected from the group consisting of
(a) nucleotide sequences that have at least about 60% sequence identity to SEQ ID NO 2,
(b) nucleotide sequences that hybridise under at least low stringency hybridisation, preferably under at least moderate stringency conditions, and even more preferably under at least high level stringency conditions to the complement of SEQ ID NO 2, and
(c) nucleotide sequences that encode the ammo acid sequence set forth in SEQ ID NO 1 or a homologue, analogue or derivative thereof, including for example, a mimotope of the am o acid set forth in SEQ ID NO 1
(II) introducing the isolated nucleic acid molecule of (i) in an expressible format into a suitable vaccine vector, and
(in) incubating or growing the vaccine vector for a time and under conditions sufficient for expression of the immunogenic component encoded by said nucleic acid molecule to occur
15
For the purposes of defining the level of stringency, a low stringency is defined herein as being a hybridisation and/or a wash carried out in 6xSSC buffer, 0 1 % (w/v) SDS at 28°C A moderate stringency is defined herein as being a hybridisation and/or washing carried out in 2xSSC buffer, 0 1 % (w/v) SDS at a temperature in the range 20 45°C to 65°C A high stringency is defined herein as being a hybridisation and/or wash carried out in 0 1xSSC buffer, 0 1% (w/v) SDS at a temperature of at least 65°C
Generally, the stringency is increased by reducing the concentration of SSC buffer, and/or increasing the concentration of SDS and/or increasing the temperature of the
25 hybridisation and/or wash Those skilled in the art will be aware that the conditions for hybridisation and/or wash may vary depending upon the nature of the hybridisation membrane or the type of hybridisation probe used Conditions for hybridisations and washes are well understood by one normally skilled in the art For the purposes of clarification of the parameters affecting hybridisation between nucleic acid molecules,
30 reference is found in pages 2 10 8 to 2 10 16 of Ausubel et al (1987), which is herein incorporated by reference As used herein, a nucleic acid molecule in an expressible format ' is a protein- encoding region of a nucleic acid molecule placed in operable connection with a promoter or other regulatory sequence capable of regulating expression in the vaccine vector system
Reference herein to a "promoter" is to be taken in its broadest context and includes the transcπptional regulatory sequences of a classical genomic gene, including the TATA box which is required for accurate transcription initiation, with or without a CCAAT box sequence and additional regulatory elements (i e upstream activating sequences enhancers and silencers) which alter gene expression in response to developmental and/or external stimuli, or in a tissue-specific manner In the present context, the term "promoter" is also used to describe a recombinant, synthetic or fusion molecule, or derivative which confers, activates or enhances the expression of a nucleic acid molecule to which it is operably connected, and which encodes the immunogenic polypeptide Preferred promoters can contain additional copies of one or more specific regulatory elements to further enhance expression and/or to alter the spatial expression and/or temporal expression of the said nucleic acid molecule
Placing a nucleic acid molecule under the regulatory control of i e , "in operable connection with" a promoter sequence means positioning the said molecule such that expression is controlled by the promoter sequence Promoters are generally, but not necessarily, positioned 5 (upstream) to the genes that they control In the construction of heterologous promoter/structural gene combinations it is generally preferred to position the p omoter at a distance from the gene transcription start site that is approximately the same as the distance between that promoter and the gene it controls in its natural setting, i e , the gene from which the promoter is derived
Furthermore, the regulatory elements comprising a promoter are usually positioned within 2 kb of the start site of transcription of the gene As is known in the art, some variation in this distance can be accommodated without loss of promoter function Similarly, the preferred positioning of a regulatory sequence element with respect to a heterologous gene to be placed under its control is defined by the positioning of the element in its natural setting, i e , the genes from which it is derived Again, as is - J
known in the art, some variation in this distance can also occur
The prerequisite for producing intact polypeptides in bacteπa such as E coli is the use of a strong promoter with an effective πbosome binding site Typical promoters suitable for expression in bacterial cells such as E coli include, but are not limited to, the lacz promoter, temperature-sensitive λL or λR promoters, T7 promoter or the IPTG- mducible tac promoter A number of other vector systems for expressing the nucleic acid molecule of the invention in E coli are well-known in the art and are described, for example, in Ausubel et al (1987) or Sambrook et al (1989) Numerous plasmids with suitable promoter sequences for expression in bacteria and efficient πbosome binding sites have been described, such as for example, pKC30 (λL Shimatake and Rosenberg, 1981), pKK173-3 (tac Amann and Brosius 1985), pET-3 (T7 Studier and Moffat, 1986), the pFLEX series of expression vectors (Pfizer Ine , CT, USA) or the pQE series of expression vectors (Qiagen, CA), amongst others Typical promoters suitable for expression in viruses of eukaryotic cells and eukaryotic cells include the SV40 late promoter, SV40 early promoter and cytomegalovirus (CMV) promoter, CMV IE (cytomegalovirus immediate early) promoter amongst others
Means for introducing the isolated nucleic acid molecule or a genetic construct comprising same into a cell for expression of the immunogenic component of the vaccine composition are well-known to those skilled in the art The technique used for a given organism depends on the known successful techniques Means for introducing recombinant DNA into animal cells include microinjection, transfection mediated by DEAE-dextran, transfectιon mediated by posomes such as by using hpofectamine (Gibco, MD, USA) and/or cellfectm (Gibco, MD, USA), PEG-mediated DNA uptake, electroporation and microparticle bombardment such as by using DNA-coated tungsten or gold particles (Agracetus Ine , Wl, USA) amongst others
The immunogenic component of a vaccine composition as contemplated herein exhibits excellent therapeutic activity, for example, in the treatment and/or prophylaxis of PPE when administered in an amount which depends on the particular case For example, for recombinant peptide molecules, from about 0 5 μg to about 20 mg may be administered, preferably from about 1 ug to about 10 mg more preferably from about 10 ug to about 5 mg and most preferably from about 50 ^g to about 1 mg equivalent of the immunogenic component in a volume of about 1 ml to about 5ml For
DNA vaccines, a preferred amount is from about 0 1 μg/ml to about 5 mg/ml in a volume of about 1 to about 5 ml The DNA can be present in "naked" form or it can be administered together with an agent facilitating cellular uptake (e g , in posomes or cationic hpids) The important feature is to administer sufficient immunogen to induce a protective immune response The above amounts can be administered as stated or calculated per kilogram of body weight Dosage regime can be adjusted to provide the optimum therapeutic response For example, several divided doses can be administered or the dose can be proportionally reduced as indicated by the exigencies of the therapeutic situation Booster administration may also be required
The vaccine of the present invention can further comprise one or more additional immunomodulatory components such as, for example, an adjuvant or cytokine molecule, amongst others, that is capable of increasing the immune response against the immunogenic component Non-limiting examples of adjuvants that can be used in the vaccine of the present invention include the RIBI adjuvant system (Ribi Ine , Hamilton, MT, USA), alum, mineral gels such as aluminium hydroxide gel, oil-m-water emulsions, water-m-oil emulsions such as, for example, Block co-polymer (CytRx, Atlanta GA, USA),QS-21 (Cambridge Biotech Ine , Cambridge MA, USA), SAF-M (Chiron, Emeryville CA, USA), AMPHIGEN ® adjuvant, Freund's complete adjuvant, Freund's incomplete adjuvant, and Saponm, QuilA or other saponm fraction, monophosphoryl hpid A, and Avπdine lipid-amme adjuvant Other immunomodulatory agents that can be included in the vaccine include, for example, one or more cytokmes, such as interferon and/or interleukin, or other known cytokines Non-ionic surfactants such as, for example, polyoxyethylene oleyl ether and n-hexadecyl polyethylene ether may also be included in the vaccines of the present invention
The vaccine composition can be administered in a convenient manner such as by oral, intravenous (where water soluble), intramuscular, subcutaneous, mtranasal, mtradermal or suppository routes or by implantation (eg , using slow release 1 -3
technology) Depending on the route of administration, the immunogenic component may be required to be coated in a material to protect it from the action of enzymes, acids and other natural conditions which may inactivate it such as those in the digestive tract
The vaccine composition may also be administered parenterally or intrapeπtoneally Dispersions can also be prepared in glycerol, liquid polyethylene glycois, and mixtures thereof or in oils Under ordinary conditions of storage and use, these preparations can contain a preservative to prevent the growth of microorganisms Alternatively, the vaccine composition can be stored in lyophilised form to be rehydrated with ar appropriate vehicle or carrier prior to use
Pharmaceutical forms suitable for mjectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile mjectable solutions or dispersion In all cases the form must be fluid to the extent that easy syπngabihty exists, unless the pharmaceutical form is a solid or semi-solid such as when slow release technology is employed In any event, it must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms
The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), suitable mixtures thereof and vegetable oils The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the mai'.tenance of the required particle size in the case of dispersion and by the use of surfactants The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents such as, for example,, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like In many cases, it will be preferable to include isotonic agents such as, for example,, sugars or sodium chloride Prolonged absorption of the mjectable compositions can be brought about by the use in the compositions of agents delaying absorption such as, for example,, aluminum monostearate and gelatin Sterile mjectable solutions are prepared by incorporating the active compound in the required amount in the appropπate solvent with various of the other ingredients enumerated above as required, followed by filter-sterilization Generally dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients selected from those enumerated above In the case of sterile powders for the preparation of sterile mjectable solutions, the preferred methods of preparation are vacuum drying and the freeze-drying technique which yield a powder of the active ingredient plus any additional desired ingredient from previously sterile-filtered solution thereof
The present invention extends to vaccine compositions which confer protection against infection by one or more isolates or sub-types of L intracellulans including those that belong to the same serovar or serogroup as Lawsonia intracellulans The vaccine composition preferably also confers protection against infection by other species of the genus Lawsonia or other microorganisms related thereto, as determined at the nucleotide, biochemical, structural, physiological and/or immunointeractive level, the only requirement being that said other species or other microorganism expresses a polypeptide which is immunologically cross-reactive to the polypeptide of the invention described herein For example, such related microorganisms may comprise genomic DNA which is at least about 70% identical overall to the genomic DNA of Lawsonia intracellulans as determined using standard genomic DNA hybridisation and analysis techniques
The terms "serog-Dup" and "serovar" relate to a classification of microorganirms which is based upon serological typing data, in particular data obtained using agglutination assays such as the microscopic agglutination test (MAT) Those skilled in the art will be aware that serovar and serogroup antigens are a mosaic on the cell surface and, as a consequence there will be no strict delineation between bacteria belonging to a serovar and/or serogroup Moreover, organisms which belong to different species may be classified into the same serovar or serogroup because they are indistinguishable by antigenic determination As used herein, the term "serovar" means one or more Lawsonia strains which are antigenically-identical with respect to antigenic determinants produced by one or more loci Quantitatively serovars may be differentiated from one another by cross-agglutination absorption techniques As used herein the term "serogroup" refers to a group of Lawsonia spp whose members cross-agglutinate with shared group antigens and do not cross-agglutinate with the members of other groups and, as a consequence the members of a serogroup have more or less close antigenic relations with one another by simple cross-agglutination
The present invention thus clearly extends to vaccine compositions for the treatment and/or prophylaxis of animals in particular vaccine compositions for the treatment and/or prophylaxis of porcine and/or avian species against any bacterium belonging to the same serovar or serogroup as Lawsonia intracellulans Preferably, such organisms will express a polypeptide having an ammo acid sequence identity of at least about 60% overall with respect to SEQ ID NO 1
The present invention extends further to vaccine compositions capable of conferring protection against a "genetic variant" of Lawsonia intracellulans, the only requirement being that said variant expresses a polypeptide having an overall ammo acid sequence identity of at least about 60% with respect to SEQ ID NO 1 and/or comprises at least about 5 contiguous ammo acid residues derived from SEQ ID NO 1 or a homologue, analogue or derivative thereof which is immunologically cross-reactive thereto Genetic variants of L intracellulans can be developed by mutation, recombination, conjugation or transformation of L intracellulans or may occur naturally It will be known to a person skilled in the art how to produce such derivatives
In a particularly preferred embodiment, the vaccine composition of the invention is intended for or suitable for the prophylaxis and/or treatment of infection in a porcine or avian animal and more preferably, for prophylaxis and/or treatment of a porcine animal for infection by L intracellulans
In a particularly preferred embodiment, the vaccine composition of the invention is intended for or suitable for the prophylaxis and/or treatment of infection in a porcine or avian animal and more preferably for prophylaxis and/or treatment of a porcine animal for infection by L intracellulans
Accordingly, the present invention clearly extends to the use of the immunogenic polypeptide of the invention according to any one of the preceding embodiments or as exemplified herein in the preparation of a medicament for the treatment and/or prophylaxis of PPE in animals particularly porcine or avian animals
The invention further extends to a method of treatment and/or prophylaxis of PPE in an animal such as an avian or porcine animal said method comprising administering the vaccine composition or the immunogenic polypeptide of the invention as described or exemplified herein to said animal for a time and under conditions sufficient for an immune response to occur thereto Preferably, in the case of administration of a vaccine composition, the immune response to the immunogen is a protective immune response
Those skilled in the art will recognise the general applicability of the invention in vaccinating animals other than porcine and avian animals against L intracellulans and/or related microorganisms In the general application of the vaccine of the present invention, the only prerequisite is that the animal on which protection is conferred is capable of being infected with Lawsonia intracellulans and/or a related microorganism thereto and that, in the case of a related microorganism to L intracellulans, said related microorganism expresses a B-cell or T-cell epitope which mimics or cross- reacts with the polypeptide component of the vaccine composition described herein Animals which may be protected by the vaccine of the present invention include, but are not limited to, humans, primates, companion animals (e g , cats dogs), livestock animals (e g , pigs, sheep, cattle, horses, donkeys, goats), laboratory test animals (e g , mice, rats, guinea pigs, rabbits) and captive wild animals (e g , kangaroos, foxes, deer) The present invention also extends to the vaccination of birds such as poultry birds, game birds and caged birds
The present invention further extends to combination vaccines comprising an effective 1 /
amount of a first immunogenic component comprising the polypeptide of the present invention combined with an effective amount of a second immunogenic component comprising one or more other antigens capable of protecting a porcine animal, or bird, against either Lawsonia spp or another pathogen that infects and causes disease in ^ said animal In a preferred embodiment, the second immunogenic component is selected from the group consisting of the L intracellulans autolysm, hemolysin, OmpH, and SodC polypeptides and homologues, analogues or derivatives thereof, in particular immunogenic variants or derivatives thereof, and nucleic acid molecules encoding same
The isolated or recombinant FlgE polypeptide of the invention or an immunologically- equivalent homologue, analogue or derivative thereof is also useful for the preparation of immunologically interactive molecules which are useful in the diagnosis of infection of an animal by Lawsonia spp , in particular by L intracellulans or a related organism thereto
As used herein, the term "immunologically interactive molecule" includes antibodies and antibody derivatives and functional equivalents, such as a Fab, or a SCAB (single- chain antibody), any of which optionally can be conjugated to an enzyme, radioactive or fluorescent tag, amongst others The only requirement of such immunologically interactive molecules is that they are capable of binding specifically to the immunogenic polypeptide of the present invention as hereinbefore described
Accordingly, a further aspect of the mveruon extends to an immunologically interactive molecule which is capable of binding ιo any one or more of the following
(i) a peptide, ohgopeptide or polypeptide which comprises an ammo acid sequence which has at least about 60% overall sequence identity to the ammo acid sequence set forth in SEQ ID NO 1 ,
(II) a peptide comprising at least 5 contiguous ammo acid residues derived from SEQ ID NO 1 , or
(in) a homologue, analogue or derivative of (i) or (n) which mimics a B-cell or
T-cell epitope thereof ln a preferred embodiment the immunologically interactive molecule is an antibody that binds specifically to a polypeptide consisting of the amino acid of SEQ ID NO 1
Conventional methods can be used to prepare the immunologically interactive molecules For example, by using a polypeptide of the present invention, polyclonal antisera or monoclonal antibodies can be made using standard methods For example, a mammal, (e g , a mouse, hamster, or rabbit) can be immunized with an immunogenic form of the polypeptide of the present invention which elicits an antibody response in the mammal Techniques for conferring immunogenicity on a polypeptide include conjugation to carriers, or other techniques well known in the art For example, the polypeptide can be administered in the presence of adjuvant or can be coupled to a carrier molecule, as known in the art, that enhances the immunogenicity of the polypeptide The progress of immunization can be monitored by detection of antibody titres in plasma or serum Standard ELISA or other immunoassay can be used with the immunogen as antigen to assess the levels of antibodies Following immunization, antisera can be obtained and, for example, IgG molecules corresponding to the polyclonal antibodies can be isolated from the antisera
To produce monoclonal antibodies, antibody producing cells (lymphocytes) can be harvested from an animal immunised with a peptide of the present invention and fused with myeloma cells by standard somatic cell fusion procedures, thus immortalizing these cells and yielding hybπdoma cells Such techniques are well known in the art, for example, the hybπdoma technique originally developed by Kohler and Milstem
(1975), as we'l as other tec iniques such as the human B-cell hybπdoma technique (Kozbor et al , 1983), the EBV-hybπdoma technique to produce human monoclonal antibodies (Cole et al , 1985), and screening of combinatorial antibody libraries (Huse et al , 1989) Hybπdoma cells can be isolated and screened immunochemically for production of antibodies that are specifically reactive with the polypeptide and monoclonal antibodies isolated therefrom
As with all immunogenic compositions for eliciting antibodies, the immunogenically effective amounts of the peptides of the invention must be determined empirically Factors to be considered include the immunogenicity of the native peptide, whether or not the peptide will be complexed with or covalently attached to an adjuvant or carrier protein or other carrier, the route of administration for the composition, i e , intravenous intramuscular, subcutaneous, etc , and the number of immunizing doses to be administered Such factors are known in the vaccine art and it is well within the skill of immunoiogists to make such determinations without undue experimentation
The term "antibody" as used herein, is intended to include fragments thereof which are also specifically reactive with a peptide that mimics or cross-reacts with a B-cell or T- cell epitope of the Lawsonia intracellulans FlgE polypeptide set forth in SEQ ID NO 1 Antibodies can be fragmented using conventional techniques and the fragments screened for utility in the same manner as described above for whole antibodies For example, F(ab')2 fragments can be generated by treating antibody with pepsin The resulting F(ab')2 fragment can be treated to reduce disulfide bridges to produce Fab' fragments
It is within the scope of this invention to include any secondary antibodies (monoclonal, polyclonal or fragments of antibodies), including anti-idiotypic antibodies, directed to the first mentioned antibodies discussed above Both the first and second antibodies can be used in detection assays or a first antibody can be used with a commercially available anti-immunoglobuhn antibody An antibody as contemplated herein includes any antibody specific to any region of a peptide which mimics, or cross-reacts with a B-cell or T-cell epitope of the Lawsonia intracellulans FlgE polypeptide set forth in SEQ ID NO 1 as here before described
The antibodies described herein are useful for determining B-cell or T-cell epitopes of the ammo acid sequence set forth in SEQ ID NO 1 such as, for example, by testing the ability of synthetic peptides to cross-react immunologically with said am o acid sequence or to elicit the production of antibodies which cross-react with said ammo acid sequence Using methods described herein, polyclonal antibodies, monoclonal antibodies or chimeπc monoclonal antibodies can also be raised to peptides which mimic or cross-react with a B-cell or T-cell epitope of the Lawsonia intracellulans FlgE - 40 -
polypeptide set forth in SEQ ID NO 1
More particularly the polyclonal monoclonal or chimeπc monoclonal antibodies can be used to detect the peptides of the invention and/or any homologues, analogues or derivatives thereof, in various biological materials For example, they can be used in an ELISA, radioimmunoassay or histochemical test In other words, the antibodies can be used to test for binding to a polypeptide of the invention or to a homologue, analogue or derivative thereof in a biological sample to diagnose the presence of Lawsonia intracellulans therein
Accordingly, a further aspect of the invention provides a method of diagnosing infection of an animal by Lawsonia intracellulans or a related microorganism thereto, said method comprising the steps of contacting a biological sample derived from said animal with an immunologically interactive molecule which is capable of binding to a peptide, ohgopeptide or polypeptide comprising the ammo acid sequence set forth in SEQ ID NO 1 or a homologue, analogue or derivative thereof, for a time and under conditions sufficient for an antigen antibody complex to form, and detecting said complex formation According to this embodiment of the present invention, the immunologically interactive molecule is preferably an antibody molecule prepared against the Lawsonia intracellulans FlgE polypeptide set forth in SEQ ID NO 1 or an analogue or derivative thereof
The biological sample is one which might contain a polypeptide having an ammo acid sequence set forth in SEQ ID NO 1 or a homologue, analogue or thereof, in particular a biological sample derived from a porcine or avian host of the pathogen Lawsonia intracellulans or a related microorganism thereto, and can include any appropriate tissue or fluid sample from the animal Preferred biological samp'es are derived from the ileum, caecum, small intestine, large intestine, whole serum or lymph nodes of the porcine or avian host animal being tested Alternatively or in addition the biological test sample may comprise faeces or a rectal swab derived from the animal
To distinguish L intracellulans from other microorganisms resident in the gut or other organ of an animal the antibodies should not be prepared against highly-conserved epitopes of FlgE such as those regions of at least 5 am o acids in length which are conserved between L intracellulans and a microorganism which is present in the gut or other organ of an animal in respect of which diagnosis is sought such as, for ^ example, E coli
Conventional immunoassays can be used to perform this embodiment of the invention A wide range of immunoassay techniques are available as can be seen by reference to US Patent Nos 4,016,043 4,424,279 and 4,018 653 These, of course, include both single-site and two-site or "sandwich" assays of the non-competitive types, as well as the traditional competitive binding assays These assays also include direct binding of a labelled antibody to a target It will be readily apparent to the skilled technician how to modify or optimise such assays to perform this embodiment of the present invention, and all such modifications and optimisations are encompassed by the present invention
In one alternative embodiment, the present invention contemplates a method of identifying whether or not an animal has suffered from a past infection, or is currently infected with Lawsonia intracellulans or a related microorganism thereto, said method comprising contacting blood or serum derived from said animal with the immunogenic polypeptide of the invention for a time and under conditions sufficient for an antigen antibody complex to form, and detecting said complex formation This embodiment differs from the embodiment described supra in that it relies upon the detection of emulating antibodies against Lawsonia intracellulans or related organism in the animals blood or serum which are present as a consequence of a past or present infection by this pathogen However, it will be apparent to those skilled in the art that the principle of the assay format is the same As with other embodiments of the invention referred to supra, conventional immunoassays can be used Persons skilled in the art will readily be capable of varying known immunoassay formats to perform the present embodiment This embodiment of the invention can also utilise derivatives of blood and serum which comprise immunologically interactive molecules such as, for example, partially-purified IgG or IgM fractions and buffy coat samples, amongst - 4:
others The preparation of such fractions will also be known to those skilled in the art
A further aspect of the present invention provides an isolated nucleic acid molecule which comprises a sequence of nucleotides which encodes, or is complementary to a nucleic acid molecule which encodes, a peptide, ohgopeptide or polypeptide selected from the following
(i) a peptide, ohgopeptide or polypeptide which comprises an ammo acid sequence having at least about 60% identical overall to the amino acid sequence set forth in SEQ ID NO:1 , (II) a peptide comprising at least 5 contiguous ammo acids derived from
SEQ ID NO:1 , or
(iii) a homologue, analogue or derivative of (i) or (n) which mimics a B-cell or
T-cell epitope of Lawsonia spp.
In a preferred embodiment, the present invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides which encodes, or is complementary to a nucleic acid molecule which encodes, a polypeptide immunogen which comprises, mimics or cross-reacts with a B-cell or T-cell epitope of the Lawsonia intracellulans FlgE polypeptide set forth in SEQ ID NO'1
In a particularly preferred embodiment, the present invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides encoding the L. intracellulans FlgE polypeptide having an ammo acid sequence set forth in SEQ ID NO: 1.
It is within the scope of the invention to encompass polymeric forms of the immunogenic polypeptide described herein, such as aggregates of the amino acid sequence set forth in SEQ ID NO:1 or a homologue, analogue or derivative thereof or, alternatively, as polypeptides comprising repeats of the amino acid sequence set forth in SEQ ID NO:1 or a homologue, analogue or derivative thereof. The present invention extends further to nucleic acid molecules encoding such polymeric forms. thereof.
Alternatively or in addition, the isolated nucleic acid molecule of the invention further comprises a sequence of nucleotides which has at least about 60% overall sequence identity to the nucleotide sequence set forth in SEQ ID NO:2 or to a complementary nucleotide sequence thereof. More preferably, the percentage sequence identity to SEQ ID NO:2 or to a complementary nucleotide sequence thereto is at least about 80%. Still more preferably, the percentage sequence identity is at least about 90%. Yet still more preferably, the percentage sequence identity is at least about 95%.
In a preferred embodiment, the nucleic acid molecule comprises the nucleotide sequence set forth in SEQ ID NO:2, or the FlgE-encoding nucleotide sequence present in pALK11 (ATCC 207156), or a degenerate variant thereof, and complements thereof.
In determining whether or not two nucleotide sequences fall within these percentage limits, those skilled in the art will be aware that it is necessary to conduct a side-by-side comparison or multiple alignment of sequences. In such comparisons or alignments, differences may arise in the positioning of non-identical residues, depending upon the algorithm used to perform the alignment. In the present context, reference to a percentage identity between two or more nucleotide sequences shall be taken to refer to the number of identical residues between said sequences as determined using any standard algorithm known to those skilled in the art. For example, nucleotide sequences may be aligned and their identity calculated using the BESTFIT programme or other appropriate programme of the Computer Genetics Group, Inc., University Research Park, Madison, Wisconsin, United States of America (Devereaux et al, 1984).
Alternatively or in addition, the isolated nucleic acid molecule of the invention is capable of hybridising under at least low stringency conditions and to the nucleotide sequence set forth in SEQ ID NO:2 or to a complementary nucleotide sequence thereto or to a nucleic acid fragment comprising at least about 20 contiguous nucleotides in length derived from the sequence set forth in SEQ ID NO:2 or to a complementary nucleotide sequence thereto
Preferably said nucleic acid molecule is capable of hybridising under at least moderate stringency conditions even more preferably under high stringency conditions s For the purposes of defining the level of stringency, a low stringency is defined herein as being a hybridisation and/or a wash carried out in 6xSSC buffer 0 1 % (w/v) SDS at 28 CC A moderate stringency is defined herein as being a hybridisation and/or wash carried out in 2xSSC buffer, 0 1 % (w/v) SDS at a temperature in the range 45 nC to 10 65°C A high stringency is defined herein as being a hybridisation and/or wash carried out in 0 1xSSC buffer, 0 1% (w/v) SDS at a temperature of at least 65 °C
Generally, the stringency is increased by reducing the concentration of SSC buffer, and/or increasing the concentration of SDS and/or increasing the temperature of the 5 hybridisation and/or wash Those skilled in the art will be aware that the conditions for hybridisation and/or washing may vary depending upon the nature of the hybridisation membrane or the type of hybridisation probe used Conditions for hybridisations and washes are well understood by one normally skilled in the art For the purposes of clarification of the parameters affecting hybridisation between nucleic acid molecules, 0 reference is found in pages 2 10 8 to 2 10 16 of Ausubel ef a/ (1987), which is herein incorporated by reference
The present invention clearly encompasses genetic constructs comprising the subject nucleic acid molecule in an expressible format s- -table for the preparation of a 5 recombinant immunogenic polypeptide of the present invention, such as for use in recombinant univalent or polyvalent recombinant vaccines
In such cases, the nucleic acid molecule will be operably connected to a promoter sequence which can thereby regulate expression of said nucleic acid molecule in a 0 prokaryotic or eukaryotic cell as described supra
The genetic construct optionally further comprises a terminator sequence The term -
"terminator" refers to a DNA sequence at the end of a transcπptional unit which signals termination of transcription A ' terminator" is a nucleotide sequence, generally located within the 3 -non-translated region of a gene or mRNA comprising a polyadenylation signal to facilitate the post-transcπptional addition of a polyadenylate sequence to the 3'-end of a primary mRNA transcript Terminator sequences may be isolated from the genetic sequences of bacteria, fungi, viruses, animals and/or plants Terminators active in animal cells are known and described in the literature
In a preferred embodiment, the genetic construct can be a cloning or expression vector, as known in the art, such as a plasmid, cosmid, or phage, comprising a nucleic acid molecule of the present invention, and host cells transformed or transfected therewith In a non-limiting embodiment, the vector is plasmid pALK11 (ATCC Accession No. 207156)
The genetic constructs of the present invention are particularly useful for producing the immunogenic component of the vaccine composition described herein or for use in a DNA vaccine.
A range of genetic diagnostic assays to detect infection of an animal by Lawsonia intracellulans or a related microorganism can be employed using the nucleic acid molecule described herein such as, for example, assays based upon the polymerase chain reaction (PCR) and nucleic acid hybridisation All such assays are contemplated in the present invention
Accordingly, a still further aspect of the invention provides a diagnostic method of detecting Lawsonia intracellulans or related microorganism in a biological sample derived from an animal subject, said method comprising the steps of hybπdismg one or more probes or primers derived from the nucleotide sequence set forth in SEQ ID NO 2 or a complementary nucleotide sequence thereto or a homologue, analogue or derivative thereof, to a DNA or RNA molecule present in said sample and then detecting said hybridisation using a detection means As used herein the term ' probe" refers to a nucleic acid molecule which is derived from the nucleotide sequence set forth in SEQ ID NO 2 and which is capable of being used in the detection thereof Probes may comprise DNA (single-stranded or double- stranded) or RNA (i e , πboprobes) or analogues thereof
The term "primer" refers to a probe as hereinbefore defined which is further capable of being used to amplify a nucleotide sequence from Lawsonia intracellulans or a related microorganism thereto in a PCR
Preferred probes and primers include fragments of the nucleotide sequence set forth in SEQ ID NO 2 and synthetic single-stranded DNA or RNA molecules of at least about 15 nucleotides in length derived from the sequence set forth in SEQ ID NO 2 or a complementary nucleotide sequence thereto
Preferably, probes and primers according to this embodiment will comprise at least about 20 contiguous nucleotides derived from SEQ ID NO 2 or a complementary sequence thereto, even more preferably at least about 25 contiguous nucleotides, still even more preferably at least about 50 contiguous nucleotides and even more preferably at least about 100 nucleotides to about 500 nucleotides derived from the sequence set forth in SEQ ID NO 2 or a complement thereof Probes and primers comprising the full-length of SEQ ID NO 2 or a complementary nucleotide sequence thereto are also encompassed by the present invention
For the present purpose, "homologues" of a nucleotide sequence shall be taken to refer to an isolated nucleic acid molecule which encodes a polypeptide that is functionally equivalent to the polypeptide encoded by the nucleic acid molecule of the present invention or to a polypeptide which is a homologue, analogue or derivative of SEQ ID NO 1 , notwithstanding the occurrence within said sequence, of one or more nucleotide substitutions, insertions, deletions, or rearrangements
"Analogues" of a nucleotide sequence set forth herein shall be taken to refer to an isolated nucleic acid molecule which encodes a functionally-equivalent polypeptide to the polypeptide encoded by the nucleic acid molecule of the present invention or a homologue, analogue or derivative of a polypeptide having the amino acid sequence of SEQ ID NON notwithstanding the occurrence of any non-nucleotide constituents not normally present in said isolated nucleic acid molecule such as, for example, carbohydrates, radiochemicals including radio nucleotides, reporter molecules such as, but not limited to biotin, DIG, alkaline phosphatase or horseradish peroxidase, amongst others.
"Derivatives" of a nucleotide sequence set forth herein shall be taken to refer to any isolated nucleic acid molecule which contains at least about 50% nucleotide sequence identity to 15 or more contiguous nucleotides present in the nucleotide sequence set forth in SEQ ID ΝO:2 or a complementary nucleotide sequence thereto. Generally, the nucleotide sequence of the present invention may be subjected to mutagenesis to produce single or multiple nucleotide substitutions, deletions and/or insertions. Nucleotide insertional derivatives of the nucleotide sequence of the present invention include 5' and 3' terminal fusions as well as intra-sequence insertions of single or multiple nucleotides or nucleotide analogues. Insertional nucleotide sequence variants are those in which one or more nucleotides or nucleotide analogues are introduced into a predetermined site in the nucleotide sequence of said sequence, although random insertion is also possible with suitable screening of the resulting product being performed. Deletional nucleotide sequence variants are characterised by the removal of one or more nucleotides from the nucleotide sequence. Substitutional nucleotide sequence variants are those in which at least one nucleotide in the sequence has been removed and a different nucleotide or nucleotide analogue inserted in its place. In a preferred embodiment, such substitutions are selected based on the degeneracy of the genetic code, as known in the art, with the resulting substitutional variant encoding the amino acid sequence of SEQ ID NO:1.
Probes or primers can comprise inosine, adenine, guanine, thymidine, cytidine or uracil residues or functional analogues or derivatives thereof that are capable of being incorporated into a polynucleotide molecule, provided that the resulting probe or primer is capable of hybridising under at least low stringency conditions to SEQ ID NO:2 or to a complementary nucleotide sequence thereof, or is at least about 60% identical to SEQ ID NO 2 or to a complementary nucleotide sequence thereof
The biological sample according to this aspect of the invention includes any organ, tissue, cell or exudate which contains or is likely to contain Lawsonia intracellulans or a nucleic acid derived therefrom A biological sample can be prepared in a suitable solution such as, for example, an extraction buffer or suspension buffer The present invention extends to the testing of biological solutions thus prepared, the only requirement being that said solution at least comprises a biological sample as described herein
The diagnostic assay of the present invention is useful for the detection of Lawsonia intracellulans or a microorganism which is related thereto which expresses the flagellar hook protein of the present invention or a flagellar hook protein-like polypeptide
The present invention clearly contemplates diagnostic assays which are capable of both genus-specific and species-specific detection Accordingly, in one embodiment, the probe or primer, or a homologue, analogue or derivative thereof, comprises DNA capable of being used to detect multiple Lawsonia spp In an alternative embodiment, the probe or primer or a homologue, analogue or derivative thereof comprises DNA capable of being used to distinguish Lawsonia intracellulans from related microorganisms
Less-highly consen/ed regions within SEQ ID NO 2 are particularly us~ful as species- specific probes and/or primers for the detection of L intracellulans and very closely related species
Furthermore, the diagnostic assays described herein can be adapted to a genus- specific or species-specific assay by varying the stringency of the hybridisation step Accordingly, a low stringency hybridisation can be used to detect several different species of Lawsonia in one or more biological samples being assayed, while a high stringency hybridisation can be used to distinguish Lawsonia intracellulans from such other species
The detection means according to this aspect of the invention may be any nucleic acid- based detection means such as for example, nucleic acid hybridisation techniques or paper chromatography hybridisation assay (PACHA), or an amplification reaction such as PCR, or nucleic acid sequence-based amplification (NASBA) system The invention further encompasses the use of different assay formats of said nucleic acid-based detection means, including restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), single-strand chain polymorphism (SSCP), amplification and mismatch detection (AMD) interspersed repetitive sequence polymerase chain reaction (IRS-PCR), inverse polymerase chain reaction (iPCR), in situ polymerase chain reaction and reverse transcription polymerase chain reaction (RT-PCR), amongst others
Where the detection means is a nucleic acid hybridisation technique, the probe can be labelled with a reporter molecule capable of producing an identifiable signal (e g , a radioisotope such as 32P or35 S, or a biot ylated molecule) According to this embodiment, those skilled in the art will be aware that the detection of said reporter molecule provides for identification of the probe and that, following the hybridisation reaction, the detection of the corresponding nucleotide sequences in the biological sample is facilitated Additional probes can be used to confirm the assay results obtained using a single probe
A variation of '.he nucleic acid hybridisation technique contemplated by the present invention is the paper chromatography hybridisation assay (PACHA) described by Reinhartz ef al (1993) and equivalents thereof, wherein a target nucleic acid molecule is labelled with a reporter molecule such as biotm, applied to one end of a nitrocellulose or nylon membrane filter strip and subjected to chromatography under the action of capillary or other forces (e g , an electric field) for a time and under conditions sufficient to promote migration of said target nucleic acid along the length of said membrane to a zone at which a DNA probe is immobilised thereto such as, for example, in the middle region According to this detection format, labelled target nucleic acid comprising the Lawsonia spp nucleotide sequences complementary to the probe will hybridise thereto and become immobilised in that region of the membrane to which the probe is bound Non-complementary sequences to the probe will diffuse past the site at which the probe is bound The target nucleic acid may comprise a crude or partially-pure extract of DNA or RNA or, alternatively, an amplified or purified DNA Additional variations of this detection means which utilise the nucleotide sequences described herein are clearly encompassed by the present invention
Wherein the detection means is a RFLP, nucleic acid derived from the biological sample, in particular DNA, is digested with one or more restriction endonuclease enzymes and the digested DNA is subjected to electrophoresis, transferred to a solid support such as, for example, a nylon or nitrocellulose membrane, and hybridised to a probe optionally labelled with a reporter molecule as hereinbefore defined According to this embodiment, a specific pattern of DNA fragments is displayed on the support, wherein said pattern is preferably specific for a particular Lawsonia spp., to enable the user to distinguish between different species of the bacterium.
Wherein the detection means is an amplification reaction such as, for example, a polymerase chain reaction or a nucleic acid sequence-based amplification (NASBA) system or a variant thereof, one or more nucleic acid primer molecules of at least 15 contiguous nucleotides in length derivable from SEQ ID NO.2 or its complementary nucleotide sequence, or a homologue, analogue or derivative thereof, is hybridised to nucleic acid der /ed from a biological sample, and nucleic acid copies of the FlgE- encoding genetic sequences in said sample, or a part or fragment thereof, are enzymically-amplified
Those skilled in the art will be aware that there must be a sufficiently high percentage of nucleotide sequence identity between the primers and the sequences in the biological sample template molecule to which they hybridise (i e , the "template molecule") As stated previously, the stringency conditions can be selected to promote hybridisation - 3 ;
Preferably each primer is at least about 95% identical to a region of SEQ ID NO 2 or its complementary nucleotide sequence in the template molecule to which it hybridises
Those skilled in the art will also be aware that in one format PCR provides for the hybridisation of non-complementary primers to different strands of the template molecule such that the hybridised primers are positioned to facilitate the 5 → 3 synthesis of nucleic acid in the intervening region, under the control of a thermostable DNA polymerase enzyme As a consequence, PCR provides an advantage over other detection means in so far as the nucleotide sequence in the region between the hybridised primers may be unknown and unrelated to any known nucleotide sequence
In an alternative embodiment, wherein the detection means is AFLP, the primers are selected such that, when nucleic acid derived from the biological sample, in particular DNA, is amplified, different length amplification products are produced from different Lawsonia spp The amplification products can be subjected to electrophoresis, transferred to a solid support such as, for example, a nylon or nitrocellulose membrane, and hybridised to a probe optionally labelled with a reporter molecule as hereinbefore described According to this embodiment, a specific pattern of amplified DNA fragments is displayed on the support, said pattern optionally specific for a particular Lawsonia ssp , to enable the user to distinguish between different species of the bacterium in much the same way as for RFLP analysis
The technique of AMD facilitates, not only the detection of Lawsonia spp DNA in a biological sample, out also the determination of nucleotide seque ce variants which differ from the primers and probes used in the assay format Wherein the detection means is AMD, the probe is end-labelled with a suitable reporter molecule and mixed with an excess of the amplified template molecule The mixtures are subsequently denatured and allowed to renature to form nucleic acid "probe template hybrid molecules" or "hybrids", such that any nucleotide sequence variation between the probe and the temple molecule to which it is hybridised will disrupt base-pairing in the hybrids These regions of mismatch are sensitive to specific chemical modification using hydroxylamine (mismatched cytosine residues) or osmium tetroxide (mismatched thymidine residues) allowing subsequent cleavage of the modified site using piperidine The cleaved nucleic acid may be analysed using denaturing polyacrylamide gel electrophoresis followed by standard nucleic acid hybridisation as described supra to detect the Lawsoπ/a-deπved nucleotide sequences Those skilled in the art will be aware of the means of end-labelling a genetic probe according to the performance of the invention described in this embodiment
According to this embodiment the use of a single end-labelled probe allows unequivocal localisation of the sequence variation The distance between the poιnt(s) of sequence variation and the end-label is represented by the size of the cleavage product
In an alternative embodiment of AMD, the probe is labelled at both ends with a reporter molecule, to facilitate the simultaneous analysis of both DNA strands
Wherein the detection means is RT-PCR, the nucleic acid sample comprises an RNA molecule which is a transcription product of Lawson/a-deπved DNA or a homologue, analogue or derivative thereof As a consequence, this assay format is particularly useful when it is desirable to determine expression of one or more Lawsonia genes According to this embodiment, the RNA sample is reverse-transcribed to produce the complementary single-stranded DNA which is subsequently amplified using standard procedures
Variations of the embodiments described herein are des cribed in detail by McPherson et al (1991 )
The present invention clearly extends to the use of any and all detection means referred to supra for the purposes of diagnosing Lawsonia spp and in particular Lawsonia intracellulans infection in animal
The amplification reaction detection means described supra can be further coupled to a classical hybridisation reaction detection means to further enhance sensitivity and -> .
specificity of the inventive method, such as by hybridising the amplified DNA with a probe which is different from any of the primers used in the amplification reaction
Similarly, the hybridisation reaction detection means described supra can be further coupled to a second hybridisation step employing a probe which is different from the probe used in the first hybridisation reaction
A further aspect of the invention provides an isolated probe or primer derived from SEQ ID NO 2 or a complementary nucleotide sequence thereto
The present invention does not extend to immunogenic polypeptides which comprises exclusively the C-termmal region of the FlgE polypeptide as described in International Patent Application No PCT/AU96/00767 or nucleotide sequences encoding same or vaccine compositions therefor
The present invention is further described by the following non-limiting examples.
EXAMPLE 1 SOURCES OF PIG TISSUE
Infected Pig Intestines
Sections of grossly thickened ilea were taken from pigs naturally or experimentally affected by PPE The presence of L. intracellulans bacteria in the ilea vas confirmed using immunofluorescent staining with specific monoclonal antibodies (McOπst ef a/., 1987) An example of a suitable antibody is monoclonal antibody IG4 available from the University of Edinburgh, UK.
EXAMPLE 2
ISOLATION OF LAWSONIA INTRACELLULARIS BACTERIA FROM THE 4
INFECTED PIG ILEUM
Lawsonia intracellulans bacteria were extracted directly from lesions of PPE in pigs by filtration and further purified over a Percoll (Pharmacia Uppsala Sweden) gradient as follows Infected ilea were collected from pigs and the presence of L intracellulans was confirmed histologically before storage at -80 °C Sections of ileum were thawed and approximately 8g of infected mucosa were scraped from the intestinal wall The mucosa was homogenised with 40 ml sterile phosphate buffered saline (PBS) on half speed for 10 seconds using a Sorvall omnimixer This suspension was centrifuged at 2000 xg for 4 minutes The supernatant was discarded and the ceil pellet was resuspended in 40 ml PBS and re-centπfuged This washing step was repeated twice The cell pellet was then resuspended in 20 ml PBS and homogenised at full speed for one minute to release L intracellulans bacteria
This homogenate was centrifuged at 1000 xg for 4 minutes giving a pellet containing a crude mixture of homogenised epithelial cells and intestinal bacteria The supernatant was filtered using filters with pore sized 3 μm, 1 2 μm and 0 8 μm (Milhpore Corporation, MA, USA) The filtrate was centrifuged at 8000 xg for 30 minutes resulting in a small pellet of L intracellulans bacteria The L intracellulans bacteria were further purified using a 45% self forming Percoll gradient as follows 2 mis of the bacterial preparation was mixed by inversion into 30 mis of a 45% self forming Percoll (Pharmacia LKB, Uppsala, Sweden) gradient (45% v/v of Percoll, 150 mM NaCl) The gradients were centrifuged in a Sorvall centrifuge using the SS34 rotor, at 20,000 rpm for 30 minutes at 4°C Usually a number of bands form within the gradient The band (usually located approx 10-20 mm from the base of the tube) containing the L intracellulans bacteria was collected and the volume made up to 16 mis with PBS The solution was then centrifuged for 15 minutes at 8000 rpm The resultant pellet was washed with PBS before being resuspended in a final volume of approximately one ml -
EXAMPLE 3 PURIFICATION OF LAWSONIA INTRACELLULARIS GENOMIC DNA
Genomic DNA was extracted from Percoll-gradient purified Lawsonia intracellulans bacteria recovered from infected pig ilea scrapings (Example 2) by the methods described by Anderson et al (1984) and Sambrook et al (1989)
Briefly, the L intracellulans cells were pelleted by centπfugation at 14,000 x g at 4°C for 15 mm The cells were resuspended in 10 ml of TE buffer (1 mM Tris-HCI, 0 1 mM EDTA, pH 8.0) and centrifuged as before The pellet was then resuspended in 4 ml of TE buffer containing 4 mg/ml lysozyme (Sigma Chemical Co.) and incubated at 37"C for 20 m SDS and protemase K (Promega, Wl, USA) were added to final concentrations of 1 % (w/v) and 200 μg/ml, respectively, and incubation was continued at 45°C for 4 hours. The lysate was then extracted with an equal volume of phenol, phenol chloroform (1 :1 ) and chloroform, respectively, and the nucleic acids were recovered from the supernatant by ethanol precipitation. The pellet was gently dissolved in TE, treated with RnaseA (Promega, Wl, USA) at 37°C for 30 min and then digested with proteinase K in the presence of 0.5% (w/v) SDS for 1 h at 50°C. After another round of phenokchloroform (1 :1) and ethanol precipitation, the purified DNA was dissolved in TE The DNA was then stored at 4°C
EXAMPLE 4
IMMUNOSCREENING OF A L. INTRACELLULARIS LIBRARY USING
EXPERIMENTAL SERA FROM VACCINATED PIGS The genomic DNA from Example 3 was partially digested with the restriction endonuclease SauZA (Promega) and hgated into Lambda ZAP Express (Stratagene, CA, USA). The lambda library was plated on a lawn of E. coli XLI-Blue cells at a density of 1 ,000 phage forming units (pfu) per 150 mm L-broth agar plate. The library was screened using the method described in the Protoblot Technical Manual (Promega, Wl, USA) The filters were blocked in blocking buffer (10 mM Tris-HCI, pH 8.0, 150 mM NaCl, 0.05% Tween 20, 5% Blotto), prior to screening with sera from the pigs Y12 and/or 395. The pigs Y12 and 395 had been immunised with formalin-killed L intracellulans and heat-killed L intracellulans, respectively as described in International Patent Application No PCT/AU96/00767 Positive plaques which were identified in the primary screen were picked re-plated at a lower density and re- screened with either or both sera until an individual plaque was isolated Plasmid DNA from the positive lambda phage clone was isolated by in vivo excision, as recommended by the manufacturer (Stratagene CA USA) A clone containing the partial flgE gene of L intracellulans was identified in this way
EXAMPLE 5 ANALYSIS OF L. INTRACELLULARIS EXPRESSING PHAGE CLONES
Phagemid DNA from positive λZAP II Express phage clones was isolated by in vivo excision, by the conditions recommended by the manufacturer (Stratagene)
Plasmid DNA for restriction analysis was extracted by alkaline-lysis, as described by Sambrook et al (1989), and for automated sequencing, using the High Pure Plasmid Kit, as recommended by the manufacturer (Boehπnger Mannheim, Mannheim, Germany)
The nucleotide sequence (1005 bp) of the 5' region of the flgE gene of Lawsonia intracellulans was obtained from the clone isolated as described in Example 4 The remaining portion of the flgE gene was amplified using the Vectorette System as described by the manufacturer (Genosys Biotechnologies Ine , TX, USA)
Briefly, the Vectored System enables the amplification of specific DNA fragments where the sequence of only one primer is known There are three basic steps as follows
(i) digestion of target DNA (Lawsonia intracellulans genomic DNA in this case) with a restriction enzyme,
(II) hgation of synthetic o gonucleotides to the digested DNA, and (in) amplification of the remaining flgE nucleotide sequence using a first primer specific for the known 5' sequence of flgE and a second primer directed toward the ligated synthetic o gonucleotide X
The nucleotide sequence of the amplified product containing the flgE gene was then obtained DNA sequencing of amplified DNA and isolated clone inserts was performed by the Dye-terminator method of automated sequencing (ABI Biosystems CA USA) The nucleotide sequence of the complete coding region of the flgE gene is set out in SEQ ID NO 2
EXAMPLE 6 IDENTIFICATION OF L. INTRACELLULARIS COMPONENTS
Sequence similarity of the DNA molecules encoding putative vaccine candidates identified from Example 4 and 5 was identified using the BLAST algorithms (Gish and States 1993) Nucleotide sequence SEQ ID NO 2 and its corresponding deduced ammo acid sequence (SEQ ID NO 1) have sequence similarity to flagellar hook polypeptides derived from other pathogenic microorganisms (Figure 1 ) Unique regions of the Lawsonia intracellulans FlgE polypeptide are apparent from a comparison of the am o acid sequence of this polypeptide to those from other microorganisms (Figure 1)
EXAMPLE 7 Expression and purification of recombinant FlgE in Escherichia coli
The FlgE gene was amplified from L intracellulans chromosomal DNA using the following primers
Primer FlaF 5'-GCGAATTCCATATGATGGGGAGTTTGTTTATTGNTGCC-3' (SEQ ,D NO 5 ), and Primer FlgE3' S'-GCTCTAGAGACTAGTCATATTAACGCTTTAGTTCAAGTGC-S'
(SEQ ID NO 6 )
The resulting 1 5 kb PCR fragment was cloned into the pGEMT-TA vector (Promega) The FlgE- containing DNA fragment was isolated from this construct following complete digestion with Xbal and partial digestion with A/del The resulting band was gel-purified and directionally- cloned, as an A/del -Xbal fragment, into a heat-inducible lambda-PL expression vector
The recombinant vector was introduced into E. coli cells which were maintained at 30"C. Heat induction of FlgE expression occurred upon shifting the incubation temperature to 42 °C.
Wet E. coli cells expressing recombinant FlgE were lysed by homogenization at 10,000 psi (2 passes), and particulate matter comprising the recombinant FlgE protein, was collected by centrifugation. The pelleted material was washed with 2 x RIPA/TET buffer [2 x RIPA is 20mM Tπs (pH 7.4), 0.3 M NaCl, 2.0% sodium deoxycholate, and 2% (v/v) Igepal CA-630 ™ (Sigma); TET is 0.1 M Tris (pH 8.0), 50 mM EDTA, and 2% (v/v) Triton X-100] at a 5:4 (w/v) ratio. The washed pellet was then solubilized in 8 M Urea, 50 mM Tris, pH 8.0 and centrifuged (40,000 x g; 40 min).
The solubilized protein was applied to a Q-sepharose FF column using 4 M Urea, 50 mM Tris, pH 7.0 as buffer, and eluted using a salt gradient. The desired protein eluted from this column at 10-15% NaCl concentration. The pooled eluant fractions were step-dialyzed using 10kDa molecular weight cut-off membrane against 2 M Urea, 50 mM Tris (pH 7.2), and then step-dialyzed to 50 mM Tris, pH 7.0. The final product was filtered through a 0.22 μM membrane. The protein concentration of the filtrered solution was 0.85 mg/ml, with an estimated purity of greater than about 80% as determined using SDS/PAGE.
EXAMPLE 8
PREPARATION OF BIOLOGICAL MATERIAL FOR DEPOSIT - AMPLIFICATION OF flgE
Template DNA was purified from DNA isolated from infected pig intestinal mucosa isolated from the ileum of pigs infected with L. intracellulans. DNA purification from intestinal mucosa was performed according to the method of Nollau ef al. (1996). Due to the presence of contaminating polysaccharides and other material, the DNA content of the samples was not quantitated and samples were used empirically in PCR amplifications
The PCR amplifications consisted of 1 u\ pig intestinal mucosa, 1 uM each of the forward (RA170 5' CTATTTTTAGGAGATGTTATC 3 , SEQ ID NO 3) and reverse primers (RA171 5' TACAAAATTAACAATAAAATAC 3', SEQ ID NO 4), 7 5 units KlenTaql polymerase (Ab Peptides, Ine , St Louis Missouri), 0 075 units Pfu polymerase (Stratagene Cloning Systems, La Jolla, California), 1 x PC2 (KlenTaql) buffer and 0 2 mM dNTPs in a 50 u\ volume PCR was carried out in 4 stages (i) 94°C for 5 mm, (n) 94°C for 1 mm, 58°C for 30 seconds, 72X for 2 mm, x 33 cycles, (in) 72°C for 10 mιn, (iv) hold at 4°C
The PCR fragment encoding the flgE gene of L intracellulans was subcloned into pCR2 1-TOPO (Invitrogen Corp , Carlsbad, CA) and designated pALK11 (ATCC Accession No. 207156)
MICROORGANISM DEPOSITS
The plasmid pALK11 was deposited with the American Type Culture Collection (ATCC) at 10801 University Boulevard, Manassas, VA 20110, USA on 11th March, 1999 and was assigned ATCC Accession No 207156
REFERENCES
1 Altuvia Y Schueler, 0 and Margaht H (1995) J Mol Biol 249 244-250
2 Amann and Brosius (1985) Gene 40 183
3 Anderson B J M M Bills, J R Egerton and J S Mattick (1984) Journal of Bacteriology 160:748-754 Ausubel, F M , Brent, R , Kingston, RE Moore, D D , Seidman, J G , Smith J A and Struhl, K (1987) In Current Protocols in Molecular Biology Wiley Interscience (ISBN 047150338) Barker, I K and Van Dreumel A A (1985) In "Pathology of Domestic Animals 3rd Edition Vol 2 p 1 -237 eds K V F Jubb P C Kennedy and N Palmer (Academic Press Orlando) Cole ef al (1985) In Monoclonal antibodies in cancer therapy Alan R Bliss Ine pp 77-96 Dayhof, M D (1978) In Nat Biomed Res Found Washington D C Vol5, Suppl. 3. De Groot, A S , Carter, E J , Roberts, C G P , Edelson, B T , Jesdale, B M , Meister, G E , Houghten, R A , Montoya, J , Romulo, R C , Berzofsky, J A , and Ramirezm, B D L L (1995) Vaccines 96, Cold Spring Harbor Laboratory, Cold Spring Harbor NY Devereux, J , Haeberli, P and Smithies, O (1984) Nucl Acids Res 12: 387-395 0 Elwell, MR, Chapman, AL and Frenkel, JK (1981) Veterinary Pathology 18: 136- 139 1 Fox, JG, Murphy, JC, Otto, G Peequet-Goad, ME, Larson, QHK and Scott JA (1989) Veterinary Pathology 26: 515-517 2 Gabriel, E Meister, G E , Caroline, G P Roberts, C G P , Berzofsky, J A , and De Groot, A S (1995) Vaccines 95, Cold Spring Harbor Laboratory, Cold Spring Harbor NY 3 Gebhart, C J , Ward, G E , Chang, K And Kurtz H J (1983) American Journal of Veterinary Research 44 361-367 4 Gish, W and States, D J (1993) Nature Genetics 3 266-272 Goodman et al (1987) Biopolymers 26 525-532 Huse ef al (1989) Science 246 1275-1281 Jones L A Nibbelmk S and Glock R D (1997) Am J Vet Res 58 1125- 1131 Jonsson, L and Martmsson, K (1976) Acta Vetennaria Scandinavica 17 223- 232 Kohler and Milstem (1975) Nature 256 495-499 Kozbor e a/ (1983) Immunol Today 4 72 Lawson, G H K , McOπst, S , Jansi, S and Mackie R A (1993) Journal of Clinical Microbiology 31 1136-1 142 Love, R J and Love, D M (1977) Veterinary Record 100 473 Margaht, H , Spouge, J L , Cornette, J L , Cease K B , Deϋsi, C , and Berzofsky, J A (1987) J Immunol 138 2213-2229 Mason, RW, Monkton, P and Hasse D (1998) Australian Veterinary Journal (submitted for publication) McOπst, S , Boid, R , Lawson, G H K and McConnell, I (1987) The Veterinary Record 121 421-422 McOπst, S, Jasni, S, Mackie, RA, Maclntyre, N, Neef, N and Lawson GHK (1993) Infection and Immmunity 61 4286-4292 McOπst, S ef al (1995) International Journal of Systematic Bacteriology 45: 820-825 McPherson, M J , Quirke, P and Taylor, G R (1991)/n PCR A Practical Approach (series editors, D Rickwood and B D Hames) IRL Press Limited, Oxford pp 1-253 Meister, G E , Roberts, C G P Berzofsky, J A , and De Groot, A S ( 1995) Vaccine 13 581-591 Mierke ef al (1990) Int J Peptide Protein Research 35 35-45 Mohapatra, S S , Cao, Y , Nι, H , and Salo, D (1995) Allergy 50 37-44 Needleman and Wunsch (1970) J Mol Biol 48 443-453 Nollau, P , Moser, C and C Wagener (1996) BioTechniques 20 784-788 O'Neil, I P A (1970) Veterinary Record 87 742-747 Parker K C Bednarek M A and Cohgan J E (1994) J Immunol 152 163-175 Portoghese e a/ (1990) J Med Chem 33 1714-1720 Reinhartz A Alajem S Samson, A and Herzberg M (1993) Gene 136 221- 226 Rowland, A C and Lawson, G H K (1976) Veterinary Record 97 178-180 Sambrook, J , E F Fπtsch and T Maniatis (1989) Molecular cloning A laboratory manual Second edition Cold Spring Harbour Laboratory, Cold Spring Harbour, N Y Schodeb TR and Fox JG (1990) Veterinary Pathology 27: 73-80 Shimatake and Rosenberg (1981) Nature 292 128 Stills, H F (1991 ) Infection and immunology 59 3227-3236 Straw, B E (1990) Journal of American Veterinary Medical Association 197 355-357 Studier and Moffat (1986) J Mol Biol 189 113 Thompson, J D , Higgins, D G , and Gibson, T J (1994) Nucl Acids Res 22 4673-4680 Vajda, S and DeLisi, C (1990) Biopolymers 29 1755-1772 van Regenmortel, M (1992) Molecular dissection of protein antigens In Structure of antigens (van Regenmortel M ed ) CRC Press, London, pp1-27

Claims

- 6
WE CLAIM
1 An isolated or recombinant immunogenic polypeptide which comprises, mimics or cross-reacts with a B-cell or T-cell epitope of a Lawsonia spp FlgE polypeptide
2 The isolated or recombinant immunogenic polypeptide of claim 1 capable of eliciting the production of antibodies against Lawsonia spp when administered to an avian or porcine animal
3 The isolated or recombinant immunogenic polypeptide of claim 1 capable of conferring a protective immune response against Lawsonia spp when administered to an avian or porcine animal
4 The isolated or recombinant immunogenic polypeptide of claim 2 wherein the Lawsonia spp is L intracellulans
5 The isolated or recombinant immunogenic polypeptide of claim 3 wherein the Lawsonia spp is L intracellulans
6 An isolated or recombinant immunogenic polypeptide selected from the following (i) a peptide, ohgopeptide or polypeptide which comprises an ammo acid sequence which has at least about 60% sequence identity overall to the ammo acid sequence set forth in SEQ ID NO 1 ,
(n) a homologue, analogue or derivative of (i) which mimics a B-cell or T-cell epitope of a Lawsonia spp ' igE polypeptide
7 The isolated or recombinant immunogenic polypeptide of claim 6 capable of eliciting the production of antibodies against Lawsonia spp in a porcine or avian animal
8 The isolated or recombinant immunogenic polypeptide of claim 7 capable of conferring a protective immune response against Lawsonia spp in a porcine or avian animal
9. The isolated or recombinant immunogenic polypeptide of claim 8, capable of inducing humoral immunity against Lawsonia spp. in a porcine or avian animal.
10. The isolated or recombinant immunogenic polypeptide of claim 9, capable of inducing humoral immunity against Lawsonia spp. in a porcine animal.
1 1. The isolated or recombinant immunogenic polypeptide of claim 8 wherein the Lawsonia spp. is L. intracellulans.
12. The isolated or recombinant immunogenic polypeptide of claim 10 wherein the Lawsonia spp. is L. intracellulans.
13. The isolated or recombinant immunogenic polypeptide of claim 6 that comprises the amino acid sequence set forth in SEQ ID NO: 1 or the amino acid sequence encoded by the FlgE-encoding nucleotide sequence of pALK11 (ATCC 207156) and is capable of eliciting the production of antibodies against Lawsonia intracellulans when administered to an avian or porcine animal.
14. The isolated or recombinant immunogenic polypeptide of claim 13 that consists essentially of the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence encoded by the FlgE-encoding nucleotide sequence of pALK11 (ATCC 207156) .
15. The isolated or recombinant immunogenic polypeptide of claim 13 or 14 capable of inducing a protective immune response against Lawsonia intracellulcis in a porcine or avian animal.
16. The isolated or recombinant immunogenic polypeptide of claim 15 capdble of inducing a protective immune response against Lawsonia intracellulans in a porcine animal.
17. A vaccine composition for the prophylaxis or treatment of infection of an animal by Lawsonia spp., said vaccine composition comprising an immunogenic component 6^ -
which comprises an isolated or recombinant polypeptide having at least about 60% sequence identity overall to the ammo acid sequence set forth in SEQ ID NO 1 or an immunogenic homologue, analogue or derivative thereof which is immunologically cross-reactive with Lawsonia intracellulans, and one or more carriers, diluents or adjuvants suitable for veterinary or pharmaceutical use
18 The vaccine composition according to claim 17 wherein the Lawsonia spp is L intracellulans
19 The vaccine composition according to claim 18 wherein the immunogenic component comprises an isolated or recombinant polypeptide that comprises the am o acid sequence set forth in SEQ ID NO 1 or the ammo acid sequence encoded by the FlgE-encoding nucleotide sequence of pALK11 (ATCC 207156)
20 The vaccine composition of claim 19, wherein the immunogenic component consists essentially of the ammo acid sequence of SEQ ID NO 1
21 A combination vaccine composition for the prophylaxis or treatment of infection of an animal by Lawsonia spp , said vaccine composition comprising
(i) a first immunogenic component which comprises an isolated or recombinant polypeptide having at least about 60% sequence identity overall to the am o acid sequence set forth in SEQ ID NO 1 or an immunogenic homologue, analogue or derivative thereof which is immunologically cross-reactive with
Lawsonia intracellulans,
(II) a second immunogenic component comprising an antigenic L intracellulans peptide, polypeptide or protein, and
(in) one or more carriers, diluents or adjuvants suitable for veterinary or pharmaceutical use
22 A vaccine vector that comprises, in an expressible form, an isolated nucleic acid molecule having a nucleotide sequence that encodes an isolated or recombinant immunogenic polypeptide which comprises the ammo acid sequence set forth in SEQ ID NO: 1 , such that said immunogenic polypeptide is expressible at a level sufficient to confer immunity against Lawsonia spp., when administered to a porcine or avian animal-
23. The vaccine vector of claim 22 wherein the immunogenic polypeptide is expressed using the steps of:
(i) placing an isolated nucleic acid molecule which comprises the nucleotide sequence set forth in SEQ ID NO: 2 or degenerate variant, a homologue, analogue or derivative thereof which has at least about 60% sequence identity thereto, in operative association with a promoter sequence;
(ii) introducing the isolated nucleic acid molecule and promoter sequence of step
(a) into the vaccine vector; and
(hi) incubating, growing, or propagating the vaccine vector for a time and under conditions sufficient for expression of the immunogenic polypeptide encoded by said nucleic acid molecule to occur.
24. The vaccine vector of claim 23 wherein the Lawsonia spp. is L. intracellulans.
25. A polyclonal or monoclonal antibody molecule that is capable of binding specifically to an FlgE polypeptide or a derivative of an FlgE polypeptide that is derived from Lawsonia spp. and has at least about 60% sequence identity overall to the amino acid sequence set forth in SEQ ID NO: 1.
26. The antibouy molecule of claim 25 wherein the FlgE polypeptide or derivative thereof comprises the amino acid sequence set forth in SEQ ID NO: 1.
27. A method of diagnosing infection of a porcine or avian animal by Lawsonia intracellulans or a microorganism that is immunologically cross-reactive thereto, said method comprising the steps of contacting a biological sample derived from said animal with the antibody molecule of claim 25 for a time and under conditions sufficient for an antige antibody complex to form, and then detecting said complex formation.
28. The method of claim 27 wherein the biological sample comprises whole serum, lymph nodes, ileum, caecum, small intestine, large intestine, faeces or a rectal swab derived from a porcine animal.
29. A method of identifying whether or not a porcine or avian animal has suffered from a past infection, or is currently infected, with Lawsonia intracellulans or a microorganism that is immunologically cross-reactive thereto, said method comprising contacting blood or serum derived from said animal with the immunogenic polypeptide of claim 1 for a time and under conditions sufficient for an antige antibody complex to form and then detecting said complex formation.
30. An isolated nucleic acid molecule which comprises a sequence of nucleotides which encodes, or is complementary to a nucleic acid molecule that encodes, a peptide, ohgopeptide or polypeptide selected from the group aconsisting of:
(i) a peptide, ohgopeptide or polypeptide which comprises an amino acid sequence which has at least about 60% sequence identity overall to the amino acid sequence set forth in SEQ ID NO: 1 ;and
(iii) a homologue, analogue or derivative of (i) which mimics a B-cell or T- cell epitope of Lawsonia spp.
31. The isolated nucleic acid molecule of claim 30, wherein the peptide, ohgopeptide or polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 1 or the amino acid sequence encoded by the FlgE-encoding nucleotide sequence of pALK11 (ATCC 207156) or a B-cell epitope or T-cell epitope thereof.
32. The isolated nucleic acid molecule of claim 31 compπsing the nucleotide sequence set forth in SEQ ID NO: 2 or a complementary nucleotide sequence thereto, or a degenerate variant thereof.
33. The isolated nucleic acid molecule of claim 32 consisting essentially of the nucleotide sequence of SEQ ID NO: 2 or a degenerate variant thereof.
34 A method of detecting Lawsonia intracellulans or related microorganism in a biological sample derived from a porcine or avian animal subject, said method comprising the steps of hybridising one or more probes or primers derived from the nucleotide sequence set forth in SEQ ID NO. 2 or a complementary nucleotide sequence thereto to said sample and then detecting said hybridisation using a detection means.
35 The method of claim 34 wherein the biological sample comprises whole serum, lymph nodes, ileum, caecum, small intestine, large intestine, faeces or a rectal swab derived from a porcine animal
36. The method of claim 34 wherein the detection means comprises any nucleic acid based hybridisation or amplification reaction.
37. A probe or primer having at least about 15 contiguous nucleotides in length derived from SEQ ID NO: 2 or a complementary nucleotide sequence thereto.
38. A plasmid designated pALK11 (ATCC Accession No. 207156).
39. The combination vaccine according to claim 21 wherein the second immunogenic component comprises an antigenic L. intracellulans peptide, polypeptide or protein selected from the group consisting of OmpH, SodC, hemolysin and autolysin.
EP00924976A 1999-05-13 2000-05-11 LAWSONIA DERIVED GENE AND RELATED FlgE POLYPEPTIDES, PEPTIDES AND PROTEINS AND THEIR USES Withdrawn EP1181315A4 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US13397399P 1999-05-13 1999-05-13
US133973P 1999-05-13
PCT/AU2000/000437 WO2000069904A1 (en) 1999-05-13 2000-05-11 LAWSONIA DERIVED GENE AND RELATED FlgE POLYPEPTIDES, PEPTIDES AND PROTEINS AND THEIR USES

Publications (2)

Publication Number Publication Date
EP1181315A1 true EP1181315A1 (en) 2002-02-27
EP1181315A4 EP1181315A4 (en) 2002-08-14

Family

ID=22461178

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00924976A Withdrawn EP1181315A4 (en) 1999-05-13 2000-05-11 LAWSONIA DERIVED GENE AND RELATED FlgE POLYPEPTIDES, PEPTIDES AND PROTEINS AND THEIR USES

Country Status (9)

Country Link
EP (1) EP1181315A4 (en)
JP (1) JP2003516113A (en)
AU (1) AU771376B2 (en)
BR (1) BR0011294A (en)
CA (1) CA2372098A1 (en)
MX (1) MXPA01011669A (en)
NZ (1) NZ515331A (en)
PE (1) PE20010316A1 (en)
WO (1) WO2000069904A1 (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6605696B1 (en) 1999-10-22 2003-08-12 Pfizer, Inc. Lawsonia intracellularis proteins, and related methods and materials
ES2360225T3 (en) 2000-12-20 2011-06-02 Intervet International Bv VACCINE AGAINST LAWSONIA INTRACELLULARIS.
CA2536989A1 (en) * 2003-09-12 2005-03-24 Akzo Nobel N.V. Lawsonia intracellularis subunit vaccine
US8834891B2 (en) 2005-03-14 2014-09-16 Boehringer Ingelheim Vetmedica, Inc. Immunogenic compositions comprising Lawsonia intracellularis
US8398994B2 (en) 2005-07-15 2013-03-19 Boehringer Ingelheim Vetmedica, Inc. Lawsonia vaccine and methods of use thereof
EP2859900A1 (en) 2006-12-11 2015-04-15 Boehringer Ingelheim Vetmedica, Inc. Effective method of treatment of porcine circovirus and lawsonia intracellularis infections
CN114712392B (en) * 2022-05-16 2022-11-25 西部医美生物科技成都有限公司双流医疗分公司 Immune cell preparation from autologous blood separation and application thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5885823A (en) * 1995-06-05 1999-03-23 Nobl Laboratories, Inc. Lawsonia intracellularis cultivation, anti-Lawsonia intracellularis vaccines and diagnostic agents
ATE329031T1 (en) * 1995-11-30 2006-06-15 Agriculture Victoria Serv Pty THERAPEUTIC COMPOSITIONS FOR THE TREATMENT OF LAWSONIA INTRACELLULARIS INFECTIONS

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
No further relevant documents disclosed *
See also references of WO0069904A1 *

Also Published As

Publication number Publication date
CA2372098A1 (en) 2000-11-23
AU771376B2 (en) 2004-03-18
AU4385900A (en) 2000-12-05
MXPA01011669A (en) 2003-09-10
BR0011294A (en) 2002-02-26
WO2000069904A1 (en) 2000-11-23
JP2003516113A (en) 2003-05-13
PE20010316A1 (en) 2001-03-15
EP1181315A4 (en) 2002-08-14
NZ515331A (en) 2003-07-25

Similar Documents

Publication Publication Date Title
AU718333B2 (en) Therapeutic and diagnostic compositions
JP3998155B2 (en) Vacuole-forming toxin deficient pylori and related methods
AU767390B2 (en) (lawsonia) derived gene and related OmpH polypeptides, peptides and proteins and their uses
AU771376B2 (en) Lawsonia derived gene and related FlgE polypeptides, peptides and proteins and their uses
AU775323B2 (en) Lawsonia derived gene and related hemolysin polypeptides, peptides and proteins and their uses
EP1177212A1 (en) Lawsonia derived gene and related sodc polypeptides, peptides and proteins and their uses
US7052697B1 (en) Lawsonia derived gene and related OmpH polypeptides, peptides and proteins and their uses
US20030157120A1 (en) Lawsonia derived gene and related flge polypeptides, peptides and proteins and their uses
EP1332154A1 (en) Novel therapeutic compositions for treating infection by lawsonia spp
US6846487B2 (en) Therapeutic compositions for treating infection by Lawsonia spp.
US7029683B1 (en) Lawsonia derived gene and related hemolysin polypeptides, peptides and proteins and their uses
AU780980B2 (en) Novel therapeutic compositions for treating infection by lawsonia SPP
US20030049265A1 (en) Heliobacter pylori antigen
MXPA00000028A (en) Compounds encoding the protective m-like protein of streptococcus equi

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20011114

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

A4 Supplementary search report drawn up and despatched

Effective date: 20020627

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20061201