EP1144622A2 - Polynucleotides and their application in diagnostics - Google Patents

Polynucleotides and their application in diagnostics

Info

Publication number
EP1144622A2
EP1144622A2 EP00901580A EP00901580A EP1144622A2 EP 1144622 A2 EP1144622 A2 EP 1144622A2 EP 00901580 A EP00901580 A EP 00901580A EP 00901580 A EP00901580 A EP 00901580A EP 1144622 A2 EP1144622 A2 EP 1144622A2
Authority
EP
European Patent Office
Prior art keywords
polypeptide
polynucleotide
seq
sequence
polynucleotides
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00901580A
Other languages
German (de)
French (fr)
Inventor
Carlota SmithKline Beecham VINALS-BASSOLS
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
GlaxoSmithKline Biologicals SA
Original Assignee
SmithKline Beecham Biologicals SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB9901078.7A external-priority patent/GB9901078D0/en
Priority claimed from GBGB9902090.1A external-priority patent/GB9902090D0/en
Priority claimed from GBGB9902163.6A external-priority patent/GB9902163D0/en
Priority claimed from GBGB9902168.5A external-priority patent/GB9902168D0/en
Priority claimed from GBGB9902169.3A external-priority patent/GB9902169D0/en
Priority claimed from GBGB9907901.4A external-priority patent/GB9907901D0/en
Application filed by SmithKline Beecham Biologicals SA filed Critical SmithKline Beecham Biologicals SA
Publication of EP1144622A2 publication Critical patent/EP1144622A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4748Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809Methods for determination or identification of nucleic acids involving differential detection
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds

Definitions

  • the present invention relates to polynucleotides, (herein referred to as "CASB611 polynucleotide(s)", “CASB500 polynucleotide(s)”, “CASB501 polynucleotide(s)”, “CASB502 polynucleotide(s)”, “CASB505 polynucleotide(s)”, “CASB507 polynucleotide(s)”), polypeptides encoded thereby (referred to herein as “CASB611”, “CASB500”, “CASB501”, “CASB502", “CASB505", and “CASB507” respectively or “CASB611 polypeptide(s)", “CASB500 polypeptide (s)", “CASB501 polypeptide (s)", “CASB502 polypeptide (s)”, “CASB505 polypeptide (s)”, “CASB507 polypeptide (s)”respectively), recombinant materials and methods for their production.
  • the invention relates to methods for using such polypeptides and polynucleotides, including the diagnostics and treatment of cancer and autoimmune diseases and other related conditions.
  • the invention relates to methods for identifying agonists and antagonists/inhibitors using the materials provided by the invention, and treating conditions associated with CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptide imbalance with the identified compounds.
  • the invention relates to diagnostic assays for detecting diseases associated with inappropriate CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptide activity or levels.
  • Polynucleotides and polypeptides of the present invention are believed to be important immunogens for specific prophylactic or therapeutic immunization against tumours, because they are specifically expressed or highly over-expressed in tumours compared to normal cells and can thus be targeted by antigen-specific immune mechanisms leading to the destruction of the tumour cell. They can also be used to diagnose the occurrence of tumour cells. Furthermore, their inappropriate expression in certain circumstances can cause an induction of autoimmune, inappropriate immune responses, which could be corrected through appropriate vaccination using the same polypeptides or polynucleotides. In this respect the most important biological activities to our purpose are the antigenic and immunogenic activities of the polypeptide of the present invention.
  • a polypeptide of the present invention may also exhibit at least one other biological activity of a CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptide, which could qualify it as a target for therapeutic or prophylactic intervention different from that linked to the immune response.
  • cDNA libraries enriched for genes of relevance to a particular tissue or physiological situation can be constructed using recently developed subtractive cloning strategies. Furthermore, cDNAs found in libraries of certain tissues and not others can be identified using appropriate electronic screening methods.
  • High throughput genome- or gene-based biology allows new approaches to the identification and cloning of target genes for useful immune responses for the prevention and vaccine therapy of diseases such as cancer and autoimmunity.
  • the present invention relates to CASB611 , CASB500, CASB501 ,
  • polynucleotides include isolated polynucleotides comprising a nucleotide sequence which has at least 70% identity, preferably at least 80% identity, more preferably at least 90% identity, yet more preferably at least 95% identity, to SEQ ID NOsJ - 6 respectively over the entire length of SEQ ID NOs: 1 - 6.
  • polynucleotides which have at least 97% identity are highly preferred, whilst those with at least 98-99% identity are more highly preferred, and those with at least 99% identity are most highly preferred.
  • Such polynucleotides include a polynucleotide comprising the polynucleotide of SEQ ID NOs: 1 - 6 as well as the polynucleotide of SEQ ID NOs: 1 - 6.
  • Said polynucleotide can be inserted in a suitable plasmid or recombinant microrganism vector and used for immunization (see for example Wolff et. al, Science 247:1465-1468 (1990); Corr et. al., j. Exp. Med. 184:1555-1560 (1996); Doe et. al, Proc. Natl. Acad. Sci. 93:8578-8583 (1996)).
  • the invention also provides polynucleotides which are complementary to the above described polynucleotides.
  • the invention also provides a polynucleotide comprising a nucleotide sequence that has at least 70% identity to a nucleotide sequence encoding a polypeptide of the invention over the entire coding region, encoded by a polynucleotide comprising the sequence contained in any one of SEQ ID Nos: 1 - 6; or a nucleotide sequence complimentary to said isolated polynucleotide.
  • the invention also provides a fragment of a CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polynucleotide which when administered to a subject has the same immunogenic properties as the polynucleotide of SEQ ID NOs: 1 - 6.
  • the invention also provides a polynucleotide encoding an immunological fragment of a CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptide as hereinbefore defined.
  • the nucleotide sequences of SEQ ID NO: 1 (CASB611) and SEQ ID NO:2 show no homology with any known gene.
  • the nucleotide sequences of SEQ ID NOJ-6 show homology to intron portions of the chromosomal PBEF gene (Homo sapiens BAC clone RP11-22N19 from 7q22, complete sequence; ACCESSION : AC007032), SEQ ID NO: 3 and 5 (CASB501 and CASB505) being located between exon 8 and exon 7 of the PBEF gene (nucleotides 67 484 to 67 966 and 68 107 to 68 583), and SEQ ID NO:4 (CASB502) and 6 (CASB507) being located downstream of exon 8 (from 69 274 to 69 732 and from 70 163 to 71 223).
  • CASB500 is located on chromosome 6 (accession number HSJ651N20).
  • Preferred polypeptides and polynucleotides of the present invention are expected to have, inter alia, similar biological functions/properties to their homologous polypeptides and polynucleotides. Furthermore, preferred polynucleotides of the present invention have at least one activity of SEQ ID NOs:l - 6, as appropriate.
  • the present invention also relates to partial polynucleotide and polypeptide sequences which were first identified prior to the determination of the corresponding sequences of SEQ ID NOs: 1 - 6. Accordingly, in a further aspect, the present invention provides for an isolated polynucleotide which:
  • (a) comprises a nucleotide sequence which has at least 70% identity, preferably at least 80% identity, more preferably at least 90% identity, yet more preferably at least 95% identity, even more preferably at least 97-99% identity to SEQ ID NO: 7- 12 over the entire length of SEQ ID NOJ-12;
  • (b) has a nucleotide sequence which has at least 70% identity, preferably at least 80% identity, more preferably at least 90% identity, yet more preferably at least 95% identity, even more preferably at least 97-99% identity, to SEQ ID NO: 1 -6 over the entire length of SEQ ID NOJ-12; or
  • nucleotide sequences of SEQ ID NO: 7- 12 and the peptide sequence encoded thereby are derived from EST (Expressed Sequence Tag) sequences. It is recognised by those skilled in the art that there will inevitably be some nucleotide sequence reading errors in EST sequences (see Adams, M.D. et al, Nature 377 (supp) 3, 1995). Accordingly, the nucleotide sequence of SEQ ID NOJ-12 and the peptide sequence encoded therefrom are therefore subject to the same inherent limitations in sequence accuracy.
  • Polynucleotides of the present invention may be obtained, using standard cloning and screening techniques, from a cDNA library derived from mRNA in cells of human colon cancer, (for example Sambrook et al, Molecular Cloning: A Laboratory Manual, 2 nd Ed., Cold Spring harbor Laboratory Press, Cold Spring harbor, N.Y. (1989)). Polynucleotides of the invention can also be obtained from natural sources such as genomic DNA libraries or can be synthesized using well known and commercially available techniques.
  • the polynucleotide may include the coding sequence for the mature polypeptide, by itself; or the coding sequence for the mature polypeptide in reading frame with other coding sequences, such as those encoding a leader or secretory sequence, a pre-, or pro- or prepro- protein sequence, or other fusion peptide portions.
  • a marker sequence which facilitates purification of the fused polypeptide can be encoded.
  • the marker sequence is a hexa-histidine peptide, as provided in the pQE vector (Qiagen, Inc.) and described in Gentz et al, Proc Natl Acad Sci USA (1989) 86:821-824, or is an HA tag.
  • the polynucleotide may also contain non-coding 5' and 3' sequences, such as transcribed, non- translated sequences, splicing and polyadenylation signals, ribosome binding sites and sequences that stabilize mRNA.
  • Polynucleotides which are identical or sufficiently identical to a nucleotide sequence contained in SEQ ID NOs: 1 - 6, may be used as hybridization probes for cDNA and genomic DNA or as primers for a nucleic acid amplification (PCR) reaction, to isolate full- length cDNAs and genomic clones encoding polypeptides of the present invention and to isolate cDNA and genomic clones of other genes (including genes encoding paralogs from human sources and orthologs and paralogs from species other than human) that have a high sequence similarity to SEQ ID NO: 1 - 6.
  • these nucleotide sequences are 70% identical, preferably 80%) identical, more preferably 90% identical, most preferably 95% identical to that of the referent.
  • the probes or primers will generally comprise at least 15 nucleotides, preferably, at least 30 nucleotides and may have at least 50 nucleotides. Particularly preferred probes will have between 30 and 50 nucleotides. Particularly preferred primers will have between 20 and 25 nucleotides.
  • polypeptides or polynucleotides derived from sequences from homologous animal origin could be used as immunogens to obtain a cross-reactive immune response to the human gene.
  • a polynucleotide encoding a polypeptide of the present invention may be obtained by a process which comprises the steps of screening an appropriate library under stringent hybridization conditions with a labeled probe having the sequence of SEQ ID NOs: 1 - 6 or a fragment thereof; and isolating full- length cDNA and genomic clones containing said polynucleotide sequence.
  • Such hybridization techniques are well known to the skilled artisan.
  • Preferred stringent hybridization conditions include overnight incubation at 42°C in a solution comprising: 50% formamide, 5xSSC (150mM NaCl, 15mM trisodium citrate), 50 mM sodium phosphate (pH7.6), 5x Denhardt's solution, 10 % dextran sulfate, and 20 microgram/ml denatured, sheared salmon sperm DNA; followed by washing the filters in OJx SSC at about 65°C.
  • the present invention also includes polynucleotides obtainable by screening an appropriate library under stingent hybridization conditions with a labeled probe having the sequence of SEQ ID NOs: 1 - 6 or a fragment thereof.
  • an isolated cDNA sequence will be incomplete, in that the region coding for the polypeptide is short at the 5' end of the cDNA.
  • PCR Nucleic acid amplification
  • the products of this reaction can then be analysed by DNA sequencing and a full-length cDNA constructed either by joining the product directly to the existing cDNA to give a complete sequence, or carrying out a separate full-length PCR using the new sequence information for the design of the 5' primer.
  • the present invention relates to CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptides.
  • peptides of the present invention include isolated polypeptides encoded by a polynucleotide comprising the sequence contained in one of SEQ ID NOSJ - 6.
  • the invention also provides an immunogenic fragment of a CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptide, that is a contiguous portion of the CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptide which has the same or similar immunogenic properties to the polypeptide encoded by a polynucleotide comprising the sequence contained in one of SEQ ID NOSJ - 6.
  • the fragment (if necessary when coupled to a carrier) is capable of raising an immune response which recognises the CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptide.
  • an immunogenic fragment may include, for example, the CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptide lacking an N-terminal leader sequence, a transmembrane domain or a C-terminal anchor domain.
  • polypeptides or immunogenic fragment of the invention may be in the form of the "mature" protein or may be a part of a larger protein such as a precursor or a fusion protein. It is often advantageous to include an additional amino acid sequence which contains secretory or leader sequences, pro-sequences, sequences which aid in purification such as multiple histidine residues, or an additional sequence for stability during recombinant production. Furthermore, addition of exogenous polypeptide or lipid tail or polynucleotide sequences to increase the immunogenic potential of the final molecule is also considered.
  • the invention relates to genetically engineered soluble fusion proteins comprising a polypeptide of the present invention, or a fragment thereof, and various portions of the constant regions of heavy or light chains of immunoglobulins of various subclasses (IgG, IgM, IgA, IgE).
  • immunoglobulin is the constant part of the heavy chain of human IgG, particularly IgGl, where fusion takes place at the hinge region.
  • the Fc part can be removed simply by incorporation of a cleavage sequence which can be cleaved with blood clotting factor Xa.
  • this invention relates to processes for the preparation of these fusion proteins by genetic engineering, and to the use thereof for drug screening, diagnosis and therapy.
  • a further aspect of the invention also relates to polynucleotides encoding such fusion proteins.
  • fusion protein technology can be found in International Patent Application Nos. WO94/29458 and WO94/22914.
  • the proteins may be chemically conjugated, or expressed as recombinant fusion proteins allowing increased levels to be produced in an expression system as compared to non- fused protein.
  • the fusion partner may assist in providing T helper epitopes (immunological fusion partner), preferably T helper epitopes recognised by humans, or assist in expressing the protein (expression enhancer) at higher yields than the native recombinant protein.
  • the fusion partner will be both an immunological fusion partner and expression enhancing partner.
  • Fusion partners include protein D from Haemophilus influenza B and the non-structural protein from influenzae virus, NS1 (hemagglutinin).
  • Another immunological fusion partner is the protein known as LYTA.
  • LYTA the protein known as the protein known as LYTA.
  • Lyta is derived from Streptococcus pneumoniae which synthesize an N-acetyl-L- alanine amidase, amidase LYTA, (coded by the lytA gene ⁇ Gene, 43 (1986) page 265- 272 ⁇ an autolysin that specifically degrades certain bonds in the peptidoglycan backbone.
  • the C-terminal domain of the LYTA protein is responsible for the affinity to the choline or to some choline analogues such as DEAE. This property has been exploited for the development of E.coli C-LYTA expressing plasmids useful for expression of fusion proteins. Purification of hybrid proteins containing the C-LYTA fragment at its amino terminus has been described ⁇ Biotechnology: 10, (1992) page 795-798 ⁇ . It is possible to use the repeat portion of the Lyta molecule found in the C terminal end starting at residue 178, for example residues 188 - 305.
  • the present invention also includes variants of the aforementioned polypeptides, that is polypeptides that vary from the referents by conservative amino acid substitutions, whereby a residue is substituted by another with like characteristics. Typical such substitutions are among Ala, Val, Leu and He; among Ser and Thr; among the acidic residues Asp and Glu; among Asn and Gin; and among the basic residues Lys and Arg; or aromatic residues Phe and Tyr. Particularly preferred are variants in which several, 5-10, 1-5, 1-3, 1-2 or 1 amino acids are substituted, deleted, or added in any combination.
  • Polypeptides of the present invention can be prepared in any suitable manner.
  • Such polypeptides include isolated naturally occurring polypeptides, recombinantly produced polypeptides, synthetically produced polypeptides, or polypeptides produced by a combination of these methods. Means for preparing such polypeptides are well understood in the art.
  • Recombinant polypeptides of the present invention may be prepared by processes well known in the art from genetically engineered host cells comprising expression systems. Accordingly, in a further aspect, the present invention relates to an expression system which comprises a polynucleotide of the present invention, to host cells which are genetically engineered with such expression sytems and to the production of polypeptides of the invention by recombinant techniques. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.
  • host cells can be genetically engineered to incorporate expression systems or portions thereof for polynucleotides of the present invention.
  • Introduction of polynucleotides into host cells can be effected by methods described in many standard laboratory manuals, such as Davis et al. , Basic Methods in Molecular Biology (1986) and Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold
  • Preferred such methods include, for instance, calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction or infection.
  • the proteins of the invention are coexpressed with thioredoxin in trans (TIT).
  • TIT thioredoxin in trans
  • Coexpression of thioredoxin in trans versus in cis is preferred to keep antigen free of thioredoxin without the need for protease.
  • Thioredoxin coexpression eases the solubilisation of the proteins of the invention.
  • Thioredoxin coexpression has also a significant impact on protein purification yield, on purified-protein solubility and quality.
  • bacterial cells such as Streptococci, Staphylococci, E. coli, Streptomyces and Bacillus subtilis cells
  • fungal cells such as yeast cells and Aspergillus cells
  • insect cells such as Drosophila S2 and Spodoptera Sf9 cells
  • animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, HEK 293 and Bowes melanoma cells
  • plant cells include bacterial cells, such as Streptococci, Staphylococci, E. coli, Streptomyces and Bacillus subtilis cells
  • fungal cells such as yeast cells and Aspergillus cells
  • insect cells such as Drosophila S2 and Spodoptera Sf9 cells
  • animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, HEK 293 and Bowes melanoma cells
  • plant cells include bacterial cells, such as Streptococci, Staphylococci, E.
  • expression systems can be used, for instance, chromosomal, episomal and virus-derived systems, e.g., vectors derived from bacterial plasmids, from bacteriophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retro viruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids.
  • the expression systems may contain control regions that regulate as well as engender expression.
  • any system or vector which is able to maintain, propagate or express a polynucleotide to produce a polypeptide in a host may be used.
  • the appropriate nucleotide sequence may be inserted into an expression system by any of a variety of well-known and routine techniques, such as, for example, those set forth in Sambrook et al., Molecular Cloning, A Laboratory Manual (supra).
  • Appropriate secretion signals may be incorporated into the desired polypeptide to allow secretion of the translated protein into the lumen of the endoplasmic reticulum, the periplasmic space or the extracellular environment. These signals may be endogenous to the polypeptide or they may be heterologous signals.
  • the expression system may also be a recombinant live microorganism, such as a virus or bacterium.
  • the gene of interest can be inserted into the genome of a live recombinant virus or bacterium. Inoculation and in vivo infection with this live vector will lead to in vivo expression of the antigen and induction of immune responses.
  • Viruses and bacteria used for this purpose are for instance: poxviruses (e.g; vaccinia, fowlpox, canarypox), alphaviruses (Sindbis virus, Semliki Forest Virus, Dialoguelian Equine Encephalitis Virus), adenoviruses, adeno-associated virus, picornaviruses (poliovirus, rhinovirus), herpesviruses (varicella zoster virus, etc), Listeria, Salmonella , Shigella, BCG. These viruses and bacteria can be virulent, or attenuated in various ways in order to obtain live vaccines. Such live vaccines also form part of the invention.
  • poxviruses e.g; vaccinia, fowlpox, canarypox
  • alphaviruses Semliki Forest Virus, Kunststoffuelian Equine Encephalitis Virus
  • adenoviruses adeno-associated virus
  • picornaviruses
  • Polypeptides of the present invention can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, ion metal affinity chromatography (IMAC) is employed for purification.
  • IMAC ion metal affinity chromatography
  • Well known techniques for refolding proteins may be employed to regenerate active conformation when the polypeptide is denatured during intracellular synthesis, isolation and or purification.
  • Another aspect of the invention relates to a method for inducing , re-inforcing or modulating an immunological response in a mammal which comprises inoculating the mammal with a fragment or the entire polypeptide or polynucleotide of the invention, adequate to produce antibody and/or T cell immune response for prophylaxis or for therapeutic treatment of cancer and autoimmune disease and related conditions.
  • Yet another aspect of the invention relates to a method of inducing, re-inforcing or modulating immunological response in a mammal which comprises, delivering a polypeptide of the present invention via a vector or cell directing expression of the polynucleotide and coding for the polypeptide in vivo in order to induce such an immunological response to produce immune responses for prophylaxis or treatment of said mammal from diseases.
  • a further aspect of the invention relates to an immunological/vaccine formulation (composition) which, when introduced into a mammalian host, induces, re-inforces or modulates an immunological response in that mammal to a polypeptide of the present invention wherein the composition comprises a polypeptide or polynucleotide of the invention or an immunological fragment thereof as herein before defined.
  • the vaccine formulation may further comprise a suitable carrier. Since a polypeptide may be broken down in the stomach, it is preferably administered parenterally (for instance, subcutaneous, intramuscular, intravenous, or intradermal injection).
  • Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents or thickening agents.
  • the formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampoules and vials and may be stored in a freeze-dried condition requiring only the addition of the sterile liquid carrier immediately prior to use.
  • a further aspect of the invention relates to the in vitro induction of immune responses to a fragment or the entire polypeptide or polynucleotide of the present invention or a molecule comprising the polypeptide or polynucleotide of the present invention, using cells from the immune system of a mammal, and reinfusing these activated immune cells of the mammal for the treatment of disease.
  • Activation of the cells from the immune system is achieved by in vitro incubation with the entire polypeptide or polynucleotide of the present invention or a molecule comprising the polypeptide or polynucleotide of the present invention in the presence or absence of various immunomodulator molecules.
  • a further aspect of the invention relates to the immunization of a mammal by administration of antigen presenting cells modified by in vitro loading with part or the entire polypeptide of the present invention or a molecule comprising the polypeptide of the present invention and administered in vivo in an immunogenic way.
  • antigen presenting cells can be transfected in vitro with a vector containing a fragment or the entire polynucleotide of the present invention or a molecule comprising the polynucleotide of the present invention, such as to express the corresponding polypeptide, and administered in vivo in an immunogenic way.
  • the vaccine formulation of the invention may also include adjuvant systems for enhancing the immunogenicity of the formulation.
  • the adjuvant system raises preferentially a TH1 type of response.
  • An immune response may be broadly distinguished into two extreme catagories, being a humoral or cell mediated immune responses (traditionally characterised by antibody and cellular effector mechanisms of protection respectively). These categories of response have been termed THl-type responses (cell-mediated response), and TH2-type immune responses (humoral response). Extreme THl-type immune responses may be characterised by the generation of antigen specific, haplotype restricted cytotoxic T lymphocytes, and natural killer cell responses. In mice THl-type responses are often characterised by the generation of antibodies of the IgG2a subtype, whilst in the human these correspond to IgGl type antibodies. TH2-type immune responses are characterised by the generation of a broad range of immunoglobulin isotypes including in mice IgGl, IgA, and IgM.
  • cytokines the driving force behind the development of these two types of immune responses.
  • High levels of THl-type cytokines tend to favour the induction of cell mediated immune responses to the given antigen, whilst high levels of TH2-type cytokines tend to favour the induction of humoral immune responses to the antigen.
  • TH1 and TH2-type immune responses are not absolute. In reality an individual will support an immune response which is described as being predominantly TH1 or predominantly TH2. However, it is often convenient to consider the families of cytokines in terms of that described in murine CD4 +ve T cell clones by Mosmann and Coffman (Mosmann, T.R. and Coff an, R.L. (1989) TH1 and TH2 cells: different patterns oflymphokine secretion lead to different functional properties. Annual Review of Immunology, 7, pl45-173). Traditionally, THl-type responses are associated with the production of the INF- ⁇ and IL-2 cytokines by T-lymphocytes.
  • cytokines often directly associated with the induction of THl-type immune responses are not produced by T-cells, such as IL-12.
  • TH2- type responses are associated with the secretion of IL-4, IL-5, IL-6 and IL-13.
  • the best indicators of the TH1 :TH2 balance of the immune response after a vaccination or infection includes direct measurement of the production of TH1 or TH2 cytokines by T lymphocytes in vitro after restimulation with antigen, and/or the measurement of the IgGl :IgG2a ratio of antigen specific antibody responses.
  • a THl-type adjuvant is one which preferentially stimulates isolated T-cell populations to produce high levels of THl-type cytokines when re-stimulated with antigen in vitro, and promotes development of both CD8+ cytotoxic T lymphocytes and antigen specific immunoglobulin responses associated with THl-type isotype.
  • Adjuvants which are capable of preferential stimulation of the TH1 cell response are described in International Patent Application No. WO 94/00153 and WO 95/17209.
  • 3 De-O-acylated monophosphoryl lipid A is one such adjuvant. This is known from GB 2220211 (Ribi). Chemically it is a mixture of 3 De-O-acylated monophosphoryl lipid A with 4, 5 or 6 acylated chains and is manufactured by Ribi Immunochem, Montana. A preferred form of 3 De-O-acylated monophosphoryl lipid A is disclosed in European Patent 0 689 454 Bl (SmithKline Beecham Biologicals SA).
  • the particles of 3D-MPL are small enough to be sterile filtered through a 0J2micron membrane (European Patent number 0 689 454).
  • 3D-MPL will be present in the range of lO ⁇ g - lOO ⁇ g preferably 25-50 ⁇ g per dose wherein the antigen will typically be present in a range 2-50 ⁇ g per dose.
  • Another preferred adjuvant comprises QS21 , an Hplc purified non-toxic fraction derived from the bark of Quillaja Saponaria Molina.
  • this may be admixed with 3 De- O-acylated monophosphoryl lipid A (3D-MPL), optionally together with an carrier.
  • 3D-MPL 3 De- O-acylated monophosphoryl lipid A
  • Non-reactogenic adjuvant formulations containing QS21 have been described previously (WO 96/33739). Such formulations comprising QS21 and cholesterol have been shown to be successful TH1 stimulating adjuvants when formulated together with an antigen.
  • Further adjuvants which are preferential stimulators of TH1 cell response include immunomodulatory oligonucleotides, for example unmethylated CpG sequences as disclosed in WO 96/02555. Combinations of different TH1 stimulating adjuvants, such as those mentioned hereinabove, are also contemplated as providing an adjuvant which is a preferential stimulator of TH1 cell response.
  • QS21 can be formulated together with 3D- MPL.
  • the ratio of QS21 : 3D-MPL will typically be in the order of 1 : 10 to 10 : 1; preferably 1 :5 to 5 : 1 and often substantially 1 : 1.
  • the preferred range for optimal synergy is 2.5 : 1 to 1 : 1 3D-MPL: QS21.
  • a carrier is also present in the vaccine composition according to the invention.
  • the carrier may be an oil in water emulsion, or an aluminium salt, such as aluminium phosphate or aluminium hydroxide.
  • a preferred oil-in-water emulsion comprises a metabolisible oil, such as squalene, alpha tocopherol and Tween 80.
  • a metabolisible oil such as squalene, alpha tocopherol and Tween 80.
  • the antigens in the vaccine composition according to the invention are combined with QS21 and 3D-MPL in such an emulsion.
  • the oil in water emulsion may contain span 85 and/or lecithin and/or tricaprylin.
  • QS21 and 3D-MPL will be present in a vaccine in the range of l ⁇ g - 200 ⁇ g, such as 10-100 ⁇ g, preferably lO ⁇ g - 50 ⁇ g per dose.
  • the oil in water will comprise from 2 to 10% squalene, from 2 to 10% alpha tocopherol and from 0J to 3% tween 80.
  • the ratio of squalene: alpha tocopherol is equal to or less than 1 as this provides a more stable emulsion.
  • Span 85 may also be present at a level of 1%. In some cases it may be advantageous that the vaccines of the present invention will further contain a stabiliser.
  • Non-toxic oil in water emulsions preferably contain a non-toxic oil, e.g. squalane or squalene, an emulsifier, e.g. Tween 80, in an aqueous carrier.
  • a non-toxic oil e.g. squalane or squalene
  • an emulsifier e.g. Tween 80
  • the aqueous carrier may be, for example, phosphate buffered saline.
  • a particularly potent adjuvant formulation involving QS21, 3D-MPL and tocopherol in an oil in water emulsion is described in WO 95/17210.
  • the present invention also provides a polyvalent vaccine composition comprising a vaccine formulation of the invention in combination with other antigens, in particular antigens useful for treating cancers, autoimmune diseases and related conditions.
  • a polyvalent vaccine composition may include a TH-1 inducing adjuvant as hereinbefore described.
  • An important aspect of the invention in addition to the polynucleotides themselves, also relates to the use of the polynucleotides of the present invention and oligonucleotides derived from them, as diagnostic and monitoring reagents.
  • Oligonucleotide fragments derived from the polynucleotides of the invention for use as probes or primers generally comprise at least 15 bases. Particularly preferred probes will have between 30 and 50 nucleotides. Particularly preferred primers will have between 20 and 25 nucleotides.
  • the identification of genetic or biochemical markers in blood, other biological fluids, faeces, or tissues that will enable the detection of very early changes along the carcinogenesis pathway will help in determining the best treatment for the patient and the efficacy of the treatment.
  • Surrogate tumour markers such as polynucleotide expression, can be used to diagnose different forms and states of cancer.
  • the identification of expression levels of the polynucleotides of the invention will be useful in both the staging of the cancerous disorder and grading the nature of the cancerous tissue.
  • the staging process monitors the advancement of the cancer and is determined on the presence or absence of malignant tissue in the areas biopsied.
  • the polynucleotides of the invention can help to perfect the staging process by identifying markers for the aggresivity of a cancer, for example the presence in different areas of the body.
  • the grading of the cancer describes how closely a tumour resembles normal tissue of its same type and is assessed by its cell morphology and other markers of differentiation.
  • the polynucleotides of the invention can be useful in determining the tumour grade as they can help in the determination of the differentiation status of the cells of a tumour.
  • polypeptide of the invention can be produced by stroma cells, in which cases, its specific expression or differential expression is a marker of disease conditions. Differential expression
  • the diagnostic assays offer a process for diagnosing or determining a susceptibility to cancers, autoimmune disease and related conditions through diagnosis by methods comprising determining from a sample derived from a subject an abnormally decreased or increased level of polypeptide or mRNA.
  • This method of diagnosis is known as differential expression.
  • the expression of a particular gene is compared between a diseased tissue and a normal tissue.
  • a difference between the polynucleotide-related gene, mRNA, or protein in the two tissues is compared, for example in molecular weight, amino acid or nucleotide sequence, or relative abundance, indicates a change in the gene, or a gene which regulates it, in the tissue of the human that was suspected of being diseased.
  • RNA level Decreased or increased expression can be measured at the RNA level.
  • PolyA RNA is first isolated from the two tissues and the detection of mRNA encoded by a gene corresponding to a differentially expressed polynucleotide of the invention can be detected by, for example, in situ hybridization in tissue sections, reverse transcriptase-PCR, using Northern blots containing poly A+ mRNA, or any other direct or indierect RNA detection method.
  • An increased or decreased expression of a given RNA in a diseased tissue or surrounding tissues compared to a normal tissue or in the absence of disease suggests that the transcript and/or the expressed protein has a role in the disease.
  • detection of a higher or lower level of mRNA corresponding to SEQ ID NOS 1-6 relative to normal level is indicative of the presence of cancer in the patient.
  • mRNA expression levels in a sample can be determined by generation of a library of expressed sequence tags (ESTs) from the sample.
  • ESTs expressed sequence tags
  • the relative representation of ESTs in the library can be used to assess the relative representation of the gene transcript in the starting sample.
  • the EST analysis of the test can then be compared to the EST analysis of a reference sample to determine the relative expression levels of the polynucleotide of interest.
  • mRNA analyses can be carried out using serial analysis of gene expression (SAGE) methodology (Velculescu et. Al. Science (1995) 270:484) , differential display methodology (For example, US 5,776,683) or hybridization analysis which relies on the specificity of nucleotide interactions.
  • SAGE serial analysis of gene expression
  • differential display methodology For example, US 5,776,683
  • hybridization analysis which relies on the specificity of nucleotide interactions.
  • the polynucleotide sequence encodes a polypeptide
  • the comparison could be made at the protein level.
  • the protein sizes in the two tissues may be compared using antibodies to detect polypeptides in Western blots of protein extracts from the two tissues. Expression levels and subcellular localization may also be detected immunologically using antibodies to the corresponding protein.
  • the diagnosis can be determined by detection of gene product expression levels encoded by at least one sequence set forth in SEQ ID NOS: 1 - 6.
  • a comparison of the mRNA or protein levels in a diseased versus normal tissue may also be used to follow the progression or remission of a disease.
  • polynucleotide sequences in a sample can be assayed using polynucleotide arrays. These can be used to examine differential expression of genes and to determine gene function. For example, arrays of the polynucleotide sequences SEQ ID NOS 1 - 6 can be used to determine if any of the polynucleotides are differentially expressed between a normal and cancer cell. In one embodiment of the invention, an array of oligonucleotides probes comprising SEQ ID NOS 1 - 6 nucleotide sequence or fragments thereof can be constructed to conduct efficient screening of e.g., genetic mutations.
  • Array technology methods are well known and have general applicability and can be used to address a variety of questions in molecular genetics including gene expression, genetic linkage, and genetic variability (see for example: M.Chee et al, Science, Vol 274, pp 610- 613 (1996)).
  • Diagnosis includes determination of a subject's susceptibility to a disease, determination as to whether a subject presently has the disease, and also the prognosis of a subject affected by the disease.
  • the present invention further relates to a diagnostic kit for performing a diagnostic assay which comprises:
  • a polynucleotide of the present invention preferably the nucleotide sequence of any one of SEQ ID NOs: 1 - 6, or a fragment thereof ;
  • a polypeptide of the present invention preferably the polypeptide encoded by a polynucleotide comprising the sequence contained in any one of SEQ ID Nos 1 - 6 or a fragment thereof; or (d) an antibody to a polypeptide of the present invention, preferably to the polypeptide encoded by a polynucleotide comprising the sequence contained in any one of SEQ ID Nos
  • the nucleotide sequences of the present invention are also valuable for chromosomal localisation.
  • the sequence is specifically targeted to, and can hybridize with, a particular location on an individual human chromosome.
  • the mapping of relevant sequences to chromosomes according to the present invention is an important first step in correlating those sequences with gene associated disease. Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found in, for example, V. McKusick, Mendelian Inheritance in Man (available on-line through Johns Hopkins University Welch Medical Library).
  • genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes).
  • linkage analysis coinheritance of physically adjacent genes.
  • the differences in the cDNA or genomic sequence between affected and unaffected individuals can also be determined.
  • gene amplification at the genomic level could be assessed and correlated with the stage of disease.
  • polypeptides of the invention or their fragments or analogs thereof, or cells expressing them, can also be used as immunogens to produce antibodies immunospecific for polypeptides of the present invention.
  • immunospecific means that the antibodies have substantially greater affinity for the polypeptides of the invention than their affinity for other related polypeptides in the prior art.
  • the invention provides an antibody immunospecific for a polypeptide according to the invention or an immunological fragment thereof as hereinbefore defined.
  • the antibody is a monoclonal antibody.
  • Antibodies generated against polypeptides of the present invention may be obtained by administering the polypeptides or epitope-bearing fragments, analogs or cells to an animal, preferably a non-human animal, using routine protocols.
  • any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler, G. and Milstein, C, Nature (1975) 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al, Immunology Today (1983) 4:72) and the EBV-hybridoma technique (Cole et al. , Monoclonal Antibodies and Cancer Therapy, 77-96, Alan R. Liss, Inc., 1985).
  • the above-described antibodies may be employed to isolate or to identify clones expressing the polypeptide or to purify the polypeptides by affinity chromatography.
  • the antibody of the invention may also be employed to prevent or treat cancer, particularly colon cancer, autoimmune disease and related conditions.
  • Another aspect of the invention relates to a method for inducing or modulating an immunological response in a mammal which comprises inoculating the mammal with a polypeptide of the present invention, adequate to produce antibody and/or T cell immune response to protect or ameliorate the symptoms or progression of the disease.
  • Yet another aspect of the invention relates to a method of inducing or modulating immunological response in a mammal which comprises, delivering a polypeptide of the present invention via a vector directing expression of the polynucleotide and coding for the polypeptide in vivo in order to induce such an immunological response to produce antibody to protect said animal from diseases.
  • the present invention therefore provides a method of diagnosing and/or treating abnormal conditions such as, for instance, cancer and autoimmune diseases, in particular, colon cancer, related to either a presence of, an excess of, or an under- expression of, any one of CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507.
  • abnormal conditions such as, for instance, cancer and autoimmune diseases, in particular, colon cancer
  • the present invention further provides for a method of screening compounds to identify those which stimulate or which inhibit the function of any one of the CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptides.
  • agonists or antagonists may be employed for therapeutic and prophylactic purposes for such diseases as hereinbefore mentioned.
  • Compounds may be identified from a variety of sources, for example, cells, cell-free preparations, chemical libraries, and natural product mixtures.
  • Such agonists, antagonists or inhibitors so-identified may be natural or modified substrates, ligands, receptors, enzymes, etc., as the case may be, of the polypeptide; or may be structural or functional mimetics thereof (see Coligan et al.
  • the invention provides a method for screening to identify compounds which stimulate or which inhibit the function of the polypeptide of the invention which comprises a method selected from the group consisting of:
  • the polypeptide of the invention may be used to identify membrane bound or soluble receptors, if any, through standard receptor binding techniques known in the art. Well known screening methods may also be used to identify agonists and antagonists of the polypeptide of the invention which compete with the binding of the polypeptide of the invention to its receptors, if any.
  • the present invention relates to a screening kit for identifying agonists, antagonists, ligands, receptors, substrates, enzymes, etc. for polypeptides of the present invention; or compounds which decrease or enhance the production of such polypeptides, which comprises: (a) a polypeptide of the present invention; (b) a recombinant cell expressing a polypeptide of the present invention;
  • polypeptide of the present invention (d) antibody to a polypeptide of the present invention; which polypeptide is preferably that encoded by a polynucleotide comprising the sequence contained in any one of SEQ ID NOsJ - 6.
  • a polypeptide of the present invention may also be used in a method for the structure-based design of an agonist, antagonist or inhibitor of the polypeptide, by: (a) determining in the first instance the three-dimensional structure of the polypeptide;
  • Gene therapy may also be employed to effect the endogenous production of CASB611 , CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptides by the relevant cells in the subject.
  • gene therapy see Chapter 20, Gene Therapy and other Molecular Genetic-based Therapeutic Approaches, (and references cited therein) in Human Molecular Genetics, T Strachan and A P Read, BIOS Scientific Publishers Ltd (1996).
  • compositions and administration are provided.
  • Vaccine preparation is generally described in Pharmaceutical Biotechnology, Vol.61 Vaccine Design - the subunit and adjuvant approach, edited by Powell and Newman, Plenum Press, 1995. New Trends and Developments in Vaccines, edited by Voller et al., University Park Press, Baltimore, Maryland, U.S.A. 1978. Encapsulation within liposomes is described, for example, by Fullerton, U.S. Patent 4,235,877. Conjugation of proteins to macromolecules is disclosed, for example, by Likhite, U.S. Patent 4,372,945 and by Armor et al., U.S. Patent 4,474,757.
  • each vaccine dose is selected as an amount which induces an immunoprotective response without significant, adverse side effects in typical vaccinees. Such amount will vary depending upon which specific immunogen is employed. Generally, it is expected that each dose will comprise l-1000 ⁇ g of protein, preferably 2-100 ⁇ g, most preferably 4-40 ⁇ g. An optimal amount for a particular vaccine can be ascertained by standard studies involving observation of antibody titres and other responses in subjects. Following an initial vaccination, subjects may receive a boost in about 4 weeks. Definitions
  • Isolated means altered “by the hand of man” from the natural state. If an "isolated” composition or substance occurs in nature, it has been changed or removed from its original environment, or both.
  • a polynucleotide or a polypeptide naturally present in a living animal is not “isolated,” but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is “isolated”, as the term is employed herein.
  • Polynucleotide generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA including single and double stranded regions.
  • Variant refers to a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide, but retains essential properties.
  • a typical variant of a polynucleotide differs in nucleotide sequence from another, reference polynucleotide. Changes in the nucleotide sequence of the variant may or may not alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Nucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below.
  • a typical variant of a polypeptide differs in amino acid sequence from another, reference polypeptide.
  • a variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions in any combination.
  • a substituted or inserted amino acid residue may or may not be one encoded by the genetic code.
  • a variant of a polynucleotide or polypeptide may be a naturally occurring such as an allelic variant, or it may be a variant that is not known to occur naturally. Non-naturally occurring variants of polynucleotides and polypeptides may be made by mutagenesis techniques or by direct synthesis.
  • Identity ' as known in the art is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences.
  • identity also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences.
  • Identity and similarity can be readily calculated by known methods, including but not limited to those described in (Computational Molecular Biology, Lesk, A.M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D.W., ed., Academic Press, New York. 1993; Computer Analysis of Sequence Data, Part I, Griffin, A.M., and Griffin, H.G.. eds.,
  • Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, the GCG program package (Devereux, J., et al., Nucleic Acids Research 12(1): 387 (1984)), BLASTP, BLASTN, and FASTA (Atschul, S.F. et al., J. Molec. Biol. 215: 403-410 (1990).
  • the BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al, NCBI NLM NIH Bethesda. MD 20894; Altschul, S., et al, J. Mol. Biol. 215: 403-410 (1990).
  • the well known Smith Waterman algorithm may also be used to determine identity.
  • the preferred algorithm used is FASTA.
  • the preferred parameters for polypeptide or polynuleotide sequence comparison using this algorithm include the following:
  • Preferred parameters for polypeptide sequence comparison with other methods include the following:
  • Gap Length Penalty 4 A program useful with these parameters is publicly available as the "gap" program from Genetics Computer Group, Madison WI. The aforementioned parameters are the default parameters for polypeptide comparisons (along with no penalty for end gaps).
  • a program useful with these parameters is publicly available as the "gap" program from Genetics Computer Group, Madison WI.
  • the aforementioned parameters are the default parameters for polynucleotide comparisons.
  • a polynucleotide sequence of the present invention may be identical to the reference sequence of SEQ ID NO:l, that is be 100% identical, or it may include up to a certain integer number of nucleotide alterations as compared to the reference sequence.
  • Such alterations are selected from the group consisting of at least one nucleotide deletion, substitution, including transition and transversion, or insertion, and wherein said alterations may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among the nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.
  • the number of nucleotide alterations is determined by multiplying the total number of nucleotides in SEQ ID NO:l by the numerical percent of the respective percent identity(divided by 100) and subtracting that product from said total number of nucleotides in SEQ ID NO:l, or: n n ⁇ x n - (x n • y), wherein n n is the number of nucleotide alterations, x n is the total number of nucleotides in SEQ ID NO:l, and y is, for instance, 0.70 for 70%, 0.80 for 80%, 0.85 for 85%, 0.90 for 90%, 0.95 for 95%,etc, and wherein any non-integer product of x n and y is rounded down to the nearest integer prior to subtracting it from x n .
  • Alterations of a polynucleotide sequence encoding the polypeptide of SEQ ID NO:2 may create nonsense, missense or frameshift mutations in this coding sequence and thereby alter the polypeptide encoded by the polynucleotide following such alterations.
  • “Homolog” is a generic term used in the art to indicate a polynucleotide or polypeptide sequence possessing a high degree of sequence relatedness to a subject sequence. Such relatedness may be quntified by determining the degree of identity and/or similarity between the sequences being compared as hereinbefore described. Falling within this generic term are the terms “ortholog”, meaning a polynucleotide or polypeptide that is the functional equivalent of a polynucleotide or polypeptide in another species and "paralog” meaning a functionally similar sequence when considered within the same species.
  • RNA is extracted from frozen (-70°C) colon tumour and matched normal colon samples using the TriPure reagent and protocol (Boehringer).
  • Target RNA is prepared by pooling total RNA from three tumour samples (30 ⁇ g each).
  • Driver RNA is prepared by pooling total RNA from three matched normal colon samples (10 ⁇ g each) and total RNA from seven normal tissues other than colon(brain, heart, kidney, liver, bladder, skin, spleen; 10 ⁇ g each).
  • Total RNA from non-colon normal tissues is purchased from InVitrogen.
  • RNA is purified from total RNA using oligo-dT magnetic bead technology (Dynal) and quantified by spectrofluorimetry (BioRad).
  • Target and driver mRNA are reverse transcribed into cDNA using one of two strategies: 1) Target sequences for PCR oligonucleotides are introduced onto the ends of the newly synthesised cDNA during reverse transcription using the template switching capability of reverse transcriptase (ClonTech SMART PCR cDNA synthesis kit). 2) Target and driver mRNA are reverse transcribed into cDNA using an oligo-dT primer and converted to double-strand cDNA; the cDNA is cleaved with Rsal and linkers for PCR amplification are ligated onto the extremities of the cDNA fragments.
  • target and driver cDNA are amplified by long range PCR (ClonTech SMART PCR Synthesis Kit and Advantage PCR Polymerase Mix) and used as starting material for subtractive cloning.
  • long range PCR ClonTech SMART PCR Synthesis Kit and Advantage PCR Polymerase Mix
  • cycling conditions and optimisation of the number of PCR cycles are as described in the Advantage PCR protocol.
  • ClonTech PCR SELECT see ClonTech kit protocol and N. Gurskaya et al. 1996. Analytical Biochemistry: 240, 90
  • cRDA M. Hubank and D. Schatz. 1994. Nucleic Acids Research: 22, 5640.
  • PCR SELECT protocol the primary PCR SELECT subtraction products are submitted to a supplementary round of cRDA subtraction.
  • cRDA protocol two consecutive cycles of cRDA subtraction are performed.
  • target and driver RNA are assembled for the first subtraction as above with the exception that non-colon RNA is left out of the driver pool and amounts of normal colon are increased to 10 ⁇ g.
  • Preparation of target and driver cDNA and subtractive hybridisation are performed as described above.
  • a second subtraction is then performed on the products of the first subtraction, but the driver is now composed of a pool of normal colon and normal non- colon mRNA from the seven normal tissues.
  • Total bacterial DNA is extracted from 100 ⁇ l over-night cultures. Bacteria are lysed with guanidium isothiocyantate and the bacterial DNA is affinity purified using magnetic glass (Boehringer). Plasmid inserts are recovered from the bacterial DNA by Advantage PCR amplification (Clontech). The PCR products are dotted onto two nylon membranes to produce high density cDNA arrays using the Biomek 96 HDRT tool (Beckman). The spotted cDNA is covalently linked to the membrane by UV irradiation. The first membrane is hybridised with a mixed cDNA probe prepared from the tumour of a single patient. The second membrane is hybridised with an equivalent amount of mixed cDNA probe prepared from normal colon of the same patient.
  • the probe cDNA is prepared by PCR amplification as described above and is labelled using the AlkPhos Direct System (Amersham). Hybridisation conditions and stringency washes are as described in the AlkPhos Direct kit. Hybridised probe is detected by chemiluminescence. Hybridisation intensities for each cDNA fragment on both blots (see figure 1) are measured by film densitometry or direct measurement (BioRad Fluor-S Max). The ratio of the tumour to normal hybridisation intensities (T/N) is calculated for each gene to evaluate the degree of over-expression in the tumour. Genes which are significantly over-expressed in colon tumours are folio wed-up. Significance is arbitrarily defined as one standard deviation of the T/N frequency distribution. Differential screening experiments are repeated using RNA from multiple patient donors (> 18) to estimate the frequency of over-expressing tumours in the patient population.
  • the DNA arrays are hybridised with mixed cDNA probes from normal tissues other than colon (see list above) to determine the level of expression of the candidate gene in these tissues.
  • Real-time RT-PCR (U. Gibson. 1996. Genome Research: 6,996) is used to compare mRNA transcript abundance of the candidate antigen in tumour and normal colon tissues from multiple patients. In addition, mRNA levels of the candidate gene are re-evaluated by this approach in a panel of normal tissues.
  • RNA is extracted from snap frozen colon tissue biopsies using TriPure reagent (Boehringer). Total RNA from normal tissues is from InVitrogen as above. Poly-A + mRNA is purified from total RNA after DNAase treatment using oligo-dT magnetic beads (Dynal). Quantification of the mRNA is performed by spectrofluorimetry (BioRad) using Sybrll dye (Molecular Probes). Primers for amplification are designed with the Perkin-Elmer Primer Express software using default options for TaqMan amplification conditions.
  • Real-time reactions are assembled according to standard PCR protocols using 2 ng of purified mRNA for each reaction.
  • Sybrl dye (Molecular Probes) is added at a final dilution of 1/75000 for real-time detection.
  • Amplification (40 cycles) and real-time detection is performed in a PE 7700 system.
  • Ct values are calculated using the 7700 Sequence Detector software for the tumour (CtT) and normal (CtN) samples of each patient.
  • the difference between Ct values (CtN-CtT) is a direct measure of the difference in transcript levels between the tumour and normal tissues.
  • CtN"CtT 2 (CtN"CtT) j s a n estimate of the relative transcript levels in the two tissues (i.e. fold mRNA over- expression in tumor).
  • the percentage of over-expressing patients and the average level of mRNA over-expression in the tumours of these patients is calculated from the data set of patients.
  • Ct values for 12 normal tissues are reported.
  • the tissues tested are bladder, brain, breast, cervix, heart, kidney, liver, lung, oesophagus, placenta and uterus.
  • the range and mean of the Ct value is an indicator of the specificity of tissue expression.
  • 2 types of sequences are described, classified into categories A and B.
  • a sequence of category A has a colon-specific expression.
  • a sequence of category B is overexpressed in colon cancer.
  • Colon tumour cDNA libraries are constructed using the Lambda Zap system (Stratagene) from 2 ⁇ g of poly A+ mRNA as described in the supplied protocol. 1.5 x10° independent phage are plated for each screening of the library. Phage plaques are transferred onto nylon filters, hybridised using a cDNA probe labelled with AlkPhos Direct (Amersham Pharmacia) and positive phage are detected by chemiluminescence. The positive phage are excised from the agar plat, eluted in 500 ⁇ l SM buffer and confirmed by gene-specific PCR. Eluted phage are converted to single strand Ml 3 bacteriophage by in vivo excision.
  • the bacteriophage is then converted to double strand plasmid DNA by infection of E. coli. Infected bacteria are plated and submitted to a second round of screening with the cDNA probe. Plasmid DNA is purified from positive bacterial clones and submitted to Southern blot analysis to estimated the size of the cDNA inserts. CDNA inserts from multiple independent clones are sequenced on both strands.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptides and polynucleotides and methods for producing such polypeptides by recombinant techniques are disclosed. Also disclosed are methods for utilizing CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptides and polynucleotides in diagnostics, and vaccines for prophylactic and therapeutic treatment of cancers, particularly colon cancers, autoimmune diseases, and related conditions.

Description

Novel Compounds
FIELD OF THE INVENTION
The present invention relates to polynucleotides, (herein referred to as "CASB611 polynucleotide(s)", "CASB500 polynucleotide(s)", "CASB501 polynucleotide(s)", "CASB502 polynucleotide(s)", "CASB505 polynucleotide(s)", "CASB507 polynucleotide(s)"), polypeptides encoded thereby (referred to herein as "CASB611", "CASB500", "CASB501", "CASB502", "CASB505", and "CASB507" respectively or "CASB611 polypeptide(s)", "CASB500 polypeptide (s)", "CASB501 polypeptide (s)", "CASB502 polypeptide (s)", "CASB505 polypeptide (s)", "CASB507 polypeptide (s)"respectively), recombinant materials and methods for their production. In another aspect, the invention relates to methods for using such polypeptides and polynucleotides, including the diagnostics and treatment of cancer and autoimmune diseases and other related conditions. In a further aspect, the invention relates to methods for identifying agonists and antagonists/inhibitors using the materials provided by the invention, and treating conditions associated with CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptide imbalance with the identified compounds. In a still further aspect, the invention relates to diagnostic assays for detecting diseases associated with inappropriate CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptide activity or levels.
BACKGROUND OF THE INVENTION
Polynucleotides and polypeptides of the present invention are believed to be important immunogens for specific prophylactic or therapeutic immunization against tumours, because they are specifically expressed or highly over-expressed in tumours compared to normal cells and can thus be targeted by antigen-specific immune mechanisms leading to the destruction of the tumour cell. They can also be used to diagnose the occurrence of tumour cells. Furthermore, their inappropriate expression in certain circumstances can cause an induction of autoimmune, inappropriate immune responses, which could be corrected through appropriate vaccination using the same polypeptides or polynucleotides. In this respect the most important biological activities to our purpose are the antigenic and immunogenic activities of the polypeptide of the present invention. A polypeptide of the present invention may also exhibit at least one other biological activity of a CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptide, which could qualify it as a target for therapeutic or prophylactic intervention different from that linked to the immune response.
Functional genomics relies heavily on high-throughput DNA sequencing technologies and the various tools of bioinformatics to identify gene sequences of potential interest from the many molecular biology databases now available. cDNA libraries enriched for genes of relevance to a particular tissue or physiological situation can be constructed using recently developed subtractive cloning strategies. Furthermore, cDNAs found in libraries of certain tissues and not others can be identified using appropriate electronic screening methods.
High throughput genome- or gene-based biology allows new approaches to the identification and cloning of target genes for useful immune responses for the prevention and vaccine therapy of diseases such as cancer and autoimmunity.
DESCRIPTION OF THE INVENTION
Polynucleotides
In a first aspect, the present invention relates to CASB611 , CASB500, CASB501 ,
CASB502, CASB505, or CASB507 polynucleotides. Such polynucleotides include isolated polynucleotides comprising a nucleotide sequence which has at least 70% identity, preferably at least 80% identity, more preferably at least 90% identity, yet more preferably at least 95% identity, to SEQ ID NOsJ - 6 respectively over the entire length of SEQ ID NOs: 1 - 6. In this regard, polynucleotides which have at least 97% identity are highly preferred, whilst those with at least 98-99% identity are more highly preferred, and those with at least 99% identity are most highly preferred. Such polynucleotides include a polynucleotide comprising the polynucleotide of SEQ ID NOs: 1 - 6 as well as the polynucleotide of SEQ ID NOs: 1 - 6. Said polynucleotide can be inserted in a suitable plasmid or recombinant microrganism vector and used for immunization ( see for example Wolff et. al, Science 247:1465-1468 (1990); Corr et. al., j. Exp. Med. 184:1555-1560 (1996); Doe et. al, Proc. Natl. Acad. Sci. 93:8578-8583 (1996)).
The invention also provides polynucleotides which are complementary to the above described polynucleotides. The invention also provides a polynucleotide comprising a nucleotide sequence that has at least 70% identity to a nucleotide sequence encoding a polypeptide of the invention over the entire coding region, encoded by a polynucleotide comprising the sequence contained in any one of SEQ ID Nos: 1 - 6; or a nucleotide sequence complimentary to said isolated polynucleotide.
The invention also provides a fragment of a CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polynucleotide which when administered to a subject has the same immunogenic properties as the polynucleotide of SEQ ID NOs: 1 - 6.
The invention also provides a polynucleotide encoding an immunological fragment of a CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptide as hereinbefore defined.
The nucleotide sequences of SEQ ID NO: 1 (CASB611) and SEQ ID NO:2 show no homology with any known gene.. The nucleotide sequences of SEQ ID NOJ-6 show homology to intron portions of the chromosomal PBEF gene (Homo sapiens BAC clone RP11-22N19 from 7q22, complete sequence; ACCESSION : AC007032), SEQ ID NO: 3 and 5 (CASB501 and CASB505) being located between exon 8 and exon 7 of the PBEF gene (nucleotides 67 484 to 67 966 and 68 107 to 68 583), and SEQ ID NO:4 (CASB502) and 6 (CASB507) being located downstream of exon 8 (from 69 274 to 69 732 and from 70 163 to 71 223).
CASB500 is located on chromosome 6 (accession number HSJ651N20).
Preferred polypeptides and polynucleotides of the present invention are expected to have, inter alia, similar biological functions/properties to their homologous polypeptides and polynucleotides. Furthermore, preferred polynucleotides of the present invention have at least one activity of SEQ ID NOs:l - 6, as appropriate.
The present invention also relates to partial polynucleotide and polypeptide sequences which were first identified prior to the determination of the corresponding sequences of SEQ ID NOs: 1 - 6. Accordingly, in a further aspect, the present invention provides for an isolated polynucleotide which:
(a) comprises a nucleotide sequence which has at least 70% identity, preferably at least 80% identity, more preferably at least 90% identity, yet more preferably at least 95% identity, even more preferably at least 97-99% identity to SEQ ID NO: 7- 12 over the entire length of SEQ ID NOJ-12;
(b) has a nucleotide sequence which has at least 70% identity, preferably at least 80% identity, more preferably at least 90% identity, yet more preferably at least 95% identity, even more preferably at least 97-99% identity, to SEQ ID NO: 1 -6 over the entire length of SEQ ID NOJ-12; or
(c) the polynucleotides of SEQ ID NO:7-12; or
The nucleotide sequences of SEQ ID NO: 7- 12 and the peptide sequence encoded thereby are derived from EST (Expressed Sequence Tag) sequences. It is recognised by those skilled in the art that there will inevitably be some nucleotide sequence reading errors in EST sequences (see Adams, M.D. et al, Nature 377 (supp) 3, 1995). Accordingly, the nucleotide sequence of SEQ ID NOJ-12 and the peptide sequence encoded therefrom are therefore subject to the same inherent limitations in sequence accuracy.
Polynucleotides of the present invention may be obtained, using standard cloning and screening techniques, from a cDNA library derived from mRNA in cells of human colon cancer, (for example Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring harbor Laboratory Press, Cold Spring harbor, N.Y. (1989)). Polynucleotides of the invention can also be obtained from natural sources such as genomic DNA libraries or can be synthesized using well known and commercially available techniques.
When polynucleotides of the present invention are used for the recombinant production of polypeptides of the present invention, the polynucleotide may include the coding sequence for the mature polypeptide, by itself; or the coding sequence for the mature polypeptide in reading frame with other coding sequences, such as those encoding a leader or secretory sequence, a pre-, or pro- or prepro- protein sequence, or other fusion peptide portions. For example, a marker sequence which facilitates purification of the fused polypeptide can be encoded. In certain preferred embodiments of this aspect of the invention, the marker sequence is a hexa-histidine peptide, as provided in the pQE vector (Qiagen, Inc.) and described in Gentz et al, Proc Natl Acad Sci USA (1989) 86:821-824, or is an HA tag. The polynucleotide may also contain non-coding 5' and 3' sequences, such as transcribed, non- translated sequences, splicing and polyadenylation signals, ribosome binding sites and sequences that stabilize mRNA.
Polynucleotides which are identical or sufficiently identical to a nucleotide sequence contained in SEQ ID NOs: 1 - 6, may be used as hybridization probes for cDNA and genomic DNA or as primers for a nucleic acid amplification (PCR) reaction, to isolate full- length cDNAs and genomic clones encoding polypeptides of the present invention and to isolate cDNA and genomic clones of other genes (including genes encoding paralogs from human sources and orthologs and paralogs from species other than human) that have a high sequence similarity to SEQ ID NO: 1 - 6. Typically these nucleotide sequences are 70% identical, preferably 80%) identical, more preferably 90% identical, most preferably 95% identical to that of the referent. The probes or primers will generally comprise at least 15 nucleotides, preferably, at least 30 nucleotides and may have at least 50 nucleotides. Particularly preferred probes will have between 30 and 50 nucleotides. Particularly preferred primers will have between 20 and 25 nucleotides. In particular, polypeptides or polynucleotides derived from sequences from homologous animal origin could be used as immunogens to obtain a cross-reactive immune response to the human gene.
A polynucleotide encoding a polypeptide of the present invention, including homologs from species other than human, may be obtained by a process which comprises the steps of screening an appropriate library under stringent hybridization conditions with a labeled probe having the sequence of SEQ ID NOs: 1 - 6 or a fragment thereof; and isolating full- length cDNA and genomic clones containing said polynucleotide sequence. Such hybridization techniques are well known to the skilled artisan. Preferred stringent hybridization conditions include overnight incubation at 42°C in a solution comprising: 50% formamide, 5xSSC (150mM NaCl, 15mM trisodium citrate), 50 mM sodium phosphate (pH7.6), 5x Denhardt's solution, 10 % dextran sulfate, and 20 microgram/ml denatured, sheared salmon sperm DNA; followed by washing the filters in OJx SSC at about 65°C. Thus the present invention also includes polynucleotides obtainable by screening an appropriate library under stingent hybridization conditions with a labeled probe having the sequence of SEQ ID NOs: 1 - 6 or a fragment thereof.
The skilled artisan will appreciate that, in many cases, an isolated cDNA sequence will be incomplete, in that the region coding for the polypeptide is short at the 5' end of the cDNA.
There are several methods available and well known to those skilled in the art to obtain full-length cDNAs, or extend short cDN As, for example those based on the method of Rapid Amplification of cDNA ends (RACE) (see, for example, Frohman et al., PNAS USA 85, 8998-9002, 1988). Recent modifications of the technique, exemplified by the Marathon™ technology (Clontech Laboratories Inc.) for example, have significantly simplified the search for longer cDNAs. In the Marathon™ technology, cDNAs have been prepared from mRNA extracted from a chosen tissue and an 'adaptor' sequence ligated onto each end. Nucleic acid amplification (PCR) is then carried out to amplify the 'missing' 5' end of the cDNA using a combination of gene specific and adaptor specific oligonucleotide primers. The PCR reaction is then repeated using 'nested' primers, that is, primers designed to anneal within the amplified product (typically an adaptor specific primer that anneals further 3' in the adaptor sequence and a gene specific primer that anneals further 5' in the known gene sequence). The products of this reaction can then be analysed by DNA sequencing and a full-length cDNA constructed either by joining the product directly to the existing cDNA to give a complete sequence, or carrying out a separate full-length PCR using the new sequence information for the design of the 5' primer.
Polypeptides
In a further aspect, the present invention relates to CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptides.
Further peptides of the present invention include isolated polypeptides encoded by a polynucleotide comprising the sequence contained in one of SEQ ID NOSJ - 6. The invention also provides an immunogenic fragment of a CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptide, that is a contiguous portion of the CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptide which has the same or similar immunogenic properties to the polypeptide encoded by a polynucleotide comprising the sequence contained in one of SEQ ID NOSJ - 6. That is to say, the fragment (if necessary when coupled to a carrier) is capable of raising an immune response which recognises the CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptide. Such an immunogenic fragment may include, for example, the CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptide lacking an N-terminal leader sequence, a transmembrane domain or a C-terminal anchor domain.
The polypeptides or immunogenic fragment of the invention may be in the form of the "mature" protein or may be a part of a larger protein such as a precursor or a fusion protein. It is often advantageous to include an additional amino acid sequence which contains secretory or leader sequences, pro-sequences, sequences which aid in purification such as multiple histidine residues, or an additional sequence for stability during recombinant production. Furthermore, addition of exogenous polypeptide or lipid tail or polynucleotide sequences to increase the immunogenic potential of the final molecule is also considered.
In one aspect, the invention relates to genetically engineered soluble fusion proteins comprising a polypeptide of the present invention, or a fragment thereof, and various portions of the constant regions of heavy or light chains of immunoglobulins of various subclasses (IgG, IgM, IgA, IgE). Preferred as an immunoglobulin is the constant part of the heavy chain of human IgG, particularly IgGl, where fusion takes place at the hinge region. In a particular embodiment, the Fc part can be removed simply by incorporation of a cleavage sequence which can be cleaved with blood clotting factor Xa. Furthermore, this invention relates to processes for the preparation of these fusion proteins by genetic engineering, and to the use thereof for drug screening, diagnosis and therapy. A further aspect of the invention also relates to polynucleotides encoding such fusion proteins. Examples of fusion protein technology can be found in International Patent Application Nos. WO94/29458 and WO94/22914. The proteins may be chemically conjugated, or expressed as recombinant fusion proteins allowing increased levels to be produced in an expression system as compared to non- fused protein. The fusion partner may assist in providing T helper epitopes (immunological fusion partner), preferably T helper epitopes recognised by humans, or assist in expressing the protein (expression enhancer) at higher yields than the native recombinant protein. Preferably the fusion partner will be both an immunological fusion partner and expression enhancing partner.
Fusion partners include protein D from Haemophilus influenza B and the non-structural protein from influenzae virus, NS1 (hemagglutinin). Another immunological fusion partner is the protein known as LYTA. Preferably the C terminal portion of the molecule is used. Lyta is derived from Streptococcus pneumoniae which synthesize an N-acetyl-L- alanine amidase, amidase LYTA, (coded by the lytA gene {Gene, 43 (1986) page 265- 272} an autolysin that specifically degrades certain bonds in the peptidoglycan backbone. The C-terminal domain of the LYTA protein is responsible for the affinity to the choline or to some choline analogues such as DEAE. This property has been exploited for the development of E.coli C-LYTA expressing plasmids useful for expression of fusion proteins. Purification of hybrid proteins containing the C-LYTA fragment at its amino terminus has been described {Biotechnology: 10, (1992) page 795-798}. It is possible to use the repeat portion of the Lyta molecule found in the C terminal end starting at residue 178, for example residues 188 - 305.
The present invention also includes variants of the aforementioned polypeptides, that is polypeptides that vary from the referents by conservative amino acid substitutions, whereby a residue is substituted by another with like characteristics. Typical such substitutions are among Ala, Val, Leu and He; among Ser and Thr; among the acidic residues Asp and Glu; among Asn and Gin; and among the basic residues Lys and Arg; or aromatic residues Phe and Tyr. Particularly preferred are variants in which several, 5-10, 1-5, 1-3, 1-2 or 1 amino acids are substituted, deleted, or added in any combination.
Polypeptides of the present invention can be prepared in any suitable manner. Such polypeptides include isolated naturally occurring polypeptides, recombinantly produced polypeptides, synthetically produced polypeptides, or polypeptides produced by a combination of these methods. Means for preparing such polypeptides are well understood in the art.
Vectors, Host cells, Expression Systems
Recombinant polypeptides of the present invention may be prepared by processes well known in the art from genetically engineered host cells comprising expression systems. Accordingly, in a further aspect, the present invention relates to an expression system which comprises a polynucleotide of the present invention, to host cells which are genetically engineered with such expression sytems and to the production of polypeptides of the invention by recombinant techniques. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.
For recombinant production, host cells can be genetically engineered to incorporate expression systems or portions thereof for polynucleotides of the present invention. Introduction of polynucleotides into host cells can be effected by methods described in many standard laboratory manuals, such as Davis et al. , Basic Methods in Molecular Biology (1986) and Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). Preferred such methods include, for instance, calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction or infection.
Preferably the proteins of the invention are coexpressed with thioredoxin in trans (TIT). Coexpression of thioredoxin in trans versus in cis is preferred to keep antigen free of thioredoxin without the need for protease. Thioredoxin coexpression eases the solubilisation of the proteins of the invention. Thioredoxin coexpression has also a significant impact on protein purification yield, on purified-protein solubility and quality.
Representative examples of appropriate hosts include bacterial cells, such as Streptococci, Staphylococci, E. coli, Streptomyces and Bacillus subtilis cells; fungal cells, such as yeast cells and Aspergillus cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, HEK 293 and Bowes melanoma cells; and plant cells.
A great variety of expression systems can be used, for instance, chromosomal, episomal and virus-derived systems, e.g., vectors derived from bacterial plasmids, from bacteriophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retro viruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids. The expression systems may contain control regions that regulate as well as engender expression. Generally, any system or vector which is able to maintain, propagate or express a polynucleotide to produce a polypeptide in a host may be used. The appropriate nucleotide sequence may be inserted into an expression system by any of a variety of well-known and routine techniques, such as, for example, those set forth in Sambrook et al., Molecular Cloning, A Laboratory Manual (supra). Appropriate secretion signals may be incorporated into the desired polypeptide to allow secretion of the translated protein into the lumen of the endoplasmic reticulum, the periplasmic space or the extracellular environment. These signals may be endogenous to the polypeptide or they may be heterologous signals.
The expression system may also be a recombinant live microorganism, such as a virus or bacterium. The gene of interest can be inserted into the genome of a live recombinant virus or bacterium. Inoculation and in vivo infection with this live vector will lead to in vivo expression of the antigen and induction of immune responses. Viruses and bacteria used for this purpose are for instance: poxviruses (e.g; vaccinia, fowlpox, canarypox), alphaviruses (Sindbis virus, Semliki Forest Virus, Venezuelian Equine Encephalitis Virus), adenoviruses, adeno-associated virus, picornaviruses (poliovirus, rhinovirus), herpesviruses (varicella zoster virus, etc), Listeria, Salmonella , Shigella, BCG. These viruses and bacteria can be virulent, or attenuated in various ways in order to obtain live vaccines. Such live vaccines also form part of the invention. Polypeptides of the present invention can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, ion metal affinity chromatography (IMAC) is employed for purification. Well known techniques for refolding proteins may be employed to regenerate active conformation when the polypeptide is denatured during intracellular synthesis, isolation and or purification.
Vaccines
Another aspect of the invention relates to a method for inducing , re-inforcing or modulating an immunological response in a mammal which comprises inoculating the mammal with a fragment or the entire polypeptide or polynucleotide of the invention, adequate to produce antibody and/or T cell immune response for prophylaxis or for therapeutic treatment of cancer and autoimmune disease and related conditions. Yet another aspect of the invention relates to a method of inducing, re-inforcing or modulating immunological response in a mammal which comprises, delivering a polypeptide of the present invention via a vector or cell directing expression of the polynucleotide and coding for the polypeptide in vivo in order to induce such an immunological response to produce immune responses for prophylaxis or treatment of said mammal from diseases.
A further aspect of the invention relates to an immunological/vaccine formulation (composition) which, when introduced into a mammalian host, induces, re-inforces or modulates an immunological response in that mammal to a polypeptide of the present invention wherein the composition comprises a polypeptide or polynucleotide of the invention or an immunological fragment thereof as herein before defined.The vaccine formulation may further comprise a suitable carrier. Since a polypeptide may be broken down in the stomach, it is preferably administered parenterally (for instance, subcutaneous, intramuscular, intravenous, or intradermal injection). Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents or thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampoules and vials and may be stored in a freeze-dried condition requiring only the addition of the sterile liquid carrier immediately prior to use.
A further aspect of the invention relates to the in vitro induction of immune responses to a fragment or the entire polypeptide or polynucleotide of the present invention or a molecule comprising the polypeptide or polynucleotide of the present invention, using cells from the immune system of a mammal, and reinfusing these activated immune cells of the mammal for the treatment of disease. Activation of the cells from the immune system is achieved by in vitro incubation with the entire polypeptide or polynucleotide of the present invention or a molecule comprising the polypeptide or polynucleotide of the present invention in the presence or absence of various immunomodulator molecules. A further aspect of the invention relates to the immunization of a mammal by administration of antigen presenting cells modified by in vitro loading with part or the entire polypeptide of the present invention or a molecule comprising the polypeptide of the present invention and administered in vivo in an immunogenic way. Alternatively, antigen presenting cells can be transfected in vitro with a vector containing a fragment or the entire polynucleotide of the present invention or a molecule comprising the polynucleotide of the present invention, such as to express the corresponding polypeptide, and administered in vivo in an immunogenic way.
The vaccine formulation of the invention may also include adjuvant systems for enhancing the immunogenicity of the formulation. Preferably the adjuvant system raises preferentially a TH1 type of response.
An immune response may be broadly distinguished into two extreme catagories, being a humoral or cell mediated immune responses (traditionally characterised by antibody and cellular effector mechanisms of protection respectively). These categories of response have been termed THl-type responses (cell-mediated response), and TH2-type immune responses (humoral response). Extreme THl-type immune responses may be characterised by the generation of antigen specific, haplotype restricted cytotoxic T lymphocytes, and natural killer cell responses. In mice THl-type responses are often characterised by the generation of antibodies of the IgG2a subtype, whilst in the human these correspond to IgGl type antibodies. TH2-type immune responses are characterised by the generation of a broad range of immunoglobulin isotypes including in mice IgGl, IgA, and IgM.
It can be considered that the driving force behind the development of these two types of immune responses are cytokines. High levels of THl-type cytokines tend to favour the induction of cell mediated immune responses to the given antigen, whilst high levels of TH2-type cytokines tend to favour the induction of humoral immune responses to the antigen.
The distinction of TH1 and TH2-type immune responses is not absolute. In reality an individual will support an immune response which is described as being predominantly TH1 or predominantly TH2. However, it is often convenient to consider the families of cytokines in terms of that described in murine CD4 +ve T cell clones by Mosmann and Coffman (Mosmann, T.R. and Coff an, R.L. (1989) TH1 and TH2 cells: different patterns oflymphokine secretion lead to different functional properties. Annual Review of Immunology, 7, pl45-173). Traditionally, THl-type responses are associated with the production of the INF-γ and IL-2 cytokines by T-lymphocytes. Other cytokines often directly associated with the induction of THl-type immune responses are not produced by T-cells, such as IL-12. In contrast, TH2- type responses are associated with the secretion of IL-4, IL-5, IL-6 and IL-13.
It is known that certain vaccine adjuvants are particularly suited to the stimulation of either TH1 or TH2 - type cytokine responses. Traditionally the best indicators of the TH1 :TH2 balance of the immune response after a vaccination or infection includes direct measurement of the production of TH1 or TH2 cytokines by T lymphocytes in vitro after restimulation with antigen, and/or the measurement of the IgGl :IgG2a ratio of antigen specific antibody responses. Thus, a THl-type adjuvant is one which preferentially stimulates isolated T-cell populations to produce high levels of THl-type cytokines when re-stimulated with antigen in vitro, and promotes development of both CD8+ cytotoxic T lymphocytes and antigen specific immunoglobulin responses associated with THl-type isotype.
Adjuvants which are capable of preferential stimulation of the TH1 cell response are described in International Patent Application No. WO 94/00153 and WO 95/17209.
3 De-O-acylated monophosphoryl lipid A (3D-MPL) is one such adjuvant. This is known from GB 2220211 (Ribi). Chemically it is a mixture of 3 De-O-acylated monophosphoryl lipid A with 4, 5 or 6 acylated chains and is manufactured by Ribi Immunochem, Montana. A preferred form of 3 De-O-acylated monophosphoryl lipid A is disclosed in European Patent 0 689 454 Bl (SmithKline Beecham Biologicals SA).
Preferably, the particles of 3D-MPL are small enough to be sterile filtered through a 0J2micron membrane (European Patent number 0 689 454). 3D-MPL will be present in the range of lOμg - lOOμg preferably 25-50μg per dose wherein the antigen will typically be present in a range 2-50μg per dose.
Another preferred adjuvant comprises QS21 , an Hplc purified non-toxic fraction derived from the bark of Quillaja Saponaria Molina. Optionally this may be admixed with 3 De- O-acylated monophosphoryl lipid A (3D-MPL), optionally together with an carrier.
The method of production of QS21 is disclosed in US patent No. 5,057,540.
Non-reactogenic adjuvant formulations containing QS21 have been described previously (WO 96/33739). Such formulations comprising QS21 and cholesterol have been shown to be successful TH1 stimulating adjuvants when formulated together with an antigen.
Further adjuvants which are preferential stimulators of TH1 cell response include immunomodulatory oligonucleotides, for example unmethylated CpG sequences as disclosed in WO 96/02555. Combinations of different TH1 stimulating adjuvants, such as those mentioned hereinabove, are also contemplated as providing an adjuvant which is a preferential stimulator of TH1 cell response. For example, QS21 can be formulated together with 3D- MPL. The ratio of QS21 : 3D-MPL will typically be in the order of 1 : 10 to 10 : 1; preferably 1 :5 to 5 : 1 and often substantially 1 : 1. The preferred range for optimal synergy is 2.5 : 1 to 1 : 1 3D-MPL: QS21.
Preferably a carrier is also present in the vaccine composition according to the invention. The carrier may be an oil in water emulsion, or an aluminium salt, such as aluminium phosphate or aluminium hydroxide.
A preferred oil-in-water emulsion comprises a metabolisible oil, such as squalene, alpha tocopherol and Tween 80. In a particularly preferred aspect the antigens in the vaccine composition according to the invention are combined with QS21 and 3D-MPL in such an emulsion. Additionally the oil in water emulsion may contain span 85 and/or lecithin and/or tricaprylin.
Typically for human administration QS21 and 3D-MPL will be present in a vaccine in the range of lμg - 200μg, such as 10-100μg, preferably lOμg - 50μg per dose. Typically the oil in water will comprise from 2 to 10% squalene, from 2 to 10% alpha tocopherol and from 0J to 3% tween 80. Preferably the ratio of squalene: alpha tocopherol is equal to or less than 1 as this provides a more stable emulsion. Span 85 may also be present at a level of 1%. In some cases it may be advantageous that the vaccines of the present invention will further contain a stabiliser.
Non-toxic oil in water emulsions preferably contain a non-toxic oil, e.g. squalane or squalene, an emulsifier, e.g. Tween 80, in an aqueous carrier. The aqueous carrier may be, for example, phosphate buffered saline.
A particularly potent adjuvant formulation involving QS21, 3D-MPL and tocopherol in an oil in water emulsion is described in WO 95/17210. The present invention also provides a polyvalent vaccine composition comprising a vaccine formulation of the invention in combination with other antigens, in particular antigens useful for treating cancers, autoimmune diseases and related conditions. Such a polyvalent vaccine composition may include a TH-1 inducing adjuvant as hereinbefore described.
Diagnostic Assays, disease monitoring, chromosomal localisation, and gene amplification
An important aspect of the invention, in addition to the polynucleotides themselves, also relates to the use of the polynucleotides of the present invention and oligonucleotides derived from them, as diagnostic and monitoring reagents. Oligonucleotide fragments derived from the polynucleotides of the invention for use as probes or primers generally comprise at least 15 bases. Particularly preferred probes will have between 30 and 50 nucleotides. Particularly preferred primers will have between 20 and 25 nucleotides.
The identification of genetic or biochemical markers in blood, other biological fluids, faeces, or tissues that will enable the detection of very early changes along the carcinogenesis pathway will help in determining the best treatment for the patient and the efficacy of the treatment. Surrogate tumour markers, such as polynucleotide expression, can be used to diagnose different forms and states of cancer. The identification of expression levels of the polynucleotides of the invention will be useful in both the staging of the cancerous disorder and grading the nature of the cancerous tissue. The staging process monitors the advancement of the cancer and is determined on the presence or absence of malignant tissue in the areas biopsied. The polynucleotides of the invention can help to perfect the staging process by identifying markers for the aggresivity of a cancer, for example the presence in different areas of the body. The grading of the cancer describes how closely a tumour resembles normal tissue of its same type and is assessed by its cell morphology and other markers of differentiation. The polynucleotides of the invention can be useful in determining the tumour grade as they can help in the determination of the differentiation status of the cells of a tumour.
On the other hand, the polypeptide of the invention can be produced by stroma cells, in which cases, its specific expression or differential expression is a marker of disease conditions. Differential expression
The diagnostic assays offer a process for diagnosing or determining a susceptibility to cancers, autoimmune disease and related conditions through diagnosis by methods comprising determining from a sample derived from a subject an abnormally decreased or increased level of polypeptide or mRNA. This method of diagnosis is known as differential expression. The expression of a particular gene is compared between a diseased tissue and a normal tissue. A difference between the polynucleotide-related gene, mRNA, or protein in the two tissues is compared, for example in molecular weight, amino acid or nucleotide sequence, or relative abundance, indicates a change in the gene, or a gene which regulates it, in the tissue of the human that was suspected of being diseased.
Decreased or increased expression can be measured at the RNA level. PolyA RNA is first isolated from the two tissues and the detection of mRNA encoded by a gene corresponding to a differentially expressed polynucleotide of the invention can be detected by, for example, in situ hybridization in tissue sections, reverse transcriptase-PCR, using Northern blots containing poly A+ mRNA, or any other direct or indierect RNA detection method. An increased or decreased expression of a given RNA in a diseased tissue or surrounding tissues compared to a normal tissue or in the absence of disease suggests that the transcript and/or the expressed protein has a role in the disease. Thus detection of a higher or lower level of mRNA corresponding to SEQ ID NOS 1-6 relative to normal level is indicative of the presence of cancer in the patient.
mRNA expression levels in a sample can be determined by generation of a library of expressed sequence tags (ESTs) from the sample. The relative representation of ESTs in the library can be used to assess the relative representation of the gene transcript in the starting sample. The EST analysis of the test can then be compared to the EST analysis of a reference sample to determine the relative expression levels of the polynucleotide of interest.
Other mRNA analyses can be carried out using serial analysis of gene expression (SAGE) methodology (Velculescu et. Al. Science (1995) 270:484) , differential display methodology (For example, US 5,776,683) or hybridization analysis which relies on the specificity of nucleotide interactions. Alternatively, where the polynucleotide sequence encodes a polypeptide, the comparison could be made at the protein level. The protein sizes in the two tissues may be compared using antibodies to detect polypeptides in Western blots of protein extracts from the two tissues. Expression levels and subcellular localization may also be detected immunologically using antibodies to the corresponding protein. Further assay techniques that can be used to determine levels of a protein, such as a polypeptide of the present invention, in a sample derived from a host are well-known to those of skill in the art. A raised or decreased level of polypeptide expression in the diseased tissue compared with the same protein expression level in the normal tissue indicates that the expressed protein may be involved in the disease.
In the assays of the present invention, the diagnosis can be determined by detection of gene product expression levels encoded by at least one sequence set forth in SEQ ID NOS: 1 - 6. A comparison of the mRNA or protein levels in a diseased versus normal tissue may also be used to follow the progression or remission of a disease.
Use of arrays for diagnosis
A large number of polynucleotide sequences in a sample can be assayed using polynucleotide arrays. These can be used to examine differential expression of genes and to determine gene function. For example, arrays of the polynucleotide sequences SEQ ID NOS 1 - 6 can be used to determine if any of the polynucleotides are differentially expressed between a normal and cancer cell. In one embodiment of the invention, an array of oligonucleotides probes comprising SEQ ID NOS 1 - 6 nucleotide sequence or fragments thereof can be constructed to conduct efficient screening of e.g., genetic mutations. Array technology methods are well known and have general applicability and can be used to address a variety of questions in molecular genetics including gene expression, genetic linkage, and genetic variability (see for example: M.Chee et al, Science, Vol 274, pp 610- 613 (1996)).
"Diagnosis" as used herein includes determination of a subject's susceptibility to a disease, determination as to whether a subject presently has the disease, and also the prognosis of a subject affected by the disease. The present invention, further relates to a diagnostic kit for performing a diagnostic assay which comprises:
(a) a polynucleotide of the present invention, preferably the nucleotide sequence of any one of SEQ ID NOs: 1 - 6, or a fragment thereof ;
(b) a nucleotide sequence complementary to that of (a);
(c) a polypeptide of the present invention, preferably the polypeptide encoded by a polynucleotide comprising the sequence contained in any one of SEQ ID Nos 1 - 6 or a fragment thereof; or (d) an antibody to a polypeptide of the present invention, preferably to the polypeptide encoded by a polynucleotide comprising the sequence contained in any one of SEQ ID Nos
1 - 6.
(e) any specific ligand to a polypeptide of the present invention
The nucleotide sequences of the present invention are also valuable for chromosomal localisation. The sequence is specifically targeted to, and can hybridize with, a particular location on an individual human chromosome. The mapping of relevant sequences to chromosomes according to the present invention is an important first step in correlating those sequences with gene associated disease. Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found in, for example, V. McKusick, Mendelian Inheritance in Man (available on-line through Johns Hopkins University Welch Medical Library). The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes).The differences in the cDNA or genomic sequence between affected and unaffected individuals can also be determined. In addition, gene amplification at the genomic level could be assessed and correlated with the stage of disease.
Antibodies
The polypeptides of the invention or their fragments or analogs thereof, or cells expressing them, can also be used as immunogens to produce antibodies immunospecific for polypeptides of the present invention. The term "immunospecific" means that the antibodies have substantially greater affinity for the polypeptides of the invention than their affinity for other related polypeptides in the prior art.
In a further aspect the invention provides an antibody immunospecific for a polypeptide according to the invention or an immunological fragment thereof as hereinbefore defined. Preferably the antibody is a monoclonal antibody.
Antibodies generated against polypeptides of the present invention may be obtained by administering the polypeptides or epitope-bearing fragments, analogs or cells to an animal, preferably a non-human animal, using routine protocols. For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler, G. and Milstein, C, Nature (1975) 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al, Immunology Today (1983) 4:72) and the EBV-hybridoma technique (Cole et al. , Monoclonal Antibodies and Cancer Therapy, 77-96, Alan R. Liss, Inc., 1985).
Techniques for the production of single chain antibodies, such as those described in U.S. Patent No. 4,946,778, can also be adapted to produce single chain antibodies to polypeptides of this invention. Also, transgenic mice, or other organisms, including other mammals, may be used to express humanized antibodies.
The above-described antibodies may be employed to isolate or to identify clones expressing the polypeptide or to purify the polypeptides by affinity chromatography. The antibody of the invention may also be employed to prevent or treat cancer, particularly colon cancer, autoimmune disease and related conditions.
Another aspect of the invention relates to a method for inducing or modulating an immunological response in a mammal which comprises inoculating the mammal with a polypeptide of the present invention, adequate to produce antibody and/or T cell immune response to protect or ameliorate the symptoms or progression of the disease. Yet another aspect of the invention relates to a method of inducing or modulating immunological response in a mammal which comprises, delivering a polypeptide of the present invention via a vector directing expression of the polynucleotide and coding for the polypeptide in vivo in order to induce such an immunological response to produce antibody to protect said animal from diseases.
It will be appreciated that the present invention therefore provides a method of diagnosing and/or treating abnormal conditions such as, for instance, cancer and autoimmune diseases, in particular, colon cancer, related to either a presence of, an excess of, or an under- expression of, any one of CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507.
Screening
The present invention further provides for a method of screening compounds to identify those which stimulate or which inhibit the function of any one of the CASB611, CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptides. In general, agonists or antagonists may be employed for therapeutic and prophylactic purposes for such diseases as hereinbefore mentioned. Compounds may be identified from a variety of sources, for example, cells, cell-free preparations, chemical libraries, and natural product mixtures. Such agonists, antagonists or inhibitors so-identified may be natural or modified substrates, ligands, receptors, enzymes, etc., as the case may be, of the polypeptide; or may be structural or functional mimetics thereof (see Coligan et al. , Current Protocols in Immunology l(2):Chapter 5 (1991)). Screening methods will be known to those skilled in the art. Further screening methods may be found in for example D. Bennett et al., J Mol Recognition, 8:52-58 (1995); and K. Johanson et al, J Biol Chem, 270(16):9459-9471 (1995) and references therein.
Thus the invention provides a method for screening to identify compounds which stimulate or which inhibit the function of the polypeptide of the invention which comprises a method selected from the group consisting of:
(a) measuring the binding of a candidate compound to the polypeptide (or to the cells or membranes bearing the polypeptide) or a fusion protein thereof by means of a label directly or indirectly associated with the candidate compound; (b) measuring the binding of a candidate compound to the polypeptide (or to the cells or membranes bearing the polypeptide) or a fusion protein thereof in the presense of a labeled competitior;
(c) testing whether the candidate compound results in a signal generated by activation or inhibition of the polypeptide, using detection systems appropriate to the cells or cell membranes bearing the polypeptide;
(d) mixing a candidate compound with a solution containing a polypeptide of claim 1 , to form a mixture, measuring activity of the polypeptide in the mixture, and comparing the activity of the mixture to a standard; or (e) detecting the effect of a candidate compound on the production of mRNA encoding said polypeptide and said polypeptide in cells, using for instance, an ELISA assay.
The polypeptide of the invention may be used to identify membrane bound or soluble receptors, if any, through standard receptor binding techniques known in the art. Well known screening methods may also be used to identify agonists and antagonists of the polypeptide of the invention which compete with the binding of the polypeptide of the invention to its receptors, if any.
Thus, in another aspect, the present invention relates to a screening kit for identifying agonists, antagonists, ligands, receptors, substrates, enzymes, etc. for polypeptides of the present invention; or compounds which decrease or enhance the production of such polypeptides, which comprises: (a) a polypeptide of the present invention; (b) a recombinant cell expressing a polypeptide of the present invention;
(c) a cell membrane expressing a polypeptide of the present invention; or
(d) antibody to a polypeptide of the present invention; which polypeptide is preferably that encoded by a polynucleotide comprising the sequence contained in any one of SEQ ID NOsJ - 6.
It will be readily appreciated by the skilled artisan that a polypeptide of the present invention may also be used in a method for the structure-based design of an agonist, antagonist or inhibitor of the polypeptide, by: (a) determining in the first instance the three-dimensional structure of the polypeptide;
(b) deducing the three-dimensional structure for the likely reactive or binding site(s) of an agonist, antagonist or inhibitor;
(c) synthesing candidate compounds that are predicted to bind to or react with the deduced binding or reactive site; and
(d) testing whether the candidate compounds are indeed agonists, antagonists or inhibitors.
Gene therapy may also be employed to effect the endogenous production of CASB611 , CASB500, CASB501, CASB502, CASB505, or CASB507 polypeptides by the relevant cells in the subject. For an overview of gene therapy, see Chapter 20, Gene Therapy and other Molecular Genetic-based Therapeutic Approaches, (and references cited therein) in Human Molecular Genetics, T Strachan and A P Read, BIOS Scientific Publishers Ltd (1996).
Compositions and administration
Vaccine preparation is generally described in Pharmaceutical Biotechnology, Vol.61 Vaccine Design - the subunit and adjuvant approach, edited by Powell and Newman, Plenum Press, 1995. New Trends and Developments in Vaccines, edited by Voller et al., University Park Press, Baltimore, Maryland, U.S.A. 1978. Encapsulation within liposomes is described, for example, by Fullerton, U.S. Patent 4,235,877. Conjugation of proteins to macromolecules is disclosed, for example, by Likhite, U.S. Patent 4,372,945 and by Armor et al., U.S. Patent 4,474,757.
The amount of protein in each vaccine dose is selected as an amount which induces an immunoprotective response without significant, adverse side effects in typical vaccinees. Such amount will vary depending upon which specific immunogen is employed. Generally, it is expected that each dose will comprise l-1000μg of protein, preferably 2-100μg, most preferably 4-40μg. An optimal amount for a particular vaccine can be ascertained by standard studies involving observation of antibody titres and other responses in subjects. Following an initial vaccination, subjects may receive a boost in about 4 weeks. Definitions
"Isolated" means altered "by the hand of man" from the natural state. If an "isolated" composition or substance occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or a polypeptide naturally present in a living animal is not "isolated," but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated", as the term is employed herein.
"Polynucleotide" generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA including single and double stranded regions.
"Variant" refers to a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide, but retains essential properties. A typical variant of a polynucleotide differs in nucleotide sequence from another, reference polynucleotide. Changes in the nucleotide sequence of the variant may or may not alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Nucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below. A typical variant of a polypeptide differs in amino acid sequence from another, reference polypeptide.
Generally, differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical. A variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions in any combination. A substituted or inserted amino acid residue may or may not be one encoded by the genetic code. A variant of a polynucleotide or polypeptide may be a naturally occurring such as an allelic variant, or it may be a variant that is not known to occur naturally. Non-naturally occurring variants of polynucleotides and polypeptides may be made by mutagenesis techniques or by direct synthesis.
"Identity ' as known in the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences. "Identity" and "similarity" can be readily calculated by known methods, including but not limited to those described in (Computational Molecular Biology, Lesk, A.M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D.W., ed., Academic Press, New York. 1993; Computer Analysis of Sequence Data, Part I, Griffin, A.M., and Griffin, H.G.. eds.,
Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje. G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux. J., eds., M Stockton Press, New York, 1991; and Carillo, H., and Lipman, D., SIAM J. Applied Math, 48: 1073 (1988). Preferred methods to determine identity are designed to give the largest match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, the GCG program package (Devereux, J., et al., Nucleic Acids Research 12(1): 387 (1984)), BLASTP, BLASTN, and FASTA (Atschul, S.F. et al., J. Molec. Biol. 215: 403-410 (1990). The BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al, NCBI NLM NIH Bethesda. MD 20894; Altschul, S., et al, J. Mol. Biol. 215: 403-410 (1990). The well known Smith Waterman algorithm may also be used to determine identity.
The preferred algorithm used is FASTA. The preferred parameters for polypeptide or polynuleotide sequence comparison using this algorithm include the following:
Gap Penalty: 12
Gap extension penalty: 4
Word size: 2, max 6
Preferred parameters for polypeptide sequence comparison with other methods include the following:
1) Algorithm: Needleman and Wunsch, J. Mol Biol. 48: 443-453 (1970)
Comparison matrix: BLOSSUM62 from Hentikoff and Hentikoff, Proc. Natl. Acad. Sci. USA. 89:10915-10919 (1992)
Gap Penalty: 12
Gap Length Penalty: 4 A program useful with these parameters is publicly available as the "gap" program from Genetics Computer Group, Madison WI. The aforementioned parameters are the default parameters for polypeptide comparisons (along with no penalty for end gaps).
Preferred parameters for polynucleotide comparison include the following: 1) Algorithm: Needleman and Wunsch, J. Mol Biol. 48: 443-453 (1970) Comparison matrix: matches = +10, mismatch = 0 Gap Penalty: 50 Gap Length Penalty: 3
A program useful with these parameters is publicly available as the "gap" program from Genetics Computer Group, Madison WI. The aforementioned parameters are the default parameters for polynucleotide comparisons.
By way of example, a polynucleotide sequence of the present invention may be identical to the reference sequence of SEQ ID NO:l, that is be 100% identical, or it may include up to a certain integer number of nucleotide alterations as compared to the reference sequence. Such alterations are selected from the group consisting of at least one nucleotide deletion, substitution, including transition and transversion, or insertion, and wherein said alterations may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among the nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence. The number of nucleotide alterations is determined by multiplying the total number of nucleotides in SEQ ID NO:l by the numerical percent of the respective percent identity(divided by 100) and subtracting that product from said total number of nucleotides in SEQ ID NO:l, or: nn < xn - (xn • y), wherein nn is the number of nucleotide alterations, xn is the total number of nucleotides in SEQ ID NO:l, and y is, for instance, 0.70 for 70%, 0.80 for 80%, 0.85 for 85%, 0.90 for 90%, 0.95 for 95%,etc, and wherein any non-integer product of xn and y is rounded down to the nearest integer prior to subtracting it from xn. Alterations of a polynucleotide sequence encoding the polypeptide of SEQ ID NO:2 may create nonsense, missense or frameshift mutations in this coding sequence and thereby alter the polypeptide encoded by the polynucleotide following such alterations.
"Homolog" is a generic term used in the art to indicate a polynucleotide or polypeptide sequence possessing a high degree of sequence relatedness to a subject sequence. Such relatedness may be quntified by determining the degree of identity and/or similarity between the sequences being compared as hereinbefore described. Falling within this generic term are the terms "ortholog", meaning a polynucleotide or polypeptide that is the functional equivalent of a polynucleotide or polypeptide in another species and "paralog" meaning a functionally similar sequence when considered within the same species.
EXAMPLES
Example 1
Subtractive cDNA cloning of colon tumour-associated antigen (TAA) candidates.
Subtractive cDNA libraries are produced using standard technologies. Briefly, total
RNA is extracted from frozen (-70°C) colon tumour and matched normal colon samples using the TriPure reagent and protocol (Boehringer). Target RNA is prepared by pooling total RNA from three tumour samples (30 μg each). Driver RNA is prepared by pooling total RNA from three matched normal colon samples (10 μg each) and total RNA from seven normal tissues other than colon(brain, heart, kidney, liver, bladder, skin, spleen; 10 μg each). Total RNA from non-colon normal tissues is purchased from InVitrogen.
Messenger RNA is purified from total RNA using oligo-dT magnetic bead technology (Dynal) and quantified by spectrofluorimetry (BioRad).
Target and driver mRNA are reverse transcribed into cDNA using one of two strategies: 1) Target sequences for PCR oligonucleotides are introduced onto the ends of the newly synthesised cDNA during reverse transcription using the template switching capability of reverse transcriptase (ClonTech SMART PCR cDNA synthesis kit). 2) Target and driver mRNA are reverse transcribed into cDNA using an oligo-dT primer and converted to double-strand cDNA; the cDNA is cleaved with Rsal and linkers for PCR amplification are ligated onto the extremities of the cDNA fragments.
In both cases, target and driver cDNA are amplified by long range PCR (ClonTech SMART PCR Synthesis Kit and Advantage PCR Polymerase Mix) and used as starting material for subtractive cloning. For amplification, cycling conditions and optimisation of the number of PCR cycles are as described in the Advantage PCR protocol.
Two subtractive cloning strategies are used: ClonTech PCR SELECT (see ClonTech kit protocol and N. Gurskaya et al. 1996. Analytical Biochemistry: 240, 90) and cRDA(M. Hubank and D. Schatz. 1994. Nucleic Acids Research: 22, 5640) . When the PCR SELECT protocol is used, the primary PCR SELECT subtraction products are submitted to a supplementary round of cRDA subtraction. When the cRDA protocol is used, two consecutive cycles of cRDA subtraction are performed.
In each case the products of both cycles of subtraction are cloned into pCR-TOPO (InVitrogen) and transformed into E. coli to produce a subtracted cDNA plasmid library.
An alternative strategy is also followed: subtraction of normal colon sequences and sequences from non-colon normal tissues are subtracted in separate hybridisations. In this case, target and driver RNA are assembled for the first subtraction as above with the exception that non-colon RNA is left out of the driver pool and amounts of normal colon are increased to 10 μg. Preparation of target and driver cDNA and subtractive hybridisation are performed as described above. A second subtraction is then performed on the products of the first subtraction, but the driver is now composed of a pool of normal colon and normal non- colon mRNA from the seven normal tissues.
Differential Screening of cDNA arrays.
Identification of tumour-associated genes in the subtracted cDNA library is accomplished by differential screening.
Total bacterial DNA is extracted from 100 μl over-night cultures. Bacteria are lysed with guanidium isothiocyantate and the bacterial DNA is affinity purified using magnetic glass (Boehringer). Plasmid inserts are recovered from the bacterial DNA by Advantage PCR amplification (Clontech). The PCR products are dotted onto two nylon membranes to produce high density cDNA arrays using the Biomek 96 HDRT tool (Beckman). The spotted cDNA is covalently linked to the membrane by UV irradiation. The first membrane is hybridised with a mixed cDNA probe prepared from the tumour of a single patient. The second membrane is hybridised with an equivalent amount of mixed cDNA probe prepared from normal colon of the same patient. The probe cDNA is prepared by PCR amplification as described above and is labelled using the AlkPhos Direct System (Amersham). Hybridisation conditions and stringency washes are as described in the AlkPhos Direct kit. Hybridised probe is detected by chemiluminescence. Hybridisation intensities for each cDNA fragment on both blots (see figure 1) are measured by film densitometry or direct measurement (BioRad Fluor-S Max). The ratio of the tumour to normal hybridisation intensities (T/N) is calculated for each gene to evaluate the degree of over-expression in the tumour. Genes which are significantly over-expressed in colon tumours are folio wed-up. Significance is arbitrarily defined as one standard deviation of the T/N frequency distribution. Differential screening experiments are repeated using RNA from multiple patient donors (> 18) to estimate the frequency of over-expressing tumours in the patient population.
In addition, the DNA arrays are hybridised with mixed cDNA probes from normal tissues other than colon (see list above) to determine the level of expression of the candidate gene in these tissues.
Example 2
Real-time RT-PCR analysis
Real-time RT-PCR (U. Gibson. 1996. Genome Research: 6,996) is used to compare mRNA transcript abundance of the candidate antigen in tumour and normal colon tissues from multiple patients. In addition, mRNA levels of the candidate gene are re-evaluated by this approach in a panel of normal tissues.
Total RNA is extracted from snap frozen colon tissue biopsies using TriPure reagent (Boehringer). Total RNA from normal tissues is from InVitrogen as above. Poly-A+ mRNA is purified from total RNA after DNAase treatment using oligo-dT magnetic beads (Dynal). Quantification of the mRNA is performed by spectrofluorimetry (BioRad) using Sybrll dye (Molecular Probes). Primers for amplification are designed with the Perkin-Elmer Primer Express software using default options for TaqMan amplification conditions.
Real-time reactions are assembled according to standard PCR protocols using 2 ng of purified mRNA for each reaction. Sybrl dye (Molecular Probes) is added at a final dilution of 1/75000 for real-time detection. Amplification (40 cycles) and real-time detection is performed in a PE 7700 system. Ct values are calculated using the 7700 Sequence Detector software for the tumour (CtT) and normal (CtN) samples of each patient. The difference between Ct values (CtN-CtT) is a direct measure of the difference in transcript levels between the tumour and normal tissues. As Ct values are log-linearly related to copy number and that the efficiency of PCR amplification under the prevailing experimental conditions is close to the theoretical amplification efficiency, 2 (CtN"CtT) js an estimate of the relative transcript levels in the two tissues (i.e. fold mRNA over- expression in tumor). The percentage of over-expressing patients and the average level of mRNA over-expression in the tumours of these patients is calculated from the data set of patients.
The values indicated in table 1 are "Colon range Ct" and "colon mean Ct", representing the range and mean of Ct values for colon sample pairs, to assess the global mRNA abundance, 40 corresponding to the maximum Ct and thus to an absence of amplification.
TABLE 1 : Expression of CASB genes in colon cancer and normal colon
Gene relevant colon range colon mean Ct name /tested Ct patients
CASB611 15 20-40 28.4
CASB500 18 17-26.5 22
CASB501 17 20.5-40 25.7
CASB502 18 31.4-37.3 25.6
CASB505 17 22.6-40 29
CASB507 9 29.5-40 33.8
TABLE 2:
In addition, Ct values for 12 normal tissues are reported. The tissues tested are bladder, brain, breast, cervix, heart, kidney, liver, lung, oesophagus, placenta and uterus. The range and mean of the Ct value is an indicator of the specificity of tissue expression. Thus, 2 types of sequences are described, classified into categories A and B. A sequence of category A has a colon-specific expression. A sequence of category B is overexpressed in colon cancer.
TABLE 3 : Expression of CASB genes in normal tissues
Gene name Normal NT NT class Comments
Tissues Range Ct mean Ct
CASB611 12 22-40 33 A High only in rectum
CASB500 12 19-26.5 22.5 B
CASB501 12 22.5-28.5 25.3 B
CASB502 12 21.5-28.5 23 B
CASB505 12 14-35 26.5 B High in lung
CASB507 12 33.5-38.5 35 B
NT range Ct and mean Ct: Ct values (range and mean) in normal tissues
Example 3
Identification of the full length cDNA sequence
Colon tumour cDNA libraries are constructed using the Lambda Zap system (Stratagene) from 2 μg of poly A+ mRNA as described in the supplied protocol. 1.5 x10° independent phage are plated for each screening of the library. Phage plaques are transferred onto nylon filters, hybridised using a cDNA probe labelled with AlkPhos Direct (Amersham Pharmacia) and positive phage are detected by chemiluminescence. The positive phage are excised from the agar plat, eluted in 500μl SM buffer and confirmed by gene-specific PCR. Eluted phage are converted to single strand Ml 3 bacteriophage by in vivo excision. The bacteriophage is then converted to double strand plasmid DNA by infection of E. coli. Infected bacteria are plated and submitted to a second round of screening with the cDNA probe. Plasmid DNA is purified from positive bacterial clones and submitted to Southern blot analysis to estimated the size of the cDNA inserts. CDNA inserts from multiple independent clones are sequenced on both strands.
When the full length gene cannot be obtained directly from the cDNA library, missing sequence is isolated using RACE technology (Marathon Kit, ClonTech.). This approach relies on reverse transcribing mRNA into double strand cDNA, ligating linkers onto the ends of the cDNA and amplifying the desired extremity of the cDNA using a gene-specific primer and one of the linker oligonucleotides. Marathon PCR products are cloned into a plasmid and sequenced.
All publications, including but not limited to patents and patent applications, cited in this specification are herein incorporated by reference as if each individual publication were specifically and individually indicated to be incorporated by reference herein as though fully set forth.
SEQUENCE INFORMATION SEQ ID 1:
CTGCATTGAGTTTATTTATTTATTTATTACTTGTTTGTTTGGATGCTCTTTCCAGCAGACTCATGTCAGGAG GCTAGGAAGGGATTCCTTGGGGACCACTGGATGCTGGTAGTTAAATGCCAGGAGGCTGAATGGACCTGAAGA TGGAGGAGACTCTGCAGTCTTGGTCAGCCACCCTTGGGTGCTTGCCACCCTGCACTCTAGCAGGATTGATGG TCTCTGGATTTGTAGCTGTGACCGGTCATGGTGGAATGCTCGGTGGTTTGCACTGGAGAGGCCCACATGGTG GCGACTGAGGCCCTGTGGGGTGAGGTTGGCTCATGATAGCTCTGAAAGTTGATGGCACAATTGAGACAAGGA CGTGGAGTTCTGGAACTTTCCCAGGGTCCTTGCAGCCCGAGATGAAGCCCTCCAACATTGCAGCTCACTGCT GTGAAGGCTGAAAGGGGAGACAGGAGGCTGCTGGGTACCTCAGGTGCCAGGCATGAGGTTCTCCGCTGTCTG GAGTCTTGCTTTGGGAGTGCTACACCTGTGGGACTCCCCAGGCACCACCCAAAGGCGGGGCTCTGGCTCAAG CTTGCATGGTTTACAGAGCCTCACATGATGTCCTTTCAGGTTTGTTGAGTTGGGGCTAGGGACTCGGTGGCA GCAGAGCCTGGTTCTCCTGCCTGACCAGGCCGTTGGCAGGACGCCTCTTCCCCTCTGTGGAGAAGATGGAGA AGCAGAGAAGCAGGATACAGAGCAGGCTGGAAAGGACTAGAAGCCTCATGGTGAGAAGGCAGATTTTCCCTC GTTCCGAAT
SEQ ID NO 2:
TTTTTTAGGGTTCAGTTCCAGCTGATTTTATTTCCTTCTCAAAAAAAGTTATTTACAGAAGGTATATATCAA CAATCTGACAGGCAGTGAACTTGACATGATTAGCTGGCATGATTTTTTCTTTTTTTTCCCCCAAACATTGTT TTTGTGGCCTTGAATTTTAAGACAAATATTCTACACGGCATATTGCACAGGATGGATGGCAAAAAAAAGTTT AAAAACAAAAACCCTTAACGGAACTGCCTTAAAAAGGCAGACGTCCTAGTGCCTGTCATGTTATATTAAACA TACATACACACAATCTTTTTGCTTATTATAATACAGACTTAAATGTACAAAGATGTTTTCCACTTTTTTCAA TTTTTAAACACAACAGCTATAAACCTGAACACATATGCTATCATCATGCCATAAGACTAAAACAATTATATT TAGCGACAAGTAGAAAGGATTAAATAGTCAAATACAAGAATGAAAAACGCAGTACATAGTGTCGCGAACTCA AATCGGCATTTAGATAGATCCAGTGGTTTAAACGGCACGTTTTTGCTTATAAAAAAAGTGCAAAAAAGATGT GGTTTACAAGTTAAAGCTACAGAATCCCTTTTTGCTGTAATTGCACCAGTTTTAAAGCCTCTGGACAGAGCA GTATTTCGTTTAAAACTTTGTTTTTCTTAAAAGCTTACAGTGTTTGGCTAATTCTCCTCCCCTTTTTACAAG ACGGGGGCCGGAGGGTGGACACTGGTGGCAGGTTAAGGGATACTGTCACTTTAAGAAGCCTGCAGATTGAAG TGTAAACATGGAGAAATTAGGGGCTGATTTTTTAAACTGTGTGAGATATTAACCAGCCGCCCTGTTATAAAA TCAGGAAATCCAAACAGCGATTTACACCGATTAACACCCCCTTTATATATTTTTTACAAAAATACACTGAGA AAATAATCAAACGTTTTCATCTCTCTTGTCTTTTTTTGTTTTTTAAAAGTGTCAAAAGTCTACATTTAAATA TAAAAAATTAAAAGTTAAAACTCTAGCCCTTCAGTGAAGGAGACGTAAAATGGCGTGGGTAACAACAACTAC CAAAAAAAAAAGAAAAAAAAAAGAAAAAAAGGAAAAGGAAGGAATAAAGAAATAAAGGAAGTAAAAAGAAAG GAAAGAAAAAAAGGGACAAAAGAAAAAATATGTTTGGCCCAGTATAAATACGTCCCACATATAAAATGGCAT CTGATTACATTTACAAGGAAAAAGAAATACGAGGATGGAGCATCGGTGAAGGAAAAAAACACGTCTTCTCAT TTACACCTATAAGGAATAAACACACACACTGAGAAAAAATTTGGCCCTGAATTGTTTTTTTAAAGTCCAGCA CAGATTTGAGTTGCGTTTGAATCCTTTAAAGAGTTAAGAATGAAAAAAAGCTGGTGATAATTTCGTTGTAGG AATCAAACATAGCGCCATCTATCTGCTTTTTATATTATCCTACACTATTTTAAAAACTGCTCAACAGTCTTA TACAGAAATCTTTAAAAGATAGACAGGATAACATGCTATATTAACCCCACCATTGAAATAATCCAACACCAT C AC G AT T C C GAT T AAG AG AAGN AAAAAAT
SEQ ID NO: 3 GAGAAATTTTAATTTGGTGTACAAAACTTTTAGTAGTTAGTGAATGAGTAAGATGATTTGTGTATTGTGCAG TTTGGCTTTAAGAGCAAAGGAGAACTTAGAGACTATGGGTTCTAGATGCTGTGTCTGCCTTTCACAGTTTCT CTGAACTTTGTGATTGAACTGGATTCATATTGGAGTTATATATCAGACAAAAACCAAAGTCATTGGGCACAA GCAGAATAAGTCCAAATTAAAAGTATAATCATGAGTTTGTTAAATAATGCTTTATATACTTCTTTAAAATAT ACTTATTTAATATTAAGGATTTTTTTTTCCTTGAATCCATATAATTTGAAAGGTCTAAGGGGAAAAACTTGT TTTGAGCCACTTTATGATGTGAATTCACTTCATAGGGAAATAACATGCTTGGTTTTTAATGTACTTTAACCC TTTTAAAGTACACTGGACC AATTTTAGAGAGCATATACATAGTGTTATAAAAT
SEQ ID NO: 4 CAGTTCTTGAAATCTGAAATCCNGTTTCTGAAATCTTGAATTGCCTCCCANTTGGCCATTTTCCCTTTGAGC CAAAAGTTTCAGATTTTTGGAGCATTTTGGATTTGGGATGCTCAACCTGTGTAAATATTTGTTAATATATAA TGTAATAATTTTAAAAGATCTCAAACAATTAATTTTGAAAATTACCATTTAATTATGCCAGCATTGGTCATT CTCCCTAATTTTCTAGTCCGCCTCTAATCTGTTCTCCTCAGTAATAATAAAAAGATAGCACATTCATTTATT ATAAAGCCCCAAGTAGGTATAAGTTTAACTCATAACTGTTTGAAGAGTCAGCTTTATGTCTGAAATAATCAC TTTATACAATGTGTGTGTGTGTTTTTTTTTTTAAAGGACTAGACTTAGAACCTTTCCCCATACTGTCAATGG TATACCTGGGGTAGTGCAGCATGCACATTTCAAGATTGTAAAGACTACTACCCGAATCCAAAATTGAGAGAG AACCTGTTTATATAAAACTCATTAGTGAACACTCTTCTTAACAGCTACAGAGGCTGCCAGTAGCTATGATGT TAATTCTCTACTTCATGCATCTGTAGGCTAAATGGAAAATTAAGATATGACTGAAGAGAAGCTCCTCTTCAT ATTCAGGTCTGCAACTTTTCTCTTTAAAAAGGAGAGAATTAAGATCAATGAATACCAATACTGGAGAACTTT ACAACGTATGAATTAACTCCTACAGTCAAGGGGTCACTACTTATAACGTTGTATCAGTAAGTCACCTAACGA TCTACTTGTATCATGTCTAGCAAACTTCACTGTCCCCATCTTACTTGCTTTCTCCATGACACCTGAATTTTC CTGATGCTTTCTTTCTCTTGACTTCAATGACATCTCCCATGTTTCACCATTTTTCCCCTATTTCTATGGTTC CCTTTTCAGTCTTCCCAGATGCTGTGCTCTCCTTCTTTAATCTAACCTGTCAGATGGCAATATTTCTCATAG TTCTGACTTAGGCACTTGTCTTCTGTAACATACCTTGTGTGAAACACTCAAAAGCTT
SEQ ID NO: 5
ACATTTTTTATTACGTAACAGTAAAAACATGAAACCTATCAAGTTTGCTAAAACCAAATATTGCAGGCTAAG ACAAGACTTTCAGATTGGCCTATCATTTAATAGAATAAGAAAAGACCTCCTTAATTCTGTTTCCCTTTCTTA AGGGGTAAGTATCATCTGCTCATTAACTGACAAATGGTGTGGTCAAGTAGCAAGGCTGCAGCCAAAAGACCT ACACTGGATATCTGACTCCTTATCTTTCATGTTGTGTGACCTTGAGCAAGTTACTTTAACCTTTTTAAGCCT CTGNTTTTTTCTTCTATAACAGAGACAGTAATATTTATCACTGGTTTTTTTTGNAGAGATTAATGGGCGTAT CTTATGTAAATCACCTAAAATATTTTTCTAGGTAGTAGGCATCAAATAAGCCTGCTATTACTACTTTTTGGA GAAGATAACCAGGTCCTTGGACATTACCACCAAAGGTACCCTG
SEQ ID NO: 6
CCGACGTCGACTATCCAAGATGTACTATTATTGGCATATAGTTTCAAAAATTCACAGAAGGGAGCCAGGTGC TCTCATTGCCTAACAAAATAATGGAAATATGTATTCATTCTAACATCTTGACATACAGTATAAAGGGCACTC AGCAAGTGCTTTTTAGTTAGACTGATTTTAAATGAGTAGATTCAGGAATACCAGAAAACGCACACACACACA GATAATTGGTTGAAAATACGAGGTTAGAAACTTAACCATTGAAGAGGAGTAAGGCTACTTAAAGCGTTAAAA ACTAATTGGGTAAGGTATGGTTGACCCAGCTACTTCATTTGCCTTACGATGTATATTCATTAAACTAAGTCA CTCACCTTCTCTGTGATGTTGATGGTTTGGTATAGTAAACATGAGATATGATTAAAGGTGATTCAGGGATAG ATCAAGTGTCTGCCTAAGTAAATCTGGGNTTTCAATTTTTTTTCTAGACATCTTGGA
SEQ ID NO: 7
TTGAGTTTATTTATTTATTTATTACTTGTTTGTTCTGGATGCTCTTTCCAGCAGACTCATGTCAGGAGGCTA
GGAAGGGATTCCTTGGGGACCACTGGATGCTGGTAGTTAAATGCCAGGAGGCTGAATGGACCTGAAGATGGA GGAGACTCTGCAGTCTTGGTCAGCCACCCTTGGGTGCTTGCCACCCTGCACTCTAGCAGGATTGATGGTCTC
TGGATTTGTAGCTGTGACCGGTCATGGTGGAATGCTCGGTGGTTTGCACTGGAGAGGCCCACATGGTGGCGA CTGAGGCCCTGTGGGGTGAGGTTGGCTCATGATAGCTCTGAAAGTTGATGGCACAATTGAGACAAGGACGTG GAGTTCTGGAACTTTCCCAGGGTCCTTGCAGCCCGAGATGAAGCCCTCCAACATTGCAGCTCACTGCTGTGA AGGCTGAAAGGGGAGACAGGAGGCTGCTGGGTACCTCAGGTGCCAGGCATGAGGTTCTCCGCTGTCTGGAGT CTTGCTTTGGGAGTGCTACACCTGTGGGACTCCCCAGGCACCACCCAAAGGCGGGGCTCTGGCTCAAGCTTG CATGGTTTACAGAGCCTCACATGATGTCCTTTCAGGTTTGTTGAGTTGGGGCTAGGGACTCGGTGGCAGCAG AGCCTGGTTCTCCTGCCTGACCAGGCCGTTGGCAGGACGCCTCTTCCCCTCTGTGGAGAAGATGGAGAAGCA GAGAAGCAGGATACAGAGCAGGCTGGAAAGGACTAGAAGCCTCATGGTGAGAAGGCAGATTTTCCCTCGTTC CGAAT SEQ ID NO: 8
TTTTTTAGGGTTCAGTTCCAGCTGATTTTATTTCCTTCTCAAAAAAAGTTATTTACAGAA GGTATATATCAACAATCTGACAGGCAGTGAACTTGACATGATTAGCTGGCATGATTTTTT CTTTTTTTTCCCCCAAACATTGTTTTTGTGGCCTTGAATTTTAAGACAAATATTCTACAC GGCATATTGCACAGGATGGATGGCAAAAAAAAGTTTAAAAACAAAAACCCTTAACGGAAC TGCCTTAAAAAGGCAGACGTCCTAGTGCCTGTCATGTTATATTAAACATACATACACACA ATCTTTTTGCTTATTATAATACAGACTTAAATGTACAAAGATGTTTTCCACTTTTTTCAA TTTTTAAACACAACAGCTATAAACCTGAACACATATGCTATCATCATGCCATAAGACTAA AACAATT TATTTAGCGACAAGTAGAAAGGATT AATAGTCAAATACAAGAATG AAAAC GCAGTACATAGTGTCGCGAACTCAAATCGGCATTTAGATAGATCCAGTGGTTTAAACGGC ACGTTTTTGCTTATAAAAAAAGTGCAAAAAAGATGTGGTTTACAAGTTAAAGCTACAGAA TCCCTTTTTGCTGTAATTGCACCAGTTTTAAAGCCTCTGGACAGAGCAGTATTTCGTTTA AAACTTTGTTTTTCTTAAAAGCTTACAGTGTTTGGCTAATTCTCCTCCCCTTTTTACAAG ACGGGGGCCGGAGGGTGGACACTGGTGGCAGGTTAAGGGATACTGTCACTTTAAGAAGCC TGCAGATTGAAGTGTAAACATGGAGAAATTAGGGGCTGATTTTTTAAACTGTGTGAGATA TTAACCAGCCGCCCTGTTATAAAATCAGGAAATCCAAACAGCGATTTACACCGATTAACA CCCCCTTTATATATTTTTTACAAAAATACACTGAGAAAATAATCAAACGTTTTCATCTCT CTTGTCTTTTTTTGTTTTTTAAAAGTGTCAAAAGTCTACATTTAAATATAAAAAATTAAA AGTTAAAACTCTAGCCCTTCAGTGAAGGAGACGTAAAATGGCGTGGGTAACAACAACTAC CAAAAAAAAAAGAAAAAAAAAAGAAAAAAAGGAAAAGGAAGGAATAAAGAAATAAAGGAA GTAAAAAGAAAGGAAAGAAAAAAAGGGACAAAAGAAAAAATATGTTTGGCCCAGTATAAA TACGTCCCACATATAAAATGGCATCTGATTACATTTACAAGGAAAAAGAAATACGAGGAT GGAGCATCGGTGAAGGAAAAAAACACGTCTTCTCATTTACACCTATAAGGAATAAACACA CACACTGAGAAAAAATTTGGCCCTGAATTGTTTTTTTAAAGTCCAGCACAGATTTGAGTT GCGTTTGAATCCTTTAAAGAGTTAAGAATGAAAAAAAGCTGGTGATAATTTCGTTGTAGG AATCAAACATAGCGCCATCTATCTGCTTTTTATATTATCCTACACTATTTTAAAAACTGC TCAACAGTCTTATACAGAAATCTTTAAAAGATAGACAGGATAACATGCTATATTAACCCC ACCATTGAAATAATCCAACACCATC CGATTCCGATTAAGAGAAGNAAAAAA SEQ ID NO: 9
GAGAAATTTTAATTTGGTGTACAAAACTTTTAGTAGTTAGTGAATGAGTAAGATGATTTGTGTATTGTGCAG TTTGGCTTTAAGAGCAAAGGAGAACTTAGAGACTATGGGTTCTAGATGCTGTGTCTGCCTTTCACAGTTTCT CTGAACTTTGTGATTGAACTGGATTCATATTGGAGTTATATATCAGACAAAAACCAAAGTCATTGGGCACAA GCAGAATAAGTCCAAATTAAAAGTATAATCATGAGTTTGTTAAATAATGCTTTATATACTTCTTTAAAATAT ACTTATTTAATATTAAGGATTTTTTTTTCCTTGAATCCATATAATTTGAAAGGTCTAAGGGGAAAAACTTGT TTTGAGCCACTTTATGATGTGAATTCACTTCATAGGGAAATAACATGCTTGGTTTTTAATGTACTTTAACCC TTTTAAAGTACACTGGACCAAATTTTAGAGAGCATATACATAGTGTTATAAAAT SEQ ID NO: 10
TTTTTTTTTTTAAGCTTTTGAGTGTTTCACACAAGGTATGTTACAGAAGACAAGTGCCTAAGTCAGAACTAT GAGAAATATTGCCATCTGACAGGTTAGATTAAAGAAGGAGAGCACAGCATCTGGGAAGACTGAAAAGGGAAC CATAGAAATAGGGGAAAAATGGTGAAACATGGGAGATGTCATTGAAGTCAAGAGAAAGAAAGCATCAGGAAA ATTCAGGTGTCATGGAGAAAGCAAGTAAGATGGGGACAGTGAAGTTTGCTAGACATGATACAAGTAGATCGT TAGGTGACTTACTGATACAACGTTATAAGTAGTGACCCCTTAACTGTAGGAGTTAATTCATACGTTGTAAAG TTCTCCAGTATTGGTATTCATTGATCTTAATTCTCTCCTTTTTANAGAGNAAAGTTGCAGACGTGAATATGA GGAGG SEQ ID NO: 11
CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGTACATTTTTTATTACGTAACAGTAAAAACAT GAAACCTATCAAGTTTGCTAAAACCAAATATTGCAGGCTAAGACAAGACTTTCAGATTGGCCTATCATTTAA TAGAATAAGAAAAGACCTCCTTAATTCTGTTTCCCTTTCTTAAGGGGTAAGTATCATCTGCTCATTAACTGA CAAATGGTGTGGTCAAGTAGCAAGGCTGCAGCCAAAAGACCTACACTGGATATCTGACTCCTTATCTTTCAT GTTGTGTGACCTTGAGCAAGTTACTTTAACCTTTTTAAGCCTCTGTTTTTTTCTTCTATAACAGAGACAGTA ATATTTATCACTGTTTTTTTTTGTAGAGATTAAATGGCGTATCTTATGTAAATCACCTAAAATATTTTTCTA GTAGTAGGGCATCAAAATAAGCCCTGCTATTACTACTTTTTGAAGAAGATAAACCAAGTCCCTGGAACATTA ACCACCAAAAAGTACCACTGGTTTTCACACCCCCCC
SEQ ID NO: 12
CCTATGCATCAAGCTTGGTACCGAGCTCGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTCGCCCTTA CCGACGTCGACTATCCAAGATGTACTATTATTGGCATATAGTTTCAAAAATTCACAGAAGGGAGCCAGGTGC TCTCATTGCCTAACAAAATAATGGAAATATGTATTCATTCTAACATCTTGACATACAGTATAAAGGGCACTC AGCAAGTGCTTTTTAGTTAGACTGATTTTAAATGAGTAGATTCAGGAATACCAGAAAACGCACACACACACA GATAATTGGTTGAAAATACGAGGTTAGAAACTTAACCATTGAAGAGGAGTAAGGCTACTTAAAGCGTTAAAA ACTAATTGGGTAAGGTATGGTTGACCCAGCTACTTCATTTGCCTTACGATGTATATTCATTAAACTAAGTCA CTCACCTTCTCTGTGATGTTGATGGTTTGGTATAGTAAACATGAGATATGATTAAAGGTGATTCAGGGATAG ATCAAGTGTCTGCCTAAGTAAATCTGGGNTTTCAATTTTTTTTCTAGACATCTTGGA

Claims

Claims
1. An isolated polynucleotide which comprises a nucleotide sequence which has at least 70% identity to that of SEQ ID NOs: 1 - 6 over the entire length of SEQ ID NOs: 1 - 6; or a nucleotide sequence complementary to said isolated polynucleotide; and fragments of the polynucleotides.
2. The isolated polynucleotide as defined in claim 1 in which the identity is at least 95% to SEQ ID Nos: 1 - 6.
3. An isolated polynucleotide selected from:
(a) the polynucleotide of any one of SEQ ID NOsJ- 6; and
(b) a polynucleotide obtainable by screening an appropriate library under stringent hybridization conditions with a labeled probe having the sequence of any one of SEQ ID NOs: 1 - 6 or a fragment thereof; and
(c) a fragment of (a) or (b); or a nucleotide sequence complementary to said isolated polynucleotide
4. A process for diagnosing a disease or a susceptibility to a disease in a subject related to presence or expression or activity of a polynucleotide of any one of claims 1 to 3 in a subject comprising analyzing for the presence or amount of said polynucleotide in a sample derived from said subject.
5. A process for diagnosing the presence of colon cancer or a susceptibility to colon cancer in a subject related to presence or expression or activity of a polynucleotide of any one of claims 1 to 3 in a subject comprising analyzing for the presence or amount of said polynucleotide in a sample derived from said subject.
EP00901580A 1999-01-19 2000-01-17 Polynucleotides and their application in diagnostics Withdrawn EP1144622A2 (en)

Applications Claiming Priority (13)

Application Number Priority Date Filing Date Title
GB9901078 1999-01-19
GBGB9901078.7A GB9901078D0 (en) 1999-01-19 1999-01-19 Novel compounds
GB9902090 1999-01-29
GBGB9902090.1A GB9902090D0 (en) 1999-01-29 1999-01-29 Novel compounds
GB9902169 1999-02-01
GB9902168 1999-02-01
GBGB9902163.6A GB9902163D0 (en) 1999-02-01 1999-02-01 Novel compounds
GB9902163 1999-02-01
GBGB9902168.5A GB9902168D0 (en) 1999-02-01 1999-02-01 Novel compounds
GBGB9902169.3A GB9902169D0 (en) 1999-02-01 1999-02-01 Novel compounds
GB9907901 1999-04-07
GBGB9907901.4A GB9907901D0 (en) 1999-04-07 1999-04-07 Novel compounds
PCT/EP2000/000346 WO2000043509A2 (en) 1999-01-19 2000-01-17 Polynucleotides and their applications in diagnostics

Publications (1)

Publication Number Publication Date
EP1144622A2 true EP1144622A2 (en) 2001-10-17

Family

ID=27547331

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00901580A Withdrawn EP1144622A2 (en) 1999-01-19 2000-01-17 Polynucleotides and their application in diagnostics

Country Status (5)

Country Link
EP (1) EP1144622A2 (en)
JP (1) JP2002534977A (en)
AU (1) AU2292400A (en)
CA (1) CA2358697A1 (en)
WO (1) WO2000043509A2 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MXPA02012717A (en) 2000-06-21 2003-09-22 Amgen Inc COLON STROMATIC POLYPEPTIDES-1, EPITELIALS, SECRETS, NUCLEIC ACIDS CODING THEM AND THEIR USES.

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4312827B2 (en) * 1993-12-02 2009-08-12 ザ・ジョーンズ・ホプキンス・ユニバーシティ Human mutator gene hMSH2 and hereditary nonpolyposis colorectal cancer
AU5305596A (en) * 1996-03-11 1997-10-01 Human Genome Sciences, Inc. Human muty
US6333152B1 (en) * 1997-05-21 2001-12-25 The Johnshopkins University Gene expression profiles in normal and cancer cells

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0043509A3 *

Also Published As

Publication number Publication date
CA2358697A1 (en) 2000-07-27
WO2000043509A3 (en) 2000-11-02
AU2292400A (en) 2000-08-07
JP2002534977A (en) 2002-10-22
WO2000043509A2 (en) 2000-07-27

Similar Documents

Publication Publication Date Title
US20050129717A1 (en) Novel uses
US20090202577A1 (en) CASB618 Polynucleotides and Polypeptides and Their Use
US6635255B1 (en) CASB414:antigen overexpressed in several tumors
CA2323760A1 (en) Human casb12 polypeptide, a serine protease
WO2000058460A2 (en) Casb619 involved in colon cancers
WO2000043509A2 (en) Polynucleotides and their applications in diagnostics
WO2000043511A1 (en) Polypeptide
EP1062331A1 (en) Compounds related to pap-1
CA2387043A1 (en) Colon-tumour-associated antigens
HK1072187A (en) Use of casb616 polypeptides and polynucleotides for cancer treatment
CA2386028A1 (en) Human tumor-associated lak-4p related polynucleotides and polypeptides and their uses
ZA200107445B (en) CASB618 polynucleotides and polypeptides and their use.

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20010820

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI PAYMENT 20010820

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: GLAXOSMITHKLINE BIOLOGICALS S.A.

17Q First examination report despatched

Effective date: 20030306

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20030717