EP1080101A1 - Nouvelles molecules de la famille de proteines associees au t139 et utilisations correspondantes - Google Patents

Nouvelles molecules de la famille de proteines associees au t139 et utilisations correspondantes

Info

Publication number
EP1080101A1
EP1080101A1 EP99919992A EP99919992A EP1080101A1 EP 1080101 A1 EP1080101 A1 EP 1080101A1 EP 99919992 A EP99919992 A EP 99919992A EP 99919992 A EP99919992 A EP 99919992A EP 1080101 A1 EP1080101 A1 EP 1080101A1
Authority
EP
European Patent Office
Prior art keywords
seq
nucleic acid
polypeptide
protein
amino acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP99919992A
Other languages
German (de)
English (en)
Inventor
Douglas Holtzman
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Millennium Pharmaceuticals Inc
Original Assignee
Millennium Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Millennium Pharmaceuticals Inc filed Critical Millennium Pharmaceuticals Inc
Publication of EP1080101A1 publication Critical patent/EP1080101A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6872Intracellular protein regulatory factors and their receptors, e.g. including ion channels
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • the invention relates to a novel secreted protein and the gene encoding it .
  • membrane-associated and secreted proteins for example, cytokines
  • cytokines play a vital role in the regulation of cell growth, cell differentiation, and a variety of specific cellular responses.
  • a number of medically useful proteins including erythropoietin, granulocyte-macrophage colony stimulating factor, human growth hormone, and various interleukins, are secreted proteins.
  • an important goal in the design and development of new therapies is the identification and characterization of membrane-associated and secreted proteins and the genes which encode them.
  • membrane-associated proteins are receptors which bind a ligand and transduce an intracellular signal, leading to a variety of cellular responses.
  • the identification and characterization of such a receptor enables one to identify both the ligands which bind to the receptor and the intracellular molecules and signal transduction pathways associated with the receptor, permitting one to identify or design modulators of receptor activity, e.g., receptor agonists or antagonists and modulators of signal transduction.
  • the present invention is based, at least in part, on the discovery of a gene encoding T139.
  • the T139 cDNA described below (SEQ ID NO:l) has a 1338 nucleotide open reading frame (nucleotides 95-1432 of SEQ ID NO : 1 ; SEQ ID NO: 3) which encodes a 446 amino acid protein (SEQ ID NO: 2) .
  • This protein includes a predicted signal sequence of about 26 amino acids (from about amino acid 1 to about amino acid 26 of SEQ ID NO: 2) and a predicted mature protein of about 420 amino acids (from about amino acid 27 to amino acid 446 of SEQ ID NO : 2 ; SEQ ID NO:4) .
  • T139 protein possesses a sperm-coating protein (SCP) domain (amino acids 47 to 190, of SEQ ID NO:2; SEQ ID NO:5), a C-type lectin domain (amino acids 297 to 412, of SEQ ID NO: 2; SEQ ID NO: 6), and two epidermal growth factor (EGF)-like domains (amino acids 232 to 260 of SEQ ID NO: 2; SEQ ID NO : 7 , referred to herein as the "EGF1 domain” and amino acids 264 to 291 of SEQ ID NO: 2; SEQ ID NO: 8, referred to herein as the "EGF2 domain”) .
  • SCP sperm-coating protein
  • EGF epidermal growth factor
  • T139 molecules of the present invention are useful as modulating agents in regulating a variety of cellular processes. Accordingly, in one aspect, this invention provides isolated nucleic acid molecules encoding T139 proteins or biologically active portions thereof, as well as nucleic acid fragments suitable as primers or hybridization probes for the detection of T139-encoding nucleic acids.
  • the invention features a nucleic acid molecule which is at least 45% (or 55%, 65%, 75%, 85%, 95%, or 98%) identical to the nucleotide sequence shown in SEQ ID NO:l, or SEQ ID NO: 3, or the nucleotide sequence of the cDNA insert of the plasmid deposited with ATCC as Accession Number (the "cDNA of ATCC 98694"), or a complement thereof.
  • the invention features a nucleic acid molecule which includes a fragment of at least 300 (325, 350, 375, 400, 425, 450, 500, 550, 600, 650, 700, 800, 900, 1000, or 1290) nucleotides of the nucleotide sequence shown in SEQ ID N0:1, or SEQ ID NO: 3, or the nucleotide sequence of the cDNA of ATCC 98694, or a complement thereof .
  • the invention also features a nucleic acid molecule which includes a nucleotide sequence encoding a protein having an amino acid sequence that is at least 45% (or 55%, 65%, 75%, 85%, 95%, or 98%) identical to the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, or the amino acid sequence encoded by the cDNA of ATCC 98694.
  • a T139 nucleic acid molecule has the nucleotide sequence shown SEQ ID N0:1, or SEQ ID NO: 3, or the nucleotide sequence of the cDNA of ATCC 98694.
  • nucleic acid molecule which encodes a fragment of a polypeptide having the amino acid sequence of SEQ ID NO : 2 or SEQ ID NO : 4 , the fragment including at least 15 (25, 30, 50, 100, 150, 300, or 400) contiguous amino acids of SEQ ID NO: 2 or SEQ ID NO: 4 or the polypeptide encoded by the cDNA of ATCC 98694.
  • the invention includes a nucleic acid molecule which encodes a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO : 4 or an amino acid sequence encoded by the cDNA of ATCC 98694, wherein the nucleic acid molecule hybridizes to a nucleic acid molecule comprising SEQ ID NO:l or SEQ ID NO : 3 under stringent conditions.
  • an isolated T139 protein having an amino acid sequence that is at least about 65%, preferably 75%, 85%, 95%, or 98% identical to the amino acid sequence of SEQ ID NO : 4 (mature human T139) or the amino acid sequence of SEQ ID NO: 2 (immature human T139) ; and an isolated T139 protein having an amino acid sequence that is at least about 85%, 95%, or 98% identical to the SCP-like domain of SEQ ID NO:2 (e.g., about amino acid residues 47 to 190 of SEQ ID NO:2), C- type lectin domain (e.g., about amino acid residues 297 to 412 of SEQ ID NO : 2 ) , and EGF-like domains (e.g., about amino acids residues 232 to 260 or 264 to 291 of SEQ ID NO: 2) .
  • SCP-like domain of SEQ ID NO:2 e.g., about amino acid residues 47 to 190 of SEQ ID NO:2
  • an isolated T139 protein which is encoded by a nucleic acid molecule having a nucleotide sequence that is at least about 65%, preferably 75%, 85%, or 95% identical to SEQ ID NO: 3 or the cDNA of ATCC 98694; an isolated T139 protein which is encoded by a nucleic acid molecule having a nucleotide sequence at least about 65% preferably 75%, 85%, or 95% identical to the SCP-like domain encoding portion of SEQ ID N0:1 (e.g., about nucleotides 233 to 665 of SEQ ID NO:l), C-type lectin domain encoding portion of SEQ ID NO:l (e.g., about nucleotides 983 to 1330 of SEQ ID NO:l), or EGF-like domain encoding portions of SEQ ID NO:l (e.g., about nucleotides 788 to 874 and 884 to 967 of SEQ ID NO:l); and an isolated T139 protein which is encode
  • polypeptide which is a naturally occurring allelic variant of a polypeptide that includes the amino acid sequence of SEQ ID NO : 2 or SEQ ID NO: 4 or an amino acid sequence encoded by the cDNA of ATCC 98694, wherein the polypeptide is encoded by a nucleic acid molecule which hybridizes to a nucleic acid molecule comprising SEQ ID N0:1 or SEQ ID NO: 3 under stringent conditions.
  • T139 nucleic acid molecules which specifically detect T139 nucleic acid molecules.
  • a T139 nucleic acid molecule hybridizes under stringent conditions to a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO : 1 , SEQ ID NO: 3, or the cDNA of ATCC 98694, or a complement thereof.
  • the T139 nucleic acid molecule is at least 300 (325, 350, 375, 400, 425, 450, 500, 550, 600, 650, 700, 800, 900, 1000, or 1290) nucleotides in length and hybridizes under stringent conditions to a nucleic acid molecule comprising the nucleotide sequence shown in SEQ ID NO:l, SEQ ID NO : 3 , the cDNA of ATCC 98694, or a complement thereof.
  • an isolated T139 nucleic acid molecule comprises nucleotides 233 to 665 of SEQ ID NO : 1 , encoding the SCP-like domain of T139; nucleotides 983 to 1330 of SEQ ID NO:l, encoding the C-type lectin domain of T139; or nucleotides 788 to 874 or 884 to 967 of SEQ ID NO : 1 , encoding a EGF like domain of T139, or a complement thereof.
  • the invention provides an isolated nucleic acid molecule which is antisense to the coding strand of a T139 nucleic acid.
  • Another aspect of the invention provides a vector, e.g., a recombinant expression vector, comprising a T139 nucleic acid molecule of the invention.
  • the invention provides a host cell containing such a vector.
  • the invention also provides a method for producing T139 protein by culturing, in a suitable medium, a host cell of the invention containing a recombinant expression vector such that a T139 protein is produced.
  • Another aspect of this invention features isolated or recombinant T139 proteins and polypeptides .
  • Preferred T139 proteins and polypeptides possess at least one biological activity possessed by naturally occurring human T139, e.g., (1) the ability to form protein:protein interactions with proteins; and (2) the ability to bind a T139 ligand. Other activities include: (1) modulation of cellular proliferation and (2) modulation of cellular differentiation.
  • the T139 proteins of the present invention can be operatively - 6 - linked to a non-T139 polypeptide (e.g., heterologous amino acid sequences) to form T139 fusion proteins.
  • the invention further features antibodies that specifically bind T139 proteins, such as monoclonal or polyclonal antibodies.
  • the T139 proteins or biologically active portions thereof can be incorporated into pharmaceutical compositions, which optionally include pharmaceutically acceptable carriers.
  • the present invention provides a method for detecting the presence of T139 activity or expression in a biological sample by contacting the biological sample with an agent capable of detecting an indicator of T139 activity such that the presence of T139 activity is detected in the biological sample.
  • the invention provides a method for modulating T139 activity comprising contacting a cell with an agent that modulates (inhibits or stimulates) T139 activity or expression such that T139 activity or expression in the cell is modulated.
  • the agent is an antibody that specifically binds to T139 protein.
  • the agent modulates expression of T139 by modulating transcription of a T139 gene, splicing of a T139 mRNA, or translation of a T139 mRNA.
  • the agent is a nucleic acid molecule having a nucleotide sequence that is antisense to the coding strand of the T139 mRNA or the T139 gene.
  • the methods of the present invention are used to treat a subject having a disorder characterized by aberrant T139 expression or activity by administering an agent which is a T139 modulator to the subject.
  • the T139 modulator is a T139 protein.
  • the T139 modulator is a T139 nucleic acid molecule.
  • the T139 modulator is a peptide, peptidomimetic, or other - 7 - small molecule.
  • the disorder characterized by aberrant T139 protein or nucleic acid expression is a proliferative or differentiative disorder, particularly of the immune system.
  • T139 nucleic acids, polypeptides, and modulators of T139 expression or activity can be used to modulate spermatogenesis .
  • such molecules can be used as a contraceptive to decrease spermatogenesis .
  • such molecules can be used to increase spermatogenesis.
  • Such molecules may also be useful for treatment of disorders related to defects in sperm-egg fusion and disorders of acrosome formation or function.
  • T139 nucleic acids, polypeptides, and modulators may also be useful for treatment of various testicular disorders, e.g., testicular cancer.
  • T139 may serve as an antigen in a contraceptive vaccinogen.
  • the present invention also provides a diagnostic assay for identifying the presence or absence of a genetic lesion or mutation characterized by at least one of: (i) aberrant modification or mutation of a gene encoding a T139 protein; (ii) mis-regulation of a gene encoding a T139 protein; and (iii) aberrant post- translational modification of a T139 protein, wherein a wild-type form of the gene encodes a protein with a T139 activity.
  • the invention provides a method for identifying a compound that binds to or modulates the activity of a T139 protein.
  • such methods entail measuring a biological activity of a T139 protein in the presence and absence of a test compound and identifying those compounds which alter the activity of the T139 protein.
  • the invention also features methods for identifying a compound which modulates the expression of - 8 -
  • T139 by measuring the expression of T139 in the presence and absence of a compound.
  • Figure 1 depicts the cDNA sequence (SEQ ID N0:1) and predicted amino acid sequence (SEQ ID NO: 2) of human T139 (also referred to as "TANGO 139") .
  • the open reading frame of SEQ ID NO : 1 extends from nucleotide 95 to nucleotide 1432 (SEQ ID NO: 3) .
  • Figures 2A-2C depict alignments of portions the amino acid sequences of T139 with various consensus sequences.
  • Figure 2A shows the alignment of T139 amino acids 47 to 190 of SEQ ID NO : 2 with the SCP-like domain consensus sequence derived from a hidden Markov model (PF00188; SEQ ID NO:9).
  • Figure 2B shows the alignment of T139 amino acids 297 to 412 of SEQ ID NO : 2 with the C- type lectin domain consensus sequence derived from a hidden Markov model (PF00059; SEQ ID NO:10) .
  • Figure 2C shows the alignment of T139 amino acids 232 to 260 (EGFl) and 264 to 291 (EGF2) of SEQ ID NO : 2 with the EGF-like domain consensus sequence derived from a hidden Markov model (PF00008; SEQ ID NO: 11).
  • Figure 3 is a hydropathy plot of T139. The position of cysteines (cys) are indicated by the vertical bars immediately below the plot. Relative hydrophobicity is shown above the dotted line, and relative hydrophilicity is shown below the line.
  • the present invention is based on the discovery of a cDNA molecule encoding human T139.
  • a nucleotide sequence encoding a human T139 protein is shown in Figure 1 (SEQ ID NO:l; SEQ ID NO : 3 - 9 - includes the open reading frame only) .
  • a predicted amino acid sequence of T139 protein is also shown in Figure 1 (SEQ ID NO: 2) .
  • the T139 cDNA of Figure 1 (SEQ ID N0:1), which is approximately 1856 nucleotides long, including untranslated regions, encodes a protein amino acid having a molecular weight of approximately 49 kDa (excluding post-translational modifications) .
  • a plasmid containing a cDNA encoding human T139 was deposited with American Type Culture Collection (ATCC) , Rockville, Maryland on March 12, 1998, and assigned Accession Number 98694. This deposit will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. This deposit was made merely as a convenience for those of skill in the art and is not an admission that a deposit is required under 35 U.S.C. ⁇ 112.
  • T139 is homologous to testis-specific protein-1 (TPX-1) , a member of the SCP-like domain protein family.
  • Comparison of the T139 SCP-like domain with the SCP-like domain consensus (SEQ ID NO: 9) revealed that the T139 SCP-like domain is 28% identical (45/162 amino acids) and 50% similar (81/162 amino acids) to the consensus.
  • Alignment of the C-type lectin domain of human T139 protein (SEQ ID NO: 6) with the C-type lectin domain consensus sequence (SEQ ID NO: 10) revealed that the domains are 27% identical (28/103 amino acids) and 63% similar (65/103 amino acids) .
  • C-type lectin domains appear to function as calcium-dependent carbohydrate- recognition domains and contain four conserved cysteines.
  • the first and fourth cysteines and the second and third cysteines in the consensus participate in disulfide bonding with each other.
  • One example of a protein having a C-type lectin domain is the REG protein, a 166 amino - 10 - acid polypeptide shown to stimulate beta-cell regeneration in a adult mouse pancreas.
  • REG protein a 166 amino - 10 - acid polypeptide shown to stimulate beta-cell regeneration in a adult mouse pancreas.
  • EGF-like domains of human T139 protein SEQ ID NOS : 7 and 8
  • EGF-like domain consensus sequence SEQ ID NO: 11
  • EGF-like domains are found in the extracellular portion of membrane-bound proteins or in secreted proteins.
  • EGF-like domains typically include six cysteine residues involved in disulfide bond formation with two conserved glycines between the fifth and sixth cysteine.
  • the secondary structure of EGF-like domains appears to be a two-stranded ⁇ -sheet followed by a loop to a C-terminal short two-stranded sheet.
  • Tango 139 is expressed at high levels in the kidney and at low levels in the testis as an about 2.0 kb transcript. Additional T139 transcripts of about 2.4 kb and 3.5 kb were also present in these two tissues. No T139 expression was observed in the heart, brain, placenta, lung, liver, skeletal muscle, pancreas, spleen, thymus, ovaries, small intestine, colon, and peripheral blood leukocytes.
  • Human T139 is one member of a family of molecules (the "T139 family") having certain conserved structural and functional features.
  • family when referring to the protein and nucleic acid molecules of the invention is intended to mean two or more proteins or nucleic acid molecules having a common structural domain and having sufficient amino acid or nucleotide sequence identity as defined herein.
  • family members can be naturally occurring and can be from either the same or different species.
  • a family can contain a - 11 - first protein of human origin and a homologue of that protein of murine origin, as well as a second, distinct protein of human origin and a murine homologue of that protein.
  • Members of a family may also have common functional characteristics.
  • a T139 protein includes a SCP- like, C-type lectin, or EGF-like domain having at least about 65%, preferably at least about 75%, and more preferably about 85%, 95%, or 98% amino acid sequence identity to the SCP-like domain of SEQ ID NO: 5, C-type lectin domain of SEQ ID NO: 6, or EGF-like domain of SEQ ID NOS: 7 or 8.
  • Preferred T139 polypeptides of the present invention have an amino acid sequence sufficiently identical to the SCP-like domain of SEQ ID NO: 5, C-type lectin domain of SEQ ID NO: 6, or EGF-like domain of SEQ ID NOS : 7 or 8.
  • the term "sufficiently identical” refers to a first amino acid or nucleotide sequence which contains a sufficient or minimum number of identical or equivalent (e.g., an amino acid residue which has a similar side chain) amino acid residues or nucleotides to a second amino acid or nucleotide sequence such that the first and second amino acid or nucleotide sequences have a common structural domain and/or common functional activity.
  • T139 activity refers to an activity exerted by a T139 protein, polypeptide or nucleic acid molecule on a T139 responsive cell as determined in vivo, or in vi tro, according to standard techniques.
  • a T139 activity can be a direct - 12 - activity, such as an association with or an enzymatic activity on a second protein or an indirect activity, such as a cellular signaling activity mediated by interaction of the T139 protein with a second protein.
  • a T139 activity includes at least one or more of the following activities: (i) interaction with other proteins; and (ii) interaction with a T139 receptor.
  • another embodiment of the invention features isolated T139 proteins and polypeptides having a T139 activity.
  • a signal sequence is a peptide containing about 20 amino acids which occurs at the extreme N-terminal end of secretory and integral membrane proteins and which contains large numbers of hydrophobic amino acid residues and serves to direct a protein containing such a sequence to a lipid bilayer.
  • a signal sequence or signal peptide is a peptide containing about 20 amino acids which occurs at the extreme N-terminal end of secretory and integral membrane proteins and which contains large numbers of hydrophobic amino acid residues and serves to direct a protein containing such a sequence to a lipid bilayer.
  • nucleic acid molecules that encode T139 proteins or biologically active portions thereof, as well as nucleic acid molecules sufficient for use as hybridization probes to identify T139-encoding nucleic acids (e.g., T139 mRNA) and fragments for use as PCR primers for the amplification or mutation of T139 nucleic acid molecules.
  • nucleic acid molecule is intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mRNA) and analogs of the DNA or RNA generated using nucleotide analogs.
  • the - 13 - nucleic acid molecule can be single-stranded or double- stranded, but preferably is double-stranded DNA.
  • an “isolated” nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid.
  • an “isolated” nucleic acid is free of sequences (preferably protein encoding sequences) which naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived.
  • the isolated T139 nucleic acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived.
  • an "isolated" nucleic acid molecule such as a cDNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
  • a nucleic acid molecule of the present invention e.g., a nucleic acid molecule having the nucleotide sequence of SEQ ID NO:l, SEQ ID NO: 3, or the cDNA of ATCC 98694, or a complement of any of these nucleotide sequences, can be isolated using standard molecular biology techniques and the sequence information provided herein. Using all or portion of the nucleic acid sequences of SEQ ID NO : 1 , SEQ ID NO: 3, or the cDNA of ATCC 98694 as a hybridization probe, T139 nucleic acid molecules can be isolated using standard hybridization and cloning techniques (e.g., as described in Sambrook et al . , eds . , Molecular Cloning: A Laboratory Manual . 2nd, ed . , Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) . - 14 -
  • a nucleic acid of the invention can be amplified using cDNA, mRNA or genomic DNA as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques.
  • the nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis.
  • oligonucleotides corresponding to T139 nucleotide sequences can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.
  • an isolated nucleic acid molecule of the invention comprises a nucleic acid molecule which is a complement of the nucleotide sequence shown in SEQ ID NO:l, SEQ ID NO: 3, or the cDNA of ATCC 98694, or a portion thereof.
  • a nucleic acid molecule which is complementary to a given nucleotide sequence is one which is sufficiently complementary to the given nucleotide sequence that it can hybridize to the given nucleotide sequence thereby forming a stable duplex.
  • the nucleic acid molecule of the invention can comprise only a portion of a nucleic acid sequence encoding T139, for example, a fragment which can be used as a probe or primer or a fragment encoding a biologically active portion of T139.
  • the nucleotide sequence determined from the cloning of the human T139 gene allows for the generation of probes and primers designed for use in identifying and/or cloning T139 homologues in other cell types, e.g., from other tissues, as well as T139 homologues from other mammals.
  • the probe/primer typically comprises substantially purified oligonucleotide.
  • the oligonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 12, preferably about 25, more preferably about 50, 75, 100, 125, 150, 175, 200, 250, 300, 350 or 400 consecutive nucleotides of - 15 - the sense or anti-sense sequence of SEQ ID N0:1, SEQ ID NO: 3, or the cDNA of ATCC 98694 or of a naturally occurring mutant of SEQ ID NO : 1 , SEQ ID NO: 3, or the cDNA of ATCC 98694.
  • Probes based on the human T139 nucleotide sequence can be used to detect transcripts or genomic sequences encoding the same or identical proteins.
  • the probe comprises a label group attached thereto, e.g., a radioisotope, a fluorescent compound, an enzyme, or an enzyme co- factor.
  • a label group attached thereto e.g., a radioisotope, a fluorescent compound, an enzyme, or an enzyme co- factor.
  • Such probes can be used as a part of a diagnostic test kit for identifying cells or tissue which mis-express a T139 protein, such as by measuring a level of a T139-encoding nucleic acid in a sample of cells from a subject, e.g., detecting T139 mRNA levels or determining whether a genomic T139 gene has been mutated or deleted.
  • a nucleic acid fragment encoding a "biologically active portion of T139" can be prepared by isolating a portion of SEQ ID NO:l, SEQ ID NO: 3, or the nucleotide sequence of the cDNA of ATCC 98694 which encodes a polypeptide having a T139 biological activity, expressing the encoded portion of T139 protein (e.g., by recombinant expression in vi tro) and assessing the activity of the encoded portion of T139.
  • a nucleic acid fragment encoding a biologically active portion of T139 includes a SCP-like, C-type lectin, or EGF-like domain, e.g., any of SEQ ID NOS: 5-8.
  • the invention further encompasses nucleic acid molecules that differ from the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO : 3 , or the cDNA of ATCC 98694 due to degeneracy of the genetic code and thus encode the same T139 protein as that encoded by the nucleotide sequence shown in SEQ ID NO:l, SEQ ID NO: 3, or the cDNA of ATCC 98694.
  • SEQ ID NO: 1 SEQ ID NO: 3
  • cDNA of ATCC 98694 due to degeneracy of the genetic code and thus encode the same T139 protein as that encoded by the nucleotide sequence shown in SEQ ID NO:l, SEQ ID NO: 3, or the cDNA of ATCC 98694.
  • T139 nucleotide sequence shown in SEQ ID NO : 1 , SEQ ID NO: 3, or the cDNA of ATCC 98694
  • DNA sequence polymorphisms that lead to changes in the amino acid sequences of T139 may exist within a population (e.g., the human population) .
  • Such genetic polymorphism in the T139 gene may exist among individuals within a population due to natural allelic variation.
  • the terms "gene” and "recombinant gene” refer to nucleic acid molecules comprising an open reading frame encoding a T139 protein, preferably a mammalian T139 protein.
  • Such natural allelic variations can typically result in 1-5% variance in the nucleotide sequence of the T139 gene. Any and all such nucleotide variations and resulting amino acid polymorphisms in T139 that are the result of natural allelic variation and that do not alter the functional activity of T139 are intended to be within the scope of the invention.
  • nucleic acid molecules encoding T139 proteins from other species which have a nucleotide sequence which differs from that of a human T139, are intended to be within the scope of the invention.
  • Nucleic acid molecules corresponding to natural allelic variants and homologues of the T139 cDNA of the invention can be isolated based on their identity to the human T139 nucleic acids disclosed herein using the human cDNAs, or a portion thereof, as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions.
  • a membrane-bound human T139 cDNA can be isolated based on its identity to soluble T139.
  • an isolated nucleic acid molecule of the invention is at least 300 (325, 350, 375, 400, 425, 450, 500, 550, 600, 650, 700, 800, 900, 1000, or 1290) nucleotides in length and - 17 - hybridizes under stringent conditions to the nucleic acid molecule comprising the nucleotide sequence, preferably the coding sequence, of SEQ ID N0:1, SEQ ID NO : 3 , or the cDNA of ATCC 98694.
  • hybridizes under stringent conditions is intended to describe conditions for hybridization and washing under which nucleotide sequences at least 60% (65%, 70%, preferably 75%) identical to each other typically remain hybridized to each other.
  • stringent conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989) , 6.3.1-6.3.6.
  • a preferred, non-limiting example of stringent hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45°C, followed by one or more washes in 0.2 X SSC, 0.1% SDS at 50-65°C.
  • an isolated nucleic acid molecule of the invention that hybridizes under stringent conditions to the sequence of SEQ ID NO:l, SEQ ID NO: 3, the cDNA of ATCC 98694 corresponds to a naturally- occurring nucleic acid molecule.
  • a "naturally-occurring" nucleic acid molecule refers to an RNA or DNA molecule having a nucleotide sequence that occurs in nature (e.g., encodes a natural protein) .
  • allelic variants of the T139 sequence that may exist in the population, the skilled artisan will further appreciate that changes can be introduced by mutation into the nucleotide sequence of SEQ ID NO : 1 , SEQ ID NO: 3, the cDNA of ATCC 98694, thereby leading to changes in the amino acid sequence of the encoded T139 protein, without altering the functional ability of the T139 protein. For example, one can make nucleotide substitutions leading to amino acid substitutions at "non-essential" amino acid residues.
  • non-essential amino acid residue is a - 18 - residue that can be altered from the wild-type sequence of T139 (e.g., the sequence of SEQ ID N0:2) without altering the biological activity, whereas an "essential" amino acid residue is required for biological activity.
  • amino acid residues that are conserved among the T139 proteins of various species are predicted to be particularly unamenable to alteration.
  • preferred T139 proteins of the present invention contain at least one SCP-like, C-type lectin, or EGF-like domain.
  • conserved domains are less likely to be amenable to mutation.
  • Other amino acid residues, however, may not be essential for activity and thus are likely to be amenable to alteration.
  • nucleic acid molecules encoding T139 proteins that contain changes in amino acid residues that are not essential for activity. Such T139 proteins differ in amino acid sequence from SEQ ID NO : 2 yet retain biological activity.
  • the isolated nucleic acid molecule includes a nucleotide sequence encoding a protein that includes an amino acid sequence that is at least about 45% identical, 65%, 75%, 85%, 95%, or 98% identical to the amino acid sequence of SEQ ID NO: 2.
  • An isolated nucleic acid molecule encoding a T139 protein having a sequence which differs from that of SEQ ID NO: 2 can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of SEQ ID NO : 1 , SEQ ID NO: 3, the cDNA of ATCC 98694 such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations can be introduced by standard techniques, such as site-directed mutagenesis - 19 - and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted non-essential amino acid residues.
  • a “conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain.
  • Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine) , acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
  • a predicted nonessential amino acid residue in T139 is preferably replaced with another amino acid residue from the same side chain family.
  • mutations can be introduced randomly along all or part of a T139 coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for T139 biological activity to identify mutants that retain activity. Following mutagenesis, the encoded protein can be expressed recombinantly and the activity of the protein can be determined.
  • a mutant T139 protein can be assayed for: (1) the ability to form protein: protein interactions with proteins; or (2) the ability to bind a T139 receptor. In yet another preferred embodiment, a mutant T139 can be assayed for the ability to modulate cellular proliferation or cellular differentiation. - 20 -
  • the present invention encompasses antisense nucleic acid molecules, i.e., molecules which are complementary to a sense nucleic acid encoding a protein, e.g., complementary to the coding strand of a double- stranded cDNA molecule or complementary to an mRNA sequence. Accordingly, an antisense nucleic acid can hydrogen bond to a sense nucleic acid.
  • the antisense nucleic acid can be complementary to an entire T139 coding strand, or to only a portion thereof, e.g., all or part of the protein coding region (or open reading frame) .
  • An antisense nucleic acid molecule can be antisense to a noncoding region of the coding strand of a nucleotide sequence encoding T139.
  • the noncoding regions (“5' and 3' untranslated regions") are the 5' and 3' sequences which flank the coding region and are not translated into amino acids.
  • antisense nucleic acids of the invention can be designed according to the rules of Watson and Crick base pairing.
  • the antisense nucleic acid molecule can be complementary to the entire coding region of T139 mRNA, but more preferably is an oligonucleotide which is antisense to only a portion of the coding or noncoding region of T139 mRNA.
  • the antisense oligonucleotide can be complementary to the region surrounding the translation start site of T139 mRNA, e.g., an oligonucleotide having the sequence CTCTGGATGCAGCATGGGTCTGTTGGGCCC (SEQ ID NO: 12) or GATGCAGCATGGGTCTGTTG (SEQ ID NO: 13).
  • An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length.
  • An antisense nucleic acid of the invention can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art.
  • an antisense nucleic acid e.g., an - 21 - antisense oligonucleotide
  • an antisense nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used.
  • modified nucleotides which can be used to generate the antisense nucleic acid include 5- fluorouracil , 5-bromouracil , 5-chlorouracil , 5- iodouracil, hypoxanthine , xanthine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5- carboxymethylaminomethyl -2 -thiouridine , 5- carboxymethylaminomethyluracil, dihydrouracil , beta-D- galactosylqueosine, inosine, N6-isopentenyladenine, 1- methylguanine, 1-methylinosine, 2 , 2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3 -methylcytosine, 5- methylcytosine, N6-adenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2- thiouracil, beta-D-
  • the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).
  • an expression vector into which a nucleic acid has been subcloned in an antisense orientation i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).
  • the antisense nucleic acid molecules of the invention are typically administered to a subject or generated in si tu such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding a T139 protein to thereby inhibit expression of the protein, e.g., by inhibiting transcription and/or translation.
  • the hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule which binds to DNA duplexes, through specific interactions in the major groove of the double helix.
  • An example of a route of administration of antisense nucleic acid molecules of the invention include direct injection at a tissue site.
  • antisense nucleic acid molecules can be modified to target selected cells and then administered systemically .
  • antisense molecules can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecules to peptides or antibodies which bind to cell surface receptors or antigens.
  • the antisense nucleic acid molecules can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of the antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol III promoter are preferred.
  • An antisense nucleic acid molecule of the invention can be an ⁇ -anomeric nucleic acid molecule.
  • An ⁇ -anomeric nucleic acid molecule forms specific double- stranded hybrids with complementary RNA in which, contrary to the usual 3-units, the strands run parallel to each other (Gaultier et al . (1987) Nucleic Acids . Res . 15:6625-6641).
  • the antisense nucleic acid molecule can - 23 - also comprise a 2 ' -o-methylribonucleotide (Inoue et al . (1987) Nucleic Acids Res . 15:6131-6148) or a chimeric RNA-DNA analogue (Inoue et al . (1987) FEES Lett . 215:327- 330) .
  • the invention also encompasses ribozymes.
  • Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region.
  • ribozymes e.g., hammerhead ribozymes (described in Haselhoff and Gerlach (1988)
  • a ribozyme having specificity for a T139- encoding nucleic acid can be designed based upon the nucleotide sequence of a T139 cDNA disclosed herein (e.g., SEQ ID N0:1, SEQ ID NO:3).
  • a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a T139-encoding mRNA. See, e.g., Cech et al .
  • T139 mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel and Szostak (1993) Science 261:1411-1418.
  • the invention also encompasses nucleic acid molecules which form triple helical structures.
  • T139 gene expression can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the T139 (e.g., the T139 promoter and/or enhancers) to form triple helical structures that prevent transcription of the T139 gene in target cells.
  • the nucleic acid molecules of the invention can be modified at the base moiety, sugar moiety or phosphate backbone to improve, e.g., the stability, hybridization, or solubility of the molecule.
  • the deoxyribose phosphate backbone of the nucleic acids can be modified to generate peptide nucleic acids (see Hyrup et al . (1996) Bioorganic & Medicinal Chemistry 4 (l):5-23).
  • peptide nucleic acids refer to nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained.
  • the neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength.
  • the synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols as described in Hyrup et al . (1996) supra ; Perry-O' Keefe et al . (1996) Proc . Natl . Acad . Sci . USA 93:14670-675.
  • PNAs of T139 can be used therapeutic and diagnostic applications.
  • PNAs can be used as antisense or antigene agents for sequence- specific modulation of gene expression by, e.g., inducing transcription or translation arrest or inhibiting replication.
  • PNAs of T139 can also be used, e.g., in the analysis of single base pair mutations in a gene by, e.g., PNA directed PCR clamping; as 'artificial restriction enzymes when used in combination with other enzymes, e.g., SI nucleases (Hyrup (1996) supra ; or as probes or primers for DNA sequence and hybridization
  • PNAs of T139 can be modified, e.g., to enhance their stability or cellular uptake, by attaching lipophilic or other helper groups to - 25 -
  • PNA by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art.
  • PNA-DNA chimeras of T139 can be generated which may combine the advantageous properties of PNA and DNA.
  • Such chimeras allow DNA recognition enzymes, e.g., RNAse H and DNA polymerases, to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity.
  • PNA-DNA chimeras can be linked using linkers of appropriate lengths selected in terms of base stacking, number of bonds between the nucleobases, and orientation (Hyrup (1996) supra) .
  • PNA-DNA chimeras can be performed as described in Hyrup (1996) supra and Finn et al. (1996) Nucleic Acids Research 24 (17) : 3357-63.
  • a DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry and modified nucleoside analogs, e.g., 5'-(4- methoxytrityl) amino-5' -deoxy-thymidine phosphoramidite, can be used as a between the PNA and the 5 ' end of DNA (Mag et al . (1989) Nucleic Acid Res . 17:5973-88).
  • PNA monomers are then coupled in a stepwise manner to produce a chimeric molecule with a 5' PNA segment and a 3' DNA segment (Finn et al . (1996) Nucleic Acids Research 24 (17) : 3357-63) .
  • chimeric molecules can be synthesized with a 5' DNA segment and a 3' PNA segment (Peterser et al . (1975) Bioorganic Med . Chem . Lett . 5:1119-11124) .
  • the oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo) , or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al . (1989) Proc. Natl . Acad . Sci . USA 86:6553-6556; Le aitre et al . (1987) Proc . Natl . Acad. Sci . USA 84:648-652; PCT Publication No. W088/09810) or the blood-brain barrier (see, e.g., PCT Publication No. - 26 -
  • oligonucleotides can be modified with hybridization-triggered cleavage agents (see, e.g., Krol et al . (1988) Bio/Techniques 6:958-976) or intercalating agents (see, e.g., Zon (1988) Pharm . Res . 5:539-549).
  • the oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
  • T139 proteins and Anti-T139 Antibodies
  • One aspect of the invention pertains to isolated T139 proteins, and biologically active portions thereof, as well as polypeptide fragments suitable for use as immunogens to raise anti-T139 antibodies.
  • native T139 proteins can be isolated from cells or tissue sources by an appropriate purification scheme using standard protein purification techniques.
  • T139 proteins are produced by recombinant DNA techniques.
  • a T139 protein or polypeptide can be synthesized chemically using standard peptide synthesis techniques .
  • an “isolated” or “purified” protein or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the T139 protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized.
  • the language “substantially free of cellular material” includes preparations of T139 protein in which the protein is separated from cellular components of the cells from which it is isolated or recombinantly produced.
  • T139 protein that is substantially free of cellular material includes preparations of T139 protein having less than about 30%, 20%, 10%, or 5% (by - 27 - dry weight) of non-T139 protein (also referred to herein as a "contaminating protein”) .
  • T139 protein or biologically active portion thereof is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, 10%, or 5% of the volume of the protein preparation.
  • culture medium represents less than about 20%, 10%, or 5% of the volume of the protein preparation.
  • T139 protein is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals which are involved in the synthesis of the protein. Accordingly such preparations of T139 protein have less than about 30%, 20%, 10%, 5% (by dry weight) of chemical precursors or non-T139 chemicals.
  • Biologically active portions of a T139 protein include peptides comprising amino acid sequences sufficiently identical to or derived from the amino acid sequence of the T139 protein (e.g., the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 4), which include less amino acids than the full length T139 proteins, and exhibit at least one activity of a T139 protein.
  • biologically active portions comprise a domain or motif with at least one activity of the T139 protein.
  • a biologically active portion of a T139 protein can be a polypeptide which is, for example, 10, 25, 50, 100 or more amino acids in length.
  • Preferred biologically active polypeptides include one or more identified T139 structural domains, e.g., SCP-like domain (SEQ ID NO:5), C-type lectin domain (SEQ ID NO:6), or one of the EGF-like domains (SEQ ID NO: 7 and 8) .
  • T139 protein has the amino acid - 28 - sequence shown of SEQ ID NO: 2.
  • Other useful T139 proteins are substantially identical to SEQ ID NO : 2 and retain the functional activity of the protein of SEQ ID NO: 2 yet differ in amino acid sequence due to natural allelic variation or mutagenesis.
  • a useful T139 protein is a protein which includes an amino acid sequence at least about 45%, preferably 55%, 65%, 75%, 85%, 95%, or 99% identical to the amino acid sequence of SEQ ID NO: 2 and retains the functional activity of the T139 proteins of SEQ ID NO:2.
  • the T139 protein is a protein having an amino acid sequence 55%, 65%, 75%, 85%, 95%, or 98% identical to the SCP- like, C-type lectin, or EGF-like domain (any one of SEQ ID NOS:5-8).
  • the T139 protein retains the functional activity of the T139 protein of SEQ ID NO: 2.
  • the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence) .
  • the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position.
  • the determination of percent homology between two sequences can be accomplished using a mathematical algorithm.
  • a preferred, non-limiting example of a mathematical algorithm utilized for the comparison of two - 29 - sequences is the algorithm of Karlin and Altschul (1990) Proc . Natl . Acad . Sci . USA 87:2264-2268, modified as in Karlin and Altschul (1993) Proc . Natl . Acad . Sci . USA 90:5873-5877.
  • Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al . (1990) J. Mol . Biol . 215:403-410.
  • Gapped BLAST can be utilized as described in Altschul et al . (1997) Nucleic Acids Res . 25:3389-3402.
  • the default parameters of the respective programs e.g., XBLAST and NBLAST
  • the percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, only exact matches are counted.
  • T139 chimeric or fusion proteins.
  • a T139 "chimeric protein” or “fusion protein” comprises a T139 polypeptide operatively linked to a non-T139 polypeptide.
  • a "T139 - 30 - polypeptide” refers to a polypeptide having an amino acid sequence corresponding to T139
  • a “non-T139 polypeptide” refers to a polypeptide having an amino acid sequence corresponding to a protein which is not substantially identical to the T139 protein, e.g., a protein which is different from the T139 protein and which is derived from the same or a different organism.
  • the T139 polypeptide can correspond to all or a portion of a T139 protein, preferably at least one biologically active portion of a T139 protein.
  • the term "operatively linked" is intended to indicate that the T139 polypeptide and the non-T139 polypeptide are fused in- frame to each other.
  • the non-T139 polypeptide can be fused to the N-terminus or C-terminus of the T139 polypeptide .
  • One useful fusion protein is a GST-T139 fusion protein in which the T139 sequences are fused to the C- terminus of the GST sequences. Such fusion proteins can facilitate the purification of recombinant T139.
  • the fusion protein is a T139 protein containing a heterologous signal sequence at its N-terminus.
  • the native T139 signal sequence i.e., about amino acids 1 to 22 of SEQ ID NO:2
  • T139 can be increased through use of a heterologous signal sequence.
  • the gp67 secretory sequence of the baculovirus envelope protein can be used as a heterologous signal sequence ( Current Protocols in Molecular Biology, Ausubel et al . , eds . , John Wiley & Sons, 1992) .
  • Other examples of eukaryotic heterologous signal sequences include the secretory sequences of melittin and human placental alkaline phosphatase - 3 1 -
  • useful prokaryotic heterologous signal sequences include the phoA secretory signal (Molecular cloning, Sambrook et al , second edition, Cold spring harbor laboratory press, 1989) and the protein A secretory signal (Pharmacia Biotech; Piscataway, New Jersey) .
  • the fusion protein is an T139-immunoglobulin fusion protein in which all or part of T139 is fused to sequences derived from a member of the immunoglobulin protein family.
  • T139-immunoglobulin fusion proteins of the invention can be incorporated into pharmaceutical compositions and administered to a subject to inhibit an interaction between a T139 receptor and a T139 protein on the surface of a cell, to thereby suppress T139-mediated signal transduction in vivo .
  • T139-immunoglobulin fusion proteins of the invention can be used as immunogens to produce anti-T139 antibodies in a subject, to purify T139 receptors and in screening assays to identify molecules which inhibit the interaction of T139 with its receptor.
  • a T139 chimeric or fusion protein of the invention is produced by standard recombinant DNA techniques.
  • DNA fragments coding for the different polypeptide sequences are ligated together in- frame in accordance with conventional techniques, for example by employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid - 32 - undesirable joining, and enzymatic ligation.
  • the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers.
  • PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence (see, e.g., Current Protocols in Molecular Biology, Ausubel et al . eds . , John Wiley & Sons: 1992).
  • anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence
  • expression vectors are commercially available that already encode a fusion moiety (e.g., a GST polypeptide) .
  • An T139-encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the T139 protein.
  • the present invention also pertains to variants of the T139 proteins which function as either T139 agonists (mimetics) or as T139 antagonists.
  • Variants of the T139 protein can be generated by mutagenesis, e.g., discrete point mutation or truncation of the T139 protein.
  • An agonist of the T139 protein can retain substantially the same, or a subset, of the biological activities of the naturally occurring form of the T139 protein.
  • An antagonist of the T139 protein can inhibit one or more of the activities of the naturally occurring form of the
  • T139 protein by, for example, competitively binding to a downstream or upstream member of a cellular signaling cascade which includes the T139 protein.
  • specific biological effects can be elicited by treatment with a variant of limited function.
  • Treatment of a subject with a variant having a subset of the biological activities of the naturally occurring form of the protein can have fewer side effects in a subject relative to treatment with the naturally occurring form of the T139 proteins.
  • Variants of the T139 protein which function as either T139 agonists (mimetics) or as T139 antagonists can be identified by screening combinatorial libraries of mutants, e.g., truncation mutants, of the T139 protein for T139 protein agonist or antagonist activity.
  • a variegated library of T139 variants is generated by combinatorial mutagenesis at the nucleic acid level and is encoded by a variegated gene library.
  • a variegated library of T139 variants can be produced by, for example, enzymatically ligating a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential T139 sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g., for phage display) containing the set of T139 sequences therein.
  • a degenerate set of potential T139 sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g., for phage display) containing the set of T139 sequences therein.
  • methods which can be used to produce libraries of potential T139 variants from a degenerate oligonucleotide sequence. Chemical synthesis of a degenerate gene sequence can be performed in an automatic DNA synthesizer, and the synthetic gene then ligated into an appropriate expression vector.
  • libraries of fragments of the T139 protein coding sequence can be used to generate a variegated population of T139 fragments for screening and subsequent selection of variants of a T139 protein.
  • a library of coding sequence fragments can be generated by treating a double stranded PCR - 34 - fragment of a T139 coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double stranded DNA, renaturing the DNA to form double stranded DNA which can include sense/antisense pairs from different nicked products, removing single stranded portions from reformed duplexes by treatment with SI nuclease, and ligating the resulting fragment library into an expression vector.
  • an expression library can be derived which encodes N-terminal and internal fragments of various sizes of the T139 protein.
  • Recursive ensemble mutagenesis (REM) , a technique which enhances the frequency of functional mutants in the libraries, can be used in combination with the screening assays to identify T139 variants (Arkin and Yourvan (1992) Proc . Natl . Acad . Sci . USA 89:7811-7815; Delgrave et al . (1993) Protein Engineering 6 (3) : 327-331) .
  • An isolated T139 protein, or a portion or fragment thereof, can be used as an immunogen to generate antibodies that bind T139 using standard techniques for polyclonal and monoclonal antibody preparation.
  • the - 35 - full-length T139 protein can be used or, alternatively, the invention provides antigenic peptide fragments of T139 for use as immunogens .
  • the antigenic peptide of T139 comprises at least 8 (preferably 10, 15, 20, or 30) amino acid residues of the amino acid sequence shown in SEQ ID NO: 2 and encompasses an epitope of T139 such that an antibody raised against the peptide forms a specific immune complex with T139.
  • Preferred epitopes encompassed by the antigenic peptide are regions of T139 that are located on the surface of the protein, e.g., hydrophilic regions.
  • a hydrophobicity analysis of the human T139 protein sequence indicates that the regions between, e.g., amino acids 125 and 140, between amino acids 265 and 280, and between amino acids 315 and 335 of SEQ ID NO : 2 are particularly hydrophilic and, therefore, are likely to encode surface residues useful for targeting antibody production.
  • a T139 immunogen typically is used to prepare antibodies by immunizing a suitable subject, (e.g., rabbit, goat, mouse or other mammal) with the immunogen.
  • An appropriate immunogenic preparation can contain, for example, recombinantly expressed T139 protein or a chemically synthesized T139 polypeptide.
  • the preparation can further include an adjuvant, such as Freund' s complete or incomplete adjuvant, or similar immunostimulatory agent. Immunization of a suitable subject with an immunogenic T139 preparation induces a polyclonal anti-T139 antibody response.
  • another aspect of the invention pertains to anti-T139 antibodies.
  • the term "antibody” as used herein refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site which specifically binds an antigen, such as - 36 -
  • a molecule which specifically binds to T139 is a molecule which binds T139, but does not substantially bind other molecules in a sample, e.g., a biological sample, which naturally contains T139.
  • immunologically active portions of immunoglobulin molecules include F(ab) and F(ab') 2 fragments which can be generated by treating the antibody with an enzyme such as pepsin.
  • the invention provides polyclonal and monoclonal antibodies that bind T139.
  • the term "monoclonal antibody” or “monoclonal antibody composition”, as used herein, refers to a population of antibody molecules that contain only one species of an antigen binding site capable of immunoreacting with a particular epitope of T139. A monoclonal antibody composition thus typically displays a single binding affinity for a particular T139 protein with which it immunoreacts .
  • Polyclonal anti-T139 antibodies can be prepared as described above by immunizing a suitable subject with a T139 immunogen.
  • the anti-T139 antibody titer in the immunized subject can be monitored over time by standard techniques, such as with an enzyme linked immunosorbent assay (ELISA) using immobilized T139.
  • ELISA enzyme linked immunosorbent assay
  • the antibody molecules directed against T139 can be isolated from the mammal (e.g., from the blood) and further purified by well-known techniques, such as protein A chromatography to obtain the IgG fraction.
  • antibody-producing cells can be obtained from the subject and used to prepare monoclonal antibodies by standard techniques, such as the hybridoma technique originally described by Kohler and Milstein (1975) Nature 256:495-497, the human B cell hybridoma technique (Kozbor et al . (1983) Immunol Today 4:72), the EBV-hybridoma technique (Cole et al . (1985) , Monoclonal Antibodies and Cancer Therapy, Alan R. - 37 -
  • an immortal cell line typically a myeloma
  • lymphocytes typically splenocytes
  • the immortal cell line (e.g., a myeloma cell line) is derived from the same mammalian species as the lymphocytes.
  • murine hybridomas can be made by fusing lymphocytes from a mouse immunized with an immunogenic preparation of the present invention with an immortalized mouse cell line, e.g., a myeloma cell line that is sensitive to culture medium containing hypoxanthine , aminopterin and thymidine ("HAT medium") .
  • an immortalized mouse cell line e.g., a myeloma cell line that is sensitive to culture medium containing hypoxanthine , aminopterin and thymidine ("HAT medium") .
  • HAT medium hypoxanthine , aminopterin and thymidine
  • Any of a number of myeloma cell lines can be used as a fusion partner according to standard techniques, e.g., the P3- NSl/l-Ag4-l, P3-x63-Ag8.653 or Sp2/0-Agl4 myeloma lines. These myeloma lines
  • HAT-sensitive mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol ("PEG") .
  • PEG polyethylene glycol
  • Hybridoma cells resulting from the fusion are then selected using HAT medium, which kills unfused and unproductively fused myeloma cells (unfused splenocytes die after several days because they are not transformed) .
  • Hybridoma cells producing a monoclonal antibody of the invention are detected by screening the hybridoma culture supernatants for antibodies that bind T139, e.g., using a standard ELISA assay.
  • a monoclonal anti-T139 antibody can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e.g., an antibody phage display library) with T139 to thereby isolate immunoglobulin library members that bind T139.
  • Kits for generating and screening phage display libraries are commercially available (e.g., the Pharmacia .Reco.TLbi.nant Phage Antibody System, Catalog No. 27-9400-01; and the Stratagene Surf ZAPTM Phage Display Ki t , Catalog No. 240612) .
  • examples of methods and reagents particularly amenable for use in generating and screening antibody display library can be found in, for example, U.S. Patent No. 5,223,409; PCT Publication No. WO 92/18619; PCT Publication No. WO 91/17271; PCT Publication WO 92/20791; PCT Publication No. WO 92/15679; PCT Publication WO 93/01288; PCT Publication No. WO 92/01047; PCT Publication No. WO 92/09690; PCT Publication No. WO 90/02809; Fuchs et al . (1991) Bio/Technology 9:1370-1372; Hay et al . (1992) Hum. Antibod . Hybridomas 3:81-85; Huse et al . (1989) Science 246:1275-1281; Griffiths et al . (1993) EMBO J 12 : 725-734.
  • recombinant anti-T139 antibodies such as chimeric and humanized monoclonal antibodies, comprising both human and non-human portions, which can be made using standard recombinant DNA techniques, are - 3 9 - within the scope of the invention.
  • Such chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art, for example using methods described in PCT Publication No. WO 87/02671; European Patent Application 184,187; European Patent Application 171,496; European Patent Application 173,494; PCT Publication No. WO 86/01533; U.S. Patent No. 4,816,567; European Patent Application 125,023; Better et al.
  • An anti-T139 antibody (e.g., monoclonal antibody) can be used to isolate T139 by standard techniques, such as affinity chromatography or immunoprecipitation.
  • An anti-T139 antibody can facilitate the purification of natural T139 from cells and of recombinantly produced T139 expressed in host cells. Moreover, an anti-T139 antibody can be used to detect T139 protein (e.g., in a cellular lysate or cell supernatant) in order to evaluate the abundance and pattern of expression of the T139 protein. Anti-T139 antibodies can be used diagnostically to monitor protein levels in tissue as part of a clinical testing procedure, e.g., to, for example, determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling the antibody to a detectable substance.
  • Examples of detectable substances include various enzymes, prosthetic groups, fluorescent - 40 - materials, luminescent materials, bioluminescent materials, and radioactive materials.
  • suitable enzymes include horseradish peroxidase, alkaline phosphatase, 3-galactosidase, or acetylcholinesterase;
  • examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin;
  • examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin;
  • an example of a luminescent material includes luminol ;
  • examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include 125 1 , 131 I, 35 S or 3 H.
  • vectors preferably expression vectors, containing a nucleic acid encoding T139 (or a portion thereof) .
  • vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • plasmid refers to a circular double stranded DNA loop into which additional DNA segments can be ligated.
  • viral vector is another type of vector, wherein additional DNA segments can be ligated into the viral genome.
  • vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors) .
  • Other vectors e.g., non-episomal mammalian vectors
  • expression vectors are capable of directing the - 41 - expression of genes to which they are operatively linked.
  • expression vectors of utility in recombinant DNA techniques are often in the form of plasmids (vectors) .
  • the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses) , which serve equivalent functions.
  • the recombinant expression vectors of the invention comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operatively linked to the nucleic acid sequence to be expressed.
  • "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence (s) in a manner which allows for expression of the nucleotide sequence (e.g., in an in vi tro transcription/translation system or in a host cell when the vector is introduced into the host cell) .
  • regulatory sequence is intended to include promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990) . Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cell and those which direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences) . It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as - 42 - the choice of the host cell to be transformed, the level of expression of protein desired, etc.
  • the expression vectors of the invention can be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., T139 proteins, mutant forms of T139, fusion proteins, etc.).
  • the recombinant expression vectors of the invention can be designed for expression of T139 in prokaryotic or eukaryotic cells, e.g., bacterial cells such as E. coli , insect cells (using baculovirus expression vectors) yeast cells or mammalian cells. Suitable host cells are discussed further in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990) .
  • the recombinant expression vector can be transcribed and translated in vi tro, for example using T7 promoter regulatory sequences and T7 polymerase.
  • Fusion vectors add a number of amino acids to a protein encoded therein, usually to the amino terminus of the recombinant protein.
  • Such fusion vectors typically serve three purposes: 1) to increase expression of recombinant protein; 2) to increase the solubility of the recombinant protein; and 3) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification.
  • a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein.
  • Such enzymes, and their cognate recognition - 43 - sequences, include Factor Xa, thrombin and enterokinase .
  • Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith and Johnson (1988) Gene 67:31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ) which fuse glutathione S- transferase (GST) , maltose E binding protein, or protein A, respectively, to the target recombinant protein.
  • GST glutathione S- transferase
  • Suitable inducible non-fusion E. coli expression vectors include pTrc (Amann et al . , (1988) Gene 69:301-315) and pET lid (Studier et al . , Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 60-89) .
  • Target gene expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-lac fusion promoter.
  • Target gene expression from the pET lid vector relies on transcription from a T7 gnlO-lac fusion promoter mediated by a coexpressed viral RNA polymerase (T7 gnl) . This viral polymerase is supplied by host strains BL21(DE3) or HMS174(DE3) from a resident ⁇ prophage harboring a T7 gnl gene under the transcriptional control of the lacUV 5 promoter.
  • One strategy to maximize recombinant protein expression in E. coli is to express the protein in a host bacteria with an impaired capacity to proteolytically cleave the recombinant protein (Gottesman, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 119-128) .
  • Another strategy is to alter the nucleic acid sequence of the nucleic acid to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in E. coli (Wada et al . (1992) Nucleic Acids Res . 20:2111-2118). Such alteration of nucleic acid sequences of the invention can be carried out by standard DNA synthesis techniques. - 44 -
  • the T139 expression vector is a yeast expression vector.
  • yeast expression vectors for expression in yeast S. cerivisae include pYepSecl (Baldari et al . (1987) EMBO J. 6:229-234), pMFa (Kurjan and Herskowitz, (1982) Cell 30:933-943), pJRY88 (Schultz et al. (1987) Gene 54:113-123), pYES2 (Invitrogen Corporation, San Diego, CA) , and picZ (InVitrogen Corp, San Diego, CA) .
  • T139 can be expressed in insect cells using baculovirus expression vectors.
  • Baculovirus vectors available for expression of proteins in cultured insect cells include the pAc series (Smith et al . (1983) Mol . Cell Biol . 3:2156-2165) and the pVL series (Lucklow and Summers (1989) Virology 170:31- 39) .
  • a nucleic acid of the invention is expressed in mammalian cells using a mammalian expression vector.
  • mammalian expression vectors include pCDM8 (Seed (1987) Nature 329:840) and pMT2PC (Kaufman et al . (1987) EMBO J. 6:187- 195) .
  • the expression vector's control functions are often provided by viral regulatory elements.
  • commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40.
  • suitable expression systems for both prokaryotic and eukaryotic cells see chapters 16 and 17 of Sambrook et al . ( supra) .
  • the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid) .
  • tissue-specific regulatory elements are known in the art.
  • suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert et al . (1987) Genes - 45 -
  • lymphoid-specific promoters Calame and Eaton (1988) Adv. Immunol . 43:235-275
  • promoters of T cell receptors Winoto and Baltimore (1989) EMBO J. 8 : 129 - 133
  • immunoglobulins Bonerji et al. (1983) Cell 33:729-740; Queen and Baltimore (1983) Cell 33:741-748
  • neuron-specific promoters e.g., the neurofilament promoter; Byrne and Ruddle (1989) Proc . Natl . Acad. Sci .
  • pancreas-specific promoters Eslund et al . (1985) Science 230:912-916)
  • mammary gland-specific promoters e.g., milk whey promoter; U.S. Patent No. 4,873,316 and European Application Publication No. 264,166
  • Developmentally- regulated promoters are also encompassed, for example the murine hox promoters (Kessel and Gruss (1990) Science 249:374-379) and the ⁇ -fetoprotein promoter (Campes and Tilghman (1989) Genes Dev. 3:537-546).
  • the invention further provides a recombinant expression vector comprising a DNA molecule of the invention cloned into the expression vector in an antisense orientation. That is, the DNA molecule is operatively linked to a regulatory sequence in a manner which allows for expression (by transcription of the DNA molecule) of an RNA molecule which is antisense to T139 mRNA. Regulatory sequences operatively linked to a nucleic acid cloned in the antisense orientation can be chosen which direct the continuous expression of the antisense RNA molecule in a variety of cell types, for instance viral promoters and/or enhancers, or regulatory sequences can be chosen which direct constitutive, tissue specific or cell type specific expression of antisense RNA.
  • the antisense expression vector can be in the form of a recombinant plasmid, phagemid or attenuated virus in which antisense nucleic acids are produced under the control of a high efficiency regulatory region, the activity of which can be determined by the cell type into - 46 - which the vector is introduced.
  • a recombinant plasmid, phagemid or attenuated virus in which antisense nucleic acids are produced under the control of a high efficiency regulatory region, the activity of which can be determined by the cell type into - 46 - which the vector is introduced.
  • a host cell can be any prokaryotic or eukaryotic cell.
  • T139 protein can be expressed in bacterial cells such as E. coli , insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells
  • Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques.
  • transformation or transfection techniques As used herein, the terms
  • transformation and transfection are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co- precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al . ( supra) , and other laboratory manuals.
  • a gene that encodes a selectable marker (e.g., resistance to antibiotics) is generally introduced into the host cells along with the gene of interest.
  • selectable markers include those which confer resistance to drugs, such as G418, hygromycin and methotrexate .
  • Nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as that encoding T139 or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die) .
  • a host cell of the invention such as a prokaryotic or eukaryotic host cell in culture, can be used to produce (i.e., express) T139 protein. Accordingly, the invention further provides methods for producing T139 protein using the host cells of the invention. In one embodiment, the method comprises culturing the host cell of invention (into which a recombinant expression vector encoding T139 has been introduced) in a suitable medium such that T139 protein is produced. In another embodiment, the method further comprises isolating T139 from the medium or the host cell.
  • the host cells of the invention can also be used to produce nonhuman transgenic animals.
  • a host cell of the invention is a fertilized oocyte or an embryonic stem cell into which T139-coding sequences have been introduced.
  • Such host cells can then be used to create non-human transgenic animals in which exogenous T139 sequences have been introduced into their genome or homologous recombinant - 48 - animals in which endogenous T139 sequences have been altered.
  • Such animals are useful for studying the function and/or activity of T139 and for identifying and/or evaluating modulators of T139 activity.
  • a "transgenic animal” is a non-human animal, preferably a mammal, more preferably a rodent such as a rat or mouse, in which one or more of the cells of the animal includes a transgene.
  • Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, amphibians, etc.
  • a transgene is exogenous DNA which is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome of the mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues of the transgenic animal.
  • an "homologous recombinant animal” is a non-human animal, preferably a mammal, more preferably a mouse, in which an endogenous T139 gene has been altered by homologous recombination between the endogenous gene and an exogenous DNA molecule introduced into a cell of the animal, e.g., an embryonic cell of the animal, prior to development of the animal.
  • a transgenic animal of the invention can be created by introducing T139-encoding nucleic acid into the male pronuclei of a fertilized oocyte, e.g., by microinj ection, retroviral infection, and allowing the oocyte to develop in a pseudopregnant female foster animal.
  • the T139 cDNA sequence e.g., that of (SEQ ID NO:l, SEQ ID NO : 3 , or the cDNA of ATCC 98694) can be introduced as a transgene into the genome of a non-human animal.
  • a nonhuman homologue of the human T139 gene such as a mouse T139 gene
  • a nonhuman homologue of the human T139 gene can be isolated based on hybridization to the human T139 cDNA and used as a transgene.
  • Intronic sequences and polyadenylation signals can also be included in the transgene to increase - 49 - the efficiency of expression of the transgene.
  • a tissue- specific regulatory sequence (s) can be operably linked to the T139 transgene to direct expression of T139 protein to particular cells.
  • transgenic founder animal can be identified based upon the presence of the T139 transgene in its genome and/or expression of T139 mRNA in tissues or cells of the animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene encoding T139 can further be bred to other transgenic animals carrying other transgenes .
  • a vector is prepared which contains at least a portion of a T139 gene (e.g., a human or a non-human homolog of the T139 gene, e.g., a murine T139 gene) into which a deletion, addition or substitution has been introduced to thereby alter, e.g., functionally disrupt, the T139 gene.
  • the vector is designed such that, upon homologous recombination, the endogenous T139 gene is functionally disrupted (i.e., no longer encodes a functional protein; also referred to as a "knock out" vector) .
  • the vector can be designed such that, upon homologous recombination, the endogenous T139 gene is mutated or otherwise altered but still encodes functional protein (e.g., the upstream regulatory region can be altered to thereby alter the expression of the - 50 - endogenous T139 protein) .
  • the altered portion of the T139 gene is flanked at its 5' and 3' ends by additional nucleic acid of the T139 gene to allow for homologous recombination to occur between the exogenous T139 gene carried by the vector and an endogenous T139 gene in an embryonic stem cell.
  • the additional flanking T139 nucleic acid is of sufficient length for successful homologous recombination with the endogenous gene.
  • flanking DNA both at the 5' and 3' ends
  • the vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced T139 gene has homologously recombined with the endogenous T139 gene are selected (see e.g., Li et al . (1992) Cell 69:915) .
  • the selected cells are then injected into a blastocyst of an animal (e.g., a mouse) to form aggregation chimeras (see, e.g., Bradley in
  • transgenic non-humans animals can be produced which contain selected systems which allow for regulated expression of the transgene.
  • a system is the cre/loxP recombinase system of bacteriophage PI.
  • cre/loxP recombinase system of bacteriophage PI.
  • a recombinase system is the FLP recombinase system of Saccharomyces cerevisiae (0' Gorman et al . (1991) Science 251:1351-1355.
  • mice containing transgenes encoding both the Cre recombinase and a selected protein are required.
  • Such animals can be provided through the construction of "double" transgenic animals, e.g., by mating two transgenic animals, one containing a transgene encoding a selected protein and the other containing a transgene encoding a recombinase.
  • Clones of the non-human transgenic animals described herein can also be produced according to the methods described in Wilmut et al . (1997) Nature 385:810- 813 and PCT Publication ⁇ os . WO 97/07668 and WO 97/07669.
  • a cell e.g., a somatic cell
  • the quiescent cell can then be fused, e.g., through the use of electrical pulses, to an enucleated oocyte from an animal of the same species from which the quiescent cell is isolated.
  • the reconstructed oocyte is then cultured such that it develops to morula or blastocyte and then transferred to pseudopregnant female foster animal.
  • the offspring borne of this female foster animal will be a clone of the animal from which the cell, e.g., the somatic cell, is isolated. - 52 -
  • compositions suitable for administration can be incorporated into pharmaceutical compositions suitable for administration.
  • Such compositions typically comprise the nucleic acid molecule, protein, or antibody and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration.
  • the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated.
  • Supplementary active compounds can also be incorporated into the compositions.
  • a pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal , and rectal administration.
  • Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens ; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the - 53 - adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • the parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
  • compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF; Parsippany, NJ) or phosphate buffered saline (PBS) .
  • the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi .
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol , phenol, ascorbic acid, thimerosal , and the like.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the - 54 - composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions can be prepared by incorporating the active compound (e.g., a T139 protein or anti-T139 antibody) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • the active compound e.g., a T139 protein or anti-T139 antibody
  • dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition.
  • the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a - 55 - glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
  • a suitable propellant e.g., a gas such as carbon dioxide, or a nebulizer.
  • Systemic administration can also be by transmucosal or transdermal means.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.
  • Transmucosal administration can be accomplished through the use of nasal sprays or suppositories .
  • the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
  • the compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
  • the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art.
  • the materials can also be obtained commercially from Alza Corporation and Nova - 56 -
  • Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.
  • Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • the specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.
  • the nucleic acid molecules of the invention can be inserted into vectors and used as gene therapy vectors .
  • Gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration (see U.S. Patent 5,328,470) or by stereotactic injection (see e.g., Chen et al . (1994) Proc . Natl . Acad. Sci . USA 91:3054-3057).
  • the pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded.
  • the pharmaceutical preparation can - 57 - include one or more cells which produce the gene delivery system.
  • compositions can be included in a container, pack, or dispenser together with instructions for administration.
  • the nucleic acid molecules, proteins, protein homologues, and antibodies described herein can be used in one or more of the following methods: a) screening assays; b) detection assays (e.g., chromosomal mapping, tissue typing, forensic biology) , c) predictive medicine (e.g., diagnostic assays, prognostic assays, monitoring clinical trials, and pharmacogenomics) ; and d) methods of treatment (e.g., therapeutic and prophylactic) .
  • a T139 protein interacts with other cellular proteins and can thus be used for (i) regulation of cellular proliferation; (ii) regulation of cellular differentiation; and (iii) regulation of cell survival.
  • the isolated nucleic acid molecules of the invention can be used to express T139 protein (e.g., via a recombinant expression vector in a host cell in gene therapy applications), to detect T139 mRNA (e.g., in a biological sample) or a genetic lesion in a T139 gene, and to modulate T139 activity.
  • T139 proteins can be used to screen drugs or compounds which modulate the T139 activity or expression as well as to treat disorders characterized by insufficient or excessive production of T139 protein or production of T139 protein forms which have decreased or aberrant activity compared to T139 wild type protein.
  • the anti-T139 antibodies of the invention can be used to detect and isolate T139 proteins and modulate T139 activity. This invention further pertains to novel agents identified by the above-described screening assays and uses thereof for treatments as described herein.
  • the invention provides a method (also referred to herein as a "screening assay") for identifying modulators, i.e., candidate or test compounds or agents (e.g., peptides, peptidomimetics, small molecules or other drugs) which bind to T139 proteins or have a stimulatory or inhibitory effect on, for example, T139 expression or T139 activity.
  • modulators i.e., candidate or test compounds or agents (e.g., peptides, peptidomimetics, small molecules or other drugs) which bind to T139 proteins or have a stimulatory or inhibitory effect on, for example, T139 expression or T139 activity.
  • the invention provides assays for screening candidate or test compounds which bind to or modulate the activity of a T139 polypeptide or biologically active portion thereof.
  • the test compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the 'one-bead one-compound' library method; and synthetic library methods using affinity chromatography selection.
  • the biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam (1997) Anticancer Drug Des . 12:145) .
  • an assay is a cell -based assay in which a cell which expresses T139 protein, or a biologically active portion thereof, is contacted with a test compound and the ability of the test compound to bind to a T139 protein determined.
  • the cell for example, can be a yeast cell or a cell of mammalian origin. Determining the ability of the test compound to bind to the T139 protein can be accomplished, for example, by coupling the test compound with a radioisotope or enzymatic label such that binding of the test compound to the T139 protein or biologically active portion thereof can be determined by detecting the labeled compound in a complex.
  • test compounds can be labeled with 125 I, 35 S, 14 C, or 3 H, either directly or indirectly, and the radioisotope detected by direct counting of radioemmission or by scintillation counting.
  • test compounds can be enzymatically labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determination of conversion of an appropriate substrate to product .
  • the assay comprises contacting a cell which - 60 - expresses a T139 protein, or a biologically active portion thereof, with a known compound which binds T139 to form an assay mixture, contacting the assay mixture with a test compound, and determining the ability of the test compound to interact with a T139 protein, wherein determining the ability of the test compound to interact with a T139 protein comprises determining the ability of the test compound to preferentially bind to T139 or a biologically active portion thereof as compared to the known compound.
  • an assay is a cell -based assay comprising contacting a cell expressing a T139 protein, or a biologically active portion thereof, with a test compound and determining the ability of the test compound to modulate (e.g., stimulate or inhibit) the activity of the T139 protein or biologically active portion thereof. Determining the ability of the test compound to modulate the activity of T139 or a biologically active portion thereof can be accomplished, for example, by determining the ability of the T139 protein to bind to or interact with a T139 target molecule.
  • a "target molecule” is a molecule with which a T139 protein binds or interacts in nature, for example, a T139 receptor, a molecule in the extracellular milieu, or a molecule associated with the external surface of a cell membrane.
  • a T139 target molecule can be a non-T139 molecule or a T139 protein or polypeptide of the present invention.
  • a T139 target molecule is a component of a signal transduction pathway which facilitates transduction of an extracellular signal (e.g., a signal generated by binding of a T139 molecule to its receptor) through the cell membrane and into the cell .
  • Determining the ability of the T139 protein to bind to or interact with a T139 target molecule can be - 61 - accomplished by one of the methods described above for determining direct binding. In a preferred embodiment, determining the ability of the T139 protein to bind to or interact with a T139 target molecule can be accomplished by determining the activity of the target molecule.
  • the activity of the target molecule can be determined by detecting induction of a cellular second messenger of the target (e.g., intracellular Ca 2+ , diacylglycerol, IP3, etc.), detecting catalytic/enzymatic activity of the target an appropriate substrate, detecting the induction of a reporter gene (e.g., a T139- responsive regulatory element operatively linked to a nucleic acid encoding a detectable marker, e.g. luciferase) , or detecting a cellular response, for example, cell survival, cellular differentiation, or cell proliferation.
  • a reporter gene e.g., a T139- responsive regulatory element operatively linked to a nucleic acid encoding a detectable marker, e.g. luciferase
  • detecting a cellular response for example, cell survival, cellular differentiation, or cell proliferation.
  • an assay of the present invention is a cell -free assay comprising contacting a T139 protein or biologically active portion thereof with a test compound and determining the ability of the test compound to bind to the T139 protein or biologically active portion thereof. Binding of the test compound to the T139 protein can be determined either directly or indirectly as described above.
  • the assay includes contacting the T139 protein or biologically active portion thereof with a known compound which binds T139 to form an assay mixture, contacting the assay mixture with a test compound, and determining the ability of the test compound to interact with a T139 protein, wherein determining the ability of the test compound to interact with a T139 protein comprises determining the ability of the test compound to preferentially bind to T139 or biologically active portion thereof as compared to the known compound.
  • an assay is a cell -free assay comprising contacting T139 protein or biologically active portion thereof with a test compound and determining the ability of the test compound to modulate (e.g., stimulate or inhibit) the activity of the T139 protein or biologically active portion thereof. Determining the ability of the test compound to modulate the activity of T139 can be accomplished, for example, by determining the ability of the T139 protein to bind to a T139 target molecule by one of the methods described above for determining direct binding. In an alternative embodiment, determining the ability of the test compound to modulate the activity of T139 can be accomplished by determining the ability of the T139 protein further modulate a T139 target molecule. For example, the catalytic/enzymatic activity of the target molecule on an appropriate substrate can be determined as previously described.
  • the cell -free assay comprises contacting the T139 protein or biologically active portion thereof with a known compound which binds T139 to form an assay mixture, contacting the assay mixture with a test compound, and determining the ability of the test compound to interact with a T139 protein, wherein determining the ability of the test compound to interact with a T139 protein comprises determining the ability of the T139 protein to preferentially bind to or modulate the activity of a T139 target molecule.
  • solubilizing agent such that a membrane-bound form of T139 is maintained in solution.
  • solubilizing agents include non-ionic detergents such as n-octylglucoside, n-dodecylglucoside, n-dodecylmaltoside, octanoyl -N-methylglucamide , decanoyl -N-methylglucamide , Triton ® X-100, Triton ® X-114, Thesit ® , - 63 -
  • T139 or its target molecule it may be desirable to immobilize either T139 or its target molecule to facilitate separation of complexed from uncomplexed forms of one or both of the proteins, as well as to accommodate automation of the assay.
  • Binding of a test compound to T139, or interaction of T139 with a target molecule in the presence and absence of a candidate compound can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtitre plates, test tubes, and micro-centrifuge tubes.
  • a fusion protein can be provided which adds a domain that allows one or both of the proteins to be bound to a matrix.
  • glutathione-S- transferase/T139 fusion proteins or glutathione-S- transferase/target fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical; St. Louis, MO) or glutathione derivatized microtitre plates, which are then combined with the test compound or the test compound and either the non-adsorbed target protein or T139 protein, and the mixture incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH) . Following incubation, the beads or microtitre plate wells are washed to remove any unbound components, the matrix immobilized in the case of beads, complex determined either directly or indirectly, for example, as described above. Alternatively, the complexes can be dissociated from the matrix, and the level of T139 binding or activity determined using standard techniques. - 64 -
  • T139 or its target molecule can be immobilized utilizing conjugation of biotin and streptavidin.
  • Biotinylated T139 or target molecules can be prepared from biotin-NHS (N-hydroxy- succinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals; Rockford, IL) , and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical) .
  • antibodies reactive with T139 or target molecules but which do not interfere with binding of the T139 protein to its target molecule can be derivatized to the wells of the plate, and unbound target or T139 trapped in the wells by antibody conjugation.
  • Methods for detecting such complexes include immunodetection of complexes using antibodies reactive with the T139 or target molecule, as well as enzyme-linked assays which rely on detecting an enzymatic activity associated with the T139 or target molecule.
  • modulators of T139 expression are identified in a method in which a cell is contacted with a candidate compound and the expression of T139 mRNA or protein in the cell is determined.
  • the level of expression of T139 mRNA or protein in the presence of the candidate compound is compared to the level of expression of T139 mRNA or protein in the absence of the candidate compound.
  • the candidate compound can then be identified as a modulator of T139 expression based on this comparison. For example, when expression of T139 mRNA or protein is greater (statistically significantly greater) in the presence of the candidate compound than in its absence, the candidate compound is identified as a stimulator of T139 mRNA or - 65 - protein expression.
  • the candidate compound when expression of T139 mRNA or protein is less (statistically significantly less) in the presence of the candidate compound than in its absence, the candidate compound is identified as an inhibitor of T139 mRNA or protein expression.
  • the level of T139 mRNA or protein expression in the cells can be determined by methods described herein for detecting T139 mRNA or protein.
  • the T139 proteins can be used as "bait proteins" in a two-hybrid assay or three hybrid assay (see, e.g., U.S. Patent No. 5,283,317; Zervos et al . (1993) Cell 72:223-232; Madura et al . (1993) J. Biol . Chem . 268:12046-12054; Bartel et al . (1993) Bio/Techniques 14:920-924; Iwabuchi et al .
  • T139-binding proteins proteins which bind to or interact with T139
  • T139-binding proteins proteins which bind to or interact with T139
  • T139-binding proteins are also likely to be involved in the propagation of signals by the T139 proteins as, for example, upstream or downstream elements of the T139 pathway.
  • the two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains.
  • the assay utilizes two different DNA constructs.
  • the gene that codes for T139 is fused to a gene encoding the DNA binding domain of a known transcription factor (e.g., GAL-4).
  • a DNA sequence, from a library of DNA sequences, that encodes an unidentified protein (“prey" or "sample”) is fused to a gene that codes for the activation domain of the known transcription factor.
  • the DNA- binding and activation domains of the transcription - 66 - factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ) which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected and cell colonies containing the functional transcription factor can be isolated and used to obtain the cloned gene which encodes the protein which interacts with T139.
  • a reporter gene e.g., LacZ
  • This invention further pertains to novel agents identified by the above-described screening assays and uses thereof for treatments as described herein.
  • cDNA sequences identified herein can be used in numerous ways as polynucleotide reagents. For example, these sequences can be used to: (i) map their respective genes on a chromosome; and, thus, locate gene regions associated with genetic disease; (ii) identify an individual from a minute biological sample (tissue typing) ; and (iii) aid in forensic identification of a biological sample. These applications are described in the subsections below.
  • T139 nucleic acid molecules described herein or fragments thereof can be used to map the location of T139 genes on a chromosome.
  • the mapping of the T139 sequences to chromosomes is an important first step in correlating these sequences with genes associated with disease . - 67 -
  • T139 genes can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp in length) from the T139 sequences. Computer analysis of T139 sequences can be used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers can then be used for PCR screening of somatic cell hybrids containing individual human chromosomes . Only those hybrids containing the human gene corresponding to the T139 sequences will yield an amplified fragment. Somatic cell hybrids are prepared by fusing somatic cells from different mammals (e.g., human and mouse cells) .
  • mammals e.g., human and mouse cells
  • PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular sequence to a particular chromosome. Three or more sequences can be assigned per day using a single thermal cycler. Using the T139 sequences to design oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomes.
  • Other mapping strategies - 68 - which can similarly be used to map a T139 sequence to its chromosome include in si tu hybridization (described in Fan et al . (1990) Proc . Natl . Acad . Sci . USA 81 -. 6223 - 21 ) , pre-screening with labeled flow-sorted chromosomes, and pre-selection by hybridization to chromosome specific cDNA libraries.
  • Fluorescence in situ hybridization (FISH) of a DNA sequence to a metaphase chromosomal spread can further be used to provide a precise chromosomal location in one step.
  • Chromosome spreads can be made using cells whose division has been blocked in metaphase by a chemical like colcemid that disrupts the mitotic spindle.
  • the chromosomes can be treated briefly with trypsin, and then stained with Giemsa. A pattern of light and dark bands develops on each chromosome, so that the chromosomes can be identified individually.
  • the FISH technique can be used with a DNA sequence as short as 500 or 600 bases.
  • clones larger than 1,000 bases have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection.
  • 1,000 bases, and more preferably 2,000 bases will suffice to get good results at a reasonable amount of time.
  • Reagents for chromosome mapping can be used individually to mark a single chromosome or a single site on that chromosome, or panels of reagents can be used for marking multiple sites and/or multiple chromosomes. Reagents corresponding to noncoding regions of the genes actually are preferred for mapping purposes. Coding sequences are more likely to be conserved within gene families, thus increasing the chance of cross hybridizations during chromosomal mapping. - 69 -
  • differences in the D ⁇ A sequences between individuals affected and unaffected with a disease associated with the T139 gene can be determined. If a mutation is observed in some or all of the affected individuals but not in any unaffected individuals, then the mutation is likely to be the causative agent of the particular disease. Comparison of affected and unaffected individuals generally involves first looking for structural alterations in the chromosomes such as deletions or translocations that are visible from chromosome spreads or detectable using PCR based on that D ⁇ A sequence. Ultimately, complete sequencing of genes from several individuals can be performed to confirm the presence of a mutation and to distinguish mutations from polymorphisms .
  • the T139 sequences of the present invention can also be used to identify individuals from minute biological samples.
  • the United States military for example, is considering the use of restriction fragment length polymorphism (RFLP) for identification of its personnel.
  • RFLP restriction fragment length polymorphism
  • an individual's genomic D ⁇ A is digested with one or more restriction enzymes, and - 70 - probed on a Southern blot to yield unique bands for identification.
  • This method does not suffer from the current limitations of "Dog Tags" which can be lost, switched, or stolen, making positive identification difficult.
  • the sequences of the present invention are useful as additional DNA markers for RFLP (described in U.S. Patent 5,272,057).
  • sequences of the present invention can be used to provide an alternative technique which determines the actual base-by-base DNA sequence of selected portions of an individual's genome.
  • the T139 sequences described herein can be used to prepare two PCR primers from the 5' and 3' ends of the sequences. These primers can then be used to amplify an individual's DNA and subsequently sequence it.
  • Panels of corresponding DNA sequences from individuals, prepared in this manner, can provide unique individual identifications, as each individual will have a unique set of such DNA sequences due to allelic differences.
  • the sequences of the present invention can be used to obtain such identification sequences from individuals and from tissue.
  • the T139 sequences of the invention uniquely represent portions of the human genome. Allelic variation occurs to some degree in the coding regions of these sequences, and to a greater degree in the noncoding regions. It is estimated that allelic variation between individual humans occurs with a frequency of about once per each 500 bases.
  • Each of the sequences described herein can, to some degree, be used as a standard against which DNA from an individual can be compared for identification purposes.
  • the noncoding sequences of SEQ ID NO : 1 can comfortably provide positive individual identification - 71 - with a panel of perhaps 10 to 1,000 primers which each yield a noncoding amplified sequence of 100 bases. If predicted coding sequences, such as those in SEQ ID NO : 3 are used, a more appropriate number of primers for positive individual identification would be 500-2,000. If a panel of reagents from T139 sequences described herein is used to generate a unique identification database for an individual, those same reagents can later be used to identify tissue from that individual. Using the unique identification database, positive identification of the individual, living or dead, can be made from extremely small tissue samples.
  • DNA-based identification techniques can also be used in forensic biology.
  • Forensic biology is a scientific field employing genetic typing of biological evidence found at a crime scene as a means for positively identifying, for example, a perpetrator of a crime.
  • PCR technology can be used to amplify DNA sequences taken from very small biological samples such as tissues, e.g., hair or skin, or body fluids, e.g., blood, saliva, or semen found at a crime scene. The amplified sequence can then be compared to a standard, thereby allowing identification of the origin of the biological sample.
  • sequences of the present invention can be used to provide polynucleotide reagents, e.g., PCR primers, targeted to specific loci in the human genome, which can enhance the reliability of DNA-based forensic identifications by, for example, providing another "identification marker" (i.e. another DNA sequence that is unique to a particular individual) .
  • an "identification marker” i.e. another DNA sequence that is unique to a particular individual
  • actual base sequence information can be used for - 72 - identification as an accurate alternative to patterns formed by restriction enzyme generated fragments.
  • Sequences targeted to noncoding regions of SEQ ID N0:1 are particularly appropriate for this use as greater numbers of polymorphisms occur in the noncoding regions, making it easier to differentiate individuals using this technique.
  • polynucleotide reagents include the T139 sequences or portions thereof, e.g., fragments derived from the noncoding regions of SEQ ID N0:1 having a length of at least 20 or 30 bases.
  • the T139 sequences described herein can further be used to provide polynucleotide reagents, e.g., labeled or labelable probes which can be used in, for example, an in si tu hybridization technique, to identify a specific tissue, e.g., brain tissue. This can be very useful in cases where a forensic pathologist is presented with a tissue of unknown origin. Panels of such T139 probes can be used to identify tissue by species and/or by organ type. In a similar fashion, these reagents, e.g., T139 primers or probes can be used to screen tissue culture for contamination (i.e., screen for the presence of a mixture of different types of cells in a culture) .
  • these reagents e.g., T139 primers or probes can be used to screen tissue culture for contamination (i.e., screen for the presence of a mixture of different types of cells in a culture) .
  • the present invention also pertains to the field of predictive medicine in which diagnostic assays, prognostic assays, pharmacogenomics, and monitoring clinical trails are used for prognostic (predictive) purposes to thereby treat an individual prophylactically .
  • diagnostic assays for determining T139 protein and/or nucleic acid expression as well as T139 activity in the context of a biological sample (e.g., blood, serum, cells, tissue) to thereby determine whether an individual - 73 - is afflicted with a disease or disorder, or is at risk of developing a disorder, associated with aberrant T139 expression or activity.
  • the invention also provides for prognostic (or predictive) assays for determining whether an individual is at risk of developing a disorder associated with T139 protein, nucleic acid expression or activity. For example, mutations in a T139 gene can be assayed in a biological sample. Such assays can be used for prognostic or predictive purpose to thereby prophylactically treat an individual prior to the onset of a disorder characterized by or associated with T139 protein, nucleic acid expression or activity.
  • Another aspect of the invention provides methods for determining T139 protein, nucleic acid expression or T139 activity in an individual to thereby select appropriate therapeutic or prophylactic agents for that individual (referred to herein as "pharmacogenomics").
  • Pharmacogenomics allows for the selection of agents (e.g., drugs) for therapeutic or prophylactic treatment of an individual based on the genotype of the individual
  • Yet another aspect of the invention pertains to monitoring the influence of agents (e.g., drugs or other compounds) on the expression or activity of T139 in clinical trials.
  • agents e.g., drugs or other compounds
  • An exemplary method for detecting the presence or absence of T139 in a biological sample involves obtaining a biological sample from a test subject and contacting the biological sample with a compound or an agent capable - 74 - of detecting T139 protein or nucleic acid (e.g., mRNA, genomic DNA) that encodes T139 protein such that the presence of T139 is detected in the biological sample.
  • a preferred agent for detecting T139 mRNA or genomic DNA is a labeled nucleic acid probe capable of hybridizing to T139 mRNA or genomic DNA.
  • the nucleic acid probe can be, for example, a full-length T139 nucleic acid, such as the nucleic acid of SEQ ID NO: 1 or 3 , or a portion thereof, such as an oligonucleotide of at least 15, 30, 50, 100, 250 or 500 nucleotides in length and sufficient to specifically hybridize under stringent conditions to T139 mRNA or genomic DNA.
  • a preferred agent for detecting T139 protein is an antibody capable of binding to T139 protein, preferably an antibody with a detectable label.
  • Antibodies can be polyclonal, or more preferably, monoclonal.
  • an intact antibody, or a fragment thereof can be used.
  • labeled with regard to the probe or antibody, is intended to encompass direct labeling of the probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, as well as indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled.
  • indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such that it can be detected with fluorescently labeled streptavidin.
  • biological sample is intended to include tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject. That is, the detection method of the invention can be used to detect T139 mRNA, protein, or genomic DNA in a biological sample in vi tro - 75 - as well as in vivo .
  • vi tro techniques for detection of T139 mRNA include Northern hybridizations and in si tu hybridizations.
  • vi tro techniques for detection of T139 protein include enzyme linked immunosorbent assays (ELISAs) , Western blots, immunoprecipitations and immunofluorescence .
  • vi tro techniques for detection of T139 genomic DNA include Southern hybridizations.
  • in vivo techniques for detection of T139 protein include introducing into a subject a labeled anti-T139 antibody.
  • the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.
  • the biological sample contains protein molecules from the test subject.
  • the biological sample can contain mRNA molecules from the test subject or genomic DNA molecules from the test subject.
  • a preferred biological sample is a peripheral blood leukocyte sample isolated by conventional means from a subject.
  • the methods further involve obtaining a control biological sample from a control subject, contacting the control sample with a compound or agent capable of detecting T139 protein, mRNA, or genomic DNA, such that the presence of T139 protein, mRNA or genomic DNA is detected in the biological sample, and comparing the presence of T139 protein, mRNA or genomic DNA in the control sample with the presence of T139 protein, mRNA or genomic DNA in the test sample.
  • kits for detecting the presence of T139 in a biological sample (a test sample) can be used to determine if a subject is suffering from or is at increased risk of developing a disorder associated with aberrant expression of T139.
  • the kit can comprise a labeled compound or - 76 - agent capable of detecting T139 protein or mRNA in a biological sample and means for determining the amount of T139 in the sample (e.g., an anti-T139 antibody or an oligonucleotide probe which binds to DNA encoding T139, e.g., SEQ ID NO : 1 or SEQ ID NO: 3) .
  • Kits may also include instruction for observing that the tested subject is suffering from or is at risk of developing a disorder associated with aberrant expression of T139 if the amount of T139 protein or mRNA is above or below a normal level.
  • the kit may comprise, for example: (1) a first antibody (e.g., attached to a solid support) which binds to T139 protein; and, optionally, (2) a second, different antibody which binds to T139 protein or the first antibody and is conjugated to a detectable agent.
  • a first antibody e.g., attached to a solid support
  • a second, different antibody which binds to T139 protein or the first antibody and is conjugated to a detectable agent.
  • the kit may comprise, for example: (1) a oligonucleotide, e.g., a detectably labelled oligonucleotide, which hybridizes to a T139 nucleic acid sequence or (2) a pair of primers useful for amplifying a T139 nucleic acid molecule.
  • a oligonucleotide e.g., a detectably labelled oligonucleotide, which hybridizes to a T139 nucleic acid sequence
  • a pair of primers useful for amplifying a T139 nucleic acid molecule.
  • the kit may also comprise, e.g., a buffering agent, a preservative, or a protein stabilizing agent.
  • the kit may also comprise components necessary for detecting the detectable agent (e.g., an enzyme or a substrate) .
  • the kit may also contain a control sample or a series of control samples which can be assayed and compared to the test sample contained.
  • Each component of the kit is usually enclosed within an individual container and all of the various containers are within a single package along with instructions for observing whether the tested subject is suffering from or is at risk of developing a disorder associated with aberrant expression or activity of T139. - 77 -
  • the methods described herein can furthermore be utilized as diagnostic or prognostic assays to identify subjects having or at risk of developing a disease or disorder associated with aberrant T139 expression or activity.
  • the assays described herein such as the preceding diagnostic assays or the following assays, can be utilized to identify a subject having or at risk of developing a disorder associated with T139 protein, nucleic acid expression or activity.
  • the prognostic assays can be utilized to identify a subject having or at risk for developing such a disease or disorder.
  • the present invention provides a method in which a test sample is obtained from a subject and T139 protein or nucleic acid (e.g., mRNA, genomic DNA) is detected, wherein the presence of T139 protein or nucleic acid is diagnostic for a subject having or at risk of developing a disease or disorder associated with aberrant T139 expression or activity.
  • a test sample refers to a biological sample obtained from a subject of interest.
  • a test sample can be a biological fluid (e.g., serum), cell sample, or tissue.
  • the prognostic assays described herein can be used to determine whether a subject can be administered an agent (e.g., an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule, or other drug candidate) to treat a disease or disorder associated with aberrant T139 expression or activity.
  • an agent e.g., an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule, or other drug candidate
  • agents e.g., an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule, or other drug candidate
  • agents e.g., an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule, or other drug candidate
  • such methods can be used to determine whether a subject can be effectively treated with a specific agent or class of agents (e.g., agents of a type which decrease T139 activity) .
  • the present invention provides methods for determining whether a subject can be effectively treated with an agent for a - 78 - disorder associated with aberrant T139 expression or activity in which a test sample is obtained and T139 protein or nucleic acid is detected (e.g., wherein the presence of T139 protein or nucleic acid is diagnostic for a subject that can be administered the agent to treat a disorder associated with aberrant T139 expression or activity) .
  • the methods of the invention can also be used to detect genetic lesions or mutations in a T139 gene, thereby determining if a subject with the lesioned gene is at risk for a disorder characterized by aberrant cell proliferation and/or differentiation.
  • the methods include detecting, in a sample of cells from the subject, the presence or absence of a genetic lesion characterized by at least one of an alteration affecting the integrity of a gene encoding a T139-protein, or the mis-expression of the T139 gene.
  • such genetic lesions can be detected by ascertaining the existence of at least one of 1) a deletion of one or more nucleotides from a T139 gene; 2) an addition of one or more nucleotides to a T139 gene; 3) a substitution of one or more nucleotides of a T139 gene, 4) a chromosomal rearrangement of a T139 gene; 5) an alteration in the level of a messenger RNA transcript of a T139 gene, 6) aberrant modification of a T139 gene, such as of the methylation pattern of the genomic DNA, 7) the presence of a non-wild type splicing pattern of a messenger RNA transcript of a T139 gene, 8) a non-wild type level of a T139-protein, 9) allelic loss of a T139 gene, and 10) inappropriate post-translational modification of a T139-protein.
  • assay techniques known in the art which can be used for detecting lesions in a
  • detection of the lesion involves the use of a probe/primer in a polymerase chain reaction (PCR) (see, e.g., U.S. Patent Nos. 4,683,195 and 4,683,202), such as anchor PCR or RACE PCR, or, alternatively, in a ligation chain reaction (LCR) (see, e.g., Landegran et al . (1988) Science 241:1077-1080; and Nakazawa et al . (1994) Proc . Natl . Acad . Sci . USA 91:360- 364) , the latter of which can be particularly useful for detecting point mutations in the T139-gene (see Abravaya et al.
  • PCR polymerase chain reaction
  • LCR ligation chain reaction
  • This method can include the steps of collecting a sample of cells from a patient, isolating nucleic acid (e.g., genomic, mRNA or both) from the cells of the sample, contacting the nucleic acid sample with one or more primers which specifically hybridize to a T139 gene under conditions such that hybridization and amplification of the T139-gene (if present) occurs, and detecting the presence or absence of an amplification product, or detecting the size of the amplification product and comparing the length to a control sample. It is anticipated that PCR and/or LCR may be desirable to use as a preliminary amplification step in conjunction with any of the techniques used for detecting mutations described herein.
  • nucleic acid e.g., genomic, mRNA or both
  • Alternative amplification methods include: self sustained sequence replication (Guatelli et al . (1990) Proc . Natl . Acad . Sci . USA 87 :1874-1878) , transcriptional amplification system (Kwoh, et al . (1989) Proc. Natl . Acad. Sci . USA 86.1173-1177) , Q-Beta Replicase (Lizardi et al . (1988) Bio/Technology 6:1197), or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection - 80 - schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers.
  • mutations in a T139 gene from a sample cell can be identified by alterations in restriction enzyme cleavage patterns.
  • sample and control DNA is isolated, amplified (optionally) , digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis and compared. Differences in fragment length sizes between sample and control DNA indicates mutations in the sample DNA.
  • sequence specific ribozymes see, e.g., U.S. Patent No. 5,498,531 can be used to score for the presence of specific mutations by development or loss of a ribozyme cleavage site.
  • genetic mutations in T139 can be identified by hybridizing a sample and control nucleic acids, e.g., DNA or RNA, to high density arrays containing hundreds or thousands of oligonucleotides probes (Cronin et al . (1996) Human Mutation 7:244-255; Kozal et al . (1996) Nature Medicine 2:753-759) .
  • genetic mutations in T139 can be identified in two-dimensional arrays containing light-generated DNA probes as described in Cronin et al . supra. Briefly, a first hybridization array of probes can be used to scan through long stretches of DNA in a sample and control to identify base changes between the sequences by making linear arrays of sequential overlapping probes.
  • This step allows the identification of point mutations.
  • This step is followed by a second hybridization array that allows the characterization of specific mutations by using smaller, specialized probe arrays complementary to all variants or mutations detected.
  • Each mutation array is composed of parallel probe sets, one complementary to - 81 - the wild-type gene and the other complementary to the mutant gene.
  • any of a variety of sequencing reactions known in the art can be used to directly sequence the T139 gene and detect mutations by comparing the sequence of the sample T139 with the corresponding wild-type (control) sequence.
  • Examples of sequencing reactions include those based on techniques developed by Maxim and Gilbert ((1977) Proc . Natl . Acad . Sci . USA 74:560) or Sanger ((1977) Proc . Natl . Acad.
  • RNA/RNA or RNA/DNA heteroduplexes Other methods for detecting mutations in the T139 gene include methods in which protection from cleavage agents is used to detect mismatched bases in RNA/RNA or RNA/DNA heteroduplexes (Myers et al . (1985) Science 230:1242).
  • the art technique of "mismatch cleavage" starts by providing heteroduplexes of formed by hybridizing (labeled) RNA or DNA containing the wild-type T139 sequence with potentially mutant RNA or DNA obtained from a tissue sample.
  • the double-stranded duplexes are treated with an agent which cleaves single-stranded regions of the duplex such as which will exist due to basepair mismatches between the control and sample strands.
  • RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated with SI nuclease to enzymatically digesting the mismatched regions.
  • either DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and - 82 - with piperidine in order to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then separated by size on denaturing polyacrylamide gels to determine the site of mutation. See, e.g., Cotton et al (1988) Proc . Natl Acad Sci USA 85:4397; Saleeba et al (1992) Methods Enzymol . 217:286- 295.
  • the control DNA or RNA can be labeled for detection.
  • the mismatch cleavage reaction employs one or more proteins that recognize mismatched base pairs in double-stranded DNA (so called "DNA mismatch repair" enzymes) in defined systems for detecting and mapping point mutations in T139 cDNAs obtained from samples of cells.
  • DNA mismatch repair enzymes
  • the mutY enzyme of E. coli cleaves A at G/A mismatches and the thymidine DNA glycosylase from HeLa cells cleaves T at G/T mismatches (Hsu et al . (1994) Carcinogenesis 15:1657- 1662) .
  • a probe based on a T139 sequence is hybridized to a cDNA or other DNA product from a test cell(s) .
  • the duplex is treated with a DNA mismatch repair enzyme, and the cleavage products, if any, can be detected from electrophoresis protocols or the like. See, e.g., U.S. Patent No. 5,459,039.
  • alterations in electrophoretic mobility will be used to identify mutations in T139 genes.
  • SSCP single strand conformation polymorphism
  • SSCP single strand conformation polymorphism
  • RNA rather than DNA
  • the subject method utilizes heteroduplex analysis to separate double stranded heteroduplex molecules on the basis of changes in electrophoretic mobility (Keen et al . (1991) Trends Genet 7:5).
  • the movement of mutant or wild-type fragments in polyacrylamide gels containing a gradient of denaturant is assayed using denaturing gradient gel electrophoresis (DGGE) (Myers et al . (1985) Nature 313:495) .
  • DGGE denaturing gradient gel electrophoresis
  • D ⁇ A will be modified to insure that it does not completely denature, for example by adding a GC clamp of approximately 40 bp of high-melting GC-rich D ⁇ A by PCR.
  • a temperature gradient is used in place of a denaturing gradient to identify differences in the mobility of control and sample D ⁇ A (Rosenbau and Reissner (1987) Biophys Chem 265:12753).
  • Other techniques for detecting point mutations include, but are not limited to, selective oligonucleotide hybridization, selective amplification, or selective primer extension.
  • oligonucleotide primers may be prepared in which the known mutation is placed centrally and then hybridized to target D ⁇ A under conditions which permit hybridization only if a perfect match is found (Saiki et al . (1986) Nature 324:163); Saiki et al . (1989) Proc . Natl Acad .
  • Oligonucleotides used as primers for specific amplification may carry the mutation of interest in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al . (1989) Nucleic Acids Res . 17:2437-2448) or at the extreme 3' end of one primer where, under appropriate conditions, mismatch can prevent, or reduce polymerase extension (Prossner (1993) Tibtech 11:238) .
  • amplification may also be performed using Taq ligase for amplification (Barany (1991) Proc . Natl . Acad . Sci USA 88:189). In such cases, ligation will occur only if there is a perfect match at the 3' end of the 5' sequence making it possible to detect the presence of a known mutation at a specific site by looking for the presence or absence of amplification.
  • the methods described herein may be performed, for example, by utilizing pre-packaged diagnostic kits comprising at least one probe nucleic acid or antibody reagent described herein, which may be conveniently used, e.g., in clinical settings to diagnose patients exhibiting symptoms or family history of a disease or illness involving a T139 gene.
  • any cell type or tissue preferably peripheral blood leukocytes, in which T139 is expressed - 85 - may be utilized in the prognostic assays described herein.
  • Pharmacogenomics Agents, or modulators which have a stimulatory or inhibitory effect on T139 activity can be administered to individuals to treat (prophylactically or therapeutically) disorders (e.g., an immunological disorder) associated with aberrant T139 activity.
  • disorders e.g., an immunological disorder
  • the pharmacogenomics i.e., the study of the relationship between an individual's genotype and that individual's response to a foreign compound or drug
  • Differences in metabolism of therapeutics can lead to severe toxicity or therapeutic failure by altering the relation between dose and blood concentration of the pharmacologically active drug.
  • the pharmacogenomics of the individual permits the selection of effective agents (e.g., drugs) for prophylactic or therapeutic treatments based on a consideration of the individual's genotype. Such pharmacogenomics can further be used to determine appropriate dosages and therapeutic regimens. Accordingly, the activity of T139 protein, expression of T139 nucleic acid, or mutation content of T139 genes in an individual can be determined to thereby select appropriate agent (s) for therapeutic or prophylactic treatment of the individual . Pharmacogenomics deals with clinically significant hereditary variations in the response to drugs due to altered drug disposition and abnormal action in affected persons. See, e.g., Linder (1997) Clin . Chem . 43 (2) :254-266.
  • G6PD glucose-6- phosphate dehydrogenase deficiency
  • the activity of drug metabolizing enzymes is a major determinant of both the intensity and duration of drug action.
  • the discovery of genetic polymorphisms of drug metabolizing enzymes is a major determinant of both the intensity and duration of drug action.
  • NAT 2 N-acetyltransferase 2
  • cytochrome P450 enzymes CYP2D6 and CYP2C19 has provided an explanation as to why some patients do not obtain the expected drug effects or show exaggerated drug response and serious toxicity after taking the standard and safe dose of a drug.
  • These polymorphisms are expressed in two phenotypes in the population, the extensive metabolizer (EM) and poor metabolizer (PM) .
  • EM extensive metabolizer
  • PM poor metabolizer
  • the prevalence of PM is different among different populations.
  • the gene coding for CYP2D6 is highly polymorphic and several mutations have been identified in PM, which all lead to the absence of functional CYP2D6.
  • T139 protein, expression of T139 nucleic acid, or mutation content of T139 genes in an individual can be determined to thereby select appropriate agent (s) for therapeutic or prophylactic treatment of the individual.
  • pharmacogenetic studies can be used to apply genotyping of polymorphic alleles encoding drug-metabolizing enzymes to the identification of an individual's drug responsiveness phenotype . This knowledge, when applied to dosing or drug selection, can avoid adverse reactions or therapeutic failure and thus enhance therapeutic or prophylactic efficiency when treating a subject with a T139 modulator, such as a modulator identified by one of the exemplary screening assays described herein.
  • T139 e.g., the ability to modulate aberrant cell proliferation and/or differentiation
  • agents e.g., drugs, compounds
  • T139 the ability to modulate aberrant cell proliferation and/or differentiation
  • the effectiveness of an agent determined by a screening assay as described herein to increase T139 gene expression, protein levels, or upregulate T139 activity can be monitored in clinical trails of subjects exhibiting decreased T139 gene expression, protein levels, or downregulated T139 activity.
  • the effectiveness of an agent determined by a screening assay to decrease T139 gene expression, protein levels, or downregulated T139 activity can be monitored in clinical trails of subjects exhibiting increased T139 gene expression, protein levels, or upregulated T139 activity.
  • the expression or - 88 - activity of T139 and, preferably, other genes that have been implicated in, for example, a cellular proliferation disorder can be used as a "read out" or markers of the immune responsiveness of a particular cell.
  • genes, including T139 that are modulated in cells by treatment with an agent (e.g., compound, drug or small molecule) which modulates T139 activity (e.g., identified in a screening assay as described herein) can be identified.
  • an agent e.g., compound, drug or small molecule
  • T139 activity e.g., identified in a screening assay as described herein
  • cells can be isolated and RNA prepared and analyzed for the levels of expression of T139 and other genes implicated in the disorder.
  • the levels of gene expression can be quantified by Northern blot analysis or RT-PCR, as described herein, or alternatively by measuring the amount of protein produced, by one of the methods as described herein, or by measuring the levels of activity of T139 or other genes.
  • the gene expression pattern can serve as a marker, indicative of the physiological response of the cells to the agent. Accordingly, this response state may be determined before, and at various points during, treatment of the individual with the agent.
  • the present invention provides a method for monitoring the effectiveness of treatment of a subject with an agent (e.g., an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule, or other drug candidate identified by the screening assays described herein) comprising the steps of (i) obtaining a pre-administration sample from a subject prior to administration of the agent; (ii) detecting the level of expression of a T139 protein, mRNA, or genomic DNA in the preadministration sample; - 89 -
  • an agent e.g., an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule, or other drug candidate identified by the screening assays described herein
  • the present invention provides for both prophylactic and therapeutic methods of treating a subject at risk of (or susceptible to) a disorder or having a disorder associated with aberrant T139 expression or activity.
  • disorders include kidney defects such as kidney failure or hyperplasia.
  • the invention provides a method for preventing in a subject, a disease or condition associated with an aberrant T139 expression or activity, by administering to the subject an agent which modulates T139 expression or at least one T139 activity.
  • Subjects at risk for a disease which is caused or contributed to by aberrant T139 expression or activity can be identified by, for example, any or a combination of diagnostic or - 90 - prognostic assays as described herein.
  • Administration of a prophylactic agent can occur prior to the manifestation of symptoms characteristic of the T139 aberrancy, such that a disease or disorder is prevented or, alternatively, delayed in its progression.
  • a T139 agonist or T139 antagonist agent can be used for treating the subject. The appropriate agent can be determined based on screening assays described herein.
  • the modulatory method of the invention involves contacting a cell with an agent that modulates one or more of the activities of T139 protein activity associated with the cell.
  • An agent that modulates T139 protein activity can be an agent as described herein, such as a nucleic acid or a protein, a naturally-occurring cognate ligand of a T139 protein, a peptide, a T139 peptidomimetic, or other small molecule.
  • the agent stimulates one or more of the biological activities of T139 protein. Examples of such stimulatory agents include active T139 protein and a nucleic acid molecule encoding T139 that has been introduced into the cell.
  • the agent inhibits one or more of the biological activities of T139 protein.
  • inhibitory agents include antisense T139 nucleic acid molecules and anti- T139 antibodies. These modulatory methods can be performed in vi tro (e.g., by culturing the cell with the agent) or, alternatively, in vivo (e.g, by administering the agent to a subject) .
  • the present invention provides methods of treating an individual afflicted with a disease or disorder characterized by aberrant - 91 - expression or activity of a T139 protein or nucleic acid molecule.
  • the method involves administering an agent (e.g., an agent identified by a screening assay described herein) , or combination of agents that modulates (e.g., upregulates or downregulates) T139 expression or activity.
  • an agent e.g., an agent identified by a screening assay described herein
  • the method involves administering a T139 protein or nucleic acid molecule as therapy to compensate for reduced or aberrant T139 expression or activity. Stimulation of T139 activity is desirable in situations in which T139 is abnormally downregulated and/or in which increased T139 activity is likely to have a beneficial effect. Conversely, inhibition of T139 activity is desirable in situations in which T139 is abnormally upregulated and/or in which decreased T139 activity is likely to have a beneficial effect.
  • Example 1 Isolation and Characterization of Human T139 cDNA RNA was isolated from human fetal kidney tissue, and the polyA ⁇ fraction was purified using Oligotex beads (Qiagen) . Three micrograms of polyA ⁇ RNA were used to synthesize a cDNA library using the Superscript cDNA Synthesis kit (Gibco BRL; Gaithersburg, MD) . Complementary DNA was directionally cloned into the expression plasmid pMET7 using the Sail and NotI sites in the polylinker to construct a plasmid library. Transformants were picked and grown for single-pass - 92 - sequencing.
  • JthKall5e09 One cDNA clone (j thKall5e09) was identified that encoded a protein with homology to testis-specific protein- 1 (TPX-1) , an acrosomal sperm protein that is a member of the SCP-like family of cysteine-rich secreted proteins. JthKall5e09 contains an open reading frame of 446 amino acids, which is referred to as "Tango 139".
  • T139 was analyzed using Northern blot hybridization. Oligonucleotide primers (5' CCATGCTGCATCCAGAG 3' (SEQ ID NO: 14); 5'
  • CACAGACAAAGGCTTCTATC 3' (SEQ ID NO: 15) were used to amplify a 543 bp fragment from the coding region of jthKall4e09, and the DNA was radioactively labeled with 32 P-dCTP using a Prime-It kit (Stratagene, La Jolla, CA) according to the supplier's instructions. Filters containing human mRNA (MTNI and MTNII from Clontech, Palo Alto, CA) were probed in ExpressHyb hybridization solution (Clontech) and washed at high stringency according to manufacturer's recommendations. Tango 139 is expressed at high levels as a transcript of about 2.0 kb in the kidney, with lower levels in the testis.
  • kidney and testis there are additional transcripts in both kidney and testis at about 2.4 and 3.5 kb.
  • No other tissues examined (heart, brain, placenta, lung, liver, skeletal muscle, pancreas, spleen, thymus, ovaries, small intestine, colon and peripheral blood leukocytes) showed any expression.
  • the predicted amino acid sequence of human T139 protein was compared to amino acid sequences of known proteins and various motifs were identified.
  • the molecular weight of the human T139 proteins was predicted. - 93 -
  • T139 The human T139 cDNA isolated as described above ( Figure 1; SEQ ID N0:1) encodes a 446 amino acid protein ( Figure 1; SEQ ID N0:2).
  • the signal peptide prediction program SIGNALP (Nielsen et al . (1997) Protein Engineering 10:1-6) predicted that T139 includes a 26 amino acid signal peptide (amino acid 1 to about amino acid 26 of SEQ ID NO: 2) preceding the 420 amino acid mature protein (about amino acid 27 to amino acid 446; SEQ ID NO: 4) .
  • a hydropathy plot of T139 is presented in Figure 3.
  • T139 has a region of homology (amino acids 47 to 190, of SEQ ID NO: 2; SEQ ID NO: 5) to a SCP-like domain consensus sequence (PF00188, of SEQ ID NO: 2; SEQ ID NO: 9).
  • Figure 2B shows the region of homology (amino acids 297 to 412, SEQ ID NO : 2 ; SEQ ID NO: 6) to the C-type lectin domain consensus sequence (PF00059, SEQ ID NO:10). Although significant homology was observed, the four cysteines in this region of T139 do not match the four conserved cysteines in the consensus sequence; the alignment only recognized three of the four cysteines in this region of T139 as identical to the consensus cysteines.
  • Figure 2C shows the regions of homology (amino acids 232 to 260 of SEQ ID NO: 2; (EGFl) and 264 to 291 of SEQ ID NO:2; (EGF2); SEQ ID NO:
  • a signal peptide is predicted to exist from amino acids 1 to 26, using the prediction program SIGNALP (Nielsen et al . (1997) Protein Engineering 10:1-6).
  • T139 is homologous to testis- specific protein-1 (TPX-1; Kasahara et al . (1989) Genomics 5:527-34) .
  • TPX-1 is a testis-specific protein that is expressed by spermatogenic cells and is thought to cause spermatogenic cells to bind to somatic Sertoli cells. Sertoli cells are essential for the proliferation, differentiation, and survival of spermatogenic cells.
  • Human TPX-1 is a member of the CRISP family. Members of this family have a cysteine- rich C-terminal region having the pattern CX 8 CX 8 CX 8 CX 8 C (Foster and Gerton (1996) Mol . Reprod . Dev. 44:221-29; Kratzch et al .
  • AEG acidic epididymal glycoprotein
  • T139 may play a role in spermatogenesis and other testicular functions.
  • T139 nucleic acids, polypeptides, and modulators of T139 expression or activity can be used to modulate spermatogenesis or sperm-egg fusion.
  • such molecules may be useful for treatment of a variety of testicular disorders, e.g., testicular cancer.
  • Recombinant T129 can be produced in a variety of expression systems.
  • the mature T129 peptide can be expressed as a recombinant glutathione-S- - 95 - transferase (GST) fusion protein in E . coli and the fusion protein can be isolated and characterized.
  • GST glutathione-S- - 95 - transferase
  • T129 can be fused to GST and this fusion protein can be expressed in E. coli strain PEB199.
  • Expression of the GST-T129 fusion protein in PEB199 can be induced with IPTG.
  • the recombinant fusion protein can be purified from crude bacterial lysates of the induced PEB199 strain by affinity chromatography on glutathione beads .
EP99919992A 1998-04-23 1999-04-23 Nouvelles molecules de la famille de proteines associees au t139 et utilisations correspondantes Withdrawn EP1080101A1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US6566198A 1998-04-23 1998-04-23
US65661 1998-04-23
PCT/US1999/008896 WO1999054343A2 (fr) 1998-04-23 1999-04-23 Nouvelles molecules de la famille de proteines associees au t139 et utilisations correspondantes

Publications (1)

Publication Number Publication Date
EP1080101A1 true EP1080101A1 (fr) 2001-03-07

Family

ID=22064263

Family Applications (1)

Application Number Title Priority Date Filing Date
EP99919992A Withdrawn EP1080101A1 (fr) 1998-04-23 1999-04-23 Nouvelles molecules de la famille de proteines associees au t139 et utilisations correspondantes

Country Status (3)

Country Link
EP (1) EP1080101A1 (fr)
AU (1) AU3758599A (fr)
WO (1) WO1999054343A2 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
TW202042836A (zh) * 2019-02-18 2020-12-01 日商肽夢想股份有限公司 血球凝集素結合肽

Also Published As

Publication number Publication date
WO1999054343A2 (fr) 1999-10-28
AU3758599A (en) 1999-11-08

Similar Documents

Publication Publication Date Title
US8754199B2 (en) Tango 240 nucleic acids and uses thereof
AU751396B2 (en) Novel molecules of the Tango-77 related protein family and uses thereof
US6410232B1 (en) Molecules of the follistatin-related protein family and uses thereof
US6197551B1 (en) Spoil-1 protein and nucleic acid molecules and uses therefor
WO1999052945A2 (fr) MOLECULES DE LA FAMILLE DES PROTEINES RELIEES AUX BGCKr ET LEUR UTILISATION
US6225085B1 (en) LRSG protein and nucleic acid molecules and uses therefor
US20050032172A1 (en) Novel molecules of the FTHMA-070-related protein family and the T85-related protein family and uses thereof
WO1999054437A2 (fr) Nouvelles molecules de la famille des proteines liees a t125 et utilisations de celles-ci
WO2000008045A2 (fr) Nouvelles molecules de la famille de proteines apparentees a tango-93 et leurs utilisations
AU753279B2 (en) Novel molecules of the T129-related protein family and uses thereof
US6326481B1 (en) Molecules of the AIP-related protein family and uses thereof
WO2000000633A1 (fr) OCT1p, PROTEINE PRESENTANT UNE HOMOLOGIE AVEC LA FAMILLE DES PROTEINES ORGANIQUES ET TRANSPORTEUSES DE GLUCIDES ET UTILISATION
WO1999054343A2 (fr) Nouvelles molecules de la famille de proteines associees au t139 et utilisations correspondantes
US20020164330A1 (en) Novel molecules of the tango-77 related protein family and uses thereof
EP1586660A1 (fr) Nouvelles molécules de la famille des protéines liées à T85 et utilisation des dites molécules
US20040142420A1 (en) Novel molecules of the TANGO-93-related protein family and uses thereof
WO1999067415A9 (fr) Nouvelles molecules de la famille de proteines associees a t110 et leurs utilisations
WO2000006699A1 (fr) Nouvelles molecules de la famille des proteines liees au tango 175 et utilisations de ces dernieres
WO2000006699A9 (fr) Nouvelles molecules de la famille des proteines liees au tango 175 et utilisations de ces dernieres
WO2002028900A2 (fr) Tach: nouvelle famille d'acides nucleiques et de polypeptides recepteurs tnf

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20001123

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20031031