EP1053356A2

EP1053356A2 - Method for diagnosis and treatment of disorders of carbohydrate metabolism

Info

Publication number: EP1053356A2
Application number: EP99906659A
Authority: EP
Inventors: Suad Efendic
Original assignee: Individual
Current assignee: Individual
Priority date: 1998-02-11
Filing date: 1999-02-11
Publication date: 2000-11-22
Also published as: WO1999041411A3; AU2651299A; WO1999041411A2; JP2002503483A; CA2319065A1

Abstract

The present invention relates to a method of detecting a disorder in carbohydrate metabolism, such as type II diabetes (NIDDM), by detecting a promoter of an adenylate cyclase III gene, the promoter having enhanced activity. The present invention also relates to a promoter from an adenylate cyclase III gene having enhanced activity, and isolated DNA molecules containing this promoter. The promoter having enhanced activity can be part of a transgenic animal. In another embodiment, the invention relates to a method of treating a patient having a disorder in carbohydrate metabolism, such as type II diabetes (NIDDM), and a method of enhancing or restoring a patient's response to insulin. Each of these methods includes administering to the patient a down regulator, an antagonist, or an inhibitor of expression of the adenylate cyclase III gene, or of the activity of one of its gene products.

Description

METHOD FOR DIAGNOSIS AND TREATMENT OF DISORDERS OF CARBOHYDRATE METABOLISM

Background of the Invention

Diabetes mellitus is a serious and chronic disorder that affects 6% of the world's population and all ethnic groups. In the United States, approximately 5% of the population has diabetes. Symptoms of diabetes include hyperglycemia and reduced production or release of insulin. Diabetes mellitus is classified into two types, type I diabetes or insulin-dependent diabetes mellitus (IDDM) and type II diabetes or non-insulin-dependent diabetes mellitus (NIDDM). Type I diabetes, in which the pancreas has stopped producing insulin, affects 10% of all diabetics, often begins in childhood and is known as juvenile onset diabetes. In the more prevalent type II diabetes, affecting 90% of all diabetics, the pancreas can produce insulin, but insulin secretion in response to meals is diminished, and the diabetic's tissues are not as responsive to insulin as tissues from a non-diabetic. Type II diabetes is also known as adult onset diabetes.

Diminished response to or low levels of insulin result in chronic high levels of blood glucose, which gradually alters normal body chemistry and leads to failure of the microvascular system in many organs. This leads to dire consequences. For example, in the United States, diabetes is the largest cause of blindness, is involved in about 70% of amputations, and is the cause of kidney failure in 33% of patients requiring dialysis. Medical treatment of side effects of diabetes and lost productivity due to inadequate treatment of diabetes are estimated to have an annual cost of about $40 billion in the United States alone.

In man, it is well established that decreased insulin response to glucose and loss of periodic insulin release are two of the earliest of findings to occur in NIDDM even before onset of overt hyperglycemia. Decreased insulin response to glucose and loss of periodic insulin release are also characteristics of a model of human diabetes, the Goto-Kakizaki (GK) rat. The GK model originated in 1973 by selective breeding of 211 nondiabetic istar rats, using high-normal blood glucose levels during an oral glucose tolerance test as selection index. By the sixth generation (F_s) the GK rats showed diabetic glucose tolerance, a suppressed glucose- „ _, 9 2

induced insulin response in the perfused pancreas, and they were distinctly diabetic. This led to the conclusion that the diabetic state was spontaneously induced in GK rats through a polygenic mode of inheritance. The genetic locus or loci affected in diabetic humans and GK rats have not been established. There is a need to determine a genetic locus that correlates with or plays a role in decreased insulin response to glucose and loss of periodic insulin release. Thus, providing associated methods of diagnosing and treating diabetes and related disorders of carbohydrate metabolism.

Summary of the Invention

The present invention relates to a method of detecting a disorder in carbohydrate metabolism, such as type II diabetes (NIDDM), by analyzing a promoter of an adenylate cyclase III gene having enhanced activity in cells or tissue from a patient. The promoter having enhanced activity can be detected either directly by its sequence, or indirectly by the levels of or activities of gene products of the adenylate cyclase III gene. Detection can be accomplished employing, on cells or tissues from the patient, methods such as polymerase chain reaction, expressing a reporter gene under the control of the promoter, determining adenylate cyclase III mRNA levels, measuring the amount or activity of adenylate cyclase III., or determining cAMP levels.

The present invention also relates to a promoter having enhanced activity from an adenylate cyclase LU gene, and isolated DNA molecules containing this promoter. The promoter having enhanced activity is a naturally occurring promoter that is stronger titan the corresponding wild type promoter. For example, an enhanced promoter is found in the adenylate cyclase III gene from an animal with type II diabetes, preferably a diabetic GK rat. The enhanced promoter can be part of a transgenic animal,

In another embodiment, the invention relates to a method of treating a patient having a disorder in carbohydrate metabolism, such as type II diabetes (NIDDM), and a method of enhancing or restoring a patient's response to insulin. Each of these methods includes administering to the patient a down regulator, an antagonist, or an inhibitor of expression of the adenylate cyclase III gene, or of the activity of one of its gene products,

Brief Description of the Drawings Figure 1 shows insulin secretion by diabetic (GK, ■„ n=7,8) and control (D, n=7,8) islets at 3.3 or 16.7 mM glucose in the presence and absence of 5μM forskolin. Results are expressed as mean ± SEM. G=glucose; F=forskolin.

Figure 2 shows cAMP generation by diabetic (GK, ■„ n=7,8) and control (D, π=7,8) islets at 3.3 or 16.7 mM glucose in the presence and absence of 5μM forskolin. Results are expressed as mean ± SEM. G=glucose; F=forskolin. Figure 3 illustrates AC-III mRNA expression determined by in situ hybridization in single islets in the presence of 3.3 mM glucose (A: control, B: diabetic); 3.3 mM glucose and 5 μM forskolin (C: control, D: diabetic); 16.7 mM glucose (E: control, F: diabetic); 16.7 mM glucose and 5 μM forskolin (G: control; H: diabetic).

Figure 4 illustrates a schematic structure of the promoter region of AC-III gene, Exons are represented by a solid box and the transcription start site is marked by a curved arrow. Two point-mutations upstream from the transcription start site were observed at positions -28 (A→G) and -358 (A→C) only in islets and peripheral blood cells from diabetic animals.

Figure 5 illustrates transfection analysis of the two mutations in the promoter region of AC-III gene in the diabetic rat. Light intensity reflecting luciferase activity produced by COS cells transfected with vectors carrying a fragment of the promoter region of AC-III gene from control rat (D) or the corresponding fragment containing the two mutations from a diabetic rat (■) only (A) or cotransfected with pCAT-3 control vectors (B and C). Effect of 5 μM forskolin is marked (C). Results are expressed as mean + SEM Light Intensity Units.

Detailed Description of the Invention Definitions As used herein, AC-III refers to adenylate cyclase III (adenylyl cyclase III or adenyl cyclase III), which is an isozyme of adenylate cyclase, including the isozyme whose expression is enhanced in islet cells of GK strain diabetic rats. Generally herein, AC-III is used to refer to the related gene, promoter, mRNA, and the like and the full expression adenylate cyclase III is used to refer to the adenylate cyclase III protein. As used herein, a promoter of the adenylate cyclase III gene (AC-III promoter) having enhanced activity, or an enhanced promoter, is a promoter of the AC-III gene that is a more powerful promoter than a wild-type AC-III promoter. A more powerful promoter has effects such as increasing expression of a gene, increasing the amount of mRNA transcript, and the like, compared to the wild-type promoter. As used herein, "wild type" refers to a dominant genotype which naturally occurs in the normal population (i.e., members of the population not afflicted with type II diabetes (NIDDM) or a like disorder of glucose metabolism). A wild type AC-HI promoter is a promoter that is functionally coupled to the wild type AC-III gene, A preferred promoter of the adenylate cyclase III gene having enhanced activity has the sequence of the wild-type AC-III promoter with one or more base substitutions, additions, or deletions. That is, a preferred promoter of the adenylate cyclase III gene having enhanced activity is a mutant of a wild type AC-III promoter.

As used herein, an individual is "at risk" for developing type II diabetes (NIDDM), or another disorder of carbohydrate metabolism, when the individual has traits or characteristics, such as an enhanced AC-III promoter, that correlate with later development of type II diabetes (NIDDM), or the disorder of carbohydrate metabolism.

As used herein, disorder of carbohydrate metabolism refers to disorders such as non-insulin dependent diabetes mellitus (NIDDM) or type II diabetes, preclinical stages of these disorders, other disorders affecting the insulin response, and syndromes and side effects related to these disorders. As used herein, diabetes refers to either NIDDM, IDDM, or both. The AC-PI Promoter and Its Role in Detecting and Treating Disorders of Glucose Metabolism

The present invention relates to a promoter of the adenylate cyclase 111 gene having enhanced activity and its correlation with and role in disorders of carbohydrate metabolism, such as type II diabetes (NIDDM). Spontaneously diabetic animals show decreased insulin release in response to glucose, exhibit elevated cAMP at high glucose concentrations, and overexpress the AC-III gene. The present invention results from the discovery that such spontaneously diabetic animals have a promoter of the AC-III gene that has enhanced activity compared to the wild type AC-III promoter. The AC-III promoter having enhanced activity is a causative agent of the observed overexpression of the AC-III gene and is involved in the observed decreased insulin release in response to glucose and elevated cAMP at high glucose concentrations, Increased levels of AC-III promoter activity, of AC-III expression, and of cAMP are each part of a reduced response of islet cells to glucose levels and an impaired insulin response to glucose. This indicates a role for the AC- III promoter having enhanced activity in type II diabetes (NIDDM) and other disorders of carbohydrate metabolism. Detecting or modulating the enhanced AC- III promoter, or its downstream effects, provides for methods and compositions for diagnosing and treating disorders of carbohydrate metabolism characterized by an impaired insulin response, such as type II diabetes (NIDDM).

Methods and compositions for diagnosing and treating disorders of glucose metabolism can employ various manifestations of the AC-III promoter having enhanced activity. For example, this enhanced AC-III promoter provides a genetic marker for the risk or presence of disorders of glucose metabolism. Downstream products, such as AC-III mRNA, AC-III protein, and cAMP also provide distinctive, detectable features indicating the presence of the AC-III promoter having enhanced activity. Specifically, the enhanced AC-III promoter increases expression of the AC-III gene, which results in increased AC-III mRNA levels and increased AC-III protein, which in turn increases c MP levels. Even further downstream of the gene, enhanced activity of the AC-III promoter is associated with the insulin response. The insulin response can be measured in a subject's cells or tissues for diagnostic purposes. This illustrates that the presence of the AC-III promoter having enhanced activity manifests itself at all levels from the organisms genetic makeup through intracellular macromolecules and messengers to a cell or tissue's biological responses. Each of these manifestations can be used in diagnosis or treatment of type II diabetes (NIDDM) of another disorder of carbohydrate metabolism.

Detecting Disorders of Carbohydrate Metabolism Detecting the AC-πi Promoter Having Enhanced Activity

The type II diabetes (NIDDM) associated AC-III promoter having enhanced activity provides avenues for diagnosis of type II diabetes (NIDDM) and other disorders of carbohydrate metabolism. The AC-III promoter is found in genetic material of cells and tissues throughout an animal regardless of whetlier they express AC-ffi. Thus, various cells and tissues, such as blood or pancreatic tissue, can serve as a source of DNA or other biological materials for detecting the AC-III promoter itself. Detection of the enhanced AC-III promoter in a patient indicates that the patient is at risk to develop type II diabetes (NIDDM), if no other symptoms are already apparent. In the presence of early stage, but inconclusive, symptoms of type II diabetes (NIDDM), detection of the enhanced AC-III promoter can confirm an otherwise uncertain diagnosis. In a diabetic patient, detection of the enhanced AC- III promoter can indicate type II diabetes (NIDDM).

The presence of the enhanced AC-III promoter can be detected either directly, by determining the sequence of the patient's AC-HI gene promoter regions, or indirectly. Indirect detection of the enhanced AC-III promoter includes detecting the effect of this promoter on effector binding to the AC-III gene or associated regulatory sequences, on the structure of the AC-III gene, on expression of the AC- III gene, or the like. The enhanced AC-III promoter can also be detected by its production higher levels of an indicator protein in heterologous expression systems, compared to a wild-type AC-III promoter.

Detecting the Sequence of an AC-III Gene Promoter

The sequence of promoter and coding regions of the AC-III gene from normal animals is known in the art and is shown in Table 1 (SEQ ID NO. 1) (Wang, et al., Genes encoding components of the olfactory signal transduction cascade contain a DNA binding site that may direct neuronal expression. Mol. Cell. Biol. 13, 5805-5813, 1993; the disclosure of which is specifically incorporated herein by reference).

Table 1 - The sequence surrounding the start site of a wild type adenylate cyclase III gene. The transcription start site is underlined.

CCCTATGGCTGTTCTTTCCTCATCTTGAGCTGCCTCCCAAAGTGATCCCTTGATGCTGAGGGCTCTTC CCAGTCCCCTGAGTACATTTTCTTCTGAAAACGACTTTTACTCCTAACAAGGTGTTCTGTCAAAATTG ATACCACGGCTTAGCAGACTGATAGATTCAAAAGGAACATTTGCGTCTTTAAGGAAGAATCCAAACAC ATCTCAATTGGTAGGATGGAGATCTTCGAGAAGCAAGGCCTCTTTCGGGCCCACGTGCCAGGTACCAA GCAAGCTACTCCAGGCCTCTTTTGTCACCAGGTTAGGCTGTATATTCCCTTGAGGAGAGATCAAGCCC CACGCTTGACGTCTGGGCTGCCAGGGTAGGCGGAGACACTGAGATGGGGCGCGCCCATTCGGGGAGCG

GTCCCCAAACCTCAGCCAGGGCCTCTCCTTTCCCCGGAAGGAAACCAGGGTAGAAGGGCGGCTGGGGT

GCCTCAGCACGCCTCACCTGCAGGGAGGA ACGTCCTGGGCTTTGATCTTCTGTAACACGGTCTGTTC GAGGCAAAGCGTGGAGTCACCTCGCTCTTT CTGTCTGCCACCTACTCGGCGTTTCCACGCAGCTATC

TCCGGGCGCTGGCAAGTGGGGGGACACCGGGGACAGCGAGGGGCCCCTCCACCCGGCGTCCAGGAGGC GGCGACAAGGCGGGGAGGGGCCGCCCGCCTCCTGGGGCCTGCGGCGCGCGTGAATCAGTGTGCAGAGC GCGGCGCACGGACCTCGGCTGGCTCGCCCTGCGTGCGGGGAGAGGATGCTGGCAGGCTGCCCCGGCCT GGGCCCGCCATCCGCAGCGTGAGCCACCGCCGTCCTCTGCGACCACGGATGCTGAACCACAGCCCCGC GCCTCTACCGGCCCGACCCGGGGCCTGACCGCAAGGGGACCCGCGCACAGGCTCCGGGCGGAGGAGCT GGCGCGGCGGCACTGCGGGAAGCAGC

The AC-III gene from pancreatic β-islet cells of a spontaneously diabetic animal has been sequenced (Table 2, SEQ ID NO. 2) and includes a wild type coding sequence and base substitutions in an untranslated promoter region. An enhanced promoter of the AC-III gene in GK diabetic rats has two point mutations compared to the same promoter in control rats. The enhanced AC-III promoter has an A to C point mutation at position -358 and A to G at position -28. (Table 2, SEQ. ID NO. 2)

Table 2 - The sequence surrounding the start site of the adenylate cyclase gene from GK diabetic rats including an enhanced promoter of the adenylate cyclase III gene. The transcription start site is underlined. The residues that differ from the wild type sequence are in bold.

CCCTATGGCTGTTCTTTCCTCATCTTGAGCTGCCTCCCAAAGTGATCCCTTGATGCTGAGGGCTCTTC

CCAGTCCCCTGAGTACATTTTCTTCTGAAAACGACTTTTACTCCTAACAAGGTGTTCTGTCAAAATTG ATACCACGGCTTAGCAGACTGATAGATTCAAAAGGAACATTTGCGTCTTTAAGGAAGAATCCAAACAC ATCTCAATTGGTAGGATGGAGATCTTCGCGAAGCAAGGCCTCTTTCGGGCCCACGTGCCAGGTACCAA GCAAGCTACTCCAGGCCTCTTTTGTCACCAGGTTAGGCTGTATATTCCCTTGAGGAGAGATCAAGCCC CACGCTTGACGTCTGGGCTGCCAGGGTAGGCGGAGACACTGAGATGGGGCGCGCCCATTCGGGGAGCG

GTCCCCAAACCTCAGCCAGGGCCTCTCCTTTCCCCGGAAGGAAACCΛGGGTAGAAGGGCGGCTGGGGT GCCTCAGCACGCCTCACCTGCAGGGAGGATACGTCCTGGGCTTTGATCTTCTGTAACACGGTCTGTTC GAGGCAAAGCGTGGAGTCGCCTCGCTCTTTTCTGTCTGCCACCTACTCGGCGTTTCCACGCAGCTA C TCCGGGCGCTGGCAAGTGGGGGGACACCGGGGACAGCGAGGGGCCCCTCCACCCGGCGTCCAGGAGGC GGCGACAAGGCGGGGAGGGGCCGCCCGCCTCCTGGGGCCTGCGGCGCGCGTGAATCAGTGTGCAGAGC

GCGGCGCACGGACCTCGGCTGGCTCGCCCTGCGTGCGGGGAGAGGATGCTGGCAGGCTGCCCCGGCCT GGGCCCGCCATCCGCAGCGTGAGCCACCGCCGTCCTCTGCGACCACGGATGCTGAACCACAGCCCCGC GCCTCTACCGGCCCGACCCGGGGCCTGACCGCAAGGGGACCCGCGCACAGGCTCCGGGCGGAGGAGCT GGCGCGGCGGCACTGCGGGAAGCAGC

Generally, a method for detecting an AC-III promoter having enhanced activity compares the sequence or a signal representing the sequence, of an experimental sample containing an AC-III promoter with a one or more control samples containing either a known wild-type or a known enhanced AC-III promoter. An experimental sample that contains a sequence or produces a signal that matches a known enhanced AC-III promoter, contains an AC-HI promoter with enhanced activity. An experimental sample that contains a sequence or produces a signal that matches a known wild-type AC-III promoter, contains a wild-type AC-III promoter. An experimental sample that contains a sequence or produces a signal different from a known enhanced AC-III promoter or wild type AC-III promoter, may be an AC-III promoter with enhanced activity, but any enhanced activity of the experimental promoter must be measured.

Many diagnostic methods for detection and analysis of a sequence of a nucleic acid, such as an enhanced AC-III promoter, are known to those of skill in the art. These include, for example, direct sequencing, ARMS (amplification refractory mutation system), restriction endonuclease assays, oligonucleotide hybridization techniques, and immunoassays. These methods can be employed for detecting an enhanced AC-III gene in a variety of cells or tissues, such as blood or pancreatic tissue. While some commonly used procedures are described below, other available methods are included in the scope of the invention.

Sequencing Techniques

DNA obtained from a blood or tissue sample from a patient in need of diagnosis for type II diabetes (NIDDM) or another disorder of carbohydrate metabolism can be sequenced by known methods and compared to the wild type sequence to indicate an enhanced AC-III promoter.

Southern Blot Techniques

In Southern blot analysis, DNA is obtained from blood or tissue of a patient suspected of being at risk for, or having, type II diabetes (NIDDM) or another disorder of carbohydrate metabolism and then separated by gel electrophoresis. Following electrophoresis, the double stranded DNA is converted to single stranded DNA, for example, by soaking the gel in NaOH, The DNA is then transferred to a sheet of nitrocellulose, The transferred DNA is contacted with a labeled probe. For example, labeled probe can be applied to the nitrocellulose after it dries.

As used herein, a "probe" is a nucleic acid sequence that is complementary to the sequence of interest. The probe can be either a DNA sequence or an RNA sequence. Preferably the probe is about 8 to 16 nucleotides in length. A radioactive label, such as ³²P is an example of a suitable label. Other suitable labels include fluorophores or an enzyme which catalyzes a color producing reaction (e.g., horse radish peroxidase).

Because the probe has a sequence complementary to the DNA sequence of interest, it will hybridize to the specific DNA sequence. As used herein, "hybridize" means that the probe will form a double-stranded molecule with the specific DNA sequence by complementary base pairing under conditions of high stringency (e.g., 65 °C; 0.1 x SSC; Sambrook et al., Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, New York: Cold Spring Harbor Press (1989)). After the probe is allowed to hybridize to the DNA, excess probe is washed away. The hybridized DNA is easily visualized from the labeled probe using known techniques. Hybridization of the probe indicates that the sample DNA contains a sequence that is complementary to the labeled probe. Several types of probes can be used for detecting an AC-III promoter having enhanced activity. For example, a probe complementary to a sequence in an enhanced promoter, but not in a wild-type promoter, will hybridize to and result in a signal from an experimental sample that has the sequence of the enhanced promoter, but not an experimental sample having the wild-type sequence. This signal indicates detection of an enhanced promoter in the experimental sample. Similarly, a probe complementary to a sequence in a wild-type promoter, but not in an enhanced promoter, will hybridize to and result in a signal from an experimental sample that has the sequence of the wild- type promoter, but not an experimental sample having the enhanced promoter sequence. In this case a signal indicates detection of a wild type promoter in the experimental sample. One of skill in the art realizes that other combinations of probes and signals are possible for indicating the presence of an enhanced promoter.

PCR Techniques It is often desirable to amplify the sample DNA for more efficient analysis.

Polymerase chain reaction (PCR) can be used to amplify the DNA. PCR is a technique that is well known to one of skill in the art. An exemplary method includes developing oligonucleotide primers that hybridize to opposite strands of DNA flanking the enhanced AC-III promoter. As used herein, a "primer" is a short nucleotide sequence which is complementary to a DNA sequence flanlcing the DNA sequence of interest and that serves to prime chain elongation by a suitable polymerase. Preferably the primer is about 15 to 20 nucleotides in length. The specific fragment defined by the primers exponentially accumulates by repeated cycles of denaturation, oligonucleotide primer annealing and primer extension. The amplified domain can then be analyzed by hybridization or screening techniques, such as the Southern blot technique described above. Suitable oligonucleotide primers are shown in Example 5. ARMS

ARMS (amplification refractory mutation system) is a PCR based technique in which an oligonucleotide primer that is complementary to either a wild-type allele or mutant allele is used to amplify a DNA sample. A description of ARMS can be found in Current Protocols in Human Genetics, Chapter 9.8, John Wiley & Sons, ed by Dracopoli et al. (1995).

In one variation of ARMS, a pair of primers is used in which one primer is complementary to a known mutant sequence. If the DNA sample is amplified, the preseuce of the mutant sequence is confirmed. Lack of amplification indicates that the mutant sequence is not present. For detecting an AC-III promoter having enhanced activity, the mutant sequence is the sequence of the enhanced promoter. In another variation of this ARMS, the primers are complementary to wild-type sequences. Amplification of the DNA sample, indicates that the DNA has the wild type sequence complementary to the primers, If no amplification occurs, the DNA likely contains a mutation at the sequence where hybridization should have occurred and may contain an enhanced promoter, but any enhanced activity of the experimental promoter must be measured.

Restriction Endonuclease Assays

Restriction endonuclease assays can also be used to screen a sample of DNA from a suitable cell or tissue, such as blood or pancreatic tissue, for mutants. Such assays are described and used by Pras et al., "Mutations in the SLC3 Al transporter gene hi Cystinuria " Am. J. Hum. Genet., 56:1297-1303 (1995). Briefly, a DNA sample is amplified and then exposed to restriction endonucleases that will or will not cleave the DNA depending on whether or not a mutation is present. After cleavage, the size of restriction fragments are observed to determine whether or not cleavage occurred. The pattern of cleavage represents structural differences. For detecting an AC-III promoter having enhanced activity, restriction endonucleases are selected to provide different cleavage for the wild-type AC-III promoter and the enhanced AC-III promoter. Cleavage of an experimental sample of DNA yields a restriction pattern that is compared to the restriction patterns for the control wild-type and enhanced AC-III promoters. A match of one of the control patterns by the experimental pattern identifies the experimental sequence as matching that control sequence. If the experimental pattern does not match either of the control patterns, the DNA likely contains a mutation at the promoter sequence and may contain an enhanced promoter, but any enhanced activity of the experimental promoter must be measured.

Oligonucleotide Hybridization Techniques

Hybridization techniques, such as dot blots, are known to one of skill in the art and can be used to determine whetlier a DNA sample contains a specific sequence, such as the sequence of an AC-HI promoter having enhanced activity. A discussion of allele specific oligonucleotide testing can be found in Current Protocols in Human Genetics, Chapter 9.4, supra.

In a dot blot, a DNA sample is denatured and exposed to a labeled probe which is complementary to the sequence of a wild-type AC-HI promoter or to an enhanced AC-HI promoter. Hybridization of a probe that is complementary to the wild-type AC-IH promoter (a "wild type probe") indicates that the wild-type AC-III promoter is present. If the wild type probe does not hybridize to the DNA in the sample, the wild-type AC-III promoter is not present. In a variation of this technique a probe that is complementary to an enhanced AC-IH promoter can be used. Hybridization of a probe that is complementary to the enhanced AC-IH promoter (an "enhanced probe") indicates that the enhanced AC-πi promoter is present. If the enhanced probe does not hybridize to the DNA in the sample, the enhanced AC-πi promoter is not present, If no hybridization occurs with either a wild-type or an enhance probe, the DNA likely contains a mutation at the sequence where hybridization should have occurred and may contain an enhanced promoter, but any enhanced activity of the experimental promoter must be measured.

Heterologous Expression Systems The enhanced AC-III promoter can also be detected by its production of higher levels of an indicator protein in heterologous expression systems, compared to a wild-type AC -HI promoter. Increased heterologous expression can be detected in several ways known to those of skill in the art. Increased heterologous expression using the AC-III promoter from a patient can be detected either directly, by measuring the presence of the transcript from heterologous expression, or indirectly. Indirect detection of increased heterologous expression using the AC-III promoter from a patient includes detecting the activity of or the presence of an indicator such as a reporter protein, typically an enzyme such as luciferase or β-galactosidase, or the like.

For example, an experimental sample of DNA can be extracted from a suitable tissue, such as blood or pancreatic tissue, and tested for the presence of an AC -πi promoter have enhanced activity. The experimental sample of DNA is inserted into an expression vector adjacent to, or in a position from which it can control the expression of, a heterologous gene. Preferably, the heterologous gene encodes a detectable marker such as a detectable polynucleotide or protein. Preferably, the heterologous gene encodes an enzyme that catalyzes a light or color producing reaction, such as luciferase or β-galactosidase, whose signal represents the level of gene expression. The level of expression of the heterologous gene is compared to control levels of expression produced by a wild type AC-III promoter or an enhanced AC-III promoter. An enhance promoter produces greater expression of the heterologous gene than a wild type promoter. One suitable heterologous detection system is described in Example 5 ,

Detecting the AC-HI mRNA Transcript

Enhanced AC-III promoter activity results in enhanced AC-IH gene expression and production of increased amounts of an AC-III mRNA transcript encoding an active adenylate cyclase III. The enhanced AC-III promoter does not alter the sequence of the mRNA compared to the wild-type AC-III promoter. The level of expression of the AC-III mRNA transcript is increased in islet cells from a diabetic animal compared to a control animal at high and low glucose levels. Such an effect can also be produced in an in vitro system. Thus, the enhanced AC-IH promoter produces increased levels of AC-πi mRNA transcript both in vivo and in vitro, and either type of system can be used in methods to detect an AC-III promoter having enhanced activity. Increased expression of AC-III mRNA correlates with the presence of the enhanced AC-III promoter and is characteristic of disorders of carbohydrate metabolism such as type II diabetes (NIDDM).

Detection of increased levels of AC-III mRNA transcript in a patient indicates that the patient is at risk to develop type II diabetes (NIDDM), if no other symptoms are already apparent, hi the presence of early stage, but inconclusive, symptoms of type π diabetes (NIDDM), detection of increased levels of AC-III mRNA transcript can confirm an otherwise uncertain diagnosis. In a diabetic patient, detection of increased levels of AC-III mRNA transcript can indicate type II diabetes (NIDDM). Increased levels mRNA transcript can be detected in several ways known to those of skill in the art. Increased levels of AC-III mRNA transcript can be detected either directly, by measuring the presence of the mRNA, or indirectly. For example, increased levels of AC-III mRNA result in increased production of AC-III protein and adenylate cyclase activity, in both in vitro and in vivo systems. Increased levels of AC-III protein can be determined by increased levels of cAMP, in both in vitro and in vivo systems. Increased levels of cAMP produce biological effects, such as changes in insulin levels. Indirect detection of increased levels of AC-HI mRNA transcript includes detecting insulin levels, AC-UI protein, adenylate cyclase activity, cAMP levels, or the like. Each of these indirect indicators of ACΗI mRNA level can be detected by common methods known in the art. Some methods for detecting AC-III protein or activity levels are described hereinbelow, additional methods are known to those of skill in the art.

Many diagnostic methods for detection and analysis of a sequence of a nucleic acid, such as an AC-III mRNA, are known to those of skill in the art, and include, for example, direct certain of the methods described hereinabove for detecting a DNA sequence or downstream products of a DNA sequence. These methods include either directly, or after reverse transcription of the mRNA to DNA, as appropriate or desired, restriction endonuclease assays, oligonucleotide hybridization techniques, and immunoassays. While some commonly used procedures are described below, other available methods are included in the scope of the invention. Northern Blot Techniques

The presence or amount of an mRNA transcript can be determined by Northern Blot Techniques, following a procedure similar to that outlined for the Southern Blot Technique,

Western Blot Techniques

When mRNA production is coupled to protein production, the levels of AC- III mRNA production is reflected in adenylate cyclase III protein expression, which can be detected by imrnunoassay, for example by Western Blot Techniques. In this procedure, a tissue sample is obtained from an individual and separated by gel electrophoresis. Following electrophoresis, the proteins are transferred to nitrocelhdose. The proteins are then contacted with a labeled probe, for example, by applying the labeled probe to the nitrocellulose after it is dried. Suitable probes include l beled anti-adenylate cyclase III antibodies, preferably those antibodies specific for a specific epitope. Exemplary labels include radioactive isotopes, enzymes, fluorophores and chromophores. After excess antibody is rinsed away, the presence of the specific protein/antibody complex is easily determined by known methods, for example by development of the label attached to the anti-adenylate cyclase IH antibody, or by the use of secondary antibodies.

Detecting Adenylate Cyclase Protein or Activity

Cells, such as islet cells, from a diabetic animal having the enhanced AC-HI promoter produce increased levels of adenylate cyclase HI under conditions of high glucose, compared to control cells. Increased levels of adenylate cyclase πi can be detected either directly, by measuring the presence of adenylate cyclase III by, for example, imrnunoassay, or indirectly. Indirect detection of increased levels of adenylate cyclase III include detecting its activity in a direct or coupled enzyme assay, or the like. Increased levels of adenylate cyclase III can be detected in several ways known to those of skill in the art. Detection of increased levels of adenylate cyclase HI in cells from a patient indicates that the patient is at risk to develop type H diabetes (NIDDM), if no other symptoms are already apparent. In the presence of early stage, but inconclusive, symptoms of type π diabetes (NIDDM), detection of increased levels of adenylate cyclase III in cells from a patient can confirm an otherwise uncertain diagnosis. In a diabetic patient, detection of increased levels of adenylate cyclase III in cells from a patient can indicate the type of type II diabetes (NIDDM).

Western Blot Techniques

The levels of adenylate cyclase III protein expression can be detected by imrnunoassay, for example by Western Blot Techniques. In this procedure, a tissue sample is obtained from an individual and separated by gel electrophoresis, Following electrophoresis, the proteins are transferred to nitrocellulose. The proteins are then contacted with a labeled probe, for example, by applying the labeled probe to the nitrocellulose after it is dried. Suitable probes include labeled anti-adenylate cyclase III antibodies, preferably those antibodies specific for a specific epitope. Exemplary labels include radioactive isotopes, enzymes, fluorophores and chromophores. After excess antibody is rinsed away, the presence of the specific protein/antibody complex is easily determined by known methods, for example by development of the label attached to the anti-adenylate cyclase III antibody, or by the use of secondary antibodies.

Activity Assays

Adenylate cyclase activity assays are well described in the scientific literature. For example, suitable assays are described by Kuo et al. "Adenylate cyclase in islets of Langerhans. Isolation of islets and regulation of adenylate cyclase activity by various hormones and agents." J. Biol. Che . 248:2705-2711 (1972).

Detecting cAMP Levels

Cells, such as islet cells, from a diabetic animal having the enhanced AC-III promoter produce increased levels of cAMP under conditions of high glucose, compared to control cells. Increased levels of c AMP can be detected in several ways known to those of skill in the art. Increased levels of cAMP can be detected either directly, by measuring the presence of c AMP by, for example, chromatography or radioimmunoassay, or indirectly. Indirect detection of increased levels of cAMP includes using cAMP as a substrate for an indicator enzyme or as a ligand for an indicator protein, or the like. Detection of increased levels of cAMP in cells from a patient indicates that the patient is at risk to develop type II diabetes (NIDDM), if no other symptoms are already apparent. In the presence of early stage, but inconclusive, symptoms of type II diabetes (NIDDM), detection of increased levels of cAMP in cells from a patient can confirm an otherwise uncertain diagnosis. In a diabetic patient, detection of increased levels of cAMP in cells from a patient can indicate the type of type II diabetes (NIDDM). At low levels of glucose, cAMP levels in islet cells from a diabetic animal with the enhanced AC-III promoter are similar or increased compared to control cells. At high levels of glucose, the amounts of AC-IH mRNA and cAMP are much higher in islet cells from a diabetic animal than in control cells. Increased levels of adenylate cyclase and cAMP at high glucose concentrations correlate with the presence of the enhanced AC-III promoter and are characteristic of disorders of carbohydrate metabolism such as type II diabetes (NIDDM).

Insulin Secretion and Responsiveness and the Enhanced AC-IH Promoter

Cells, such as islet cells, from a diabetic animal having the enhanced the AC- III promoter produce decreased levels of insulin secretion under conditions of high glucose, compared to control cells. Decreased levels of insulin secretion can be detected in several ways known to those of skill in the art. Decreased levels of insulin can be detected either directly, by measuring the presence of insulin by, for example, chromatography or radioimmunoassay, or indirectly. Detection of decreased levels of insulin secretion from cells of a patient indicates that the patient is at risk to develop type II diabetes (NIDDM), if no other symptoms are already apparent.

Therapy for Diabetes The type II diabetes (NIDDM) associated enhanced AC-III promoter provides avenues for treatment or therapy of type II diabetes (NIDDM). The presence of the enhanced AC-III promoter correlates with diminished insulin response to glucose in islet cells from diabetic animals. Antagonizing the effects of the enhanced AC-πi promoter can restore a normal insulin response. The effects of the enhanced AC-III promoter can be antagonized in any way known to those of skill in the art for down regulating gene expression or for antagonizing or inhibiting the function or activity of a gene product, such as an mRNA or a protein.

Ultimately, gene therapy can be used to remove or replace the enhanced AC-πi promoter or the AC-HI gene.

Direct methods for antagonizing the enhanced AC-III promoter include inhibiting its enhanced activity by binding of a sense or antisense targeted binding molecule, by binding of a protein or small molecule antagonist, by preventing binding of activators (or other cofactors) necessary for activity of the enhanced AC- III promoter, or the like. Downstream targets include the mRNA transcript, adenylate cyclase-III (the protein and its activity), and cAMP. A variety of methods can be used antagonize or inhibit the effect of increased levels of ACΗI mRNA. For example, the function of the mRNA can be disrupted by inducing its degradation, by preventing its export from the nucleus, by binding of a sense or antisense targeted binding molecule, by binding of a protein or small molecule antagonist, by preventing binding of the ribosome or cofactors in translation, or the like. A variety of methods can be used antagonize or inhibit the effect of increased levels of adenylate cyclase III. For example, the function of the adenylate cyclase III can be disrupted by preventing its synthesis, by inducing its degradation, by preventing its folding, by inhibiting its activity, or the like. A variety of methods can be used antagonize or inhibit the effect of increased levels of cAMP. For example, the effects of increased levels of cAMP can be disrupted by antagonizing or inhibiting the downstream receptors or enzymes that interact with cAMP, by inhibiting cAMP synthesis, by inducing cAMP degradation, or the like.

Transgenic Animals

The enhanced AC-III promoter provided in this application useful for the development of transgenic animals having disorders in carbohydrate metabolism, such as type π diabetes (NIDDM). Such transgenic animals are used, for example, to screen compounds for treating such disorders. Useful variations of a transgenic animal include "knock in" animals. In a "knock in" animal, the wild type AC-III promoter is deleted and replaced by the enhanced AC-III promoter. Experiments can be performed on the animal to determine the effects of this transition, and to test compounds that down regulate, inhibit or antagonize the enhance promoter or associated gene products.

The present invention can be better understood with reference to the following examples. These examples are intended to be representative of specific embodiments of the invention, and are not intended as limiting the scope of the invention.

EXAMPLES General Methods

Animals

Male Goto-Kakizaki (GK) diabetic rats were obtained from the colony at Karolinska Hospital. GK rats are a lean, spontaneous animal model of type-2 diabetes. As controls, male Wistar rats were obtained from a commercial breeder (B&K Universal, SoUentuna, Sweden). All rats were fed ad libitum with free access to water and were kept in rooms in which alternate 12-hour periods of light and darkness were enforced. GK and control rats had similar body weights; the GK rats had a mean weight of 316 +_9g (n=19) and the control rats had a mean weight of 309 + 9g (N=1 ). Blood glucose level just prior to pancreas isolation was significantly elevated in GK compared to control rats [11.3 + 1.4 mmol/1 (n=15) in GK vs. 4.4 + 0.1 mmol/1 (n=15) in control rats, pθ.0001].

Isolation of Pancreatic Islets

After euthanasia, islets were surgically removed from the rats and isolated as described in Korsgren et al. "Effects of hyperglycaemia on function of isolated mouse pancreatic islets transplanted under the kidney capsule." Diabetes 38:510- 515 (1989). Briefly, islets were isolated from pancreas of both control and GK rats by digestion with collagenase (Boehringer-Mannheim, Mannheim, Germany). The islets were cultured for 48 hours in RPMI-1640 supplemented with 11 mM glucose and 10% (vol/vol) fetal calf serum. Before further experimentation, the islets were pre-incubated in Krebs-Ringer bicarbonate (KRB) buffer supplemented with 2g/l bovine plasma albumin (Sigma Chemical Co., St. Louis, MO, USA) with 3.3 M glucose for 45 minutes,

Presentation of Results and Statistics

Insulin secretion, cAMP generation, and light intensity from transfection studies are expressed as the mean + SEM. All statistical tests were performed with SigmaStat for Windows Version 1.0 (Jandel Scientific Software, Ekrath, Germany). Test of significance of differences were performed using the r-test for unpaired data and the Mann- Whitney Rank Sum test.

Example 1: Decreased Insulin Release from Islets of Diabetic Animals

Insulin release from islets of diabetic animals was measured, and compared to levels from control islets, to correlate the insulin levels with indicators such as cAMP levels and adenylate cyclase expression levels.

Forskolin strongly stimulates adenylyl cyclase (AC) and cAMP generation and is used as another control for effects on AC activity. Forskolin is used to determine whether the observed effect on insulin release is due to increased sensitivity of the cells to cAMP, or increased levels of cAMP.

Methods

Insulin release was determined in batches of 20 islets incubated for 45 minutes at 37 °C in 1000 μl KRB supplemented with 3.3 mM or 16.7 mM glucose alone and with 5 μM forskolin (Sigma) at both glucose concentrations. After the incubation period, 900 μl of the effluent was removed and frozen at -20 °C for subsequent analysis by radioimmunoassay (RIA) of insulin (Herbert, et al., 1965).

Results The results of this study of insulin release are shown in Table 3 and Figure 1.

Compared to control islets, insulin release was decreased in diabetic islets at 3.3 mM glucose (p<0.002) and at 16.7 mM glucose (pθ.0001). In control islets, stimulation by forskolin increased insulin release approximately 4-fold at both 3.3mM glucose (pO.OOOl) and at 16.7 mM glucose (pO.OOOl). In diabetic islets, stimulation by forskolin increased insulin release approximately 9-fold at 3.3mM glucose (p<0.0001) and approximately 18-fold at 16.7 mM glucose (pO.OOOl). The observed effects of forskolin on insulin release are in accord with previously published results.

Table 3 -- Insulin Release in Diabetic and Control Islets at High and Low Glucose Concentrations and in the Presence and Absence of Forskolin.

Insulin Release (μU/islet)

Glucose (mM) Forskolin (5 μM) Diabetic Islets Control Islets

3.3 - 3.9±0.6 5.9±0.5

16.7 - 6.3±0.6 25.8+2.5

3.3 + 36.9±2.9 27.2±4.3

16.7 + 110±12 105±11

Conclusions

Compared to control islets, diabetic islets show a significantly smaller increase in insulin release as glucose concentration increases. When adenylyl cyclase is subjected to strong stimulation by forskolin, control rats and diabetic rats release similar amounts of insulin at either high or low glucose levels.

Example 2: Increased cAMP Levels in Islet Cells From Diabetic Animals cAMP levels were measured at low and high concentrations of glucose and in the presence and absence of forskolin to determine whether the results observed in Example 1 were due to increased sensitivity of diabetic islets to cAMP or to increased levels of cAMP in diabetic islets.

Methods

Cyclic AMP was determined from the same batches of 20 islets in which insulin secretion was measured in Example 1. After removal of 900 μl for determination of insulin, the medium was replaced with 300 μl ice-cold acetate 9/41411

22

buffer with 0.5 mM isobutylmethylxanthine (IBMX). The islets were then immersed in boiling water for 4 minutes and left to cool at +4 °C. The islets were briefly centrifuged, sonicated, and subsequently frozen at -20 °C. Radioimmunoassay of cAMP was performed using a commercially available kit NEK-033 (Dupont, Bel gium).

Results

The results of this study of cAMP generation are shown in Table 4 and Figure 2. At low levels of glucose, 3,3 mM, the cyclic AMP level in diabetic islets was not significantly different from the level in control islets. At high levels of glucose, 16.7 mM, the cyclic AMP level in diabetic islets was significantly elevated compared to the level in control islets (pO.OOOl). In control islets, stimulation by forskolin induced a 6-fold increase in cAMP levels at 3.3 mM glucose (pO.OOOl) and approximately a 5-fold increase in cAMP levels at 16.7 mM glucose (pO.OOOl). In diabetic islets, stimulation by forskolin induced a 9-fold increase in cAMPJevels at 3.3 mM glucose (pO.OOOl) and about a 6-fold increase at 16.7 mM glucose (pO.OOOl). Thus, compared to control islets, stimulation of diabetic islets by forskolin resulted in significantly higher (pO.OOOl) levels of cAMP production at both high and low glucose concentrations. At 3.3 mM glucose, forskolin stimulated diabetic islets produced almost twice as much (1.9x, pO.OOOl) cAMP as control islets. At 16.7 mM glucose, forskolin stimulated diabetic islets produced almost three times as much (2.9x, pO.OOOl) cAMP as control islets.

Table 4 — cAMP Generation in Diabetic and Control Islets at High and Low Glucose Concentrations and in the Presence and Absence of Forskolin. cAMP Generated (fmol/islet)

Glucose (mM) Forskolin (5 μM) Diabetic Islets Control Islets

3.3 - 31.2±3.7 24.0±1.6

16.7 - 38.9±4.8 18.1±0.8

3.3 + 279±14 148±14

16.7 + 242±14 84.9±9.8 Conclusions

Forskolin effects on insulin levels are paralleled by islet cAMP levels in response to forskolin in diabetic rats at both low and high glucose concentrations.

Thus, the exaggerated insulin response in forskolin stimulated diabetic islets can be accounted for by increased cAMP generation rather than altered sensitivity to the cAMP. Forskolin stimulation reveals the increased AC-πi levels present in diabetic islets.

Forskolin is known to strongly stimulate adenylate cyclase (AC) which catalyzes the conversion of ATP to cAMP. Forskolin stimulation fully restored the impaired insulin response to glucose in isolated diabetic islets. Moreover, forskolin markedly enhanced insulin responses at substimulatory glucose level in diabetic but not control islets.

Example 3: Increased Expression of Adenylate Cyclase IH mRNA in Islet Cells From Diabetic Animals

Levels of adenylate cyclase III mRNA were measured to determine whether increased levels cAMP generation in diabetic islets were due to increased amounts of the mRNA, and hence increased AC-HI protein, or, perhaps, the presence of a more active AC-III.

Methods

Islets were isolated from both control and diabetic rats by digestion with collagenase (Boehringer-Mannheim). The islets were cultured for 48 hours in RPMI-1640 supplemented with 11 mM glucose and 10% (vol/vol) fetal calf serum. The islets were first pre-incubated in Krebs-Ringer bicarbonate (KRB) buffer supplemented with 2g/l bovine plasma albumin (Sigma) with 3.3 mM glucose for 45 minutes. Duplicate batches of 20 islets were subsequently incubated at 37 °C for 45 minutes in 1000 μl KRB supplemented with 3.3 mM or 16.7 mM glucose alone and with 5μM forskolin (Sigma) at both glucose concentrations. The islets were then transferred onto restricted areas of microscope slides (ProbeOn, Fisher Scientific, Pittsburgh, PA, USA) and dried at 55 °C for 30 minutes. In situ hybridization was performed essentially as by Dagerlind, et al. (1 92) "Sensitive mRNA detection using unfixed tissue: combined radioactive and nonradioactive in situ hybridization histochemistry," Histochemistry 98, 39-49.. This method employs ^a5S labeled synthetic oligonucleotide probes (Scandinavian Gene Synthesis AB, Koping, Sweden). The labeling was performed with deoxyadenosine 5'-α-thiotriphosphate ( ⁱS) (New England Nuclear, USA) with terminal deoxynucleotidyl transferase (Amersham, UK). A mixture of four different oligonucleotide probes each approximately 48 bases long and binding to different regions of rat AC-III mRNA were employed in order to increase the sensitivity of the method. The AC-HI mRNA sequence (Bakalyar and Reed, (1990).

Identification of a specialized adenylyl cyclase that may mediate odorant detection, Science. 250, 1403-1406.) was obtained from GenBank and the oligonucleotide probes were selected by the MacVector system (see Table 5 for details). A constant ratio of the GC (guanine/cytosine) content of approximately 60% was employed. The oligonucleotide probe was approximately 48 bases long and was checked for the absence of palindromes or long sequences of homology with the species against available GenBank data. A probe complementary to the antisense strand of AC-IH mRNA was used as a control probe in parallel slides to assure the specificity of the hybridization signals. After emulsion autoradiography, islet cells expressing mRNA for adenylate cyclase were examined in dark field microscopy and presented at X200 magnification. Control probes produced a uniformly weak background signal without revealing any positive cells.

Table 5 - Probes used for detection of AC-III mRNA expression by in situ hybridization*

Probe Bases

Probe #1 994-1041 (R&C)

CTCCCTGCAGCAGCTGCATCCCTTCTAGCTCGTCTTGC TGCTGCTGGGC (SEQ. ID. NO.3)

Probe #2 1486-155 (R&C)

GTGGTCCTCCCGGTAGTCAGGCAGGCCGCAGATGCAGT AGTAACAGTC (SEQ. ID. NO.4)

Probe #3 2227-22274 (R&C)

ACAGCTGAAGGCAGCCCCACTCTGCTTCTCCTTCTCCA CCGAGTAGCG (SEQ. ID. NO.5)

Probe #4 3018-3065 (R&C)

ACATGCTCTGGCAACATGTTGGTGACCAAGGCCTCGTT CCACCGGCGC (SEQ. ID. NO.6)

Probe #5 3018-3065 (Control)

GCGCCGGTGGAACGAGGCCTTGGTCACCAACATGCTTG CCAGAGCATGT (SEQ. ID. NO.7)

* GenBank accession # M55075, R&C refers to reverse and complemented

Results

To determine if the enhanced generation of c AMP in GK islets reflects a similar ovcrexpression of AC in the diabetic islets, mRNA expression of type-HI adenylate cyclase (AC-III) was determined in islets under the above conditions in which insulin and cAMP generation were studied. These results are reported in Figure 3.

Even in the absence of forskolin, at 3.3 mM glucose, intense expression of AC-III mRNA was observed in diabetic islets compared to control islets (not shown). Similar levels of mRNA were observed at 16.7 mM glucose. Still, forskolin clearly enhanced labeling of AC-III mRNA in control islets both at 3.3 and 16.7 mM glucose. This forskolin mediated increase mirrored rises in cAMP and insulin release caused by forskolin. Expression levels of AC-III mRNA were, however, already very high in GK islets at 3.3 or 16.7 mM glucose. Hence, it was difficult to discern a further rise in expression level in response to forskolin. To decrease the enhanced basal mRNA signals in GK islets so as to delineate the effects of forskolin, a set of experiments (FIG. 3) in which a mixture of only 2 probes (Probes 1 and 3, Table 1) were performed. Messenger RNA expression was clearly reduced to the series using a mixture of 4 probes. However, the enhanced AC-III mRNA overexpression in GK islets was clearly visible at glucose levels and the addition of forskolin further induced mRNA expression several fold higher in the GK compared to control islets (FIG. 3, B, D, F and G).

Conclusions In situ hybridization with specific probes for AC-IH demonstrated an overexpression of AC-III mRNA in diabetic islets.

Example 4: Mutant Promoter in the Adenylate Cyclase HI Gene of Islet Cells From Diabetic Animals In light of the observations of increased levels of cAMP and of adenylate cyclase III mRNA in islets from diabetic animals, regulatory elements of the - adenylate cyclase III gene from these diabetic animals were examined for mutations.

Mutations could influence tire rate or amount of adenylate cyclase gene transcription.

Methods

Direct PCR sequencing was used to examine a promoter region of the AC-III gene in isolated islets and peripheral blood. Islets were isolated from six control and six GK rats by digestion with collagenase (Boehringer-Mannheim). The islets were cultured for 48 hours in RPMI-1640 supplemented with 11 mM glucose and 10% (vol/vol) fetal calf serum. Blood was collected from the same rats from which the islets were isolated. Islets and blood from every two GK and Wistar rats were pooled. Additionally, blood was also collected from another nondiabetic rat strain, the DA strain. DNA from leukocytes in peripheral blood was extracted by a modified

"salting-out" method (Olerup, et al., HLA-DQB1 and -DQAl typing by PCR amplification with sequence-specific primers (PCR-SSP) in 2 hours. Tissue Antigen, 41, 119-134, 1993). DNA from cultured islets was prepared by digestion of proteinase K overnight at 37 °C. Subsequently, a volume of isopropanol equal to the sample volume was added to cause DNA precipitation.

PCR primers for amplifying the AC-III promoter region were designed using the computer program Oligo 5.0 (NBI, USA) using an adenylate cyclase gene sequence from GenBank account number S64908 (Wang, et al., Genes encoding components of the olfactory signal transduction cascade contain a DNA binding site that may direct neu onal expression. Mol. Cell. Biol. 13, 5805-5813, 1993). A forward primer corresponding to positions -563 to -549 relative to the transcription on start site was linked with an 18-bp-21 Ml 3 sequence resulting in primer sequence TGTAAAACGACGGCCAGTTCTTGAGCTGCCTCCCAAAG (SEQ. ID. NO. 8). The reverse primer corresponded to positions +263 to +282 relative to the transcription start site and had the sequence GTTCAGCATCCGTGGTCGCA (SEQ. ID. NO. 9). The PCR reaction volume (100 μl) contained 200 nM dNTP, 1.5 μM MgCK 5 U Taq. polymerase (Pharmacia, Sweden), 0.2 μM primers and 1 μg DNA. PCR was carried out in Gene-AMP 9600 cycler (Perkin-Elmer, USA) for 35 cycles of 96 °C for 10 s, 60 °C for one minute and 72 °C for one minute. Purity of PCR products was evaluated on a 1% agarose gel and subsequently purified with A icon- 100 column (Amicon). A dye primer (-21M13) cycle sequencing kit with A pli Taq FS enzyme

(Perkin-Elmer) was applied to sequencing of the amplified PCR fragments. The process followed the manufacturer's instructions. Sequencing reactions were resolved on an ABI-377 DNA automated sequencer. Long Ranger gels (5%) of 36 cm x 0.2 mm were used and were run at 1.6 kV ( 100 bp/hr) at 51 °C for eight hours. The data were analyzed by Sequencing Program 2.1.1.

Results

The promoter region of the AC-III gene of control and diabetic animals was screened for mutations by sequencing. A genomic DNA fragment of the AC-III gene of 825 bp was sequenced, which included 563 bp in the 5' untranslated region. The sequences determined for diabetic (n=6) and control rats (Wistar (n=6) and DA (n=l)) were identical to the published sequence from olfactory tissue in rats (Wang, et al., 1993 supra) except that the promoter region of the DNA from diabetic rats included two point mutations. These mutations were at positions -358 bp, A->C, and -28 bp, A→G, of the promoter region of AC-III gene in islets and peripheral blood of diabetic rats (see Figure 4). Homozygous peaks for these two point- mutations in diabetic rats appeared in the electrophoretogram resulting from this experiment. For diabetic rats compared to control rats, no base changes were found in the mRNA transcription sequence from position 1 to 262.

Conclusions The observed increase cAMP formation in GK islets correlates with an inherited feature based on functional mutations in the promoter region of the AC-Ill gene. These results demonstrate a state of AC-IH mRNA overexpression and enhanced cAMP generation in the β-cells of GK rats linked to point-mutations in the promoter region of the AC-III gene in the diabetic rats. This can explain the strong insulinotropic responses induced by forskolin in GK islets. This defect contributes to the impaired oscillatory insulin release and decreased insulin response to glucose in GK rats and thus constitutes an important hereditary component of the poly genie mode of inheritance in this model of NIDDM.

Example 5: Increased Promoter Activity of the Mutant Adenylate Cyclase

Promoter From Islet Cells From Diabetic Animals

A direct measurement was made to determine whether the mutant adenylate cyclase III promoter had increased activity compared to the wild type promoter.

Methods

A luciferase reporter vector, pGL3 -enhancer vector (Promega, USA), which allows for a foreign promoter to be inserted and results in luciferase gene expression in transfected host cells, was used to compare the activity of the AC-IH gene promoter of diabetic and control rats. The full-length fragments of 580 bp of the AC-III gene promoter region from diabetic and control rats were amplified by PCR. The 5' end of the two primers had SAC I and Hind III sites, respectively, to facilitate cloning (the 5' primer TTTTGAGCTCTCTTGAGCTGCCTCCCAAAG (SEQ. ID. NO. 10); the V primer AATTAAGCTTTGGAAACGCCGAGTAGGTGG (SEQ. ID. NO. 11)). The PCR reactions and cycle conditions are described in Example 4. The PCR products were cloned by double digestion with Sac I and Hind HI (Boehringer) using 20 units of restriction enzymes per 1 μg DNA and ligation to similarly cut vector DNA. The cloned inserts were confirmed by DNA sequencing using a dye terminator cycle sequencing kit with Ampli Taq. FA (Perkin-Elmer) and RV primer 3. The correct sequence containing the two novel mutations from GK rats or a corresponding fragment from control rats (wild -type) were inserted in a pGL3 -enhancer vector. The COS cells used for transfection were cultured in Dulbecco's medium containing sodium pyruvate, 1 g/1 glucose, 10% fetal bovine serum and 10μl/mL gentamycin. The transfection of the recombiπant vectors into COS cells was performed by Transfectam Reagent (Promega), according to the kit protocol. In this experiment, a mixture of 5μg DNA with lOμl Transfectam was added to 5 X 10⁵ COS cells prepared one day before. The pGL3 -control vector and pGLE-enhancer vector without any inserts were also transfected simultaneously as positive and negative controls of transfection, respectively. Each DNA was transfected into at least five dishes of COS cells as five parallel experiments.

The luciferase activity produced in COS cells was detected by a scintillation counter (LS 6000SC, Beckman) after 48-hour cell culture, according to instructions of the luciferase assay system (Promega). One-minute counting time was selected to determine light intensity in individual samples and initiate each sample reaction immediately before measurement. Light intensity (proportional to luciferase activity) is expressed as the sum of the square root of measured counts per minute (cpm) minus background cpm. The luciferase activity from the pGL3-control vector used for monitoring the transfection efficiency was the highest among all the observations with a light intensity of 2257 + 299 light intensity units which indicated successful transfection in our reporter system. In contrast, results of negative transfection control with ρGL3 -enhancer vector alone was 6 + 1 similar to background level 5 + 1 light intensity units (COS cells without vectors).

In another set of experiments, luciferase vectors carrying the mutant or the normal AC-III promoter fragments were cotransfected with pCAT3-control vectors (Promega) as internal control plasmid for normalization of transfection efficiency. In these experiments 2 μg luciferase vector and 2 μg pCAT3 -control vector mixed with 8 μl Transfectam (Promega) were cotransfected in each cell preparation (2.5 x 10 COS cells in 6-well plates), Cotransfections were performed in at least three cell preparations. Groups of cotransfected cells were incubated for 48 h without and with 5 μM forskolin. After 48 h, the cells were harvested using 200 μl reported lysis buffer (Promega) and divided into two parts for estimation of luciferase and CAT activities.

To determine CAT activity, the cell extract was heated at 60 °C for 10 in. and kept at -70 °C until performing the assays. The activity of luciferase was determined as described above. CAT assay was performed using C-labe]ed chloramphenicol (DuPont, USA) and n-butyryl coenzyme A, following the CAT assay kit description (Promega). The background CAT activity in non-transfected COS cells was 7407 + 39 cpm (n=2), In transfected cells, CAT activity was almost identically increased in all the cell groups whether bemg cotransfected with vectors carrying the normal or diabetic enhanced promoter fragment. This was true either in the presence or absence of 5 μM forskolin [147719 + 1957 cpm (control promoter, n=3), 146520 + 1381 cpm (control promoter plus forskolin, n=3), 148083 + 1934 cpm (GK promoter, n=3) and 149801 + 388 cpm (GK promoter plus forskolin, n=3)].

Results

Evidence of a regulatory effect of the mutant promoter was obtained by using a luciferase reporter gene system. These results are reported in Figure 5. An approximately 5.5-fold higher luciferase activity was obtained from vectors carrying the mutant promoter [1968 + 223 light intensity units] compared to vector carrying the wild-type promoter [361 + 66 light intensity units, p .0007 vs vectors carrying mutant promoter].

In another set of experiments, COS cells were transfected with pCAT-3 control vectors together with vectors carrying either the enhanced AC-iπ promoter from diabetic animals or the wild-type AC-HI promoter. The results are presented in

Figure 5. An approximately 24-fold increase in luciferase activity was obtained from vectors carrying the enhanced promoter from diabetic animals (3660±250 light intensity units) compared to vectors carrying the wild-type AC-III promoter (153±57 light intensity units, p<0.0002). Addition of forskolin did not amplify these responses. In the presence of forskolin, the enhanced promoter from diabetic animals produced 2441±253 light intensity units and vectors carrying the wild-type AC-HI promoter produced 95±31 light intensity units, pO,0008. These results suggest that the effects of forskolin on AC-III message levels is mediated by a post- transcriptional mechanism.

Conclusions

The AC-III gene from diabetic rats has a promoter with activity that is enhanced compared to the wild type promoter.

The invention has been described with reference to various specific and preferred embodiments and techniques, However, it should be understood that many variations and modifications may be made while remaining within the spirit and scope of the invention. All publications and patent applications in this specification are indicative of the level of ordinary skill in the art to which this invention pertains.

Claims

WHAT IS CLAIMED IS:

1. A method of detecting a disorder in carbohydrate metabolism in a patient comprising: obtaining a cell or tissue sample from the patient; analyzing a promoter of an adenylate cyclase HI gene for enhanced activity; and correlating the enhanced activity of the promoter with the presence of a disorder in carbohydrate metabolism.

2. The method of claim 1 , wherein the carbohydrate is glucose and the disorder is type H diabetes (NIDDM).

3. The method of claim 1 , wherein analyzing the promoter for enhanced activity comprises detecting overexpression of adenylate cyclase III mRNA in the cell or tissue sample.

4. The method of claim 1 , wherein analyzing the promoter for enhanced activity comprises detecting increased levels of cAMP in the cell or tissue sample.

5. The method of claim 1 , wherein analyzing the promoter for enhanced activity comprises detecting a mutational change in a promoter of an adenylate cyclase III gene in the cell or tissue sample.

6. The method of claim 5, wherein the mutation is less than about 600 bases upstream from a transcription sequence of the adenylate cyclase III gene,

7. The method of claim 6, wherein the mutation is between about bases -300 to about -400 or between about bases -1 to about -100.

8. The method of claim 7, wherein the mutation is at a nucleotide corresponding to position -358 of the adenylate cyclase IH gene from the islet cells of GK rats.

9. The method of claim 8, wherein the mutation is A to C.

10. The method of claim 9, wherein the mutation is at a nucleotide corresponding to position -28 of the adenylate cyclase III gene from the islet cells of GK rats.

11. The method of claim 10, wherein the mutation is A to G.

12. The method of claim 1 , wherein analyzing the promoter for enhanced activity comprises amplifying a sequence of a promoter of the adenylate cyclase III gene in the cell or tissue sample.

13. The method of claim 12, wherein the amplifying comprises employing polymerase chain reaction and primers with sequences:

TGTAAAACGACGGCCAGTTCTTGAGCTGCCTCCCAAAG (SEQ. ID. NO. 8); GTTCAGCATCCGTGGTCGCA (SEQ. ID. NO. 9);

TTTTGAGCTCTCTTGAGCTGCCTCCCAAAG (SEQ. ID. NO. 10); or AATTAAGCTTTGGAAACGCCGAGTAGGTGG (SEQ. ID. NO. 11)).

14. The method of claim 1, wherein analyzing the promoter for enhanced activity comprises expressing a reporter gene under the control of a promoter of the adenylate cyclase IH gene from the cell or tissue sample.

1 . The method of claim 14, wherein the reporter gene is a luciferase gene.

16. The method of claim 1 , wherein the cell or tissue is a blood cell or pancreatic tissue.

17. An isolated DNA molecule comprising the sequence of the adenylate cyclase III gene with an adenylate cyclase III promoter having enhanced activity.

18. The molecule of claim 17, wherein the promoter having enhance is from the adenylate cyclase III gene of a diabetic animal.

19. The molecule of claim IS , wherein the animal is a GK rat.

20. An isolated DNA molecule comprising an enhanced promoter of an adenylate cyclase III gene.

21. The molecule of claim 20, wherein the enhanced promoter is from the adenylate cyclase III gene of a diabetic animal.

22. The molecule of claim 21, wherein the animal is a GK rat.

23. A method of treating a patient having a disorder of carbohydrate metabolism, comprising: adrninistering to the patient a down regulator, an antagonist, or an inhibitor of expression of adenylate cyclase III activity.

24. A method of enhancing or restoring a patient's response to insulin, comprising: administering to the patient a down regulator, an antagonist, or an inliibitor of expression of adenylate cyclase III activity.

25. A transgenic animal expressing a gene under control of a heterologous enhanced adenylate cyclase HI promoter

26. A method for screening compounds for use in therapy of a disorder in carbohydrate metabolism comprising: administering candidate compounds to the transgenic animal of claim 24.