EP1032702A1

EP1032702A1 - Reagents and methods for detecting genes related to major histocompatibility complex of domestic fowl, such as chicken

Info

Publication number: EP1032702A1
Application number: EP98955723A
Authority: EP
Inventors: Rima Zoorob; Charles Auffray; Anne-Marie Chaussee
Original assignee: Centre National de la Recherche Scientifique CNRS; Institut National de la Recherche Agronomique INRA
Current assignee: Centre National de la Recherche Scientifique CNRS; Institut National de la Recherche Agronomique INRA
Priority date: 1997-11-21
Filing date: 1998-11-23
Publication date: 2000-09-06
Also published as: FR2771422B1; EP1566450A3; US20040170952A1; EP1566450A2; WO1999027132A1; FR2771422A1

Abstract

The invention concerns nucleic acid molecules for detecting the MHC genes involved in phenomena of resistance or proneness to the development of virus-induced tumours. The primers prepared from said molecules can be used in a method for genotyping domestic fowl, characterised in that it consists in: amplifying a nucleic acid sample derived from the animal under study using one or several pairs of primers capable of being specifically hybridised with the nucleic acid of a pleomorphic region of the Rfp-Y or B systems of the MHC of said fowl; detecting the resulting PCR products.

Description

REAGENTS AND METHODS FOR THE DETECTION OF GENES RELATED TO THE MAJOR COMPLEX OF HISTOCOMPATIBILITY OF BREEDING BIRDS, SUCH AS CHICKEN

The invention relates to the detection of genes linked to the major histocompatibility complex (MHC) of farmed birds, such as chicken. As such, it relates to nucleic acid molecules making it possible to detect those of the MHC genes involved in the phenomena of resistance or susceptibility to the development of viral-induced tumors. The invention also relates to the applications of these nucleic acid molecules, in particular for the development of genotyping tests in farmed birds, in particular chicken, and for the selection of animals of interest.

Infectious viral diseases are feared by breeders because of their contagious nature which leads to significant losses of animals.

Vaccination was an effective prophylaxis until the emergence of hypervirulent strains, making it necessary to identify resistant haplotypes.

Various methods have thus been proposed in an attempt to select those of the animals which are capable of resisting such pathologies and those which are on the contrary liable to be affected.

The most commonly used techniques are based on serological polymorphisms or RFLP type. However, these methods do not provide precise knowledge on the phenomenon of resistance or susceptibility to the disease, in particular by lack of discriminating character vis-à-vis the genes of the B or Rfp-Y systems of the MHC.

The work of the inventors on the sequencing of genes of the MHC showed the genetic complexity of this region, which led them to take into account another type of polymorphism, namely based on the sequence of these genes and related regions, such than those of their promoters and of microsatellite regions. The inventors have thus developed means for obtaining oligonucleotide molecules highly specific for the polymorphisms observed, making it possible to identify the parts of genes, and even the sites involved in controlling the resistance or the susceptibility to the development of tumors.

The specific nature of these molecules, vis-à-vis a given gene from one of the MHC systems, makes them particularly reliable discriminating tools for precisely identifying the resistance or susceptibility capacity of the chicken studied, or d other birds, to viral infection, and to study at molecular level the MHC sequences involved.

The object of the invention is therefore to provide nucleic acid molecules making it possible to specifically detect, in farmed birds and in particular in chicken, the genes linked to MHC involved in the phenomena of resistance or susceptibility to the development of viral-induced tumors. It also aims to provide a method and a kit for the detection of genotypes for easy routine implementation.

The nucleic acid molecules of the invention are characterized in that they are molecules, isolated from their natural environment, of nucleic acids of genes coding for proteins involved in the control of resistance or susceptibility to the development of viral-induced tumors in farmed birds, such as those of Marek's disease in chicken, with, where appropriate, the regions attached to them, such as those of the promoter or of microsatellites. The term gene as used in the description and claims encompasses these regions.

These nucleic acid molecules are more particularly characterized in that they present the nucleic acid sequences of genes of the B system or of the Rfp-Y system of the MHC of farmed birds, with the exception of the sequences of the genes of class II BL, of the gene 17.5, of the gene 12.3 and of the gene B-IVF of class I, or are capable of pairing with one of the strands of a gene capable of coding for a protein as defined above under weakly stringent conditions.

The pairing under low stringency conditions referred to above is carried out at room temperature, in a 0.1 SSC medium, with washing at room temperature. Class II BL genes are described in I munogenetics 31: 179-187, 1990 and Eur. J. Immunol, 1993, 23: 1139-1145.

Gene 17.5 belongs to the superfamily of genes coding for lectins and gene 12.3 to the family of genes coding for guanine-binding proteins (guanine nucleotide-binding protein). This gene is described in Immunogenetics 39: 221-229, 1994.

The 12.3 gene is described in P.N.A.S. USA, vol. 86, 4594-4598, June 1989, Genetics.

The class I B-IVF gene is described in Immunogenetics 31: 405-409, 1990.

The invention relates in particular to nucleic acid molecules corresponding to those of the sequences of one of the following genes:

Rfp-Y system chaining

B-FV (Figure 1), B-F VI (Figure 2); . sequence of system B,

8.4 genomics (Figure 3); B-F I (Figure 4); C12.1 (Figure 5); DM (Figure 6); TAPI (from the start of exon 2 to the 3 'end) (Figure 7); and TAP2G (figure

8), and other genes included in FIG. 10 and suites 1 to 35.

The study of the nucleic acid sequences of the molecules defined above has made it possible to pinpoint the blocks of polymorphisms which must be detected in order to establish a reliable and precise genotyping. By comparing the sequences of these blocks, originating from different genes of the same haplotype or from the same gene of different haplotypes, the inventors took into account the divergent sequences and developed, for each gene, oligonucleotides complementary to these divergent sequences. .

There are thus specific primers which discriminate against a given gene of the B system or of the Rfp-Y system.

The invention relates especially to the molecules of oligonucleotides corresponding to these sequences and comprising a part of the polymorphic region of the MHC systems of chicken or other farmed birds.

It is recalled that the polymorphic region may be in the gene or in a related region such as the microsatellite regions or that of the promoter.

According to an embodiment of the invention, the polymorphisms are linked to the function of the MHC systems. It is thus advantageously molecules corresponding to a part of an exon. By way of example, mention will be made of molecules corresponding to exon 2 (domain α 1) of the chicken's YF genes. A suitable pair of primers consists of:

YF VI α 1: GGCCCCGGGATGCCGCGGTTC YF VI α 1, R: ATCCGCTCACCGCCCTGG According to another embodiment of the invention, the oligonucleotide molecules correspond to a part of a polymorphic region which is not linked to the function of the MHC systems. Preferred regions of this type are microsatellites.

By considering, for example, the B-FI gene, oligonucleotide molecules which can be used to form primer pairs correspond to the following sequences: B-FI: 5 'CCA GCA GTC ACT GCA CAT AT 3'

B-FI, R: 5 'AGG TGG AGT GCG CAA AGT T 3', and 12.1: 5 'ACA CGC AGC AGA ACT TGG TAA 3' 12.1 R: 5 'GGA AGG AAG ACC TTG GAA 3'

With the oligonucleotide molecules defined above and those developed from known genes, but according to the approach of the invention, highly specific sets of primers are available, making it possible to precisely determine the haplotype of the animal to be studied and to detect whether it is resistant to the development of viral-induced tumors, or on the contrary capable of being affected.

The invention therefore also relates to a method of genotyping farmed birds and in particular chicken.

This method is characterized in that it comprises the amplification of a sample of nucleic acid originating from the animal to be studied using one or more pairs of primers capable of hybridizing specifically with the nucleic acid of a polymorphic region of the Rfp-Y or B systems of the MHC of said birds, and

- detection of the PCR products obtained.

A simple comparison of the results obtained with a benchmark established beforehand allows the haplotype of the animal to be quickly determined.

The nucleic acid sample consists in particular of genomic DNA extracted from biological material of the animal to be studied or by this material itself, in particular from the blood of the animal. It may alternatively be cDNA, RNA or even PNA (polypeptides nucleic acids).

The primers are produced from the oligonucleotide molecules defined above and, in general, from any gene (and related region) coding for a protein involved in the control of the resistance or the susceptibility to viral-induced tumors in farmed birds and in particular chicken, in particular the BL genes of class II, 17.5, 12.3 and B-FIV of class I.

These are, for example, primers of microsatellite regions making it possible to detect haplotypes of the B complex, such as those produced from the B-FI gene, and mentioned above, or primers making it possible to detect haplotypes of the system. RFp-Y, and developed from the 17.5 gene, like the couple:

17.52: CAG GAT CTG CAC TGG CCA ATA

17.5, RI: GAA TGG CGG TGC TTC CGT GCC TGG

The detection of PCR products is carried out according to conventional techniques. These techniques include sequencing, electrophoresis, hybridizations with SSOP or SSCP analysis.

This technique will advantageously be chosen according to the nature of the polymorphism involved. Thus, in the case of microsatellite type polymorphism, PCR products will be advantageously detected according to their size by using electrophoresis techniques.

When the polymorphism concerns only a few nucleotides, or even a single nucleotide, hybridization techniques will be used more specifically for the purpose of differentiating haplotypes of PCR products (analysis on a membrane using probes specific for 'haplotypes, SSOP or Sequence Specifies Oligonucleotide Probe), differential migration of denatured samples (SSCP or Single Strand Conformational Polymorphism), or sequencing. In general, the latter technique is preferred given the simplicity of its implementation.

The invention thus provides a simple and rapid technique for establishing the genetic profile of a large number of animals to be studied, which makes it possible to determine the haplotypes and to select those of interest with a view to breeding.

In addition, each type of gene that can be discriminated using primers with the required specificity and its belonging to system B or

Since Rfp-Y can be established, it is possible to carry out more comprehensive basic studies. The invention also relates to a box or kit for detecting the genotype of the chicken or other farmed bird according to the method defined above.

These boxes or kits are characterized in that they contain the reagents necessary for carrying out at least one PCR and the revelation test.

In particular, they include the primers for the PCR, a positive control for the reaction, as well as instructions for use.

The primers are in lyophilized form or in solution or, depending on the method of detection, on a support. The support can be, in a conventional manner, a multiwell plate or be in the form of DNA chips.

The invention further relates to an experimental system which makes it possible to study the resistance to tumor development in chicken.

These are animal lines that have been genetically sorted on their MHC characteristics. Depending on these characteristics, the lines are either resistant or susceptible to tumors induced by viruses, such as Marek's disease virus. This genetic selection, which was initially carried out on serological criteria, was then continued on the basis of the study of the polymorphism of the MHC genes. It is a genetic material which is perfectly defined from a molecular point, and constitutes a precious tool for the study of polymorphism of microsatellite type sequences. This The material, as well as the product of the crossing between some of the lines between them, was used to determine the microsatellite sequences of the MHC which are polymorphic and to assess whether this polymorphism can be correlated with the typing data already available for these lines.

Other characteristics and advantages of the invention are set out in the examples which follow, in which reference is made to FIG. 9 representing a photo of electrophoresis of PCR products illustrating the genotyping test of the invention. It will be recalled that FIGS. 1 to 8, already mentioned above, illustrate the gene sequences according to the invention.

Example:

Study of Rfp-Y haplotypes of chicken using microsatellite primers.

amplification with the High Fidelity PCR System Expand ™ Kit

. With the primers 17.5 Rl / 17.52

Genomic DNA: 1 μg Oligos take: 0.3 μM dNTP: 8 μl qs H ₂ 0 50 μl 50 μl of Mix 2 is added by mixing,

Mix 2: 0.75 μl of enzyme

10 μl TP10X with MgCl ₂ qs H ₂ 0 50 μl Amplification program:

30 Cycles

94 ° C 94 ° C 65 ° C 72 ° C 4 ° C 2 '30' 'l' l '

. With B-FI / B-FI, R:

Genomic DNA: 1 μg

Oligos take: 0.3 μM dNTP: 8 μl qs H ₂ 0 50 μl and add 50 μl of Mix 2 by mixing.

Amplification program:

30 Cycles

94 ° C 94 ° C 60 ° C 72 ° C 4 ° C 2 '30' 'l' l '

revelation by agarose gel electrophoresis or by sequencing.

The test was applied to 9 chicken haplotypes, serologically selected for complex B.

These are haplotypes B4, B5, B7, B12, B13, B14, B15, B21 and an unknown haplotype BX.

Several individuals of the same type have been studied for B12 (6 individuals), B13 (3 individuals), B14 (4 individuals), B21 (4 individuals) and a single individual for the other haplotypes.

FIG. 9 gives a photo of electrophoresis on agarose gel at 1% of the PCR products obtained at the end of the amplification step.

Lanes 1 and 27 correspond to the size markers and lanes (2 to 25) to the PCR products of the following haplotypes: lane 2: B4; lane 4: B5; lane 5: B7; tracks 6 to 11: B12; tracks 12, 13, 14: B13; tracks 15, 16, 17, 18: B14; lane 19: B15; tracks 20, 21, 23, 24; B21; track 25: BX (no detection for tracks 3 and 22). Examination of this figure shows that individuals who have the B12 haplotype give the same band and are therefore very homogeneous. The same observation applies to individuals B14. On the other hand, with B21, we see that the profiles are different, which demonstrates the ineffectiveness of the serological approach. Given the position of the BX band, it is determined that it is a B4 haplotype.

The practical application of this method amounts to subjecting individuals naturally resistant to the protocol described above taking into account the two Rfp-Y and B systems of the MHC and to select from animals to be tested only those whose profile corresponds to that of resistant animals.

The invention thus provides the means to verify the homogeneity of the animals and to carry out rigorous selections by taking into account each system of the MHC, and in these systems the genes sought.

Claims

1 / Molecules of nucleic acids isolated from their natural environment, from genes coding for proteins involved in the control of the resistance or susceptibility to the development of tumors in chicken, such as those of Marek's disease, and of regions related to said genes characterized in that they present the nucleic acid sequences of genes of the B system or of the Rfp-Y system, corresponding to the major histocompatibility complex of farmed birds with the exception of the sequences of the class genes II BL, of the gene 17.5, of the gene 12.3 and of the gene B-IVF of class I, or are capable of pairing with one of the strands of a gene capable of coding for a protein as defined above in weakly stringent conditions.

2 / Nucleic acid molecules according to claim 1, characterized in that they correspond to one of the following sequences:

. Rfp-Y system chaining

B-FV (Figure 1), B-FVI (Figure 2); . sequence of system B,

8.4 genomics (Figure 3); B-FI (Figure 4); C121 (Figure 5), DM (Figure 6), TAPI (from the start of exon 2 to the 3 'end) (Figure 7), and TAP2G (Figure 8).

3 / Nucleic acid molecules according to claim 1 or 2, characterized in that they correspond to part of the sequences defined in claims 1 or 2, this part being specific and discriminating for a given gene from the B and Rfp-Y systems.

4 / Nucleic acid molecules according to claim 3, characterized in that they are oligonucleotide molecules corresponding to a part of the polymorphic region of the systems of the major histocompatibility complex of chicken.

5 / Nucleic acid molecules according to claim 4, characterized in that they are oligonucleotide molecules corresponding to a part of exon.

6 / Nucleic acid molecules according to claim 4, characterized in that they are oligonucleotide molecules corresponding to a part of polymorphic region which is not linked to the function of MHC systems, such as microsatellite regions.

7 / Method of genotyping farmed birds and in particular chicken, characterized in that it comprises

- amplification of a nucleic acid sample from the animal to be studied using one or more pairs of primers capable of specifically hybridizing with the nucleic acid of a polymorphic region of the MHC Rfp-Y or B systems of said birds, and

- detection of the PCR products obtained. 8 / Method according to claim 7, characterized in that the primers are produced from the molecules according to any one of claims 3 to 6, and from any gene (and related region) coding for a protein involved in the control of resistance or susceptibility to viral-induced tumors in farmed birds, especially chicken, particularly class II genes BL, 17.5, 12.3 and B-FIV.

9 / Method according to claim 7 or 8, characterized in that the detection of PCR products is carried out by sequencing.

10 / Box or kit for the genotyping of farmed birds and in particular chicken, characterized in that they contain the reagents necessary for carrying out at least one PCR and of the revelation test, according to the method of claim 8 or 9, in particular the primers produced from the nucleic acid molecules according to any one of claims 3 to 6.