EP1144659A2 - Trans-acting factors in yeast - Google Patents

Abstract

Genetic screening methods are provided for use in the identification of trans-acting factors associated with the termination of transcription in yeast. Also provided are DNA constructs for use in such methods. Trans-acting factors identified using the methods of the invention may provide novel targets for antifungal intervention.

Description

TRANS-ACTING FACTORS IN YEAST

The present invention is concerned with methods to identify trans-acting factors that modulate termination of transcription in yeast and DNA constructs which are useful for such methods.

Transcriptional termination of RNA polymerase II is an important event in the transcription of protein- coding genes in eukaryotes. Two main signals are involved in this process: an upstream polyadenylation (poly (A)) signal and a downstream element (DSE) .

Although poly (A) signals have been demonstrated to play a central role in transcription termination, the mechanism by which they regulate this process is still largely unclear. Transcription of a gene by RNA polymerase II progresses downstream of the transcription unit of the gene, generating an extended pre-mRNA transcript. Poly (A) signals have been shown to activate trans-acting factors which cleave and polyadenylate this pre-mRNA. Recent evidence has suggested that poly (A) signals may induce RNA polymerase II to terminate transcription as a consequence of the cleavage reaction (Birse et al . (1998) 28: 298-301) . DSEs, which are located in the region where transcription terminates, act as RNA polymerase II pausing signals increasing the efficiency of transcriptional termination. Their ability to pause RNA polymerase II may be either intrinsic to their DNA sequence, whereby the sequence induces a particular structural feature in the DNA itself (Kerppola et al.

(1990) Biochemistry 29: 269-278) or in the mRNA transcript (Pribyl et al. (1988) Mol. Cell. Biol . 8: 5369-5377) or may be induced by binding of trans- acting factors that cause the DNA to bend (Ashfield et al. (1994) EMBO J. 13: 5656-5667; Ashfield at al.

(1991) EMBO J. 10: 4197-4207). In view of this pausing activity DSEs may also be described as pause elements .

An efficient transcription termination is particularly critical for the expression of adjacent genes. If this process is impaired, RNA polymerase II continues transcription beyond the normal termination site and may reach a downstream gene. This can result in "transcriptional interference", with inhibition of binding of transcription factors to the promoter of the downstream gene and consequent partial or complete suppression of its expression (Irniger et al (1991) Nucleic Acids Res. 20: 4733-4739; Cullen et al. (1984) Nature 307: 241-245). Impairment of transcription termination has also been shown to inhibit transmission of eukaryotic chromosomes (Hill et al.(1987) Mol. Cell. Biol. 7: 2397-2405) and meiotic gene conversion (Rocco et al . (1992) Proc. Natl. Acad. Sci. USA 89: 12068-12072).

Yeast is particularly sensitive to transcriptional interference because of the very compressed nature of its genome (Oliver et al . (1992) Nature 357: 38-46). Knowledge of the factors that regulate transcription termination and of the genes from which these are encoded would thus be particularly useful for the development of new anti- fungal chemicals.

The present inventors have thus developed genetic constructs and yeast transformed therewith which can be used in the identification of such factors and the elucidation of the transcription termination regulatory process in yeast. In particular, the present invention provides improved methods to identify trans-acting factors that modulate transcription termination of RNA polymerase II in yeast.

The particular embodiments of the invention utilise the GAL1 , GAL1 0, GAL 7 gene cluster and the ura 4 gene of Sa ccharomyces which have been modified so that they can signal changes in transcription termination events.

DEFINITIONS

The term "trans-acting factor" refers to a protein which is involved in the regulation of the termination of transcription performed by polymerase II in yeast.

The term "polymerase II" refers to yeast RNA polymerase II which transcribes protein encoding genes, often referred to as "PolII" genes.

The term "reporter gene" refers to a yeast gene wherein the specific expression or non-expression generates an early selectable phenotype.

The term "cis-mutation" or "cis-acting mutation" refers to a mutation that modulates termination of transcription of the gene in which it occurs.

The term "trans-mutation" or "trans-acting mutation" refers to a mutation that modulates termination of transcription of a gene different from that in which it occurs.

The term "synthetic intron" refers to a sequence of nucleotides that, although does not correspond to the sequence any known naturally occurring intron, when it is inserted into a gene behaves as an intron, being removed from the transcipt and thus leading to the production of a functional mRNA from said gene.

GAL1 , GAL10 and GAL 7 form the GAL gene cluster in S. cerevisiae and are responsible for the metabolic conversion of galactose to glucose-6-phosphate . It has been previously demonstrated that, in Saccharomyces cerevisiae, deletions in the GAL10 polyadenylation signal causes transcriptional interference and dramatically reduces GAL7 expression (Greger, I. H. and Proudfoot, N. J. (1998) EMBO J. 17: 4771-4779) . Yeast cells in which GAL 7 expression has been abolished are not viable on a galactose- containing medium because of the toxic effect of the metabolic intermediate galactose-1-phosphate (Douglas, H.C. et al. (1964) Genetics 49: 837-844).

The present inventors have made use of the existence of transcriptional interference between GAL7 and GAL10 genes and have developed a method that allows isolation of trans-acting factors involved in transcriptional termination.

Accordingly, in a first aspect the invention provides a method for identifying trans-acting factors capable of modulating termination of transcription in yeast which method comprises:

(a) providing a Sa ccharomyces strain which is incapable of growth on galactose-containing medium because of a defect in the transcription termination signal of the GAL10 gene,

(b) culturing said strain on galactose- containing medium, optionally in the presence of a mutagen to obtain revertants capable of growing on galactose-containing medium,

(c) screening said revertants for the presence of cis-acting mutations or trans-acting mutations, (d) preparing (i) a plasmid library of genome fragments from revertants comprising transacting mutations and/or (ii) a plasmid library of genome fragments from the Saccharomyces strain of step (a) ,

(e) transforming (i) each member of the plasmid library of step (d) (i) into a Saccharomyces strain as provided in step (a) and/or (ii) each member of the plasmid library of step (d) (ii) into Saccharomyces revertants containing transacting mutations identified in step (c) ,

(f) screening the transformants of step (e) for capability of growth on galactose

wherein any transformant from step (e) (i) capable of growth on galactose will comprise a mutated variant of a DNA encoding a trans-acting factor capable of modulating termination of transcription, whereas any transformant of step (e) (ii) incapable of growth on galactose will comprise a DNA encoding a trans-acting factor capable of modulating termination of transcription in yeast. This method of the invention will be hereinafter referred to as the GAL method. The Saccharomyces strain to be used in the GAL method, preferably a Saccharomyces cerevisiae strain, may be obtained by transforming a gall 0^'/gal 7^~ strain with a plasmid comprising a GAL 7 gene and a termination signal-defective GAL10 gene. Preferably, transcription termination of the GAL10 gene has been impaired by partial or complete deletion of the polyadenylation signal. Any plasmid suitable for transformation in yeast cells may be utilised to construct the Sa ccharomyces strain. The GAL 7-10 insert is introduced into the plasmid using standard techniques well known in the art and described in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Press. The plasmid may be transformed into yeast cells employing any standard technique known in the art.

Revertants, which are identified by their ability to grow in the presence of galactose, may be obtained by incorporating a mutagen, for example ethidium bromide, into the culture medium. This chemical also blocks aerobic respiration and thus facilitates discrimination between GAL7⁺ and GAL 7^' yeast cells. However, spontaneous revertants may also be obtained in the absence of any mutagen.

Revertant strains may arise from mutations in the GAL10- 7 region (cis-acting) or as a result of mutations in genes that indirectly prevent transcriptional interference of GAL 7 ( trans-acting) . Any method known in the art may be used to screen revertants for the presence of cis- or trans- mutations. For example, if the starting yeast strain used in step (a) contains a plasmid comprising a GAL10- 7 insert then the plasmid may be isolated from the revertants and transformed into a gall 0^~/gal 7^' strain. The ability of the transformed strain to grow on a galactose-containing medium may then be assayed, the GAL 7⁺ phenotype being indicative of a cis-mutation whilst a GAL7^' phenotype is indicative of a transmutation.

Revertants containing trans-acting mutations may be further analysed in order to identify the mutant gene or genes which may encode trans-acting factors associated with transcriptional termination. Two different procedures which may be used for this purpose are described below. The first procedure is particularl suitable for use when the revertant carries a dominant mutation, the second when the revertant carries a recessive mutation.

In the first procedure a genomic library, most preferably a plasmid-based genomic library, is prepared from a revertant containing a trans-acting mutation and this is transformed back into the starting Saccharomyces strain, described above. The phenotype of the transformed Sa ccharomyces strain is then assessed. Colonies that show a GAL⁺ phenotype will contain a plasmid comprising a mutated variant of a DNA encoding a trans-acting factor capable of modulating termination of transcription, the mutated variant carrying a dominant trans-acting mutation.

In the second procedure, a genomic library, most preferably a plasmid-based genomic library, is prepared from the starting Saccharomyces strain described above and transformed into the revertants carrying trans-acting mutations. The ability of the transformants to grow on galactose is then assessed. Colonies showing a GAL^' phenotype will contain a plasmid comprising a DNA encoding a trans-acting factor capable of modulating termination of transcription. This method allows the identification of trans-acting factors from revertants characterised by recessive trans-acting mutations. In both procedures, the plasmid is purified and the genomic fragment contained therein sequenced in order to identify the relevant gene.

In order to select the appropriate procedure to use to identify the gene or genes mutated in a given revertant containing a trans-acting mutation, the revertant may first be analysed to determine whether the mutation is dominant or recessive. For example, the mutation may be introduced into a diploid strain by mating the revertant haploid strain with the starting haploid Sa ccharomyces strain described above and the phenotype of the resulting diploid strain assessed. Diploids with a mutant phenotype, capable of growing on galactose, are indicative of the presence of a dominant mutation while diploids with a wild-type phenotype, incapable of growing on galactose, are indicative of the presence of a recessive mutation.

In a second aspect the invention relates to DNA constructs comprising a yeast reporter gene into which is inserted means of prematurely terminating transcription of the reporter gene when said construct is transformed into a yeast cell.

In one embodiment a DNA construct is provided which comprises a yeast reporter gene having inserted within an intron thereof a polyadenylation signal and downstream of said polyadenylation signal at least one yeast polymerase II pause element. The intron may be one which naturally occurs in the reporter gene or may be artificially inserted into the reporter gene by a recombination event, which is always the case when the reporter gene does not contain any intron. An intron suitable for insertion into the reporter gene may be either isolated from another yeast gene or artificially constructed. For example, a suitable synthetic intron is one having the sequence of nucleotides set forth in Figure 1 but comprising a polyadenylation signal inserted into the Stu I site and a polymerase II pause element inserted into the Xho I site. A polyadenylation signal that may be used in the DNA construct of the invention is a ura 4 polyadenylation signal which may be obtained, as an example, by amplifying ura 4 DNA with the following primers : 5' -TTTGGTTGGTTATTGAAA 5' -CTACATGGTATTTTACAT and digesting the amplification product with the restriction enzymes Styl and Rsa l. Preferably, the yeast polymerase II pause element is inserted in the intron downstream of the polyadenylation signal in forward orientation. Suitable yeast polymerase II pause elements may be derived from the yeast ura 4 or nmt2 gene. Such polymerase II pause elements have the following sequences : ura 4 : 5' -ATGTAAAATACCATGTAG nmt2 :

5' -TTAAAAAAACTATTGATAGTATAATCGTAAGGAC However, any other suitable polyadenylation signals and yeast polymerase II pause elements can be utilised in the construct. In a preferred embodiment, the DNA construct comprises as a yeast reporter gene the ura 4 gene of Saccharomyces pombe (described in Humphrey et al. (1994) EMBO J. 13: 2331-2451) into which the above described intron has been introduced, for example, into the unique Stul site. Preferred DNA constructs comprising the ura 4 gene are, for example, the pUIpA+ura4 or pUIpA+n/nt2 constructs described in Example 1.

In an alternative embodiment a DNA construct is provided which comprises a single yeast reporter gene having inserted therein a synthetic intron, said synthetic intron containing a yeast polyadenylation signal which is ineffective at preventing transcription of the full reporter gene.

Preferably, said synthetic intron has a restriction site downstream of said polyadenylation signal suitable for the insertion of a yeast polymerase II pause element. A suitable synthetic intron is, for example, one having the sequence cf nucleotides set forth in Figure 1 but comprising a polyadenylation signal inserted into a Stul site. A suitable yeast polyadenylation signal is the ura 4 polyadenylation signal described above. As will be demonstrated in Example 2 below, when this polyadenylation signal is inserted into an intron its terminating activity is reduced to a minimal level and termination of transcription does not occur unless a polymerase II pause element is inserted downstream thereof. Preferably, the yeast reporter gene is the ura 4 gene of Sa ccharomyces pombe into which a synthetic intron has been introduced, for example, into a Stul site. For example, a preferred DNA construct is the pUIpA construct described in Example 1.

The invention also provides yeast cells, preferably S . pombe cells, lacking a functional genomic copy of a reporter gene that have been transformed with the above described DNA constructs containing said reporter gene. Where the reporter gene is ura 4, ura 4^' Sa ccharomyces cells are utilised, preferably ura 4^' Sa ccharomyces pombe cells.

The ura 4 gene encodes for the enzyme orotidine 5' -phosphate decarboxylase that is essential for the biosynthesis of uracil. In the presence of 5-fluoro orotic acid (5-FOA), an analog of its natural substrate, the enzyme leads to the production of 5- fluoro uracil, which is toxic to the yeast cells. Thus, an expressed or non-expressed ura4 gene provides the necessary selectable phenotype. In particular, yeast cells are able to grow in the absence of galactose but die in the presence 5-FOA if the enzyme is correctly expressed while they die in the absence of exogenous uracil but can grow in the presence of 5- FCA if expression of the enzyme is inhibited. In a fourth aspect the invention provides a method for the identification of trans-acting factors capable of modulating transcription in yeast which method comprises:

(a) providing a ura 4^' Sa ccharomyces strain transformed with the above-described DNA construct comprising a ura 4 gene having inserted therein a synthetic intron containing a polyadenylation signal and at least one polymerase pause element,

(b) culturing said strain on medium omitting uracil, optionally in the presence of a mutagen, and identifying revertants to ura⁺ phenotype,

(c) screening said revertants for the presence of cis-acting or trans-acting mutations,

(d) preparing (i) a plasmid library of genome fragments from revertants comprising transacting mutations and/or (ii) a plasmid library of genome fragments from the Saccharomyces strain of step (a) ,

(e) transforming (i) each member of the plasmid library of step (d) (i) into a Sa ccharomyces strain as provided in step (a) and/or (ii) each member of the library of step (d) (ii) into Saccharomyces revertants containing trans-acting mutations identified in step

!f) screening the transfor ants of step (e) for the presence of ura⁺ or ura^~ phenotype by culturing them in the absence of uracil or/and in the presence of uracil and 5-FOA,

wherein any reverted transformant of step (e) (i) that displays a ura 4⁺ phenotype will contain a plasmid comprising a mutated variant of a DNA encoding a trans-acting factor capable of modulating termination of transcription in yeast whereas any transformant of step (e) (ii) that displays a ura 4^~ phenotype will contain a wild-type DNA encoding a trans-acting factor capable of modulating termination of transcription in yeast .

This method will be hereinafter referred to as the ura4 method. A preferred Saccharomyces strain for use in the ura4 method is Saccharomyces pombe . Preferably, revertants capable of growing in the absence of uracil are obtained by incorporating in the medium a mutagen such as ethidium bromide. However, spontaneous revertants may also be obtained in the absence of any mutagen .

Various techniques may be utilised in the ura4 method to screen revertants for the presence of cis- or trans-mutations. For example, the reporter gene DNA construct may be isolated from said revertants and transformed into a ura 4^~ Saccharomyces strain. The apability of the transformed strain to grow in the absence of uracil may then be assayed, a ura 4⁺ phenotype being indicative of a cis-mutation whilst a ura 4^~ phenotype is indicative of a trans-mutation.

Again, revertants containing trans-acting mutations may be further analysed in order to identify the mutant gene or genes, which may encode trans- acting factors associated with transcriptional termination. The following procedures may be used for this purpose, the choice of procedure depending on the dominant or recessive nature of the trans-mutation.

In a first procedure a genomic library, most preferably a plasmid-based genomic library, is prepared from revertants containing trans-mutations and this is transformed into the starting Saccharomyces strain described above. The phenotype of the the transformed Sa ccharomyces strain is then assessed. Colonies that display a ura 4⁺ phenotype will contain a plasmid comprising a mutated variant of a DNA encoding a trans-acting factor capable of modulating termination of transcription.

In a second procedure a genomic library, again most preferably a plasmid-based genomic library, is prepared from the Sa ccharomyces strain described above and this is transformed into revertants found to contain a trans-mutation. The capability of the transformants to grow in the absence of uracil is then assessed. Colonies showing a ura^~ phenotype will contain a plasmid comprising a DNA encoding a transacting factor capable of modulating termination of transcription.

In both procedures the plasmid is then purified and the genomic fragment contained therein sequenced in order to identify the relevant gene or genes.

As described above in connection with the GAL method, it is possible to select the more appropriate procedure to follow by testing revertants containing trans-acting mutation for the presence of either recessive or dominant mutations.

A variant ura4 method may be developed in order to identify trans-acting factors that modulate transcription at the level of poly (A) signals. Accordingly, in a further aspect the invention provides a method for the identification of transacting factors capable of modulating termination of transcription in yeast which method comprises:

(a) providing a ura 4^' Sa ccharomyces strain transformed with the above described DNA construct comprising a ura4 gene having inserted therein a synthetic intron containing a polyadenylation signal which is ineffective at preventing transcription of the full reporter gene, the said Sa ccharomyces strain displaying a wild-type phenotype,

(b) culturing said strain on medium including uracil and 5-FOA, optionally in the presence of a mutagen, and identifying revertants to the ura 4^~ phenotype,

(c) screening said revertants for the presence of cis-acting or trans-acting mutations

(d) preparing (i) a plasmid library of genome fragments from revertants comprising transacting mutations and/or (ii) a plasmid library of genome fragments from the Sa ccharomyces strain of step (a) ,

(e) transforming (i) each member of the plasmid library of step (d) (i) into a Sa ccharomyces strain as provided in step (a) and/or (ii) each member of the plasmid library of step (d) (ii) into a Sa ccharomyces revertant containing trans-acting mutations identified i step (c) ,

f) screening the transformants of step (e) for the presence of a ura^~ or ura ^~ phenotype by culturing them in the absence of uracil or/and in the presence of uracil and 5-FOA,

wherein any reverted transformant of step (e) (i) that displays a ura 4^~ phenotype will contain a plasmid comprising a mutated variant of a DNA encoding a trans-acting factor capable of modulating termination of transcription in yeast whereas any transformant of step (e) (ii) that displays a ura 4^~ phenotype will contain a DNA encoding a trans-acting factor capable of modulating termination of transcription in yeast. This method will be hereinafter referred to as the variant ura4 method.

A preferred Saccharomyces strain for use in the variant ura4 method is Saccharomyces pombe .

Preferably, revertants are obtained by incorporating into the medium a mutagen such as ethidium bromide. However, spontaneous revertants may also be obtained in the absence of any mutagen. Different techniques may be used to screen revertants for the presence of cis-acting or transacting mutations. For example, the DNA construct may be isolated from the revertants and transformed into the transformed ura 4^' Sa ccharomyces strain described above. The ability of the transformed strain to grow on a medium including uracil and 5-FOA may then be assayed, a ura 4^~ phenotype being indicative of a cis- acting mutation whilst a ura 4⁺ phenotype is indicative of a trans-acting mutation. Again, revertants containing trans-acting mutations may be further analysed in order to identify the mutant gene or genes, which may encode transacting factors associated with transcriptional termination. The following procedures may be used for this purpose, the choice of procedure depending on the dominant or recessive nature of the trans-mutation. In a first procedure a genomic library, most preferably a plasmid-based genomic library, is prepared from a revertant containing a trans-acting mutation and this is transformed into the Saccharomyces strain displaying a wild type phenotype described above. The phenotype of the transformed Saccharomyces strain is then assessed wherein colonies that show a ura 4^~ phenotype will contain a plasmid comprising a mutated variant of a DNA encoding a trans-acting factor capable of modulating termination of transcription in yeast, the mutated variant carrying a dominant mutation.

In a second procedure a genomic library, again most preferably a plasmid-based genomic library, is prepared from the Saccharomyces strain described above and transformed into revertants found to contain a trans-acting mutation. The phenotype of the transformants is then assessed. Colonies showing a ura 4^~ phenotype will contain a plasmid comprising a DNA encoding a trans-acting factor capable of modulating termination of transcription in yeast.

In both procedures the plasmid is then purified and the genomic fragment contained therein sequenced in order to identify the relevant gene or genes. Methods similar to the ura4 method or the variant ura4 method may be developed utilising constructs comprising as a yeast reporter gene any other gene the specific expression or non-expression of which generates an early selectable phenotype. The Gal, ura4 and variant ura4 methods can also be used in combination in order to identify with greater reliability trans-acting factors capable of modulating termination of transcription in yeast. Accordingly, in a futher aspect the invention provides a method for the identification of transacting factors capable of modulating termination of transcription in yeast comprising:

(a) carrying out the GAL method,

(b) transforming a ura 4^~ Sa ccharomyces strain as provided in step (a) of the ura4 method with a plasmid comprising a nucleic acid encoding a trans-acting factor which as been identified in step (a) , and

(c) screening the transformants of step (b) for reversion to ura 4⁺ phenotype by culturing them in the absence of uracil .

In a further apect the invention provides a methods for the identification of trans-acting factors capable of modulating termination of transcription in yeast comprising:

(a) carrying out the GAL method

(b) transforming a ura 4^~ Sa ccharomyces strain as provided in step (a) of the variant ura4 method with a plasmid comprising a nucleic acid encoding a trans-acting factor which has been identified in step (a) , and

(c) screening the transformants of step (b) for reversion to ura 4^' phenotype by culturing them in the presence of uracil and 5-FOA.

In yet a further aspect the invention provides a method for the identification of trans-acting factors capable of modulating termination of transcription in yeast comprising:

(a) carrying out the variant ura4 method, (b) transforming a Sa ccharomyces strain which has defect in the transcription termination signal of the GAL1 0 gene with a plasmid comprising a nucleic acid encoding the trans-acting factor identified in step (a) , and

(c) screening said transformants for reversion to a wild type phenotype by culturing them in the presence of galactose.

In a further aspect, the invention provides trans-acting factors capable of modulating termination of transcription which have been identified by any of the above described methods. The identification of a trans-acting factor as being involved in modulating termination of transcription with any of the above- described methods is an indication that the factor is yeast-specific and therefore a potential target for anti-fungal intervention.

Also provided by the invention are genes and nucleic acids encoding the above described transacting factors. As exemplified herein, the main advantage of using a ^library transformation' approach to identify the gene or genes which are mutated in a trans-revertant identified using the GAL method, the ura4 method or the variant ura4 method is that it leads directly to the isolation of a fragment of yeast genomic DNA containing the relevant gene or genes. One particular trans-acting factor which the inventors have identified using the Ura4 screening method of the invention is the Sa ccha romyces pombe homologue of the well known cleavage/ polyadenylation factor CstF64 (see Figure 3). CstF64 is the protein product of the S . pombe gene designated SPBC3B9.11c. The protein sequence is available under Genbank accession number 2950466, SPTREMBL: 043040. As discussed in Example 4, it appears that the C-terminal region of CstF64, which is conserved in a wide range of eukaryotic species, may have an important role in transcriptional termination. In order to investigate the function of the C-terminal domain of the S . pombe CstF64 homologue the inventors have performed a conventional yeast two-hybrid experiment using this region of the protein and have thereby identified a number of proteins which interact with this domain. It is postulated that interactions between the C-terminal domain of the S . pombe CstF64 protein and other proteins which have been shown to directly interact with this domain of the protein may be important in the process of transcription termination. Consequently, chemical compounds which prevent, disrupt or enhance such interactions and thereby modulate the termination of transcription in yeast may have potential antifungal activity. Accordingly, in a further aspect the invention provides a method of identifying compounds which are capable of inhibiting, enhancing or disrupting the binding of the CstF64 protein of Saccharomyces pombe to an interacting protein previously identified as binding to the C-terminal domain of the said CstF64 protein, which method comprises: providing a host cell containing a DNA construct comprising a reporter gene or a counter-selectable marker gene operably linked to a promoter regulated by a transcription factor having a DNA binding domain and an activating domain; expressing in said host cell a first hybrid DNA sequence encoding a first hybrid protein comprising the CstF64 protein or a C-terminal fragment thereof fused in-frame to either the DNA binding domain or the activating domain of the said transcription factor; expressing in said host cell a second hybrid DNA sequence encoding a second hybrid protein comprising an interacting protein or a fragment thereof fused in-frame to either the DNA binding domain or the activating domain of the said transcription factor, such that when the first fusion protein comprises the activation domain of the said transcription factor the second fusion protein comprises the DNA binding domain of the said transcription factor and when the first fusion protein comprises the DNA binding domain of the transcription factor the second fusion protein comprises the activation domain; contacting the host cell with a sample of the compound under test; and detecting any binding of the CstF64 protein or C-terminal fragment thereof to the interacting protein or fragment thereof by either detecting the production of any reporter gene product in the said host cell or by applying positive selection for loss of expression of the counter- selectable marker gene.

The method of the invention can be carried out using the CstF64 protein, or a fragment thereof including the conserved C-terminal domain (see Figure 3) and any protein or polypeptide which has previously been identified as interacting with the C-terminal domain of CstF64 (referred to hereinafter as an

"interacting protein" or "interacting polypeptide") , or a fragment thereof which includes the region required for interaction with CstF64. Most preferably, the interacting protein will be a protein product of one of the S . pombe genes listed in Table 1, see below. These proteins were identified as interacting with the C-terminal domain of CstF64 using yeast two-hybrid analysis. Nucleotide sequences for each of the genes listed in Table 1, and also amino acid sequences for the corresponding protein products, are all deposited in publicly accessible sequence databases. A list of accession numbers is provided below.

The screening method of the invention is itself based upon yeast two-hybrid methodology. The classical yeast two-hybrid system (described by Chien et al . , Proc. Natl. Acad. Sci. USA., 88, 9578-9582,

1991) does not allow selection for events responsible for dissociation of particular interactions in a simple direct way, and hence its use in the characterization and manipulation of protein-protein interactions has been limited. Nevertheless, the classical yeast two-hybrid system can be used to screen for compounds that inhibit or enhance the interaction between two proteins. A typical screen might be based on the use of a lacZ reporter gene under the control of the gal4 promoter, the read-out of the screen being β-galactosidase activity which can be easily measured using an appropriate fluorescent or luminescent substrate.

Other two-hybrid systems have been developed which are more suitable for use in screening for dissociation events. These systems, generally designated reverse hybrid screens, make use of yeast strains in which the expression of interacting hybrid proteins increases the expression of a counter-selectable marker that is toxic under particular conditions. Under these conditions, dissociation of an interaction provides a selective advantage, thereby facilitating detection: A few growing yeast colonies in which hybrids fail to interact can be identified among millions of non-growing colonies expressing interacting proteins. Several reverse hybrid systems known in the art could be used to perform screens in accordance with this aspect of the invention. The first reverse two-hybrid system utilizes a yeast strain, which is resistant to cycloheximide due to the presence of a mutant CYH2 gene. This strain also contains the wild-type CYH2 allele under the transcriptional control of the GAL1 promoter. Expression of the wild-type GAL4 protein is sufficient to restore growth sensitivity to cycloheximide. Growth sensitivity towards cycloheximide is also restored by the co-expression of the avian c-Rel protein and its IκB- counterpart, p40, as GAL4 fusion proteins. Restoration of growth sensitivity towards cycloheximide requires the association of c-REL and p40 at the GAL1 promoter and correlates with the ability of the c-REL/p40 interaction to activate expression from the GAL1 promoter (Leanna and Hannink, 1996, NAR 24:3341-3347)

Another reverse hybrid system makes use of the most widely used counter-selectable marker in yeast genetics, URA3, which encodes orotidine-5 ' -phosphate decarboxylase, an enzyme required for the biosynthesis of uracil. Yeast cells that contain wild-type URA3, either on a plasmid or integrated in the genome, grow on media lacking uracil (URA3⁺ phenotype) . However, the ura3-encoded decarboxylase can also catalyze the conversion of a non-toxic analogue, 5-fluorooritic acid (FOA) into a toxic product, 5-fluoroacil (Boeke et al., 1984, Mol. Gen. Genet. 197:345-346). Hence mutations that prevent an interaction can be selected from large libraries or random alleles. Similarly, molecules that dissociate or prevent an interaction could be selected from large libraries of peptides or compounds (Vidal et al., 1996, PNAS 93:10315-10320; Vidal et al., 1996, PNAS 93:10321-10326). A third reversed yeast two-hybrid is based on the GAL80 gene as relay gene. GAL80 encodes a protein that binds to and masks the activation domain of a transcriptional activator, such as GAL4. The reporter genes, which will provide the transcriptional read-out (HIS3 or LACZ), are dependent upon the functional GAL4 for expression. Only when the level of GAL80 masking protein is reduced by interfering with the two-hybrid interaction will Gal4 function as a transcriptional activator, providing a positive transcriptional read-out for molecules that inhibit the two-hybrid protein-protein interaction. An important feature of this reverse two-hybrid system is that the basal level and the half-time of the relay protein, GAL80, can be fine-tuned to provide maximum sensitivity (Powers and Erickson, 1996, WO95/26400) .

DNA constructs comprising a ura4 gene having inserted therein a synthetic intron comprising a polyadenylation signal which is ineffective at preventing transcription of the full reporter gene (described above and used in the variant ura4 method) may advantageously be employed to identify polymerase II pause elements from other eukaryotic genes.

Accordingly, in another aspect the invention provides a method of identifying polymerase II pause elements from eukaryotic genes comprising:

(a) inserting a DNA fragment comprising a putative polymerase II pause element from an eukaryotic gene into a DNA construct comprising a ura 4 gene having inserted within an intron thereof a polyadenylation signal ineffective at preventing transcription of the full ura 4 gene, said polymerase II pause element being inserted downstream of said polyadenylation signal,

(b) transforming a ura 4^' strain of

Saccharomyces, said strain having been transformed with a plasmid incorporating a DNA construct comprising a ura 4 gene having inserted within an intron thereof a polyadenylation signal ineffective at preventing transcription of the full ura 4 gene, with a plasmid comprising the DNA construct prepared in step (a) ,

(c) screening for reversion to the ura 4^' phenotype by culturing on a medium in the presence of uracil and 5-FOA.

wherein reversion to the ura 4^~ phenotype indicates that said inserted fragment has a polymerase II pausing activity.

The putative polymerase II pause element is introduced in the intron downstream of the polyadenylation signal. Preferably, the intron inserted into the ura 4 gene is a synthetic intron having the sequence of nucleotides set forth in Figure 1 but comprising the ura 4 polyadenylation signal described above inserted into the Stul site. The putative polymerase II pause element to be tested in the method of the invention is then inserted into the Xhol site. A suitable DNA construct for use in the method is, for example, the pUIpA construct described in Example 1.

In a further aspect the invention provides a novel yeast polymerase II pause element that the present inventors have identified in the 3' region of the nmt2 gene of S . pombe using the above-described method. Accordingly, the invention provides a yeast polymerase II pause element of the nmt2 gene of S . Pombe having the nucleotide sequence: TTAAAAAAACTATTGATAGTA AATCGTAAGGAC or the complement thereof. The invention further provides a yeast polymerase pause element from the ura 4 gene of S . pombe having the nucleotide sequence:

ATGTAAAATACCATGTAG or the complement thereof.

Also provided by the invention are DNA molecules comprising the above-identified nmt2 and ura 4 polymerase II pause elements. The DNA molecules of the invention will preferably be double-stranded. In the case of DNA molecules comprising the ura 4 pause element, it is to be understood that these molecules should preferably not contain any further nucleotide sequences from the ura 4 DSE (Birse et al . EMBO J. , 16: 3633-3643 (1997)) contiguous with the 18bp ura 4 pause element sequence identified herein. Birse et al . identified a 49bp ura 4 DSE fragment which functions as a transcriptional pause element. The inventors have now identified a core 18bp fragment of the DSE (ATGTAAAATACCATGTAG) which is a functional polymerase II pause element. The whole of this fragment is required to achieve full pausing activity.

The present invention will be better understood with reference to the following Examples, together with the accompanying Figures in which:

Figure 1 shows the nucleotide sequence of a synthetic intron used in the construction of pUI and hence pUIpA, pUIpA+ura4 and pUIpA+nmt2. The splicing consensus sequences and the Stul and Xhol restriction sites are indicated.

Figure 2 shows a Northern Blot analysis of the mRNA transcripts obtained from pURA4, pUI, pUIpA, pUIpA+ura4, pUIpA+nmt2, pUIpA+ura4R and pUIpA+nmt2R. The arrows indicate the position of the unspliced (U) , wild-type (WT) or truncated (T) transcript. The ability or inability of the transformed cells to grow in a medium without uracil is indicated for each transformant as + or -, respectively.

Figure 3 illustrates the identity of the mutant gene present in the S . pombe termination mutant strain m70 as that of the cleavage/polyadenylation factor CstF64. Schematic representations of the Human, Xenopus, S . cerevisiae and S . pombe CstF64 homologues are shown. RBD denotes RNA binding domain' which is known to be required for 3¹ cleavage activity. Dark and light grey shaded boxes denote homology between the 4 eukaryotic species. The mutation causing the mutant phenotype in the m70 strain is a nonsense mutation towards the C-terminus of CstF64.

Standard yeast genetic and molecular biological techniques which may be used in accordance with the invention are described in:

Methods in Yeast Genetics. A Laboratory Course Manual . (1997 ) Cold Spring Harbor Press

Guide to Yeast Genetics and Molecular Biology. Methods in Enzymology, Vol. 194. (1991) Academic Press Molecular Genetics of Yeast. A Practical Approach. (1993) IRL Press at OUP

EXAMPLE 1: PREPARATION OF REPORTER GENE DNA CONSTRUCT

A synthetic intron, shown in Figure 1, was obtained by annealing the following complementary oligonucleotides : 5' -GTAGGTGCTATTTTAGGCCTCGAGTATTTTACTAACTTCTTTTAG 5' -CTAAAAGAAGTTAGTAAAATACTCGAGGCCTAAAATAGCACCTAC

This intron was then introduced into the unique Stul site of pURA4 (described in Humphrey et al. (1994) EMBO J. 13: 2331-2451), generating pUI. A minimal ura4 polyadenylation signal was obtained by amplifying ura 4 DNA with the following primers :

5' -TTTGGTTGGTTATTGAAA 5' -CTACATGGTATTTTACAT

The amplification products were digested with the restriction enzymes Styl and Rsal and the 134bp blunt ended Styl-Rsal fragment was cloned into a Stul site within the intronic sequence of pUI, creating pUIpA.

Ura 4 and nmt2 yeast polymerase II pause elements were obtained by annealing the following complementary oligonucleotide pairs:

ura 4 :

5' -ATGTAAAATACCATGTAG 5' -CTACATGGTATTTTACAT

nmt2 :

5' -TTAAAAAAACTATTGATAGTATAATCGTAAGGAC

5' -GTCCTTACGATTATACTATCAATAGTTTTTTTAA

pUIpA was then digested with Xhol, blunt ended and the ura 4 or nmt2 yeast polymerase II pause element was introduced, generating pUIpA+ura4 or pUIpA+nmt2, respectively. All constructs were confirmed by DNA sequencing. EXAMPLE 2: ANALYSIS OF TRANSCRIPTION TERMINATION IN pUIpA, pUIpA+ura4 AND pUIpA+nmt2.

Methods : pUI, pUIpA, pUIpA+ura4 and pUIpA+nmt2 were transformed into ura 4^~ S . Pombe cells following the DMSO-enhanced method described in Hill et al. (1991) Nucleic Acids Res. 19: 5791, but adding 20μg of boiled salmon sperm carrier DNA together with the transforming plasmid. The transformants were tested for their ability to grow on a medium not containing uracil. Total RNA was extracted according to the method described in Kohrer et al. (1991) Methods Enzymol. 194: 398-405. A Northern blot analysis was performed as described in Humphrey et al. (1994) EMBO J. 13: 2331-2451. In general, the RNA was separated in a 1.5% formaldehyde gel, blotted onto a nylon membrane and hybridised with a 1.2kb HincII-EcoRV random primer labelled probe. As a control, the same experimental procedure was followed utilising the pURA4 plasmid (positive control) and the pUIpA+ura4R and pUIpA+nmt2R plasmids (negative constrols), that derive from the insertion of the above-described ura 4 or nmt2 polymerase pause elements in into pUIpA in the reverse orientation.

Results :

Three different ura 4 transcripts can be produced from the pUIpA, pUIpA+ura4 and pUIpA+nmt2 plasmids, depending on the efficacy of the termination signals. If the termination signals are recognised by the transcription machinery a short, truncated transcript (T) would be produced. Otherwise, an unspliced mRNA (US) would be formed. This may then be processed to give the wild-type ura4 mRNA (WT) . Figure 2 shows that if the polyadenylation signal is present alone, as in the case of pUIpA, most of the transcript is correctly spliced and a wild-type ura4 mRNA is produced. Addition of a yeast polymerase II pause element in forward orientation, as in the case of PUIpA+ura4 and PUIpA+nmt2, leads to efficient transcription termination and the production of only the truncated mRNA.

These results demonstrate that the inserted ura 4 polyadenylation signal has a minimal termination activity in the intronic environment and is unable to direct termination of transcription unless a polymerase II pause element is inserted downstream of it. These result are confirmed by the analysis of the phenotype of the transformants, as shown in Figure 2.

EXAMPLE 3: DETECTION OF TRANS-ACTING FACTORS MODULATING TRANSCRIPTION TERMINATION WITH THE GAL METHOD.

Experimental procedure:

A pYClC-7 plasmid, constructed by inserting a GAL10-7 fragment into the BamHI site of YCplac22 was transformed into a gall O^' /gal l^' S . Cerevisiae deletion strain. Both the plasmid and the deletion strain have been previously described in Greger et al (1998) EMBO J. 17:4771-4779.

The transformants were grown on agar plates in the presence of galactose and ethidium bromide. Colonies of revertants, capable of growing on galactose, were identified. The revertants were then screened to verify if they carried a trans- or cis- mutation by isolating the pYC10-7 plasmid from them, transforming it into the gal l O^'/gal l^' S . Cerevisiae strain and culturing the transformed cells in the presence of galactose. The ability of the transformed cells to grow on galactose was considered as being indicative of the presence of a cis-acting mutation whereas an inability to grow on galactose was considered as being indicative of the presence of a trans-acting mutation. Revertants carrying a trans-acting mutation were then analysed to determine if the mutation was dominant or recessive. The mutation was introduced into a diploid strain by mating the revertant haploid strain with the pYC10-7-transformed gall O^'/gal l^' S. Cerevisiae strain and the transformants were cultured in galactose. The ability of the transformed cells to grow on galactose was considered as being indicative of the presence of a dominant mutation whereas an inability to grow on galactose was considered as being indicative of the presence of a recessive mutation. A plasmid genomic library was prepared from revertants carrying a dominant trans-acting mutation and transformed into pYC10-7-transformed gall O^' /gal l^' S . Cerevisiae cells. Cells capable of growth on galactose were selected and DNA fragments encoding putative trans-acting factors were purified from these cells and sequenced. A database search was performed with the identified sequence.

All the above steps were performed according to protocols described in:

Methods in Yeast Genetics. A Laboratory Course Manual. (1997) Cold Spring Harbor Press, Guide to Yeast Genetics and Molecular Biology. Methods in Enzymology, Vol. 194. (1991) Academic Press, or Molecular Genetics of Yeast. A Practical Approach. (1993) IRL Press at OUP.

Results :

A large number of revertant strains containing both cis- and trans-acting mutations have been isolated using the GAL screen. Of particular interest are a group of trans mutants which express significant levels of gal7p (protein) but still fail to make detectable levels of GAL 1 mRNA. It is likely that these trans mutants may result from the mutation of genes associated with translation initiation or termination that allow for translational initiation on the internal GAL 1 cistron. Such mutant genes may identify functions unique to yeast gene expression, since in these highly compressed eukaryotic genomes internal translational initiation on polycistronic mRNAs may prove to be a more general phenomenon. The products of these genes may be potential targets for anti-fungal intervention.

EXAMPLE 4: DETECTION OF TRANS-ACTING FACTORS MODULATING TRANSCRIPTION TERMINATION WITH THE URA4 METHOD

Experimental procedure:

Sa ccharomyces pombe cells transformed with the pUIpA+ura4 plasmid, as described in Example 2 above, were cultured on agar plates containing ethidium bromide and in the absence of uracil. Colonies of revertants, capable of growing on uracil were identified.

The revertants were screened to verify if they carried a trans- or cis- mutation by isolating the pUIpA+ura4 plasmid, transforming it into ura 4^' S . pombe cells and culturing the transformed cells in the absence of uracil. The ability of the transformed cells to grow in the absence of uracil was considered as being indicative of the presence of a cis-mutation whereas an inability to grow in the absence of uracil was considered as being indicative of the presence of a trans-mutation.

Revertants carrying a trans-mutation were then analysed to determine if the mutation was dominant or recessive. The mutation was introduced into a diploid strain by mating the revertant haploid strain with the pUIpA+ura4-transformed ura 4^' S . pombe strain and the transformants were cultured in the absence of uracil. The ability of the transformed cells to grow in the absence of uracil was considered as being indicative of the presence of dominant mutation whereas an inability to grow in the absence of uracil was considered as being indicative of the presence of a recessive mutation.

A plasmid genomic library was prepared from revertants carrying a dominant trans-mutation and transformed into pUIpA+ura4-transformed ura 4^~ S . pombe cells. Cells capable of growth in the absence of uracil were selected and DNA fragments encoding for putative trans-acting factors were purified from these cells and sequenced. A database search was performed with the identified sequence.

All the above steps were performed according to protocols described in: Methods in Yeast Genetics. A Laboratory Course Manual . (1997) Cold Spring Harbor Press

Guide to Yeast Genetics and Molecular Biology. Methods in Enzymolcgy, Vol. 194. (1991) Academic Press Molecular Genetics of Yeast. A Practical Approach. (1993) IRL Press at OUP.

Results :

Several hundred mutant strains which revert to a ura^~ phenotype have been identified using the above- described ura4 screen. These have been divided into cis mutations which directly modify the ura 4 gene, deleting the termination signals and trans mutations that alter trans-acting factors so that they no longer recognise the termination signal within the ura 4 gene. The fact that significant numbers of different trans mutant strains have been obtained demonstrates the effectiveness of this screen and indicates that this genetic approach will yield a significant number of factors associated with transcriptional termination. A gene for one of these trans acting factors has been cloned from a recessive mutant S . pombe strain called m70. This was done by transforming m70 with a wild type S . pombe gene library and selecting for m70 colonies that have reverted from ura⁺ back to ura^' (using resistance to 5-FOA as the selection) . Figure 3 illustrates the identity of this mutant gene as that of a well known cleavage/polyadenylation factor called CstF64. Remarkably the mutation in this gene that causes the mutant phenotype is a nonsense mutation towards the carboxyl terminus of the S . pombe CstF64 gene homologue. This stop codon effectively results in a C-terminal truncation of CstF64, deleting a region of the polypeptide sequence that has no previously ascribed function. This domain of the protein is however conserved in sequence between other eukaryotes raising the possibility that it has an important role in transcriptional termination, possibly by interacting with the transcriptional apparatus .

To address this hypothesis a standard genetic screen has been carried out to search for proteins that interact with this C-terminal domain. This interaction screen technique is called Yeast 2 Hybrid analysis (described by Chien et al Proc. Natl. Acad. Sci. USA 88, 9578-9582, 1991), a widely employed technique in molecular genetics. In outline this procedure involves production of a yeast strain containing a β-gal and HIS3 reporter gene, both controlled by promoters containing multiple binding sites for the transcription factor Gal4p. As with many transcription factors, Gal4p contains two functional domains, a DNA binding domain that interacts with the specific promoter sequence and an activation domain that activates transcription by interacting with and so recruiting RNA polymerase initiation complexes. The reporter strain is also transformed with a plasmid that expresses a fusion protein combining the Gal4p DNA binding domain and the C-terminal domain of the S . pombe CstF64 as described above (the so called bait sequence) . Although this hybrid protein binds to the reporter promoters it cannot activate the reporter gene since it lacks the Gal4p activation domain. However, by transforming this yeast strain with a plasmid library in which a DNA sequence coding for the Gal4 activation domain is fused to a random mixture of S . pombe cDNA sequences, some of the transformed yeast express β-gal and HIS3. These positive yeast colonies result from expression of protein domains (so called prey sequences) in the S . pombe library that interact with the C-terminal domain of the S . pombe CstF6 . Since these protein domains are fused to the Gal4p activation domain, such interactions will recruit activation domains to the reporter promoters and so allow growth and β-gal expression. By this approach a number of protein domains that interact with the C-terminal domain of the S . pombe CstF64 have been identified. The genes encoding these proteins are listed in Table 1, together with details of the homologous S . cerevisiae protein and a description of the likely function of the protein. Table 1

Of particular interest among the 6 proteins that have domains interacting with the C-terminal domain of the S . pombe CstF64 are the homologues of the

S . cerevisiae genes STH1 and SFH1, which are both subunits of the chromatin remodelling complex, RSC (Cairns et al . Cell 87, 1249-1260, 1996). The fact that components of RSC may interact with the C-terminal domain of the CstF64, raises the intriguing possibility that chromatin remodelling may play a direct role in the process of transcriptional termination. Since it is known that the chromatin structure of transcribed genes must be unravelled during the transcription process, it is possible that contacts between the polyadenylation apparatus and chromatin remodelling activities may play a direct role in the mechanism of transcriptional termination. The functional link between CstF64 and res2 as originally defined in the yeast two-hybrid system has been confirmed by the finding that an S . pombe strain WO.00/42204 PCT/GBOO/00111

- 3(

with a gene knock-out in res2 is also defective in PolII transcription termination. Thus, the CstF64/res2 interaction may also represent an interesting new target for anti-fungal intervention. The res2 protein is described by Zhu, Y. et al . , EMBO J, 16, 1023, 1997.

The following is a list of database accession numbers for the genes listed in Table 1 (gene sequences plus corresponding protein sequences):

dphl embl locus SPAC26A3.16 Genbank accession Z69240.1 SWISS-PROT:Q10169

SPCC830.01 Genbank accession 5738866 (STH1 homologue) CAB52874

PID:el536817

AL109850.1

Part of same gene also present on cosmid SPCC1620, locus

SPCC1620.14c Genbank accession

4008567, AL034491.1, CAA22498,

SPTREMBL: 094421.

SPCC16A11.14 Genbank accession 6468468 (SFH1 homologue) CAB53086.1

AL109957.2

SPAC19A8.12 Genbank accession Z98974.2 (PSUl-like protein) CAB11648

SPTREMBL:013828

res2 Genbank accession D17761

SPAC57A7.12 Genbank accession Z95396.2 (Hsp70 homologue) SPTREMBL: P87142

Claims

Claims :

1. A method of identifying trans-acting factors capable of modulating termination of transcription in yeast which method comprises:

(a) providing a Sa ccharomyces strain which is incapable of growth on galactose-containing medium because of a defect in the transcription termination signal of the

GAL10 gene,

(b) culturing said strain on galactose- containing medium, optionally in the presence of a mutagen, to obtain revertants capable of growth on galactose-containing medium, and

(c) screening revertants obtained in step (b) for the presence of cis-acting mutations or trans-acting mutations.

(d) preparing (i) a plasmid library of genome fragments from a revertant comprising a trans-acting mutation and/or (ii) a plasmid library of genome fragments from the Sa ccharomyces strain of step (a) ,

(e) transforming (i) each member of the plasmid library of step (d) (i) into a Sa ccharomyces strain as provided in step (a) and/or (ii) each member of the plasmid library of step (d) (ii) into Saccharomyces revertants containing trans-acting mutations identified in step (c) , and (f) screening the transformants of step (e) for capability of growth on galactose,

wherein any transformants from step (e) (i) capable of growth on galactose will comprise a mutated variant of a DNA encoding a trans-acting factor capable of modulating termination of transcription in yeast, whereas any transformant of step (e) (ii) incapable of growth on galactose will comprise DNA encoding a trans-acting factor capable of modulating termination of transcription in yeast.

2. A method as claimed in claim 1 wherein the defect in the transcription termination signal of the GALI O gene is a deletion of all or a portion of the GALI O polyadenylation signal.

3. A method as claimed in claim 1 or claim 2 wherein said Saccharomyces strain which is incapable of growth on galactose lacks functional genomic versions of GAL10 and GAL 1 and is transformed with a plasmid comprising a GAL10- 1 insert in which the GAL10 polyadenylation signal is deleted.

4. A method as claimed in claim 3 wherein said cis-acting or trans-acting mutations are identified by isolating the plasmid comprising the GAL10- 1 insert from said revertants, transforming a Saccharomyces strain which lacks functional genomic versions of GAL10 and GAL 1 with the plasmid so isolated and screening the transformants for capability of growth on galactose.

5. A method as claimed in any one of the preceding claims wherein the Saccharomyces strain used in step (a) is Saccharomyces cerevisiae .

6. A method as claimed in any one of the preceding claims wherein in step (b) said strain is cultured in the presence of ethidium bromide.

7. A trans-acting factor capable of modulating termination of transcription identified according to the method of any one of claims 1 to 6.

8. A nucleic acid sequence encoding a trans- acting factor as claimed in claim 7.

9. A DNA construct comprising a yeast reporter gene having inserted within an intron thereof, a polyadenylation signal and downstream of said polyadenylation signal at least one yeast polymerase II pause element.

10. A DNA construct as claimed in claim 9 wherein said intron has been introduced into said yeast reporter gene by a recombination event.

11. A DNA construct as claimed in claim 10 wherein said intron is a synthetic intron.

12. A DNA construct as claimed in claim 11 wherein said intron comprises the sequence shown in Figure 1, but with said polyadenylation signal inserted into the Stu I site and said polymerase II pause element inserted into the Xho I site.

13. A DNA construct as claimed in any one of claims 9 to 12 wherein said yeast polymerase II pause element is inserted downstream of the polyadenylation signal in forward orientation and is from the yeast ura 4 or nmt2 gene.

14. A DNA construct as claimed in any one of claims 9 to 13 wherein said polyadenylation signal is from the yeast ura 4 gene.

15. A DNA construct as claimed in claim 14 wherein said ura 4 polyadenylation signal is obtainable by:

(a) amplifying ura 4 DNA with the following primers

5 ' TTTGGTTGGTTATTGAAA

5' CTACATGGTATTTTACAT, and

(b) digesting the amplification product of step (a) with Sty I and Rsa I.

16. A DNA construct as claimed in any one of claims 13 to 15 wherein said yeast polymerase II pause element is a ura 4 pause element having the sequence:

-ATGTAAAATACCATGTAG .

17. A DNA construct as claimed in any one of claims 13 to 15 wherein said yeast polymerase II pause element is an nmt2 pause element having the sequence:

5 ' -TTAAAAAAACTATTGATAGTATAATCGTAAGGAC.

18. A DNA construct as claimed in any of claims 12 to 17 wherein said polyadenylation signal is inserted in the Stu I site of the DNA sequence of Figure 1.

19. A DNA construct as claimed in any of claims 12 to 18 wherein said yeast polymerase II pause element is inserted into the Xho 1 site of the DNA sequence of Figure 1.

20. A DNA construct as claimed in any of claims 10 to 19 wherein said yeast gene does not include an intron in its naturally occurring state.

21. A DNA construct as claimed in claim 20 wherein said yeast gene is the ura 4 gene of Saccharomyces pombe .

22. A DNA construct as claimed in claim 27 wherein said intron has been introduced into the Stu I site of the ura 4 gene.

23. A DNA construct comprising a single yeast reporter gene having inserted therein a synthetic intron, said synthetic intron containing a yeast polyadenylation signal which is ineffective at preventing transcription of the full reporter gene.

24. A DNA construct as claimed in claim 23 wherein said synthetic intron has a restriction site downstream of said polyadenylation signal suitable for the insertion of a yeast polymerase II pause element.

25. A DNA construct as claimed in claim 24 wherein said synthetic intron comprises the sequence shown in Figure 1 but with said polyadenylation signal inserted in the Stu I site.

26. A DNA construct as claimed in claim 25 wherein the restriction site downstream of said polyadenylation signal is the Xho I site of the sequence of Figure 1.

27. A DNA construct as claimed in any of claims 23 to 26 wherein said polyadenylation signal is from the yeast ura 4 gene.

28. A DNA construct as claimed in claim 27 wherein said polyadenylation signal is obtainable by:

(a) amplifying ura4 DNA with the following primers :

5 ' TTTGGTTGGTTATTGAAA 5 'CTACATGGTATTTTACAT, and

(b) digesting the amplification product of step (a) with Sty I and Rsa I .

29. A DNA construct as claimed in any of claims 25 to 28 wherein said single yeast reporter gene does not have an intron in its naturally occurring state.

30. A DNA construct as claimed in claim 29 wherein said single yeast reporter gene is the ura 4 gene of S. pombe .

31. A DNA construct as claimed in claim 30 wherein said synthetic intron has been introduced within the Stu 1 site of the ura4 gene.

32. A yeast cell transformed with a DNA construct as claimed in any of claims 9 to 31 wherein said yeast cell lacks a functional genomic copy of said reporter gene.

33. A yeast cell as claimed in claim 32 wherein said reporter gene is ura 4 and said DNA construct is as claimed m any of claims 21, 22, 30 or 31.

34. A yeast cell as claimed in claim 32 or claim 33 which is S. pombe .

35. A method for the identification of transacting factors capable of modulating termination of transcription in yeast which method comprises:

(a) providing a ura 4^' Saccharomyces strain transformed with the DNA construct of any of claims 21 or 22,

(b) culturing said strain on medium omitting uracil, optionally in the presence of a mutagen, and identifying revertants to ura 4⁺ phenotype,

(c) screening said revertants for the presence of cis-acting or trans-acting mutations,

(d) preparing (i) a plasmid library of genome fragments from the revertants comprising trans-acting mutations identified in step (c) and/or (ii) a plasmid library of genome fragments from the Sa ccharomyces strain of step (a),

(e) transforming (i) each member of the plasmid library of step (d) (i) into a Sa ccharomyces strain as provided in step (a) and/or (ii) each member of the plasmid library of step (d) (ii) into the Sa ccharomyces revertants containing trans-acting mutations identified in step(c)

(f) screening the transformants of step (e) for the presence of a ura 4^~ or ura 4⁺ phenotype by culturing them in the absence of uracil and/or in the presence of uracil and 5-FOA,

wherein any transformant of step (e) (i) that displays a ura 4^~ phenotype will comprise a mutated variant of a DNA encoding a trans-acting factor capable of modulating termination of transcription in yeast whereas any transformant of step (e) (ii) that displays a ura 4^' phenotype will contain DNA encoding a transacting factor capable of modulating termination of transcription in yeast.

36. A method as claimed in claim 35 wherein the presence of cis-acting mutations is determined by isolating from said revertants the DNA construct of any one of claims 21 or 22, transforming a ura 4^' strain of Saccharomyces with said isolated DNA construct and screening for reversion to the ura 4⁺ phenotype .

37. A method for the identification of transacting factors capable of modulating termination of transcription in yeast which method comprises:

(a) providing a ura 4^~ Saccharomyces strain transformed with a DNA construct as claimed in claim 30 or 31 which displays a wild-type phenotype,

(b) culturing said strain on medium including uracil and 5-FOA, optionally in the presence of a mutagen and identifying revertants to ura 4^~ phenotype,

(c) screening said revertants for the presence of cis-acting or trans-acting mutations, (d) preparing (i) a plasmid library of genome fragments from the revertants comprising trans-acting mutations identified in step (c) and/or (ii) a plasmid library of genome fragments from the Saccharomyces strain of step (a) ,

(e) transforming (i)each member of the plasmid library of step (d) (i)into a Sa ccharomyces strain as provided in step (a) and/or (ii) each member of the plasmid library of step (d) (ii) into a Sa ccharomyces revertant containing a trans-acting mutation identified in step (c)

(f) screening the transformants of step (e) for the presence of ura 4⁺ or ura 4^' phenotype by culturing them in the absence of uracil and/or in the presence of uracil and 5-FOA,

wherein any transformant of step (e) (i) that displays a ura 4^' phenotype will comprise a mutated variant of a DNA encoding a trans-acting factor capable of modulating termination of transcription in yeast whereas any transformant of step (e) (ii) that displays a ura 4⁺ phenotype will contain DNA encoding a transacting factor capable of modulating termination of transcription in yeast.

38. A method as claimed in claim 37 wherein the presence of a cis-acting mutation is determined by isolating from said revertants the DNA construct of claim 30 or 31, transforming a ura 4^' strain of Sa ccha romyces with said isolated DNA construct and confirming maintenance of the ura 4^~ phenotype by culturing on medium comprising uracil and 5-FOA.

39. A method as claimed in any of claims 35 to 38 wherein in step (b) said strain is cultured in the presence of ethidium bromide.

40. A method as claimed in claim 35 wherein said ura 4^' Saccharomyces strain is S. pombe .

41. A trans-acting factor capable of modulating termination of transcription in yeast identified by the method of any one of claims 35 to 40.

42. A nucleic acid encoding a trans-acting factor as claimed in claim 41.

43. A method for identification of trans-acting factors capable of modulating termination of transcription in yeast comprising:

(a) carrying out a method as claimed in any one of claims 1 to 6,

(b) transforming a ura 4^' Saccharomyces strain transformed with the DNA construct of claim 30 or 31 with a plasmid comprising a gene encoding a trans-acting factor which has been identified in step (a) , and

(c) screening the transformants of step (b) for reversion to ura 4^' phenotype by culturing on medium in the absence of uracil and/or in the presence of uracil and 5-FOA.

44. A method for identification of trans-acting factors capable of modulating termination of transcription in yeast comprising:

(a) carrying out a method as claimed in any one of claims 1 to 6 ,

(b) transforming a ura 4^' Sa ccharomyces strain transformed with a DNA construct of claim 21 or claim 22 with a plasmid comprising a gene encoding a trans-acting factor which has been identified in step (a) , and

(c) screening the transformants of step (b) for reversion to ura 4⁺ phenotype by culturing on medium without uracil.

45. A method for identification of trans-acting factors capable of modulating termination of transcription in yeast comprising:

(a) carrying out a method as claimed in any one of claims 35 to 40,

(b) transforming a Sa ccharomyces strain which has a defect in the transcription termination signal of the GAL10 gene with a plasmid comprising a DNA molecule encoding a trans-acting factor which has been identified in step (a) , and

(c) screening said transformants for reversion to wild-type phenotype by culturing them in the presence of galactose.

46. A method of identifying polymerase II pause elements from eukaryotic genes comprising the steps of:

(a) inserting a DNA fragment comprising a putative polymerase II pause element from a eukaryotic gene into a DNA construct as claimed in claim 30 or 31 downstream of said polyadenylation signal,

(b) transforming a ura 4^' strain of Saccharomyces , transformed with a plasmid incorporating the DNA construct of claim 30 or 31, with a plasmid comprising the DNA construct prepared in step (a) and

(c) screening for reversion to the ura 4^' phenotype by culturing on medium in the presence of uracil and 5-FOA

wherein the ura 4^~ phenotype is indicative that said inserted fragment has polymerase II pausing activity.

47. A yeast polymerase II pause element identified by the method of claim 46.

48. A yeast polymerase II pause element as claimed in claim 47 isolated from the nmt2 gene of S. pombe and having the following nucleotide sequence:

TTAAAAAAACTATTGATAGTATAATCGTAAGGAC

or the complement thereof.

49. A yeast polymerase II pause element having the following nucleotide sequence:

TTAAAAAAACTATTGATAGTATAATCGTAAGGAC

or the complement thereof

50. A DNA molecule comprising a yeast polymerase II pause element as claimed in claim 49.

51. A yeast polymerase II pause element having the following nucleotide sequence:

ATGTAAAATACCATGTAG

or the complement thereof.

52. A DNA molecule comprising a yeast polymerase II pause element as claimed in claim 51.

53. A method of identifying compounds which are capable of inhibiting, enhancing or disrupting the binding of the CstF64 protein of Sa ccharomyces pombe to an interacting protein previously identified as binding to the C-terminal domain of the said CstF64 protein, which method comprises: providing a host cell containing a DNA construct comprising a reporter gene or a counter-selectable marker gene operably linked to a promoter regulated by a transcription factor having a DNA binding domain and an activating domain; expressing in said host cell a first hybrid DNA sequence encoding a first hybrid protein comprising the CstF64 protein or a C-terminal fragment thereof fused in-frame to either the DNA binding domain or the activating domain of the said transcription factor; expressing in said host cell a second hybrid

DNA sequence encoding a second hybrid protein comprising an interacting protein or a fragment thereof fused in-frame to either the DNA binding domain or the activating domain of the said transcription factor, such that when the first fusion protein comprises the activation domain of the said transcription factor the second fusion protein comprises the DNA binding domain of the said transcription factor and when the first fusion protein comprises the DNA binding domain of the transcription factor the second fusion protein comprises the activation domain; contacting the host cell with a sample of the compound under test; and detecting any binding of the CstF64 protein or C-terminal fragment thereof to the interacting protein or fragment thereof by either detecting the production of any reporter gene product in the said host cell or by applying positive selection for loss of expression of the counter- selectable marker gene.

54. A method as claimed in claim 53 wherein the interacting protein is the S. pombe res2 protein.

55. A method as claimed in claim 53 wherein the interacting protein is the S. pombe dphl protein.

56. A method as claimed in claim 53 wherein the interacting protein is a protein encoded by the S. pombe gene designated SPCC16A11.14.

57. A method as claimed in claim 53 wherein the interacting protein is a protein encoded by the S. pombe gene designated SPCC830.01.

58. A method as claimed in claim 53 wherein the interacting protein is a PSUl-like protein encoded by the S . pombe gene designated SPAC19A8.12.

59. A method as claimed in claim 53 wherein the interacting protein is a Hsp70-like protein encoded by the s. pombe gene designated SPAC57A7.12.